IMPROVEMENT OF LOVASTATIN PRODUCTION by Fusarium
pseudocircinatum IBRL B3-4 via SOLID SUBSTRATE
FERMENTATION
by
SYARIFAH AB RASHID
Thesis submitted in fulfillment of the requirements for the degree of
Doctor of Philosophy
AUGUST 2015
i
ACKNOWLEDGEMENT
In the name of Allah, The Most Merciful and The Most Gracious
To those individuals without whom I would not be penning these words in the first place, million thanks:
To Professor Dr Hajah Darah Ibrahim, my main supervisor, for her guidance from the early stage of the research until the thesis writing phase. She did inspire and impress me in her own way not only as a supervisor but also as a mother, advisor, spirit booster and even a friend. Thank you for all the chances and trust that you gave me. I really did learn a lot from you, really a lot.
To my co-supervisor, Dr Nyoman, to whom I am particularly grateful for guiding me from far away in Bandung, Indonesia. Thank you for your ideas mostly during the turbulent times. Also, special thanks to Malaysian Ministry of Education for the sponsorship under MyBrain15 program and also Ministry of Higher
Education for research grant (Postgraduate Research Grant Scheme) awarded.
I also would like to express my gratitude towards staff of School Biological
Sciences, School of Pharmaceutical Sciences, School of Chemistry, USM Drug
Centre and USM Animal Research and Service Centre especially to Professor
Baharuddin Salleh, Dr Latifah, Dr Shaida Fariza, Dr Ooi, Dr Isma Suzyta, Dr
Ahmad Makaleh, Professor Baharuddin Saad, Puan Melati, Encik Yusuf, Mamu,
Encik Hilman, Encik Rosli, Encik Kamarudin, Puan Jamilah, Encik Johari, Encik
Rizal, Puan Faizah, Puan Azliza, Cik Shafiqah and Puan Shafawati, for providing the unconditional help.
ii
Finally, to those I hold closest to my heart, my family and friends, whose understandings enlighten my way. To Mama (Nik Zabidah Nik Ab Razak) and Abah
(Ab Rashid Ali), thank you for the sacrifices and encouragement that both of you done throughout my life. To my friends, thank you for all the sweet memories and believing in me when I myself did not. I am no one without Allah and those good people I mentioned above.
Lots of love,
SYARIFAH AB RASHID
iii
TABLE OF CONTENTS Page
Acknowledgements ii Table of Contents iv List of Tables xiii List of Figures xv List of Plates xix List of Symbols and Abbreviations xx List of Publications and Conferences xxii Abstrak xxiii Abstract xxvi
CHAPTER 1 INTRODUCTION 1 1.1 Hypercholesterolemia versus its reversal agent 1 1.2 Fermentation and idiolites perspectives 2 1.3 Lovastatin in action 2 1.4 Rationales of study and objectives 4
CHAPTER 2 LITERATURE REVIEW 9 2.1 Agricultural crops in Malaysia: Rice processing and its 9 byproduct 2.2 Cholesterol: a review 10 2.2.1 Biomedical applications of lovastatin 11 2.2.1.1 The triumph of lovastatin in heart 12 disease 2.3 Statins 13 2.3.1 Back to the past: the historical statins 13 2.3.2 Biosynthesis of lovastatin 15 2.3.3 Lovastatin in SSF 16 2.4 Solid substrate fermentation (SSF) and its consideration 19 factors 2.4.1 Definition of SSF 19 2.4.2 Rationale of filamentous fungi selection 20 2.4.2.1 Fusarium sp. and its major mycotoxins 22
iv
2.4.3 Substrates suitability 28 2.4.4 Roles of particle size in SSF 30
2.4.5 Moisture content or water activity (aw) rules 31 2.4.6 pH and its control 32 2.4.7 The influence of temperature 33 2.4.8 The importance of aeration in SSF 34 2.4.9 Effect of carbon and nitrogen 34 2.4.10 Scale up system: bioreactors 35 2.5 Concluding remarks 38
CHAPTER 3 GENERAL MATERIALS AND METHODS 40 3.1 Substrates and fungi 40 3.1.1 Sources 40 3.1.2 Purification and maintenance of fungi 40 3.1.3 Inoculum preparation via direct counting using a 41 haemocytometer 3.2 Analysis 41 3.2.1 Extraction of fermented solid substrates 41 3.2.2 Lovastatin estimation 42 3.2.3 Fungal growth determination 43 3.2.4 Statistical analysis 45
CHAPTER 4 ISOLATION, SCREENING AND 46 IDENTIFICATION OF LOVASTATIN LATENT PRODUCERS VIA MORPHOLOGICAL AND MOLECULAR APPROACHES 4.1 Introduction 46 4.2 Materials and Methods 47 4.2.1 Isolation of potential lovastatin producer 47 4.2.2 Chemical compositions analysis 49 4.2.2.1 Moisture content 49 4.2.2.2 Determination of crude protein 49 4.2.2.3 Ash content 50
v
4.2.2.4 Determination of crude lipid 51 4.2.2.5 Crude fiber content 52 4.2.2.6 Determination of carbohydrate 53 4.2.3 Primary screening of lovastatin producers 53 4.2.3.1 Solid substrate fermentation compositions 53 4.2.3.2 Thin layer chromatography 54 4.2.4 Secondary screening via high performance 55 liquid chromatography 4.2.5 Identification of potential lovastatin producer 56 4.2.5.1 Colony and structural morphologies 56 4.2.5.1(a) Macroscopic observation of IBRL B3-4 56 4.2.5.1(b) Microscopic observation of IBRL B3-4: 57 Light microscope and Scanning Electron Microscope 4.2.5.2 The genus and species confirmation by 58 molecular approach 4.2.5.2(a) Freeze drying method for fungal 58 preparation 4.2.5.2(b) Extraction of dried IBRL 3-4 isolate sample 58 4.2.5.2(c) Polymerase chain reaction (PCR) 59 amplification and DNA sequencing of Translation Elongation Factor-1α gene (TEF-1α) 4.2.5.2(d) PCR products purification 60 4.2.5.2(e) TEF-1α gene sequence analysis 61 4.3 Results and Discussion 61 4.3.1 Evaluation of nutrients compositions in rice bran 61 and brown rice 4.3.2 Primary and secondary screenings of lovastatin 63 producers on TLC plate and HPLC analysis 4.3.3 Identification of IBRL B3-4 68 4.3.3.1 Macroscopic observation 68 4.3.3.2 Microscopic observation: Characters on CLA 72
vi
and SNA 4.3.3.3 Molecular confirmation of fungal genera 79 4.4 Conclusion 84
CHAPTER 5 IMPROVEMENT OF PHYSICAL AND CHEMICAL 85 PARAMETERS AND THEIR EFFECTS TOWARD LOVASTATIN PRODUCTION IN A FLASK SYSTEM 5.1 Introduction 85 5.2 Materials and Methods 87 5.2.1 Microorganisms, inoculum and substrate 87 preparations 5.2.2 Influence of different organic solvents towards 87 lovastatin recovery 5.2.3 Process parameters improvement 87 5.2.3.1 Time course profile of lovastatin synthesis 88 before physical parameters improvement in flask system 5.2.3.2 Influence of physical parameters on 88 lovastatin production by F. pseudocircinatum IBRL B3-4 5.2.3.2(a) Effect of substrate size 88 5.2.3.2(b) Effect of different percentage of moisture 89 content 5.2.3.2(c) Effect of surroundings temperature 89 5.2.3.2(d) Effect of inoculum size 90 5.2.3.2(e) Effect of initial pH 90 5.2.3.2(f) Effect of substrate quantity 90 5.2.3.2(g) Effect of mixing frequency 91 5.2.3.3 Time course profile of lovastatin synthesis 91 after physical parameters improvement 5.2.3.4 The influence of chemical parameters on 92 lovastatin production by F. pseudocircinatum
vii
IBRL B3-4 5.2.3.4(a) Effect of carbon sources supplementation 92 5.2.3.4(b) Effect of nitrogen sources supplementation 93 5.2.3.4(c) Effect of mineral addition 94 5.2.3.5 Time course profile of lovastatin production 94 after chemical parameters improvement 5.2.4 Analysis 95 5.2.4.1 Extraction of fermented solid substrates 95 5.2.4.2 Lovastatin estimation 95 5.2.4.3 Fungal growth determination 95 5.2.4.4 Statistical analysis 95 5.3 Results and Discussion 96 5.3.1 Organic solvents extraction 96 5.3.2 Improvement of physical and chemical parameters 100 on lovastatin synthesis by F. pseudocircinatum IBRL B3-4 5.3.2.1 Time course profile of lovastatin production 100 before physical parameters improvement 5.3.2.1(a) Effect of substrate size on lovastatin 102 production 5.3.2.1(b) Effect of moisture content on lovastatin 105 production 5.3.2.1(c) Effect of temperature on lovastatin 107 production 5.3.2.1(d) Effect of inoculum size on lovastatin 109 production 5.3.2.1(e) Effect of pH on lovastatin production 112 5.3.2.1(f) Effect of substrate quantity on lovastatin 114 production 5.3.2.1(g) Effect of mixing frequency on lovastatin 116 production 5.3.2.2 Time course profile of lovastatin synthesis after 118 physical parameters improvement
viii
5.3.2.3 Influence of chemical parameters on lovastatin 121 production and growth of F. pseudocircinatum IBRL B3-4 5.3.2.3(a) Effect of carbon sources 121 5.3.2.3(b) Effect of nitrogen sources 125 5.3.2.3(c) Effect of minerals salt addition 129 5.3.2.4 Time course profile of lovastatin synthesis 133 after chemical parameters improvement 5.4 Conclusion 139
CHAPTER 6 LOVASTATIN PRODUCTION BY F. 140 pseudocircinatum IBRL B3-4 IN A LABORATORY SCALE SYSTEM AND PURIFICATION OF LOVASTATIN PRODUCED UNDER SSF 6.1 Introduction 140 6.2 Materials and Methods 142 6.2.1 Preparations of microorganism and inoculums 142 6.2.2 Basal composition of SSF in a tray system 142 6.2.3 Parameter improvement process in a tray system 143 6.2.3.1 Profiles of growth and lovastatin production 143 before improvement 6.2.3.2 Effect of substrate size 144 6.2.3.3 Effect of moisture content 144 6.2.3.4 Effect of incubation temperature 145 6.2.3.5 Effect of inoculum size 145 6.2.3.6 Effect of initial pH 145 6.2.3.7 Effect of mixing frequency 146 6.2.3.8 Time course profile after physical parameters 146 improvement 6.2.4 Purification of lovastatin via chromatographic 146 procedure 6.2.4.1 Open column chromatography 146 6.2.4.1(a) Sample preparation 146
ix
6.2.4.1(b) Column packing 147 6.2.4.1(c) Sample loading and fraction collection 147 6.2.4.2 Preparative thin layer chromatography 148 6.2.4.3 High performance liquid chromatography 149 6.2.5 Analysis 149 6.2.5.1 Extraction of lovastatin 149 6.2.5.2 Lovastatin estimation 149 6.2.5.3 Fungal growth determination 149 6.2.5.4 Statistical analysis 149 6.3 Results and Discussion 150 6.3.1 Parameter improvement process in a tray system 150 6.3.1.1 Time course profiles before physical parameters 150 improvement 6.3.1.1(a) Effect of substrate sizes 154 6.3.1.1(b) Effect of moisture content 157 6.3.1.1(c) Effect of temperature 159 6.3.1.1(d) Effect of inoculum size 162 6.3.1.1(e) Effect of initial pH 164 6.3.1.1(f) Effect of mixing frequency 166 6.3.1.2 Time course profile after physical parameters 168 improvement 6.3.2 Comparison of lovastatin production and fungal 169 growth between flask and tray systems 6.3.3 Purification of lovastatin 177 6.3.3.1 Purification by open column chromatography 177 6.3.3.2 Purification via TLC and HPLC 181 6.4 Conclusion 185
CHAPTER 7 PRELIMINARY STUDIES OF FRACTIONAL 186 LOVASTATIN ON BRINE SHRIMP AND LABORATORY RATS 7.1 Introduction 186 7.2 Materials and Methods 187
x
7.2.1 Mycotoxins production 187 7.2.1.1 Mycotoxins analysis 188 7.2.1.1(a) Moniliformin (MON) 188 7.2.1.1(b) Beauvericin (BEA) 190
7.2.1.1(c) Fumonisin B1 (FUM) 191 7.2.2 Lethality test of fractional lovastatin on brine 192 shrimp 7.2.2.1 Hatching brine shrimp 192 7.2.2.2 Fractional lovastatin preparation 193 7.2.2.3 Brine shrimp test 193
7.2.2.4 Determination of lethal concentration (LC50) 194 7.2.3 Application of fractional lovastatin towards rats 194 7.2.3.1 Administration of lovastatin 194 7.2.3.2 Cholesterol diet versus standard diet 195 7.2.3.3 Sprague Dawley grouping 195 7.2.3.4 Cholesterol test 196 7.2.3.5 Cholesterol analysis via colorimetric method 196 7.2.3.5(a) Standard preparation 196 7.2.3.5(b) Cholesterol sample preparation 197 7.2.4 Statistical analysis 198 7.3 Results and Discussion 198 7.3.1 Mycotoxins produced by F. pseudocircinatum 198 IBRL B3-4 7.3.2 Toxicity test on brine shrimp 203 7.3.3 Cholesterol lowering effect of fractional lovastatin 205 on Sprague Dawley rats 7.3.3(a) Growth pattern of rats under fractional 205 lovastatin treatment 7.3.3(b) HDL and LDL level in Sprague Dawley 209 7.4 Conclusion 217
CHAPTER 8 SUMMARY AND GENERAL CONCLUSION 218 8.1 Recommendations and suggestions 221
xi
REFERENCES 222 APENDICES 244
xii
LIST OF TABLES Page
Table 4.1 List of isolation locations and filamentous fungi codes 48 lists
Table 4.2 The PCR thermal cycles applied for TEF-1α 60 amplification
Table 4.3 The chemical components in rice bran and brown rice 62 (%)
Table 4.4 Double screening programmes in tracing lovastatin 64 latent producers
Table 4.5 Other potential lovastatin producers obtained by 68 different researchers
Table 4.6 Colony morphology of Fusarium species on PDA 74
Table 4.7 Structural morphologies of related Fusarium sp with 77 IBRL B3-4 isolate
Table 4.8 The outcomes of sequence alignment in Fusarium-ID 81 and GenBank (NCBI)
Table 5.1 Lovastatin recovery by various solvents 100
Table 5.2 Summary for the optimal physical parameters gained by 120 researchers using various filamentous fungi via SSF system
Table 5.3 Carbon sources effect towards lovastatin production by 125 various filamentous fungi in SSF system
Table 5.4 Various nitrogen sources which potentially can induce 129 lovastatin production
Table 5.5 Mineral salts effect on lovastatin production obtained by 133 different researchers
xiii
Table 5.6 Comparison of lovastatin production using various 136 filamentous fungi
Comparison of lovastatin productivity produced via SSF Table 6.1 172 in flask and scale up systems
Comparisons of chromatographic purification Table 6.2 181
Table 7.1 Preparation of fractional lovastatin for toxicity test 193
Table 7.2 Formulation for Reaction Mix solution 197
Table 7.3 Initial and final body weight of Sprague Dawley rats 206
Table 7.4 HDL and LDL levels in female Sprague Dawley prior to 211 doses treatment Table 7.5 HDL and LDL levels in male Sprague Dawley prior to 211 doses treatment Table 7.6 HDL and LDL levels in female under different doses 212 treatment
Table 7.7 HDL and LDL levels in male after been treated with 213 different doses of fractional lovastatin
Table 7.8 Percentage reduction of blood cholesterol level by 215 Laetisporus sp. extract and commercial lovastatin product compared to control
Table 7.9 Fungi as cholesterol lowering agent in rats 216
Table 8.1 Lovastatin production of F. pseudocircinatum IBRL B3- 219 4 before and after improvement in flask and tray systems
xiv
LIST OF FIGURES Page
Figure 2.1 Different structures of natural, semisynthetic and 17 synthetic statins and its similarity with HMG portion of HMG CoA reductase
Figure 2.2 Biosynthesis pathway for lovastatin generation in 18 simplified scheme.
Figure 2.3 The illustrations of filamentous fungi growth invading 21 the substrate matrix during fermentation process
Figure 2.4 The skeleton structure of moniliformin 23
Figure 2.5 The structure of fumonisin 25
Figure 2.6 Structure of cyclic hexadepsipeptide beauvericin and 27 enniatins
Figure 2.7 Structure of zearalenone 28
Figure 2.8 Various types of bioreactors for SSF system application 37
Figure 4.1 DNA purification of the TEF-1α of IBRL B3-4 80
Figure 4.2 The consensus sequences of IBRL B3-4 80
Figure 5.1 Effect of solvents on lovastatin production 96
Figure 5.2 Production of lovastatin before physical parameters 101 improvement
Figure 5.3 Effect of different substrate particle sizes towards 103 lovastatin production by F. pseudocircinatum IBRL B3- 4.
Figure 5.4 Influence of initial moisture content on lovastatin 106 production
Figure 5.5 Effect of temperature towards lovastatin production by 109 F. pseudocircinatum IBRL B3-4
xv
Figure 5.6 Effect of inoculum size on lovastatin production by F. 111 pseudocircinatum IBRL B3-4
Figure 5.7 Effect of pH towards lovastatin production 113
Figure 5.8 Effect of substrate quantity on lovastatin production by 115 F. pseudocircinatum IBRL B3-4
Figure 5.9 Effect of mixing frequency towards lovastatin 117 production
Figure 5.10 Lovastatin production by F. pseudocircinatum IBRL 119 B3-4 after physical improvement
Figure 5.11 Effect of different carbon sources towards lovastatin 123 titer
Figure 5.12 Effect of various levels of sucrose on lovastatin 123 production in SSF
Figure 5.13 Effect of different nitrogen sources towards lovastatin 126 production by F. pseudocircinatum IBRL B3-4
Figure 5.14 Effect of different concentrations of yeast extract on the 128 production of lovastatin
Figure 5.15 Effect of different mineral salts on lovastatin production 130 by F. pseudocircinatum IBRL B3-4
Figure 5.16 Effect of calcium chloride on lovastatin production 131
Figure 5.17 Lovastatin production after chemical parameter 134 improvement
Figure 5.18 Comparison of lovastatin production before and after 135 parameters improvement
Figure 6.1 Time course profiles for substrate quantity in a tray 152 system
xvi
Figure 6.2 Effect of substrate quantity in a tray system 155
Figure 6.3 Effect of moisture content on lovastatin formation by F. 158 pseudocircinatum IBRL B3-4 in tray system
Figure 6.4 Effect of temperature towards lovastatin in tray system 161
Figure 6.5 Effect of inoculum size on lovastatin production in a 163 tray system
Figure 6.6 Effect of pH towards lovastatin production 165
Figure 6.7 Effect of mixing frequency on lovastatin production 168
Figure 6.8 Lovastatin production and fungal growth of F. 169 pseudocircinatum IBRL B3-4 in tray system after physical improvement
Figure 6.9 A comparison between flask and tray systems on 171 lovastatin production and F. pseudocircinatum IBRL B3-4 growth
Figure 6.10 Chromatogram result for ratio of 7:3 (dichloromethane: 179 ethyl acetate)
Figure 6.11 Chromatogram of purified lovastatin obtained from 184 preparative TLC (A) and also an overlay of lovastatin standard with purified lovastatin
Figure 7.1 The fermented sample of corn grits by F. 200 pseudocircinatum IBRL B3-4 displayed null appearance
of beauvericin (A). Figure 7.2 The detection of MON in fermented corn grits sample 201
Figure 7.3 FUM outcome displayed by UPLC system 202
Figure 7.4 A. salina nauplii condition after 48 hours exposure in 203 artificial seawater (4 x 10 magnification) Figure 7.5 Toxicity of fractional lovastatin against brine shrimp 204
xvii
Figure 7.6 Effect of treatment doses on female rats’ body weights 207
Figure 7.7 Effect of different doses on male rats’ body weights 208
xviii
LIST OF PLATES Page
Plate 4.1 The observe and reverse view of IBRL B3-4 on 69 different agars under light exposure.
Plate 4.2 The growth of IBRL B3-4 isolate under dark condition. 70 A1-A2 are growth on PDA, B1-B2 display growth on SNA and C1-C2 are growth on CLA
Plate 4.3 The microscopic structures of IBRL B3-4 isolate on 75 CLA and SNA agars under magnification of 40 x 10
Plate 4.4 The crucial structures of IBRL B3-4 under SEM view 76
Plate 6.1 Open column chromatography revealed 3 colour layers 178 namely red, pinkish and yellowish
Plate 6.2 A view of lovastatin spots on preparative TLC obtained 182 by fraction of 7:3 (dichloromethane: ethyl acetate)
xix
LIST OF SYMBOLS AND ABBREVIATION
ANOVA Analysis of variance AOAC Association of Analytical Communities BEA Beauvericin CLA Carnation leaf agar DMSO Dimethyl sulfoxide DNA Deoxyribonucleic acid FDA Food and Drug Administration FUM Fumonisin GCMS Gas chromatography mass spectrometry HDL High density lipoprotein HMG CoA 3-hydroxy-3-methyl-glutaryl-CoA reductase HPLC High performance liquid chromatography IUPAC International Union of Pure and Applied Chemistry IVC Individually ventilated cage LC Liquid chromatography LC50 Lethal concentration 50 LDKS Lovastatin Diketide Synthase LDL Low density lipoprotein LNKS Lovastatin Nonketide Synthase MEGA Molecular Evolution and Genetic Analysis MON Moniliformin MS Multiple sclerosis NCBI National Center for Biotechnology Information OECD Organization for Economic Cooperation and Development OPA Ortho phthaldialdehyde PBS Phosphate buffer saline PCR Polymerase Chain Reaction PDA Potato dextrose agar RSM Response surface methodology SmF Submerged fermentation SNA Spezieller Nährstoffarmer agar SSF Solid substrate fermentation TBAHS Tetrabutylammonium hydrogen sulphate TLC Thin layer chromatography UPLC Ultra performance liquid chromatography VLDL Very low density lipoprotein WA Water agar WHO World Health Organization ZEN Zearalanone psi Pounds per square inch mL Milliliter µg/g Microgram per gram µl Microliter µg/µL Microgram per microliter µm Micrometer mg Milligram mg/g Milligram per gram
xx mg/kg Milligram per kilogram rpm Revolutions per minute kg kilogram min Minute mm Millimeter v/w Volume per weight w/w Weight per weight w/v Weight per volume v/v Volume per volume °C Degree celsius G Gravity M Molar cm Centimeter nm Nanometer Rf Retention factor Rt Retention time
xxi
LIST OF PUBLICATIONS AND CONFERENCES a) Publications
1) Syarifah, A.R., Darah, I. and I Nyoman, P.A. (2013). Effect of cultural conditions on lovastatin production by Aspergillus niger SAR I using combination of rice bran and brown rice as substrate. International Journal of Applied Biology and Pharmaceutical Technology, 4(2): 150-156 2) Syarifah, A.R., Darah, I. and I Nyoman, P.A. (2014). Isolation and screening of lovastatin producing fungi: Fusarium pseudocircinatum IBRL B3-4 as a potential producer. Journal of Pure and Applied Microbiology, 8(3): 1763-1772 3) Syarifah, A.R., Darah, I. and I Nyoman, P.A. A new latent lovastatin producer viz. Fusarium pseudocircinatum IBRL B3-4, produced in laboratory tray system. Pertanika Journal of Tropical Agricultural Science, 37(4): 509-522 b) Conferences: Oral presentation 1) Syarifah, A.R., Darah, I. and I Nyoman, P.A. (2010). Screening of novel lovastatin producer under solid substrate fermentation by using rice bran as a substrate and brown rice as a support material. 1st Joint Symposium of ITB and USM, Institut Teknologi Bandung Indonesia, 20-21 December 2010 2) Syarifah, A.R., Darah, I. and I Nyoman, P.A. (2011). A potential cooperation of rice bran and brown rice with mesophilic fungi in producing lovastatin under solid substrate fermentation (SSF). International Congress of the Malaysian Society for Microbiology (ICMSM), Bayview Beach Resort, Batu Feringgi, Penang, 8-11 December 2011 3) Syarifah, A.R., Darah, I. and I Nyoman, P.A. (2012). The influence of physical parameters towards hypercholesterol reducing agent production, lovastatin, under solid substrate fermentation (SSF) condition. 8th IMT-GT UNINET Biosceince Conference, Darussalam-Banda Aceh, Indonesia, 22-24 November 2012 b) Poster presentation 1) Syarifah, A.R., Darah, I. and I Nyoman, P.A. (2012). Assessment of double screening programmes via solid substrate fermentation (SSF) in a flask system and identification of lovastatin potential producer. 8th IMT-GT UNINET Biosceince Conference, Darussalam-Banda Aceh, Indonesia, 22-24 November 2012
xxii
PENAMBAHBAIKAN PENGHASILAN LOVASTATIN OLEH Fusarium
pseudocircinatum IBRL B3-4 MELALUI FERMENTASI
SUBSTRAT PEPEJAL
ABSTRAK
Keupayaan bran beras dan beras perang dalam menurunkan kolesterol dan menyokong sistem fermentasi substrat pepejal (SSF) tidak dapat dinafikan.
Tambahan pula, kemudahan untuk mendapatkan substrat-substrat tersebut di kilang adalah mudah serta harga yang tidak mahal. Sejak beberapa tahun yang lepas, penyelidik-penyelidik telah mengkaji keupayaan padi serta komponennya yang lain seperti bran, beras, jerami dan juga sekam, mempunyai kebolehan dalam menghasilkan metabolit sekunder termasuklah statin. Hospital tempatan di Malaysia mendapat permintaan yang tinggi terhadap statin dan pengambilan lovastatin adalah yang paling ketara di mana sebanyak 51% preskripsi telah dibuat kepada pesakit- pesakit berkolesterol tinggi. Maka, kajian ini menekankan kepada penambahbaikan penghasilan lovastatin oleh Fusarium pseudocircinatum IBRL B3-4 melalui SSF.
Bran beras dan beras perang memberikan nilai komposisi berbeza terhadap kelembapan, protein, lipid, fiber, karbohidrat dan abu. Komponen tertinggi yang didapati dalam bran beras adalah karbohidrat iaitu sebanyak 41.20 ± 2.10% manakala fiber memonopoli komposisi beras perang (48.53 ± 0.58%). Daripada jumlah 78 kulat berfilamen, 55 pencilan menunjukkan titik gelap yang positif di atas plat kromatografi lapisan nipis (TLC) dengan faktor pengekalan (Rf) antara 0.26 hingga 0.32. Walau bagaimanapun, hanya 28 pencilan kulat telah dikesan mensintesiskan lovastatin melalui menerusi sistem kromatografi cecair berprestasi
xxiii tinggi (HPLC). Pencilan IBRL B3-4 menunjukkan penghasilan lovastatin tertinggi berjumlah 281.67 ± 44.44 µg lovastatin/g. Berdasarkan morfologi koloni dan struktur pada agar kentang dektrosa (PDA), koloni pencilan IBRL B3-4 tumbuh sehingga 54 mm dan 60 mm masing-masing di bawah keadaan gelap dan bercahaya.
Untuk penelitian struktur di atas agar bunga teluki (CLA) dan agar Spezieller
Nahrstoffarmer (SNA), pencilan tersebut mempunyai mikrokonidia berbentuk bujur
(4.5-7.0 x 1.7-2.6 µm), makrokonidia yang melengkuk serta berbentuk sabit (32.0-
46.4 x 1.2-2.9 µm), kepala palsu, hifa berlingkar serta rantaian pendek. Melalui pendekatan molekular pula, pencilan ini memberikan persamaan urutan sebanyak
99.33% (pangkalan data Fusarium-ID) dan 99.00% (pangkalan data GenBank) dengan F. pseudocircinatum. Kondisi terbaik bagi F. pseudocircinatum IBRL B3-4 untuk menghasilkan lovastatin dalam sistem kelalang adalah menggunakan saiz asal substrat, kandungan kelembapan sebanyak 70% (i/b), suhu pengeraman pada 30 ±
2°C, saiz inokulum 1 x 105 spora/mL, pH 6.5, 5 g kuantiti substrat (nisbah 1:1) dengan keadaan statik tanpa pengadukan. Sistem ini juga memerlukan nutrisi tambahan iaitu 1.5% (b/b) sukrosa, 1% (b/b) ekstrak yis dan 0.5% (b/b) kalsium klorida. Sistem dulang juga memerlukan kondisi yang hampir sama dengan sistem kelalang kecuali kandungan kelembapan (60%; i/b) dan kuantiti substrat (100 g atau ketebalan 0.5 cm). Produktiviti akhir yang dikesan daripada sistem kelalang ialah
1770.00 ± 60.00 µg lovastatin/g pepejal kering manakala dalam sistem dulang pula sebanyak 2436.67 ± 15.56 µg lovastatin/g pepejal kering, mewakili 38% peningkatan. Kedua-dua sistem memerlukan 12 hari untuk mencapai produktiviti yang maksima. Semasa penelitian toksin kulat, F. pseudocircinatum IBRL B3-4 telah mensintesiskan moniliformin (MON) dan fumonisin B1 (FUM B1) masing- masing sebanyak 4.20 ± 1.12 µg MON/g substrat and 1.73 ± 0.71 µg FUM/g
xxiv substrat. Walau bagaimanapun, nilai kepekatan maut 50% (LC50) untuk fraksi lovastatin menunjukkan aktiviti tidak toksik kerana nilai tersebut melebihi 1 mg/mL.
Sepanjang 4 minggu, fraksi lovastatin berkepekatan 110 mg sampel fraksi/kg berat badan (yang mewakili 550 to 750 µg lovastatin/g berat kering lovastatin) memberikan dos terbaik untuk merendahkan lipoprotein ketumpatan rendah (LDL) dan meningkatkan lipoprotein ketumpatan tinggi (HDL) dalam tikus jantan dan betina Sprague dawley. Nilai akhir LDL yang dikesan melalui pembaca mikroplat
Termo Saintifik Multiskan® Spektrum ialah 0.006 ± 0.001 µg/µL and 0.004 ± 0.001
µg/µL, masing-masing untuk tikus jantan dan betina. Manakala nilai HDL pula, ia meningkat menjadi 0.023 ± 0.001 µg/µL (tikus jantan) dan 0.022 ± 0.003 µg/µL
(tikus betina). Keputusan yang diperolehi daripada kajian ini mencadangkan penggunaan fraksi lovastatin daripada F. pseudocircinatum IBRL B3-4 sebagai agen merendahkan kolesterol.
xxv
IMPROVEMENT OF LOVASTATIN PRODUCTION by Fusarium
pseudocircinatum IBRL B3-4 via SOLID SUBSTRATE
FERMENTATION
ABSTRACT
The ability of rice bran and brown rice in lowering cholesterol and supporting solid substrate fermentation (SSF) system are undeniable. Plus, the accessibility for these substrates is reachable at the mill factory with inexpensive price. For the last few years, researchers have investigated paddy and its other components like bran, rice, straw and husk, own the potentiality in producing secondary metabolite including statin. Malaysian local hospital has experienced a high demand on statin and lovastatin is the most outstanding drug with 51% prescription done for hypercholesterolemia patients. Thus, this recent investigation emphasized the improvement of lovastatin production by Fusarium pseudocircinatum IBRL B3-4 via SSF. Rice bran and brown rice denoted different composition values in moisture, protein, lipid, fibre, carbohydrate and ash. The highest component in rice bran was carbohydrate with 41.20 ± 2.10% while fibre was the superior composition in brown rice (48.53 ± 0.58%). Out of 78 filamentous fungi, only 55 isolates displayed positive dark spot on the thin layer chromatography plate (TLC) with retention factor (Rf) of 0.26 to 0.32. However, only 28 fungal isolates were detected to synthesise lovastatin through high performance liquid chromatography system (HPLC). IBRL B3-4 isolate depicted the highest lovastatin production with 281.67 ± 44.44 µg lovastatin/g dry solid. Based on the colony and structural morphologies on potato dextrose agar (PDA), the colony of IBRL B3-4
xxvi isolate was grown to 54 mm and 60 mm under dark and light conditions, respectively. For structural observation on carnation leaf agar (CLA) and Spezieller
Nahrstoffarmer agar (SNA), the isolate owned oval shape microconidia (4.5-7.0 x
1.7-2.6 µm), slender and falcate shape macroconidia (32.0-46.4 x 1.2-2.9 µm), false head, coiled hyphae and also short chain structure. As a respond to the molecular approach, this isolate depicted 99.33% (Fusarium-ID database) and 99.00%
(GenBank database) sequence similarity with F. pseudocircinatum. The best condition for F. pseudocircinatum IBRL B3-4 to produce lovastatin in the flask system was under the original substrate size, 70% (v/w) moisture content, incubation temperature of 30 ± 2°C, inoculum size of 1 x 105 spore/mL, pH 6.5, 5 g of substrate quantity (1:1 ratio) with static condition. It also needed external nutrients namely
1.5% (w/w) sucrose, 1% (w/w) yeast extract and 0.5% (w/w) calcium chloride. The tray system also required almost the same conditions with the flask system except for moisture content (60%; v/w) and substrate quantity (100 g or 0.5 cm thickness).
The final productivity detected from flask system was 1770.00 ± 60.00 µg lovastatin/g dry solid while in tray system was 2436.67 ± 15.56 µg lovastatin/g dry solid, which represented 38% increment. Both systems required 12 days incubation period to synthesis the maximal productivity. During mycotoxin investigation, F. pseudocircinatum IBRL B3-4 has synthesized moniliformin (MON) and fumonisin
B1 (FUM B1) at 4.20 ± 1.12 µg MON/g substrate and 1.73 ± 0.71 µg FUM/g substrate, respectively. However, the lethality concentration 50% values (LC50) for fractional lovastatin signified non-toxic activities as the value was higher than 1 mg/mL. Within 4 weeks treatment, fractional lovastatin concentration of 110 mg fraction sample/kg body weight (which represented 550 to 750 µg lovastatin/g dry solid of lovastatin) was slightly the best dose to reduce the low density lipoprotein
xxvii
(LDL) and increase the high density lipoprotein (HDL) in male and female Sprague dawley rats. The final LDL value detected via Thermo Scientific Multiskan®
Spectrum microplate readers in male and female was 0.006 ± 0.001 µg/µl and 0.004
± 0.001 µg/µl, respectively. While for the HDL, it amplified to 0.023 ± 0.001 µg/µl
(in male) and 0.022 ± 0.003 µg/µl (in female). The results obtained from this work suggested the application of fractional lovastatin from F. pseudocircinatum IBRL
B3-4 can greatly appointed this compound as an anti cholesterol lowering agent.
xxviii
CHAPTER 1
INTRODUCTION
1.1 Hypercholesterolemia versus its reversal agent
Hypercholesterolemia is an anomalous cholesterol level in blood which is out of normal range and regularly welcomes the cardiovascular-relating events. Any substances or compounds which can obstruct the extra production of cholesterol in liver are recognized as hypercholesterolemia agent. Cardiovascular diseases are a cluster of heart and blood vessel abnormalities which can be controlled by cholesterol antidotes like statins. Besides anticholesterol agent, statin is also well established as a stroke preventer and able to block the peripheral vascular disease (Maron et al., 2000). At the same time, it possesses biological and pleiotropic effects including antithrombotic and anti-inflammatory which may lead to atherosclerotic plaque reduction (Rosenson and
Tangney 1998; Fenton and Shen 1999; Vaughan et al., 2000) and also as a treatment against Alzheimer disease, multiple sclerosis, hypertension, ostreoporosis, ventricular arrhythmia and immune response (Glorioso et al., 1999; De Sutter et al., 2000; Meier et al., 2000; Chong et al., 2001; Zamvil and Steinmann, 2002; Eckert et al., 2005). The controllers for the hypercholesterolemia are low density lipoprotein (LDL) and high density lipoprotein (HDL). Both of these carriers are responsible to translocate the cholesterol in blood within cell which results changes in cholesterol.
1
1.2 Fermentation and idiolites perspectives
Fermentation is an ample process to produce complex molecules and active compounds such as antibiotics, enzymes, vitamins, amino and organic acid that are not viable to be chemically constructed (Reddy et al., 2012). It is a technique of biological modification of complex substrates to become simpler compounds by microorganism including bacteria, fungi and yeast. Apart from carbon dioxide and alcohol, the metabolic breakdown also releases the additional compounds which are also known as secondary metabolites (Subramaniyam and Vimala, 2012) or idiolites. Chemical structures of these metabolites are secreted by certain microbes and some plants. They are spawned throughout trophophase period (rapid growth phase or log phase) and are further synthesized at the later phase namely iodophase (stationary phase). The accomplishment of any biosynthesis extension in iodophase relies on the tropophase
(Barrios-González et al., 2003). Secondary metabolism in the iodophase employs primary metabolites to generate species-specific and chemically vary end products that are not vital for microbial growth (Waites et al., 2001). The booster of secondary metabolite production is when the growth is restricted due to the lack of nutrients either carbon, nitrogen or phosphate (Barrios-Gonzales et al., 2003).
1.3 Lovastatin in action
Statins are the recommended drugs for hypercholesterolemia which are derived via fermentation as a secondary metabolite compound. Together with recognized diets and physical exercises, statins can be a navigator for the cholesterol level in blood. A
2
few statins have been manufactured as a single-ingredient products with their own commercial names by US Food and Drug Administration namely atorvastatin, fluvastatin, lovastatin, pitavastatin, pravastatin, rosuvastatin and simvastatin
(United State Food and Drug Administration, 2012). The standard recommended dose by medical practitioners was 20 to 40 mg. These drugs’ concentration can deduct LDL by about 25% to 40% and increase HDL nearly 5% to 10% (Scirica and Cannon, 2005).
Lovastatin is categorized under natural statin and formerly known as mevinolin, monacolin K and Mevacor. This persuasive drug is responsible to demolish 3-hydroxy-
3-methyl glutaryl coenzyme A reductase (HMG CoA) which is attracted to trap at the early step of cholesterol biosynthesis. Due to the heat and mass transfer problems which occurs in solid substrate fermentation system (SSF), submerged fermentation (SmF) has become a favorite mediator for lovastatin production (Pandey, 2003). Nevertheless, it can also be generated by the emerging technology of SSF which displays more advantages. This system promises more biotechnological benefits over than SmF even in a basic laboratory scale. It offers higher fermentation yield and product concentration packaged with better stability, lower in catabolic suppression, sterility demand (Hölker et al., 2004), energy requisite, producing less dissipate water and biological friendly
(Pandey, 2003). SSF has proven in exhibiting much distinctiveness which is indeed very useful and has become a major industrial microbial producer.
Production of lovastatin by SmF and SSF has been widely investigated and commonly, filamentous fungi exhibit tremendous potentiality. Reports from 2003 onwards recognized that other than Aspergillus terreus (Casas López et al., 2004;
Pansuriya and Singhal, 2010), there are numbers of different genus or species of fungi 3
that hold abilities to generate lovastatin specifically Aspergillus niger, Fusarium sp.
(Raghunath et al., 2012), Penicillium funiculosum (Reddy et al., 2011), Aspergillus fisheri (Latha et al., 2012), Monascus purpureus, Monascus ruber (Seraman et al.,
2009; Panda et al., 2010), Monascus pilosus (Miyake et al., 2006), Aspergillus flavipes
(Valera et al., 2005), Trichoderma viridae and Trichoderma longibrachiatum (Samiee et al., 2003).
1.4 Rationales of Study and Objectives
Increment of hypercholesterolemia patients, high demand in statin drugs prescription, large capacity of agriculture wastes in Malaysia and advancement in SSF which can turn the waste into myriad of value added products, are the concrete rationales for this research.
An outbreak of world’s bestselling drugs in 2013 which is recently highlighted by Forbes magazine exposes that hypercholesterolemia generic remedy namely statin, still holding the throne of the greatest selling drugs totaling of USD13,696 million in
2006. Until now, the number has not yet been broken by sales of any other drugs.
According to the World Health Organization’s report, in 2008, 30% of global deaths
(equal to 17.3 million of people) are caused by cardiovascular diseases and hypercholesterolemia was the main trigger. It has been predicted that by 2030, a total mortality can potentially hit to 23.3 million figures (World Health Organization, 2013).
Cardiovascular disease is one of the forefront diseases that cause death at Malaysian government hospitals in 2009. The report indicates a total of 55.9% of patients suffered
4
from acute coronary syndrome (ACS) due to dyslipidemia condition (an elevation of lipoprotein level which leads to hypercholesterolemia) (Ministry of Health Malaysia,
2010). A local data collection of cholesterol level among Penangites at Sungai Pinang
Township indicated 3 out of 12 persons hit the cholesterol reading of 5.2 mmol/L or more (Kiew and Chong, 2013). The worrisome increases after National Cardiovascular
Disease Database Malaysia (2008) reveals that the development of ACS among
Malaysians is at a younger age (58) compared to other countries i.e. China, Thailand and the West (above age of 60).
Statins are a potent hypercholesterolemia modifying drug in Malaysia as 91% of discharged patients from our local hospitals have experienced the statins treatment
(Wan Ahmad et al., 2011; Ahmad et al., 2011). The figure increases almost 19% from year 2007 to 2008. Among statins, lovastatin is the most outstanding drug in Malaysian hospitals with 51% prescription and this recent status has appointed lovastatin to be under top 40 most wanted drugs in this country. Since year 2007 to 2008, the demand towards lovastatin increased and its rank in National Cardiovascular Disease Database
Malaysia changed from 13th to 9th (National Cardiovascular Disease Database Malaysia,
2008). In 2005, the expenditure of general cholesterol lowering drug (including statin) was about RM108.5 million out of RM2.2 billion of total drugs expenses (Sameerah and Sarojini, 2007). After considering all of the provided facts, Malaysians needs to have a new mode of ‘drug’ to lessen the government burden and obtain the healthiness.
One of the best solutions is by considering the traditional or staple food which owns the medicinal value in lowering cholesterol such as ‘Angkak’ or red yeast rice production, an edible traditional medicinal-food for hypercholesterolemia. The trial on rice bran and
5
brown rice in producing anticholesterol agents are rarely being investigated especially through solid substrate fermentation system, albeit both of these products are valuable of respect in their own right. Kang et al. (2012) recorded a tremendous action of rice bran in reducing lipid level in mice by inspecting the lipid excretion in fecal. Even in humans, rice bran still maintains its anticholesterol greatness by improving 78% of lipid ratios in hypercholesterolemia patients (Gerhardt and Gallo, 1998). Brown rice, on the other hand, is also bringing a parallel impact as same as rice bran. Through research, a brown rice diet in Sprague dawley managed to put the LDL condition at ameliorate level (Roohinejad et al., 2010). There was also a significant decrease in lipid activity after 10 days of lipid profile in rabbit as reported by Mohd Esa et al. (2011). Due to these consistent evidences, the rice bran and brown rice should release no doubt to be selected as a ruling element in SSF for the production of anticholesterol agent purpose.
In addition, the originality of lovastatin is another selection factor for this experiment. It is generated naturally from the fermentation process and holds a low adverse side effect towards animal and human (Tobert, 2003). Up until now, only about
4.6% of patients stop prescribing their lovastatin medicine because of the side effect
(Goswami et al., 2012). Ever since from its first discovery until the patent approval by
Food and Drug Administration (FDA), lovastatin is widely produced under fermentation process and SmF is the foremost system for its production. SmF by batch or fed-batch culture is the well recognized method to generate lovastatin in the system by diversifying the conditions of physico-nutritional parameters. The advancement in
SmF gives another idea to develop the SSF system. Isolation, screening, optimization, scale up system and purification of lovastatin via SmF which including Plackett-
6
Burman study, factorial designs and response surface methodology (RSM), are inclusively reported by researchers (Lai et al., 2003; Seraman et al., 2010). Thus, it is important to initiate another research of SSF lovastatin-based.
Agro-industry is still an important sector that contributes to Malaysia economical growth. In year 2013, Malaysia produced RM789.9 billion of Gross
Domestic Product and out of the figure, RM56.9 billion representing agriculture, forestry and fishing sector (The Malaysian Economy in Figures, 2013). From the statistic, it can be concluded that agricultural (or agro-industry) waste becomes a troublesome burden to the government. Farmers in Malaysia habitually use an easy initiative method to overcome the biomass abundant (mostly paddy and oil palm’s left- over) which is by allowing a direct open burning. Under low cost and time saving factors, the burning activity is done to clear the land and fertilize the soil for the next planting cycle. The biomass burning inspires the greenhouse gas emissions such as carbon dioxide, methane, carbon monoxide and nitrous oxide (N2O), into the atmosphere. However, carbon dioxide is the most widely produced gas from the combustion of biomass (Mastura, 2008). The existence of those gases contribute to the production of chemicals in the ozone layer (troposphere) that directly involve in controlling the concentration of hydroxide radicals during the regulation cycle of other atmospheric gases. Some of the biomass wastes or residues can naturally be used as fertilizer, however, it involves a long decomposition process until at a certain stage it can transfer into pests’ territory (Ahmad et al., 2002). Some of the damped biomasses such as rice bran and palm kernel cake are also being consumed by ruminant and non- ruminant animal as a feedstuff.
7
The benefits offered by SSF specifically its high yield and concentrated final
product with less energy requirement and effective process (Perez-Guerra et al., 2003),
provide some promises to disentangle all of the aforementioned problems. Hence, it
directly leads into sensible reasons to proceed this experiment. The objectives of the
present research are;
1. To isolate, screen and identify potential local fungi which can significantly produce
lovastatin under SSF
2. To improve cultural conditions and medium compositions for lovastatin production
3. To compare lovastatin production in flask and laboratory tray systems
4. To purify lovastatin via chromatographic purification
5. To test the effectiveness of fractional lovastatin as cholesterol lowering agent on
laboratory animal, Sprague dawley rats.
8
CHAPTER 2
LITERATURE REVIEW
2.1 Agricultural crops in Malaysia: Rice processing and its byproduct
In a year, a total of 998 million tones of agricultural wastes are produced worldwide and out of the number, 1.2 million tones is represented by Malaysia alone
(Twana and Fauziah, 2012). According to the Department of Statistic Malaysia, in
2010, the oil palm sector conquers the landfill agricultural production with 64,282,738 tones of fresh fruit bunches followed by paddy (2,464,831 tones), cocoa (402 tones) and rubber (56 tones).
The world needs to support 600 million tones production of Oryza sativa (rice) yearly (Chen et al., 2012) and 150 million hectares of land area are preserved for paddy planting (Food and Agriculture Organization, 2004). Rice has a few layers namely hull, bran layer, endosperm and embryo. Once the outer layer (the hull or husk) is eradicated, it will expose the brown rice which is the carrier of the essential nutrients. Rice is a staple food for Asian but the grain polishing process has eliminated a lot of nutrients richness. Cleaning, hulling and post-hulling processing which cover whitening, polishing and grading procedures are the basic steps in rice refining (Mohd Esa et al.,
2013). Those programs destroy B1, B3 and B6 vitamins at 80%, 67% and 90%, respectively. Others ousted minerals are half of manganese and phosphorus with 60% iron and all of the dietary fiber and vital fatty acid (Babu et al., 2009).
The main outcome of rice process is endosperm or rice with 70% production which excludes its minor portion (20% rice husk, 8% rice bran and 2% rice germ) 9
(Wells, 1993; de Deckere and Korver, 1996; Van Hoed et al., 2006). A hundred kilograms of paddy equal to 56 to 58 kg white rice, 10 to 12 kg broken rice, 18 to 20 kg hull or husk and 10 to 12 kg rice bran (Kahlon, 2009). Rice husk and bran are the only leftovers that are applied into feed formulation (Department of Veterinary Services,
2013).
Comparing to the white rice, brown rice is claimed to be the best rice to consume. Within the brown rice, there is a bran layer and it is composed of pericarp, seed coat, nucellus and aluerone layer (Tahira et al., 2007). Brown rice becomes the second choice because of low eating quality and poor in palatability. The hard and dark cooked grain which is originated from the bran contributes to difficulty during munching process. But yet, those two elements (bran and brown rice) are the best options for healthy diets.
2.2 Cholesterol: a review
Cholesterol is vital during essential bile acids secretion and also very low density lipoproteins (VLDL) production for hormone biosynthesis. Generally, it is a fat substance or steroid molecule which is accumulated in our blood and cells. One-third of body cholesterol (75%) originated via diet and the other two-thirds (25%) are naturally generated from intracellular precursors by organs (Albert et al., 1980; Demain 1999;
Furberg 1999). Cholesterol comes in two main packages; the bad cholesterol LDL and the good cholesterol HDL. The emergence of extra LDL in blood commonly relates to the increasing risk of heart attack and stroke. By contrast, HDL becomes a life guard
10
against those diseases. Besides genetic heritage, lifestyle and diet, the accumulation of cholesterol around the arteries is also depending on age factor (Scirica and Cannon,
2005). The animal-based food such as meats, poultry and dairy products and also some seafood are sources for exogenous cholesterol ingestion with 30% to 75% naturally absorbed by human body. For endogenous synthesis, it takes place in liver and spares
600 to 1000 mg/day cholesterol for our body usage. About 750 to 1250 mg cholesterol are secreted each day in bile. Generally, cholesterol and other fats cannot directly suspend in blood. Thus, it has to be carried by its own transporter, HDL and LDL. In vivo, cholesterol synthesis is triggered from acetyl CoA, reacts with acetoacetyl CoA to form HMG CoA and then it is narrowed down to mevalonate with HMG CoA reductase intervention (Campbell and Farrel, 2008). During this rate limiting step, the invading of cholesterol inhibitors such as statins are very crucial in controlling cholesterol over production.
2.2.1 Biomedical applications of lovastatin
Cholesterol obstruction by lovastatin not only works on hypercholesterolemia but also in other clinical terms. The trafficking condition during or after the elimination of HMG CoA reductase in cholesterol biosynthesis pathway (specifically in mevalonate pathway) allows bunch of mystifying pathways with unknown mechanisms system that might spare a lot of advantages in healing other chronic diseases.
11
2.2.1.1 The triumph of lovastatin in heart diseases
Human heart is a pump that comprises four chambers with remarkable ‘lup-dup’ rhythm, symbolic of the opening and closing of its valves. A complete blood pumping travels from right ventricle to left ventricle via pulmonary artery and pulmonary vein and finally, the oxygenated blood will be transported throughout the body by arteries.
This tremendous process repeats around 72 times in a minute, more than 100,000 times daily, over 37 million times yearly and almost 3 billion times in a lifetime.
Approximately, the human heart pumps 4,000 gallons of blood per day. The hard work of heart may welcome variety of diseases and usually the blood vessels become the main factor of the problematic compare with the heart itself. The failure of coronary arteries to transport blood and oxygen required by the heart muscle is defined as coronary heart disease and the most widespread cause of this disease is atherosclerosis.
The event happens due to the plaque attachment to the coronary arteries wall and obstructs the blood flow. The plaque is built of cholesterol deposit, calcium and anomalous cells (Pampel and Pauley, 2004). The lovastatin intakes can increase the good cholesterol level (HDL) in blood system which leads into lesion retardation around the artery. Furthermore, it is also believed to cure all kinds artery related problems including improvement of endothelial function, controlling the inflammatory responses, sustaining plaque constancy and averting thrombus development
(Sreenivasan et al., 2008).
12
2.3 Statins
2.3.1 Back to the past: the historical statins
Akira Endo is the best person to enlighten the discovery of statins. In 1971, a research team was set up to isolate fungi and mushrooms. Within two years, they managed to identify Penicillium citrinum ML-236B as a mevastatin or compactin producer, an inhibitor for lipid secretion. Pioneering in statin group, mevastatin scientifically denoted a reduction of plasma cholesterol in hens, dogs and monkeys.
However, Japan stopped the trial because of the tumor detection in dogs. The next finding is a ‘controversy’ lovastatin. In Tokyo (February 1979), Endo has isolated mevastatin analogues from Monascus ruber namely monacolin K, monacolin J and also monacolin L. Within those compounds, monacolin K generated the major product and vaguely indicated better result in demolishing HMG CoA reductase compared with the original mevastatin. Those three derivatives (monacolin K, monacolin J and monacolin
L) are patented by the owner in February, April and October 1979, respectively (Endo,
2004). Meanwhile, in 1978, Alfred Alberts and Julie Chen from Merck Research
Laboratory found a new soil fungus, Aspergillus terreus which can also produced HMG
CoA inhibitor. They called it mevinolin but later it is officially launched as lovastatin
(Tobert, 2003). Merck formally patented mevinolin in June 1979 and four months later, it is verified that monacolin K and mevinolin consisted the same structure. Mevinolin is found earlier than monacolin K (November 1978 versus February 1979), but the copyright was four months behind monacolin K (June 1979 versus February 1979).
There is no toxic revealed by this compound during toxicity test on animal and via this result, Merck boldly continued the clinical test on hypercholesterolemia patients. The 13
trials exposed a significant drop of plasma cholesterol with slight side effects. On
November 1986, Merck moved one step forward by submitting an application to the
Food and Drug Administration (FDA) for lovastatin commercialization. The FDA committees signed an approval on 1 September 1987 with a condition. The drug can be prescribed to the patients only if the diet or non-pharmacological techniques can not lessen the overproduction of cholesterol in blood (Merck and Co., 1987).
Basically, statins are built up of polyketide portion (hydroxyl-hexahydro naphthalene ring system) initiated from acetate units bonded together in a head-to-tail formation (Manzoni and Rollini, 2002). Native lactone (a close ring form) and β- hydroxyl acid (open ring form) are two major forms of statins. After mevastatin failure
(compactin) and successful medicinal effect of lovastatin, statins welcoming a new comer into the cluster namely simvastatin (or Synvinolin and Zocor). It contains the same molecular structure as lovastatin but with the additional side chain methyl group.
Then, the world witnessed the existence of pravastatin followed by fluvastatin, atorvastatin, cerivastatin and recent finding in 2003, rosuvastatin. As mentioned earlier, statins are triggered from fermentation. Thus, all of the statins are huddled into natural, semisynthetic and synthetic. Mevastatin and lovastatin are certainly natural statins while simvastatin is categorized under semisynthetic as it is synthesized from lovastatin by replacing the 2-methylbutryl side chain with 2,2-dimethylbutyryl. Pravastatin undergoes a biological transformation from mevastatin which involves Strepromyces carbophilus during the process. Other new statins members such as fluvastatin, atorvastatin, pitavastatin and rosuvastatin are in synthetic cluster. Even statins share a general action mechanism and structural composition which are very identical to HMG portion, they
14
diverge in their chemical structures (Figure 2.1). These structures are very potent in showing affinity towards HMG CoA reductase. The differences of each statins lie in the hydrophobic components which covalently tie a linkage to HMG-like moiety. In synthetic class, they have fluorophenyl groups to link to the structure. Decalin ring substituent appears in naturally derived statins and a special case for pravastatin as it consists a hydroxyl substituent at the hexahydronaphthalene nucleus which is considered as hydrophilic (Nigović et al., 2012).
2.3.2 Biosynthesis of lovastatin
The IUPAC name of lovastatin is [(1S,3R,7R,8aS)-8-[2-[(2R,4R)-4-hydroxy-6-oxo- oxan-2-yl]ethyl]-3,7- dimethyl-1,2,3,7,8,8a- hexahydronapthalen-1-yl](2S) 2- methylbutanoate with empirical formula of C24H36O5 and 404.55 molecular weight. It is a white, nonhygroscopic crystalline powder which is unsolvable in water except in ethanol, methanol and acetonitrile (Goswami et al., 2012). Lovastatin is consumed as lactone prodrug which is transformed into active HMG CoA inhibitor form (hydroxyl acid) in the hepatocyte organ, liver. As noted above, all statins derived via acetate units to structure out polyketide skeleton. Lovastatin Nonketide Synthase (LNKS) and
Lovastatin Diketide Synthase (LDKS) are two polyketides preserved for lovastatin in
Polyketide Synthase system (Barrios-González and Miranda, 2010). By referring to previous study by Endo (1979), two main chains are involved to spawn monacolin K or lovastatin which are monacolin J and monacolin L. Figure 2.2 designates the first synthesised chain of monacolin L which is constituted of nine acetate molecules and
15
then it alters into monacolin J (assemble from two units of acetate and nine methionine units) under hydroxylation process. Monacolin J subsequently linked to methyl butryl
CoA lovastatin which is assembled from two acetate units and one methione unit.
Polyketide Synthase system codes the LNKS and LDKS in Aspergillus terreus with a few essential genes engaged; lov B, lov C, lov F and lov D. LNKS is a gene outcome of lov B that interacts with lov C (enoyl reductase) to perform dihydro monacolin L which is next synthesised into monacolin J. The other pathway to generate monacolin J is via
LDKS system and it is a prominent key to guarantee an efficient production of lovastatin. lov F cooperated with lov D, a transesterases enzyme, which allow the attachment of 2-methylbutyric acid to monacolin J and proceed to the formation of monacolin K or lovastatin (Manzoni and Rollini, 2002; Sreevanivasan et al., 2008;
Barrios-Gonzales and Miranda, 2010).
2.3.3 Lovastatin in SSF
Low cost factor due to dual-duty of solid substrate (as a matrix and nutrients support) is the utmost reason for SSF selection. One of the ancient uses of SSF, which dates approximately at the first century A.D., is angkak (also known as anka or Chinese red rice) production by Monascus sp. At that time, in China, Angkak production was secretly produced. However, during Ming Dynasty (A.D 1368-1644), this medicinal- value rice was widely published to treat a lot of diseases including colic dyspepsia, diarrhea, hangovers and bruised muscles. Besides, it is also consumed by Chinese to improve the blood circulation and upgrading the spleen and stomach function
16
HMG CoA Lovastatin Pravastatin Fluvastatin
Rosuvastatin Atorvastatin Simvastatin Pitavastatin
Figure 2.1: Different structures of natural, semisynthetic and synthetic statins and its similarity with HMG portion of HMG CoA reductase (Manzoni and Rollini, 2002)
17
+ LNKS (lovB)
enoyl reductase Acetyl-CoA Malonyl-CoA (lovC)
+ S-adenosylmethionine Dihydromonacolin L Cytochrome P450
(lovA or ORF17)
Monacolin L
LDKS Acetyl-CoA (lovF) + + Malonyl-CoA + 2-metylbutyryl-CoA SAM
Monacolin J
Transesterase (lovD)
Lovastatin
Figure 2.2: Biosynthesis pathway for lovastatin generation in simplified scheme. The different enzymes that impregnated their own specific genes are actively involved in every part of bioconversion (Manzoni and Rollini, 2002).
18
(Arunachalam and Narmadhapriya, 2011). According to recent studies, single and co- culture inoculation (Panda et al., 2009; Panda et al., 2010) of Monascus sp. initiates the activity of lovastatin which indirectly proves that Monascus sp. fronting the lovastatin production in SSF compared with other filamentous fungi. Szakacs et al. (1998), Valera et al. (2005), Wei et al. (2007), Pansuriya and Singhal (2010), Reddy et al. (2011) and
Latha et al. (2012) are researchers who gave their efforts in investigating the best lovastatin producers among filamentous fungi under SSF condition. It includes the mutant or wild-type species of suspected fungi. Furthermore, studies on maximizing the production of secondary metabolite lovastatin is started to be emphasized via response surface methodology (RSM), Plackett-Burman, Box-Behnken factorial and as well as fabrication and modeling of bioreactor designs.
2.4 Solid substrate fermentation (SSF) and its consideration factors
2.4.1 Definition of SSF
Solid substrate fermentation is a general term in describing any fermentation process which involves solids including suspensions of solid particles in an unremitting aqueous phase and even trickle filters. Solid state fermentation is also categorized under solid substrate fermentation (Mitchell et al., 2006). It is characterized as growing microorganism on adequate moist of solid supports which are comprised of insoluble natural substrates and inert carriers (Hölker et al., 2004). A natural territory is created by allowing the absence or near absence of free water in the fermentation process
(Pandey et al., 2000). Throughout this experiment, SSF term is used to represent solid
19
substrate fermentation. As reported by Pandey (2003), the selection of microorganism and substrate, physico-chemical parameters, isolation and purification of the product are some critical aspects that should be considered prior to SSF employment.
2.4.2 Rationale of filamentous fungi selection
Common microbes such as bacteria, yeast and fungi are capable to grow and conquering the solid substrate. However, the most highlighted microbe in SSF, especially the ones with lovastatin-producing ability, goes to fungi kingdom. By considering the physiological, enzymological and biochemical properties in a low water activity (Aw) event in SSF, filamentous fungi are the best selection compared with the other unicellular microorganisms (Raimbault, 1998; Pérez-Guerra et al., 2003).
Two gigantic groups in macro fungi are Ascomycetes and Basidiomycetes.
However, only a few of the members can synchronize their growth with SSF surroundings (Hölker et al., 2004). The hallmark of filamentous fungi is its special hyphae with enzymatic tip. The hyphae ability in elongating, branching and attacking the substrate has made this microorganism more superior in host colonisation and nutrients utilisation (Figure 2.3). After inoculation process, spores take 10 hours to germinate. At this time, the substrate bed has to supply some heat to make sure a precise temperature for smooth germination. This progress results in daughter hyphae production which induces new branches and finally expanding the micro colony.
Elongation of hyphae stimulates the micro colonies meeting which welcome a negative interaction between hyphae tips. Such this incident forces the tips to change their route
20
Figure 2.3: The illustrations of filamentous fungi growth invading the substrate matrix during fermentation process (Rahardjo et al., 2006).
21
or retarding the growth. For those that keep on extending, they can choose to grow at the surface of the liquid film or injecting into the matrices (Mitchell et al., 2006).
Hyphae are grown in linear and constant pattern to permit a contact to the cell wall of solid substrate. Once it grips the substrate, the hyphal apex emits an amount of hydrolytic enzyme to ensure a smooth penetration into the substrate. Unlike SmF, the enzyme excretion in SSF is more concentrate and contribute a lot in penetration efficiency. Other than invading the host, a close connection between hyphae and substrate also encourage biological synthesis and fungal metabolic activities
(Raimbault, 1998) like secondary metabolites production.
2.4.2.1 Fusarium sp. and its major mycotoxins
This genus is defined as plant destructor with pan-tropical distribution via air, seeds, soils or plant debris. Commonly, the members of this genus are actively contributed in economic losses involving cereal grains (Goswami and Kistler, 2004), vascular wilts on banana (Liew et al., 1998), bakanae on rice (Nur Ain Izzati, 2007), pokkah boeng on sugarcane (Siti Nordahliawate, 2007), root rots on vegetable such as asparagus (Al-Amodi and Salleh, 2005) and some researchers reported cankers production on soft and hardwood trees (Wingfield et al., 2008).
This species is literally divided into three clades; African, American and Asian.
According to the hypothesis of O’Donnell et al. (1998), the originality of fungi host including its evolvement should be taking into account during clade clustering.
However, numbers of species composition does not suit with the hypothesis. Among
22
these three groups, African is announced as the biggest clade which has 23 phylogenetic lineages and it huddles as productive chlamydospore-formers. The so-called ‘American clade’ has 18 phylogenetic lineages while the Asian is the smallest clade with 10 phylogenetic lineages (Kvas et al., 2009).
Mycotoxins are classified as unavoidable natural contamination in most of foods and feeds. Fumonisins (FUM), zearalenone (ZEN), moniliformin (MON) and beauvericin (BEA) are the most regular toxins produced by Fusarium sp. (Logrieco et al., 2002; Leslie et al., 2004; Sopterean and Puia 2012). The sodium or potassium salt of 1-hydroxycyclobut-1-ene-3,4-dione (Figure 2.4) is the precise criterion to elaborate moniliformin (MON). Its first outbreak was in 1973 after the extraction process of
F. proliferatum which was inoculated in a corn culture. However, the identified species shown a similar characteristic with F. moniliforme, thus the mycologists came out with moniliformin name (Cole et al., 1973). At least 30 Fusarium species produce this compound in the cereal grains (commonly corn) and the most influential species are F. proliferatum and F. subglutinans.
Figure 2.4: The skeleton structure of moniliformin (sodium salt) (Munimbazi and Bullerman, 2001)
23
This metabolite is very toxic either to plants or animals. The symptoms of afflicted animal may be varied and commonly muscular failing, respiratory suffering, cyanosis, coma and also death, are the ordinary signs. Analyte that contains moniliformin has to go through cleanup process before it is further analysed via liquid chromatography, capillary electrophoresis or immunochemical reactions (Munimbazi and Bullerman, 2001).
Fumonisin is named after F. verticilloides which previously known as F. moniliforme. It comprises B1, B2 and B3 and commonly B1 is found at the highest level compared with others (Marasas, 1996). (Rheeder et al., 2002). Approximately, 70 to
80% of the total fumonisins are represented by FUMB1 and FUMB2 reaches up 15 to
25%. The FUMB3 produces the lowest level which is around 3 to 8%. These percentages occur in solid or liquid medium condition (Branham and Plattner, 1993;
Marín et al., 1995). Fumonisin B2 (FUMB2) and fumonisin B3 (FUMB3) show up after the finding of FUMB1 in 1988. The backbone of FUMB2 and FUMB3 are lacked in free hydroxyl groups compared with FUMB1 (Figure 2.5) (Plattner et al., 1992).
The detection of FUMB1 in a sample usually is done via liquid chromatography
(LC) completed with fluorescence detector. This toxin contains a least UV-light absorbing chromophore and has no fluorescence production because of the simple long chain alcohols, thus a derivatization of the free amine is required for detection purpose
(Shephard et al., 1990; Kedera et al., 1999).
There are a few of diseases related to fumonisins such as leukoencephalomalacia
(ELEM), pulmonary oedema syndrome (PES) and hepatocarcinoma. These diseases
24
occur in horses, swines and rats, respectively (Harisson et al., 1990; Marasas, 1996;
Gelderblom et al., 2001). To date, the disease afflicts in animals and no solid report of adverse affects to be correlated with human. However, these toxins are believed to be a part of the cause of oesophagael cancer which transpires in South Africa, China, Italy and Iran (Franceschi et al., 1990; Rheeder et al., 1992; Wang et al., 2000; Shephard et al., 2000).
X OH
CH 3
CH3 OR CH3 Y NH2
R = COCH2CH(COOH)CH 2COOH FB1 : X = OH, Y = OH FB : X = OH, Y = H 2 FB3 : X = H, Y = OH
Figure 2.5: The structure of fumonisin (Shephard, 2001)
A cyclic hexadepsipeptide compound (Figure 2.6), namely beauvericin, is originated from various fungi known as entomopathogenic (Beauveria sp. and
Paecilomyces sp.) and plant-pathogenic (Fusarium sp and Polyporus fumosoroseus) fungi (Hamill et al., 1969; Logrieco et al., 1998; Munkvold et al., 1998). Its structure and function is almost similar to the membrane-damaging antibiotics known as enniatins A, B and C that are also produced by a number of Fusarium sp. However, it 25
can be distinguished with the existence of N-methylamino acids. Beauvericin works in insecticidal, anti tumor and antimicrobial which includes bacteria, fungi and virus
(Wang and Xu, 2012). As insecticidal agent, research was done by testing beauvericin on Calliphora erythrocephala, Aedes aegypti, Lygus sp., Spodoptera frugiperda and
Schizaphis graminum. However, beauvericin depicted an extra effective action on Aedes aegypti (Grove and Pople, 1980). During cell line test, beauvericin stimulates the extracellular Ca2+ into the cytosol and result in the release of Cyt c from the mitochondria. The signal which is sent by Cyt c leads to activate apoptosis (Kouti et al.,
2003). It also fights against bacteria (including pathogenic bacteria) with no selective option between Gram positive and Gram negative. This potentiality may lead to the settlement of drug resistance problem due to bacterial infections (Nilanonta et al., 2000;
Meca et al., 2010). Besides, based on Fukuda et al. (2004) and Zhang et al. (2007), beauvericin is also believed to be an antifungal agent when it combines with ketoconazole or miconazole mostly in defecting Candida parapsilosis. While Shin et al.
(2009) detected a potent finding of cyclic hexadepsipeptides beauvericin as an inhibitor of HIV-1 integrase. Thus, this compound should be put under serious investigation for other latest booming viruses i.e. SARS, H1N1, HBV and AIV.
Zearalanone (ZEN) is an oestrogenic mycotoxin which is actively produced by certain species of Fusarium and Gibberella. It is recognized to afflict a hormonal problem in pigs and sheep but the same effect is not significantly displayed by human.
In fact, this compound has been approved by International Agency for Research on
Cancer (IARC, WHO) under code IARC Group 3 as a non carcinogenic towards
26
humans. It has an empirical formula of C18H22O5 (Figure 2.7) and it is characterized chemically as a phenolic resorcyclic acid lactone (Lawley et al., 2012).
ZEN is generally analysed via thin layer chromatography (Smith et al., 2004), gas chromatography mass spectrometry (GCMS) (Tanaka et al., 2000; Zhang et al.,
2006) and it is also a widely used analyser, high performance liquid chromatography with fluorescence or mass spectrometry detection (Pallaroni and Holst, 2003; Maragou et al., 2008). The molecular methods such as enzyme-linked immunosorbent assays
(ELISA), immunoblot assay, immunofiltration assay, immunoassay with capillary electrophoresis combination and fiber optic biosensors have been well established for fast track screening mycotoxins (Abouzied and Pestka, 1994; Schneider et al., 1995;
Maragos and Thompson, 1999; Pal et al., 2004; Suzuki et al., 2007).
Figure 2.6: Structure of cyclic hexadepsipeptide beauvericin and enniatins (Jestoi et al., 2004)
27
Figure 2.7: Structure of zearalenone (ZEN) (Weiss et al., 2003)
2.4.3 Substrates suitability
Another key aspect emphasized in SSF is choosing the suitable substrate. The superior option is the one that can be a holder or physical supporter and also as nutrients supplier. Numerous substrates can be selected among natural (agricultural crops or waste) or synthetic sources (inert support). Three classes derive from natural-based substrates namely starchy substrate (e.g. rice, rice bran, cassava, banana meal, wheat bran), cellulose or lignocelluloses (e.g. corn, wheat straw, sugar-beet pulp) and soluble sugar sources (e.g. grape pomace, sweet sorghum). These natural substrates are economic and environmentally abundant around Malaysia. Some treatments should be applied to obtain a fine substrate and reachable for fungal hyphae to break through into its structure. Size reduction in solid substrate is recommendable by chopping or grinding and for further refining process, chemical treatment is suggested. The treatment comprises high degree of heat cooking or by applying acid and alkali
(Raimbault, 1998; Manpreet et al., 2005). 28
The use of synthetic substrate or inert support such as agar, gelatin, calcium alginate, polyacrylamide, scotch brite, polyurethane foam (Kumar et al., 2012) and nylon sponge (Toca-Herrera et al., 2007), is not really a favorite choice in SSF as it demands higher cost and result in poor accessibility. Usually, this type of substrate is recommended only in laboratory scale (Manpreet et al., 2005). Two considerations should be accentuated in substrate selection that is specific substrate and product formation. The specific substrate necessitates an appropriate value addition and waste management while the second condition links with the focused final product (Pandey,
2003) either enzymes, secondary metabolites, fermentable sugar or bio-fuel. Thus, the physical conditions of substrates such as particle size, shape, porosity and consistency can affect its utilization in SSF. As highlighted by Manpreet et al. (2005), particle size and shape are significant factors in influencing the use of the substrate.
Cotton oil cake, gram husk, corn hull, ground nut oil cake, rice husk, orange peel and pulp and sugarcane baggases are some potential medium for lovastatin production in SSF (Pansuriya and Singhal, 2010) but starchy substrates namely wheat bran and red rice or angkak are crowned as the best choice (Panda et al., 2010; Pansuriya and
Singhal, 2010). In recent years, Mohd Esa et al. (2011) observed that brown rice demonstrated a significant LDL decrement in rabbit blood while Aparna and Reddy
(2012) also recorded the same potentiality in rice bran containing lovastatin. The bran owns a phenolic base compound with vitamins, minerals and fibre bonus that subtract the cholesterol activity in blood (Wilson et al., 2002).
At the industry level, the criterion for substrates employment is based on: (1) substrates are able to give maximum yield and biomass for each gram of used substrate. 29
The concentration of yield and biomass must also at high level, (2) the used substrate will not result in the formation of unwanted material and if it cannot be avoided, the rate should be at a minimum level, (3) the material should be cheap to offset the economic pressures, maintain its good quality and easily available in appropriate quantities throughout the year, (4) the substrate must not possess any problems in the matter of aeration and agitation or in the aspects of down streaming processes such as extraction, product purification or in materials waste control (Ibrahim, 1994). Therefore, the screenings of various substrates are important in selecting a suitable one.
2.4.4 Roles of particle size in SSF
The particle size is a critical factor in determining the growth of fungi and directly affecting the activity of target compound. Another important responsibility that needs to be carried out by particle size is heat and mass transfer during SSF process
(Rodriguez-Leon et al., 2008). Penetration of hyphae or mycelium is highly depending on the physical condition of the substrate mostly its surface area and also porosity. The extension of microbial colonisation, air penetration, carbon dioxide removal and downstream extraction are depending on the substrate size. Besides, it guarantees nutrient accessibility and also oxygen availability. The recommended size in SSF is between 1 mm to 1 cm (Manpreet et al., 2005).
The smaller substrate size provides a wider surface area for microbial attachment but if too small, it causes the substrate agglomeration and deteriorates the fungal growth. The use of a larger particle size contributes to better ventilation which is
30
a consequence from the increment of interparticle space within the substrate. However, the space is limited for microbial attack (Cuoto and Sanroman, 2006). Void fraction variation is a phenomenon that relates with particle sizes. The genuine reason for this incident is mainly caused by the formation and elongation of fungal hyphae in SSF
(Rodriguez-Leon et al., 2008).
2.4.5 Moisture content or water activity (aw) rules
This term has an intimate relation with SSF as this process requests a minimum level of visible water. Water is prominent in SSF mostly to retain the fungi metabolism.
An inadequate level of water would welcome a bad diffusion of solutes and gas which is caused by substrate lacking or the existence of too concentrated inhibitive metabolites around the cell. This condition can slow down or stop the cell metabolism. For filamentous fungi, solid substrate media complete their habitual life media and by depending on substrate porosity, it can conquer even at the surface or the whole part of matrices (Gervais and Molin, 2003).
Condition with too high moisture will only provides a poor void fraction in the substrate and perturbs the oxygen penetration. At this period, bacteria will contaminate the media (Pandey, 2003) since this culture needs about 75% (w/w) moisture content to allow its growth (Gautam et al., 2002; Perez-Guerra et al., 2003). In contrast, a low water attendance helps in difficulty of nutrients accessibility which restricts the microbial colonisation (Pandey, 2003).
31
Water activity (aw) agenda arises to explain the relationship between a heterogeneous system and water vapour phase (Gervais and Molin, 2003) or for more precise concept it is a ratio of water vapour pressure in a system to the vapour pressure of pure water at the same temperature. The aw of pure water is equal to 1.00 and it boosts up with the addition of any soluble materials or liquid. Compared with bacteria, filamentous fungi and certain yeasts own lower value of aw (0.6-0.7) which means that they can stand at hectic environment. In turn, these types of microorganism are ready to be applied into the SSF system which is officially known with aw deficiency (Manpreet et al., 2005).
2.4.6 pH and its control
The pH measuring and controlling are very complex to be handled in SSF. At a low level, the pH condition can combat the parasitic microorganisms growth that are potentially ruining the media. But, SSF system has no complete equipments and electrodes (compared to SmF) to gain and control the desirable pH. It becomes worse because of the pH gradients presence due to the heterogeneous criterion of the process
(Rodriguez-Leon et al., 2008).
Microorganism selection and substrate formulation are the keys to overcome the pH problems in SSF. As suggested by Manpreet et al. (2005), it is vital to choose suitable microorganism that restrain the abilities to adapt in wide range of pH. Fungal growth can stand between pH ranges of 3.5 to 6.0. Secondly is by adjusting the substrate formulation. The complex chemical compositions in SSF requests a new
32
formulated media by considering the buffering capacity of different components.
Another solution is by using buffer formulation with components that have no lethal influence on biological activities (Rodriguez-Leon et al., 2008).
2.4.7 The influence of temperature
In SSF, temperature can greatly empower the heat phenomenon which may occur within the substrate bed. Pandey (2003) stated that the inner temperature is 20°C higher than the outside and this condition can retard the microbial growth, sporulation and product generation. The major problem is because of the poor thermal conduction which forces it to abundantly accumulate in the bed. Fungal growth is well tangled at temperature around 20°C to 55°C (Bhargav et al., 2008).
At the early stage of SSF, oxygen works along with temperature without intruding the heat properties in the substrate matrix. Furthermore, the combination of oxygen transfer and temperature in the middle of the process can spawn the extra heat during fermentation. An appliance equipped with evaporative cooling system is the best option to remove the heat capacity. Overall, the rate of heat transfer depends on intra- and inter-particle heat transfer and also heat rate which is released at the surface of the particles into the gas phase (Raimbault, 1998). Conventionally, the heat is controlled to limit its overproduction by mixing the substrate manually to permit some force aeration, applying a shallow substrate depth and adjusting the incubation temperature (Manpreet et al., 2005). All of these devices and principles must be employed during the up scaling system as the heat invites a bigger crisis at this stage.
33
2.4.8 The importance of aeration in SSF
Aeration meets major requirements in SSF that is; (1) to provide an aerobic conditions by supplying the oxygen, (2) to delete carbon dioxide, (3) to control the heat which is influenced by the outer temperature and also accumulated within the substrate bed, (4) to maintain the suitable water activity level that produced in the metabolic progress (Raimbault, 1998). The rate of aeration must be adequate but not too excessive in order to avoid the moisture loss (Anisha et al., 2010). The loss can be lessened by using air at > 90% relative humidity for aeration (Stuart and Mitchell, 2003).
2.4.9 Effect of carbon and nitrogen
Type, source and nature of carbon and nitrogen are classified under the most critical factors that need to be considered either in SmF or SSF (Rodriguez-Leon et al.,
2008). The presence of those elements in the system ensures the media balance and can directly influence the maximum production of secondary metabolites. Carbon source application also can regulate secondary metabolism called catabolic suppression
(Goswami et al., 2012). In managing media formulations, it is mandatory to take into account the composition of biomass. Cellular biomass represents 40-50% carbon, 30-
50% oxygen, 6-8% hydrogen and 3-12% nitrogen. A miniature quantity of phosphorus, sulfur and iron are requested to be component of cells and its metabolism. A significant consideration must be focused onto carbon as its utilization hold the key to product yield while nitrogen is assigned to determine microbial growth (Rodriguez-Leon et al.,
2008).
34
2.4.10 Scale up system: bioreactors
Regarding the lovastatin production, an extra attention was given on small scale level. Most of researchers acknowledge flask system as it holds less risks in contamination, aeration and agitation problems. However, there is a significant development in understanding the design, operation and scale up systems of bioreactors in fermentation. Furthermore, there will be more advantage with the involvement of mathematical modeling which can overcome the complexity of physico-chemical phenomena and biochemistry during the fermentation process (Pandey, 2003).
Bioreactor or fermenter is an apparatus that allows growth or an enzymatic reaction to produce the desired product (Ibrahim, 2002).
Raghava Rao et al. (2003) have outlined a few rules and conditions before employing bioreactors; (1) materials have to be inexpensive, immobile and resistant towards oxidization and abrasion, (2) the system must meet the ability to operate aseptically and can avoid biological pollution, (3) efficiency in controlling and regulating the operational parameters, (4) the homogeneity of biomass should be prepared and (5) simple maintenance by considering the labor cost, loading-unloading matters and also product recovery.
Bioreactors are tagged into their own classes by considering the sizes and the engagement of dry solid substrate quantity. Consequently, the lab scale can process few grams to few kilograms, a prepilot-scale generates higher fold from lab scale, pilot-scale several kilograms than prepilot-scale and industrial-scale boost to a few tons (Sermanni and Tiso, 2008). Mitchell et al. (2006) have slightly a different opinion. For them, SSF
35
bioreactors should be clustered based on the design of agitation and aeration systems and they simply assembled the fermenters in Group I, Group II, Group III and Group IV
(Figure 2.8). As illustrated in the figure, bioreactor in Group I consists a static bed condition which means the mixing process is done not so often (maybe once or twice a day) and the air aeration is within the bed without force blowing. Moisture and temperature control are crucial to provide a conditioned air. Tray bioreactor is the most favourite choice in this group. It is applied during koji production in Japan and well known as the simplest and oldest fermenter in SSF. The recommended substrate thickness in tray system is around 5 to 15 cm (Sermanni and Tiso, 2008).
Group II is almost the same concept with Group I; a static bed plus intermittent agitation (once daily). But, the air needs to be blown vigorously around the bed. A
‘packed-bed’ term is commonly referred to this kind of bioreactors. Column of cylindrical or rectangular cross section with oriented vertically is the usual shape for
Group II. In addition, pierced base plate (for air way) is made to sustain the matrix bed
(Mitchell et al., 2006). Packed-bed type is able to provide a sufficient exchange surface microbial growth and heat removal are observed (Robinson and Nigam, 2003). Group
III consists drum type bioreactors specifically stirred and rotating drums (horizontal cylindrical cross section shape). The agitation has to be constantly supplied into the bed
(minimum gap is from minutes to hours). Generally, in rotating drums bioreactors, a few rotations will be performed in the parallel axis to amalgamate the bed. While in the which allows it to have a great process control, mostly in heat elimination (Sermanni and Tiso, 2008). However, when it comes to the up scaling condition, limitation in
36
Aeration/ No mixing (or very Continuous mixing or frequent intermittent Mixing infrequent) mixing
No forced Group I Group III aeration (air passes around bed)
Tray chamber Rotating drum Stirred drum
Forced Group II Group IV aeration (air blown forcefully via the bed
Gas-solid Stirred Rocking Packed bed fluidized bed bed drum
Figure 2.8: Various types of bioreactors are engineered to fulfill SSF conditions. Aeration and mixing system are two major concerns mostly during scale up program (Mitchell et al., 2006)
37
stirred fermenter, a paddle or shaft is designed on the same basis of the previous purpose. The spread air is blown only via headspace and not in vigor aeration.
A mix and vigorous air blow within the bed is the main criterion of Group IV.
The speciality cof this group is it can be run in a continuous or discontinuous agitation pattern. It can be split into two classes; Group IVa which consists of bioreactors equipped with a nonstop agitation system while Group IVb comes with mixing influence ranged from minutes till hours. Gas-solid fluidized beds, rocking drum and stirred-aerated bioreactors are some products produced from this cluster. The gas-solid fluidized beds can be simplified with the appearance of holed bottom basis surface to permit air blowing (in upwards motion) into the bed and supply adequate velocity to fluidize it. Three parts is created in rocking drum viz. inner and outer perforated cylinders plus outer solid cylinder. Those spacious are constructed for substrates placement, air moving and also rotation spaces. The stirred-aerated reactor is fabricated with almost the same concept to static packed-bed; perforated bottom plate and force air insertion. However, it is distinguished based on the mixer presence at the top of the bioreactor to induce a continuous substrates mingle (Mitchell et al., 2006).
2.5 Concluding remarks
Malaysia is blessed with various agricultural crops which ultimately lead to the residues abundance at the landfill. Instead of the detrimental scenery, it will be a huge benefit to recycle the waste into a value-added byproduct such as secondary metabolite.
Rice bran is claimed to be one of the paddy leftovers which is commonly formulated for
38
animal feed. Rice bran and brown rice are globally known as cholesterol reducing mediator and both constituents fulfill the substrate selection requirement in SSF system which are insoluble, supporting the system physically, possess their own nutrients composition and locally cultivated crop in Malaysia hence promising a sustain availability through the year. Beside of the substrate’s suitability factor, several other physico-chemical conditions including the particle size, moisture content, pH, temperature, aeration, external carbon and nitrogen supplementary have to be considered in handling SSF. Furthermore, a significant development in scale up systems of bioreactors holds better possibility in manifolding the desired product formation. In this fermentation process, the interaction between the filamentous fungi and substrates
(rice bran and brown rice) are expectantly direct into secondary metabolite production known as lovastatin. This statin is derived via fermentation process through polyketide sythase system thus it holds a low adverse side effect towards animal and human.
Filamentous fungi are the best selection for SSF system according to their physiological, enzymological and biochemical properties which are preferable to grow in a low water activity condition. However, the existence of mycotoxins within the fungi needs to be genetically manipulated or even by interrupting the biosynthesis system.
39
CHAPTER 3
GENERAL MATERIALS AND METHODS
3.1 Substrates and fungi
3.1.1 Sources
Substrates comprised of unprocessed brown rice and rice bran which were supplied by local rice mill factory (Kilang Beras Leong Guan Sdn Bhd) located at Kampung
Bumbung Lima, Kepala Batas, Pulau Pinang, Malaysia. The unprocessed brown rice was defined as the first grain after the husk removal while the byproduct of fine polishing white rice was announced as rice bran. Filamentous fungi were isolated from the substrates themselves and also soil samples taken from Northern region of Malaysia i.e. Perak (Kampung Parit Aman, Bagan Serai, Perak) and Pulau Pinang (Kampung
Bumbung Lima, Kepala Batas and Kampung Bakar Kapor, Penaga, Pulau Pinang). The remaining fungi were available at culture stocks of Industrial Biotechnology Research
Laboratory, School of Biological Sciences, Universiti Sains Malaysia (IBRL, USM).
3.1.2 Purification and maintenance of fungi
Paddy field soils were selected to undergo a serial dilution of 10-1 until 10-9. In order to avoid spore agglomeration, only 10-5 up to 10-9 dilutions were spread onto potato dextrose agar (PDA) plate which supplemented with 0.05% (w/v) Triton X-100 (Sigma-
Aldrich, USA) (Pang, 2010). The plates were incubated for seven days and surrounded
40 with temperature of 30°C. The pure fungal colony was transferred onto PDA slant and stored at 4°C chiller. It was sub-cultured for fortnightly.
3.1.3 Inoculum preparation via direct counting using a haemocytometer
Ten milliliter of sterile 0.1% (w/v) Tween 80 was added into a well sporulated slant (Smits et al., 1996). By using inoculation loop, the spores were gently scraped and transferred into a sterile universal bottle. This spore suspension stock was shaken for about a minute, prior to serial dilution performance. Throughout this experiment, 1x107 spore/mL was applied into SSF system unless otherwise stated. The lowest dilution was placed on a direct microscopic counting chamber namely haemocytometer (0.1 mm depth, 1/400 mm2; Neubauer, Germany) and the needed concentration was determined according to the calculation (Equation 3.1).
Equation 3.1:
spore Inoculum concentration ( ) = Number of spores × Dilution factor × 104 mL
3.2 Analysis
3.2.1 Extraction of fermented solid substrates
One gram of fermented substrate which was previously dried at 80 °C for 24 hour was added with 30 mL of solvent (dichloromethane). Then, the samples were sonicated for 5
41 min, followed by shaking process using orbital shaker (Lab Companion SI300R) at 200 rpm for 2 hours under room temperature. In order to separate the solvent and substrate, the samples were filtered using Whatman filter paper No.1 and further centrifuged at
3000 g for 8 minutes using Hettich Zentrifugen Mikro 220R. A total of 1 mL of supernatant was collected and lactonised with 1 % (v/v) of trifluoroacetic acid (TFA,
Scharlau, Spain). Mixture was concentrated in an incubator of 80°C. Then, the samples were subjected into high performance liquid chromatography (HPLC, Waters, USA) by diluting the concentrated samples with 5 mL acetonitrile. Samples were filtered through nylon syringe filter (Minisart NY 25, Sartorius Stedim) size of 0.45 µm prior to HPLC injection (Pansuriya and Singhal, 2010; Panda et al., 2010).
3.2.2 Lovastatin estimation
Analysis of lactone lovastatin was done using HPLC system (Waters) equipped with
UV detector under wavelength of 238 nm (Manzoni et al., 1999; Pansuriya and Singhal,
2009; Pansuriya and Singhal, 2010; Raghunath et al., 2012) and Waters BREEZE software was used to analyze the compound. A reversed phase Waters Symmetry column was set up to connect the autosampler and also UV detector. The size of the column was 4.6 mm x 250 mm and outfitted with 5.0 μm particle diameter. It comprises of dimethyloctadecylsilyl bonded amorphous silica (C18) to filter the inlet solution. All elutions were employed at flow rate of 1.0 mL/min. Acetonitrile (HPLC grade, Merck,
Germany) and Fluka ortho phosphoric acid (mixed in distilled water and adjusted to pH
3.0 using concentrated ortho phosphoric acid) was labeled as mobile phase eluents. The
42 system was equilibrated using the provided mobile phase with 77:23 (v/v) ratios. For each run, 20 µL sample solution was taken using a special needle and flowed through into the column before being analyzed by UV detector. The result was displayed in chromatogram and the lovastatin’s peak was overlaid with lovastatin standard (99.7%
HPLC purity, Calbiochem, Merck, Germany) for compound quantification. Lovastatin standard preparation was done by dissolving 25 mg of lovastatin standard powder in acetonitrile (HPLC grade, Merck, Germany). The concentration was varied from 5 to 80
µg/ mL. Results were expressed as µg lovastatin per g dry solid.
3.2.3 Fungal growth determination
The complexity in evaluating the mycelia biomass or the extent to which the mycelia have penetrated into the solid substrate is one of the main problems in SSF study. The combination methods of Tsuji et al. (1969) and Swift (1973) have solved this problem by hydrolyzing poly-N-acetylglucosamine (a chemical compound present in the cell wall of the fungi) or also known as chitin, into glucosamine. Tsuji et al. (1969) have suggested a conversion process of chitin into glucosamine while Swift (1973) found the method to detect the glucosamine using Erhlich reagent.
A total of 0.1 g of fermented substrate was mixed with 5 mL of 2 M of HCl and then boiled for 2 hours. To 1 mL of the hydrolysed aliquot, 2 drops of alcoholic phenoftalein
(1%; w/v) was added. It was further neutralised with 1M NaOH and 1% (w/v) KH2PO4
(Sigma-Aldrich, USA) until the colour changing detected. The sample was then top up
43 to 5 mL using distilled water. A volume of 3 mL aliquot was pipetted out and mixed with 1 mL acetylacetone reagent. The reagent was prepared by adding 1 mL acetylacetone solution in 50 mL of 0.5M sodium carbonate (Sigma-Aldrich, USA).
Next, 6 mL of absolute ethanol (QRëC™, New Zealand) was mixed into the sample prior to Ehrlich reagent additional (1 mL). The reagent was prepared by adding 4 mL of absolute ethanol (QRëC™, New Zealand) and concentrated HCl (1:1 ratio) into 2.7 g of p-dimethyl-amino benzaldehyde (R&M Chemicals, Canada) and then the mixture was top up to 100 mL with concentrated HCl. After the additional of Ehrlich reagent, the sample was incubated at 65°C for 15 minutes and subsequently soaked a tap water for cooling. Finally, the absorbance of the sample was read spectrophotometrically at 530 nm. Glucosamine powder (Sigma-Aldrich, USA) was used as standard. The fungal growth was expressed as mg glucosamine per g substrate and the obtained optical density (O.D) reading was evaluated according to the calculation (Equation 3.2).
Equation 3.2:
mg a × 5 mL Fungal growth = g 0.1 g where, a is absorbance at 530 nm and inserted in a standard equation of y = 9.9445x + 0.0536.
Unit: mg/mL
5 mL: HCl (2 M) volume
44
0.1 g: weight of dry fermented sample
3.2.4 Statistical analysis
All experiments were employed in triplicates and analysis of variance (ANOVA) was executed on all data of physical to chemical parameters improvement. Data were presented as mean ± standard deviation (SD) and IBM SPSS Version 20 software was used to perform the Duncan test at confidence level of p < 0.05.
45
CHAPTER 4
ISOLATION, SCREENING AND IDENTIFICATION COMPARISON OF LOVASTATIN LATENT PRODUCERS VIA MORPHOLOGICAL AND MOLECULAR APPROACHES
4.1 Introduction
Approximately about 98,000 species of fungi have been identified and more than 100 new species are monthly discovered by mycologists. No one knows the exact number of fungi species that exist in the world but they may reach to 1.5 million (Judy, 2010). Isolation and screening of microorganism own a key to the major success of SSF and SmF products. However, microorganism consortia will give a hard situation to be overcome during isolation process.
Shotgun and objectives-relying approaches are two approaches for the microorganism isolation which can be fitted in the industrial level. In a shotgun method, samples of live microorganisms and bio-film are collected from the animal, plant materials, soil, sewage and waste, man-made materials and natural habitat.
These isolates are screened for the desired species and genus. While in objective approach, it is done by considering the specific sites of microorganism with particular criterions and those elements have to be almost alike as the original components of microflora (bacteria, fungi or microscopic algae) (Waites et al.,
2001).
Local soil samples and substrates (rice bran and brown rice) are significant in finding the utmost numbers of lovastatin producer. Soil is an important loose element of earth crust which can be a perfect reservoir for ubiquitous microorganism including filamentous fungi. Rice bran and brown rice are globally known as cholesterol reducing components and as a sequel for that statement, the
46 anticholesterol producers can be logically isolated from those substrates. Penang region consists 144,613 metric tonnes of paddy production in 2011 (Department of
Agriculture Peninsular Malaysia, 2012) which made these substrates can easily be accessed at the local rice mill factories.
Main and generic statin productions are competitively contending due to the patent validation issue (Barrios-Gonzáles and Miranda, 2010). Under Lipitor trade name, Atorvastatin leads the top rank selling of statins drug (Kidd, 2006). Semi- synthetic and synthetic statins are considered as expensive drug compared to natural statins. Those statins are rooted from natural statins which nominated some cost for derivative formation. Lovastatin and mevastatin are directed from fermentation process and hold all advantages aspect offered by SSF or SmF. Thus, isolation, screening and identification of lovastatin latent producers obtained from the local samples are investigated in this chapter.
4.2 Materials and Methods
4.2.1 Isolation of potential lovastatin producer
Filamentous fungi which originated from three different paddy field soils namely
Kepala Batas, Penaga and Bagan Serai were coded as KB, P and BS, respectively.
While for the rice bran (one isolate) and brown rice (null isolate) isolation outcomes were accordingly coded with RBS1 and BR. Table 4.1 lists all the location details of fungal origin and also codes for the isolated fungi.
47
Table 4.1 List of isolation locations and filamentous fungi codes lists
Source Code or fungal type Location Paddy field soil KB1, KB2, KB3, KB4, KB5, Kepala Batas, Penang KB6, KB7, KB8 (Coordinate: 5.517235 100.431487) Paddy field soil P1, P2, P3, P4, P5, P6, P7 Kampung Bakar Kapor, Penaga, Penang (Coordinate: 5.54204 100.387575) Paddy field soil BS1, BS2, BS3, BS4, BS5, Bagan Serai, Perak BS6 (Coordinate: 5.008062 100.53943) Rice bran RBS1 Kilang Beras Leong Guan Sdn. Bhd, Bumbung Lima, Kepala Batas, Penang Brown rice Kilang Beras Leong Guan Sdn. Bhd, Kampung Bumbung Lima, Kepala Batas, Penang IBRL stock cultures NEW, C2-1, B2-2, F4, C4-2, ED25, FI3, BI1, II2, EI3, ED12, IBRL B3-4, B1-2, C4- Industrial 1, PBK2-2, PBK1-3, B2-1, Biotechnology B3-2, B2-6, 7(1), PBK1-1, Research Laboratory, 7(14), K5-5, ED24, NR, ED1, School of Biological ED19, ED16, K3-4, D3-6, D3- Sciences, USM, 5, ED8, KC, 7(2), 7(13), J3-2, Penang C3, 7(7) Aspergillus flavus Trichoderma reesei Trichophyton rubrum Rhizopus oligosporus Trichophyton mentagrophytes Aspergillus fumigatus Penicillium roquefortii Trichoderma viridae Aspergillus nidulans Aspergillus terreus H36 Collectotrichum sp. Rhizopus sp. Penicillium sp. Aspergillus niger SAR I Gliocladium roseum Penicillium citrinum Phanerochaete chrysosporium Aspergillus niger AI1
48
4.2.2 Chemical compositions analysis
Proximate analysis method of AOAC (1997) was used to perform an estimation of chemical composition in selected agricultural residues (rice bran and brown rice).
Both of the residues were crushed into powder form in order to evaluate the content of carbohydrate, moisture, ash, protein, lipid and fiber. All samples were carried out in triplicates (n = 3) and were analyzed in IBM SPSS one way ANOVA (version
20).
4.2.2.1 Moisture content
Stainless steel moisture dishes were weighed and placed with samples. Five gram of each sample was left inside a 104°C oven until achieving a constant weight. Then, the dishes were shifted into a desiccator for an hour before the calculation of moisture pencentage (Equation 4.1).
Equation 4.1:
Weight after drying Moisture percentage % = × 100 Weight before drying
4.2.2.2 Determination of crude protein
About 0.1 to 0.5 gram of dried rice bran and brown rice were weighed and transferred into digestion tube. After that, 2 g of catalyst (mixture of 10 g of copper sulphate, 100 g of potassium sulphate and 1 g of selenium) and 25 mL of sulphuric
49 acid were mixed up into the same tube. It was left for digestion process which took about 1 hour 45 minutes. Then, 300 mL of distilled water and 20 mL of 40% (w/v) sodium hydroxide (NaOH) were added. Next process was the addition of 25 mL of
4% (w/v) boric acid and indicator droplets (3 to 4 drops) into digestion flask before proceed with distillation process. The indicator referred to a mixture of methyl red
(0.125 g) and methylene blue (0.0825 g) suspended in 100 mL of 95% ethanol. The distillation was considered success once 75 mL of liquid was obtained. Final step in crude protein determination was titration of distillation solution. The collection was done by using 0.1 M of hydrochloric acid (HCl) and the complete process can be observed after the solution color was changed into pinkish. The produced crude protein was estimated based on nitrogen content as follow (Equation 4.2).
Equation 4.2:
Volume of HCl × molarity of HCl Percentage of nitrogen (%) = × 100 The sample dry weight
Crude protein = Nitrogen percentage × 6.25 (protein conversion factor)
4.2.2.3 Ash content
Oven was pre-heated at 130°C and a crucible cup filled with sample was placed inside for 5 to 10 minutes. Then, it was left for cooling in a dessicator and the dry weight was recorded. After that, the drying procedure was continued by scooping out 1 g of the dried sample into crucible cup and heated in a muffle oven at 550°C
50 for 5 hours. Again, it was cooled in a dessicator and the constant weight was taken.
The loss of mass was calculated as ash content representative.
Equation 4.3:
weight of crucible + ash − (weight of crucible) Ash (%) = × 100 Dry sample weight (1 g)
4.2.2.4 Determination of crude lipid
Sixty mL solvent mixtures (chloroform and methanol, ratio of 2:1; v/v) were added into approximately 1 to 2 g of dried sample for homogenization process. After that, the homogenized sample was flown through filter paper Whatman No. 1. The same solvent mixture was used to rinse off the remaining lipid attached to the homogenizer. Filtrate was moved into separating funnel and 30 mL of solvent mixtures were added. It was carried on with the addition of 20 mL distilled water. A one minute time was set to mix the aliquot and in order to get a separation phase of aqueous and lipid, it was kept for overnight. The bottom layer which consisted lipid was collected in a beaker and dried at 35°C for 5 hours and the constant weight was documented.
Equation 4.4:
Weight of beaker +dry lipid − weight of empty beaker Crude lipid content (%) = × 100 Dry sample weight
51
4.2.2.5 Crude fiber content
A 500 mL round bottom flask was used to place 1 g of fat free dried powder of rice bran and brown rice. After 50 mL of 5% (v/v) H2SO4 and 150 mL distilled water were added into the flask, it was refluxed for 30 minutes and cooled. An ashless
Whatman No. 541 filter paper was applied to filter the acid liquid. The excess acid was titrated by adding 5 mL of 40% (w/v) NaOH. Next, 40 mL of 25% (w/v) NaOH was mixed and afterward proceed with reflux process again for another 30 minutes.
Solution was left for cooling and filtered with ashless filter paper (the weight is known). The residues were rinsed with 1% (v/v) HCl and subsequently by boiling water. It was shifted into a crucible cup and overnight left for drying process at
100°C. The final step was residues burning inside a muffle at 550°C for 5 hours.
Then, it was transferred into dessicator and after cooling course, the obtained crude fiber was estimated as below calculation.
Equation 4.5:
a − b Crude fiber (%) = × 100 c
Indicators: a: Weight of crucible cup with ash and ashless filter paper b: Weight of crucible cup with ashless filter paper c: Weight of fat free dried sample
52
4.2.2.6 Determination of carbohydrate
Method of Onyeike et al. (1995) was applied in carbohydrate composition in rice bran and brown rice. A total of 100 was subtracted from a total addition values of ash, moisture content, lipid, fiber and protein. The final value was a carbohydrate percentage represented in each samples.
Equation 4.6:
Carbohydrate content % = 100 − % ash + %moisture + % crude fiber +
% protein + % lipid
4.2.3 Primary screening of lovastatin producers
Microorganism which isolated from soils and taken from IBRL stock culture were employed into preliminary batch. Any further process in SSF depends on this initial qualitative step.
4.2.3.1 Solid substrate fermentation compositions
A basal SSF condition consisting of 5 g of substrate mixtures (rice bran and brown rice, 1:1 ratio) was applied into 250 mL Erlenmeyer flask. Cotton plug was used to seal the flasks and autoclaved at 121°C for 15 minutes (pressure of 3 to 29 psi).
Moisture content of 70% (v/w) was set using sterile distilled water (initial pH 6.5).
Afterward, solid substrate medium was inoculated with 20% (v/w) spore suspension
(size of 1x107 spore/mL) (Pansuriya and Singhal, 2010; Szakacs et al., 1998). The
53 solid mixture was meticulously mixed for a balance distribution of spores. Those flasks were prepared in triplicates and incubated at 30 ± 2°C for 16 days.
4.2.3.2 Thin layer chromatography (TLC)
Method of Samiee et al. (2003) using TLC plate was used to accomplish the primary screening. A starting and finishing point was marked on TLC plate (silica gel 60, 20 x 20, Merck Germany) with a pencil. Plate development was observed based on those marks. A 10 µL pipette tip was used to dot approximately 100 µL of extracted crude sample onto TLC plate. The every dot was instantly dried out using a hair dryer. The complete spotted TLC plate was vertically soaked in a flat bottom chamber (20 x 20 cm) which consisted dichloromethane and ethyl acetate (70:30; v/v) as a running system. The plate was removed from the chamber once the mobile solution reached the finish point. After the solution was dried, it was stained with iodine vapor and observed under a short wavelength hand-held ultra violet (UV) lamp (254 nm). Each samples (including lovastatin standard) was prepared in three dots and the retention factor (Rf) was compared to the authentic standard.
Equation 4.7:
Distance migrated by the compound (cm) Rf = Distance migrated by the solvent front (cm)
54
4.2.4 Secondary screening via high performance liquid chromatography
(HPLC)
Lovastatin compound was detected quantitatively via Waters HPLC (USA) system under UV range of 238 nm. A special reversed phase column known as Symmetry
C18 (4.6 mm x 250 mm, pore size of 5 μm) which is packed with acetonitrile and dimethyloctadecylsilyl bonded amorphous silica as its main composition, was employed in the experiment. Waters Breeze System with 1 mL/min elution flow rate was applied to identify lovastatin compound in the sample. Acetonitrile (HPLC grade, Merck, Germany) and ortho phosphoric acid (concentrated ortho phosphoric acid diluted in distilled water and modified to pH 3) were recognized as a mobile phase eluent for HPLC system. An isocratic pattern was chosen to flow out 77:23
(v/v) mobile phase. The ratio represented acetonitrile and ortho phosphoric acid, respectively. For each injection, 20 µL of sample aliquot was taken by a special needle and flowed through C18 column and UV detector. The peaks were resulted as a chromatogram. Lovastatin was quantified by evaluating the displayed peak area.
The experiment was done in triplicates and IBM SPSS One Way ANOVA (version
20) was chosen as a reliable program to analyze the secondary screening of lovastatin.
Lovastatin standard preparation was done by dissolving 25 mg of lovastatin standard powder (99.7% HPLC purity, Calbiochem, Merck, Germany) in acetonitrile (HPLC grade, Merck, Germany) and concentration was varied from 5 to 80 µg/mL. Results were expressed as µg lovastatin per g dry solid.
55
4.2.5 Identification of potential lovastatin producer
During fungal identification, colony and structural observation including molecular recognition were taken into account. The physical criterion of single colony was further viewed under microscopes (from low to high resolution level) for its structural development. The identification progress was completed with molecular confirmation by comparing the obtained sequence configuration with Fusarium-ID and GenBank (NCBI) database (Geiser et al., 2004).
4.2.5.1 Colony and structural morphologies
The best lovastatin producer, IBRL B3-4 isolate, was selected to undergo an identification process which was performed on three different agar specifically potato dextrose agar (PDA), carnation leaf agar (CLA) and Spezieller
Nährstoffarmer agar (SNA) (Nirenberg and O’Donnell, 1998). Colony characteristics of IBRL B3-4 isolate were done on PDA while CLA and SNA were selected for conidial morphologies observation under light microscope (in situ observation) and scanning electron microscope (SEM).
4.2.5.1 (a) Macroscopic observation of IBRL B3-4
Colony appearance, its odor, mycelial textures and pigmentation were the utmost investigated criterion on PDA plate which encompassed the reverse and observe view of the plate. The IBRL B3-4 isolate was inoculated at the center of the plate using inoculation needle and any changes were documented throughout a week of monitoring progress (Nor Azliza, 2008).
56
4.2.5.1 (b) Microscopic observation of IBRL B3-4: Light microscope and
Scanning Electron Microscope (SEM)
Microconidia, macroconidia, false head, short chain structure, coiled-hyphae and others possible structure, are a few criterions that need to be recognized throughout the microscopic observation of IBRL B3-4. CLA plate was prepared from dried carnation leaves which were arranged on the 2% (w/v) water agar (WA) surface. A length of 5 to 8 mm of fresh carnation leaves were cut and dried out until brittle at
80°C for overnight. The leaves were autoclaved for 15 minutes at 121°C and around
3 to 4 selected leaves were gently laid on 2% (w/v) WA. IBRL B3-4 was meticulously streaked onto the WA, prior to leaves overlaying. For SNA observation, basically, IBRL B3-4 was streaked onto the agar and then, a small piece of Whatman filter paper No.1 was spreaded over it. The SNA was crucial to confirm the appearance of coiled hyphae in the selected fungus. A two weeks incubation period was set for CLA and SNA agar. All agars were incubated at 25°C under light and dark chamber and comparisons were done for both conditions. Light microscope completed with Olympus BX41-CCD camera was used to inspect the structural of
IBRL B3-4.
For SEM viewing, a few complex steps need to be done before observation. A well sporulated CLA was cut into 0.05 x 0.05 mm block and placed on the planchette.
Later, it was laid in a Petri dish which was overlaid with filter paper prior to 2% osmium tetroxide (OsO4) droplets. The Petri dish was covered instantly and left in fume hood for vapour fixation process. After 1 to 2 hours vapour fixation procedure, the sample was dipped into liquid nitrogen (-196°C) and transferred into a freeze
57 dryer (Emitech, USA) for 10 hour drying progress. Then, the sample was kept in a dessicator. A total of 5 to 10 nm of gold was coated onto the sample and viewed under SEM (FESEM-Zeiss LEO Supra 50VP, Germany). The specimen preparation protocol was provided by Electron Microscope Unit, School of Biological
Sciences,USM.
4.2.5.2 The genus and species confirmation by molecular approach
4.2.5.2(a) Freeze drying method for fungal preparation
The fungus was inoculated into Sabouraud Dextrose Broth (SDB, Merck, Germany) and incubated at 30°C for 2 to 3 days. The formed mycelium layer was collected aseptically into a new universal bottle. It was placed in a -20°C freezer for 24 hours and then put into freeze dryer (Labconco Freezone 6, USA) for a drying purpose.
The freeze dryer was set up at -50 0C and ˂ 0.133 mBar vacuum pressures and the sample was left in this condition for at least 24 hours, prior to extraction process.
4.2.5.2(b) Extraction of dried IBRL 3-4 isolate sample
The fungal DNA extraction was done by applying DNeasy Plant Mini Ki (Qiagen,
USA). The liquid nitrogen was previously added onto dried fungal sample and crushed into a powder form using a mortar and pestle. Firstly, a total of 0.22-0.25 g of dried sample was put in an eppendorf tube and 400 µL lysis buffer (AP1) was added followed by 4 µL RNase stock solution (100 mg/mL). Then, the sample was vortexed and proceeded with incubation process for ten minutes in a water bath
(65°). Within that time, the tube was mixed and inverted for 2 or 3 times. Next, 130
µL of AP2 or precipitation buffer was added into the mixture and was centrifuged
58 for 5 minutes at 14 000 rpm. The tube was incubated on ice subsequently. After the five minutes incubation, the lysate was applied in a purple QIAshredder Mini spin column and again it was centrifuged at 14 000 rpm for 2 minutes. Next, the flow- through solution was transferred into a new eppendorf tube, prior to AP3 (binding buffer) addition. A volume of 750 µL AP3 was added and thoroughly mixed by pipetting. Then, 650 µL of the mixture was applied into white DNeasy Mini spin column which was held by 2 mL collection tube. The sample was centrifuged at
8000 rpm for a minute and the flow-through solution was discarded. Then, 500 µL of wash buffer (AW) was added into spin column before centrifugal procedure under
8000 rpm for 1 minute. Again, a flow-through was discarded. After that, 100 µL of
AE or elution buffer was added which was pre-heated at 65°C. This new mixture was incubated for 5 minutes at room temperature (25°C) and then was centrifuged for a minute at 8000 rpm. The extracted DNA (or the flow-through) was placed at -
20°C prior to use (Henry et al., 2000; Hinrikson et al., 2005).
4.2.5.2(c) Polymerase chain reaction (PCR) amplification and DNA sequencing of Translation Elongation Factor-1α gene (TEF-1α)
A primer pair known as EF1 (forward: 5′-ATGGGTAAGGAGGACAAGAC-3′) and
EF2 (reverse: 5′GGAAGTACCAGTGATCATGTT-3′) were employed to amplify
Translation Elongation Factor-1α gene (O’Donnell et al., 1998). A total of 50 µL reaction mixture was set to carry out PCR amplification which consisted of 16 µL of
1X Buffer, 8 µL of 4mM MgCl2, 3.75 µL of both primer (0.8mM), 1 µL of 200 µM dNTP mix (Promega, USA), 0.45 µL of 1U/µL Taq DNA Polymerase (Promega,
USA), 2 µL of 12 ng DNA template and 15.05 µL of deionized water and executed with DNA EngineTM Peltier Thermal Cycler Model PTC-200 (MJ Research, USA).
59
The PCR cycles are shown in Table 4.2. The PCR product was subjected onto 1% agarose gel and was run for 90 minutes under electric voltage of 80 V and 400 mA for electrophoresis segment.
Table 4.2 The PCR thermal cycles applied for TEF-1α amplification Step Temperature (°C) Time (min) Cycle
Initial denaturation 94 1 1 Denaturation 95 0.35 Annealing 59 0.35 35 Extension 72 1.30 Final extension 72 10 1
4.2.5.2(d) PCR products purification
The product was cleaned up with QIAquick PCR Purification Kit (QIAGEN,
Germany) according to the manufacturer’s instruction. A volume of 225 µL of PB buffer (Binding buffer) was added to the PCR product (45 µL) in an eppendorf tube and then the mixture was mixed by pipetting. The solution was transferred into
QIAquick Spin Column to bind the DNA prior to centrifuge process at 13 000 rpm for 1 minute. After that, the flow-through was discarded and 750 µL of PE buffer
(wash buffer) was add-in to the spin column to wash the DNA. The sample was centrifuged at 13 000 rpm for a minute and then, again, the flow-through was removed. This step was repeated twice. Next, the QIAquick Spin Column was put into a new eppendorf tube and 50 µL of EB buffer (elution buffer) was added to elute the DNA and finally centrifuged at 13 000 for 1 minute. The purified gel was undergone electrophoresis procedure using 1% agarose gel with 1 µL loading dye and 5 µL DNA. A voltage of 80 V and 400 mA were set to run the electrophoresis gel which was taken about 90 minutes running progress. The amplified sample was compared to 1 kb DNA ladder (GeneRulersTM, Fermentas, USA) and then the
60 purified PCR product was submitted for sequencing analysis to an accredited supplier.
4.2.5.2(e) TEF-1α gene sequence analysis
The alignment of the obtained DNA sequences was done using Molecular Evolution and Genetic Analysis (MEGA 5.0) (Tamura et al., 2011). The software was equipped with ClustalW to gain consensus sequences which was manually edited.
For the identification of the isolate, the sequences were aligned and compared using a BLAST programme in National Center Biotechnology Information
(http://blast.ncbi.nlm.nih.gov/Blast.cgi) (Altschul et al., 1990) and also
FUSARIUM-ID database (http://isolate.fusariumdb.org/index.php). The fungal species identity in this study was indicated by the highest score of percentage similarity with those available species in the databases.
4.3 Results and Discussion
4.3.1 Evaluation of nutrients compositions in rice bran and brown rice
The determination of proximate analysis was performed in accordance of AOAC
(1997). Proximate analysis is the best method to quantitate the compositions of moisture, protein, lipid, fiber, ash and carbohydrate. The highest component in rice bran was carbohydrate while in brown rice was fiber. Summary for nutrients composition in both substrates was done in Table 4.3.
61
Table 4.3: The chemical components in local rice bran and brown rice (%)
Components Rice bran (%) Brown rice Rice bran (%) Brown rice (%) composition composition by Wanyo et by Thomas al., 2009 et al., 2013 Moisture 10.54 ± 0.30 9.34 ± 0.41 12.34 ± 0.24 12.88 ± 0.0 Protein 13.39 ± 0.22 12.13 ± 0.28 13.17 ± 0.12 6.48 ± 0.0 Lipid 17.73 ± 0.11 5.12 ± 0.01 20.36 ± 0.01 1.74 ± 0.1 Fiber 7.11 ± 1.87 48.53 ± 0.58 11.39 ± 0.00 8.37 ± 0.1 Ash 10.03 ± 0.33 2.56 ± 0.29 11.12 ± 0.01 0.55 ± 0.0 Carbohydrate 41.20 ± 2.10 22.33 ± 0.47 32.37 ± 0.26 78.21 ± 0.1 *Values are expressed as means ± standard deviation.
Wei et al. (2007) has screened a few solid substrates for lovastatin production. The investigated substrates were soybean cake particle, rice, corn particle, wheat bran and also rice husk. Among these substrates, rice has acknowledged as the best producer with 2.2 ± 0.085 mg/g. However, in order to understand the worth of plant species mostly the ones with medicinal benefits, proximate procedure must be carried out as a standardization process (Rajani and Kanaki, 2008). World Health
Organization (2007) has also outlined a few rules (including proximate analysis) for medicinal plant establishment.
While in SSF consideration, a proper substrate selection is the ‘heart’ for this system and it is crucial to choose the specific substrate which relates with the production of the desired product (Pandey, 2003). Rice bran and brown rice not only presenting the physical support material but also work as carbon and energy provider. An ideal substrate must be able to supply the required nutrients to microorganism for its culture growth and cells development (Pandey et al., 2008). Furthermore, it has been declared by Charles et al. (2000) that one of the prominent roles in SSF is the chemical nature of substrate including its polymerization degree and organic matter
62 content. To bear that task, an idyllic substrate is recommended to consist some macromolecule features including fibers, sugars, lipids, organic acid, lignocelluloses, starch and etc. (Raimbault, 1998). Protein is a crucial source for cells in most living things including human, animal or plant. In another side, protein can also become an energy provider besides main energy supplier such as carbohydrate and lipids. It can approximately offer 4 kcal/g of energy (Timby,
2009). The removal of organic substances and water has produced inorganic leftover known as ash. The amount of ash is a reflection of minerals composition which can be calcium, potassium, selenium, nickel, iron and others (Ajai et al., 2012). Moisture content of substrate is associated within the SSF system itself. Its existence in the system has allowed an ease for oxygen accessibility to the microbial population
(Prabhakar et al., 2005).
4.3.2 Primary and secondary screenings of lovastatin producers using TLC plate and HPLC analysis
Under running solvents of dichloromethane and ethyl acetate (70:30; v/v), a range of
0.26 to 0.32 of retention factor (Rf) was managed to be recorded (Table 4.4). Out of
78 fungi, only 23 of fungal isolates were not indicated any parallel dark spot to the lovastatin standard on TLC plate. It represented 29% of the total isolates. The results obtained from TLC were subjected onto HPLC for more precise activity of lovastatin and overall, it displayed only 28 fungi (36%) can produce lovastatin. A few of the isolates including Aspergillus flavus, Rhizopus oligosporus, Rhizopus sp.,
Aspergillus niger SAR I, Aspergillus niger AI1, C2-1, C3, RBS1, EI3, ED12, ED19,
D3-6, D3-5, ED8, B1-2, PBK2-2, 7(1), B2-1, B3-2, B2-6, P4, KB3, KB4, KB5, BS2
63
Table 4.4: Double screening programmes in tracing lovastatin latent producers
Fungi type/ Code Rf value on TLC plate Lovastatin activity (µg Fungal growth (mg (Primary screening) lovastatin/g dry solid) glucosamine/ g substrate) (Secondary screening)
Aspergillus flavus 0.28 ± 0.00 Not detected 1.03 ± 0.06 Trichoderma reesei 0.28 ± 0.00 36.67 ± 2.22 1.52 ± 0.10 Trichophyton rubrum 0.29 ± 0.00 66.67 ± 11.11 1.82 ± 0.04 Rhizopus oligosporus 0.26 ± 0.00 Not detected 0.77 ± 0.03 Trichophyton mentagrophytes 0.28 ± 0.00 120.00 ± 4.17 0.70 ± 0.04 Aspergillus fumigatus Not detected Not detected 1.03 ± 0.06 Penicillium roquefortii 0.29 ± 0.00 47.50 ± 5.83 1.99 ± 0.09 Trichoderma viridae 0.26 ± 0.00 72.92 ± 3.06 1.07 ± 0.02 Aspergillus nidulans Not detected Not detected 1.28 ± 0.00 Aspergillus terreus H36 0.29 ± 0.00 212.08 ± 48.61 0.81 ± 0.03 Collectotrichum sp. 0.27 ± 0.00 205.42 ± 3.61 0.43 ± 0.03 Rhizopus sp. 0.28 ± 0.00 Not detected 1.86 ± 0.08 Penicillium sp. 0.26 ± 0.00 59.17 ± 6.11 0.50 ± 0.03 Aspergillus niger SAR I 0.29 ± 0.00 Not detected 0.98 ± 0.11 Gliocladium roseum Not detected Not detected 1.57 ± 0.11 Penicillium citrinum 0.27 ± 0.01 205.00 ± 23.33 0.95 ± 0.04 Phanerochaete chrysosporium Not detected Not detected 1.07 ± 0.02 Aspergillus niger AI1 0.27 ± 0.00 Not detected 1.58 ± 0.03 NEW 0.32 ± 0.01 48.33 ± 8.89 1.63 ± 0.11 C2-1 0.29 ± 0.00 Not detected 0.84 ± 0.03 B2-2 Not detected Not detected 0.56 ± 0.04 F4 Not detected Not detected 0.74 ± 0.04
64
Table 4.4: Continuation… C4-2 0.27 ± 0.00 36.67 ± 7.88 0.55 ± 0.03 ED25 Not detected Not detected 1.71 ± 0.04 FI3 Not detected Not detected 1.16 ± 0.02 BI1 0.26 ± 0.00 170.42 ± 17.22 1.30 ± 0.02 II2 0.26 ± 0.00 145.00 ± 13.33 1.88 ± 0.03 EI3 0.31 ± 0.00 Not detected 0.80 ± 0.02 ED12 0.30 ± 0.00 Not detected 0.84 ± 0.03 IBRL B3-4 0.28 ± 0.00 281.67 ± 44.44 0.94 ± 0.11 B1-2 0.29 ± 0.00 Not detected 0.88 ± 0.02 C4-1 0.26 ± 0.00 56.67 ± 2.22 0.62 ± 0.03 PBK2-2 0.28 ± 0.00 Not detected 0.87 ± 0.00 PBK1-3 Not detected Not detected 0.82 ± 0.01 B2-1 0.29 ± 0.00 Not detected 1.07 ± 0.02 B3-2 0.29 ± 0.00 Not detected 0.85 ± 0.04 B2-6 0.31 ± 0.01 Not detected 0.95 ± 0.01 7(1) 0.28 ± 0.01 Not detected 0.82 ± 0.01 PBK1-1 0.28 ± 0.01 95.00 ± 3.33 0.56 ± 0.03 7(14) 0.26 ± 0.00 33.33 ± 2.24 1.28 ± 0.00 K5-5 Not detected Not detected 0.40 ± 0.02 ED24 0.26 ± 0.00 18.33 ± 2.22 0.83 ± 0.02 NR Not detected Not detected 1.64 ± 0.06 ED1 Not detected Not detected 1.07 ± 0.02 ED19 0.30 ± 0.00 Not detected 1.23 ± 0.13 ED16 Not detected Not detected 1.11 ± 0.01 K3-4 0.26 ± 0.00 13.33 ± 2.22 0.41 ± 0.02 D3-6 0.30 ± 0.00 Not detected 0.71 ± 0.02 D3-5 0.29 ± 0.00 Not detected 1.27 ± 0.03 ED8 0.30 ± 0.00 Not detected 0.82 ± 0.01
65
Table 4.4: Continuation… KC 0.26 ± 0.00 141.67 ± 5.56 0.79 ± 0.01 7(13) Not detected Not detected 0.65 ± 0.02 J3-2 Not detected Not detected 0.43 ± 0.03 C3 0.28 ± 0.00 Not detected 1.37 ± 0.13 7(7) Not detected Not detected 1.23 ± 0.13 RBS1 0.29 ± 0.00 Not detected 1.54 ± 0.05 7(2) Not detected Not detected 1.44 ± 0.08 P1 0.26 ± 0.00 93.33 ± 31.11 1.90 ± 0.01 P2 0.26 ± 0.00 38.33 ± 2.22 1.62 ± 0.04 P3 0.30 ± 0.00 18.33 ± 4.44 1.60 ± 0.04 P4 0.29 ± 0.00 Not detected 1.35 ± 0.07 P5 Not detected Not detected 0.95 ± 0.01 P6 Not detected Not detected 0.95 ± 0.04 P7 0.26 ± 0.00 16.67 ± 2.42 0.71 ± 0.02 KB1 0.26 ± 0.00 48.33 ± 2.22 1.69 ± 0.01 KB2 Not detected Not detected 1.39 ± 0.03 KB3 0.29 ± 0.02 Not detected 0.71 ± 0.02 KB4 0.27 ± 0.00 Not detected 0.56 ± 0.04 KB5 0.27 ± 0.00 Not detected 1.28 ± 0.00 KB6 0.26 ± 0.00 28.33 ± 7.78 1.55 ± 0.04 KB7 Not detected Not detected 1.11 ± 0.01 KB8 Not detected Not detected 1.23 ± 0.13 BS1 Not detected Not detected 1.63 ± 0.12 BS2 0.27 ± 0.00 Not detected 1.53 ± 0.05 BS3 0.26 ± 0.00 26.67 ± 2.22 1.67 ± 0.04 BS4 0.30 ± 0.01 21.67 ± 4.44 1.70 ± 0.04 BS5 0.28 ± 0.00 Not detected 0.45 ± 0.03 BS6 Not detected Not detected 1.69 ± 0.06
66 and BS5 can be detected on TLC but cannot be traced via HPLC. IBRL B3-4 isolate revealed the highest lovastatin activity with 281.67 ± 44.44 µg lovastatin/ g dry solid. The statistical analysis of fungal selection was conducted by evaluating the lovastatin activity via SPSS One Way ANOVA (Duncan test) and IBRL B3-4 showed a significant difference level at p < 0.05. This isolate was selected for identification purpose.
A study by Samiee et al. (2003) stated that during the lovastatin producers screening, 49 microorganism depicted positive dark spot on TLC plate, however, only 31 strains were verified by HPLC. TLC is a silica-bonded plate which plays a prominent role in qualitative screening as it can separate the compound into its component color (Gibbons and Gray, 1998). But still, it is not an ultimate reliable method for precise compound detection as it may overlap with other compounds. The TLC view of lovastatin under
UV range (254 nm) can only signify the dark spots appearance. Thus, it is worthwhile to apply higher chromatography such as HPLC for a more accurate quantitative confirmation. The displayed peak by lovastatin crude extract can be validated with lovastatin standard (contain high definition of HPLC purity, 99.7%) which can be possibly done through HPLC. Ever since lovastatin first findings, it was discovered from Monascus sp. and Aspergillus terreus and to date, researchers doing a lot of experiments regarding these two strains compared to other fungi (Szakacs et al., 1998;
Panda et al., 2010; Pansuriya and Singhal, 2010). Instead of those favorite fungi,
Samiee et al. (2003) managed to identify a few other lovastatin producers i.e. A. parasiticus, A. fisheri , A. flavus , A. umbrosus , P. funiculosom , T. viridae, T.
67 longibrachiatum and Acremonium chrysogenum. In addition, the screening results obtained by Shindia (1997) depicted that P. citrinum, Paecilomyces varioti and P. chrysogenum can also produced lovastatin. Meanwhile, Alarcón et al. (2003) have also clarified that Pleurotus ostreatus as another potential producer. The results obtained by those researchers were recorded in Table 4.5.
Table 4.5: Other potential lovastatin producers obtained by different researchers
Researchers Type of filamentous fungi Lovastatin quantity (mg/L) Shindia (1997) P. citrinum 61 Paecilomyces varioti 56 P. chrysogenum 35 Alarcón et al. (2003) Pleurotus ostreatus PL-136 70 Samiee et al. (2003) A. parasiticus 4.5 A. fisheri 2.0 A. flavus 9.0 A. umbrosus 14.1 P. funiculosom 19.3 T. viridae 9.0 T. longibrachiatum 1.0 Acremonium chrysogenum 2.5
4.3.3 Identification of IBRL B3-4
4.3.3.1 Macroscopic observation
IBRL B3-4 grew rapidly on PDA within 7 days incubation period under light and dark surrounding with approximate temperature of 25°C (Plate 4.1 and Plate 4.2). During the light exposure, this fungal has extended its mycelium diameter up to 60 mm (growth rate = 8.57 mm/day). As observed, there was also a moderate mixture of white feathery mycelium and violet pigment after 7 days incubation period (Plate 4.1 A1). Under dark
68
A1 A2
B1 B2
C1 C2
Plate 4.1: The observe and reverse view of IBRL B3-4 on different agars under light exposure. A1-A2 represent growth on PDA, B1-B2 indicate growth on SNA and C1-C2 are growth on CLA
69
A1 A2
B1 B2
C1 C2
Plate 4.2: The growth of IBRL B3-4 isolate under dark condition. A1-A2 were growth on PDA, B1-B2 display growth on SNA and C1-C2 were growth on CLA
70 condition, IBRL B3-4 has recorded 54 mm of colony diameter (growth rate = 7.71 mm/day) and a higher degree of white feathery mycelium. The violet pigment was also present (Plate 4.2 A1). The reverse plate for both of conditions showed a smooth agar structure with darker violet color. There was also a clear white margin formation either under light exposure or dark condition (Plate 4.1 A2 and Plate 4.2 A2). For SNA and
CLA agars, the colony changes were not very significant with or without light exposure within 14 days incubation time (Plate 4.1 B1-C2 and Plate 4.2 B1-C2). On SNA, a mixture of feathery mycelium and violet pigment were observed occupying the filter paper and the reverse view indicated a violet pigment color. However, the growth was more rapid and the color was darker under no light application. There was also a white borderline along the filter paper (Figure 4.2 B2) and no clear borderline detected in
Plate 4.1 B2. While on CLA, the mycelium preferred to expend its apical hyphae around the dried carnation leaves in order to gain the nutrient source. The white mycelium was observed on the leaves and changed the subjected area of agar into brownish (Plate 4.1
C1 and Plate 4.2 C1). The same condition was denoted at the reverse view. The agar structure maintained to be smooth and brownish color (Plate 4.1 C2 and Plate 4.2 C2).
No traceable odor obtained from all agars.
Basically, the colony morphology of IBRL B3-4 was similar to Fusarium sp. According to Nirenberg and O’Donnell (1998), PDA was the only nutrient agar used to characterize the colony morphology of new Fusarium species. While the low nutrient agars including CLA and SNA were employed to observe the structural morphologies of the species. The Fusarium sp. was observed under light and dark exposure however
71 the dark exposure was occasionally only for sporodochial (macroconidia) formation.
Table 4.6 denotes the colony morphology of a few Fusarium sp recorded by Nirenberg and O’Donnell (1998) which displayed almost the same characteristics with IBRL B3-4 isolate.
4.3.3.2 Microscopic observation: Characters on CLA and SNA
The in-situ observation under light microscope displayed the presentation of microconidia, macroconidia, coiled sterile hyphae, false head and short chains (Plate
4.3). The microconidia were produced from monophialides in the aerial mycelium in false head and short chain. As depicted in Plate 4.3 A, the microconidia sizes were around 4.5-7.0 x 1.7-2.6 µm. It was performed in oval shape without septate appearance and abundantly found near the aerial mycelium. The macroconidia were rare and difficult to find on CLA. A range of 32.0-46.4 x 1.2-2.9 µm macroconidia patterned with 3 to 5 septate was observed at Plate 4.3 B. Other special characteristics of IBRL
B3-4 macroconidia were its slender and slightly falcate with thin wall structure. The existence of short chain (bearing less than 10 conidia) which was hold by prostrate were another hallmark structures for IBRL B3-4 (Plate 4.3 C and Plate 4.3 D). In addition, the production of coiled hyphae at a certain part of CLA agar gave another similarity of
IBRL B3-4 with Fusarium sp. (Plate 4.3 E). However, the reliability of coiled hyphae production was greater in SNA compared to CLA (Plate 4.3 F). For SEM viewing, a few of IBRL B3-4 structures managed to be observed (Plate 4.4). Microconidia (Plate
4.4 A), macroconidia (Plate 4.4 B), false head (Plate 4.4 C) and coiled hyphae (Plate 4.4
72
D) were clearly seen compared to the observation by light microscope. Table 4.7 shows the comparison of a few related Fusarium sp. with IBRL B3-4 isolate. The comparison was based on the structural morphologies of each species.
73
Table 4.6: Colony morphology of Fusarium species on PDA
Colony morphology/ IBRL B3-4 F. circinatum F. pseudocircinatum F. denticulatum F. guttiforme Fusarium sp Growth rate of 8.57 4.70 3.50 3.00 5.20 colony (mm/ day) Mycelium White, feathery, Almost white, in the White, short, lanose- Pinkish-white, short, Almost white, characteristic white margin center tinged grayish- funiculose and lanose to funiculose later sometimes violet at the center by feathery tinged greyish- the substrate, hairy to violet by the lanose-funiculose substrate, short and lanose Pigmentation in Dark violet Greyish white to grey Orange-white to dark Greyish-orange to Greyish-orange reverse to dark violet at the violet brownish-orange to dark-violet center of the colony with the center blackish-blue Odor No perceptible No perceptible No perceptible No perceptible Faintly fruity in some isolates
74
A B C
Microconidia
Conidiophore
Short chain
D E F
False head
Plate 4.3: The microscopic structures of IBRL B3-4 isolate on CLA and SNA agars under magnification of 40 x 10. (A) microconidia, (B) macroconidia, (C) short chain microconidia, (D) false head, (E) coiled hyphae on CLA and (F) coiled hyphae on SNA agar
75
A B
C D
Plate 4.4: The crucial structures of IBRL B3-4 under SEM view. (A) shows microconidia, (B) macroconidia, (C) false head and (D) coiled hyphae
76
Table 4.7: Structural morphologies of related Fusarium sp with IBRL B3-4 isolate (Nirenberg and O’Donnell, 1998)
Structural IBRL B3-4 F. circinatum F. F. denticulatum F. guttiforme morphology/ pseudocircinatum Fusarium sp Microconidia Oval without septate Oval to allantoids, Oval to obovoid, Long oval to Obovoid, mostly (4.5-7.0 x 1.7-2.6 mostly without mostly without allantoids when 0 without septate, µm) septate, occasionally 1 septate, sometimes 1 to 1 septate, the occasionally 1 septate septate higher septate septate (7.0-12.0 x 2.5-3.9 (5.0-10.0 x 1.9-3.2 conidia fusiform (7.0-14.0 x 2.4- µm) µm) to falcate 4.0 µm) (5.4-12.4 x 2.0- 3.8 µm) Macroconidia Slender, slightly Slender, cylindrical, Slightly falcate with Slightly falcate, Absent falcate with thin mostly 3 septate a faintly beaked with a beaked wall structure, 3-5 (32.0-48.0 x 3.2-3.8 apical cell and a apical cell and septate µm) footlike basal cell, footlike basal cell, (32.0-46.4 x 1.2-2.9 mostly 3 septate slender usually 3 µm) (20.0-44.0 x 2.4-3.6 to 5 septate µm) (32.0-47.6 x 3.6- 4.0 µm) Conidiophore of Prostrate Erect, strongly Prostrate Prostrate, short Erect or aerial mycelium branched and sometimes prostrate and associated with coiled branched strongly hyphae branched Coiled hyphae Present on CLA and Present Present on CLA or Absent Absent higher degree on BLA (banana leaf SNA agar) and higher degree on SNA
77
False head Present Present Present Present Present Chlamydospores Absent Absent Absent Absent Absent Short chain Present. Bearing Absent Present. Bearing less Absent Absent less than 10 conidia than 15 conidia
78
4.3.3.3 Molecular confirmation of fungal genera
For more accurate identification of IBRL B3-4, the fungal DNA was analyzed via PCR.
The IBRL B3-4 isolate yielded a single band as a PCR product (Figure 4.1) at approximately 750 base pair and the consensus sequences of this fungal isolate was attached at Figure 4.2. Then, these sequences were aligned in Fusarium-ID and
GenBank (NCBI) and the outcomes were simplified in Table 4.8. The BLAST search indicated that IBRL B3-4 sequence alignment identical to F. pseudocircinatum in both
BLAST engines. A total of 99.33% sequence similarity was reported by Fusarium-ID and 99.00% from GenBank. By considering the results from macroscopic, microscopic and molecular approaches, IBRL B3-4 was identified as F. pseudocircinatum. In this experiment, TEF-1α was selected as primer because the gene is very specific to specification Fusarium sp (Geiser et al., 2004).
There is less information provided for F. pseudocircinatum mostly its ecology or biology. It is a new species which is identified and well elaborated by Nirenberg and
O’Donnell in 1998. According to their diagnostics, after the 14 days of incubation period on CLA, there were a few important structures recorded i.e. microconidia, macroconidia, false head, short chain and coiled hyphae. The coiled hyphae can be easily found in SNA and the coiling degree was superior compared to CLA. On PDA, white feathery mycelia were mixed with orange to violet color pigments mostly at the center of the plate.
79
M 1 2 M
750 bp
Figure 4.1: DNA purification of the TEF-1α of IBRL B3-4. M= DNA size marker of 1kb ladder and Lane 1=control and Lane 2= IBRL B3-4.
TGCAAGTTGGTAGATCAAGACACCGCCTTGGGTAGAGAACCCTACGAGTA CTACCCTCGACGATGAGCTTATCTGCCATCATAATCCCGACCAAAACCTG
GCGGGGTATTTCTCAAAAGCCAACATGCTGACATTACTTCACAGACCGGT CACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTT CGAGAAGGTTAGTCACTTTCCCTTCGATCGCGCGTCCTTTATCCATCGATT TCCCCTACGACTCGAAACGTGCCCGCTACCCCGCTCGAGTCCAAAATTTTT GCGATATGACCGTAATTTTTTTGGTGGGGCCTTTACCCCGCCACTCGAGCG GCGCGTTTTTGCCCTCTCTCATTCCACAACCTCACTGAGCGCATCGTCACG TGTCAAGTAATCACTAACCGTTCGACAATAAGAAGCCGCTGAGCTCGGTA AGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGT GAGCGTGGTATCACCATCGATATTGCTCTCTGGAAGTTCGAGACTCCTCGC TACTATGTCACCGTCATTGGTATGTTGCCGCTCATGCTTCATTCTACATCTC TTCTTACTAACATATCGCTCAGACGCTCCCGGTCACCGTGATTTCATCAAG AAGATGATCAACTGGTTCCCTCCAAACACCGTGATTTCATCAAGAAGATG
ATCAACTGGTTCCCTCCAAA
Figure 4.2: The consensus sequences of IBRL B3-4
80
Table 4.8: The outcomes of sequence alignment in Fusarium-ID and GenBank (NCBI)
Isolate TEF 1-α sequencing similarity (%)
Fusarium-ID GenBank
Fusarium pseudocircinatum Fusarium subglutinans (99.33) (98.00) Fusarium pseudocircinatum Fusarium subglutinans (99.33) (98.00) Fusarium sp. Fusarium pseudocircinatum (98.83) (99.00) Fusarium sp. Fusarium pseudocircinatum (96.19) (99.00) IBRL B3-4 Fusarium sp. Fusarium subglutinans (96.19) (98.00) Fusarium nygamai Fusarium pseudocircinatum (96.19) (99.00) Fusarium sp. Fusarium pseudocircinatum (95.52) (99.00) Fusarium sp. Fusarium pseudocircinatum (95.52) (99.00) Fusarium sp. Fusarium oxysporum (94.86) (96.00) Fusarium lactis Fusarium oxysporum (94.98) (96.00) Fusarium lactis Fusarium oxysporum (94.98) (96.00) Fusarium sp. Fusarium nygamai (94.87) (96.00)
The microconidia of F. pseudocircinatum has oval to obovoid shape with 0 to 1 septate.
The aerial mycelium impregnated false head and short chain (˂15 spores). These structures arose from monophialides and infrequently from polyphialides. The microconidia were found abundantly in the aerial mycelia. The size of microconidia was ranged from 5.0-10.0 x 1.9-3.2 µm. Slender, falcate and thin walled macroconidia were the common criterion for F. pseudocircinatum. In addition, there was also beak shape of
81 apical cell, foot shape of basal cell and primarily 3 septate macroconidia. The size for macroconidia usually ranges of 20.0-44.0 x 2.4-3.6 µm. No chlamydospores were observed. F. pseudocircinatum apparently does not involve in plant disease and its morphologies were identical to F. circinatum and F. sterilihyphosum because of the appearance of coiled hyphae, even they are not phylogenetically related. It owns the short chains structure of microconidia which make it different from F. circinatum. F. sterilihyphosum can be distinguished by comparing its macroconidia to F. pseudocircinatum. Formally, F. sterilihyphosum has slighter and longer macroconidia than those of F. pseudocircinatum.
Identification key was also done to accentuate the results obtained from macro and microscopic observation. The highlighted bold font is the lineage characteristic relates with IBRL B3-4. It has been proven that IBRL B3-4 is F. pseudocircinatum. The key is also based on Nirenberg and O’Donnell (1998) as follows:
1. 0- to 1-septate oval conidia without foot-cell produced on the agar surface, never in the aerial mycelium……………………………………………………...F. bactridioides
1. 0- to 5-septate conidia without foot-cell produced in the aerial mycelium………2
2. Chlamydospores produced within 14 days in the dark……………………….3
2. Chlamydospores not produced within 14 days in the dark……………….9
3. Chlamydospores mostly lateral or terminal, borne singly or in pains, rarely in clusters; polyphialides absent…………………………………………….section Elegans
3. Chlamydospores mostly intercalary, typically borne in chains or clusters;
polyphialides sometimes present……………………………………………………...4
4. Conidia forming chains and false heads in the aerial mycelium……………...5
82
4. Conidia not forming chains in the aerial mycelium…………………………..7
5. Some pyriform conidia produced……………………………………………………..6
5. No pyriform conidia produced……………………………………………..F. nygamai
6. Clavate and pyriform conidia produced in long linear chains (> 30 conidia) on
monophialides……………………………………………………F. napiforme
6. Obovoid and pyriform conidia produced, sometimes in short false chains
(< 15 conidia) on mono- and polyphialides……………F. pseudoanthophilum
7. Conidiophores often branched, each branch often ending with polyphialides……...
…………………………………………………………………F. pseudoanthophilum
7. Conidiophores rarely branched, rarely forming polyphialides……………………….8
8. Sporodochial conidia mostly 3-septate with an uncinate apical and basal cell;
never producing pyriform conidia in the aerial mycelium…………....F. udum
8. Sporodochial conidia mostly 3-septate with an acute apical cell; never
producing pyriform conidia in the aerial mycelium……………1. F. acutatum
8. Sporodochial conidia mostly 5-septate with a slightly beaked apical cell;
occasionally producing pyriform conidia in the aerial mycelium………………...
………………………………………………………………………...F. dlaminii
9. Coiled sterile hyphae formed in and on the agar………………………………...10
9. Coiled sterile hyphae not formed……………………………………………………11
10. Conidia aggregated in false heads, never in chains………….3. F. circinatum
10. Conidia aggregated in false heads and in short false chains (<15
conidia), when cultivated under continuous black light………………......
……………………………………………………….8. F. pseudocircinatum
11. Conidia adhering in chains and false heads………………………………………..12
11. Conidia adhering only in false heads, chains absent……………………………….24
83
12. Conidia only borne on monophialides……………………………………..13
12. Conidia borne in mono- and polyphialides…………………………………………………………………………….4
13. Conidia borne on conidiophores that often terminate verticillately with 3 phialides; cosmopolitan on numerous plant hosts, especially cereals……………………………….
……………………….………………………………F. verticillioides (Sacc.) Nirenberg
13. Conidia borne on conidiophores that usually terminate verticillately with 4 phialides; cultures typically produce slimy dark violet plaques on PDA within 5 days; pathogenic on Sorghum spp………………………………………………...F. thapsinum
14. Pyriform and clavate conidia produced in chains………………………….15
14. Pyriform conidia not produced……………………………………………..16
15. Polyphialides frequent; sporodochia produced………………………F. proliferatum
15. Polyphialides rare; sporodochia not produced…………………………...F. nisikadoi
4.4 Conclusion
This study was conducted to estimate the nutrients components in substrates and also to isolate, screen and identify the lovastatin potential producers. Quantification study of nutrients composition in rice bran and brown rice had verified carbohydrate (41.20 ±
2.10 %) and fiber (48.53 ± 0.58%) as two major constituents. A total of 78 fungal isolates were successfully isolated from double screening series. However, only 28 isolates were verified as lovastatin producers via HPLC. Among the isolates, IBRL B3-
4 gave the best lovastatin yield with 281.67 ± 44.44 µg lovastatin/g dry solid. The identification process including morphological and molecular studies has verified the
IBRL B3-4 isolate as F. pseudocircinatum. Therefore, this isolate was identified as F. pseudocircinatum IBRL B3-4 and was used in the subsequent experiments.
84
CHAPTER 5
IMPROVEMENT OF PHYSICAL AND CHEMICAL PARAMETERS AND
THEIR EFFECTS TOWARD LOVASTATIN PRODUCTION IN A FLASK
SYSTEM
5.1 Introduction
In SSF, it is a vital factor to choose the suitable microorganisms and improve the parameters process i.e. cultural conditions, medium compositions and also biochemical (Pandey et al., 2000). Referring to the report of Raimbault (1998), environmental aspects such as surrounding temperature, pH, moisture content or water yield, oxygen and nutrients level, affects the growth of microorganism and product formation.
The chosen substrate in SSF has to act as nutrient source and able to perform in deficiency or near deficiency of free water (Bhargav et al., 2008). The consideration of solid substrate selection commonly depends on cost and availability
(Pandey et al., 2000). Most of the agro wastes in Malaysia are originated from plants and lignocellulose is the main constituent either in woody or non woody plants. This component is constructed by lignin, hemicellulose and cellulose as its major chemical structures (Howard et al., 2003). Those substances submitted some nutrients to serve the microbial growth and cell anchorage. However, in attempt to boost these factors, the external nutrients need to be supplied. This condition is a reflect to the optimal concentration or unavailability of several needed nutrients in the substrate (Pandey et al., 2000).
85
Instead of open burning, the damping agro wastes requested a significant technique for disposal purpose and it is a bonus if the agro wastes can generate any value-added products including enzymes, secondary metabolites, bioremediation compounds, biofuel and etc. SSF is a superior choice due the higher yield production with better product criterions than SmF. Furthermore, it promises a low involvement of capital, operating stages, downstreaming and stirring processes including sterilisation cost (Hölker and Lenz, 2005; Nigam, 2005). This system displays a more interesting characteristics as it introduces a closeness to the natural surroundings of microorganism (Bakri et al., 2003) and also regarded as environmental friendly (Ong et al., 2004).
The objective of this chapter was to improve the physical and chemical parameters which affect the lovastatin synthesis by the previous selected filamentous fungus, F. pseudocircinatum IBRL B3-4, in a flask system. This system is also known as a very simple bench scale reactor which is blocked with cotton wool or gauze layer (Bellon-Maurel et al., 2003). Furthermore, it involves low cost requirement without controlling and regulation process of the medium (Christen et al., 1997).
86
5.2 Materials and Methods
5.2.1 Microorganisms, inoculum and substrate preparations
The preparation of microorganisms, inoculum and substrate was employed as described in Section 3.1.
5.2.2 Influence of different organic solvents towards lovastatin recovery
Various solvents with different polarity were screened to determine the best extraction agent for lovastatin resurgence. The polar to non polar organic solvents were selected to interact with lovastatin polarity and maximized its production.
Referring to Pansuriya and Singhal (2009), organic solvents were the most suitable mediator to extract both hydroxyl acid and lactone lovastatin in SSF. Thirty mL of polar and non polar solvents namely methanol (QRëC™, New Zealand), acetonitrile
(QRëC™, New Zealand), butyl acetate (Merck, Germany), ethanol (QRëC™, New
Zealand), dichloromethane (QRëC™, New Zealand), ethyl acetate (QRëC™, New
Zealand) and toluene (J.T Baker, USA) were added and undergone an extraction process (Section 4.2.1). This experiment was conducted according to Manzoni et al.
(1998), Alarcón et al. (2003) and Pansuriya and Singhal (2009).
5.2.3 Process parameters improvement
A few critical process parameters such as substrate size, moisture content, inoculum size, pH, substrate quantity, mixing frequency, carbon, nitrogen sources and mineral addition were estimated by parameter improvement studies. In order to obtain the
87 maximal production of lovastatin, each optimum parameter was consequently applied into the next study.
5.2.3.1 Time course profile of lovastatin production before physical parameters improvement in flask system
A basal condition of SSF consisted 5 g of substrate mixtures (rice bran and brown rice, 1:1 ratio) was applied into 250 mL Erlenmeyer flask. Cotton plug was used to seal the flasks prior to autoclaving process at 121°C for 15 minutes. A total of 70%
(v/w) of distilled water (pH 6.5) was added into the flask. Afterward, solid substrate medium was inoculated with 20% (v/w) spore suspension (size of 1 x 107 spore/mL). The solid mixture was mixed for a balance distribution of spore and those flasks were incubated at ambient temperature of 30 ± 2°C (Szakacs et al.,
1998; Pansuriya and Singhal, 2010). The incubation period was carried out for 16 days and three flasks were harvested in 2 days interval.
5.2.3.2 Influence of physical parameters on lovastatin production by F. pseudocircinatum IBRL B3-4
5.2.3.2 (a) Effect of substrate size
Szakacs et al. (1998), Wei et al. (2007), Pansuriya and Singhal (2010), Mohammad
Faseleh et al. (2012), Prabhakar et al. (2012) and Kumar et al. (2014) suggested the size range for substrate was from 0.3 mm to 20 mm. This experiment was conducted in the particle size range of 0.1 mm to original size (≈ 8.0 mm) due to sieve restriction. The size adjustment was done only towards brown rice as the rice bran
88 consisted the undefined size. A total of 5 g substrate mixture (1:1 ratio) was supplied into Erlenmeyer flask with 70% (v/w) moisture content (distilled water, pH 6.5) and
1 x 107 spore/mL inoculum size. These flasks were mixed before being incubated at
30 ± 2°C for 12 days (Prabhakar et al., 2012).
5.2.3.2 (b) Effect of different percentage of moisture content
For lovastatin production, Subhagar et al. (2009), Pansuriya and Singhal (2010) and
Mohammad Faseleh et al. (2012) have recommended moisture content ranging from
40 to 70% (v/w). This experiment was performed based on Latha et al. (2012). The optimum substrate size from previous study was applied into this section. The effect of moisture content was evaluated by varying the moisture percentage from 50% to
90% (v/w). One milliliter of spore suspension (size of 1 x 107 spore/mL) was added into 250 mL flask containing 5 g of sterile substrates mixture. Then, different moisture level was applied, mixed and incubated for another 12 days.
5.2.3.2 (c) Effect of surroundings temperature
According to Lingappa and Vivek Babu (2005), Panda et al. (2009), Subhagar et al.
(2009), Pansuriya and Singhal (2010) and Mohammad Faseleh et al. (2012), the best temperature to obtain lovastatin was around 25 to 35°C. By applying all of the optimum conditions from previous parameters, the effect of surrounding temperatures (range from 25 to 40°C) towards lovastatin production were investigated (Latha et al., 2012).
89
5.2.3.2 (d) Effect of inoculum size
The best range for lovastatin production as suggested by Szakacs et al. (1998), Wei et al. (2007) and Ahmad et al. (2009) was 103 to 108 spore/ mL. Inoculum sizes of 1 x 104, 1 x 105, 1 x 106, 1 x 107 and 1 x 108 spore/mL were studied. A counting chamber known as haemocyctometer was used to determine the targeted inoculum sizes. Any sizes that gave the highest lovastatin production will be applied into the subsequent cultivation parameter.
5.2.3.2 (e) Effect of initial pH
This study was based on Panda et al. (2009) and Latha et al. (2012). To determine the influence of initial pH towards lovastatin production, 1 M hydrochloric acid
(HCl) and 1 M sodium hydroxide (NaOH) were used to adjust the pH between 4 to
8. The pH was altered prior to autoclave. The optimum pH range for lovastatin production was from 5 to 6.5 (Wei et al., 2007; Panda et al., 2009; Pansuriya and
Singhal, 2010; Latha et al., 2012; Kumar et al., 2014).
5.2.3.2 (f) Effect of substrate quantity
This experiment was referred to Prabhakar et al. (2012). Based on Szakacs et al.
(1998), Xu et al. (2005), Wei et al. (2007), Subhagar et al. (2009) and Prabhakar et al. (2012), the suitable substrate quantity range for lovastatin production in flask system was from 5 to 150 g. A total of 2.5, 5.0, 10.0, 15.0 and 20.0 g substrate quantity was tested in the flask system. Substrates were put into the Erlenmeyer flask and autoclaved at 121°C for 15 minutes. Then, those flasks were applied with
90 all the optimum conditions including substrate size, moisture content, inoculum size, initial pH and also the tested parameter, substrate quantity.
5.2.3.2 (g) Effect of mixing frequency
Method of Prabhakar et al. (2012) was referred to pursue the next study. According to Szakacs et al. (1998), Wei et al. (2007), Subhagar et al. (2009), Pansuriya and
Singhal (2010), Prabhakar et al. (2012) and Kumar et al. (2014), static was the best condition for lovastatin production in flask system. The investigated mixing frequencies were set for 0 hour (static state), every 12 hours, every 24 hours and every 48 hours. All of the mixing processes were done until the optimum day (day
12th). The substrate mixtures were manually shake until a uniformity between substrate and fungus formed.
5.2.3.3 Time course profile of lovastatin synthesis after physical parameters improvement
All of the improved physical parameters were applied in the profile after physical parameters improvement. The parameters consist of 5 g substrates mixture (1:1 ratio), original size of brown rice, 70% (v/w) moisture content, distilled water pH
6.5, inoculum size of 1 x 105 spore/mL, incubation temperature of 30 ± 2°C and no mixing application throughout the fermentation period (static condition). Sixteen days incubation period was conducted and three flasks were harvested in 2 days interval.
91
5.2.3.4 The influence of chemical parameters on lovastatin production by F. pseudocircinatum IBRL B3-4
Several external supplementation i.e. carbon, nitrogen sources and mineral addition were selected to improve the lovastatin production and fungal growth. These include carbohydrates (monosaccharide, oligosaccharide and polysaccharide) as carbon representative, organic and inorganic nitrogen source and a few common minerals.
5.2.3.4(a) Effect of carbon sources supplementation
A concentration of 1% (w/w) glucose (QRëC™, New Zealand), fructose (QRëC™,
New Zealand), maltose (Sigma-Aldrich, USA), lactose (Riedel-de Haën, Germany), sucrose (QRëC™, New Zealand) and starch (Bendosen, Norway), was separately dissolved in distilled water and adjusted to pH 6.5 using 1 M hydrochloric acid
(HCl) and 1 M sodium hydroxide, prior to autoclave. Each carbon sources was added into the improved cultivation medium which contained 5 g substrates mixture
(1:1 ratio), original size of brown rice, 70% (v/w) moisture content and inoculum size of 1 x 105 spore/mL. The flasks were incubated at 30 ± 2°C under static condition for 12 days. A condition without external carbon source addition was served as a control.
The sucrose application in SSF showed the highest lovastatin yield compared to other carbon sources. Thus, it was selected to test the influence of its different concentration towards the yield. The concentration was varied from 0.5 to 2.0%
(w/w). A control (1%; w/w sucrose supplementation) was spared to compare the
92 yield improvement. The study of this parameter was based on Valera et al. (2005) and Pansuriya and Singhal (2010). In SSF, lovastatin was said to generate maximal production at the concentration range of 1% to 40% (w/w) of carbon sources
(Danuri, 2008; Pansuriya and Singhal, 2010; Latha et al., 2012; Chaynika and
Srividya, 2014).
5.2.3.4(b) Effect of nitrogen sources supplementation
In order to extent the yield of lovastatin and fungal growth, nitrogen sources were consequently added. This study was based on Valera et al. (2005). Organic and inorganic nitrogen source likes corn steep liquor (Sigma-Aldrich, USA), malt extract
(Amresco, USA), peptone (Difco Laboratories, USA), urea (Merck, Germany), ammonium chloride (Merck, Germany) and yeast extract (Scharlau, Spain), were added into flask system at 1% (w/w) level. Sucrose at concentration of 1.5% (w/w) was set as a control for this section.
The test of different concentration was employed towards yeast extract. A range of
0.5 to 2.0% (w/w) was done and the best concentration that depicted the highest lovastatin production was chosen to proceed into the next parameters. Combination of 1.5% sucrose and 1% yeast extract were selected to be a control indicator. In regard of lovastatin production, the best concentration for nitrogen sources range from 0.15 to 2% (w/w) and this investigation result was obtained by Szakacs et al.
(1998); Danuri (2008) Pansuriya and Singhal (2010).
93
5.2.3.4(c) Effect of mineral salts addition
Potassium dihydrogen phosphate (KH2PO4, Bendosen, Norway), zinc chloride
(ZnCl2, Bendosen, Norway), calcium chloride dihydrate (CaCl2∙2H2O, Fluka
Chemika, USA), cobaltous chloride hexahydrate (CoCl2∙6H2O, Fluka Chemika,
USA), iron II sulphate heptahydrate (FeSO4∙7H2O, Sigma-Aldrich, USA), magnesium sulphate heptahydrate (MgSO4∙7H2O, Riedel-de Haën, Germany), di- potassium hydrogen phosphate (K2HPO4, Bendosen, Norway) were chosen to be inspected for their additional effect on lovastatin production and fungal growth formation. The concentrations of all mineral salts were set at 0.5% (w/w) level.
To determine a suitable concentration of the optimum mineral salts, a concentration range of 0.1 to 0.6% (w/w) was applied into the flask system and the best condition was represented as the maximum lovastatin output. Control for this study was 1.5% sucrose mixed with 1% yeast extract and 0.5% CaCl2. All of the pH solutions were adjusted to 6.5 prior to autoclave. The optimal mineral salts composition suggested by Danuri (2008) and Shaligram et al. (2009) for statin production contained 0.1 to
2.0% (w/v) mineral salts. This experiment was employed according to their method.
5.2.3.5 Time course profile of lovastatin production after chemical parameters improvement
All of the improved conditions of physical and chemical parameters were applied into this section. Sixteen days incubation period was conducted in a flask system which containing unaltered substrate size, 70% (v/w) moisture content, 1 x 105
94 spore/mL inoculum size, pH 6.5, 5 g subsrate quantity, 1.5% (w/w) of sucrose, 1%
(w/w) of yeast extract and 0.5% (w/w) of calcium chloride. The flask was incubated at an optimum temperature of 30 ± 2°C under static condition. Three flasks were harvested for every 2 days and the lovastatin yield including fungal growth were accordingly analyzed.
5.2.4 Analysis
5.2.4.1 Extraction of fermented solid substrates
The method was described in Section 3.2.1
5.2.4.2 Lovastatin estimation
The method was described in Section 3.2.2
5.2.4.3 Fungal growth determination
The method was described in Section 3.2.3
5.2.4.3 Statistical analysis
The method was described in Section 3.2.4
95
5.3 Results and Discussion
5.3.1 Organic solvents extraction
A polar aprotic solvent known as dichloromethane appeared to be the best lovastatin extractor (p < 0.05) (Figure 5.1). The depicted yield was 281.67 ± 44.44 µg lovastatin/ g dry solid. The second highest yield depicted by another polar aprotic solvent, acetonitrile, as the lovastatin yield hit to 216.67 ± 5.56 µg lovastatin/ g dry solid. It was followed by butyl acetate (61.67 ± 2.22 µg lovastatin/ g dry solid), toluene (60.00 ± 3.33 µg lovastatin/ g dry solid), ethyl acetate (58.33 ± 4.44 µg lovastatin/ g dry solid), methanol (38.33 ± 2.22 µg lovastatin/ g dry solid) and the lowest reading obtained by ethanol (33.83 ± 5.56 µg lovastatin/ g dry solid.
350 3 300 2.5 250 2 200 1.5 150 100 1 50 0.5
0 0
Fungal growth (mg/g) growth Fungal Lovastatin yield (µg/g) yield Lovastatin
Lovastatin yield Fungal growth
Figure 5.1: Effect of solvents on lovastatin production
.
96
Lovastatin is characterized under secondary metabolite as a high lipophilic compound which allowed it to attain poor solubility in water (El-Batal and Al-
Habib, 2012). However, it has been reported by Chaubal et al. (1995) and Martins et al. (2012) that the isolation of the active ingredient of bioprocess product (mostly secondary metabolites) can be stimulated during extraction program specifically using organic solvents (Lisec et al., 2012). Polar to non-polar solvents were selected for lovastatin recovery in extraction program. According to Lisec et al. (2012), product can be revived from fermentation through a few practices including solvent extraction, precipitation, crystallization, ion exchange chromatography, adsorption or membrane processes. However, the organic solvent extraction displays the best method because of the efficiency and inexpensive factor. In submerged fermentation, mevinolinic acid was the major form of lovastatin and it needs to be converted into native form (lactone) by lowering the pH medium, prior to solvent extraction procedure (Samiee et al., 2003; Mabrouk et al., 2008; Ahmad et al., 2009;
Osman et al., 2011).
But when it comes to SSF, the extraction method will be different due to the difficulty in pH controlling. A successful attempt was done by Pansuriya and
Singhal (2009) in extracting or isolating lovastatin from solid substrate. They managed to obtain the dual forms of lovastatin i.e. lactone and acid form, only by using solvents namely acetonitrile, methanol and ethyl acetate without adjusting the pH. The polar solvents were believed to generate the two forms of lovastatin better than non polar solvents. The mevinolinic acid formation in solvent solution commonly undergoes a lactonization process using acid catalyst to form a more superior lactone configuration (Szakacs et al., 1998; Panda et al., 2009; Panda et al.,
97
2010) although the conversion will be very hard (Pansuriya and Singhal, 2010).
Thus, it is recommended by these researchers to mix the solvent extracted sample with trifluoroacetic acid (TFA, Scharlau, Spain) or phosphoric acid to improve the lactone formation.
Dichloromethane or methylene chloride (CH2Cl2) is a borderline polar aprotic solvent. However, it is often considered as being non-polar solution. There is no specific report of dichloromethane contribution on direct lovastatin production, mostly in SSF. Commonly, this solvent is chosen to determine most of volatile compound which is further applied into gas chromatography. Referring to report of
Laohaprasit et al. (2011), dichloromethane was the most efficient solvent to extract aldehydes, alcohols and a few types of hydrocarbons. The idea of selecting this solvent was based on the information from Manzoni et al. (1998) and Alarcón et al.
(2003). According to their paperwork, the dichloromethane has been used to isolate a few important statins from the mycelial mass. A pre-washing procedure of the mycelial mass by a strong acid (HCl) including the dichloromethane and ethyl acetate extraction managed to generate lovastatin (Alarcón et al., 2003; Manzoni et al., 1998), mevastatin, pravastatin and monacolin J (a precursor of lovastatin)
(Manzoni et al., 1998). Pleurotus ostreatus (strain PL-136) successfully produced a maximum level of lovastatin at 70 mg/L (Alarcón et al., 2003) while A. terreus was recorded to obtain 256 mg/L production (Manzoni et al., 1998) under the previous mentioned method. Numerous of mycelia produced by F. pseudocircinatum IBRL
B3-4 in this experiment have made the use of dichloromethane possible to enhance the lovastatin yield in SSF.
98
Pansuriya and Singhal (2009) were the pioneer researchers in investigating the effect of organic solvents extraction towards lovastatin synthesis in SSF. They appointed acetonitrile as the most suitable solvent for lovastatin extraction with 1722 ± 50 µg/g as an average yield content. However, they exposed no detail report for lovastatin production using other solvents (methanol, ethyl acetate, butyl acetate, toluene and chloroform). Szakacs et al. (1998) directly used the same solvent with phosphoric acid addition (as lactonization agent) to extract out lovastatin produced by A. terreus. A total of 1540 µg/g of lovastatin yield was generated under this SSF system.
Lesic et al. (2012) suggested to use non toxic types of solvent such as ethyl acetate, butyl acetate and isopropyl acetate during extraction process of lovastatin. In reflect,
Panda et al. (2009) have successfully generated 3.420 mg/g by using ethyl acetate and TFA for lactonization. However, in this experiment, the lovastatin yield using non toxic solvents exhibited lower production and the lowest production was revealed by ethanol. As reported by Chang et al. (2002), ethanol held a great potential as a lovastatin extraction solvent. It produced 1.760 mg/g of lovastatin under the average of three repeats. Butyl acetate is widely used during statin purification or crystallization process. It is well said by Hajko et al. (1998) that the application of butyl acetate with the vacuum condition and temperature above 40°C, can transform the lactone lovastatin into crystal. On the other hand, toluene was used throughout the reflux process for lactonization of lovastatin. However, meticulous inspection and consideration need to be taken into account before using toluene. It is because of the multi-step procedures, low yield production and perilous effect
99 towards human and environment. Table 5.1 summarizes the lovastatin recovery using different extraction solvents in SSF and SmF.
Table 5.1: Lovastatin recovery by various solvents
Solvent type Lovastatin production References SSF SmF (mg/g) (mg/L)
Acetonitrile 1.5 0.0004 Szakacs et al., 1998
Dichloromethane + ethyl - 5-70 Alarcón et al., 2003 acetate
Methanol 193.7 97.5 Subhagar et al., 2009; Subhagar et al., 2010 Ethyl acetate 3.420 13.75 Panda et al. (2009); Chaynika and Srividya, 2014 Acetonitrile 1.722 - Pansuriya and Singhal, 2009 Ethanol 1.760 131 Chang et al., 2002; Singgih et al., 2014
5.3.2 Improvement of physical and chemical parameters on lovastatin synthesis by F. pseudocircinatum IBRL B3-4
5.3.2.1 Time course profile of lovastatin production before physical parameters improvement
Based upon the primary and secondary screening programs in the previous chapter
(Chapter 4), F. pseudocircinatum IBRL B3-4 was selected to be applied into the section of physical and chemical parameters improvement under SSF condition.
100
Lovastatin production by F. pseudocircinatum IBRL B3-4 was monitored for 16 days with the mixture of rice bran and brown rice as substrate. After 48 hours of incubation time, the fungus started to secrete lovastatin. It emitted 28.33 ± 1.11 µg lovastatin/ g dry solid of lovastatin yield. There was a rapid rise in lovastatin yield between day 6 (55.83 ± 2.78 µg lovastatin/ g dry solid) and day 8 (140.83 ± 22.22
µg lovastatin/ g dry solid) and it kept boosting up until achieving the optimum day at day 12th. It slightly decreased after day 12th and remained constant until the end of incubation period. The maximum production of lovastatin at day 12th was 425 ±
33.33 µg lovastatin/ g dry solid and this compound indicated a growth-related pattern. The highest fungal growth was 2.78 ± 0.06 mg glucosamine/g substrate
(Figure 4.2), also achieved at day 12 of cultivation.
1000 3
800 2.5 2 600 1.5 400 1 200
0.5 (mg/g) growth Fungal Lovastatin yield (µg/g) yield Lovastatin 0 0 0 2 4 6 8 10 12 14 16 Incubation period (Day)
Lovastatin yield Fungal growth
Figure 5.2: Production of lovastatin before physical parameters improvement
101
5.3.2.1(a) Effect of substrate size on lovastatin production
The substrate particle size has a close relation to substrate characterization and system capability to exchange microbial growth including heat and mass transfer throughout fermentation process (Rodriguez-Leon et al., 2008). Specific substrate, particle size and moisture content are considered as crucial aspects in SSF which are believed to influence the microbial growth and yield (Couto and Sanromán, 2006).
The microorganisms attachment and penetration efficiency depends on the physical properties of the substrate itself i.e. vague nature, accessible region, surface area, porosity, particle size, etc. Among these factors, particle size demonstrates the major role because all other aspects lie on it (Murthy et al., 1993). Thus, the effect of different substrate size (brown rice) was tested in order to gain a compromise particle size for maximal production of lovastatin.
F. pseudocircinatum IBRL B3-4 was grown in combination of 1:1 ratio of different brown rice sizes and rice bran. Figure 5.3 shows that the lowest size of brown rice
(0.1 mm) recorded the lowest lovastatin production (235.83 ± 9.44 µg lovastatin/g dry solid) while the best production was significantly (p < 0.05) gained by the original size (434.17 ± 8.89 µg lovastatin/g dry solid). The application of 1 mm, 3 mm and 6 mm successfully produced 355 ± 30 µg lovastatin/g dry solid, 363.67±
27.78 µg lovastatin/g dry solid, 376.67 ± 4.44 µg lovastatin/g dry solid, respectively.
However, the lovastatin production depicted no correlation within the fungal growth.
The highest fungal growth was displayed by particle size of 6 mm with 1.80 ± 0.12 mg glucosamine/g substrate under the average of three repeats. Panda et al. (2009) reported that the original size of red mold rice managed to produce a high level of
102 lovastatin in SSF (3.420 mg/g). Nonetheless, there were also other optimum particle sizes recorded by other accredited researchers. According to Mohammad Faseleh et al. (2012), the size between 1.4 to 2.0 mm was the best range for lovastatin production produced by A. terreus however Wei et al. (2007) and Pansuriya and
Singhal (2010) suggested the size of ≈ 0.8 mm was more suitable for the generation of that anti cholesterol agent. The perplexity rose with Valera et al. (2005) outcome which noting the increasing sizes from 0.4 to 1.1 mm consequence in reduction of lovastatin yield. A well explanation was done by Mohammad Faseleh et al. (2012) mostly when dealing with small particle sizes.
500 2.5
400 2
300 1.5
200 1
100 0.5
Fungal growth (mg/g) growth Fungal Lovastatin yield (µg/g) yield Lovastatin 0 0 0.1 1 3 6 Original size Substrate size (mm)
Lovastatin yield Fungal growth
Figure 5.3: Effect of different substrate sizes towards lovastatin production by F. pseudocircinatum IBRL B3-4
A small particle size provides larger surface area of solid substrate which directly spares a better attachment for filamentous fungi to grow. Secondly, the use of smaller particle size offers an interspace problem (between particle and gas phase oxygen transfer) which allows a reduction for aerobic microorganism growth. The combination of diverse brown rice sizes with the undefined size of rice bran
103 permitted those varies incidents. It is important to determine an appropriate size of substrate due to its involvement in surface area, agglomeration and efficiency for microbial attack and aeration matter. In this experiment, a mixture of original size of brown rice and rice bran was pointed out as an optimum condition. The undefined size of rice bran provided a wider surface region which allowed the attack of F. pseudocircinatum IBRL B3-4 at ease level. However, a small substrate particle size may also welcome an agglomeration incident which leads into a poor growth of microorganisms (Cuoto and Sanromán, 2006). While the appearance of larger brown rice (original size) gave a better aeration due to the interspace increment but at the same time it may restrict the microbial adherence on substrate which resulted in poor substrate degradation. Due to this event, it limits the nutrients accessibility by microorganisms (Oriol et al., 1988). Based on the aeration effect, brown rice was appointed to be a material supporter for the undefined rice bran. SSF can be performed on natural organic substrate or inert support. In order to use the organic substrate in SSF, the solid substrate must be polymeric in nature, insoluble in water, able to supply nitrogen, minerals, carbon, water plus other nutrients and also can give support for microbial growth (Charles et al., 2000).
Pansuriya and Singhal (2010) have observed various influence of substrates mixture towards lovastatin production. Under 1:1 ratio, wheat bran, corn hull, gram bran, orange peel and pulp were mixed and undergone fermentation process for 10 days.
The production of combination substrate managed to generate lovastatin at a good level, 1352.00 ± 41.00 µg/g. According to Sivaramakrishnan et al. (2007), substrates combination (under the same ratio) has also been noted as the best consideration for
α-amylase production. The mixture of sesame oil cake and wheat bran was grown by
104
Aspergillus oryzae and it successfully synthesized 8235.00 ± 309.00 U/g of α- amylase.
5.3.2.1(b) Effect of moisture content on lovastatin production
A close relationship between water and SSF system has forced a critical evaluation on this variable. The water emerges as a thin layer or within the solid substrate either attached to the surface of the solid substrate particle or slightly bound within the capillary areas of the substrate (Raimbault, 1998). During the substrate preparation stage, it is necessary to add a precise amount of moisture (Krishna, 2005) as it becomes one of the key factors for cell growth and product formation (Singhania et al., 2009).
When F. pseudocircinatum IBRL B3-4 was grown on the combination of brown rice and rice bran under different moisture content, the best growth was exhibited during the application of 70% (v/w) moisture content (1.85 ± 0.04 mg glucosamine/g substrate) (Figure 5.4). At the 50% (v/w) level of moisture content, its growth (1.78
± 0.04 mg glucosamine/g substrate) was almost inline value with 70% (v/w) level.
Nevertheless, a sudden growth fluctuation was discovered during the addition of
60% (v/w) moisture content (1.45 ± 0.06 mg glucosamine/g substrate) into the system. The growth was constantly decreased during 80% (v/w) and 90% (v/w) level of moisture content. For lovastatin production, a significant level of lovastatin yield
(p < 0.05) was noticed during the application of 70% (v/w) moisture content (455.00
± 13.33 µg lovastatin/g dry solid) followed by moisture level of 60% (v/w) (278.33
105
± 36.11 µg lovastatin/g dry solid), 80% (v/w) (245 ± 16.67 µg lovastatin/g dry solid) and the lowest production was obtained by 50% (v/w) and 90% (v/w) level application. Those levels indicated the same lovastatin yield that was 58.33 ± 11.11
µg lovastatin/g dry solid and 58.33 ± 2.78 µg lovastatin/g dry solid, respectively.
Generally, the water or moisture level for filamentous fungi growth in SSF system is vary from 20 to 70% and in the case of
500 2
400 1.5 300 1 200 0.5
100
Fungal growth (mg/g) growth Fungal Lovastatin yield (µg/g) yield Lovastatin 0 0 50 60 70 80 90 Moisture content (%; v/w)
Lovastatin yield Fungal growth
Figure 5.4: Effect of initial moisture content on lovastatin production
bacteria, it will be higher (Raimbault, 1998; Pandey et al., 2001). In this experiment, the use of 50% (v/w) moisture content may cause a few events including reduction in nutrients solubility of the substrate, low range of swelling and high water pressure (Pérez-Guerra et al., 2003). In contrast, higher level of moisture can welcome the attenuation process in product yield due to steric obstruction of the growth and also interparticle space which directly affecting the oxygen transfer during fermentation progress (Lonsane et al., 1985). This incident might be happen
106 in 90% (v/w) moisture content. Pansuriya and Singhal (2010) have applied the moisture percentage of 70% (v/w) in their experiment. However, no further investigation was done on the effect of different moisture level towards lovastatin yield. Mohammad Faseleh et al. (2012) recommended 50% moisture content as a suitable moist in SSF for filamentous fungi, A. terreus, and this condition fruitfully generated 238.74 mg/kg of lovastatin. On the other hand, during the study of RSM which was carried out by Valera et al. (2005), the moisture percentage of 65% is predicted as the most appropriate moisture to combine with 0.4 mm particle size.
Under these parameters, 12.52 mg/g of lovastatin is expected to be produced. The use of 40% moisture content can also produce lovastatin under SSF condition. It was done by Subhagar et al. (2009) for 14 days on barley, long grain rice and sago starch. Yet, the production of lovastatin managed to achieve 193.7 mg/g, 190.2 mg/g and 180.9 mg/g, respectively, using Monascus sp. as the microorganism. Those events have proven that moisture content in the substrate is greatly depends on the microorganisms genera and the implemented substrate in the SSF. Substrate contains a water binding characteristic which can affect the moisture content (How and Ibrahim, 2004).
5.3.2.1(c) Effect of temperature on lovastatin production
Temperature may change throughout the fermentation process and the change depends on the substrates’ thickness and heat transfer control are more complicated in SSF than in SmF. When it comes to big scale reactor, the temperature of substrate layer can be different and the highest may reach at the bottom layer. At this time, the heat transfer is required in order to avoid product retardation. Moisture control and
107 agitation process are among two best solutions to smooth out the heat transfer process. However, temperature and heat transfer control are more complicated in
SSF than in SmF. Commonly, the control techniques used in SmF are inappropriate for SSF (Pérez-Guerra et al., 2003). Among the physical variables, temperature is possibly the most essential parameter (Krishna, 2005) because it directly distresses germination of spores, growth and product formation. However, it depends on the microorganism strains and characteristics of the substrate including the depth applying in SSF, porosity and its geometrical component (Raimbault, 1998; Gervais and Molin, 2003; Raghava Rao et al., 2003). Thus, a temperature ranged from 25 to
40°C was set to investigate its influence towards F. pseudocircinatum IBRL B3-4 and lovastatin production.
The highest lovastatin yield was obtained at 30 ± 2°C with 457.50 ± 5.00 µg lovastatin/g dry solid (p < 0.05) and fungal growth of 1.47 ± 0.08 mg glucosamine/g substrate. This result was in absolute accordance to that reported by Valera et al.
(2005), Panda et al. (2009) and Subhagar et al. (2009) which obtained the maximal lovastatin production at 30°C under SSF condition. It was trailed by temperature of
25°C (327.50 ± 6.67 µg lovastatin/g dry solid), 35°C (245.00 ± 11.67 µg lovastatin/g dry solid) and 40°C (113.33 ± 2.78 µg lovastatin/g dry solid). After undergone the glucosamine analysis, each of these temperatures gained 1.41 ± 0.06 mg glucosamine/g substrate, 1.33 ± 0.03 mg glucosamine/g substrate and 1.98 ± 0.04 mg glucosamine/g substrate, respectively. As observed in Figure 5.5, the highest fungal growth went to the highest temperature applied in this experiment, 40°C.
Mohammad Faseleh et al. (2012) have used A. terreus to produce lovastatin at 25°C.
108
In this respect, Pansuriya and Singhal (2010) and Lingappa and Vivek Babu (2005) reported the production of lovastatin by A. terreus strain was at 28°C and 35°C, respectively. The recommended optimal temperature range for mesophilic microorganism is between 20 to 40°C and better if it is below than 50°C (Manpreet et al., 2005). The major problem of temperature investigation in SSF is the heat transfer management. Throughout the fermentation, the growth of F. pseudocircinatum IBRL B3-4 generated its own metabolic heat. This condition contributed in total heat or temperature of SSF system and consequently, it became worse as there was only limited water to absorb the heat (Manpreet et al., 2005). A few biological aspects lie onto temperature such as protein denaturisation, inhibition of enzyme and also cell death (Pandey et al., 2001). A higher temperature (above
45°C) only allowed a reduction in spores germination (Hesseltine, 1972) and malfunction of microorganism metabolism yield. Conversely, a lower temperature can inhibit the spore germination (Tunga et al., 1998).
500 2.5
400 2
300 1.5
200 1
100 0.5 Fungal growth (mg/g) growth Fungal Lovastatin yield (µg/g) yield Lovastatin 0 0 25 30±2 35 40 Temperature (°C)
Lovastatin yield Fungal growth
Figure 5.5: Effect of temperature towards lovastatin production by F. pseudocircinatum IBRL B3-4
109
5.3.2.1(d) Effect of inoculum size on lovastatin production
Inoculum concentration or density is another significant factor in SSF (Gowthaman et al, 2001). Valera et al. (2005), Shaligram et al. (2009), Pansuriya and Singhal
(2010) and Mohammad Faseleh et al. (2012) are among researchers whom have inspected the effect of inoculum size towards statin production. It took 3 days for A. terreus UV1718 (under concentration of 5 x 107 spore/mL) to generate lovastatin at the maximum level on the wheat bran (Pansuriya and Singhal, 2010). On the other hand, the same genus was taken 8 days of incubation period to ferment rice straw and oil palm frond. An inoculum suspension range from 5 x 107 spore/mL to 10 x
107 spore/mL showed no significant different (p > 0.05) during the spore size investigation (Mohammad Faseleh et al., 2012). For A. flavipes, Valera et al. (2005) suggested a 6 days incubation time under concentration of 1 x 108 spore/mL to extract lovastatin from various substrates i.e. wheat bran, bagasse, gram bran and barley.
Those various results were well explained by Ramachandran et al. (2004). A lower inoculum size can possibly prolong the time for cell multiplication. This incident can only allow a longer time to obtain an adequate number of the cells to degrade the substrate and produce the required product. However, the occurrence of a rapid proliferation and biomass synthesis are guaranteed happen if the number of spores is amplified. The major factor for product reduction during the application of high inoculum size is because of the cell competition in utilizing the restricted nutrients
(Raimbault, 1998). A balance between spores number and available nutrient perhaps would yield an optimum at which the desired product synthesis would be
110 maximized. Yet, further increase in the inoculum sizes consequence in lovastatin synthesis dwindling, indicating an inadequacy of nutrient due to the augmented microbial yield. According to Figure 5.6, the best inoculum concentration was 1 x
105 spore/mL (579.167 ± 92.22 µg lovastatin/g dry solid) with fungal growth of 1.05
± 0.04 mg glucosamine/g substrate. The concentration of 1x 104 spore/mL, 1 x 106 spore/mL, 1 x 107 spore/mL and 1 x 108 spore/mL recorded lovastatin yield at
192.50 ± 11.62 µg lovastatin/g dry solid (fungal growth of 1.32 ± 0.03 mg glucosamine/g substrate), 459.17 ± 5.56 µg lovastatin/g dry solid (fungal growth of
1.48 ± 0.03 mg glucosamine/g substrate), 440.83 ± 13.89 µg lovastatin/g dry solid
(fungal growth of 1.10 ± 0.03 mg glucosamine/g substrate) and 160.00 ± 8.33 µg lovastatin/g dry solid (fungal growth of 1.68 ± 0.07 mg glucosamine/g substrate), respectively.
800 2 700 600 1.5 500 400 1 300 200 0.5
100
Fungal growth (mg/g) growth Fungal Lovastatin yield (µg/g) yield Lovastatin 0 0 1x10⁴ 1x10⁵ 1x10⁶ 1x10⁷ 1x10⁸ Inoculum size (spore/mL)
Lovastatin yield Fungal growth
Figure 5.6: Effect of inoculum size on lovastatin production by F. pseudocircinatum IBRL B3-4
111
The F. pseudocircinatum IBRL B3-4 showed the best growth during concentration
8 of 1 x 10 spore/mL concentration even it exhibited the lowest lovastatin production.
According to Ahmad et al. (2009) and Jaivel and Marimuthu (2010), a low spore suspension of filamentous fungi namely 103 spore/mL and 104 spore/mL were the optimal size for lovastatin production. On the other hand, Szakacs et al. (1998) and
Manzoni et al. (1999) recorded that 106 spore/mL of spore concentration managed to generate the maximal production of 1.5 mg/g and 230 mg/L, respectively. The best range for lovastatin production reported by Wei et al, (2007), Mohammad Faseleh et al. (2012) and Prabhakar et al. (2012) was from 107 to 108 spore/mL and this is in agree with the recent experiment’s result.
5.3.2.1(e) Effect of pH on lovastatin production
The measurement and control of this parameter is another important criterion in SSF albeit it is very complex (Pérez-Guerra et al., 2003; Krishna, 2005) as it may change in response to the microbial metabolic activities (Raimbault, 1998). Comparing to
SmF, the in situ pH monitor is practically unfeasible due to the heterogeneity condition and deficiency of suitable equipment to determine or control the pH in solid matrix (Krishna, 2005).
As illustrated in Figure 5.7, the study on initial pH designated that this variable has a significant influence on lovastatin production by F. pseudocircinatum IBRL B3-4 (p
< 0.05). However, pH 6, 6.5 and 7 showed an insignificant difference to each other.
The distilled water application which consisted pH 6.5 demonstrated the highest
112
800 1.2 700 1 600 500 0.8 400 0.6 300 0.4 200 100 0.2
0 0 (mg/g) growth Fungal Lovastatin yield (µg/g) yield Lovastatin 4 5 Distilled 6 7 8 water (6.5) pH
Lovastatin yield Fungal growth
Figure 5.7: Effect of pH towards lovastatin production yield specifically 587.50 ± 86.67 µg lovastatin/g dry solid and fungal growth of 1.05
± 0.04 mg glucosamine/g substrate. The pH higher than 7 or lower than 6, gave negative impact on lovastatin production and this condition reflected the result obtained by Mohammad Faseleh et al. (2012). Lovastatin yield at the concentration of 305.00 ± 20.00 µg lovastatin/g dry solid, 363.33 ± 25.56 µg lovastatin/g dry solid,
474.17 ± 58.89 µg lovastatin/g dry solid, 523.33 ± 42.22 µg lovastatin/g dry solid and 312.50 ± 38.33 µg lovastatin/g dry solid, was produced during the application of pH 4, 5, 6, 7 and 8, respectively.
F. pseudocircinatum IBRL B3-4 grown at its best level under pH 5 condition (1.07 ±
0.02 mg glucosamine/g substrate) and the lowest growth was detected at pH 8 (0.62
± 0.04 mg glucosamine/g substrate). The fungal growth for other pH were 0.90 ±
0.03 mg glucosamine/g substrate (pH 4), 0.91 ± 0.03 mg glucosamine/g substrate
(pH 6) and 0.70 ± 0.01 mg glucosamine/g substrate (pH 7). The effect of pH adjustment was recorded by a few researchers (Valera et al., 2005; Mabrouk et al.,
113
2008; Pansuriya and Singhal, 2009; Panda et al., 2010; Osman et al., 2011;
Mohammad Faseleh et al., 2012). From the experiments, it can be concluded that the best pH range for lovastatin production by fungi was within pH 5 to 8.5. However, most of them found out that pH 6 was the most suitable pH condition. Those informations hence recommended that the optimum initial pH for lovastatin production in SSF was at the borderline neutral pH. Small pH variations may be observed due to the characteristics of substrate and microorganism used in fermentation system (Mohammad Faseleh et al., 2012).
5.3.2.1(f) Effect of substrate quantity on lovastatin production
This variable has a close relationship with the oxygen diffusion which occurs at inter particular and intra particular level in SSF system. In reflect, the combination of wet hyphal mat with oxygen consumption can cause restriction in oxygen diffusion or perhaps its depletion. However, it happens mostly at a certain solid substrate depth
(Rahardjo et al., 2006) and this situation may welcome a problematic in nutrient achievement by aerobic filamentous fungi if the substrate thickness increases.
In this experiment, a range of 2.5 to 20 g of solid substrate quantity was set up to examine its influence on lovastatin production (Figure 5.8). After been analyzed via
Duncan Post Hoc, the original quantity (5 g) maintained as the best thickness for lovastatin production in a flask system (p < 0.05). At this level, it revealed 609.17 ±
5.56 µg lovastatin/g dry solid and fungal growth of 1.84 ± 0.03 mg glucosamine/g
114 substrate. Then, it was closely followed by other quantities namely 10, 15 and 2.5 g.
Each of these thicknesses successfully produced lovastatin concentration at 536.67 ±
49.44 µg lovastatin/g dry solid, 417.50 ± 10.00 µg lovastatin/g dry solid and 355.83
± 11.11 µg lovastatin/g dry solid, respectively. The lowest yield was gained by substrate size of 20 g with 314.17 ± 35.56 µg lovastatin/g dry solid. According to the fungal growth, it achieved the maximum growth in 5 g substrate thickness and a minimal level was recorded during 20 g substrate thickness (0.89 ± 0.1 mg glucosamine/g substrate). Fungal growth for other thicknesses were 1.38 ± 0.02 mg glucosamine/g substrate (2.5 g), 1.37 ± 0.03 mg glucosamine/g substrate (10 g) and
1.63 ± 0.04 mg glucosamine/g substrate (15 g).
700 2 600 1.6 500 400 1.2 300 0.8 200 0.4
100 Fungal growth (mg/g) growth Fungal Lovastatin yield (µg/g) yield Lovastatin 0 0 2.5 5 10 15 20 Substrate quantity (g)
Lovastatin yield Fungal growth
Figure 5.8: Effect of substrate quantity on lovastatin production by F. pseudocircinatum IBRL B3-4
The oxygen factor has forced aerobic filamentous fungi to prefer the surface part of solid substrate mat. At this level, the fungus will entirely utilise the substrate and secrete the secondary metabolites including enzymes (Rahardjo et al., 2006).
However, as the substrate mat getting thicker, the oxygen supply depletes and
115 permits the insufficient oxygen ventilation. As a result, the fungal growth at the deeper area is not so effective or might be inhibited. To explicate more about the effect of substrate quantity on lovastatin production, mode of growth of filamentous fungi on solid substrate was the best schematic description. It is divided into three layers i.e. aerial mycelial layer, wet mycelial layer and penetrative layer. Initially, the mycelia sparsely grow at each layers and as the mycelial tip keep on extending, the first layer becomes thicker because its pores is packed with water and then it forms into the second layer. At this stage, the packing density becomes tighter and allows the lower part transforms into anaerobic. As the oxygen in the substrate is demolished, the mycelia stop extending (second and third layers) (Rahardjo et al,
2006). This condition might explain the particular event happened in 10, 15 and 20 g substrate thicknesses.
5.3.2.1(g) Effect of mixing frequency on lovastatin production
Mixing frequency is commonly relates with the aeration progress and they are easily met in any fermentation system. The aeration fulfils a few of main functions in fermentation specifically (1) to preserve aerobic setting, (2) to release carbon dioxide, (3) to control the temperature in solid substrate and (4) to regulate the humidity level (Raimbault, 1998). The incident of the oxygen and carbon dioxide exchange between the substrate matrix and the gas phase happens at inter- and intra- particular level in SSF (Pérez-Guerra et al., 2003). This gas environment may considerably distress the relative levels of biomass and lovastatin production.
116
The mixing frequency was not either indicating a significant level (p > 0.05) or severe effect towards lovastatin production (Figure 5.9). However, the highest production was obtained during the employment of a static condition with lovastatin yield of 611.67 ± 7.78 µg lovastatin/g dry solid and fungal growth of 1.48 ± 0.12 mg glucosamine/g substrate. The lowest yield was detected in the most frequent mixing action i.e. 12 hour and it revealed 518.33 ± 74.44 µg lovastatin/g dry solid of lovastatin production with 1.57 ± 0.03 mg glucosamine/g substrate fungal growth.
Under intermittent mixing action of 24 and 48 hours, the produced lovastatin yield was 556.67 ± 2.22 µg lovastatin/g dry solid and 570.83 ± 72.22 µg lovastatin/g dry solid, respectively. Each of these parameters managed to generate fungal growth of
1.84 ± 0.04 mg glucosamine/g substrate (24 hour) and 1.29 ± 0.05 mg glucosamine/g substrate (48 hour). For the next parameter, the static condition was selected mainly because of less working force.
700 2 600 500 1.5 400 1 300 200 0.5
100
Fungal growth (mg/g) growth Fungal Lovastatin yield (µg/g) yield Lovastatin 0 0 0 12 24 48 Mixing frequeny (Hour)
Lovastatin yield Fungal growth
Figure 5.9: Effect of mixing frequency towards lovastatin production
117
In SSF, heat management happens to be very difficult to control and becomes harder when it comes to a large scale (Raghava Rao et al., 2003). A close association between heat transfer with metabolic yield of microorganism has forced an efficient method for aeration in order to remove the heat in SSF. The flask system commonly handled under manual aeration such as using hand for mixing or by applying a sterile spatula (or glass rod) for better uniformity in solid matrices. Raghava Rao et al. (2003) added that a good mixing aids an effective oxygen diffusion and manageable temperature or heat. However, the mixing needs to be done at a suitable rate because it may destroy the cells and slow down or diminish the desired product production (Feng et al., 2003).
5.3.2.2 Time course profile of lovastatin synthesis after physical parameters improvement
After investigating the effect of all the physical variables namely substrate size, moisture content, temperature, inoculum size, pH, substrate quantity and mixing frequency, a time course profile after physical parameters improvement was employed. All of the optimum conditions (original substrate size, 70% (v/w) moisture content, temperature of 30 ± 2°C, 1 x 105 spore/mL, distilled water pH, 5 g substrate quantity and static condition) were taken into consideration in order to achieve the optimum day for maximal production of lovastatin.
The lovastatin yield was detected after 2 days incubation period at ambient temperature and it gradually increased until day 6th. Then, the production increased
118 into almost 3 fold at day 8th and steadily speeded up until achieving the maximal detection at day 12th (615.83 ± 10.56 µg lovastatin/g dry solid). After that, the yield was slowly decreased and the time course profile was stopped at day 16th. The same pattern was recorded in the fungal growth. It has gained the maximum production at day 12th with 2.77 ± 0.05 mg glucosamine/g substrate. According to Figure 5.10, lovastatin production displayed a significant correlation with fungal growth. By comparing two profiles namely before and after physical parameters improvement, lovastatin hit almost 45% production increment. Table 5.2 summarizes the optimal physical parameters obtained by other researchers regarding the lovastatin production.
700 3 600 2.5 500 2 400 1.5 300 200 1
100 0.5 Fungal growth (mg/g) growth Fungal Lovastatin yield (µg/g) yield Lovastatin 0 0 0 2 4 6 8 10 12 14 16 Incubation period (Day)
Lovastatin yield Fungal growth
Figure 5.10: Lovastatin production by F. pseudocircinatum IBRL B3-4 after physical improvement
119
Table 5.2: Summary for the optimal physical parameters gained by researchers using various filamentous fungi via SSF system
Filamentous Optimum Optimum Optimum Optimum Optimum Optimum Optimum Lovastatin References fungi substrate moisture temperature inoculum initial pH substrate mixing production size (mm) content (°C) size quantity frequency (mg/g (%) (spore/mL) (g) (hour) substrate) A. terreus 2 65 35 108 4.5 20 0 289.63 Lingappa KLVB and Vivek Babu, 2005
A. terreus 0.84 50 to 60 28 107 to 108 5.5 50 0 2.9 Wei et al., ATCC 20542 2007
Monascus sp Original rice 70 30 103 6 20 0 2.83 Panda et al., size 2009 A. terreus UV 0.8 to 0.95 70 28 108 6 5 0 3.723 Pansuriya 1718 and Singhal., 2010
A. fischeri Data not 60 30 107 to 108 5 5 0 14.77 Latha et al., shown 2012
A. niger PN2 Data not 65 28 108 6.5 5 0 1.5 Raghunath et shown al. 2012
120
5.3.2.3 Influence of chemical parameters on lovastatin production and growth of F. pseudocircinatum IBRL B3-4
Various nutrients including carbon and nitrogen sources, vitamins and minerals can potentially control sporulation through metabolic effect. When dealing with the media formulations, it is essential to consider the biomass composition (Krishna,
2005). Commonly, a total of 40 to 50% carbon, 30 to 50% oxygen, 6 to 8% hydrogen and 3 to 12% nitrogen are represented by cellular biomass (Pandey et al.,
2001). However, other elements like phosphorus sulfur and metals are also needed but in a small amount (Krishna, 2005). In this recent experiment, the carbon and nitrogen selection was not based on amount of carbon or nitrogen consisted in the carbohydrate or organic (or inorganic) nitrogen sources.
5.3.2.3(a) Effect of carbon sources
Six carbon sources which originated from different classes were studied for their capabilities to manipulate growth and lovastatin production by F. pseudocircinatum
IBRL B3-4 (Figure 5.11). Among the various carbon sources, sucrose and maltose significantly boosted lovastatin production compared to the control (p < 0.05).
Nonetheless, sucrose revealed the highest acitivity specifically 673.75 ± 1.67 µg lovastatin/g dry solid where else maltose exposed a total yield of 651.25 ± 13.33 µg lovastatin/g dry solid. The soluble starch, glucose, lactose and fructose additions had no significant influence on lovastatin production (p > 0.05). As observed in Figure
4.12, the addition of these carbon sources inhibited the compound production and all of the activities were lower compared to the control. The control produced 555.83 ±
70.56 µg lovastatin/g dry solid and other carbon sources namely lactose, glucose,
121 soluble starch and fructose resulted in 478.75 ± 26.67 µg lovastatin/g dry solid,
400.00 ± 16.67 µg lovastatin/g dry solid, 390.00 ± 20.00 µg lovastatin/g dry solid and 156.25 ± 8.33 µg lovastatin/g dry solid, respectively. The highest fungal growth was detected during fructose employment (1.62 ± 0.05 mg glucosamine/g substrate) and the lowest fungal growth was resulted by sucrose (1.06 ± 0.03 mg glucosamine/g substrate).
Reviewing the influence of nutrient on fungal growth, Casas López et al. (2003) did mention that fructose was the fastest-utilized source and gave the highest concentration in biomass only after 72 hours of cultivation period. Other analyzed fungal growths in this experiment were 1.43 ± 0.03 mg glucosamine/g substrate
(lactose), 1.13 ± 0.06 mg glucosamine/g substrate (maltose), 1.26 ± 0.07 mg glucosamine/g substrate (glucose), 1.55 ± 0.02 mg glucosamine/g substrate (soluble starch) and 1.14 ± 0.03 mg glucosamine/g substrate (control). Thus, as sucrose contributed to the best production in the current study, it was further applied in SSF system for single-factor-multiple-level investigational test. The effect of different sucrose concentration was tested. The concentration of 1.5% (w/w) sucrose demonstrated a significant difference (p < 0.05) within other concentrations
(including the control). It revealed the highest lovastatin production with almost double increment from control (1%; w/w sucrose). At 1.5% (w/w) level, F. pseudocircinatum IBRL B3-4 produced 1293.75 ± 167.50 µg lovastatin/g dry solid and 1.72 ± 0.04 mg glucosamine/g substrate fungal growth. Then, it was followed with 1% and 2% (w/w) sucrose additions. Both of these concentration managed to spawn same level of lovastatin titer i.e. 730.00 ± 36.67µg lovastatin/g dry solid
(fungal growth of 1.43 ± 0.06 mg glucosamine/g substrate) and 730.00 ± 41.67 µg
122
800 2
600 1.5
400 1
200 0.5 Fungal growth (mg/g) growth Fungal
Lovastatin yield (µg/g) yield Lovastatin 0 0 Sucrose Fructose Lactose Maltose Glucose Soluble Control starch Carbon types (1%; w/w)
Lovastatin yield Fungal growth
Figure 5.11: Effect of different carbon sources towards lovastatin production lovastatin/g dry solid (fungal growth of 1.16 ± 0.04 mg glucosamine/g substrate), respectively. The 0.5% sucrose addition has produced 175.00 ± 18.33 µg lovastatin/g dry solid which was lower titer compared to the control (698.75 ± 34.17
µg lovastatin/g dry solid). However, the concentration of 0.5% (w/w) sucrose achieved higher fungal growth yield (1.59 ± 0.24 mg glucosamine/g substrate) than the control (1.24 ± 0.03 mg glucosamine/g substrate) (Figure 5.12).
1600 2
1200 1.5
800 1
400 0.5
Fungal growth (mg/g) growth Fungal Lovastatin yield (µg/g) yield Lovastatin 0 0 0.5 1 1.5 2 Control Sucrose (%: w/w)
Lovastatin yield Fungal growth
Figure 5.12: Effect of various levels of sucrose on lovastatin production in SSF
123
The selection of the appropriate carbon and nitrogen sources for lovastatin synthesis has stayed somewhat contentious at the very beginning of lovastatin findings
(Bizukojc and Ledakowicz, 2009). The early publication did not report on the importance of nutrients effect on lovastatin (Albert et al., 1980) however, Monaghan et al. (1980) has outlined a few nutrients formulation which consisted a combination of carbon and nitrogen sources especially for seed culture and cultivation medium.
One of the most detailed experiments regarding chemical composition in SSF for lovastatin production was executed by Xu et al. (2005). In their accordance, sucrose was one of the additive carbon sources that notably influenced Monascus ruber to secrete lovastatin. This result was consistent with the findings of recent experiment by F. pseudocircinatum IBRL B3-4. It is also worth to mention the work of Szakacs et al. (1998) who investigated seven different carbon sources to generate lovastatin using A. terreus TUB F-514 as a fermentation microorganism. The best outcome was under 2% lactose usage. In a similar, experiment using the same fungus but different strain specifically ATCC 20542 has indicated almost an equal yield of lovastatin production after been added with glucose, glycerol, lactose and whey powder. In contrast, glucose was forbidden by Casas López et al. (2003) because it welcomed the catabolic repression during fermentation. According to Osman et al.
(2011), the application of glucose either in single use or combination with oat meal demonstrated a repression effect on lovastatin titers. The inhibition of lovastatin production by carbon sources due to catabolic repression which involved in unknown mechanism might take place in this experiment during the application of fructose, lactose, glucose and soluble starch. It has been proven by Pansuriya and
Singhal (2010) and they believed that glucose, soluble starch, sucrose and lactose
124 can decrease the lovastatin synthesis using wheat bran as substrate. Nonetheless, it still depends on substrate type and microorganism preference towards nutrient sources. Table 5.3 denotes the optimal carbon sources obtained by other researchers.
Table 5.3: Carbon sources effect towards lovastatin production by various filamentous fungi in SSF system
Filamentous fungi Optimum carbon Lovastatin References source production (mg/g substrate) A. terreus 2% (w/v) lactose 1.5 Szakacs et al., 1998
Monascus ruber 3% (w/v) glycerol 4 to 6 Xu et al., 2005
Monascus purpureus 3.89% (w/v) 193.7 Subhagar et al., dextrose 2009
Monascus sp 3.89% (w/v) 2.83 Panda et al., dextrose 2010
A. fischeri 1% (w/v) lactose 14.77 Latha et al., 2012
Aspergillus sp no.76 5% (w/v) sucrose 18.75 Chaynika and Srividya, 2014
5.3.2.3(b) Effect of nitrogen sources
One of the main issues related with F. pseudocircinatum IBRL B3-4 is testing either the application of nitrogen sources is practicable or not. For different nitrogen source test, corn steep liquor, malt extract, peptone, urea, yeast extract and ammonium chloride were applied into the flask system. As illustrated in Figure 5.13, the organic yeast extract has over shadowed other sources in regard of lovastatin titers (p < 0.05)
125
1800 2.5 1500 2 1200 1.5 900 600 1 300 0.5
0 0
Fungal growth (mg/g) growth Fungal Lovastatin yield (µg/g) yield Lovastatin
Nitrogen sources (1%; w/w)
Lovastatin yield Fungal growth
Figure 5.13: Effect of different nitrogen sources towards lovastatin production by F. pseudocircinatum IBRL B3-4 with 1597.50 ± 10.00 µg lovastatin/g dry solid and fungal growth of 1.71 ± 0.03 mg glucosamine/g substrate. The other additive nitrogen sources were lower than the control (1248.75 ± 90.00 µg lovastatin/g dry solid). The use of malt extract, peptone, corn steep liquor and urea were accordingly decreased the lovastatin concentration to 871.25 ± 84.17 µg lovastatin/g dry solid (fungal growth of 1.13 ±
0.03 mg glucosamine/g substrate), 823.75 ± 59.17 µg lovastatin/g dry solid (fungal growth of 1.60 ± 0.05 mg glucosamine/g substrate), 802.50 ± 30.00 µg lovastatin/g dry solid (fungal growth of 1.71 ± 0.03 mg glucosamine/g substrate) and 251.25 ±
7.5 µg lovastatin/g dry solid (fungal growth of 1.23 ± 0.02 mg glucosamine/g substrate). The lowest lovastatin production was given by inorganic source namely ammonium chloride (50.00 ± 9.17 µg lovastatin/g dry solid) and the same source also indicated the lowest fungal growth yield (1.00 ± 0.04 mg glucosamine/g substrate) compared to others. The highest fungal growth, 1.94 ± 0.04 mg glucosamine/g substrate, was detected in control condition specifically without nitrogen addition.
126
Different concentrations of yeast extract which ranged from 0.5 to 2% (w/w) were evaluated (Figure 4.15). The previous concentration i.e. 1% (w/w) yeast extract was not indicating much difference compared to the control. Both generated almost the same concentration level of lovastatin. The yeast extract concentration of 1% (w/w) managed to produce 1597.50 ± 10.00 µg lovastatin/g dry solid while the control yield was equal to 1580.00 ± 28.33 µg lovastatin/g dry solid. Other concentrations inhibited the yield starting with 0.5% (w/w) (993.75 ± 55.00 µg lovastatin/g dry solid), followed by 1.5% (w/w) (557.50 ± 18.33 µg lovastatin/g dry solid) and 2.0%
(w/w) (533.75 ± 11.67 µg lovastatin/g dry solid). For fungal growth, the best condition obtained during 1.5% (w/w) yeast extract (2.11 ± 0.03 mg glucosamine/g substrate) and less favorable growth condition was traced in the control (1.43 ± 0.03 mg glucosamine/g substrate). The yeast extract concentrations of 0.5% (w/w), 1%
(w/w) and 2% (w/w) revealed an unstable growth namely 2.06 ± 0.02 mg glucosamine/g substrate, 1.44 ± 0.03 mg glucosamine/g substrate and 1.75 ± 0.07 mg glucosamine/g substrate, respectively. Similar to the present results of Pansuriya and Singhal (2010), they used 1% (w/w) yeast extract to obtain 3405.2 ± 42 µg/g.
Corn steep liquor, urea, peptone, yeast extract and sodium nitrate were a few of common precursors and co-factors which may promote a positive influential on lovastatin titers in SSF system (Szakacs et al., 1998; Xu et al., 2005; Pansuriya and
Singhal, 2010; Osman et al., 2011). However, the issue of establishing nitrogen sources and their concentration towards lovastatin production has been debated among researchers. Some of them proved that nitrogen source feeding was favorable for lovastatin synthesis and certain authors stated otherwise. But most of the issues come from SmF system. According to Casas López et al. (2003), nitrogen-limited
127
1800 2.5
1500 2 1200 1.5 900 1 600
300 0.5
Fungal growth (mg/g) growth Fungal Lovastatin yield (µg/g) yield Lovastatin 0 0 0.5 1 1.5 2 Control Yeast extract (%; w/w)
Lovastatin yield Fungal growth
Figure 5.14: Effect of different concentrations of yeast extract on lovastatin production phase or nitrogen starvation facilitated the growth of filamentous fungi for lovastatin biosynthesis but in contrast, Hajjaj et al. (2001) believed that carbon source exhaustion (lactose) was the best condition for that purpose. However, Lai et al.
(2005) slammed those opinions. They have proven that the combination of lactose and yeast extract were successfully put the lovastatin level at a high concentration
(572 mg/L) only after 10 days cultivation period. The malnourishment of nutrient occurs during stationary phase and commonly it associates with secondary metabolism. In lovastatin case, it is channelized into polyketide pathway. Briefly, to access the nutrient-limited phase, the carbon and nitrogen mass ratio (C:N) must be done. The amount of either carbon or nitrogen source will be amplified at a certain time and this condition forces the opponent nutrient to be a growth limiting factor
(Casas López et al., 2003). Table 5.4 indicates a few findings by other researchers in regard of the optimal nitrogen sources producing lovastatin.
128
Table 5.4: Various nitrogen sources which potentially can induce lovastatin production
Filamentous fungi Optimum nitrogen Lovastatin References source production (mg/g substrate) A. terreus 2% (w/v) corn steep 1.5 Szakacs et al., liquor 1998
M. purpureus 1.4% (w/v) 3.420 Panda et al., ammonium chloride 2009
M. purpureus 1% (w/v) peptone 193.7 Subhagar et al., 2009
Monascus sp 0.968% (w/v) malt 2.83 Panda et al., extract 2010
A. terreus UV1718 1% (w/v) peptone 3.723 Pansuriya and Singhal, 2010
A. fischeri 1% (w/v) malt 14.77 Latha et al., extract 2012
5.3.2.3(c) Effect of minerals salt addition
The evolvement of minerals is important for microorganism metabolism during fermentation (Danuri, 2008). From Figure 5.15, calcium chloride dihydrate did not gave a significant difference to the control (p > 0.05) but comparing to other minerals, it significantly promoting the lovastatin yield to 1601.25 ± 55.00 µg lovastatin/g dry solid (fungal growth of 1.11 ± 0.02 mg glucosamine/g substrate).
The use of iron II sulphate, zinc chloride, cobaltous chloride hexahydrate, di- potassium hydrogen phosphate, magnesium sulphate hexahydrate and potassium dihydrogen phosphate were gradually decreased the lovastatin production. For each minerals, the HPLC detected lovastatin level at 733.75 ± 6.67 µg lovastatin/g dry solid (fungal growth of 1.36 ± 0.05 mg glucosamine/g substrate), 565.00 ± 19.17 µg lovastatin/g dry solid (fungal growth of 1.41 ± 0.03 mg glucosamine/g substrate),
129
495.00 ± 37.50 µg lovastatin/g dry solid (fungal growth of 1.93 ± 0.04 mg glucosamine/g substrate), 448.75 ± 13.33 µg lovastatin/g dry solid (fungal growth of
1.53 ± 0.04 mg glucosamine/g substrate), 432.50 ± 6.67 µg lovastatin/g dry solid
(fungal growth of 1.27 ± 0.03 mg glucosamine/g substrate) and 307.50 ± 25.00 µg lovastatin/g dry solid (fungal growth of 1.23 ± 0.03 mg glucosamine/g substrate), respectively.
1800 2.5 1500 2 1200 1.5 900 600 1 300 0.5
0 0
Fungal growth (mg/g) growth Fungal Lovastatin yield (µg/g) yield Lovastatin
Minerals (0.5%; w/w)
Lovastatin yield Fungal growth
Figure 5.15: Effect of different mineral salts on lovastatin production by F. pseudocircinatum IBRL B3-4
Different concentration of calcium chloride has supplemented a not significant effect compared to control (p > 0.05) (Figure 5.16). The previous concentration, 0.5%
(w/w), maintained as the most suitable condition to produce lovastatin at 1630.00 ±
71.67 µg lovastatin/g dry solid with fungal growth of 1.50 ± 0.02 mg glucosamine/g substrate. As illustrated in Figure 4.17, the concentration of 0.6% (w/w) depicted
1167.50 ± 71.67 µg lovastatin/g dry solid (fungal growth of 1.66 ± 0.04 mg glucosamine/g substrate) and it was followed by 0.4% (w/w) (598.75 ± 21.67 µg
130
1800 2.5
1500 2 1200 1.5 900 1 600
300 0.5
Fungal growth (mg/g) growth Fungal Lovastatin yield (µg/g) yield Lovastatin 0 0 0.1 0.2 0.3 0.4 0.5 0.6 Control Calcium chloride (%; w/w)
Lovastatin yield Fungal growth
Figure 5.16: Effect of calcium chloride on lovastatin production lovastatin/g dry solid and fungal growth of 1.55 ± 0.02 mg glucosamine/g substrate),
0.3% (w/w) (516.25 ± 9.17 µg lovastatin/g dry solid and fungal growth of 1.54 ±
0.02 mg glucosamine/g substrate), 0.2% (w/w) (257.50 ± 3.33 µg lovastatin/g dry solid and fungal growth of 1.75 ± 0.02 mg glucosamine/g substrate) and 0.1% (w/w)
(162.50 ± 4.17 µg lovastatin/g dry solid and fungal growth of 1.55 ± 0.03 mg glucosamine/g substrate). Kim and Yun (2005) observed that the external Ca2+ assists a double action during fungal growth. It could alter the cell membrane permeability interaction by administering the internal Ca2+ gradient and also some enzyme yield in cell wall development. For higher calcium chloride level, the concentration of Ca2+ in the cell wall getting low and affects the protein and neutral sugar compositions (Kim et al., 2005). Those conditions directly influenced the active growth of fungus and the desired product formation.
Panda et al. (2009) investigated the mineral salts effect via Plackett-Burman experimental design for lovastatin production using angkak as substrate. They found
131 out that ammonium chloride, magnesium sulphate, sodium chloride and calcium chloride were significantly initiated lovastatin synthesis in SSF by M. purpureus
MTCC 269. Study of the effect of minerals on lovastatin production is rare because its influence on the production might be not that significant. However, it has been emphasized by Pansuriya and Singhal (2010) that the additional nutrients warrant unclear mechanism and may reflect in lovastatin inhibition or catabolic repression occurrence. According to Ellaiah et al. (2004), an amount of 0.5% NaCl and 0.5%
CaCO3 was needed to obtain 10.755 mg/g of neomycin (antibiotic). Danuri (2008) added that the additional of mineral salts can influence the pigmentation degree of pigment-producing fungi such as Monascus sp. As recorded by Danuri (2008), the additional of 0.25% (w/v) KH2PO4, 0.75% (w/v) NaNO3, 0.5% (w/v) MgSO4∙7H2O and 0.005% (w/v) CaCl2∙2H2O did significantly increase lovastatin production up to
22.53% (5.10 mg/g substrate) and decreased 4.11% pigment. As a result, pigment reduction can increase lovastatin production with the additional of mineral salts.
However, when it comes to F. pseudocircinatum IBRL B3-4 which is also a pigment-producing fungus, the mineral salts addition did not significantly affect the lovastatin production. Table 5.5 shows other findings of mineral salts influence on lovastatin production.
132
Table 5.5: Mineral salts effect on lovastatin production obtained by different researchers
Filamentous fungi Optimum mineral Secondary References salts metabolite production (mg/g substrate) Streptomyces 0.5% NaCl, 0.5% 10.755 (neomycin) Ellaiah et al., marinensis CaCO3 2004
0.25%(w/v) 5.10 Danuri, 2008 M. purpureus KH2PO4, NaNO3 (lovastatin) 0.75% (w/v), 0.5% (w/v) MgSO4∙7H2O, 0.005% (w/v) CaCl2∙2H2O
5.3.2.4 Time course profile of lovastatin synthesis after chemical parameters improvement
Maximum production of lovastatin by F. pseudocircinatum IBRL B3-4 occurred on
12th day of fermentation period (Figure 5.17). It took 4 days for the isolate to boost up the lovastatin before it significantly produced 1770.00 ± 60.00 µg lovastatin/g dry solid and fungal growth of 1.56 ± 0.06 mg glucosamine/g substrate. Then, the decrease was approached at day 14th and 16th. The highest fungal growth was observed earlier than the optimum day which was at day 10th. Overall, there was no correlation displayed between compound production and fungal growth. A further study was also done to investigate the increment percentage between the initial profile and after chemical parameter improvement (Figure 4.19). As shown in the figure, about 316% lovastatin increment was successfully attained by F. pseudocircinatum IBRL B3-4 in a flask system. Xu et al. (2005) and Panda et al.
(2009) have recorded that the optimum day for lovastatin production by Monascus sp. was averagely at day 14th. However, in accordance to Pansuriya and Singhal
133
(2010), A. terreus took only 3 days to generate the compound. In reflect to the report, Mohammad Faseleh et al. (2012) stated that A. terreus needed 8 days to utilise the agro-biomass and lovastatin synthesis. While Valera et al. (2005) claimed day 6th was the most suitable day for lovastatin formation by A. flavipes. As for this experiment, F. pseudocircinatum IBRL B3-4 requested 12 days to achieve the best production of lovastatin. Under flask system, F. pseudocircinatum IBRL
B3-4 can produced 1770.00 ± 60.00 µg lovastatin/g dry solid which was a competent value for other filamentous fungi reported in Table 5.6.
2000 2.5
2 1500 1.5 1000 1 500
0.5
Fungal growth (mg/g) growth Fungal Lovastatin yield (µg/g) yield Lovastatin 0 0 0 2 4 6 8 10 12 14 16 Incubation period (Day)
Lovastatin yield Fungal growth
Figure 5.17: Lovastatin production after chemical parameter improvement
134
2000
1600
1200
800
400 Lovastatin yield (µg/g) yield Lovastatin 0 0 2 4 6 8 10 12 14 16 Incubation period (Day)
Before physical improvement After physical improvement
Figure 5.18: Comparison of lovastatin production before and after parameters improvement
135
Table 5.6: Comparison of lovastatin production using various filamentous fungi
Filamentous fungi Substrate Cultivation conditions Optimum day Lovastatin References (day) production (mg/g)
Monascus sp. Angkak rice Particle size: original size 14 3.420 Panda et al., 2009 Moisture content: 70% pH: 6.0 Inoculum size: 103 spore/mL Mixing frequency: stagnant Temperature: 30°C Substrate quantity: 20 g Carbon source: Not added Nitrogen source: 14.32 g/L NH4Cl Mineral salt: MgSO4 (0.76 g/L), NaCl (14.65 g/l) and CaCl2 (0.54 g/L)
A. terreus UV Wheat bran Particle size: 0.35 mm 3 3.723 Pansuriya and 1718 Moisture content: 70% Singhal, 2010 pH: 6.0 Inoculum size: 107 spore/mL Mixing frequency: stagnant Temperature: 28°C Substrate quantity: 5 g Carbon source: Not added Nitrogen source: 1% (w/v) peptone
136
Mineral salt: K2HPO4 (2g/L) and MgSO4∙7H2O (0.5 g/L), NaCl (0.5 g/L), MnSO4 (0.5 g/L), ZnSO4∙4H2O (3.4 mg/L), FeSO4∙7H2O (5 mg/L), CoCl2.6H2O (2mg/L) and MnSO4 (1.6 mg/L)
A. fischeri Coconut oil cake Particle size: Not mentioned 7 14.77 Latha et al., 2012 Moisture content: 60% pH: 5.0 Inoculum size: 107 to 108 spore/mL Mixing frequency: stagnant Temperature: 30°C Substrate quantity: 5 g Carbon source: 1% (w/v) lactose Nitrogen source: 1% (w/v) malt extract Mineral salt: Not added
A. terreus ATCC Rice straw Particle size: 1.4 to 2 mm 8 0.157 Mohammad 74135 Moisture content: 50% Faseleh et al., 2012 pH: 6.0 Inoculum size: 107 spore/mL Mixing frequency: stagnant Temperature: 25°C
137
Substrate quantity: 20 g Carbon source: Not added Nitrogen source: Not added Mineral salt: Not added
138
5.4 Conclusion
This current study has found dichloromethane as the best lovastatin extractor liquid compared to other solvents. In regards of parameter improvement, it was highlighted a few of robust solution in developing the hypercholesterol inhibitor, lovastatin, in our local rice bran and brown rice using F. pseudocircinatum IBRL
B3-4. This statement was a reflect to the maximal lovastatin production after 12 days fermentation time. A yield comparison between before and after parameters improvement did induce to 1770.00 ± 60.00 µg lovastatin/g dry solid which represented the final compound concentration in a flask system. In order to gain such production, a few of optimum conditions were required namely original substrate size (1:1 ratio), 70% (v/w) moisture content, incubation at 30 ± 2°C, 1 x
105 spore/mL, pH 6.5, 5 g of substrate quantity, static flask condition, 1.5% (w/w) sucrose as carbon source, 1% (w/w) yeast extract as nitrogen source and 0.5% (w/w) calcium chloride as additional minerals. Those results exhibited suitability of using economical and accessible rice bran and unprocessed brown rice in Malaysia. A continuous use of these substrates allows efficiency in solid-waste management mostly rice bran. A success in a flask system had inspired for the next study of lovastatin production in a larger scale condition, a tray system.
139
CHAPTER 6
LOVASTATIN PRODUCTION BY F. pseudocircinatum IBRL B3-4 IN A
LABORATORY SCALE UP SYSTEM AND PURIFICATION OF
LOVASTATIN PRODUCED UNDER SSF
6.1 Introduction
Secondary metabolites are compounds with complex chemical structures which can be generated by certain strain of microorganism and even plants.
Apparently, in secondary metabolism, two important phase are emphasized i.e. trophophase and its later phase, idiophase. The secondary metabolites are actively synthesized during idiophase not in trophophase (rapid growth phase). However, the success of idiophase depends on the trophophase. The last two decades became a
‘golden era’ for new discovery of secondary metabolites. These findings bombard the industrial fields including cosmetics, pharmaceuticals, agriculture, food and farming (Barrios-González et al., 2003). Most of microorganism, fungi are the most applicable kingdom due to its capability in generating various metabolites (Shu,
2007). The fungi can potentially drive four major metabolic pathways which branch off from primary metabolism namely the shikimic acid, amino acids, polysaccharide and derived from acetyl Co-A (e.g. mevalonic acid and polyketide) (Barrios-
González et al., 2003).
Lovastatin is derived from polyketide pathway (Shu, 2007) and a lot of previous studies on this hypercholesterol antidote which held under SSF, were conquered by flask system (Szakacs et al., 1998; Hamidi-Esfahani et al., 2004;
140
Panda et al., 2009; Subhagar et al., 2009; Pansuriya and Singhal, 2010; Reddy et al.,
2011; Mohammad Faseleh et al., 2012) compared to scale up system. Flask system is a simple bench scale bioreactor which promises less contamination and also minimum effort in aeration and agitation issue which has made it distinguishable to a bigger bioreactor. In SSF, tray bioreactor is the simplest and may also consider as the cheapest technology. It has been occupied for many centuries mostly in making tempe and koji. It comes in many variations such as (1) small likes an incubator or spacious enough for a few people to access, (2) fabricated of different materials including bamboo, wood, plastic (plastic bag also included) or wire, (3) perforated or imperforated sides and bottom and also (4) water-cooled heat exchange surfaces may be fixed. However, when it comes to SSF stage, an important phenomenon of heat removal must be put into consideration. The event concurrently exists in a bed of solid substrate due to the metabolic heat production and it is very difficult to be demolished. This phenomenon commonly occurs within the substrate bed. Other than that, the phenomenon within the headspace (involve the gases flow transversely across the bed surface) and also bioreactor wall (heat transfer across wall or towards cooler region) may also provoke during solid fermentation (Mitchell et al., 2006).
The purity percentage in drug is a vital factor for manufacturing of safe and effectual pharmaceuticals. Generally, in fermentation, the recovery of drug can be obtained from either solvent extraction or via chromatographic method. Both of these procedures offer different advantages. The solvent extraction procedure is renowned for the easiness and fast purification while for chromatographic procedure offers a vary method and better purification quality (Ahmad et al., 2009).
Thus in the present study, the focus is stayed on the effect of physical parameters in a tray system and also purification of lovastatin via chromatographic
141 methods namely open column, preparative TLC and HPLC. Purification process requested a high concentration of compound and in reflects to this condition, the productivity from tray system was applied into the procedure.
6.2 Materials and Methods
6.2.1 Preparations of microorganism and inoculum
The spore suspension was adjusted to 1 x 105 spore/mL in accordance to serial dilution and direct counting on haemocytometer (Refer to Section 3.1.3).
6.2.2 Basal composition of SSF in a tray system
All of the optimized physical (original substrate size under ratio of 1:1, 70% (v/w) moisture content, incubation at 30 ± 2°C, 1 x 105 spore/mL, pH 6.5 and static condition) and chemical (1.5% (w/w) sucrose, 1% (w/w) yeast extract and 0.5%
(w/w) calcium chloride) parameters from a flask system were applied into a tray system (except for substrate quantity). It is reflected to the statement of Ibrahim
(1994) saying that an up scaling process involves informations transfer from a shake flask system to a higher level scheme through laboratory or tank bioreactors. For that purpose, metallic tray size of 20 x 20 x 6 cm3 was used. In a tray system, only physical parameters were optimized.
142
6.2.3 Parameter improvement process in a tray system
Same as the flask system, physical parameters must put under critical evaluation in tray system. It was proven that heat production within the solid bed is the major problem in scale up system. The test of this study was initiated with time course profile of substrate thickness and followed by other physical test i.e. substrate size, moisture content, temperature, inoculum size, pH and mixing frequency. There are many types of SSF bioreactors and all their performances are diverse (Mitchell et al., 2006). All of the physical parameters from flask system need to be reinvestigated in the tray system as there is no first-degree estimation (such as
Response Surface Methodology or Plackett-Burmann designs) applied. However, the applications of these designs are adequate to verify which explanatory variables have an impact on the response variable of interest (Panda et al., 2010; Pansuriya and Singhal, 2010).
6.2.3.1 Profiles of growth and lovastatin production before improvement
The initial profiles for tray system were done on different substrate thicknesses. Four thicknesses specifically 0.25, 0.5, 1 and 1.5 cm were set up in 20 x 20 x 6 cm3 tray.
Each thicknesses corresponded to 50, 100, 150 and 200 g, respectively (Xu et al.,
2005; Wei et al., 2007; Rizna et al., 2011; Kumar et al., 2014). The substrates combination (rice bran and brown rice, 1:1 ratio) were placed into the tray container and covered with aluminium foil. Then, the aluminium edge was sealed using masking tape to avoid water entrance into the tray during autoclave process. All of the optimized parameters from the flask system were applied into this recent study.
The substrates and solution were separately autoclaved under temperature of 121°C
143 for 15 minutes. Then, 20% (v/w) spore suspension was inoculated into the sterile solid substrate medium. It was followed by the addition of all nutrients elements, prior to mixing progress. The trays were incubated at ambient temperature of 30 ±
2°C for 16 days with 2 days interval for sampling.
6.2.3.2 Effect of substrate size
Using the optimum fermentation period, the effect of substrate size on lovastatin production in tray system was investigated. The sizes of substrate tested were 0.1, 1,
3, 6 and original condition (≈ 8.0 mm). Szakacs et al. (1998), Valera et al. (2005),
Wei et al. (2007), Pansuriya and Singhal (2010), Mohammad Faseleh et al. (2012),
Prabhakar et al. (2012) and Kumar et al. (2014) suggested the best substrate size for lovastatin production ranged from 0.3 mm to 20 mm.
6.2.3.3 Effect of moisture content
The influence of initial moisture content on lovastatin production was studied as this factor is critically vital in SSF. Five different moisture contents were examined ranging from 50 to 90% (v/w). Valera et al. (2005), Subhagar et al. (2009),
Pansuriya and Singhal (2010), Mohammad Faseleh et al. (2012) and Kumar et al.
(2014) have recommended moisture content for lovastatin production ranged from
40 to 70% (v/w).
144
6.2.3.4 Effect of incubation temperature
This method was based on Lingappa and Vivek Babu (200), Valera et al. (2005),
Panda et al. (2009), Subhagar et al. (2009), Pansuriya and Singhal (2010),
Mohammad Faseleh et al. (2012) and Kumar et al. (2014). To determine the best surrounding temperature for lovastatin production, temperatures of 25, 30 ± 2, 35 and 40°C were tested. The compound activity was analyzed after 12 days fermentation period.
6.2.3.5 Effect of inoculum size
A vary inoculum densities ranging from 1 x 104 to 1 x 108 spore/mL were separately investigated in tray system. The optimum inoculum size was applied into the next parameter namely pH. The best range suggested by Szakacs et al. (1998), Wei et al.
(2007), Ahmad et al. (2009) and Kumar et al. (2014) was 103 to 108 spore/ mL.
6.2.3.6 Effect of initial pH
The initial pH varying from 4 to 8 was used to study its effect towards lovastatin productivity. The pH adjustment was done using 1 M HCl and 1 M NaOH and it was set up prior to autoclave. The best range for lovastatin production was from pH
5 to 6.5 (Wei et al., 2007; Panda et al., 2009; Pansuriya and Singhal, 2010; Latha et al., 2012; Kumar et al., 2014).
145
6.2.3.7 Effect of mixing frequency
The mixing frequency has a close relationship with aeration. Thus, it is important to study this parameter. The effect of static condition and mixing frequencies for every
12 hours, every 24 hours and every 48 hours were investigated in tray system. Their effect towards lovastatin and fungal growth were observed after 12 days incubation period at ambient temperature of 30 ± 2°C. Stagnant was the best condition reported by Szakacs et al. (1998), Wei et al. (2007), Subhagar et al. (2009), Pansuriya and
Singhal (2010), Prabhakar et al. (2012) and Kumar et al. (2014).
6.2.3.8 Time course profile after physical parameters improvement
All of the optimized conditions from previous studies were applied into final profile.
F. pseudocircinatum IBRL B3-4 required 0.5 cm substrate thickness (100 g), original substrate size, 60% (v/w) moisture content, incubation temperature of 30 ±
2°C, 1 x 105 spore/mL inoculum size, pH 6.5 and static condition to generate the maximum production of lovastatin and fungal growth. The final profile was carried out for 16 days with 2 days interval reserved for sampling.
6.2.4 Purification of lovastatin via chromatographic procedure
6.2.4.1 Open column chromatography
6.2.4.1(a) Sample preparation
Methods of Samiee et al. (2003), Ahmad et al. (2009), Farhan (2010) and Raghunath et al. (2012) were used to conduct the purification of lovastatin in SSF system. A
146 total of 1000 mL of unlactonized crude extract (obtained from the section 4.2.4.1) was concentrated using rotary evaporator (Laborota 4000, Heidolph, Germany) at
38°C. The volume was left to decrease to almost 10 mL prior to drying procedure in the fume hood. Then, a crude stock of 10 mg/mL concentration was prepared by diluting the sample ‘paste’ in dichloromethane before loading into the column.
6.2.4.1(b) Column packing
Forty gram of silica gel 60-120 mesh (Fisher, USA) was added with 80 mL of dichloromethane and packed into a glass column size of 2 cm x 45 cm. It was left for
24 hours to ensure there was no bubble existence which can contribute to gel crack and also to gain a fully packed silica gel.
6.2.4.1(c) Sample loading and fraction collection
A total volume of 0.5 mL of concentrated crude sample (10 mg/mL) was carefully loaded onto the surface of silica gel in the column and was left to absorb into the silica. The elution in the column was executed in a stepwise manner starting with
100% dichloromethane. Then, the polarity of mobile phase was steadily changed with ethyl acetate in dichloromethane up to 100% of ethyl acetate. The ratios manner of dichloromethane-ethyl acetate was 10: 0, 9:1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7,
2:8, 1:9 and 0:10. Each chromatographic fraction (70 mL) collected with different polarities and it was concentrated under vacuum using rotary evaporator until ≈ 10 mL. The sample was further lactonized with 1% (v/v) TFA and again it was
147 subjected into rotary evaporator. The concentrated sample was mixed with acetonitrile and filtered through 0.45 µm filter prior to HPLC injection.
The fractions which consisted lovastatin activity were pooled and concentrated under reduced pressure using rotary evaporator to a viscous mass. A volume of acetonitrile was mixed to it dropwise until it was dissolved. Then, further test will be done via HPLC to detect lovastatin peak obtained from different column fractions.
The detected lovastatin peak was next applied onto preparative TLC plate for better spot separation.
6.2.4.2 Preparative thin layer chromatography
The concentrated pooled fraction (1 mg/mL) was further analyzed by preparative
TLC (Analtech TLC Uniplate™ Silica gel G 500 µm, Sigma-Aldrich, USA). Firstly, the plate was marked with a pencil for the starting point and finishing line. Then, at least 100 µl of the pooled sample was dotted onto TLC plate and immediately dried by a hair dryer. A flat-bottomed container was used to pour the running solvent system i.e. 70:30 (v/v) of dichloromethane and ethyl acetate (Samiee et al., 2003).
After arriving at the finish line, the plate was left at room temperature for drying before been exposed to iodine vapour. The spots were further verified via hand-held
UV lamp under a short wavelength (254 nm). Lovastatin spot was compared to the lovastatin standard. The validated spot of lovastatin was scrapped off until it reached
1 g weight. This powder was analyzed via final chromatography namely HPLC.
148
6.2.4.3High performance liquid chromatography
The scratched powder was dissolved in 1 mL acetonitrile and centrifuged at 8000 g for 10 minutes. It was further analyzed through HPLC (which was equipped with
Waters UV detector) at 238 wavelength and the appeared peak was compared to the authentic standard peak to confirm its purity.
6.2.5 Analysis
6.2.5.1 Extraction of lovastatin
Refer to Section 3.2.1
6.2.5.2 Lovastatin estimation
Refer to Section 3.2.2
6.2.5.3 Fungal growth determination
Refer to Section 3.2.3
6.2.5.4 Statistical analysis
Refer to Section 3.2.4
149
6.3 Results and Discussion
6.3.1 Parameter improvement process in a tray system
6.3.1.1 Time course profiles before physical parameters improvement
Mathematical modeling, substrate susceptibility and morphology of fungus, temperature, solid substrate size and void fraction within matrices, substrate quantity and substrate thickness are some several factors that need to be considered in large scale bioreactor (Bhargav et al., 2008). Performance in tray bioreactor is limited due to mass transfer and heat activity. Within substrate height above of 40 mm, it can develop extra internal temperature and also gas concentration (Pandey, 2004). Thus, it is practical to apply the substrate thickness in the initial profiles before physical parameters improvement.
In Figure 6.1, the best substrate quantity was shown in 100 g weight (0.5 cm thickness) and then it was followed by 150 g, 200 g, and 50 g. During substrate quantity of 100 g (Figure 6.1 B), lovastatin existence was observed only after 96 hours fermentation period. The activity was dynamically boosting until the optimum day at day 12th. It successfully formed 1135.00 ± 6.67 µg lovastatin/g dry solid (1.07
± 0.03 mg glucosamine/g substrate). The activity was slightly decreasing within the fermentation period extension. Fungal growth did not show any correlation pattern with the lovastatin activity. The aforementioned result was proven as the highest growth was depicted at day 8th with 2.20 ± 0.05 mg glucosamine/g substrate.
150
The solid thickness can prolong the optimum day for lovastatin formation. It was happened during the employment of 150 g and 200 g. Those quantities have displayed the 14th day of incubation period as the best day for lovastatin production.
Each of these quantities managed to generate 778.33 ± 24.44 µg lovastatin/g dry solid (Figure 6.1 C) and 210.00 ± 13.33 µg lovastatin/g dry solid (Figure 6.1 D), respectively. Meanwhile, the most thin-layered substrate, 50 g, has provided 190.00
± 20.00 µg lovastatin/g dry solid (Figure 6.1 A) of lovastatin activity on day 12th. In regard of fungal growth, the configurations in Figure 6.1 B to 6.1 D indicated the same result as Figure 6.1 A. They performed no correlation relationship between F. pseudocircinatum IBRL B3-4 growth and lovastatin productivity.
The moist substrate porosity, the bed thickness and perforations in the culture vessel are known to considerably influence the performance of SSF (Lonsane et al., 1992).
F. pseudocircinatum IBRL B3-4 is a eukaryotic microorganism which happens to live in a saprophytic lifestyle to fulfill its need for organic nutrients. It is a carbon- hetetotrophic filamentous fungus that has its own hyphal tip to invade the solid matrices and accesses the nutrients. According to Lew (2011), an internal hydrostatic pressure (turgor) of hyphae is responsible to drive a major force for the cell expansion and also mechanical supports. However, an aerobic microorganism depends on oxygen availability to expand its growth. In a static bed, the most concentrated oxygen is supplied near the surface area. As the bed height increasing, the oxygen supply at the bottom area will be slowly depleted. Thus, the microorganism cannot penetrate its hyphae into that area. It has been proven by
Ragheva Rao et al. (1993) via their mathematical model study. Initially, there was a uniform distribution of oxygen (atmosphere) throughout the bed. But when the
151
250 2.5 1200 2.5 200 2 900 2 150 1.5 1.5 600 100 1 1 50 0.5 300 0.5
0 0 0 0 Fungal growth (mg/g) growth Fungal
0 2 4 6 8 10 12 14 16 (mg/g) growth Fungal 0 2 4 6 8 10 12 14 16
Lovastatin yield (µg/g) yield Lovastatin (µg/g) yield Lovastatin Incubation period (Day) Incubation period (Day)
Lovastatin yield Fungal growth Lovastatin yield Fungal growth
1000 2.5 250 2.5 800 2 200 2 600 1.5 150 1.5 400 1 100 1 200 0.5 50 0.5
0 0 0 0 Fungal growth (mg/g) growth Fungal
0 2 4 6 8 10 12 14 16 (mg/g) growth Fungal 0 2 4 6 8 10 12 14 16
Lovastatin yield (µg/g) yield Lovastatin (µg/g) yield Lovastatin Incubation period (Day) Incubation period (Day)
Lovastatin yield Fungal growth Lovastatin yield Fungal growth
A B Figure 6.1: Effect of substrate quantity in a tray system. (A) represents 50 g, (B) equal to 100 g, (C) displays 150 g result and (D) is 200 g substrate quantity
152 fermentation is under progress, microorganism consumes the oxygen and allows a built up of concentration gradient in a tray system. Due to this event, the interior oxygen in the bed can drop to a very low value or even zero mostly at the bottom of the bed. Those incidents were exactly may happen in the substrate quantities of 150 g and 200 g.
Another factor that reinforced this present study was the problem of mass and heat transfer which commonly occurred in bioreactors. One of the tray system characteristics is its spacious compartment to load few centimeters depth of substrate thin layer. However, the depth has its own limit due to mass and heat transfer phenomena which may obstruct the desired product and biomass formation. There are a few heat phenomena that need to be considered in static substrate bed namely heat production, conduction, diffusion and transfer (Mitchell et al., 2006).
Rajagopalan and Modak (1995) modeled the heat and mass transfer in static tray bioreactor. The resultants displayed a growth limitation due to the simultaneous effect from heat and mass transfer. Furthermore, the height increment has welcomed an overheating problem and directly inhibited the desired product formation. In addition, solid substrate is a poor conductor and allows only a thin layer of substrate to undergo fermentation process (Suryanarayan, 2003). As a result, the application of 100 g was the most ideal quantity to balance all of the aforementioned phenomena in tray system size of 20 x 20 x 6 cm3.
Due to the heat and mass transfer problems, a very limited report available on lovastatin production via scale up system (mostly in SSF). Valera et al. (2005) and
153
Kumar et al. (2014) were among few researchers which investigated this statin production in bioreactors. Valera et al. (2005) have found out that 200 g substrate was the best quantity for their investigated bioreactor. As for Kumar et al. (2014), the development of packed-bed bioreactors of 7 L and 1200 L managed to fit 300 g and 50 kg of substrate, respectively. A few researchers reported the importance of substrate thickness or quantity in scale up system towards other secondary metabolites. Using tray system size of 55 x 45 x 5 cm3, Sekar and Balaraman (1998) successfully generated 1.95 g/kg and 1.18 g/kg cyclosporin A at 1 cm and 2 cm of thicknesses, respectively. In their accordance, the unperforated tray was slightly produced better cyclosporin A (1.95 g/kg) than perforated tray (1.88 g/kg).
Furthermore, they inspected the effect of other physical parameters including humidity and also inoculum size towards cyclosporin A production.
6.3.1.1(a) Effect of substrate sizes
To summarize the issue concerning the effect of substrate sizes on lovastatin production by F. pseudocircinatum IBRL B3-4 in tray system, an approach was done towards the substrate sizes. A range of 0.1 mm to the original size has depicted the best lovastatin production specifically at 1171.67 ± 55.56 µg lovastatin/g dry solid (fungal growth of 1.57 ± 0.06 mg glucosamine/g substrate). This activity was eloquently achieved during the original size application in the tray system (p <
0.05). Other sizes caused detrimental effect on this anticholesterol agent. As given in
Figure 6.2, the size of 6, 3, 0.1 and 1 mm in accordingly displayed 163.33 ± 27.78
µg lovastatin/g dry solid (fungal growth of 1.80 ± 0.12 mg glucosamine/g substrate),
108.33 ± 5.56 µg lovastatin/g dry solid (fungal growth of 1.59 ± 0.04 mg
154
1500 2.5
2 1000 1.5
1 500
0.5
Fungal growth (mg/g) growth Fungal Lovastatin yield (µg/g) yield Lovastatin 0 0 0.1 1 3 6 Original size Substrate size (mm)
Lovastatin yield Fungal growth
Figure 6.2: Effect of substrate size in a tray system on lovastatin production
glucosamine/g substrate), 66.67 ± 22.22 µg lovastatin/g dry solid (fungal growth of
1.42 ± 0.06 mg glucosamine/g substrate) and 53.33 ± 4.44 µg lovastatin/g dry solid
(fungal growth of 1.27 ± 0.05 mg glucosamine/g substrate).
Valera et al. (2005) and Kumar et al. (2009) were among the researchers who examined the particle size in the scale up system. According to them, particle size of
0.3 to 0.5 mm was the best option for fungal growth and lovastatin production.
However, a report which was prepared by Mahanama et al. (2012) gave a broader range of particle size in producing secondary metabolite such as vitamin K2. They suggested that the most suitable size for soy granule (substrate) was from 1 to 1.4 mm. After 8 days of incubation period, an amount of 106.4 mg/kg vitamin K2 was formed. Generally, particle size is one of the physical parameter that can affect the microbial extension and colonization, air penetration, carbon dioxide deletion and
155 downstream extraction (Manpreet et al., 2005). It also has been emphasized by
Pandey et al. (1999) that oxygen utilization depends on this parameter. Furthermore, the optimum substrate size is crucial due to its compromise between nutrients accessibility and oxygen availability. Thus, common range for ideal particle sizes applied in SSF is from 1 mm to 1 cm (Manpreet et al., 2005). However, a too small substrate size may obstruct with microbial respiration which may lead into poor microbial growth (Pandey et al., 1999). These conditions were caused by formation of paste substrate due to agglomeration event happened during small particle size application. In this experiment, an undefined size of rice bran was balanced with the brown rice size adjustment. It has been told that the use of bigger particle size can provide a restricted surface area for fungal attack (Pandey et al., 1999). It suited to suggestion of Manpreet et al. (2005) to let the selected substrate meeting the physical treatment such as chopping, grinding or cracking the substrate in order to obtain a better accessible surface for fungi. The geometry alteration of substrate also offers different water-binding capacity which is another advantage for moisture lock in SSF system.
The particle size can also manipulate the packing within the bed and consequently the aeration of the bed (Mitchell et al., 2006). The combination of rice bran and brown rice has created different void fraction or porosity which allows air to across the bed compared to small particles alone. The air can also choose to follow another route in the bed which commonly provided by larger particle sizes. This event is known as channeling phenomena (Mitchell et al., 2006). Thus, the mixture of undefined size and original size of brown rice was the most suitable condition to permit those events and formed the maximal formation of lovastatin.
156
6.3.1.1(b) Effect of moisture content
In term of SSF, water is a scarce element that exists within the solid substrate or as a thin layer in the capillary region of solid or its surface (Gervais and Molin, 2003), depends on water holding capacity of the solid matrix and microorganism used.
Figure 6.3 exhibited the 60% (v/w) moisture content as the optimal condition for lovastatin production (p < 0.05). It demonstrated 2271.67 ± 14.44 µg lovastatin/g dry solid with 2.28 ± 0.03 mg glucosamine/g substrate fungal growth. Consequently, the moisture percentage of 70% (v/w) designated 1610.00 ± 73.33 µg lovastatin/g dry solid lovastatin activity and fungal growth of 1.57 ± 0.06 mg glucosamine/g substrate. It was followed by 80% (v/w), 90% (v/w) and the lowest production was traced under moisture level of 50% (v/w). These moisture percentages in accordingly generated 1065.00 ± 33.33 µg lovastatin/g dry solid (fungal growth of
0.85 ± 0.03 mg glucosamine/g substrate), 723.33 ± 15.56 µg lovastatin/g dry solid
(fungal growth of 0.71 ± 0.02 mg glucosamine/g substrate) and 468.33 ± 64.44 µg lovastatin/g dry solid (fungal growth of 1.32 ± 0.03 mg glucosamine/g substrate).
The moisture percentage of 60% (v/w) not only indicates the highest lovastatin productivity but also the highest fungal growth than others.
The outcome was in agreement with Raimbault (1998) and Pandey (2003). Both of them stated that the moisture content has a marked effect on uniformity of fungal growth which including spore formation and germination. Furthermore, the water stress event can also affecting the hyphal extension which predominantly caused by the turgor pressure presents in its tip. The pressure dynamic and volume changes are maintained via the water flow rate into or out of the cell (Lew, 2011). In this
157
4000 2.5 3200 2 2400 1.5 1600 1
800 0.5 Fungal growth (mg/g) growth Fungal Lovastatin yield (ug/g) yield Lovastatin 0 0 50 60 70 80 90 Moisture content (%; v/w)
Lovastatin yield Fungal growth
Figure 6.3: Effect of moisture content on lovastatin production by F. pseudocircinatum IBRL B3-4 in tray system
experiment, the tray system depicted a contra result compared to flask system (70%; v/w moisture content). Water level in SSF may change due to evaporation and biological microbial activity. Thus, water was suggested to be added intermittently via humidificator or water saturated air flow (Pérez-Guerra et al., 2003) in order to avoid dryness and heat production. Since the air was not supplied forcefully in the trays, no extra solution added and no temperature gradient control was done to overcome the produced heat within the solid matrix, the tray system of this experiment was depended on intra- and inter-particle heat transfer and also transfer process of substrate surface to gas phase. According to Mitchell et al. (2006), heat can also be removed to the surrounding via bioreactors wall. The combination of
100 g substrate with 60% (v/w) moisture content was adequate to remove the produced heat and forming superior lovastatin and also fungal growth activities. In general, the lack of free water would hinder the nutrients diffusion, gases exchange problem, imperfect functional properties of enzymes and imbalance on the metabolic
158 chain of the cells. However, the extra water content can disturb the transport event at cellular and macroscopical levels (Sermanni and Tiso, 2008). As being contemplated by Bhargav et al. (2008), low moisture surrounding combined with poor thermal substrate conductivity may allow a difficulty in heat transfer and temperature control. This event might happen during the application of 50% (v/w) moisture content. It is very complicated to dissipate the heat in static tray system other than supplementation of adequate air (aeration) or intermittent water addition.
Under moisture content of 60 to 65% (v/w), a total of 13.49 mg/g, 2.13 mg/g (1200
L fermenter) and 2.74 mg/g lovastatin (700 L) was produced in scale up system
(Valera et al., 2005; Kumar et al., 2014) which was compatible with the result of this recent experiment (optimum moisture of 60%). On the other hand, for other secondary metabolites such as cyclosporin A (antibiotic) and mycophenolic acid
(antibiotic, antifungal and antiviral agents), the optimum moisture content or humidity in tray system and packed-bed bioreactors were 95% and 70%, respectively (Sekar and Balaram; Alani et al., 2009).
6.3.1.1(c) Effect of temperature
Monitoring and controlling temperature and humidity are critical during scaling up
(Bellon-Maurel et al., 2003). A temperature range of 25 to 35°C has been found suitable for the production of lovastatin under SSF (Lingappa and Babu, 2005;
Pansuriya and Singhal, 2010; Mohammed Faseleh et al., 2012). Temperature is closely related to water activity (Aw) and aeration, thus, any changes in these
159 variables can significantly affect spores germination (Gervais and Molin, 2003;
Kumar and Kanwar, 2012). The recent study investigated temperature influential on lovastatin activity and F. pseudocircinatum IBRL B3-4 growth under 25 to 40°C.
In response to the aforesaid information, the production of lovastatin was superior around temperature of 25 to 35°C. However, the best achievement was significantly at 30 ± 2°C surrounding (p < 0.05). It has formed 2298.33 ± 8.89 µg lovastatin/g dry solid and also impregnated the highest fungal growth compared to other temperatures (2.67 ± 0.09 mg lovastatin/g substrate). The productivity also signified good levels at 25°C and 35°C. Both of the temperatures exhibited 1716.00 ± 17.78
µg lovastatin/g dry solid (fungal growth of 1.19 ± 0.04 mg lovastatin/g substrate) and 1598.33 ± 61.11 µg lovastatin/g dry solid (fungal growth of 1.34 ± 0.04 mg lovastatin/g substrate), respectively. The temperature of 40°C conversely inhibited the lovastatin production to 75.00 ± 13.33 µg lovastatin/g dry solid even though the fungal growth was moderately high (1.64 ± 0.04 mg lovastatin/g substrate). This recent result showed that F. pseudocircinatum IBRL B3-4 can stand at an extreme temperature of 40°C (Figure 6.4).
Hesseltine (1972) explored that the fungal spores formation will be hindered if it is exposed to the temperature of lower than 25°C or higher than 45°C. In respect,
Prabhakar et al. (2012) has tested A. terreus growth on solid medium and they also found out that the medium dried fast during high temperature (40 to 45°C) but the spores development were retarded only after 40°C. The main key for these incidents is heat transfer. According to Raghava Rao et al. (2003), the heat dissipation agenda
160
3
2400 2.5 2
1600 1.5
1 800
0.5
Fungal growth (mg/g) growth Fungal Lovastatin yield (µg/g) yield Lovastatin 0 0 25 30±2 35 40 Temperature (°C)
Lovastatin yield Fungal growth Figure 6.4: Effect of temperature towards lovastatin production in tray system can be restricted by inter- and intra-particle resistances and is more complex to control since there is inadequate sensors and efficiency in solid handling.
Furthermore, the quick accumulate of metabolic heat from microbial activity, substrate bed shrinkage and detrimental void fraction, can further oppressing heat transfer (Chen et al., 2005). A few evidences were contemplated in regard of the temperature or heat augmentation within the static substrate bed in a tray system.
Ikasari and Mitchell (1998) have detected a temperature increment to 50°C at only 5 cm substrate depth within 37°C incubator. On the other hand, Gutiérrez-Rojas et al.
(1996) has stated that the gradient of a static bioreactor can become steep to 3.1°C per cm of substrate bed thickness which accumulated the total temperature into extreme condition, 48°C.
In scale up system, the recommendation temperature for secondary metabolites ranging from 24°C to 30°C (Sekar and Balaram, 1998; Valera et al., 2005; Alani et
161 al., 2009; Kumar et al., 2014). However, based on Valera et al. (2005) and Kumar et al. (2014), the best temperature for lovastatin production was 30°C.
6.3.1.1(d) Effect of inoculum size
The use of spores for inoculum holds greater advantages rather than vegetative cells.
It promises better accessibility, flexibility during inoculum preparation, longer storability for consequent use and superior resistance to mishandling during transfer
(Gowthaman et al., 2001; Krishna and Nokes, 2001). The effect of inoculum sizes in a range of 1 x 104 to 1 x 108 spore/mL was displayed in Figure 6.5. Size of 1 x 105 spore/mL showed the highest lovastatin formation. However, this concentration did not display a significant difference to the result of 1 x 106 spore/mL (p > 0.05). Each of these concentrations managed to form 2308.33 ± 28.89 µg lovastatin/g dry solid and 2276.67 ± 37.78 µg lovastatin/g dry solid, respectively. Furthermore, the highest fungal growth was 2.28 ± 0.03 mg glucosamine/g substrate which detected during inoculum concentration of 1 x 105 spore/mL. While under 1 x 106 spore/mL concentration, the fungal growth production was slightly lower (1.56 ± 0.09 mg glucosamine/g substrate). The lovastatin productivity was followed by other sizes namely 1 x 107 (2021.67 ± 24.44 µg lovastatin/g dry solid), 1 x 108 (925.00 ± 16.67
µg lovastatin/g dry solid) and 1 x 104 spore/mL (915.00 ± 56.67 µg lovastatin/g dry solid). During fungal growth estimation, inoculum size of 1 x 104 spore/mL did induce a good growth activity specifically at 2.06 ± 0.06 mg glucosamine/g substrate. Then, other activities were also averagely detected at 1.71 ± 0.06 mg glucosamine/g substrate (1 x 107 spore/mL) and 1.48 ± 0.03 mg glucosamine/g substrate (1 x 108 spore/mL).
162
2500 2.5
2000 2
1500 1.5
1000 1
500 0.5
Fungal growth (mg/g) growth Fungal Lovastatin yield (µg/g) yield Lovastatin 0 0 1x10⁴ 1x10⁵ 1x10⁶ 1x10⁷ 1x10⁸ Inoculum size
Lovastatin yield Fungal growth
Figure 6.5: Effect of inoculum size on lovastatin production in a tray system
The uniformity of F. pseudocircinatum IBRL mycelia throughout the solid substrate was the main key in this recent study. Spore germination is responsible to provoke mycelia formation and its accumulation has built in a 3-dimensional net with pores in between. The pores commonly are filled either with water or air. The work outcomes of Nandakumar et al. (1996) and Thibault et al. (2000) have proven that the mycelial layer existed as submerged biofilm in SSF. In reflect, the water element has dragged together the moisture content and temperature role in spore development. It is important to balance these two variables sequentially to allow a better hyphal extension. The spore inoculation commences with lag phase that allows the cells to adapt with a new environment. At this phase, the application of lower inoculum size will prolong the multiplication process and influence sufficient number for substrate utilization and product formation. On the other hand, the increasing of spore number may guarantee a fast-track proliferation and biomass production (Ramachandran et al., 2004). In this experiment, inoculum size of 1 x 105
163 spore/mL was selected to proceed into the next parameter due to its higher production than 1 x 106 spore/mL concentration. The use of optimum inoculum size and a well balance within ambient temperature of 30 ± 2°C and 60% (v/w) moisture content, have successfully forced F. pseudocircinatum IBRL B3-4 to generate the maximal level of lovastatin in this tray system. It has been reported that inoculum size of 107 and 108 spore/mL was the best selection for producing secondary metabolites in tray and packed-bed bioreactors. Size of 108 of A. terreus was the most suitable choice to grow on the wheat bran and generated 2.74 mg/g lovastatin in 700 L bioreactor (Kumar et al., 2014). Sekar and Balaram (1998) and Valera et al.
(2005) also recorded the same optimum size regarding the cyclosporin A and lovastatin production, respectively. Mycophenolic acid denoted the best yield during
107 application (Alani et al., 2009).
6.3.1.1(e) Effect of initial pH
In fermentation, pH is resulted from substrate consumption or production of metabolite and it consistently changes within metabolic activities (Bellon-Maurel et al., 2003). Figure 6.6 exhibited that the initial pH of 5, 6 and 6.5 did not show a significant difference level (p > 0.05). However, compared to other pH i.e. 4,7 and
8, they were significantly differentiable (p < 0.05). The previous optimized pH (6.5) maintain to produce the highest lovastatin activity (2316.67 ± 18.89 µg lovastatin/g dry solid) and due to this productivity, the condition was sustained in the next investigation. The close ‘competitors’ for pH 6.5 were pH 5 and 6. They produced
2091.67 ± 75.56 µg lovastatin/g dry solid and 2308.33 ± 14.44 µg lovastatin/g dry solid, respectively. It was tailed by pH 7 (995.00 ± 60.00 µg lovastatin/g dry solid),
164
2500 2.2
2000 2.1 2 1500 1.9 1000 1.8
500 1.7
Fungal growth (mg/g) growth Fungal Lovastatin yield (µg/g) yield Lovastatin 0 1.6 4 5 6 6.5 7 8 pH
Lovastatin yield Fungal growth Figure 6.6: Effect of pH towards lovastatin production pH 4 (920.00 ± 40.00 µg lovastatin/g dry solid) and finally pH 8 (858.33 ± 78.89 µg lovastatin/g dry solid). The highest fungal growth was displayed in pH 8 (2.17 ±
0.04 mg glucosamine/g substrate) and the growth was vaguely dropped during pH
6.5 condition (2.16 ± 0.04 mg glucosamine/g substrate). Other detected fungal growths were 2.00 ± 0.17 mg glucosamine/g substrate (pH 5), 1.98 ± 0.03 mg glucosamine/g substrate (pH 7), 1.89 ± 0.06 mg glucosamine/g substrate (pH 6) and
1.82 ± 0.03 mg glucosamine/g substrate (pH 4).
pH could provide two great events namely a suitable territory for microorganism and demolishment of competitors among microorganism itself (Sermanni and Tiso,
2003). Gowthaman et al. (2001) have outlined a broad pH range for filamentous fungi. It can stand from pH 2 to 9, however, its optimal growth is within pH 3.8 to
6.0. This evidence has explained the growth of F. pseudocircinatum IBRL B3-4 which was up to pH 8. The pH versatile of filamentous fungi gives an extra
165 advantage in minimizing the bacteria contamination. It commonly can be exploited during lower pH application.
In SSF, it is very complicated to control the pH throughout fermentation process because there is no practically suitable equipment provided. Once, there is a flat- ended electrode to make off-line measurement by placing it at the bottom of solid substrate (Levonen-Munoz and Bone, 1985; Mitchell et al., 1986), yet, it may not be a very precise indicator because of free water lacking problem in SSF (Dunand et al., 1996). Thus, the pH measurement is initially set up during substrate preparation in aqueous suspension or solid sample extract (Chisti, 1999; Raghava Rao et al.,
2003). The best policy to control the pH is by removing the produced heat within the solid matrix. Heat commonly integrates to the metabolic activity that directly influences the pH. The acid or alkali solution spraying may give a better pH control
(Lonsane et al., 1972). However, it may disrupt the fungal growth or desired product formation. According to Sekar and Balaram (1998), Valera et al. (2005), Alani et al.
(2009) and Kumar et al. (2014), secondary metabolites requested pH range of 5 to
6.5 in order to improve the production. The recorded pH was in agreement with this recent experiment (pH 6.5).
6.3.1.1(f) Effect of mixing frequency
Mixing is another important factor in any fermentation process mostly in scale up level. This variable is vital to ensure the biomass and nutrients uniformity in fermented substrate. Some of devices such as horizontal paddle mixer and planetary
166 mixing device have successfully been fabricated and patented for mixing purpose
(Mitchell et al., 1992; Durand et al., 1994). The development of these devices may provide a well equipped bioreactor with better agitation and aeration systems which are built-in mainly for heat removal.
Figure 6.7 denotes a significant lovastatin production in static substrate condition (p
< 0.05). The productivity notably formed 2406.67 ± 135.56 µg lovastatin/g dry solid under fungal growth of 2.29 ± 0.07 mg glucosamine/g substrate. The 48 hours frequency has mitigated the lovastatin production (1138.33 ± 128.89 µg lovastatin/g dry solid) and also fungal growth (2.23 ± 0.08 mg glucosamine/g substrate). Other frequencies namely for every 24 and 12 hours managed to accumulate lower lovastatin production. Each of these gaps in accordingly generated 390.00 ± 33.33
µg lovastatin/g dry solid (fungal growth of 1.83 ± 0.06 mg glucosamine/g substrate) and 240.00 ± 33.33 µg lovastatin/g dry solid (fungal growth of 1.58 ± 0.03 mg glucosamine/g substrate).
Raimbault (1998) reported a solid mass compaction event may happen under static condition which indirectly caused non distribution in growth, gradient of pH, moisture and temperature. On the other hand, Flodman and Noureddini (2013) have inspected an intense hyphal network during static condition which will trap the heat within the solid matrices. However, this process can be disrupted by mechanical mixing. Furthermore, a frequent mixing or agitation progress may result in slow microbial growth and instability formation of desired product (Kalogeris et al.,
2003). In respect of this recent study, the best solution to overcome the overheat production is via substrate bed height minimizing (Bhargav et al., 2008). The
167 occurrence of heat removal in bioreactor can be put into consideration in order to explain the incident happened in static condition. It includes conduction, convection and evaporation process that occur at a few places and stages in bioreactor. Among
3000 2.5
2500 2 2000 1.5 1500 1 1000
500 0.5
Fungal growth (mg/g) growth Fungal Lovastatin yield (µg/g) yield Lovastatin 0 0 0 12 24 48 Mixing frequency (Hour)
Lovastatin yield Fungal growth
Figure 6.7: Effect of mixing frequency on lovastatin production
those processes, conduction is the most dominant mechanism in static bed condition.
Conduction can be occurred within a few phase namely solid bed, headspace gas and even bioreactor wall. In regard of metallic tray, it is common to treat heat elimination from bed to the wall, throughout the wall and from the wall to the ambiance (Mitchell et al., 2006).
6.3.1.2 Time course profile after physical parameters improvement
According to Figure 6.8, the maximal production of lovastatin maintained at day
12th. It coped to form 2436.67 ± 15.56 µg lovastatin/g dry solid with the highest fungal growth detection (2.29 ± 0.07 mg glucosamine/g substrate) at the same day.
168
However, the fungal growth activity was having fluctuate pattern at day 14th and
16th. It is difficult to gain uniformity in fungal growth during scale up level. The fungal biomass depends onto some factors which include temperature, water activity and concentration of oxygen and carbon dioxide. All of the circumstances have forced the growth to increase at different rates in bioreactors (Smits et al., 1999). On the other hand, the same graphic line was displayed in Figure 6.6 for lovastatin production. It boosted throughout 10 days fermentation period before obtaining its maximal production at day 12th and then, it was slowly inhibited during day 14th and
16th.
3000 2.8 2500 2.4 2 2000 1.6 1500 1.2 1000 0.8
500 0.4
Fungal growth (mg/g) growth Fungal Lovastatin yield (µg/g) yield Lovastatin 0 0 0 2 4 6 8 10 12 14 16 Incubation period (Day)
Lovastatin yield Fungal growth
Figure 6.8: Lovastatin production and fungal growth of F. pseudocircinatum IBRL B3-4 in tray system after physical improvement
6.3.2 Comparison of lovastatin production and fungal growth between flask and tray systems
A comparison was done between flask and tray systems and an increment of almost
38% of lovastatin production was detected in Figure 6.9. Both of these systems
169 gained the maximal productivition at the same day specifically at day 12th. In regard of fungal growth, the optimal detection for flask system was at day 10th while for tray system, it parallel within the optimal day of lovastatin production namely day
12th. As mentioned earlier, very restricted information gained for lovastatin production via scale up system under SSF. Based on investigations done by Valera et al. (2005) and Kumar et al. (2014), the bioreactor application with few physical and chemical modifications did produced lovastatin. Valera et al. (2005) used the 21 bioreactor with intermittent stirring and 2 vvm airflow rate to hold a fermentation process of wheat bran and A. flavipes. Under stagnant and aerated bed, an amount of
16.65 mg/g lovastatin was formed in 6 days period. As for Kumar et al. (2014), the 7
L and 1200 L packed bed reactors had successfully generated 2.74 mg/g and 2.13 mg/g lovastatin in 5 days incubation, respectively. However, its productivity did not show a competent value with the flask system. The productivity comparison between flask and scale up system were done in Table 6.1. According to the table, the productivity of these recent findings (flask and tray systems) was higher than
Mohammad Faseleh et al. (2012) (0.020 mg/day). Furthermore, the tray system resultant was almost in line with Panda et al. (2009) (0.244 mg/day).
170
3000 2.5
2500 2 2000 1.5 1500 1 1000
0.5 Fungal growth (mg/g) growth Fungal Lovastatin yield (ug/g) yield Lovastatin 500
0 0 0 2 4 6 8 10 12 14 16 Incubation period (Day)
Lovastatin yield for initial profile Lovastatin yield after improvement Fungal growth for initial profile Fungal growth after improvement
Figure 6.9: A comparison between flask and tray systems on lovastatin production and F. pseudocircinatum IBRL B3-4 growth
171
Table 6.1: Comparison of lovastatin productivity produced via SSF in flask and scale up systems
Filamentous System Substrate SSF conditions Lovastatin Lovastatin References fungi production productivity (mg/g) (mg/day) F. Tray (20 x 20 x Rice bran and Particle size: undefined size of 2.436 0.203 *Current pseudocircinatum 6 cm3) brown rice rice bran and brown rice original experiment IBRL B3-4 size (≈ 8.0 mm) Moisture content: 60% pH: 6.5 Inoculum size: 105 spore/mL Mixing frequency: stagnant Temperature: 30 ± 2°C Substrate quantity: 100 g Carbon source: 1.5% (w/w) sucrose Nitrogen source: 1.0% (w/w) yeast extract Mineral salt: 0.5% (w/w) CaCl2 Optimum day: 12th A. flavipes Intermittent Wheat bran Particle size: 0.3 to 0.5 mm 13.49 2.25 Valera et al., stirring reactor Moisture content: 60% 2005 pH: 5.0 Inoculum size: 108 spore/mL Mixing frequency: stagnant Temperature: 30°C Substrate quantity: 200 g
172
Carbon source: Not added Nitrogen source: Not added Mineral salt: Not added Optimum day: 6th A.terreus PL10 Packed bed Wheat bran Particle size: 0.4-0.5 mm 2.74 0.548 Kumar et al., reactor 7 L Moisture content: 65% 2014 pH: 6.5 Inoculum size: 108 spore/mL Temperature: 30°C Substrate quantity: 300 g Carbon source: Not added Nitrogen source: Not added Mineral salt: Not added Optimum day: 5th A.terreus PL10 Packed bed Wheat straw Particle size: 0.4-0.5 mm wheat 2.13 0.426 Kumar et al., reactor 1200 L and wheat bran bran and 1.5-2.0 cm wheat straw 2014 Moisture content: 65% pH: Not mentioned Inoculum size: 108 spore/mL Temperature: 30°C Substrate quantity: 50000 g Carbon source: Not added Nitrogen source: Not added Mineral salt: Not added Optimum day: 5th A. terreus UV Flask (250 mL) Wheat bran Particle size: 0.35 mm 3.723 1.241 Pansuriya and 1718 Moisture content: 70% Singhal, 2010 pH: 6.0 Inoculum size: 107 spore/mL
173
Mixing frequency: stagnant Temperature: 28°C Substrate quantity: 5 g Carbon source: Not added Nitrogen source: 1% (w/v) peptone Mineral salt: K2HPO4 (2g/L) and MgSO4∙7H2O (0.5 g/L), NaCl (0.5 g/L), MnSO4 (0.5 g/L), ZnSO4∙4H2O (3.4 mg/L), FeSO4∙7H2O (5 mg/L), CoCl2.6H2O (2mg/L) and MnSO4 (1.6 mg/L) Optimum day: 3rd Monascus sp. Flask (250 mL) Angkak rice Particle size: original size 3.420 0.244 Panda et al., Moisture content: 70% 2009 pH: 6.0 Inoculum size: 103 spore/mL Mixing frequency: stagnant Temperature: 30°C Substrate quantity: 20 g Carbon source: Not added Nitrogen source: 14.32 g/L NH4Cl Mineral salt: MgSO4 (0.76 g/L), NaCl (14.65 g/l) and CaCl2 (0.54 g/L) Optimum day: 14th A. fischeri Flask (250 mL) Coconut oil Particle size: Not mentioned 14.77 2.11 Latha et al., cake Moisture content: 60% 2012
174
pH: 5.0 Inoculum size: 107 to 108 spore/mL Mixing frequency: stagnant Temperature: 30°C Substrate quantity: 5 g Carbon source: 1% (w/v) lactose Nitrogen source: 1% (w/v) malt extract Mineral salt: Not added Optimum day: 7th F. Flask (250 mL) Rice bran and Particle size: undefined size of 1.770 0.148 *Current pseudocircinatum brown rice rice bran and brown rice original experiment IBRL B3-4 size (≈ 8.0 mm) Moisture content: 70% pH: 6.5 Inoculum size: 105 spore/mL Mixing frequency: stagnant Temperature: 30 ± 2°C Substrate quantity: 5 g Carbon source: 1.5% (w/w) sucrose Nitrogen source: 1.0% (w/w) yeast extract Mineral salt: 0.5% (w/w) CaCl2 Optimum day: 12th A. terreus ATCC Flask (500 mL) Rice straw Particle size: 1.4 to 2 mm 0.157 0.020 Mohammad 74135 Moisture content: 50% Faseleh et al., pH: 6.0 2012
175
Inoculum size: 107 spore/mL Mixing frequency: stagnant Temperature: 25°C Substrate quantity: 20 g Carbon source: Not added Nitrogen source: Not added Mineral salt: Not added Optimum day: 8th
176
6.3.3 Purification of lovastatin
6.3.3.1 Purification by open column chromatography
An attempt to purify lovastatin from the fermented solid substrate was relatively complex compared to submerged culture. Kumar et al. (2006), Ahmad et al. (2009) and Vardhan et al. (2013) are among researchers who have successfully held purification process upon lovastatin under broth condition. However, for SSF sample, chromatographic purification is the best option. This process can be accomplished by HPLC, displacement chromatography and also overloaded elution chromatography such as silica gel columns and preparative TLC (Ahmad et al.,
2009).
Crude sample was diluted to get a concentration of 10 mg/mL. The crude extract was filtered and purified initially via open chromatography (Plate 6.1). From this column, at least 3 colour layers were shown up. The resultant obtained from Section
3.3.2 has uncovered a colourless characteristic of lovastatin as the spot only appeared on TLC plate after exposing to the iodine vapour. Regardless of the colours, the fractions were collected based on volume quantity (70 mL per fraction).
The fractions were collected based on predetermined ratios of dichloromethane and ethyl acetate mixture i.e. 10: 0, 9:1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, 1:9 and 0:10. Out of the ratios, 7:3 (dichloromethane to ethyl acetate) was the most suitable ratio to elute lovastatin from open column chromatography. Figure 6.10 indicates that lovastatin peak was detected at Rt of 8.0 with a few other unidentified peaks. There was no lovastatin’s peak detected from other ratios and the resultants were attached
177
Red layer
Pink layer Yellow layer
Plate 6.1: Open column chromatography revealed 3 colour layers namely red, pink and yellow
178
9.00
8.50
8.00
mV Lactone - - 8.039 Lactone
7.50
7.00
6.50 1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 Minutes
Figure 6.10: Chromatogram result for ratio of 7:3 (dichloromethane: ethyl acetate)
179 in Appendix 11. Various Rt of lactone lovastatin reported by researchers and it ranged from 3.19 to 21.8 with common wavelength of 235 to 238 nm (Manzoni et al., 1998; Szakacs et al., 1998; Manzoni et al., 1999; Ahmad et al., 2009; Jaivel and
Marimuthu, 2010;Raghunath et al., 2012). The outcome for this recent experiment was in agreement with Raghunath et al. (2012). They managed to start the elution with 100% dichloromethane and then proceed with various ratios of dichloromethane and ethyl acetate. While Ahmad et al. (2009) suggested the combination of acetonitrile, benzene and water during chromatographic purification successfully eluted lovastatin from open column size of 3.5 x 60 cm. Table 6.2 compares the findings of chromatographic purification by Ahmad et al. (2009) and
Raghunath et al. (2012). Theoretically, the concept of column purification is based on polarity. According to Pansuriya and Singhal (2009), lovastatin is a slightly non polar compound and its molecule attracts to higher polar substances compared to non polar. The silica gel itself is polar, thus it can hold the lovastatin and let the less polar substance to flow out from silica gel. In this experiment, the use of less polar solvent (dichloromethane, polarity index equal to 3.1) to dissolve the crude paste during open column chromatography, has allowed lovastatin to bind within the silica gel. Then, a more polar solvent namely ethyl acetate (polarity index equal to 4.4) was added to elute lovastatin from the silica gel. Running solvent ratio of 7:3
(dichloromethane: ethyl acetate) has allowed the aforementioned phenomenon to take place in the open column chromatography.
180
Table 6.2: Comparisons of chromatographic purification
Running solvents Retention time (Rt) Column size (cm) References Acetonitrile- 7.5 3.5 x 60 Ahmad et al. benzene-water (2009) Dichloromethane- 4.7 *Not mentioned Raghunath et ethyl acetate al. (2012) Dichloromethane- 8.0 2 cm x 45 *Current ethyl acetate experiment
6.3.3.2 Purification via TLC and HPLC
Fraction of 7:3 (dichloromethane: ethyl acetate) was collected for further test on preparative TLC as the open column chromatography was not particularly separate the lovastatin compound. According to Gibbons and Gray (1998) the Rf value on
TLC is never beyond than 1. The success of this procedure depends on sorbent
(silica gel) and also the running system used. In this experiment, the Rf value of lovastatin was 0.46 and it demonstrated plain dark spot appearance after been vapourized with iodine (Plate 6.2). For natural product detection, there are two selection can be made either non destructive or destructive. Due to the product recovery, a non destructive method is primarily chosen compared to destructive.
Nonetheless, some invisible spots cannot be detected via non destructive method and at this time the destructive method is the best option. Spray detection is one of the destructive methods which can be applied onto TLC to discover the invisible spots.
Iodine vapour is clustered under non destructive. The use of iodine can facilitate in dark spot formation based on reaction to carbon-carbon double bonds, corresponding to lactone lovastatin molecular structure.
181
Plate 6.2: A view of lovastatin spots on preparative TLC obtained by fraction of 7:3 (dichloromethane: ethyl acetate)
The displayed Rf denoted that lovastatin has higher affinity for sorbent (stationary phase). This incident was in-line with the statement of Pansuriya and Singhal (2009) which they renowned lovastatin as a more polar compound. Generally, a more polar compound will stick to the sorbent and move gradually upward of the plate as the running solvent migrates. Thus, this compound exhibited small Rf value. On the other hand, the non polar compound smoothly migrates within the mobile phase
(running solvent) because of sorbent less affinity factor. The movement results in
182 higher Rf value (Gibbons and Gray, 1998). On preparative TLC, the lovastatin spot was well separated with other unknown compounds and consequently it was collected for purity verification via HPLC.
A recent state-of-the art of HPLC for pure lovastatin quantification has been presented in Figure 6.11. According to the displayed chromatogram, a single peak was appeared at 8.0 minute (Figure 6.11 A) and it overlapped within the standard peak line (Figure 6.11 B). Clearly, purification was achieved as the sample had a single peak at 238 nm wavelength. For further confirmation and better lovastatin purification, Ahmad et al. (2009) and Raghunath et al. (2012) suggested one month incubation at low temperature of 4°C for crystal formation. The insoluble desired compound was washed with petroleum ether to remove the impurities and then analyzed through differential scanning calorimeter (DSC), fourier transform infrared spectroscopy (FTIR) and proton nuclear magnetic resonance (1H NMR). However, these processes require high sample concentration. As given by Ahmad et al. (2009), a total of 737 mg of crude lovastatin is needed to ensure smooth process of lovastatin crystallisation.
The idea of doing open column chromatography, TLC and HPLC for purification was triggered from Farhan (2010). Dealing with pigment purification has forced her to isolate the different colours from fermented sample of Monascus ruber. This fungus is generally regarded as lovastatin producer by Chang et al. (2002), Xu et al.
(2005) and Panda et al. (2010). According to Farhan’s work, the first level of purification process was done through column chromatography (chloroform and
183
8.00 A
6.00 mV
4.00 1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 Minutes
8.00 B 7.00
6.00 mV
5.00
4.00
1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 Minutes
Figure 6.11: Chromatogram of purified lovastatin obtained from preparative TLC (A) and also an overlay of lovastatin standard with purified lovastatin
184 methanol as running solvent) and then proceeded with TLC detection. Purified sample obtained from these chromatographies was further analyzed via scanning UV visible spectrophotometer between 350 to 650 nm wavelengths in order to separate the pigments colour. However, in this recent study, the colourless lovastatin was basicly evaluated through HPLC for more precise result.
6.4 Conclusion
Production of lovastatin by F. pseudocircinatum IBRL B3-4 was studied in stainless metallic tray size of 20 x 20 x 6 cm3. F. pseudocircinatum IBRL B3-4 took 12 days to maximize the lovastatin production in a tray system. The final lovastatin production obtained from this system was 2436.67 ± 15.56 µg lovastatin/g dry solid with 2.29 ± 0.07 mg glucosamine/g substrate. The substrate thickness (0.5 cm or 100 g) and moisture content (60%; v/w) were the only parameters that distinguished tray system from flask system. Other optimal parameters were original substrate size, incubation temperature of 30 ± 2°C, 1 x 105 spore/mL inoculum size, medium adjusted to pH 6.5 and incubated under static condition. Overall, the parametric improvement in a tray system was recognized to improve 38% increment of lovastatin activity than flask system. Ratio of 7:3 (dichloromethane: ethyl acetate) was the eluent to isolate lovastatin from other unknown compound in open column chromatography. During preparative TLC analysis, a confirmation dark spot appeared at Rf of 0.46. Further analysis study of this spot in HPLC has proven a single peak chromatogram at Rt of 8.0 min which was within the lovastatin standard.
185
CHAPTER 7
PRELIMINARY STUDIES OF FRACTIONAL LOVASTATIN ON BRINE
SHRIMP AND LABORATORY RATS
7.1 Introduction
Fusarium sp. is commonly known as a plant-associated fungus which is crowned in establishing chemical diversity (Desjardins, 2006) such as mycotoxins.
This condition has given an extensive challenge for mycotoxicologists to understand the adverse consequence of Fusarium sp. towards the living organisms. Thus, a lot of works deal with toxicology of Fusarium metabolites are meticulously done. Brine shrimp lethality assay is regarded as a useful tool for primary toxicity assessment
(Carballo et al., 2002). The process may happen on the cell surface, within the cell body, at the extracellular matrix or even in the tissues beneath. However, it depends on the interaction between toxicants chemical properties and also cell membrane of the organism. In human, toxic generally initiates to effect the internal organs such as liver and kidney. Thus, the evaluation of any substance toxic properties is vital in order to avoid the adverse effect towards publics (Asante-Duah, 2002).
Research with experimental animals is the most reliable method to detect important properties of statin in controlling the abnormal cholesterol level. As reported by Li et al. (2011), the animal models assist to reveal the pathogenetic steps and causalities of artherosclerosis, one of the hypercholesterol events. In 1908, rabbits were used to trigger the artherosclerosis by feeding them milk and egg yolks.
Ever since, a great number of animal models including chicken, dog, pigeon, swine,
186 non-human primate, cat, mouse and rat, have been studied (Moghadasian et al.,
2001; Moghadasian, 2002). Consequently, there is a sensible disagreement over use of animals for such intentions and it is believed to be some ethical issues or religious opposition to killing even lower organism (Lieberman, 1999). In this recent study, other than the efficiency in converting cholesterol to bile acids (Li et al., 2011), the selection of Sprague Dawley rats also based onto its easy accessibility, less spacious requirement and less effort in handling or caring.
This chapter was carried out to preliminarily study the toxicology of fractional lovastatin towards brine shrimp and its effect as an anticholesterol agent on Sprague Dawley rats.
7.2 Materials and Methods
7.2.1 Mycotoxins production
Moniliformin (MON), beauvericin (BEA) and fumonisin (FUM) were chosen to be investigated in this recent study. The selection was based on Fotso et al. (2002) findings. According to them, F. pseudocircinatum IBRL B3-4 owns a traceable level of MON, low level of fusaproliferin, null concentration of BEA and a trace level
FUM. In this experiment, corn grit was selected as substrate as it is the only commodity that contains significant amounts of certain mycotoxin especially fumonisins. Because corn is consumed either directly or processed into products for human or animal consumption, fumonisin contamination has been reported from every part of the world (Marín et al., 2004).
187
To obtain those toxins, 45% (v/w) moisture content (distilled water, pH 6.5) was added into 85 g corn grit (250 mL Erlenmeyer flask) and autoclaved at 121°C for 15 minutes. Then, F. pseudocircinatum IBRL B3-4 with the inoculum concentration of
1 x 107 spore/mL was set in the flask, prior to 28 days fermentation period at 25°C.
The control was sterile corn grits with 45% (v/w) moisture content, without the spore suspension (Nor Azliza, 2008).
7.2.1.1 Mycotoxins analysis
7.2.1.1(a) Moniliformin (MON)
MON detection was done in accordance to Munimbazi and Bullerman (1998). A total of 10 g fermented corn grits was soaked in 50 mL of 1% (w/v) tetrabutylammonium hydrogen sulphate (TBAHS, Sigma-Aldrich, USA) and vigorously shaken via orbital shaker (Lab Companion SI300R) at 210 rpm for 30 minutes. The sample was then blended in a Waring blender for 5 minutes and filtered through Whatman No.4 filter paper. An additional 50 mL of 1% (w/v)
TBAHS was added to the solid residues and shaken for another 30 minutes. The recent sample solution was filtered through the same filter paper and combined with the previous sample aqueous. The extracted sample was defatted using 40 mL n- hexane (HPLC grade, Merck, Germany) and concentrated (about 10 mL) under reduced pressure using a rotary evaporator (Heidolph, Germany) at 60°C. The concentrated sample was dissolved in 50 mL of warm methanol and then was further added with 4 volume acetone (HPLC grade, Sigma-Aldrich, USA). During precipitation in a 125 mL separatory funnel, the acetone was removed and then, it
188 was left in a fume hood for evaporation process, prior to dissolution of 5 mL methanol (HPLC grade, Merck, Germany).
The next step was sample clean-up. A Discovery® solid phase extraction clean-up column (Supelco Sigma-Aldrich, USA) was pre-conditioned with 1 mL of methanol
(HPLC grade, Merck, Germany) , followed by 1 mL of water and 1 mL of ortho- phosphoric acid (0.1 M, Fluka, USA). After that, the previous prepared solution was flowed via the tube. Next, MON which trapped inside the tube was eluted using 1 mL of water and also 1 mL of sodium dihydrogen phosphate monohydrate (0.05 M, pH 5, Sigma-Aldrich, USA). The solution was filtered through 0.2 µm Nylon syringe filter (Minisart® NY25 Sartorius, Germany) into 12 x 32 mm glass-screwed neck vial (Waters, USA). It was stored at 4°C prior to sample analysis via Ultra
Performance Liquid Chromatography (Acquity UPLC, Waters, USA). The MON standard (Sigma-Aldrich, USA) was dissolved in acetonitrile (HPLC grade, Merck,
Germany) and a concentration ranging from 2 to 10 µg/mL was prepared as reference. All samples were organized in triplicates.
Under isocratic condition, mobile phase was set up with 8% acetonitrile (HPLC grade, Merck, Germany) and 92% ion-pair modifier mixture. For ion-pair modifier mixture preparation, a volume of 50 mL of 40% (w/v) tetrabutylammonium hydrogen sulphate (Sigma-Aldrich, USA) was mixed with 100 mL of 1.1 M potassium dihydrogen phosphate (Sigma-Aldrich, USA). Ten milliliter of concentrated ion-pair modifier mixture was made up to 1 L using extra pure water.
Then, the pH solution was adjusted to 6.5 using 5 M potassium hydroxide (KOH,
189
Fluka, USA). Acetonitrile (HPLC grade, Merck, Germany) and the diluted ion-pair modifier mixture were separately filtered through 0.2 µm Nylon syringe filter
(Minisart® NY25, Sartorius, Germany). A C18 reversed-phase column (2.1 x 100 mm, 1.7 µm) and Acquity UPLC Photodiode Array detector were connected to the
UPLC system. A wavelength of 229 nm and also 1.0 mL/min of flow rate were deposited in UPLC system. A volume of 10 µL of each samples and standards were withdrawn for MON detection. The retention time (Rt) of each sample was compared to the standard.
7.2.1.1(b) Beauvericin (BEA)
Method of Logrieco et al. (1998) was elected to evaluate BEA value in F. pseudocircinatum IBRL B3-4. Approximately, 15 g of fermented corn grits were soaked for overnight with 75 mL of acetonitrile (HPLC grade, Merck, Germany), methanol (HPLC grade, Merck, Germany) and ultra pure water (16:3:1). Next, the sample was ground in a Waring blender for 5 minutes. Aliquot was collected by separating it from the residue through Whatman No.4 filter paper, prior to twice defatted process using 25 mL of n-heptane. The second layer (bottom) was flowed and under 80°C setting of rotary evaporator, the sample was evaporated in reduced pressure condition into almost dry state. Then, the sample was suspended in 50 mL of methanol (HPLC grade, Merck, Germany) and water under 1:1 ratio.
Dichloromethane (25 mL) was added during partition procedure and this step was repeated twice. The collected sample was again evaporated via rotary evaporator to near dryness at 38°C before re-dissolved it in 1 mL of methanol (HPLC grade,
Merck, Germany).
190
After that, it was filtered through Discovery® solid phase extraction column for clean-up purpose. The column was flowed with 2 mL methanol (HPLC grade,
Merck, Germany) and left to almost dryness again at 70°C incubator, prior to dissolution in methanol (1 mL). The Waters Acquity UPLC system was set up at
205 nm. A C18 reversed-phase column size of 2.1 x 100 mm (1.7 µm internal particle size) was connected to Photodiode Array detector to analyze BEA. For standard preparation, BEA powder (≥ 97% HPLC purity, Sigma Aldrich, USA) was dissolved in HPLC grade methanol (Merck, Germany). Concentration ranged from 2 to 10
µg/mL was prepared for chromatogram reference. The mobile phase for this analysis was acetonitrile and pure water (85:15, v/v). Under isocratic condition and flow rate of 1.0 mL/min, a total of 10 µL of each samples were injected into UPLC. The retention time (Rt) of each sample was compared to the standard.
7.2.1.1(c) Fumonisin B1 (FUM)
Method of Desjardins et al. (1994) and Shephard (2001) were referred to analyze fumonisin. A total of 10 g fermented corn grits was approximately placed in a shake flask for extraction. Then, 40 mL of HPLC grade acetonitrile (Merck, Germany) and ultra pure water combination (50:50, v/v) was added into the flask. It was blended for 5 minutes using Waring blender, prior to sample filtration via Whatman No.4 filter paper. Next, the solution was defatted with 40 mL n-hexane (HPLC grade,
Merck, Germany) using separatory funnel. A volume of 1 mL of extracted sample was mixed with 2.5 mL potassium chloride (KCl, 1%; w/v, Fluka, USA) and was further flowed through Discovery® solid phase extraction column (Supelco, Sigma-
Aldrich, USA). This column was pre-conditioned with 5 mL HPLC grade methanol
191 and also 5 mL KCl. Next, 3 mL of 1% (w/v) KCl and followed by 2 mL solution mixture of acetonitrile and 1% (w/v) KCl (10:90, v/v) were flowed through the same column. After that, sample containing fumonisin was passed via the column and eluted using extraction solution namely acetonitrile and water (50:50, v/v).
Ortho phthaldialdehyde reagent was used for fluorimetric detection. It was prepared by adding 1 mL of HPLC grade methanol (Merck, Germany) into 40 mg Ortho phthaldialdehyde (OPA, Sigma-Aldrich, USA) and then it was further diluted with 5 mL of 0.1 M sodium borate (Sigma-Aldrich, USA). A volume of 50 µL of 2- mercaptoethanol (Merck, Germany) was put into the mixture. This mixture solution may stable up to 8 days and it was placed in a dark container as it sensitive to light.
Before UPLC analysis, 800 µL of OPA reagent was mixed into 200 µL of sample and also standard solution. A fluorescence detector (Waters, USA) was connected to
UPLC system. It was set with 440 nm emission and 335 nm excitation wavelengths.
The mobile phase was methanol and sodium dihydrogen phosphate at pH 3.35
(78:22, v/v, respectively) and the flow rate for this system was at 0.2 mL/min. For standard preparation, concentrations ranged from 2 to 10 µg/mL were used as FUM reference. The retention time (Rt) of each sample was compared to the standard.
7.2.2 Lethality test of fractional lovastatin on brine shrimp
7.2.2.1 Hatching brine shrimp
Method of Meyer et al. (1982) was chosen to study the toxicant production by fractional lovastatin. Brine shrimp cysts (Artemia salina) were hatched in a glass container containing artificial seawater prepared by diluting 38 g of sea salt (Sigma-
Aldrich, USA) in 1 L of distilled water (3.8%; w/v). The cysts were placed under
192 inflorescent bulb and oxygenated with an aquarium pump for 48 hours at 25°C.
After hatching, nauplii that released from the cysts shells were collected using
Pasteur pipette for the next step in lethality test.
7.2.2.2 Fractional lovastatin preparation
The previous result in 5.5.1 section was applied. Fraction sample from 7:3 ratio was collected, concentrated and dried in a fume hood. The paste was diluted with dimethyl sulfoxide (DMSO, Merck, Germany) to obtain stock solution of 500 mg/mL concentration. After that, the sample was added in 5 mL of artificial seawater to prepare the final concentration of 1000, 2000, 3000, 4000 and 5000
µg/mL. The detailed preparation of fractional lovastatin sample is summarized in
Table 7.1.
Table 7.1: Preparation of fractional lovastatin for toxicity test
Concentration (µg/mL) Volume of fractional Volume of artificial lovastatin (µL) seawater (µL) 1000 10 4990 2000 20 4980 3000 30 4970 4000 40 4960 5000 50 4950 Control (50 µL of DMSO) - 4950
7.2.2.3 Brine shrimp test
The bioassay of fractional lovastatin was done on brine shrimp (Artemia salina) at nauplii stage in order to determine the occurrence of cytotoxic activity in the compound. A total of 10 nauplii was collected and placed into a universal bottle.
Nauplii were treated with each concentration under triplicate condition. Then, toxicity observation was done for 12 hours (acute toxicity) and 24 hours (chronic
193 toxicity). Non motile nauplii were counted and the mortality percentage was determined as below.
Equation 7.1:
Mortality percentage % = Survival percentage in the control % − survival percentage in the treatment solution (%)
7.2.2.4 Determination of lethal concentration (LC50)
Lethality was determined from the average survival of nauplii in fractional lovastatin and that of control. To determine the LC50, the average of mortality percentage was plotted against logarithm of concentrations. Concentration that killed 50% of nauplii was evaluated from the linear equation and antilogarithm the value.
7.2.3 Application of fractional lovastatin towards rats
7.2.3.1 Administration of lovastatin
All of the upcoming procedures were executed basically under the guidelines of
Organization for Economic Cooperation and Development (OECD). Lovastatin compound which was eluted by dichloromethane and ethyl acetate (7:3) combination was collected for application in Sprague Dawley rats. The viscous mass of fractional lovastatin was dissolved in tween 20 (0.2%; v/v) (Tembhurne and
Sakarkar, 2011) and was fed to the rats via oral gavage (18 gauge feeding tube, 2 to
3 inches in length).
194
7.2.3.2 Cholesterol diet versus standard diet
Standard diet (Specialty Feeds, Australia) for Sprague Dawley was provided by
Animal Research and Service Centre (ARASC), Universiti Sains Malaysia. The recipe for high cholesterol feed was formulated by Aryantha et al. (2010). It was made of duck egg yolk (15%), chicken liver (10%) and lamb fat (15%). These ingredients were mixed together with 60% of standard feed (finely blended) for
Sprague Dawley rat. The feed dough was molded accordingly to the original size of standard feed. Then, it was baked in an oven of 80°C for overnight before been fed to the rats.
7.2.3.3 Sprague Dawley grouping
Four groups were set namely Group 1, Group 2, Group 3 and Group 4. There were
6 Sprague Dawley (3 males and 3 females) for each group. Group 1 was specifically for control which fed with standard diet (Specialty, Australia). For Group 2 to Group
4, the rats were fed with high cholesterol feed and they were treated at different dose of fractional lovastatin. Group 2 was treated with 1.8 mg/kg body weight (0.05 to
0.11 µg lovastatin/g dry solid), Group 3 was at 55 mg/kg body weight (200 to 300
µg lovastatin/g dry solid) and finally Group 4 was treated 110 mg/kg body weight
(550 to 750 µg lovastatin/g dry solid). Water was also fed to the rats ad libitum. All of the groups were placed in IVC (individually ventilated cage) under room temperature of 25°C. Wood fibre (Puik, Netherland) was spreaded onto the IVC platform to provide a more comfortable space for rats and also to absorb their urine and fecal. The weight for female was in the range of 197 to 205 g while for male was 221 to 228 g. Any changes in their body weight during treatment period were recorded.
195
7.2.3.4 Cholesterol test
Before high cholesterol test began, 1 mL of rats’ blood were withdrawn from their tail vein using needle (27 G x ½”, Terumo Syringe, USA) for normal cholesterol setting. Then, the high cholesterol feed was administered for 28 days in order to trigger the hypercholesterolemia in rats. At day 29, the blood sample was again withdrawn to determine the starting cholesterol level of each group, prior to fractional lovastatin administration. After that, the cholesterol test was done by determining its level for once a week over 4 weeks. It was colorimetrically measured at 570 nm using HDL and LDL/VLDL quantification kit (Sigma-Aldrich, USA).
7.2.3.5 Cholesterol analysis via colorimetric method
7.2.3.5(a) Standard preparation
This method was employed in accordance to manufacturer’s instruction. The main compositions for this kit were Cholesterol Assay Buffer, 2 x LDL/VLDL
Precipitation Buffer, Cholesterol Probe in DMSO, Enzyme Mix, Cholesterol
Esterase and Cholesterol Standard (2 µg/µL). For cholesterol standard preparation, a volume of 20 µL of the 2 µg/µL Cholesterol Standard solution was diluted with 140
µL of Cholesterol Assay Buffer in order to obtain 0.25 µg/µL standard solution.
From this stock solution, a volume of 0, 4, 8, 12, 16 and 20 µL was transferred into a
96 well plate, generating blank 0, 1, 2, 3, 4 and 5 µg per well standards. The
Cholesterol Assay Buffer was added to each well to top up the volume to 50 µL.
Cholesterol standard consisted a free cholesterol mixture and also cholesteryl esters which must be converted into cholesterol using Reaction Mix solution. Table 7.2 indicates a recipe for Reaction Mix preparation. A total of 50 µL of Reaction Mix was added into each well and then was further mixed via pipetting. The standard
196 solution in 96 well plate was covered with aluminium foil prior to incubation process at 37°C for 1 hour.
Table 7.2: Formulation for Reaction Mix solution
Reagent Total cholesterol and standards (µL) Cholesterol Assay Buffer 44 Cholesterol Probe 2 Cholesterol Enzyme Mix 2 Cholesterol Esterase 2 Total 50
7.2.3.5(b) Cholesterol sample preparation
This method was done in accordance with Sigma-Aldrich (USA). A volume of 100
µL of 2 x Precipitation Buffer was mixed with serum sample in a microcentrifuge tube (100 µL). Then, the samples were incubated for 10 minutes at room temperature and centrifuged at 2000 g for 10 minutes. After that, the supernatant fraction (HDL) was transferred into a new microcentrifuge tube. The precipitant which represented HDL/VLDL was again centrifuged at 2000 g for 10 minutes to remove the remaining trace of HDL supernatant. Next, the precipitant was dissolved in 200 µL of Phosphate Buffer Saline (PBS). The composition of PBS was sodium chloride (8 g), potassium chloride (0.2 g), disodium hydrogen phosphate (1.44 g) and potassium dihydrogen phosphate (0.25 g). All of these chemicals were dissolved in 800 mL of distilled water prior to pH adjustment (pH 7.4) using 1 M of hydrochloric acid. Then, distilled water was used to top up the solution to 1 L. It was autoclaved at 121°C for 15 minutes before being practically used in the test.
After that, each of those samples (50 µL of HDL and LDL/VLDL) were transferred into 96 well plate and mixed with 50 µL of Reaction Mix solution. The samples
197 were mixed well and incubated at 37°C for 1 hour under dark condition. The cholesterol measurement was done based on colorimetric at absorbance of 570 nm using Thermo Scientific Multiskan® Spectrum microplate readers (Thermo
Scientific, USA). The samples were analyzed via SkanIt software 2.4.4 version. The
HDL and LDL/VLDL calculations were done based on represented formula.
Equation 7.2:
Sa ÷ Sv × DF = C
Where;
Sa: Amount of cholesterol in Sprague Dawley sample (µg) from standard curve
Sv: Sample volume (µL) added into the wells
C: Concentration of cholesterol in sample
DF: Dilution factor
7.2.4 Statistical analysis
The method was described in Section 3.2.4
7.3 Results and Discussion
7.3.1 Mycotoxins produced by F. pseudocircinatum IBRL B3-4
Information on mycotoxin production by F. pseudocircinatum is very restricted.
Maize was selected to grow F. pseudocircinatum IBRL B3-4 because BEA, MON and FUM have been commonly found as Fusarium sp. natural contaminants source
(Kostecki et al., 1999; Rheeder et al., 2002). Results bestowed from this recent experiment were in agreement with Fotso et al (2002). F. pseudocircinatum
198 commonly produced MON (100 ± 16 µg/g), fusaproliferin (12 ± 0.3 µg/g), FUM
(280 ± 3 µg/kg) with no BEA existence. However, F. pseudocircinatum IBRL B3-4 isolate did not produce BEA and for MON and FUM, the production was slightly at different concentration. Figure 7.1 verifies that no BEA was produced by F. pseudocircinatum IBRL B3-4 as the Rt of the sample (Figure 7.1 A) did not parallel to the standard’s peak (Figure 7.1 B). The Rt for standard was 2.5 minutes while it took around1.3 minutes for the sample peak to come out. On the other hand, MON and FUM did produce by F. pseudocircinatum IBRL B3-4. Referring to Figure 7.2, the Rt for MON was detected at 1.2 (Figure 7.2 A) and the existed peak was parallel with MON standard (Figure 7.2 B). However, the MON production was at low level i.e. 4.20 ± 1.12 µg MON/g substrate. F. pseudocircinatum IBRL B3-4 was also traced to generate other mycotoxin namely FUM (Figure 7.3). From UPLC system, the FUM production was also in lower concentration (1.73 ± 0.71 µg FUM/g substrate) compared to Fotso et al. (2002) (Figure 7.3 A). The Rt was around 2.2 and it was overlapped within the FUM standard (Figure 7.3 B).
According to Nirenberg and O’Donnell (1998), F. pseudocircinatum was phylogenetically related to F. lactis and F. denticulatum albeit both of these species did not produce the same mycotoxins level with the F. pseudocircinatum. As reported by Fotso et al. (2002), F. lactis and F. denticulatum generated untraceable level of BEA, FUM and also fusaproliferin. However, they did generate MON at 51
± 3 µg/g and 180 ± 7 µg/g, respectively. Both of these species were categorized under the same clade with F. pseudocircinatum specifically African clade (Kvas et al., 2009).
199
A
B
Figure 7.1: The fermented sample of corn grits by F. pseudocircinatum IBRL B3-4 displayed null appearance of beauvericin (A). The standard’s peak of BEA indicated the Rt for the compound was at 2.5 minutes (B)
200
A
B
Figure 7.2: The detection of MON in fermented corn grits sample. MON was appeared at Rt of 1.2 (A) and parallel with the authentic standard (B)
201
A
B
Figure 7.3: FUM outcome displayed by UPLC system. Sample indicated the FUM appearance at Rt of 2.2 (A) which overlapped within FUM standard (B)
202
7.3.2 Toxicity test on brine shrimp
The mycotoxins production by F. pseudocircinatum IBRL B3-4 has forced an experimental design on toxicity effect. Thus, an in vivo toxicity of fractional lovastatin was done quantitatively based on brine shrimp lethality test as it was expected to indicate an initial hint of toxicity of a compound (Muhamad Syahmi et al., 2010). The 48 hours old nauplii (Figure 7.4) were selected to undergo this treatment because of their maximum sensibility achievement. It has been emphasized by Sorgeloos et al. (1978) and Sleet and Brendel (1983) that brine shrimp was vastly vulnerable towards toxins at the early stage of development.
Figure 7.4: A. salina nauplii condition after 48 hours exposure in artificial seawater (4 x 10 magnification)
Nauplii of A. salina were exposed to different concentration (ranging from 1000 to
5000 µg/mL) for 12 hours and 24 hours. A linear regression line was applied to evaluate the LC50 values by maneuvering the regression line equations (Figure 7.5).
The equation for acute toxicity was y = 129.9x - 390.4 (R2 = 0.993) and chronic toxicity was y = 138.9x - 405.4 (R2 = 0.948). The plotted graph designated that the
LC50 value for the acute condition was 2456.41 µg/mL while under chronic
203 condition, the value decreased to 1899.4 µg/mL. To justify this recent finding, it is worth to mention the result obtained by Meyer et al. (1982). They have standardized that any extracts derived from natural products that consisted the LC50 ≤ 1.0 mg/mL
(equal to 1000 µg/mL) were considered to impregnate toxic effects. Hence, due to their research outcomes, the fractional lovastatin was not toxic and it may further for the next test of this experiment namely its effect as anticholesterol agent in Sprague
Dawley rats. Fazil et al. (2011) have done a comparison between Anacardium occidentale Linn leaves extract (known as cashew in folk medicine) and commercial simvastatin. During the toxicity study, the broth extract of A. occidentale Linn depicted a low value of LC50 (226.67 ± 2.52 µg/mL) but yet, it potentially decreased the hypercholesterolemic event in the tested rabbit.
120
(%) 100 80 60 A.salina 40 20 0
-20 3 3.1 3.2 3.3 3.4 3.5 3.6 3.7 3.8 Mortality of Mortality Log concentration (µg/mL)
12 hours 24 hours Linear (12 hours) Linear (24 hours)
Figure 7.5: Toxicity of fractional lovastatin against brine shrimp. The LC50 values was determined and expressed in µg/mL
204
7.3.3 Cholesterol lowering effect of fractional lovastatin on Sprague Dawley rats
7.3.3(a) Growth pattern of rats under fractional lovastatin treatment
Growth pattern is commonly a primer indicator for toxicity effect of any medicinal compound study in animals. Table 7.3 depicts a different between the initial weight
(before been fed with cholesterol feed) and final weight (after been fed with cholesterol feed) of Sprague Dawley rats. For female, the body weight increased about 37% (Group 1), 30% (Group 2), 25% (Group 3) and 40% (Group 4) which represented the control group, 1.8 mg/kg body weight, 55 mg/kg body weight and
110 mg/kg body weight, respectively. While for male, the weight enhanced to almost 90% (Group 1), 83% (Group 2), 92% (Group 3) and 89% (Group 4). Within the sex cluster, the body weight between the control group and other groups displayed no significant different (p > 0.05).
Total growth pattern surveillance for different doses treatment was interpreted in
Figure 7.6 and Figure 7.7. The graphs indicated the growth patterns for female and male of Sprague Dawley under 29 days observation period. Day 0 represented the starting body weight before been consumed with cholesterol feed. While day 1 to 29 signified the body weights gained under fractional lovastatin treatment. Based on
Figure 7.6, the weight of female rats experienced a mitigation condition after been fed with cholesterol feed. However, their weights were slowly boosted up after day 1 treatment. Compared to the male, their body weights were stably increased starting from day 0 to day 29 (Figure 7.7). Throughout the 29 days treatment, body weights denoted by all doses exhibited no significant different with the control (p > 0.05).
205
Table 7.3: Initial and final body weight of Sprague Dawley rats
Group 1 Group 2 Group 3 Group 4
(Control) (treated with 1.8 (treated with 55 (treated with 110 mg/kg body weight) mg/kg body mg/kg body weight)
weight) Female Initial weight (g) 198.00 ± 2.00 196.67 ± 8.22 204.67 ± 6.22 196.67 ± 3.78
Final weight (g) 272.00 ± 4.00 256.00 ± 10.00 255.67 ± 3.76 275.33 ± 3.56 Male Initial weight (g) 221.33 ± 8.89 224.33 ± 4.44 228.33 ± 7.78 228.00 ± 2.00
Final weight (g) 420.00 ± 2.00 410.00 ± 30.00 438.67 ± 26.44 430.67 ± 13.78
206
275
225
Body weight(g) Body 175
125 0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 Day
Control 1.8 mg/kg body weight 55 mg/kg body weight 110 mg/kg body weight
Figure 7.6: Effect of treatment doses of fractional lovastatin on female rats’ body weights
207
500
450
400
350
Body weight(g) Body 300
250
200 0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 Day
Control 1.8 mg/kg body weight 55 mg/kg body weight 110 mg/kg body weight
Figure 7.7: Effect of different doses of fractional lovastatin on male rats’ body weights
208
Aryantha et al. (2010) stated that the body weights reflect the toxicity effect on rat.
Their investigation was based on Laetiporus sp. extract which signified a fluctuate pattern in rats’ growth throughout 14 days study. It increased during day 3 to day 5 and then declined on the day 6 before enhancing again on the following days. The weight reached its maximal value at day 11 and 12. A study of dietary models for inducing hypercholesterolemia in female Fischer rats (150 g) was done by Matos et al. (2005). Different diets calories specifically 4118.4 Kcal (control), 5018.4 Kcal
(Group 1), 4538.4 Kcal (Group 2), 4498.4 Kcal (Group 3) and 4188.4 Kcal (Group
4), were fabricated for each group. The eight weeks study has experienced body weights increase in all groups including the control. The feed provoked the weights up to 29%, 18%, 28%, 24% and 30% for control, Group 1, Group 2, Group 3 and
Group 4, respectively. Due to this report, the cholesterol feed recipe formulated by
Aryantha et al. (2010) was more superior in increasing the body weight of rats.
7.3.3(b) HDL and LDL level in Sprague Dawley
HDL and LDL were two main components in determining the cholesterol level in blood. Table 7.4 and Table 7.5 respectively exhibit these two different cholesterol levels in female and male Sprague Dawley. For normal cholesterol levels, the HDL in both sexes were not given any significant different with the control (p > 0.05).
However, the HDL concentrations in both sexes were eloquently decreased after been consumed with cholesterol-formulated feed. For female, after been treated with fractional extract under concentrations of 1.8 mg/kg body weight, 55 mg/kg body weight and 110 mg/kg body weight, the HDL was alleviated to almost 93%, 93% and 83%, respectively (Table 7.4). While for male, the normal HDL concentration was slightly higher than female. But after been fed with cholesterol feed, there was
209 no traceable HDL found in the tested doses (Table 7.5). These events happened due to the LDL level elevation in the rats’ blood. The augmentation of this cholesterol type was succesfully connoted a hypercholesterol condition in rats. Initially, there was no detectable LDL in female, however, the LDL level was extensively induced after 29 days of cholesterol-based feeding (Table 7.4). The same situation was encountered in male’s blood. The LDL concentration was eloquently raised in all groups (except Group 1) (Table 7.5). There was no detectable LDL in control group for both sexes.
An overall treatment effect of fractional lovastatin on rats was displayed in Table 7.6 and Table 7.7. In female, fractional extract doses of 55 mg/kg body weight and 110 mg/kg body weight denoted an elevation in HDL starting from Week 2 to Week 4.
There were no cholesterol changes after the application of 1.8 mg/kg body weight extract dose either in HDL level or LDL level. Thus, this concentration was not efficient enough to demolish the LDL concentration or to induce the HDL. The HDL increment has forced LDL to slow down its production and this condition was observed in fraction concentration of 55 mg/kg body weight and 110 mg/kg body weight. Generally, fraction concentration of 110 mg/kg body weight was slightly the best amount to reduce cholesterol in female rats. The HDL level in female’s blood started to double-up at the second week of the treatment while the LDL denoted a remarkable increment during the third week.
210
Table 7.4: HDL and LDL levels in female Sprague Dawley prior to doses treatment Normal cholesterol Starting cholesterol level level Group/ Cholesterol type HDL LDL HDL LDL (µg/µL) (µg/µL (µg/µL) (µg/µL) ) Group 1 (Control) 0.025 ± 0.002 nd 0.024 ± 0.004 Nd Group 2 (1.8 mg/kg body 0.029 ± 0.003 nd 0.002 ± 0.001 0.023 ± 0.002 weight) Group 3 (55 mg/kg body 0.029 ± 0.004 nd 0.002 ± 0.001 0.027 ± 0.002 weight) Group 4 (110 mg/kg body 0.029 ± 0.003 nd 0.005 ± 0.001 0.027 ± 0.003 weight) *nd = not detected
Table 7.5: HDL and LDL levels in male Sprague Dawley prior to doses treatment
Normal cholesterol Starting cholesterol level level Group/ Cholesterol type HDL LDL HDL LDL (µg/µL) (µg/µL (µg/µL) (µg/µL) ) Group 1 (Control) 0.030 ± 0.004 nd 0.030 ± 0.005 nd Group 2 (1.8 mg/kg body 0.035 ± 0.005 nd nd 0.028 ± 0.005 weight) Group 3 (55 mg/kg body 0.027 ± 0.003 nd nd 0.028 ± 0.001 weight) Group 4 (110 mg/kg body 0.033 ± 0.005 nd nd 0.032 ± 0.002 weight) *nd = not detected
211
Table 7.6: HDL and LDL levels in female under different doses treatment
Week 1 Week 2 Week 3 Week 4 Treatment/Choles HDL LDL HDL LDL HDL LDL HDL LDL terol (µg/µL) (µg/µL) (µg/µL) (µg/µL) (µg/µL) (µg/µL) (µg/µL) (µg/µL) Control 0.021 ± 0.003 nd 0.024 ± 0.003 nd 0.024 ± 0.003 nd 0.024 ± 0.003 nd 1.8 mg/kg body 0.001 ± 0.001 0.022 ± 0.002 0.003 ± 0.002 0.021 ± 0.003 0.005 ± 0.002 0.020 ± 0.002 0.001 ± 0.001 0.024 ± 0.002 weight 55 mg/kg body 0.006 ± 0.003 0.026 ± 0.001 0.011 ± 0.005 0.024 ± 0.001 0.015 ± 0.001 0.006 ± 0.001 0.021 ± 0.001 0.004 ± 0.001 weight 110 mg/kg body 0.006 ± 0.001 0.026 ± 0.002 0.014 ± 0.003 0.022 ± 0.003 0.017 ± 0.003 0.005 ± 0.001 0.022 ± 0.003 0.004 ± 0.001 weight *nd = not detected *Values were shown as average ± standard deviation (n = 3)
212
Table 7.7: HDL and LDL levels in male after been treated with different doses of fractional lovastatin
Week 1 Week 2 Week 3 Week 4 Treatment/Cholest HDL LDL HDL LDL HDL LDL HDL LDL erol (µg/µL) (µg/µL) (µg/µL) (µg/µL) (µg/µL) (µg/µL) (µg/µL) (µg/µL) Control 0.028 ± 0.004 nd 0.027 ± 0.001 nd 0.027 ± 0.001 nd 0.027 ± 0.007 nd 1.8 mg/kg body nd 0.027 ± 0.005 0.001 ± 0.001 0.027 ± 0.005 0.005 ± 0.001 0.025 ± 0.002 0.001 ± 0.001 0.030 ± 0.003 weight 55 mg/kg body nd 0.027 ± 0.004 0.003 ± 0.001 0.027 ± 0.004 0.018 ± 0.004 0.013 ± 0.001 0.018 ± 0.002 0.008 ± 0.002 weight 110 mg/kg body nd 0.025 ± 0.006 0.004 ± 0.001 0.025 ± 0.005 0.018 ± 0.005 0.010 ± 0.002 0.023 ± 0.001 0.006 ± 0.001 weight *nd = not detected *Values were shown as average ± standard deviation (n = 3)
213
In male, there was no detectable HDL during Week 1 for all the tested doses but, the
HDL level was slowly produced in the following weeks (Week 2 to 4) for concentration of 55 mg/kg body weight and 110 mg/kg body weight (Table 7.7). For fraction concentration of 1.8 mg/kg body weight, the final HDL production (after 4 weeks treatment) was 0.001 ± 0.001 µg/µL which was not depicted a significant different with the control (p > 0.05). This concentration also did not exhibit a notable effect in reducing cholesterol within 4 weeks time as the LDL level was higher than HDL level (0.030 ± 0.003 µg/µL).
Concentration of 55 mg/kg body weight denoted an average effect towards male rats after 4 weeks treatment. The produced HDL was 0.018 ± 0.002 µg/µL which vaguely higher than LDL level (0.008 ± 0.002 µg/µL). HDL production was significantly triggered by the concentration of 110 mg/kg body weight (p < 0.05) with better LDL reduction compared to other doses (HDL = 0.023 ± 0.001 µg/µL,
LDL = 0.006 ± 0.001 µg/µL). The HDL was initiated to amplify at the third week while the LDL was detected to decrease at also the same week. The most concentrated fraction extract namely 110 mg/kg body weight which contained 550 to
750 µg lovastatin/g dry solid was considered to be the best condition to demolish cholesterol in both sexes of Sprague Dawley. The final remaining of HDL in male rats was slightly higher than female rats. This recent result was in agreement with
Aryantha et al. (2010) and it was comprised in Table 7.8.
The use of Sprague Dawley rats as a research animal has resulted in many scientific advancements. A test on mammals like rats will give a reliable data which usually
214 has a strong connection with human as both of them can trigger hypercholesterolemia in their body. Commonly, the fungus itself or its crude extract
Table 7.8: Percentage reduction of blood cholesterol level by Laetisporus sp. extract and commercial lovastatin product compared to control (Ayantha et al., 2010)
Week Average Treatment 1 2 3 4 (%)
Extract 110 9.4 15.9 14.7 5.6 11.4 mg/kg
Lovastatin 5.5 17.1 1.6 -2.0 5.5 powder 1.8 mg/kg Control = 101.99 to 110.73 mg/dL
was more preferable to be applied in experimental batch of lowering cholesterol level (Mori et al., 2008; Zhang et al., 2009; Jeong et al., 2010; Aryantha et al.,
2010). Semi purified or fractional compound was not very favorite choice due to the activity loss during purification process. As reported by Mori et al. (2008), three edible mushrooms namely Pleurotus eryngii, Grifola frondosa and Hypsizygus marmoreus were potentially lowered the total cholesterol in mice. An attempt of mixing 3% of the mushrooms into the normal diet were successfully lowered the cholesterol at week 8, 10, 12, 14 and 16 of treatment.
It was also important to mention a study done by Zhang et al. (2009) on edible jelly fungus or also known as Tremella aurantialba. The broth of this fungus can strongly eliminate the total cholesterol and triglyceride in rats’ serum. Resultant obtained by
Jeong et al. (2010) has proven a superb potential of white button mushroom
(Agaricus bisporus) in treating the hypercholesterolemic rats. After 4 weeks
215 consuming Agaricus bisporus powder, the levels of total cholesterol and LDL in
Sprague Dawley did decrease to 22.8% and 33.1%, respectively. In addition, a positive decrease was also spotted in hepatic cholesterol and triglyceride concentrations (36.2% and 20.8%, respectively). Based on Aryantha et al. (2010) findings, concentration doses of 55 mg/kg body weight and 110 mg/kg body weight of Laetiporus sp. also did reduce the cholesterol level in rats. The Laetiporus sp. extract which was believed to consist lovastatin managed to reduce the increase of cholesterol level by 11% for over 4 weeks treatment. The best extract concentration was 110 mg/kg body weight as it recorded 19% of total cholesterol loss in Wistar rats. Medical studies have proven that the LDL cholesterol augmentation was related with hypercholesterolemia while the HDL elevation worked to reduce the risk. Table
7.9 summarizes a few findings of fungi as cholesterol lowering agent in rats.
Table 7.9: Fungi as cholesterol lowering agent in rats Fungi type Extract Treatment Total References concentration period (week) cholesterol reduction (%) Laetiporus sp. 110 (mg/kg) 4 11.4 Aryantha et al., 2010
Agaricus 200 (mg/kg) 4 22.8 Jeong et al., bisporus 2010 a) Auricularia 5% of fungi (in 4 17 Cheung, auricula dried powder 1996 b) Tremella form) 19 fuciformis
This study only focused on the efficiency of fractional lovastatin towards cholesterol in the blood without considering the acute oral toxicity study on rats. For future study, this acute oral toxicity study which included vital internal organs analysis
216 such as kidney, liver, lung, heart and spleen can be observed for lesions progress.
The lesions may represent the toxic effect of compound towards those organs.
7.4 Conclusion
To date, there is no accessible information on anti hypercholesterolemia produced from F. pseudocircinatum. This species managed to generate a total of 4.20 µg/g
MON and 1.73 µg/g FUM B1. However, the LC50 values proved that the fractional lovastatin was not toxic towards A. salina during acute and chronic conditions. The recorded LC50 values were 2456.41 µg/mL and 1899.4 µg/mL, respectively. Study of fractional lovastatin on Sprague dawley reported that the application of 110 mg/kg body weight was the best concentration in inducing the HDL level and also inhibiting the LDL level. After 29 days treatment, in female, the HDL level increased to 0.022 ± 0.003 µg/µL with 0.004 ± 0.003 µg/µL of LDL level. While in male, the HDL and LDL level were 0.023 ± 0.001 µg/µL and 0.006 ± 0.001 µg/µL, respectively.
217
CHAPTER 8
SUMMARY AND GENERAL CONCLUSION
This research inspected the production of lovastatin of the filamentous fungus of F. pseudocircinatum IBRL B3-4 under solid substrate fermentation assessment. A few conclusions can be summarized from each chapter of the investigation namely:
1. Out of 78 filamentous fungi, only 28 isolates were potentially generated lovastatin. IBRL B3-4 isolate which later identified as F.pseudocircinatum IBRL
B3-4 was the best producer with 281.67 ± 44.44 µg lovastatin/g dry solid.
2. The optimum conditions for physical and chemical parameters including the lovastatin production can be reviewed in Table 8.1. In a flask system, F. pseudocircinatum IBRL B3-4 most suitably grown under the original substrate size,
70% (v/w) of moisture content, incubation temperature of 30 ± 2°C, inoculum size of 1 x 105 spore/mL, pH 6.5, 5 g of substrate quantity (1:1 ratio) with static condition. It also required 1.5% (w/w) sucrose, 1% (w/w) yeast extract and 0.5%
(w/w) calcium chloride as external nutrients. For tray system, it can be distinguished from the flask system with the additional of 60% (v/w) of moisture content and also
100 g of substrate quantity. A total of 1770.00 ± 60.00 µg lovastatin/g dry solid and
2436.67 ± 15.56 µg lovastatin/g dry solid were successfully generated from flask and tray systems, respectively. The difference has stated 38% increment in lovastatin production.
3. Ratio of 7:3 (dichloromethane to ethyl acetate) was the best eluent to elute lovastatin from open column chromatography. During preparative TLC analysis, the
218
Table 8.1 Lovastatin production of F. pseudocircinatum IBRL B3-4 before and after improvement in flask and tray systems
System Before improvement After improvement Flask Substrate size: Original size Substrate size: Original size Moisture content: 70% (v/w) Moisture content: 70% (v/w) Incubation temperature: 30 ± 2°C Incubation temperature: 30 ± 2°C Inoculum size: 1 x 107 spore/mL Inoculum size: 1 x 105 spore/mL pH: 6.5 pH: 6.5 Substrate quantity: 5 g Substrate quantity: 5 g Mixing frequency: Static Mixing frequency: Static Carbon source: - Carbon source: 1.5% (w/w) sucrose Nitrogen source: - Nitrogen source: 1% (w/w) yeast extract Mineral salt: - Mineral salt: 0.5% (w/w) calcium chloride Lovastatin activity: 425.00 ± 33.33 µg Lovastatin activity: 1770.00 ± 60.00 µg lovastatin/g dry solid lovastatin/g dry solid Tray Substrate size: Original size Substrate size: Original size Moisture content: 70% (v/w) Moisture content: 60% (v/w) Incubation temperature: 30 ± 2°C Incubation temperature: 30 ± 2°C Inoculum size: 1 x 105 spore/mL Inoculum size: 1 x 105 spore/mL pH: 6.5 pH: 6.5 Substrate quantity: 100 g (1.0 cm thickness) Substrate quantity: 100 g (1.0 cm thickness) Mixing frequency: Static Mixing frequency: Static Carbon source: 1.5% (w/w) sucrose Carbon source: 1.5% (w/w) sucrose Nitrogen source: 1% (w/w) yeast extract Nitrogen source: 1% (w/w) yeast extract Mineral salt: 0.5% (w/w) calcium chloride Mineral salt: 0.5% (w/w) calcium chloride Lovastatin activity: 1135.00 ± 6.67 µg Lovastatin activity: 2436.67 ± 15.56 µg lovastatin/g dry solid lovastatin/g dry solid
219 collected sample from open column chromatography displayed the Rf at 0.46 while in HPLC the lovastatin’s single peak was detected at Rt of 8.0.
4. Fractional concentration of 110 mg/kg body weight concentration which represented 550 to 750 µg lovastatin/g dry solid of lovastatin was slightly the best dose to treat hypercholesterolemia Sprague Dawley rats. The final week of treatment denoted an increment in HDL and decrement in LDL for both sexes. In female, the
HDL level increased to 0.022 ± 0.003 µg/µL with 0.004 ± 0.003 µg/µL of LDL level. While in male, the HDL and LDL level were 0.023 ± 0.001 µg/µL and 0.006 ±
0.001 µg/µL, respectively.
220
8.1 Recommendations and suggestions
This recent work has resulted F. pseudocircinatum IBRL B3-4 as a new lovastatin producer. Mycotoxin is a sub-set of the enormous array of Fusarium sp. which has created a massive negative influence of their other potentiality such as anti cholesterol agent. Further studies on this fungus must be considered prior to human test which including genetic manipulation or even interfere the mycotoxin biosynthesis. The genetic manipulation can be accomplished by inserting the genes that capable to degrade the mycotoxin. Previous work was done by Duvick (2001) via in planta detoxification method. Two different saprophytic fungi, Exophiala spinifera and Rhinocladiella atrovirens, were able to utilise FUM B1 as their sole carbon source. Both fungi can produce enzymes competent of hydrolyzing and metabolizing the toxin by oxidative deamination. Thus, genes coding the specific enzymes which transmitted the detoxification steps can be cloned and expressed.
Another option in eradicating mycotoxins is by interfering their biosynthesis process and it has been proven by Munkvold (2003). An inhibitor of α-amylase which was identified in the legume of Lablab purpureus managed to inhibit aflatoxin in biosynthesis (Munkvold, 2003). Thus, this resultant may inspire into novelty findings of MON and FUM B1 eliminator during lovastatin production of SSF.
221
REFERENCES Abouzied, M.M. and Pestka, J.J. (1994). Simultaneous screening of fumonisin B1, aflatoxin B1, and zearalenone by line immunoblot: a computer-assisted multianalyte assay system. Journal of AOAC International, 77(2):495–501 Ahmad, A., Panda, B.P, Khan, S., Mohd. Ali and Javed, S. (2009). Downstreaming and purification of lovastatin from Monascus purpureus culture. Thai Journal of Pharmaceutical Sciences, 33: 39-46 Ahmad, M.N., Lim, P.E., Abdul Khalil, H.P.S. and Suryani, S. (2002). Utilization of agricultural waste for possible solving the environmental problem. Proceedings of International Seminar on Environmental Chemistry and Toxicology, 20-21 May 2002. Yogyakarta, Indonesia Ahmad, W.A.W., Ramesh, S.V. and Zambahari, R. (2011). Malaysia-Acute coronary syndromes descriptive study (ACCORD): Evaluation of the compliance with existing guidelines in patients with acute coronary syndrome. Singapore Medical Journal, 52(7): 508-5011 Ajai, A.I, Ochigbo, S.S, Ndamitso, M.M. and Olaoluwajuwon, J. (2012). Proximate and mineral compositions of different raw cow’s milks in Minna. European Journal of Applied Engineering and Scientific Research, 1 (1):23-29 Al-Amodi, M.O. and Salleh, B. (2005). Pathogenicity of two Fusarium species associated with asparagus decline in Malaysia and Brunei Darussalam. In: Z.H., Syed Mohd, M.A., Amiza, I., Sakri, M., Awang Soh, M. Najiah, A.R., Asyraf, A.H., Saharuddin, M., Mahadzirah, A. Buhri. (eds.). Proceedings KUSTEM 4th Annual Seminar on Sustainable Science and Management. Pp: 347-350 Alani, F., Grove, J.A., Anderson, W.A. and Moo-Young, M. (2009). Mycophenolic acid production in solid-state fermentation using a packed-bed bioreactor. Biochemical Engineering Journal, 44: 106-110 Alarcón, J., Águila, S., Arancibia-Avila, P., Fuentes, O., Zamorano-Ponce, E. and Hernández, M. (2003). Production and purification of statins from Pleurotus ostreatus (Basidiomycetes) strains. Verlag der Zeitschrift für Naturforschung, 58, 62-64. Alberts, A.W., Chen, J., Kuron, G.K., Hunt, V., Huff, J., Hoffman, C., Rothrock, J., Lopez, M., Joshua, H., Harris, E., Patchett, A., Monaghan, R., Currie, S., Stapley, E., Albers- Schonberg, G., Hensens, O., Hirshfield, J., Hoogsteen, K., Liesch, J. & Springer, J. (1980). Mevinolin, a highly potent competitive inhibitor of hydroxymethyl-glutaryl coenzyme A reductase and chlosterol lowering agent. Proceedings Natural Academy of Science USA, 77, 3957–3961 Altschul, S.F., Gish, W., Miller, W., Myers, E.W. and Lipman, D.J. (1990). Basic local alignment search tool. Journal of Molecular Biology, 215(3): 403-10
222
Anisha, G.S,, John, R.P., Prema, P. and Pandey, A. (2008). Investigation on alpha- galactosidase production by Streptomyces griseoloalbus in a forcefully aerated packed- bed bioreactor operating in solid-state fermentation condition. Applied Biochemistry and Biotechnology, 160(2): 421-7 AOAC. (1997). Official methods of analysis of AOAC International (16th Ed.). In P.A. Cunniff (Eds.), Virginia AOAC International, Pp. 11-116. Aparna, D.G. and Reddy, D.S.R. (2011). Production of lovastatin by Aspergillus parasiticus NCIM 696 using rice bran under solid state fermentation. Journal of Chemical, Biological and Physical Sciences, 2(2): 284-291 Arunachalam, C. and Narmadhapriya, D. (2011). Monascus fermented rice and its beneficial aspects: A new review. Asian Journal of Pharmaceutical and Clinical Research, 4(1): 29-31 Aryantha, I.N.P, Kusmaningati, S., Sutjiatmo, A.B., Sumartini, Y., Nursidah, A. and Narvikasari, S. (2010). The effect of Laetiporus sp. (Bull. ex Fr.) Bond. et Sing. (Polyporaceae) extract on total blood cholesterol level. Biotechnology, 9(3): 312-318 Asante-Duah, K. (2002). Public Health Risk Assessment for Human Exposure to Chemicals (illustrated ed.). Kluwer Academic Publishers, Dordrecht, Netherlands, Volume 6. Pp. 1-2 Babu, P.D., Subhasree, R.S., Bhakyaraj, R. and Vidhyalakshmi, R. (2009). Brown rice- beyond the color reviving a lost health food- A review. American-Eurasian Journal of Agronomy, 2(2): 67-72 Bakri, Y., Jacques, P. and Thonart, P. (2003). Xylanase production by Penicillium canescens 10-10c in solid state fermentation. Applied Biochemistry and Biotechnology, 105-108: 737-748 Barrios-González, J. and Miranda, R.U. (2010). Biotechnological production and applications of statins. Applied Microbiology and Biotechnology, 85: 869-83 Barrios-González, J., Fernández, F.J. and Tomasini, A. (2003). Microbial secondary metabolites production and strain improvement. Indian Journal of Biotechnology, 2: 322-333 Bellon-Maurel, V., Orliac, O. and Christen, P (2003). Sensors and measurements in solid state fermentation: a review. Process Biochemistry, 38: 881-896 Bhargav, S., Panda, B.P., Ali, M. and Javed, S. (2008). Solid-state fermentation: An overview. Chemical and Biochemical Engineering Quarterly, 22(1): 49-70 Bizukojc, M. and Ledakowicz, S. (2009). Physiological, morphological and kinetic aspects of lovastatin biosynthesis by Aspergillus terreus. Biotechnology Journal, 4(5): 647-64 Booth (1971). The genus Fusarium. Commonwealth Mycological Institute, Kew, England. Pp. 23
223
Branham, B.E., and Plattner, R.D. (1993). Alanine is a precursor in the biosynthesis of fumonisin B1 by Fusarium moniliforme. Mycopathologia, 124:99-104. Burgess, L.W., Summerell, B.A., Bullock, S., Gott, K.P. and Backhouse, D. (1994). Laboratory Manual for Fusarium Research. University of Sydney. Campbell, M.K and Farrel, S.O. (2008). Biochemistry 6th Ed. California, USA: Brooks/Cole. Pp. 632 Carballo, J.L., Hernández-Inda, Pérez, P and García-Grávalos. (2002). A comparison between two brine shrimp assays to detect in vitro cytotoxicity in marine natural products. BMC Biotechnology, 23: 2-17 Casas López, J.L., Rodríguez Porcel, E.M., Vilches Ferrón, M.A., Sánchez Pérez, J.A., Fernández Sevilla, J.M. and Chisti, Y. (2004). Lovastatin inhibits its own synthesis in Aspergillus terreus. Journal of Industrial Microbiology and Biotechnology, 31: 48-50 Chang, Y.N., Huang, J.C., Lee, C.C., Shih, I.L. and Tzeng, Y.M. (2002). Use of response surface methodology to optimize culture medium for production of lovastatin by Monascus ruber. Enzyme and Microbial Technology, 30(7): 889-894 Charles, J.F., Delécluse, A. and Nielsen-LeRoux, C. (2000). Entomopathogenic bacteria: from laboratory to field application. Kluwer Academic Publishers, Dordrecht, Netherlands. Pp.320-321 Chaubal, M. V., Payne, G. F., Reynolds, C. H. and Albright, R. L. (1995). Equilibria for the Adsorption of Antibiotics onto Neutral Polymeric Sorbents- Experimental and Modelling Studies. Biotechnology and Bioengineering, 47: 215-226. Chaynika, P. and Srividya, S. (2014). Bioprospecting of lovastatin producing fungi isolated from soil samples. International Research Journal of Biological Sciences, 3(9):42-46 Chen, H.Z., Xu, F.J. and Li, Z.H. (2005). Temperature control at different bed depths in a novel solid-state fermentation system with two dynamic changes of air. Biochemical Engineering Journal, 23: 117-122 Chen, M.H., Choi, S.H., Kozukue, N., Kim, H.J. and Friedman, M. (2012). Growth-inhibitory effects of pigmented rice bran extracts and three red bran fractions against human cancer cells: Relationships with composition and antioxidative activities. Journal of Agriculture and Food Chemistry, 60: 9151-9161 Cheung, P.C.K. (1996). The hyphocholesterolemic effect of two edible mushrooms: Auricularia auricular (tree-ear) and Tremella fuciformis (white jelly-leaf) in hypercholesterolemic rats. Nutrition Research, 16(10): 1721-1725 Chisti, Y. (1999). Fermentation industrial: Basic considerations. In: R. Robinson, C. Batt, P. Patel. (Eds.). Encyclopedia of Food Microbiology. Academic Press, London. Pp. 663- 647.
224
Chong, P.H., Seeger, J.D. and Frankin, C. (2001). Clinically relevant differences between the statins: implications for therapeutic selection. American Journal of Medicine, 111: 390- 400 Christen, P., Meza, J.C. and Revah, S. (1997). Fruity aroma production in solid state fermentation by Ceratocystis fimbriata: influence of the substrate type and the presence of precursors. Mycological Research, 101: 911–919 Cole, R.J., Kirsey, J.W., Culter, H.G., Doupnik, B.L. and Peckhan, J.C. (1973). Toxin from Fusarium moniliforme: Effects on plants and animals. Science, 179: 1324-1326 Couto, S.R. and Sanromán, M.A. (2006). Application of solid-state fermentation to food industry-A review. Journal of Food Engineering, 76: 291-302. Danuri, H. (2008). Optimizing angkak pigment and lovastatin production by M. purpureus. Journal of Biosciences, 15(2): 61-66. De Deckere, E.A.M. and Korver, O. (1996). Minor Constituents of Rice Oil as Functional Foods, Nutrition Reviews, 54:S120-S126 De Sutter, J., Tavernier, R., De Buyzere, M., Jordaens, L. and De Backer, G. (2000). Lipid lowering drugs and recurrences of life-threatening ventricular arrhythmias in high-risk patients. Journal of American College of Cardiology, 36: 766-772 Demain, A.L. (1999). Pharmaceutically active secondary metabolites of microorganisms. Applied Microbiology and Biotechnology, 52: 455-463 Department of Agriculture Peninsular Malaysia. Paddy statistics of Malaysia. (2012). [Online]. [January, 2014]. http://www.doa.gov.my/c/document_library/get_file?uuid=8b3bb7ed-4363-4471-b760- 6f528e6273dc&groupId=38371 Department of Statistic Malaysia. Paddy. (2010). [Online]. [January, 2014]. http://www.statistics.gov.my/portal/download_Economics/files/DATA_SERIES/2011/p df/08Padi.pdf Department of Veterinary Services, Ministry of Agriculture and Agro-based Industry Malaysia. Nutrition. (2013). [Online]. [January, 2014]. http://www.dvs.gov.my/pemakanan Desjardins, A. E., Plattner, R. D. and Nelson, P. E. (1994). Fumonisin production and other traits of Fusarium moniliforme strains from maize in northeast Mexico. Applied and Environmental Microbiology, 60:1695-1697. Desjardins, A.E. (2006). Fusarium Mycotoxins: Chemistry, Genetics and Biology. St. Paul, Minnesota. Pp. 260 Dunand, A., Renaud, R., Maratray, J., Almanza, S. and Diez, M. (1996). INRA-Dijon reactors for solid state fermentation; designs and application. Journal of Scientific and Industrial Research, 55(3): 317-32
225
Durand, A. (1994). Bioreactor designs for solid state fermentation. Biochemical Engineering Journal, 13: 113-125 Duvick, J. (2001). Prospects for reducing fumonisin contamination of maize through genetic modification. Environmental Health Perspectives, 109(2): 337-342 Eckert, G.P., Wood, W.G. and Muller, W.E. (2005). Statins: drugs for Alzheimer’s disease? Journal of Neural Transmission, 112 (8):1057-1071 El-Batal, A.I. and Al-Habib, R. (2012). Elevated yield of lovastatin by Monascus purpureus from date wastes extract and encapsulation in nanoparticles. International Journal of Pharmaceutical Science and Health Care, 2(6): 62-83 Ellaiah, P., Srinivasulu, B. and Adinarayana, K. (2004). Optimisation studies on neomycin production by a mutant strain of Streptomyces marinensis in solid state fermentation. Process Biochemistry. 39: 529-534 Endo, A. (2004). The origin of the statins. International Congress Series, 162: 3-8 Farhan, M.S. (2010). Monascus ruber ICMP 15220 fermentation for the production of pigments. Ph.D. thesis, Massey University, New Zealand Fazil, F., Amom, Z. Mohd Esa, N., Nik Hasan, M.K., Abdul Kadir, K.K., Md Shah, Z. and Sulaiman, S. (2011). Toxicity screening and hypocholesterolemic effect evaluation of aqueous extract of Anacardium occidentale Linn. In hypercholesterolemic induced rabbits. International Journal of Phytomedicine, 3: 192-197 Feng, Y., He, Z., Ong, S.L., Hu, J., Zhang, Z. and Ng, W.J. (2003). Optimization of agitation, aeration and temperature conditions for maximum β-mannanase production. Enzyme and Microbial Technology, 32: 282–289. Fenton, J.W II and Shen, G.X, (1999). Statins as cellular antithrombotics. Haemostasis, 29: 166-169 Fisher, N.L., Burgess, L.W., Toussoun, T.A. and Nelson, P.E. (1982). Carnation leaves as a substrate and for preserving cultures of Fusarium species. Phytopathology, 72: 151-153 Flodman, H.R. and Noureddini, H. (2013). Effects of intermittent mechanical mixing on solid-state fermentation of wet corn distillers grain with Trichoderma reesei. Biochemical Engineering Journal, 81: 24-28. Food and Agriculture Organization. Genetically modified crops. (2004). [Online]. [January, 2014]. http://www.fao.org/docrep/015/i2490e/i2490e04d.pdf Fotso, J., Leslie, J.F., and Smith, J.S. (2002). Production of beauvericin, moniliformin, fusaproliferin and fumonisins B1, B2 and B3 by ex-type strains of fifteen Fusarium species. Applied and Environmental Microbiology, 68, 5195-5197
226
Franceschi, S., Bidoli, E., Baron, A.E. and La Vechhia, C. (1990). Maize and the risk of cancers of the oral cavity, pharynx, and oesophagus in north-eastern Italy. Journal of the National Cancer Institute, 82: 1407 – 1410 Fukuda, K., Arai, M., Yamaguchi, Y. and Masuma, R. (2004). New beauvericin potentiators of antifungal miconazole activity produced by Beauveria sp. FKI-1366. Journal of Antibiotics, 110-116 Furbĕrg, C.D. (1999). Natural statins and stroke risk. Circulation, 99: 185-188 Gautam P., Sabu A., Pandey A., Szakacs G. and Soccol C.R. (2002). Microbial production of extra-cellular phytase using polystyrene as inert solid support. Bioresource Technology, 83:229–233. Geiser, D.M., Jiménez-Gasco, M.D.M., Kang, S., Makalowska, I., Veeraraghavan, N., Ward, T.J., Zhang, N., Kuldau, G.A. and O’donnell, K. (2004). FUSARIUM-ID v. 1.0: A DNA Sequence Database for Identifying Fusarium. European Journal of Plant Pathology, 110(5-6): 473-479 Gelderblom, W.C.A., Abel, S., Smuts, C.M., Marnewick, J., Marasas, W.F.O., Lemmer, E.R. and Ramljak, D. (2001). Fumonisin-induced hepatocarcinogenesis: Mechanisms related to cancer initiation and promotion. Environmental Health Perspectives, 109: 291-299 Gerhardt, A.L. and Gallo, N. (1998). Full-fat rice bran and oat bran similarly reduce hypercholesterolemia in humans. Journal of Nutrition, 128(5): 865-869 Gervais, P. and Molin, P. (2003). The role of water in solid-state fermentation. Biochemical Engineering Journal, 13: 85-101 Gervais, P. and Molin, P. (2003). The role of water in solid-state fermentation. Biochemical Engineering Journal, 13: 85-101. Gibbons, S. and Gray, A.I. (1998). Isolation by planar chromatography. In: R.J.P. Cannell. Methods in Biotechnology: Natural Products Isolation (Vol. 4), Totowa, New Jersey: Humana Press Inc. Pp. 209-211 Glorioso, N., Troffe, C., Filigheddu, F., Dettori, F., Soro, A., Parpaglia, P., Pinna, P., Collatina, S. and Pahor, M. (1999). Effect of HMG-CoA reductase inhibitors on blood pressure in patients with essential hypertension and primary hypercholesterolemia. Hypertension, 34: 1281-1286 Goswami S., Vidyarti, A.S., Bhunia, B. and Mandal, T. (2012). A review on lovastatin and its production. Journal of Biochemistry Technology, 4(1): 581-587 Goswami, R.S. and Kistler, H.C. (2004). Heading for disaster: Fusarium graminearum on cereal crops. Molecular Plant Pathology, 5(6): 515-525 Gowthaman, M.K., Krishnan, C. and Moo-Young, M. (2001). Fungal solid state fermentation- An overview. In: G.G. Khachatourians, D.K. Arora, (Eds.). Applied
227
Mycology and Biotechnology, Agriculture and Food Production. Elsevier Science, The Netherlands. Pp. 305-352 Grove, J.F. and Pople, M. (1980). The insecticidal activity of beauvericin and the enniantin complex. Mycopathologia, 70: 103-105 Gutiérrez-Rojas, M., Amar, A.H.S., Auria, R.,Revah, S. and Favela-Torres, E. (1996). Heat transfer in citric acid production by solid-state fermentation. Process Biochemistry, 31: 363-369 Hajjaj, H., Niedberger, P. and Duboc, P. (2001). Lovastatin biosynthesis by Aspergillus terreus in a chemically defined medium. Applied and Environmental Microbiology, 67: 2596-2604. Hajko, P., Vesel, T., Radez, I. and Pokomy, M. (1998). Process for the isolation of lovastatin, US patent 5712,130 Hamidi-Esfahani, Z., Shojaosadati, S.A. and Rinzema, A. (2004). Modelling of simultaneous effect of moisture and temperature on A. niger growth in solid-state fermentation. Biochemical Engineering Journal, 21: 265-272 Hamill, R.L., Higgens, G.E., Boaz, H.E. and Gorman, M. (1969). The structure of beauvericin, a new desipeptide antibiotic toxic to Artemia salina. Tetrahedron Letters, 49, 4255–4258. Harrison, L.R., Colvin, B.M., Greene, J.T., Newman, L.E., Cole, J.R. (1990). Pulmonary oedema and hydrothorax in swine produced by fumonisin B1, a toxic metabolite of Fusarium moniliforme. Journal of Veterinary Diagnostic Investigation, 2, 217 – 221. Hesseltine, C.W. (1972). Solid state fermentation. Biotechnology and Bioengineering, 14: 517-532. Hölker, U. and Lenz, J. (2005). Solid-state fermentation– Are there any biotechnological advantages? Current Opinion in Microbiology, 8: 301-306. Hölker, U., Höfer, M. and Lenz, J. (2004). Biotechnological advantages of laboratory-scale solid-state fermentation with fungi, Applied Microbiology and Biotechnology, 64: 175- 186 How, H.P. and Ibrahim, C.O. (2004). Selection and optimization of lipase production from Aspergillus flavus USM A10 via solid state fermentation (SSF) on rice husks and wood dusts as substrates. Pakistan Journal of Biological Sciences, 7: 1249-1256. Howard, R.L., Abotsi, E., Jansen van Rensburg, E.L. and Howard, S. (2003). Lignocellulose biotechnology: issues of bioconversion and enzyme production. African Journal of Biotechnology, 2(12): 602–619 Ibrahim, C.O. (1994). Pengantar Mikrobiologi Industri. Penerbit Universiti Sains Malaysia, Malaysia. Pp. 165
228
Ibrahim, C.O. (2002). Prinsip Bioteknologi. Penerbit Universiti Sains Malaysia, Malaysia. Pp. 20-80 Ikasari, I. and Mitchell, D.A. (1998). Mimicking gas and temperature changes during enzyme production by Rhizopus oligosporus in solid-state fermentation. Biotechnology Letters, 20: 349-353 Jaivel, N. and Marimuthu, P. (2010). Optimization of lovastatin production in solid state fermentation by Aspergillus terreus. International Journal of Engineering Science and Technology, 2(7): 2730-2733. Jeong S.C., Jeong Y.T., Yang, B.K., Islam, R., Koyyalamudi, S.R., Pang, G., Cho, K.Y. and Song, C.H. (2010). White button mushroom (Agaricus bisporus) lowers blood glucose and cholesterol levels in diabetic and hypercholesterolemic rats. Nutrition Research, 30(1): 49-56 Jestoi M. (2008). Emerging fusarium-mycotoxins fusaproliferin, beauvericin, enniatins, and moniliformin: a review. Critical Reviews in Food Science and Nutrition, 48(1): 21-49 Judy, W. (2010). Fungi: A class of their own. Crabtree Publishing Company, USA. Pp. 4 Kahlon, T.S. (2009). Rice bran: Production, composition, functionality and food applications, physiological benefits. In: S.S. Cho, P. Samuel. Fiber: Food Applications and Health Benefits, Florida: CRC Press, Taylor & Francis Group, LLC. Pp. 305-306 Kalogeris, E., Iniotaki, F., Topakas, E., Christakopoulos, P., Kekos, D. and Macris, B. J. (2003). Performance of an intermittent agitation rotating drum type bioreactor for solid state fermentation of wheat straw. Bioresource Technology, 86, 207-213. Kang, M.Y., Kim, S.M., Rico, C.W. and Lee, S.C. (2012). Hypolipidemic and antioxidative effects of rice bran and phytic acid in high fat-fed mice. Food Science and Biotechnology, 21(1): 123-128 Kedera, C.J., Plattner, R.D. and Desjardins, A.E. (1999). Incidence of Fusarium spp. and levels of fumonisin B1 in maize in western Kenya. Applied and Environmental Microbiology 65: 41-44 Kidd, J. (2006). Life after statin patent expires. Nature Reviews Drug Discovery, 5: 813-814 Kiew, C.F. and Chong, C.P. (2013). A community health screening conducted at Sungai Pinang Township, state of Pulau Pinang, Malaysia. Malaysia Journal of Pharmaceutical Sciences, 11(1): 59-68. Kim, H.O. and Yun, J.W. (2005). A comparative study on the production of exopolysaccharides between two entomopathogenic fungi Cordyceps militaris and Cordyceps sinensis in submerged mycelial cultures. Journal of Applied Microbiology, 99, 728–738 Kim, H.O., Lim, J.M., Joo, J.H., Kim, S.W., Hwang, H.J., Choi, J.W. and Yun, J.W. (2005). Optimization of submerged culture condition for the production of mycelial biomass
229
and exopolysaccharides by Agrocybe cylindracea. Bioresource Technology, 96: 1175- 1182. Kostecki, M., Wisniewska, H., Perrone, G., Ritieni, A., Golinski, P., Chelkowski, J. and Logrieco, A. (1999). The effects of cereal substrate and temperature on production of beauvericin, moniliformin and fusaproliferin by Fusarium subglutinans ITEM-1434. Food Additives and Contaminants, 16: 361-365 Kouti, K. Lemmens, M. and Lemmens-Gruber, R. (2003). Beauvericin-induced channels in ventricular myocytes and liposomes. Biochimica et Biophysica Acta, 1609: 203-210 Krishna, C. (2005). Solid-state fermentation systems-an overview. Critical Reviews in Biotechnology, 25(1-2): 1-30 Krishna, C. and Nokes, S.E. (2001). Influence of inoculum size on phytase production and growth in solid-state fermentation by Aspergillus niger. Transactions American Society of Agricultural and Engineers, 44(4): 1031–1036 Kumar, P., Raman, S. and Narula, P. (2006). Lactonizing mevinolinic acid to lovastatin in a totally aqueous medium, US patent US705886B2 Kumar, P.A. and Kanwar, S.S. (2012). Lipase production in solid state fermentation (SSF): Recent developments and biotechnological applications. In: Rath, C.C. (Eds.). Microbiology. Dynamic Biochemistry, Process Biotechnology and Molecular Biology. Global Science Books. 6(1): 13-27. Kumar, S., Srivastava, N., Gupta, B.S. and Kuhad, R.C. (2014). Lovastatin production by Aspergillus terreus using lignocellulose biomass in large scale packed bed reactor. Food and Bioproducts Processing, 92(4): 416-424 Kvas, M., Marasas, W.F.O., Wingfield, B.D., Wingfield, M.J. and Steenkamp, E.T. (2009). Diversity and evolution of Fusarium species in the Gibberella fujikuroi complex. Fungal Divers, 34:1–21. Lai, L.S.T., Tsai, T.H., Wang, T.C. and Chen, T.Y. (2005). The Influence of culturing environments on lovastatin production by Aspergillus terreus in submerged cultures. Enzyme and Microbial Technology, 737-748 Lai,L.S.T., Pan, C.C. and Tzeng, B.K. (2003). The influence of medium design on lovastatin production and pellet formation with a high-producing mutant of Aspergillus terreus in submerged cultures. Process Biochemistry, 38(9): 1317-1326 Laohaprasit, N., Ambadipudi, D. S. and Srzednicki, G. (2011). Optimisation of extraction conditions of volatile compounds in ‘Nam Dok Mai’ mangoes. International Food Research Journal, 18(3): 1043-1049 Latha, P.M., Chanakya, P. and Srikanth, M. (2012). Lovastatin production by Aspergillus fischeri under solid state fermentation from coconut oil cake. Nepal Journal of Biotechnology, 2(1): 26-36
230
Lawley, R., Curtis, L. and Davis, J. (2012). The Food Safety Hazard Guidebook (2nd Edition). Cambridge, UK: The Royal Society of Chemistry. Pp. 253 Leslie, J.F., Zeller, K.A., Logrieco, A., Mulè, G., Moretti, A. and Ritieni, A. (2004). Species diversity of and toxin production by Gibberella fujikuroi species complex strains isolated from native prairie grasses in Kansas. Applied and Environmental Microbiology, 70(4): 2254-2262 Levonen-Muñoz, E. and Bone, D.H. (1985). Effect of different gas environment on bench- scale solid-state fermentation of oat straw by white-rot fungi. Biotechnology and Bioengineering, 28: 382–387 Lew, R.R. (2011). How does a hypha grow? The biophysics of pressurized growth in fungi. Nature Reviews Microbiology 9: 509-518 Li, X., Liu Y., Zhang H., Ren L., Li Q and Li N. (2011). Animal models for the atherosclerosis research: a review. Protein Cell, 2(3): 189-201 Lieberman, M. (1999). A brine shrimp bioassay for measuring toxicity and remediation of chemicals. Journal of Chemical Education, 76(12): 1689-1691 Liew, K.W., Mak, C. and Ho, Y.W. (1998). Status of banana Fusarium wilt in Malaysia. In: W., Zakaria, T.M.M., Mahmud, K.D., Siti, M.F., Nor ‘Aini and M. Marziah (eds.). Proceedings of the first banana seminar, 23-25 November 1998. Pp: 171-177 Lingappa, K. and Vivek Babu, C.S. (2005). Production of lovastatin by solid-state fermentation of Carob (Ceratonia siliqua) pods using Aspergillus terreus KLVB 28. Indian Journal of Microbiology, 45: 283-286 Lisec, B., Radež, I. and Žilnik, L.F. (2012). Solvent extraction of lovastatin from a fermentation broth. Separation and Purification Technology, 96: 187-193 Logrieco, A., Moretti, A., Castella, G., Kostecki, M., Golinski, P., Ritieni, A. and Chelkowski, J. (1998). Beauvericin Production by Fusarium Species. Applied and Environmental Microbiology, 64(8): 3084-3088 Logrieco, A., Rizzo, A., Ferracane, R. and Ritieni, A. (2002). Occurrence of beauvericin and enniatins in wheat affected by Fusarium avenaceum head blight. Applied and Environmental Microbiology, 68(1): 82–85. Lonsane, B.K., N.P. Ghildyal, S. Budiatman and Ramakrishna, S.V. (1985). Engineering aspects of solid-state fermentation. Enzyme and Microbial Technology, 7: 258-265. Lonsane, B.K., Saucedo-Castafleda, G., Raimbault, M., Roussos, S., Viniegra-Gonzalez, G., Ghildyal, N.P., Ramakrishna, M. and Krishnaiah, M.M. (1992). Scale up strategies for solid state fermentation systems. Process Biochemistry, 27: 259-273. Mabrouk, A.M., Kheiralla, Z.H., Hamed, E.R., Youssry, A.A. and Abd El Aty1, A.A. (2008). Production of some biologically active secondary metabolites from marine derived fungus Varicosporina ramulosa. Malaysian Journal of Microbiology, 4(1): 14-24
231
Mahanama, R., Berenjian, A., Dehghani, F. and Kavanagh, J. (2012). Modeling the effect of bed height and partile size for vitamin K2 production in a static bed fermenter. Engineering Letters, 20(1): 16-19 Manpreet, S., Sawraj, S., Sachin, D., Pankaj, S. and Banerjee, U.C. (2005). Review article: Influence of process parameters on the production of metabolites in solid state fermentation. Malaysian Journal of Microbiology, 1(2): 1-9 Manzoni, M. and Rollini, M. (2002). Biosynthesis and biotechnological production of statins by filamentous fungi and application of these cholesterol-lowering drugs. Applied Microbiology and Biotechnology, 58(5): 555-64 Manzoni, M., Rollini, M., Bergomi, S. And Cavazzoni, V. (1998). Production and purification of statin from Aspergillus terreus strains. Biotechnology Techniques, 12: 529-532 Manzoni, M., S. Bergomi, M. Rollini and V. Cavazzoni. (1999). Product of statins by filamentous fungi. Journal of Biotechnology, 21: 253-257 Maragos, C.M. and Thompson, V.S. (1999). Fiber-optic immunosensor for mycotoxins. Natural Toxins, 7(6):371-6. Maragou, N.C., Rosenberg, E., Thomaidis, N.S. and Koupparis, M.A. (2008) Direct determination of the estrogenic compounds 8-prenylnaringenin, zearalenone, alpha- and beta-zearalenol in beer by liquid chromatography-mass spectrometry. Journal of Chromatography A, 1202(1): 47-57 Marasas, W. F. O. (1996). Fumonisins: history, worldwide occurrence and impact. In L. S. Jackson, J. W. Devries and L. B. Bullerman (eds.). Fumonisins in Food. Plenum Press, New York, USA. Pp. 1-17 Marín, S., Magan, N., Ramos, A.J. and Sanchis, V. (2004). Fumonisin-producing strains of Fusarium: A review of their ecophysiology. Journal of Food Protection, 67(8): 1792- 1805 Marín, S., V. Sanchis, I. Vinas, R. Canela, and Magan, N. (1995). Effect of water activity and temperature on growth and fumonisin B1 and B2 production by Fusarium proliferatum and F. moniliforme in grain. Letters in Applied Microbiology, 21:298-301 Maron, D. J., Fazio, S. and Linton, M.F. (2000). Current perspectives on statins. Circulation, 101: 207–213 Martins, S., Aguilar, C.N., Teixeira, J.A. and Mussatto, S.I. (2012). Bioactive compounds (phytoestrogens) recovery from Larrea tridentata leaves by solvents extraction. Separation and Purification Technology, 88: 163–167 Mastura, M. (2008). Greenhouse gas emissions from a land use change activity during a haze episode in Southeast Asia. Journal of Social Sciences and Humanities, 3(1): 1-15
232
Matos, S.L, de-Paula, H., Pedrosa, M.L., dos-Santos, R.C., de-Oliveira, E.L., Chianca Júnior, D.A. and Silva, M.E. (2005). Dietary models for inducing hypercholesterolemia in rats. Brazillian Archives of Biology and Technology, 48(2): 203-209 Meca, G., Sospedra, I., Soriano, J.M., Ritieni, A., Moretti, A. and Manes, J. (2010). Antibacterial effect of the bioactive compound beauvericin produced by Fusarium proliferatum on solid medium of wheat. Toxicon, 56: 349-354 Meier, C.R., Schlienger, R.G., Kraenzlin, M.E., Schlegel, B. and Jick, H. (2000). HMG-CoA reductase inhibitors and the risk of fracture. Journal of American Medical Association, 283: 3205-3210 Merck and Co. (1987). The scientific search for an effective weapon against cholesterol. Press Release, Rahway, New Jersey, USA Meyer, B.N., Ferrigni, N.R., Putnam J.E., Jacobsen, J.E., Nichols, D.E. and MaLaughlin, J.L. (1982). Brine shrimp: A convenient general bioassay for active plants constituents. Journal of Medicinal Plants Research, 45: 31-34 Ministry of Health Malaysia. (2010). Number of discharges and deaths on government hospitals (Putrajaya: Health Informatics Centre, Planning and Development Division). Mitchell, D.A., Greenfield, P.F. and Doelle, H.W. (1986). A model substrate for solid-state fermentation. Biotechnology Letters, 8(11): 827-832 Mitchell, D.A., Krieger, N. and Beroviĉ, M. (2006). Solid-state bioreactors: Fundamental of design and operation. Springer-Verlag Berlin Heidelberg, New York, USA. Pp. 1, 33- 44, 47, 50 Miyake, T., Uchitomi, K., Zhang, M.Y., Kono, I., Nozaki, N., Sammoto, H and Inagaki, K. (2006). Effects of the principal nutrients on lovastatin production by Monascus pilosus. Bioscience, Biotechnology, and Biochemistry, 70(5): 1154-1159 Moghadasian, M.H. (2002). Experimental atherosclerosis: a historical overview. Life Sciences Journal, 70 (8): 855-65 Moghadasian, M.H., Frolich, J.J., McManus, B.M. (2001). Advances in experimental dislipidemia and atherosclerosis. Laboratory Investigation, 81: 1173–83 Mohammad Faseleh, J., Juan, B.L., Yin, W.H., Rosfarizan, M., Yong, M.G. and Parisa, S. (2012). Lovastatin production by Aspergillus terreus using agro-biomass as substrate in solid state fermentation. Journal of Biomedicine and Biotechnology, doi: 10.1155/2012/196264 Mohd Esa, N., Ling, T.B. and Peng, L.S. (2013). By-product of rice processing: An overview of health benefits and applications. Journal of Rice Research, 1:1 Mohd Esa, N., Abdul Kadir, K.K., Amom, Z. and Azlan, A. (2011). Improving the lipid profile in hypercholesterolemia-induced rabbit by supplementation of germinated brown rice. Journal of Agricultural and Food Chemistry, 59: 7985-7991
233
Monaghan, R. L., Alberts, A. W., Hoffman, C. H. and Alberts-Schonberg, G. (1980). Hypercholesterolemic fermentation products and process of preparation US Patent 4, 231, 938 Mori,K., Kobayashi, C. Tomita, T. Inatomi, S. and Ikeda, M. (2008). Antiatherosclerotic effect of the edible mushrooms Pleurotus eryngii (Eringi), Grifola frondosa (Maitake), and Hypsizygus marmoreus (Bunashimeji) in apolipoprotein E–deficient mice. Nutrition Research, 28 : 335-342 Muhamad Syahmi, A.R., Vijayarathna, S., Sasidharan, S., Latha, L.Y., Kwan, Y.P., Lau, Y.L., Shin, L.N. and Chen, Y. (2010). Acute oral toxicity and brine shrimp lethality of Elaeis guineensis Jacq., (Oil palm leaf) methanol extract. Molecules, 15: 8111-8121 Munimbazi, C. and Bullerman, L.B. (2001).Chromatographic method for the determination of the mycotoxin moniliformin in corn. Methods in Molecular Biology, 157: 131-45 Munkvold, G., Stahr, H.M., Logrieco, A., Moretti, A. and Ritieni, A. (1998). Occurrence of fusaproliferin and beauvericin in Fusarium-contaminated livestock feed in Iowa. Applied and Environmental Microbiology, 64(10): 3084-3088 Munkvold, G.P. (2003).Cultural and genetic approaches to managing mycotoxins in maize. Annual Review of Phytopathology, 41: 99-116 Murthy, M.V.R., Karanth, N.G. and Rao, K.S.M.S.R. (1993). Biochemical Engineering Aspects of Solid-State Fermentation. Advances in Applied Microbiology, 38: 99-147 Nandakumar, M.P., Thakur, M.S., Raghava Rao, K.S.M.S. and Ghildyal, N.P. (1996). Substrate particle size reduction by Bacillus coagulans in solid-state fermentation. Enzyme and Microbial Technology, 18:121-125. National Cardiovascular Disease Database Malaysia. Inaugural report of the acute coronary syndrome registry. (2008). [Online]. [January, 2014]. http://www.acrm.org.my/ncvd/documents/1stAnnualReport/20081013_ncvdACSRRepo rt.pdf Nigam, P.S. (2005). Production of bioactive seconday metabolites, In: P.S. Nigam, A. Pandey (Eds.). Biotechnology for Agroindustrial Residues Utilization, Springer, Netherlands. Pp. 129-14 Nigović, B., Mornar, A. and Sertić, M. (2012). A review of current trends and advances in analytical methods for determination of statins: Chromatography and capillary electrophoresis. In: Chromatography-The Most Versatile Method of Chemical Analysis. Pp. 385-390 Nilanonta, C., Isaka, M., Kittakoop, P., Palittapongarnpim, P., Kamchonwaongpaisan, S., Pittayakhajonwut, D., Tanticharoen, M. and Thentaranonth, Y. (2000). Antimycobacterial and antiplasmodial cyclodepsipeptides from the insect pathogenic fungus Paecilomyces tenuipes BCC1614. Planta Medica, 66: 756-758
234
Nirenberg, H.I. (1976). Untersuchungen über die morphologische und biologische differenzierung in der Fusarium Sektion Liseola. Mitt Biol Bundesanstalt Land- For ,169: 1–117. Nirenberg, H.I. and O'Donnell, K. (1998). New Fusarium species and combinations within the Gibberella fujikuroi species complex. Mycologia, 90: 434-458 Nor Azliza, I. (2008). Diversity, mycotoxin profiles and mating populations of Fusarium associated with non-agricultural grasses in peninsular Malaysia. Msc Thesis, Universiti Sains Malaysia, Malaysia Nur Ain Izzati, M.Z. (2007). Diversity of Fusarium species associated with bakanae disease of rice in Malaysia and Indonesia. Phd Thesis, Universiti Sains Malaysia, Malaysia O’Donnell, K., Cigelnik, E. and Casper, H.H. (1998). Molecular phylogenetic, morphological, and mycotoxin data support reidentification of the quorn mycoprotein fungus as Fusarium venenatum. Fungal Genetics and Biology, 23(1): 57-67 O’Donnell, K.O., Kistler, H.C., Cigelnik, E. and Ploetz, R.C. (1998). Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proceedings of the National Academy of Sciences, 95: 2044-2049 Ong, G. A. L., Suraini, A. A., Mohd Ali, H. and Mohamed Ismail, A. K. (2004). Effect of inoculum size and moisture content for the production of mannanase by Aspergillus niger in palm kernel cake under solid substrate fermentation condition. Proceedings of International Seminar on Solid State Fermentation, 4-6 October 2004, Penang, Malaysia Onyeike, E.N., Olungwe, T. and Uwakwe, A.A. (1995). Effect of heat treatment and defatting on the proximate composition of some Nigerian local soup thickeners. Food Chemistry, 53: 173-175 Oriol, E., Schettino. B., Viniegra-Gonzalez. G. and Raimbault, M. (1988). Solid- state culture of Aspergillus niger on support. Journal of Fermentation Technology, 66: 57-62. Osman, M.E., Khattab, O.H., Zaghlol, G.M., Abd El-Hameed, R.M. (2011). Screening for the production of cholesterol lowering drugs (lovastatin) by some fungi. Australian Journal of Basic and Applied Sciences, 5(6): 698-703 Pal, A., Acharya, D., Saha, D. and Dhar, T.K. (2004). Development of a membrane-based immunofiltration assay for the detection of T-2 toxin. Analytical Chemistry, 76 (14),: 4237–4240 Pallaroni, L.L. and von Holst, C. (2003). Determination of zearalenone from wheat and corn by pressurized liquid extraction and liquid chromatography-electrospray mass spectrometry. Journal of Chromatography A, 993(1-2):39-45. Pampel, F.C. and Pauley, S. (2004). Progress Against Heart Disease. Connecticut, USA: Praeger Publishers. Pp. 11
235
Panda, B.P., Javed, S. and Ali, M. Optimization of fermentation parameters for higher lovastatin production in red mold rice through co-culture of Monascus purpureus and Monascus ruber. (2010). Food and Bioprocess Technology, 3(3): 373– 378 Panda, B.P., Javed, S., Ali, M. (2009). Engineering rice based medium for production of lovastatin with Monascus species. Czech Journal of Food Sciences, 27(5): 352-360 Pandey A. (2004). Concise Encyclopedia of Bioresource Technology. Food Products Press, New York, USA Pandey, A. (2003). Solid-state fermentation. Biochemical Engineering Journal, 13: 81-84 Pandey, A., Soccol, C. and Mitchell, D. (2000). New developments in solid state fermentation: I bioprocess and product. Process Biochemistry, 35: 1153-1169 Pandey, A., Soccol, C. R., Rodriguez, L.J. and Nigam, P. (2001). Solid-state Fermentation in Biotechnology, New Delhi : Asiatech Publishers. Pp. 221. Pandey, A., Soccol, C.R. and Larrroche, C. (2008). Current Developments in Solid-state Fermentation, New Delhi: Springer. Pp. 13-25 Pandey, A., Soccol, C.R., Nigam, P. and Soccol, V.T. (2000). Biotechnological potential of agro-industrial residues. I: sugarcane bagasse. Bioresource Technology, 74(1): 69-80 Pang, P.K. (2010). Production of cellulose and xylanase by indigenous Aspergillus niger AI-1 via solid substrate fermentation and its application in deinking of mixed office waste paper. Phd Thesis, Universiti Sains Malaysia, Malaysia Pansuriya, R.C. and Singhal, R.S. (2009). Supercritical fluid extraction of lovastatin from the wheat bran obtained after solid state fermentation. Food Technology and Biotechnology, 47, 159-165 Pansuriya, R.C.and Singhal, R.S. (2010). Response surface methodology for optimization of production of lovastatin by solid state fermentation. Brazilian Journal of Microbiology, 41(1): 164-172 Pérez-Guerra, N., Torrado-Agrasar, A., López-Macias, C. and Pastrana, L. (2003). Main characteristics and applications of solid substrate fermentation. Electronic Journal of Environmental, Agricultural and Food Chemistry, 2(3): 343-350. Platnner, R.D., Weisleder, D., Shackelford, D.D., Peterson, R. and Powell, R.G. (1992). A new fumonisin from solid cultures of Fusarium moniliforme. Mycopathologia, 117: 23- 28 Prabhakar, A., Krishnaiah, K., Janaun, J. and Bono, A. (2005). An overview of engineering aspects of solid state fermentation. Malaysian Journal of Microbiology, 1(2): 10-16
236
Prabhakar, M., Lingappa, K., Babu, V., Vishalakshi, A.S. and Mahesh, D. (2012). Production by Aspergillus terreus KLVB28mu21 under solid state fermentation. Journal of Recent Advances in Applied Sciences, 27: 01-05 Raghava Rao, K.S.M.S., Ranganatham, T.V. and Karanth, N.G. (2003). Some engineering aspects of solid-state fermentation, Biochemical Engineering Journal, 13, 127-135. Ragheva Rao, K.S.M.S., Gowthaman, M.K., Ghildyal, N.P. and Karanth, N.G. (1993). A mathematical model for solid state fermentation in tray bioreactors. Bioprocess Engineering, 8:255–262. Raghunath, R., Radhakrishna, A., Angayarkanni, J. and Palaniswamy, M. (2012). Production and cytotoxicity studies of lovastatin from Aspergillus niger PN2 an endophytic fungi isolated from Taxus baccata. International Journal of Applied Biology and Pharmaceutical Technology, 3(3): 343-351 Rahardjo, Y.S.P., Tramper, J. and Rinzema, A. (2006). Modeling conversion and transport phenomena in solid-state fermentation: A review and perspectives. Biotechnology Advances, 24(2): 161-179 Raimbault, M. (1998). General and microbiological aspects of solid substrate fermentation. EJB Electronic Journal of Biotechnology, 1(3) Rajagopalan, S. and Modak, J.M. (1995). Modeling of heat and mass transfer for solid state fermentation process in tray bioreactor. Bioprocess Engineering, 13: 161–169. Rajani, M. and Kanaki, N. S. (2008). Phytochemical standardization of herbal drugs and polyherbal formulations. Bioactive Molecules and Medicinal Plants, 349-369 Ramachandran, S. Patel, A.K., Nampoothiri, K.M., Chandran, S., Szakacs, G., Soccol, C.R. and Pandey, A. (2004), Alpha amylase from a fungal culture grown on oil cakes and its properties. Brazilian Archives of Biology and Technology, 47, 309-317. Reddy, D.S.R., Latha, D.P. and Latha, K.P.J. (2011). Production of lovastatin by solid state fermentation by Penicillium funiculosum NCIM 1174. Drug Invention Today, 3(6): 75- 77 Reddy, S.M., Reddy, S.S. and Narendra, B.G. (2012). Basic Industrial Biotechnology: History of Industrial Microbiology. New Age International Publishers Ltd, New Delhi, India. Pp. 1-3 Rheeder, J.P., Marasas, W.F.O. and Vismer, H.F. (2002). Production of fumonisin analogs by Fusarium species. Applied and Environmental Microbiology, 68: 5 2101-2105 Rheeder, J.P., Marasas, W.F.O., Thiel, P.G., Sydenham, E.W., Shephard, G.S. and Van Schalkwyk, D.J. (1992). Fusarium moniliforme and fumonisins in corn in relation to human oesophageal cancer in Transkei. Phytopathology, 82: 353-357
237
Rizna, T.D., Nina, A., H., M., Puspa, D.N.L. and Minarti. (2011). Production of lovastatin and sulochrin by Aspergillus terreus using solid state fermentation. Makara Teknologi, 15(1): 1-4 Robinson, T. and Nigam, P. (2003), Bioreactor design for protein enrichment of agricultural residues by solid-state fermentation. Biochemical Engineering Journal, 13, 197-203. Rodriguez-Leon, J.A., Soccol, C.R., Pandey, A., Rodriguez, D.E. (2008). Factors affecting solid-state fermentation. In: A. Pandey, C.R. Soccol, C. Larroche, (Eds.). Current Development in Solid-state Fermentation, New Delhi: Springer. Pp. 27-46 Roohinejad, S., Omidizadeh, A., Mirhosseini, H., Saari, N., Mustafa, S., Yusof, R.M., Hussin, A.S., Hamid, A. and Abd Manap, M.Y.(2010). Effect of pre-germination time of brown rice on serum cholesterol levels of hypercholesterolaemic rats. Journal of Science of Food and Agriculture, 90(2): 245-251 Rosenson, R.S. and Tangney, C.C. (1998). Antiatherothrombotic properties of statins: implications for cardiovascular event reduction. Journal of the American Medical Association, 279: 1643–50 Sameerah, S.A.R. and Sarojini, S. (2007). Malaysian statistics on medicine 2005. (Kuala Lumpur: Pharmaceutical Services Division and the Clinical Research Centre Samiee, S.M., Moazamin, N., Haghighi, S., Mohseni, F.A., Mirdamadi, S. and Bakhtiari, M.R. (2003). Screening of lovastatin production by filamentous fungi. Iranian Biomedical Journal,7(1): 29-33 Schneider, E., Usleber, E., Märtlbauer, E., Dietrich, R. and Terplan, G. (1995). Multimycotoxin dipstick enzyme immunoassay applied to wheat. Food Additives and Contaminants, 12(3):387–393. Scirica, B.M. and Cannon, C.P. (2005). Treatment of elevated cholesterol. Circulation, 111: e360-e363 Sekar, C. and Balaraman, K. (1998). Optimization studies on the production of cyclosporine A by solid state fermentation. Bioprocess Engineering, 18: 293-296 Seraman, S., Rajendran, A. and Thangavelu, V. (2009). Response surface optimization of mixed substrate solid state fermentation for the production of lovastatin by Monascus purpureus. Engineering in Life Sciences, 9(4): 303-310 Seraman, S., Rajendran, A. and Thangavelu, V. (2010). Statistical optimization of anticholesterolemic drug lovastatin production by the red mold Monascus purpureus. Food and Bioproducts Processing, 88: 266-276 Sermanni, G.G. and Tiso, N. (2008). Aspects of design of bioreactors in SSF. In: A. Pandey, C. Larrroche, C.R. Soccol (Eds.). Current Developments in Solid-state Fermentation, New Delhi: Springer. Pp. 117-139
238
Shaligram, N.S., Singh, S.K., Singhal, R.S., Pandey, A. and Szakacs, G. (2009). Compactin production studies using Penicillium brevicompactum under solid-state fermentation conditions. Applied Biochemistry and Biotechnology,159: 505-520 Shepard, G.S., Sydenham, E.W., Thiel, P.G. and Gelderblom, W.C.A. (1990). Quantitative determination of fumonisin B1 and B2 by high performance liquid chromatography with fluorescence detection. Journal of Liquid Chromatography, 13: 2077-2087 Shephard, G.S. (2001). Liquid chromatographic method for fumonisins in corn. Methods in Molecular Biology, 157: 147-58 Shephard, G.S., Marasas, W.F.O., Leggot, N.L., Yazdanpanah, H., Rahimian, H. and Safavi, N. (2000). Natural occurrence of fumonisins in corn from Iran. Journal of Agricultural and Food Chemistry, 48: 1860-1864 Shin, C.G., An, D.G., Song, H.H. and Lee, C. (2009). Beauvericin and enniantins H, I and MK1688 are new potent inhibitors of human immunodeficiency virus type-1 integrase. Journal of Antibiotics, 62: 687-690 Shindia, A.A. (1997). Mevinolin production by some fungi. Folia Microbiologica, 42: 477-480. Shu, C.H. (2007). Fungal fermentation for medicinal products. In: S.T. Yang (Eds.). Bioprocessing for Value-Added Products from Renewable Resources, Elsevier, Amsterdam. Pp. 447–463. Singgih, M., Saraswaty, V., Ratnaningrum, D., Priatni, S. and Damayantia, S. (2014). The influence of temperature and ethanol concentration in monacolin K extraction from monascus fermented rice. Procedia Chemistry, 9: 242 – 247 Singhania, R.R., Patel., A.K., Soccol, C.R., and Pandey, A. (2009). Recent advances in solid- state fermentation. Biochemical Engineering Journal, 44: 13-18 Siti Nordahliawate, M.S. (2007). Pathogenicity and aetiology of Fusarium species associated with pokkah boeng disease on sugarcane. Msc. Thesis, Universiti Sains Malaysia, Malaysia Sivaramakrishnan, S., Gangadharan, D., Nampoothiri, K.M., Soccol, C.R. and Pandey, A. (2007). Alpha amylase production by Aspergillus oryzae employing solid-state fermentation. Journal of Scientific and Industrial Research, 66: 621-626 Sleet, R.B. and Brendel, K. (1983). Improved methods for harvesting and counting synchronous populations of Artemia nauplii for use in developmental toxicology. Ecotoxicology Environmental Safety, 7:435-446. Smith, J.S., Fotso, J., Leslie, J.F., Wu, X., van der Velde, D. and Thakur, R.A. (2004). Characterization of bostrycoidin: An analytical analog of zearalanone. Journal of Food Science , 69: 227-232
239
Smits, J. P., Rinzema, A., Tramper, J., van Sonsbeek, H. M. and Knol, W. (1996). Solid-state fermentation of wheat bran by Trichoderma reesei QM9414: Substrate composition changes, C balance, enzyme production, growth and kinetics. Applied Microbiology and Biotechnology, 46, 489-496 Smits, J.P., van Sonsbeek, H.M., Tramper, J., Knol, W., Geelhoed, W., Peeters, M. and Rinzema, A. (1999). Modelling fungal solid-state fermentation: the role of inactivation kinetics. Bioprocess Engineering, 20(5): 391-404 Sopterean, L.M. and Puia, C. (2012). The major mycotoxins produced by Fusarium fungi and their effects. ProEnvironment, 5: 55-59. Sorgeloos, P., Remiche-Van Der Wielen, C. and Persoone, G. (1978). The use of Artemia nauplii for toxicity test. A critical analysis. Ecotoxical Environmental Safety, 2: 249-255 Sreenivasan, A., Subhagar, S., Aravindan, R. and Viruthagiri, T. (2008). Microbial production and biomedical applications of lovastatin. Indian Journal Pharmaceutical Sciences, 70(6): 701-709 Stuart, D.M. and Mitchell, D.A. (2003). Mathematical model of heat transfer during solid- state fermentation in well-mixed rotating drum bioreactors. Journal of Chemical Technology and Biotechnology, 78(1): 1180-1192 Subhagar, S., Aravindan, R. and Viruthagiri, T. (2009). Response surface optimization of mixed substrate solid state fermentation for the production of lovastatin by Monascus purpureus. Engineering in Life Sciences, 9(4): 303-310 Subhagar, S., Aravindan, R. and Viruthagiri, T. (2010). Statistical optimization of anticholesterolemic drug lovastatin production by the red mold Monascus purpureus. Food and Bioproducts Processing, 88: 266-276 Subramaniyam, R. and Vimala, R. (2012). Solid state and submerged fermentation for the production of bioactive substances: A comparative study. International Journal of Science and Nature, 3(3): 480-486 Suryanarayan, S. (2003). Current industrial practice in solid state fermentations for secondary metabolite production: the Biocon India experience. Biochemical Engineering Journal, 13: 189–195. Suzuki, T., Munakata, Y., Morita, K., Shinoda, T. and Ueda, H. (2007). Sensitive detection of estrogenic mycotoxin zearalenone by open sandwich immunoassay. Analytical Chemistry, 23(1): 65-70 Swift, M.J. (1973) The estimation of mycelial biomass by determination of the hexosamine content of wood tissue decayed by fungi. Soil Biology and Biochemistry, 5:321–332 Szakacs, G., Morovjan, G. and Tengerdy, R.P. (1998). Production of lovastatin by a wild strain of Aspergillus terreus. Biotechnology Letters, 20(4): 411-415
240
Tahira, R., Ata-ur-Rehman and Butt, M.A. (2007). Characterization of rice bran oil. Journal of Agricultural Research, 45(3): 225-230 Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. and Kumar, S. (2011). MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution, 28(10): 2731-2739 Tanaka, T., Yoneda, A., Inoue, S., Dugiura, Y. and Ueno, Y. (2000). Simultaneous determination of trichothecene mycotoxins and zearalenone in cereals by gas chromatography-mass spectrometry. Journal of Chromatography A,888(1): 23-28 Tembhurne, S.V. and Sakarkar, D.M. (2011). Antiamnesic effect of petroleum ether extract of Murraya koenigii (Linn) leaves involving possible anticholinesterase and cholesterol lowering mechanism. Asian Journal of Pharmaceutical and Clinical Research, 4(1): 155-160 The Malaysian Economy in Figures. Key Economic Indicators. (2013). [Online]. [January, 2014]. http://www.epu.gov.my/documents/10124/1e9cd2e5-67a8-4b6c-b530- b1448a6a1475 Thibault, J., Pouliot, K., Agosin, E. and Pérez-Correa, R.. (2000). Reassessment of the estimation of dissolved oxygen concentration profile and KLa in solid-state fermentation. Process Biochemistry, 36:9-18. Thomas, R., Wan-Nadiah, W.A. and Bhat, R. (2013). Physiochemical properties, proximate composition, and cooking qualities of locally grown and imported rice varieties marketed in Penang, Malaysia. International Food Research Journal, 20(3): 1345-1351 Timby, B.K. (2009). Fundamental Nursing Skills and Concepts (9th ed). Lippincott Williams & Wilkins, Philadelphia, USA. Pp. 289 Tobert, J.A. (2003). Lovastatin and beyond: The history of the HMG CoA reductase inhibitors. Nature Reviews Drug Discovery, 2: 517-526 Toca-Herrera, J.L., Osma, J.F. and Couto, S.R. (2007). Potential of solid-state fermentation for laccase production. In: A. Mendez-Vilas. Communicating Current Research and Educational Topics and Trends in Applied Microbiology (Eds.). Formex, Badajoz, Spain. Pp: 391-400. Tsuji, A., Kinoshita, T. and Hoshino, M. (1969) Analytical chemical studies on amino sugars II: determination of hexosamines using 3-methyl-2-benzothiazolone hydrazone hydrochloride. Chemical and Pharmaceutical Bulletin, 17:1505–1510 Tunga, R., Banerjee, R. and Bhattacharya, B.C. (1998). Optimizing some factors affecting protease production under solid state fermentation. Bioprocess engineering, 19:187-90. Twana, A.T. and Fauziah, S.H. (2012). Vermicomposting of two types of coconut wastes employing Eudrilus eugeniae: a comparative study. International Journal Of Recycling of Organic Waste in Agriculture, 1: 7
241
United State Food and Drug Administration, FDA: FDA Drug Safety Communication: Important safety label changes to cholesterol-lowering statin drugs (2012). [Online]. [January, 2014]. http://www.fda.gov/drugs/drugsafety/ucm293101.htm Valera, H.R., Gomes, J., Lakshmi, S., Gururaja, R., Suryanarayan, S and Kumar, D. (2005). Lovastatin production by solid state fermentation usingAspergillus flavipes. Enzyme and Microbial Technology, 37(5): 521-526 Van Hoed, V., Depaemelaere, G., Vila Ayala, J., Santiwattana, P., Verhe, R. and De Greyt, W. (2006). Influence of chemical refining on the major and minor components of rice brain oil. Journal of the American Oil Chemists' Society, 83(4): 315-321 Vardhan, A., Belwal, C., Venkateswarlu, P. and Balte, A.S. (2013). A process for purification of lovastatin, US patent EP2597092A1 Waites, M.J., Morgan, N.L., Rockey, J.S. and Hington, G. (2001). Industrial Microbiology: An Introduction. Oxford, United Kingdom: Blackwell Science Ltd. Pp. 46 Wan Ahmad, W.A., Zambahari, R., Ismail, O., Sinnadurai,J., Rosman, A., Piaw, C.Z., Abidin, I.Z. and Kui-Hian, S. (2011). Malaysian National Cardiovascular Disease Database (NCVD) - Acute Coronary Syndrome (ACS) Registry: How are we different? CVD Prevention and Control, 6: 81– 89 Wang, H., Wei, H., Ma, J. and Luo, X. (2000). The fumonisin B1 content in corn from North China, a high-risk area of oesophageal cancer. Journal of Environmental Pathology Toxicology and Oncology, 19: 139 – 141. Wang, Q. and Xu, L. (2012). Beauvericin, a bioactive compound produced by fungi: A short review. Molecules, 17: 2367-2377 Wanyo, P., Chomnawang, C., and Siriamornpun, S. (2009). Substitution of wheat flour with rice flour and rice bran in flake products: Effects on chemical, physical and antioxidant properties. World Applied Sciences Journal, 7(1): 49-56. Wei, P.L., Xu, Z.N. and Cen, P.L. (2007). Lovastatin production by Aspergillus terreus in solid-state fermentation. Journal of Zhejiang University SCIENCE A, 8(9): 1521-1526 Weiss, R., Freudenschuss, M., Krska, R. and Mizaikoff, B. (2003). Improving methods of analysis for mycotoxins: molecularly imprinted polymers for deoxynivalenol and zearalenone. Food Additives and Contaminants, 20(4): 386-95 Wells, J.H. (1993). Utilization of rice bran and oil in human diets, Louisiana Agriculture, 36:5–8 Wilson, T.A., Idreis, H.M., Taylor, C.M. and Nicolosi, R.J. (2002). Whole fat rice bran reduces the development of early aortic atherosclerosis in hypercholesterolemic hamsters compared with wheat bran. Nutrition Research, 22(11): 1319-1332 Wingfield, M.J., Hammerbacher, A., Ganley, R.J., Steenkamp, E.T., Gordon, T.R., Wingfield, B.D. and Coutinho, T.A.. (2008). Pitch canker caused by Fusarium circinatum – a
242
growing threat to pine plantations and forests worldwide. Australasian Plant Pathology, 37. 319–334. World Health Organization. Cardiovascular disease: Controlling high blood pressure (2013). [Online]. [January, 2014]. http://www.who.int/cardiovascular_diseases/en/ World Health Organization. WHO guidelines for assessing quality of herbal medicines with reference to contaminants and residues. (2007). [Online]. [January, 2014]. http://apps.who.int/medicinedocs/documents/s14878e/s14878e.pdf Xu, B.J., Wang, Q.J., Jia, X.Q. and Sung, C.K. (2005). Enhanced lovastatin production by solid state fermentation of Monascus ruber. Biotechnology and Bioprocess Engineering, 10(1): 78-84 Zamvil, S.S. and Steinman, L (2002). Cholesterl-lowering statins possess anti-inflammatory activity that might be useful for treatment of MS. Neurology, 59: 970-971 Zhang Z.C., Lian B., Huang D.M. and Cui F.J. (2009). Compare activities on regulating lipid- metabolism and reducing oxidative stress of diabetic rats of Tremella aurantialba broth's extract (TBE) with its mycelia polysaccharides (TMP). Journal of Food Science, 74(1):15-21 Zhang, L., Yan, K., Zhang, Y., Huang, R., Bian, J., Zheng, C., Sun, H., Chen, Z., Sun, N., An, R., Min, F., Zhao, W., Zhuo, Y., You, J., Song, Y., Yu, Z., Liu, Z., Yang, K., Gao, H., Dai, H., Zhang, X., Wang, J., Fu, C., Pei, G., Liu, J., Zhang, S., Goodfellow, M., Jiang, Y., Kuai, J., Zhou, G. and Chen, X. (2007). High-throughput synergy screening identifies microbial metabolites as combination agents for the treatment of fungal infections. Proceedings of National Academy of Science, USA, 104: 4606- 4611 Zhang, W., Wang, H., Wang, J., Li, X., Jiang, H. and Shen, J. (2006). Multiresidue determination of zeranol and related compounds in bovine muscle by gas chromatography/mass spectrometry with immunoaffinity cleanup. Journal of AOAC International, 89(6): 1677-1681
243
APPENDICES
APENDIX 1
1.2 y = 9.944x + 0.053 R² = 0.983 1
0.8
0.6
0.4
Absorbance at 530 nm 530 at Absorbance 0.2
0 0 0.02 0.04 0.06 0.08 0.1 0.12 Amount of glucosamine (mg/mL)
Glucosamine standard curve used for fungal growth estimation
APENDIX 2
y = 9.99e+004x + 4.75e+003 R2 = 0.97
Standard curve for lovastatin determination
244
APENDIX 3
2 y = 0.310x + 0.107 R² = 0.976 1.6
1.2
0.8
0.4 Absorbance at 570 nm 570 at Absorbance
0 0 1 2 3 4 5 Amount of cholesterol (µg)
Cholesterol standard curve for LDL and HDL determination in rats’ blood
245
APENDIX 4
Media for species identification
1. Carnation leaf agar (CLA) (Fisher et al., 1982) The leaves were cut into 5 to 8 mm and placed onto 2% water agar
2. Water agar (WA) (Burgess et al., 1994) Agar 20 g Distilled water 1000 Ml
3) Potato dextrose agar (PDA) (Booth, 1971) Potato 250 g Dextrose 20 g Agar 20 g Distilled water 1000 mL
4) Spezieller Nährstoffarmer agar (Nirenberg, 1976)
KH2PO4 1g KNO3 1g MgSO4.7H2O 0.5g KCl 0.5g Glucose 0.2g Sucrose 0.2g Agar 20g H2O 1L
246
APENDIX 5
Corn grit sample without F. pseudocircinatum IBRL B3-4 for BEA test
APENDIX 6
Corn grit sample without F. pseudocircinatum IBRL B3-4 for FUM B1 test
247
APENDIX 7
Corn grit sample without F. pseudocircinatum IBRL B3-4 for MON test
APENDIX 8
25000000 y = 2E+06x - 1E+06 R² = 0.985 20000000
15000000
10000000
Area (uv*sec) Area 5000000
0 0 2 4 6 8 10 12 -5000000 Concentration of beauvericin (µg/mL)
Standard curve used for BEA determination
248
APENDIX 9
25000000 y = 2E+07x - 4E+06 R² = 0.993 20000000
15000000
10000000
Area (uv*sec) Area 50000000
0 0 2 4 6 8 10 12 -5000000 Concentration of fumonisin (µg/mL)
Standard curve used for FUM determination
APENDIX 10
1000000 y = 76576x + 58390 R² = 0.981 800000
600000
400000 Area (uv*sec) Area
200000
0 0 2 4 6 8 10 12 Concentration of moniliformin (µg/mL)
Standard curve used for MON determination
249
APENDIX 11
20.00
18.00 A 16.00
mV 14.00
12.00
10.00
8.00
1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 Minutes Chromatogram peak for ratio 10:0 (dichloromethane: ethyl acetate)
8.40 B
8.20 mV 8.00
7.80
1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 Minutes Chromatogram peak for ratio 9:1 (dichloromethane: ethyl acetate)
249
Continuation…
50.00 C
40.00
30.00 mV
20.00
10.00
1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 Minutes Chromatogram peak for ratio 8:2 (dichloromethane: ethyl acetate)
9.00 D
8.50
8.00
mV Lactone - - 8.039 Lactone
7.50
7.00
6.50 1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 Minutes Chromatogram peak for ratio 7:3 (dichloromethane: ethyl acetate)
250
Continuation…
E
40.00 mV
20.00
1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 Minutes Chromatogram peak for ratio 6:4 (dichloromethane: ethyl acetate)
11.00 F 10.50
10.00
mV 9.50
9.00
8.50
1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 Minutes Chromatogram peak for ratio 5:5 (dichloromethane: ethyl acetate)
251
Continuation…
12.00 G
11.00
mV 10.00
9.00
8.00 1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 Minutes Chromatogram peak for ratio 4:6 (dichloromethane: ethyl acetate)
10.00 H
9.50
mV 9.00
8.50
1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 Minutes Chromatogram peak for ratio 3:7 (dichloromethane: ethyl acetate)
252
Continuation…
9.50 I
9.00 mV
8.50
8.00 1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 Minutes Chromatogram peak for ratio 2:8 (dichloromethane: ethyl acetate)
10.50 J 10.00
9.50 mV 9.00
8.50
8.00 1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 Minutes
Chromatogram peak for ratio 1:9 (dichloromethane: ethyl acetate)
253
Continuation…
11.00 K
10.00 mV
9.00
1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 Minutes Chromatogram peak for ratio 0:10 (dichloromethane: ethyl acetate)
254
APENDIX 12
255