Definition of Symbols HE TANTON IRD LUB Current Lewiston / Auburn area population for each bird T S B C species by month is shown as follows: Celebrating a century of commitment to nature. In 1919, a aaaa ABUNDANT: widespread and easily found in proper group of naturalists in the Lewiston / Auburn area organized habitat in large numbers. the Stanton Bird Club, named in honor of Dr. Jonathan Y. The Birds of cccc COMMON: widespread and easily found in proper Stanton (1834-1918), a much admired Bates College habitat in smaller numbers. professor known for his love of wildlife. In 1921 the first of Lewiston / Auburn uuuu UNCOMMON: widespread in very small numbers STATUS STATUS several gifts of land from Alfred Anthony led to establishing or common only in very restricted habitat. the Thorncrag Nature Sanctuary. Today Stanton manages & Vicinity rrrr IRREGULAR: not reported every year. an expanded Thorncrag and two other sanctuaries, open to
V Variable abundance, prone to erratic outbreaks. visitors who respect the study and enjoyment of nature A Reference Guide N Usually heard or active at dusk and night. through numerous walking trails. + Identification usually requires hearing song or call. Thorncrag (450 acres) - Montello St., Lewiston Species of greatest conservation concern, see M Applesass Hill (2 acres) - Pleasant St., Lewiston www.StateoftheBirds.org, 2016 report. Woodbury (400 acres) - Pease Hill Rd., Monmouth, also accessible by Carver Rd. for Mud Pond BREEDS: shading bounds earliest date of first egg to latest date of last fledged, including multiple broods. The Stanton Bird Club is a leading voice of conservation in Confirmed at least once in Lewiston/Auburn area since Central Maine through environmental education for school 1978. Shading design indicates usual location of nest. children, natural history lectures, statewide field trips, and C before shading if colonial nesting. community events. Field trips are held throughout the year mid to high in trees tree cavity or nest box plus the Christmas Bird Count every December. All are free bushes or low trees Manmade structures and open to everyone. For a field trip and monthly meeting schedule, recent sightings, club membership, and more visit on or near ground, marsh vegetation, or burrow BRED Formerly nested in the Lewiston / Auburn area. www.StantonBirdClub.org Change in breeding status in the State of Maine: Last YEAR known to have bred. This Guide is mostly based on reports since the year 2000, with breeding data since 1978, from the following sources. (I) Introduced by man, non-native species. (R) Reintroduced or Released native species. New reports are welcomed for future editions. Atlas of Breeding Birds in Maine 1978-1983, Paul Hab. Identifies habitats in which the species is most Adamus. likely to occur in the Lewiston / Auburn area. See eBird. An online database of bird distribution and “Where to Bird” panel for description of habitats. abundance, www.ebird.org. All species within Order or Family migrate mainly by: Guillemot, a bimonthly newsletter, 1971-date, William day , at night , or both at times continuously. Townsend, ed. Neotropical Migrants move between Maine and Historical data from Birds of Maine, Ora Knight, 1908; Birds of Lewiston - Auburn and vicinity, Carrie Miller, Central / South America usually following: Founded 1919 1 – Atlantic Ocean direct (fall) 1918; and Maine Birds, Ralph Palmer, 1949. 2 – West Indies and Caribbean Sea by Florida 3 BIODIVERSITY HISTORY HISTORY BIODIVERSITY – trans-Gulf chiefly by Yucatan In the Lewiston / Auburn area: 4 – circum-Gulf by land 221 species occur regularly. Species migrating thru or wintering in Maine, most nest: 51 species are casual, accidental, or historical. A – in Arctic tundra 131 species have bred since 1978. www.StantonBirdClub.org B – in Boreal (Taiga) forests and lakes © – circumpolar or Holarctic species, also native to Hypothetical and exotic species are omitted. Be aware parts of Europe and Asia. that escaped domestic and stocked fowl, plus exotic pet Double lines (bb) separate Orders, single lines (uu) birds, are increasingly encountered. separate Families, left margin lines ( | ) group Genus. Ongoing DNA analysis is changing our understanding of Created by 3RD Edition Sequence and names follow the AOS Check-list of the origin and relationships through bird taxonomy. The Stan DeOrsey ([email protected]) August 2018 North American Birds, 7th edition thru supplement 59. sequence of this list will continue to evolve. J F M A M J J A S O N D Hab. J F M A M J J A S O N D Hab. WATERFOWL bbbbbbbbbbbbbbb Iceland Gull A © ...... rrrrr rr L Snow Goose A ...... uccu uucccu LO Glaucous Gull A © ...... r r r r L Canada Goose B ...... (R)<1939 rrrucaacccccccccccaaaccu LO Great Black-backed Gull © by1870s><1928 uuuuuurrrrrrrrrrrrrruuuu L Wood Duck ...... ucccccccccccccccuur LSM Common Tern 2 B © ...... r r L Blue-winged Teal 3-1 ...... uuu uuuur LSM NORTHERN DIVERS bbbbbbbbbbb Northern Shoveler © ...... rrr rrrr LSM Common Loon B © ...... r rcccccccccccccccccu L Gadwall © ...... rrr rrrrr LSM FULL-WEB-FOOTED SWIMMERS bbbbb American Wigeon B ...... rrr ruurrr LSM Double-crested Cormorant . 1895><1925 ucccuuuuuccccuuurr L Mallard © ...... (R)<1949 ccccaaaaccccccccccaaaaaa LSM Great Cormorant © ...... <1983 rr rr rrr L M American Black Duck ...... uuuucccuuuuuuuuuuucccccc LSM WADING BIRDS bbbbbbbbbbbbbb Northern Pintail B © ...... rr ruuurr LSM American Bittern ...... ruur r r r r r r M Green-winged Teal B ...... <1940 uuuur uuurrr LSM Least Bittern 3 ...... r r r r M Canvasback B ...... rr L Great Blue Heron ...... rr uu uCcccccccccccccuuur SMA Redhead ...... r r r L Great Egret © ...... (R)<1978 aaaaaaaaaaaaaaaaaaaaaaaa OF NOCTURNAL RAPTORS bbbbbbb Great Horned Owl ...... N uuuuuuuuuuuuuuuuuuuuuuuu F GREBES bbbbbbbbbbbbbbbbbbbb A Pied-billed Grebe ...... ruuuu r r rucccurrr LM M Snowy Owl © ...... r r r r r O B Barred Owl ...... N uuuuuuuuuuuuuuuuuuuuuuuu F M Horned Grebe © ...... r rrr ruuuuu L Red-necked Grebe B © ...... r r r r r L M Long-eared Owl © ...... N r r r r r r r r F Northern Saw-whet Owl ...... N r r r r r r Fc DOVES bbbbbbbbbbbbbbbbbbbbbbb Rock Pigeon ...... (I)(R)<1987 uuuuuuurrrrrrrrrrrruuuuu RA Sora ...... rr r r r r M PERCHING BIRDS bbbbbbbbbbbbbb American Coot ...... rrruu ruuuurr LM Tyrant Flycatchers uuuuuuuuuuu uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu Great Crested Flycatcher 3 ...... cccccccur Fd Sandhill Crane B ...... <2004 r rrrr r r r rrrrrr r O Eastern Kingbird 3 ...... rcccccccuur OB SHOREBIRDS & COASTAL SEABIRDS b 4 B 2 A M Olive-sided Flycatcher ...... rur rr F Black-bellied Plover © ...... rr rrrr r S 3 3-1 A Eastern Wood-Pewee ...... ruuuuuuuur F American Golden-Plover © ...... r rr SO 4 B A +Yellow-bellied Flycatcher ...... rr rrr MF Semipalmated Plover ...... r r r r S +Alder Flycatcher 4 B ...... ruuuurr MB Killdeer ...... M Semipalmated Sandpiper 2-1 A ...... r rrrr S Blue-headed Vireo ...... ucccccccccccu F 3 B M Short-billed Dowitcher B ...... r r r r r S Philadelphia Vireo ...... rr rr Fd 3 M American Woodcock ...... N cccuuuuurr rrrr MB Warbling Vireo ...... uuuuuuuuur Fd Wilson’s Snipe B ...... ruccrrr rrrr SM Red-eyed Vireo 3 ...... uccccccccur FR Spotted Sandpiper ...... rccuuuuuurrr S Jays and Crows uuuuuuuuuuuuu Solitary Sandpiper 3 B ...... uur rrrrrr S Blue Jay ...... aaaaaaaaaaaaaaaaaaaaaaaa FR B M Lesser Yellowlegs ...... uur rruu S American Crow ...... aaaaaaaaaaaaaaaaaaaaaaaa OFR Greater Yellowlegs 2 B ...... ruuu rr uur S +Fish Crow ...... <1985 rrrrrr r r r LF uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu Common Raven © ...... uuuuuuuuuuuuuuuuuuuuuuuu FA B Bonaparte’s Gull ...... <1982 rrrr L Larks uuuuuuuuuuuuuuuuuuuuuu B Ring-billed Gull ...... <1981 aaaaaaccuuuuuuuccccaaaaa LOR Horned Lark © ...... <1901 r r rrr r r r rrrrr O B Herring Gull © ...... ccccccccccuuuuuucccccccc LO J F M A M J J A S O N D J F M A M J J A S O N D J F M A M J J A S O N D Hab. J F M A M J J A S O N D Hab. Swallows uuuuuuuuuuuuuuuuuu Red-winged Blackbird ...... uca a Caaaaaaaaaaaaccurr MO Purple Martin 3 ...... Crrrrrrr O Brown-headed Cowbird .... B migration route variances Sabine’s Gull © ...... Oct. 2016 Common Redpoll © ...... V uuuuuuu uuu BFR
A Red Crossbill © ...... V r r r Fc Red-throated Loon © ...... Nov. 1983
B occurrences White-winged Crossbill © ...... V r r r r r r Fc with date of most recent sighting Snowy Egret ...... July 2015
Pine Siskin ...... V uuuuuuuuurr rruuuuu FR M Little Blue Heron ...... Aug. 2010 American Goldfinch ...... aaaaaaaaaaaaaaaaaaaaaaaa OBR Glossy Ibis © ...... <1972 April 2008 Longspurs uuuuuuuuuuuuuuuuuu Northern Hawk Owl © ...... N Dec. 1990 Lapland Longspur A © ...... V rrrrr r O Great Gray Owl © ...... N Jan. 1996 Snow Bunting A © ...... V uuuurrr ruuuu OS Short-eared Owl © .... BRED? N March 1991 CCIDENTAL Sparrows uuuuuuuuuuuuuuuuuuu Boreal Owl © ...... N Jan. 2008 A Eastern Towhee ...... uuccccccccccur BF Gyrfalcon A © ...... Nov. 2000 B Canada Jay B ...... Dec. 1990 American Tree Sparrow ...... ccccccu ucccc B expected: not and of range - far out Chipping Sparrow ...... OR Boreal Chickadee B ...... Sept. 2001 ruaaaaaaaaaaacr and
Field Sparrow ...... ruuuuuuuuuuuuuu OB - generally fewer than ten sightings since 1950, yet expected again: Varied Thrush ...... Dec.-Feb. 2012 Vesper Sparrow ...... rrrrrrrrrrrrr O Hoary Redpoll A © ...... Jan. 1994 breeds in region plus spring overshoots and post-breeding dispersal, winters in region and invasions Savannah Sparrow ...... uccccccccccccu SO known to wander great distances errant migrant Lark Sparrow ...... Dec.-Apr. 2018 Fox Sparrow B ...... <1983 uccr uur B ASUAL M Harris’s Sparrow ...... Dec. 1987 C CASUAL Song Sparrow ...... rrrruccaaaaaaaaaaaaccuuu BR ACCIDENTAL Yellow-breasted Chat 3 ...... Oct. 2015 Lincoln’s Sparrow B ...... rrr ruuu B Yellow-headed Blackbird ...... May 2003 Swamp Sparrow B ...... M M Golden-winged Warbler 3 ...... May 1997 ucccccccccccuurr ISTORICAL B H Blue-winged Warbler 3 ....<1980 May 2014 White-throated Sparrow ...... uuuuuuaaaacccccccaaaacuu BR Last sighting before 1950: White-crowned Sparrow B ...... ruu cc B Orange-crowned Warbler ...... Dec. 1994 Harlequin Duck, Northern 2 Dark-eyed Junco B ...... uuuuccaauuuuuuuuccaaaccc BR-F Summer Tanager ...... May 2018 Bobwhite, Passenger Pigeon, 3 Blackbirds uuuuuuuuuuuuuuuuu Clapper Rail, Purple Gallinule, Blue Grosbeak ...... April 1993 2 M Bobolink ...... Ccccccccccurr O Wilson’s Phalarope, Thick- Painted Bunting ...... Jan. 2016 3 Eastern Meadowlark ...... Androscoggin River Overlook .... 2 C L Nancy’s Bog (Apple Valley Lake) . . 18 E LMBF Lincoln St. opp. Locust St. Mt. Pisgah Rd. at Bog Rd. Barker Mill Trail, Mill St...... 3 E LBF Nezinscot River ...... 19 K SF Bates College / Mt. David ...... 4 E LOF Rt. 117 east of Rt. 4 College St. and Campus Ave. North River Rd...... 20 C LOB Beaver Park, off Pine Woods Rd.. . 5 ED $ LOF Oak Hill Cemetery...... 21 E OF Bog Brook ...... 6 K SMB Riverside Dr. or 7th St. Joe Town Rd. off Rt. 124 Papermill, Androscoggin River & Curtis Homestead ...... 7 E OBF Ricker Farm Trails...... 22 E LSOF Bog Rd. off Rt. 106 Rt. 196 at Frost Hill Ave. David Rancourt River Preserve . . . 8 E LF Pettingill Park / Woods Trail ...... 23 ED LBF Tall Pines Dr. off Field Ave. or Winter St. Durham River Park ...... 9 E LF Pineland Farms ...... 24 ED SOBF Rt. 136 in Durham Village Rt. 231 at Morse Rd. Hooper Pond Preserve, Hooper 10 K LF Poland Rail Trail, Poland Corner 25 E LF Pond Rd. off Allen Pond Rd. Rd. opp Plains Rd. Lake Auburn / Lake Shore Dr. .... 11 C LSM Poland Spring Preservation Park. . 26 ED LOF - Boat Launch Rest Area, Rt. 4 Ricker Hill - Overlook & Townsend Marsh Range Pond State Park ...... 27 EDK LF - North Auburn Empire Rd. off Rt. 122 $ Lake Cobbosseecontee - south . . . 12 C LS Riverside Dr. (Rt. 136) ...... 28 C LOB Cobbossee Rd. (causeway) Riverwalk Trail / Railroad Park / Marshall Pond, Marshall Pond Rd. 13 K LMF West Pitch Park, Oxford St. at 29 E L off Merrill Hill Rd. Beech St. & behind Hilton Inn Mayall Rd ...... 14 C O Runaround Pond Recreation Area. 30 EK LF Mt. Apatite Park ...... 15 D BF Runaround Pond Rd. Small Rd. off Hatch Rd. Sabattus Pond ...... 31 - Martin Point Park, Lake St. EK LS - South end, Rts. 9 & 126 C LSM L LAKES, ponds, rivers, or streams - Riley Rd. E LO In winter, primarily the Androscoggin River Sherwood Forest Conservation 32 E BF S SHORES of lakes and streams, or mud flats Area, Sherwood Dr. at 19th St. M MARSHES, bogs, or swamps St. Peter’s Cemetery, Deer Rd. . . 33 CE OF O OPEN fields, pastures, or meadows Summer Street Park...... 34 E LBF B BRUSHY fields, forest edges, or thickets HABITATS Map identifies site location on the map. Sunnyside Park / Riverside Trail / F FORESTS, wood lots, orchards, or groves Acc. identifies the means of access to the site: Riverside Cemetery...... 35 E LBF Fc primarily CONIFEROUS growth C area can be birded from a CAR Whipple St. at Winter St. Fd primarily DECIDUOUS growth E area is suitable for an EASY walk Thorncrag Nature Sanctuary ..... 36 ED OBF usually high in forest trees D area contains more DIFFICULT walks Highland Spring Rd. usually low in trees or on the ground K area can be birded from a KAYAK or canoe Whitman Spring Trail ...... 37 E LF no high-low symbol - at any tree height Hab. identifies the habitats found at each site. N. Auburn opp. Holbrook Rd. R RESIDENTIAL areas, towns, or feeders highlights the best areas. Woodbury Nature Sanctuary ...... 38 D LMF Pease Hill Rd. at Whippoorwill A AERIAL, often seen high overhead These areas are open to the public, hours vary, some are Rd., Carver Rd. for Mud Pond privately owned or may charge an entry fee ($). Locate with Sabattus Pond is a prime inland location to find DeLorme’s Maine Atlas, or by the given street. Woodman Rd...... 39 C MO migrating ducks and shorebirds, particularly in fall Site conditions vary over time — use at your own risk. YMCA Outdoor Education Center 40 E BF when the water level is usually lower. The south end 167 Stetson Rd. of Lake Cobbosseecontee is similar. Respect private property, do not trespass. Avoid woods in deer hunting season, late Oct. thru Nov.