Definition of Symbols HE TANTON IRD LUB Current Lewiston / Auburn area population for each bird T S B C species by month is shown as follows: Celebrating a century of commitment to nature. In 1919, a aaaa ABUNDANT: widespread and easily found in proper group of naturalists in the Lewiston / Auburn area organized habitat in large numbers. the Stanton Bird Club, named in honor of Dr. Jonathan Y. The Birds of cccc COMMON: widespread and easily found in proper Stanton (1834-1918), a much admired habitat in smaller numbers. professor known for his love of wildlife. In 1921 the first of Lewiston / Auburn uuuu UNCOMMON: widespread in very small numbers STATUS STATUS several gifts of land from Alfred Anthony led to establishing or common only in very restricted habitat. the Thorncrag Nature Sanctuary. Today Stanton manages & Vicinity rrrr IRREGULAR: not reported every year. an expanded Thorncrag and two other sanctuaries, open to

V Variable abundance, prone to erratic outbreaks. visitors who respect the study and enjoyment of nature A Reference Guide N Usually heard or active at dusk and night. through numerous walking trails. + Identification usually requires hearing song or call.  Thorncrag (450 acres) - Montello St., Lewiston Species of greatest conservation concern, see M  Applesass Hill (2 acres) - Pleasant St., Lewiston www.StateoftheBirds.org, 2016 report.  Woodbury (400 acres) - Pease Hill Rd., Monmouth, also accessible by Carver Rd. for Mud Pond BREEDS: shading bounds earliest date of first egg to latest date of last fledged, including multiple broods. The Stanton Bird Club is a leading voice of conservation in Confirmed at least once in Lewiston/Auburn area since Central through environmental education for school 1978. Shading design indicates usual location of nest. children, natural history lectures, statewide field trips, and C before shading if colonial nesting. community events. Field trips are held throughout the year mid to high in trees tree cavity or nest box plus the Christmas Bird Count every December. All are free bushes or low trees Manmade structures and open to everyone. For a field trip and monthly meeting schedule, recent sightings, club membership, and more visit on or near ground, marsh vegetation, or burrow BRED Formerly nested in the Lewiston / Auburn area. www.StantonBirdClub.org Change in breeding status in the State of Maine: Last YEAR known to have bred. This Guide is mostly based on reports since the year 2000, with breeding data since 1978, from the following sources. (I) Introduced by man, non-native species. (R) Reintroduced or Released native species. New reports are welcomed for future editions.  Atlas of Breeding Birds in Maine 1978-1983, Paul Hab. Identifies habitats in which the species is most Adamus. likely to occur in the Lewiston / Auburn area. See  eBird. An online database of bird distribution and “Where to Bird” panel for description of habitats. abundance, www.ebird.org. All species within Order or Family migrate mainly by:  Guillemot, a bimonthly newsletter, 1971-date, William day , at night , or both  at times continuously. Townsend, ed. Neotropical Migrants move between Maine and  Historical data from Birds of Maine, Ora Knight, 1908; Birds of Lewiston - Auburn and vicinity, Carrie Miller, Central / South America usually following: Founded 1919 1 – Atlantic Ocean direct (fall) 1918; and Maine Birds, Ralph Palmer, 1949. 2 – West Indies and Caribbean Sea by Florida 3 BIODIVERSITY HISTORY HISTORY BIODIVERSITY – trans-Gulf chiefly by Yucatan In the Lewiston / Auburn area: 4 – circum-Gulf by land  221 species occur regularly. Species migrating thru or wintering in Maine, most nest:  51 species are casual, accidental, or historical. A – in Arctic tundra  131 species have bred since 1978. www.StantonBirdClub.org B – in Boreal (Taiga) forests and lakes © – circumpolar or Holarctic species, also native to Hypothetical and exotic species are omitted. Be aware parts of Europe and Asia. that escaped domestic and stocked fowl, plus exotic pet Double lines (bb) separate Orders, single lines (uu) birds, are increasingly encountered. separate Families, left margin lines ( | ) group Genus. Ongoing DNA analysis is changing our understanding of Created by 3RD Edition Sequence and names follow the AOS Check-list of the origin and relationships through bird taxonomy. The Stan DeOrsey ([email protected]) August 2018 North American Birds, 7th edition thru supplement 59. sequence of this list will continue to evolve. J F M A M J J A S O N D Hab. J F M A M J J A S O N D Hab. WATERFOWL bbbbbbbbbbbbbbb  Iceland Gull A © ...... rrrrr rr L Snow Goose A ...... uccu uucccu LO Glaucous Gull A © ...... r r r r L Canada Goose B ...... (R)<1939 rrrucaacccccccccccaaaccu LO Great Black-backed Gull © by1870s><1928 uuuuuurrrrrrrrrrrrrruuuu L Wood Duck ...... ucccccccccccccccuur LSM Common Tern 2 B © ...... r r L Blue-winged Teal 3-1 ...... uuu uuuur LSM NORTHERN DIVERS bbbbbbbbbbb  Northern Shoveler © ...... rrr rrrr LSM Common Loon B © ...... r rcccccccccccccccccu L Gadwall © ...... rrr rrrrr LSM FULL-WEB-FOOTED SWIMMERS bbbbb  American Wigeon B ...... rrr ruurrr LSM Double-crested Cormorant . 1895><1925 ucccuuuuuccccuuurr L Mallard © ...... (R)<1949 ccccaaaaccccccccccaaaaaa LSM Great Cormorant © ...... <1983 rr rr rrr L M American Black Duck ...... uuuucccuuuuuuuuuuucccccc LSM WADING BIRDS bbbbbbbbbbbbbb  Northern Pintail B © ...... rr ruuurr LSM American Bittern ...... ruur r r r r r r M Green-winged Teal B ...... <1940 uuuur uuurrr LSM Least Bittern 3 ...... r r r r M Canvasback B ...... rr L Great Blue Heron ...... rr uu uCcccccccccccccuuur SMA Redhead ...... r r r L Great Egret © ...... (R)<1978 aaaaaaaaaaaaaaaaaaaaaaaa OF NOCTURNAL RAPTORS bbbbbbb  Great Horned Owl ...... N uuuuuuuuuuuuuuuuuuuuuuuu F GREBES bbbbbbbbbbbbbbbbbbbb  A Pied-billed Grebe ...... ruuuu r r rucccurrr LM M Snowy Owl © ...... r r r r r O B Barred Owl ...... N uuuuuuuuuuuuuuuuuuuuuuuu F M Horned Grebe © ...... r rrr ruuuuu L Red-necked Grebe B © ...... r r r r r L M Long-eared Owl © ...... N r r r r r r r r F Northern Saw-whet Owl ...... N r r r r r r Fc DOVES bbbbbbbbbbbbbbbbbbbbbbb Rock Pigeon ...... (I)(R)<1987 uuuuuuurrrrrrrrrrrruuuuu RA Sora ...... rr r r r r M PERCHING BIRDS bbbbbbbbbbbbbb American Coot ...... rrruu ruuuurr LM Tyrant Flycatchers uuuuuuuuuuu  uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu Great Crested Flycatcher 3 ...... cccccccur Fd Sandhill Crane B ...... <2004 r rrrr r r r rrrrrr r O Eastern Kingbird 3 ......  rcccccccuur OB SHOREBIRDS & COASTAL SEABIRDS b 4 B 2 A M Olive-sided Flycatcher ...... rur rr F Black-bellied Plover © ...... rr rrrr r S 3 3-1 A Eastern Wood-Pewee ...... ruuuuuuuur F American Golden-Plover © ...... r rr SO 4 B A +Yellow-bellied Flycatcher ...... rr rrr MF Semipalmated Plover ...... r r r r S +Alder Flycatcher 4 B ...... ruuuurr MB Killdeer ......

M Semipalmated Sandpiper 2-1 A ...... r rrrr S Blue-headed Vireo ...... ucccccccccccu F 3 B M Short-billed Dowitcher B ...... r r r r r S Philadelphia Vireo ...... rr rr Fd 3 M American Woodcock ...... N cccuuuuurr rrrr MB Warbling Vireo ...... uuuuuuuuur Fd Wilson’s Snipe B ...... ruccrrr rrrr SM Red-eyed Vireo 3 ...... uccccccccur FR Spotted Sandpiper ...... rccuuuuuurrr S Jays and Crows uuuuuuuuuuuuu  Solitary Sandpiper 3 B ...... uur rrrrrr S Blue Jay ...... aaaaaaaaaaaaaaaaaaaaaaaa FR B M Lesser Yellowlegs ...... uur rruu S American Crow ...... aaaaaaaaaaaaaaaaaaaaaaaa OFR Greater Yellowlegs 2 B ...... ruuu rr uur S +Fish Crow ...... <1985 rrrrrr r r r LF uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu Common Raven © ...... uuuuuuuuuuuuuuuuuuuuuuuu FA B Bonaparte’s Gull ...... <1982 rrrr L Larks uuuuuuuuuuuuuuuuuuuuuu  B Ring-billed Gull ...... <1981 aaaaaaccuuuuuuuccccaaaaa LOR Horned Lark © ...... <1901 r r rrr r r r rrrrr O B Herring Gull © ...... ccccccccccuuuuuucccccccc LO J F M A M J J A S O N D J F M A M J J A S O N D J F M A M J J A S O N D Hab. J F M A M J J A S O N D Hab. Swallows uuuuuuuuuuuuuuuuuu  Red-winged Blackbird ...... uca a Caaaaaaaaaaaaccurr MO Purple Martin 3 ...... Crrrrrrr O Brown-headed Cowbird ....

B migration route variances  Sabine’s Gull © ...... Oct. 2016 Common Redpoll © ...... V uuuuuuu uuu BFR 

 A Red Crossbill © ...... V r r r Fc  Red-throated Loon © ...... Nov. 1983

B occurrences White-winged Crossbill © ...... V r r r r r r Fc with date of most recent sighting  Snowy Egret ...... July 2015

Pine Siskin ...... V uuuuuuuuurr rruuuuu FR M Little Blue Heron ...... Aug. 2010 American Goldfinch ...... aaaaaaaaaaaaaaaaaaaaaaaa OBR  Glossy Ibis © ...... <1972 April 2008 Longspurs uuuuuuuuuuuuuuuuuu   Northern Hawk Owl © ...... N Dec. 1990 Lapland Longspur A © ...... V rrrrr r O  Great Gray Owl © ...... N Jan. 1996 Snow Bunting A © ...... V uuuurrr ruuuu OS  Short-eared Owl © .... BRED? N March 1991 CCIDENTAL Sparrows uuuuuuuuuuuuuuuuuuu   Boreal Owl © ...... N Jan. 2008 A Eastern Towhee ...... uuccccccccccur BF  Gyrfalcon A © ...... Nov. 2000 B  Canada Jay B ...... Dec. 1990 American Tree Sparrow ...... ccccccu ucccc B expected: not and of range - far out Chipping Sparrow ...... OR  Boreal Chickadee B ...... Sept. 2001 ruaaaaaaaaaaacr and

Field Sparrow ...... ruuuuuuuuuuuuuu OB - generally fewer than ten sightings since 1950, yet expected again:  Varied Thrush ...... Dec.-Feb. 2012 Vesper Sparrow ...... rrrrrrrrrrrrr O  Hoary Redpoll A © ...... Jan. 1994 breeds in region plus spring overshoots and post-breeding dispersal, winters in region and invasions Savannah Sparrow ...... uccccccccccccu SO known to wander great distances errant migrant  Lark Sparrow ...... Dec.-Apr. 2018     Fox Sparrow B ...... <1983 uccr uur B ASUAL M Harris’s Sparrow ...... Dec. 1987 C CASUAL Song Sparrow ...... rrrruccaaaaaaaaaaaaccuuu BR ACCIDENTAL  Yellow-breasted Chat 3 ...... Oct. 2015 Lincoln’s Sparrow B ...... rrr ruuu B  Yellow-headed Blackbird ...... May 2003 Swamp Sparrow B ...... M M Golden-winged Warbler 3 ...... May 1997 ucccccccccccuurr ISTORICAL B H  Blue-winged Warbler 3 ....<1980 May 2014 White-throated Sparrow ...... uuuuuuaaaacccccccaaaacuu BR Last sighting before 1950: White-crowned Sparrow B ...... ruu cc B  Orange-crowned Warbler ...... Dec. 1994 Harlequin Duck, Northern 2 Dark-eyed Junco B ...... uuuuccaauuuuuuuuccaaaccc BR-F  Summer Tanager ...... May 2018 Bobwhite, Passenger Pigeon, 3 Blackbirds uuuuuuuuuuuuuuuuu  Clapper Rail, Purple Gallinule,  Blue Grosbeak ...... April 1993 2 M Bobolink ......  Ccccccccccurr O Wilson’s Phalarope, Thick-  Painted Bunting ...... Jan. 2016 3 Eastern Meadowlark ......