EUBACTERIAL ENDOSYMBIONTS of the FUNGUS PISOLITHUS TINCTORIUS a University Thesis Presented to the Faculty of California State

EUBACTERIAL ENDOSYMBIONTS OF THE

FUNGUS PISOLITHUS TINCTORIUS

A University Thesis Presented to the Faculty

California State University East Bay

In Partial Fulfillment

of the Requirements for the Degree

Master of Science in Biological Science

Kaushalya Nadi Tillakarathna

December 2016

Abstract

The fungus Pisolithus tinctorius is a common inhabitant of Yellowstone National Park geothermal soils and appear to have formed symbiotic relationships with a diverse group of bacterial species to satisfy their nutritional and energy needs. In this study, I was able to isolate and identify 34 different eubacteria from three phyla from within the fruiting body of P. tinctorius from Yellowstone National Park. Five are members of the phylum

Actinobacteria, four are members of the phylum Proteobacteria and twenty-five are members of the phylum Firmicutes. Fluorescent in situ hybridization (FISH) using probes for both eubacteria and archaea, I confirmed the presence and provided a visual idea of the localization of eubacterial and archaea endosymbionts present within the tissues of fruiting body P. tinctorius. At this point, further metabolic studies are needed to confirm the role of each endosymbiotic bacterium found within the fungus P. tinctorius. The phylogenetic analysis of 16S rRNA gene sequence indicated that Piso NA-SE-3 isolate clustered with Paenibacillus species with a bootstrap value of 82 % and exhibited 16S rRNA gene sequence similarity of 96% with Paenibacillus cineris. The isolate Piso NP3-

KT 25 was closer to Corynebacterium species and clustered with a poor bootstrap value of 74 %. The isolate showed 16S rRNA gene sequence similarity of 88% with

Corynebacterium mucifaciens.

iii

EUBACTERIAL ENDOSYMBIONTS OF THE

FUNGUS PISOLITHUS TINCTORIUS

Kaushalya Nadi Tillakarathna

Approved: Date:

r '

a!fAA, YV1 t- fo.:;;t;;J Dr. Ann McPartland r 1

IV Acknowledgements

I would first like to thank my professor and mentor, Dr. Carol Lauzon at

California State University East Bay, for all the advice, support and encouragement offered to me during my thesis project. Thank you for been patient with me. I would have been lost without your help. Also, thank you for letting me participate in an opportunity of a lifetime. I would also like to thank Dr. Ken Cullings at Astrobiology department,

NASA Ames research center, Mountain View, California for all his time and expertise.

Thank you to all my thesis committee members, Dr. Maria Gallegos and Dr. Ann

McPartland for their expert analysis of my thesis research. Finally, I would like to express my gratitude towards my parents, my aunt and my husband for their unconditional love, support, and encouragements. I would not have gotten to the point I am at today without anyone of you. This work was generously funded by the Astrobiology department, NASA

Ames research center, Mountain View, California.

Table of Contents

Page

Abstract ...... iii

Acknowledgement ...... v

List of Figures ...... viii

List of Tables ...... xi

Chapter 1: Introduction  The Primitive Earth ...... 1  Hydrothermal Vents ...... 2  Symbiotic Interactions ...... 3  Kingdom Fungi ...... 7  Genus Pisolithus ...... 12  Pisolithus tinctorius ...... 12  Yellowstone National Park ...... 13  Objectives ...... 15  References ...... 15

Chapter 2: Bacterial Culturing  Introduction ...... 25  Bacterial Culture Media ...... 26  The 16S rRNA Gene ...... 26  Materials and Methods ...... 27  Results ...... 34  Discussion ...... 44  References ...... 51

Chapter 3: Phylogenetics  Introduction ...... 67  Basic Concepts ...... 68  Phylogenetic Tree Construction Methods ...... 69  Materials and Methods ...... 71  Results ...... 72  Discussion ...... 77  References ...... 78

Chapter 4: Fluorescent in situ Hybridization  Introduction ...... 81  Fluorescent in situ Hybridization (FISH) ...... 81  FISH in Microbiology ...... 82  Confocal Laser Scanning Microscopy ...... 84  Autoflorescence ...... 84  Materials and Methods ...... 85  Results ...... 88  Discussion ...... 104  References ...... 108

Chapter 5: Thesis Summary ...... 115

Complete References ...... 122

Appendix A ...... 154

Appendix B ...... 161

Appendix C ...... 194

Appendix D ...... 201

vii

List of Figures

Figure Heading Page number number 1 The four main divisions within the Kingdom fungi. 8

2 (A) The fungal body structure (B) The fungal life cycle. 10

3 (A) Landscape of Norris Geyser Basin in Yellowstone National 27 - 28 Park (B) and (C) Pisolithus tinctorius in Norris Geyser Basin (D) and (E) Interior of the P. tinctorius fruiting body.

4 Replica plating. 43

5 Tree of life. 68

6 Phylogenetic tree based on 16S rRNA sequences showing the 74 relationships between isolate PisoNA-SE-3 and related taxa.

7 Phylogenetic tree based on 16S rRNA sequences showing the 76 relationships between isolate Piso-NP3-KT-25 and related taxa.

8 P. tinctorius 10 sample, no probes (to detect autofluorescence) 90 (A) Laser 405nm (excitation), Emission spectra :420 - 600 nm (B) Laser 488 nm (excitation), Emission spectra :498 -676 nm (C) Laser 638 nm (excitation), Emission spectra: 650 -754 nm. With probe (D) NONEUB338 (negative control) with ALEXA 405. Laser 405 nm (excitation) Emission spectra :420 - 473 nm.

9 P. tinctorius sample 10, EUB338 with ALEXA 488. Laser 488 91 nm (excitation), Emission spectra :537 -557 nm. (A) Replicate 1 (B) Replicate 2 and (C) Replicate 3.

10 P. tinctorius sample 10, SRB385 with ALEXA 488. Laser 488 92 nm (excitation), Emission spectra: 537 -557 nm. (A) Replicate 1 (B) Replicate 2 and (C) Replicate 3.

11 P. tinctorius sample 10, HGC69a with ALEXA 405. Laser 405 93 nm (excitation), Emission spectra: 420 -473 nm. (A) Replicate 1 (B) Replicate 2 and (C) Replicate 3.

viii

List of Figures

Figure Heading Page number number 12 P. tinctorius NA4 sample, no probes (to detect autofluorescence) 94 (A) Laser 405nm (excitation), Emission spectra :420 -600 nm (B) Laser 488 nm (excitation), Emission spectra :498 -676 nm (C) Laser 638 nm (excitation), Emission spectra: 650 -754 nm. With probe (D) NONEUB338 (negative control) with ALEXA 405. Laser 405 nm (excitation) Emission spectra: 420 - 473 nm. 13 P. tinctorius sample NA4, EUB338 with ALEXA 488. Laser 488 95 nm (excitation), Emission spectra: 537 -557 nm. (A) Replicate 1 (B) Replicate 2 and (C) Replicate 3. 14 P. tinctorius sample NA4, SRB385 with ALEXA 488. Laser 488 96 nm (excitation), Emission spectra: 537 -557 nm. (A) Replicate 1 (B) Replicate 2 (C) Replicate 3. 15 P. tinctorius sample NA4, HGC69a with ALEXA 405. Laser 405 97 nm (excitation), Emission spectra: 420 -473 nm. (A) Replicate 1 (B) Replicate 2 and (C) Replicate 3. 16 P. tinctorius sample NA4, Actino 2 with ALEXA 405. Laser 405 98 nm (excitation), Emission spectra: 420 -473 nm. (A) Replicate 1 (B) Replicate 2 and (C) Replicate 3. 17 P. tinctorius sample NA4, MB1174 with ALEXA 488. Laser 488 99 nm (excitation), Emission spectra: 537 -557 nm. (A) Replicate 1 (B) Replicate 2 and (C) Replicate 3. 18 P. tinctorius NP-2-6 sample, no probes (to detect 100 autofluorescence) (A) Laser 405nm (excitation), Emission spectra :420 -600 nm (B) Laser 488 nm (excitation), Emission spectra :498 -676 nm(C) Laser 638 nm (excitation), Emission spectra: 650 -754 nm. With probe (D) NONEUB338 (negative control) with ALEXA 405. Laser 405 nm (excitation) Emission spectra: 420 - 473 nm. 19 P. tinctorius sample NP 2-6, EUB338 with ALEXA 488. Laser 101 488 nm (excitation), Emission spectra: 537 -557 nm. (A) replicate 1 (B) replicate 2 and (C) replicate 3.

List of Figures

Figure Heading Page number number 20 P. tinctorius sample NP 2-6, ARC915 with ALEXA 488. Laser 102 488 nm (excitation), Emission spectra: 537 -557 nm. (A) Replicate 1 (B) Replicate 2 and (C) Replicate 3. 21 P. tinctorius sample NP 2-6, MS821 with ALEXA 488. Laser 488 103 nm (excitation), Emission spectra: 537 -557 nm. (A) Replicate 1 (B) Replicate 2 and (C) Replicate 3.

List of Tables

Table Heading Page number number 1 Identification of isolated Actinobacteria from P. tinctorius 36 internal tissue samples based on partial 16S rRNA gene sequence. 2 Identification of isolated Proteobacteria from P. tinctorius 37 internal tissue samples based on partial 16S rRNA gene sequence. 3 Identification of isolated Firmicutes from P. tinctorius internal 38 - 42 tissue samples based on partial 16S rRNA gene sequence. 4 Homologous 16S rRNA sequences, with their accession 73 numbers for isolate Piso NA-SE-3. 5 Homologous 16S rRNA sequences, with their accession 75 numbers for isolate Piso-NP3-KT-25. 6 FISH probes used in this study targeting 16S rRNA or 23S 86 rRNA.

7 Spectral scan parameters. 88

CHAPTER 1

Introduction

The Primitive Earth:

The earth was formed approximately 4.5 billion years ago (Lal, 2008). The primitive earth environment was atypical than what we know today. The molted earth was hot, toxic, and constantly subjected to high pressure. The atmosphere was filled primarily with gases such as nitrogen (N2), carbon dioxide (CO2) (Hart, 1978), ammonia

(NH3), methane (CH4) water vapor (H2O) (Lal, 2008), hydrogen (H2) and hydrogen sulfide (H2S) (Miller, 1974). Oxygen, was devoid from the primitive earth environment

(Lal, 2008). In a very short period, the exact time is yet unknown, the hot molted earth cooled down and during the cooling down process, heavy materials sank and created the core of the earth, and lighter materials created the crust of the earth, and gases created the primary atmosphere (Lal, 2008). Meteoroid bombardments and volcanic explosions released water vapor and highly reduced gases into the environment that created a secondary atmosphere (Kasting, 1993). Over time, rain filled the ocean floors with water.

External and internal influences such as lightning discharges, UV radiation, cosmic rays, meteoroid bombardments and volcanic eruptions resulted in the creation of basic organic compounds from existent inorganic compounds (Kawamura, 2014). This notion has been supported by the production of variety of essential organic biomolecules in a laboratory by creating an artificial environment similar to primordial earth (Madigan et al., 1997;

Miller, 1953). The combination of water and organic molecules synthesis led to the first life forms on earth approximately 3.85-3.9 billion years ago (Lal, 2008).

The earliest forms of living organisms were unicellular prokaryotes, the Archaea, and they were hyperthermophilic, heterotrophic, autotrophic, and anaerobic. Most

Archaea reduced inorganic compounds that were readily available to satisfy their energy needs. Neither they needed any photosynthetic ability nor to become autotrophic until they exhausted the energy supplements (Woese, 1987). Approximately 3.5 billion years- old fossilized 'stromatolites' provide evidence of existence of microorganisms

(McNamara & Awramik, 1992; Schopf & Packer, 1987). These ancient microorganisms were more likely heat tolerant and similar to the microorganisms that occupies the modern day thermal environments (Madigan et al., 1997). Therefore, submarine hydrothermal vents, hot springs, geothermal pools, hot volcanic ridges are few of the relevant sites for understanding the origin of life since they provide chemical environments that are similar to primordial earth. One such environment is Yellowstone

National Park located in the United States and site where I collected P. tinctorius.

Hydrothermal Vents:

Hydrothermal vents have existed since early beginning of earth (Martin et al.,

2008) and are found in places that have volcanic activity. Examples of forms of hydrothermal vents are hot springs, geysers, fumaroles, and black/white smokers.

Typically, these sites are acidic, have high temperatures between 150º C -500º C, are rich with metals and gases such as, carbon dioxide (CO2), hydrogen (H2), nitrous oxide (N2O ), methane (CH4), and hydrogen sulfide (H2S) (Jones et al., 1983; Martin et al., 2008).

Many thermophilic archaea, thermophilic methanogens, thermophilic sulfur-oxidizing

and sulfur reducing Proteobacteria have been discovered from and near hydrothermal vents (Belkin et al., 1986; Jones et al., 1983; Kelley, 2001; Yamamoto and Takai, 2011).

Some of the bacteria found in hydrothermal vents can replicate and thrive at temperature as high as 121º C (Martin et al., 2008). The microbial communities dominating in and around the hydrothermal vents, geothermal pools and hot springs could provide indications as to the physiology and diversity of the earliest microbes on earth and provide insight into survival strategies and processes used by organisms that reside in what we consider “extreme environments”.

Symbiotic Interactions:

The success of insects over the natural history of the earth, for example, has been attributed in part to their partnerships with microorganisms. Similar successful mutualistic partnerships with microorganisms can be found in diverse environments.

Symbionts can be organized into two categories: ectosymbionts, in which bacteria remain externally attached to the host and endosymbionts in which bacteria reside inside a host

(Frey-Klett et al., 2011). Below are few examples of ectosymbiotic and endosymbiotic relationships.

1. Bacteria - human interactions: The human skin contains a diverse population of

microorganisms. Some of the resident bacteria secrete bacteriocins that have

antimicrobial properties that provide protection by limiting pathogenic bacterial

invasions (Wackett, 2008).

The gut microbiota contains approximately 300-500 different species

which play an important roles in host metabolism, immunity and disease

prevention (Guarner and Malagelada, 2003; Li et al., 2008). For example, bacteria

help in production of secondary bile acids and choline which help in host fat

absorption and fermentation of fiber into short chain fatty acids (Nicholson et al.,

2012).

+ CD4 T cells (TH1 and TH2 cells) are important in cell mediated immune

responses, specifically in destruction of pathogenic intracellular bacteria by

secretion of cytokines and chemokines (Janeway et al., 1997). The bacterium

Bacteroides fragilis is ubiquitous in gut and aids in correcting T cells deficiencies

through production of Zwitterionic polysaccharides (Mazmanian et al., 2005).

These polysaccharides are presented to T cells by bacteria to stimulate the

production of cytokines (Mazmanian et al., 2005).

Lactobacillus in the vagina can decrease frequency of sexually

transmitted diseases such as Gonorrhea (Antonio et al., 1999). In return, the

human skin, gut, and reproductive system provide shelter, protection, and food for

their symbionts.

2. Bacteria - plants interactions: The relationship between Rhizobium spp. and root

nodules of the legumes is an excellent example of endosymbiotic relationship and

one that has been studied extensively. The atmosphere contains approximately

78% of elemental nitrogen which is unusable for most organisms (Follett and

Hatfield, 2001). All the living organisms contain nitrogenous compounds and thus

nitrogen is vital for survival. The Rhizobium bacteria live inside the nodules of the

legume plants, and assist in atmospheric nitrogen fixation. Through an enzymatic

process, bacteria reduce atmospheric nitrogen (N2) to ammonia (NH3); the form

that plants can use in their metabolic process (Zahran, 1999). The presence of

Rhizobium spp., in legumes also provide an advantage when plants are faced with

competing other plants under limited nutrients (Van Der Heijden et al., 2006). In

return for all the services that are provided by Rhizobium, the plant provides

shelter, protection and sugars that are produced by photosynthesis (Van Der

Heijden et al., 2006).

3. Bacteria - algae interactions: Algae do not possess the ability to create Vitamin

B12 (Cobalamin) but some algal species have been found to be are rich with

Vitamin B12 (Croft et al., 2005). Through recent studies, it has been established

that bacteria associated with algae cells produce vitamin B12. In exchange for

vitamin B12, bacteria receive fixed carbon (Croft et al., 2005; Kazamia et al.,

2012).

4. Bacteria - fungal interactions: Bacteria and fungi create highly specific symbiotic

relationships that have direct effect on each other’s physiological and metabolical

requirements. These relationships are important and can be found in diverse

environments, such as, forests, agricultural lands, decomposing environments,

nutrient cycling, bioremediation, and in the food industry (Frey-Klett et al., 2011).

Fungi are heterotrophic and unable to fix neither carbon nor nitrogen by themselves. In some cases, photosynthetic cyanobacteria living within a fungus provide fixed carbon and nitrogen- fixing bacteria provide useable nitrogen to the fungus (Kluge et al., 1991).

Some endosymbiotic bacteria stimulate fungal spore production, suppress fungal pathogens (Frey-Klett et al., 2011), enhance the fungal viability under unfavorable soil conditions (Brulé et al., 2001) and are capable of secreting secondary metabolite such as auxofuran which promotes fungal mycelium growth

(Frey-Klett et al., 2011). In return, fungi provide, water, minerals, food, protection, biotic support and act as a vector for transportation of bacteria into new territories

(Frey-Klett et al., 2011).

Some bacterial and fungal endosymbionts take this mutualistic relationship to another level by forming strict obligate endosymbiotic relationships, that is; neither can successfully survive without each other. An example would be the interaction between Burkholderia rhizoxinica and fungus Rhizopus microsporus.

The fungus R. microsporus is the causative agent of rice seedling blight (Lackner et al., 2011). The fungus causes the rice seedling roots to rot. The bacterium B. rhizoxinica living inside the R. microsporus produces a toxin called rhizoxin, an antimitotic agent used by the fungus to kill rice seedlings (Lackner et al., 2011).

The fungus by itself cannot produce the toxin. The toxin helps in breaking down the roots and fosters absorption of vital nutrients for the fungus. The B.

rhizoxinica also fully controls Rhizopus reproduction. Fungal spores are formed

only in the presence of this endosymbiotic bacteria (Partida-Martinez et al.,

2007b). In return, fungal spores act as vector for bacterial distribution.

5. Bacteria - Lichen interactions: Lichen are a combination of green algae and/or

cyanobacteria that live in/on a fungal hypha. This union is a great example of a

ectosymbiotic relationship. Lichen thallus contain a diverse population of

microorganisms living both inside and outside. These microbial biofilms are

known to fixe nitrogen, acquisition of phosphorous and amino acids (Bates et al.,

2011; Grube et al., 2009).

Kingdom Fungi:

A fungus is a multicellular or unicellular heterotrophic, nonvascular, eukaryote that plays a major role in nutrient recycling in the environment. Fungi can be classified into four main phyla: Ascomycota, Basidiomycota, Zygomycota and Chytridiomycota

(Figure 1). The phylum Ascomycota is one of the largest, most diverse phylum of fungi which contain approximately 64,000 known species (Schoch et al., 2009). The phylum includes organisms from unicellular yeast to multicellular molds and cup fungi. Most of the ascomycetes are saprobes, mutualists or parasites (Stajich et al., 2009). The phylum

Basidiomycota is the second largest diverse group of fungi and most members are ectomycorrhizal (Gardes and Bruns, 1993). The members include: mushrooms, puffball mushrooms, smuts (thick wall dust- like fungus) and pathogenic rusts. The phylum

Zygomycota contains mostly terrestrial fungi and lack complex fruiting body structures.

Most Zygomycota are saprobes and some are pathogenic (White et al., 2006). Members include Rhizopus and molds. The phylum Chytridiomycota contain approximately 1000 different species (James et al., 2006). Mycologists believe that Chytridiomycota species could be direct ancestors of the higher fungi, but this has yet to be proven (Barr, 2001).

Most Chytridiomycota species are saprobes and parasites. As saprobes, these fungi are capable of digesting organic compounds such as, cellulose, keratin and chitin (James et al., 2006) and fungal habitats vary from extreme environments to aquatic environments

(Redman et al., 1999; Shearer et al., 2007).

Figure 1: The four main divisions within the Kingdom fungi.

(http://faculty.collegeprep.org/~bernie/sciproject/project/Kingdoms/Fungi5/Fungi_Evolut ion.htm).

The multicellular fungal structure can be divided into three main parts; a hypha, a mycelium, and a sporangium (Figure 2A). A hypha is a tubular filamentous structure that actively grows when nutrients and water are abundant (Raven et al., 2002). Over time,

hyphae branch out and developed into mycelia, a network of filamentous hyphae which help in enzyme secretion and nutrient absorption (Raven et al., 2002). Sometimes, hyphae develop into a fruiting body or a sporangium (mushroom) and produces and stores reproductive spores.

Most fungi reproduce both sexually and asexually (Figure 2B) (Chen and

McDonald, 1996). Asexual reproduction can take several forms; production of spores, budding or by development of conidia (Purves et al., 2003). Asexual fungal spores are produced within the sporangium by mitotic division and resultant daughter cells/spores are identical to parent cells (Purves et al., 2003). Budding is common in Saccharomyces cerevisiae (yeast) cells (Herskowitz, 1988). A bud is formed on side of the parent cell and before separation, daughter cell receives genetic information through mitosis (Herskowitz,

1988; Purves et al., 2003). A final form of asexual production is through the development of naked spores that are not enclosed in a sporangium found at the tip of the hypha. The structure containing these spores is called a conidium/a (Purves et al., 2003).

In sexual reproduction, one haploid (n) fungal hypha meets and fuses with another haploid (n) hypha from the same species but genetically different which prevents inbreeding (Purves et al., 2003). The union creates a dikaryote/ heterokaryote (n + n) and over the development, the two nuclei fuse with each other to form diploid (2n) cells

(Kronstad and Staben, 1997). Following meiosis, four haploid (n) cells are formed

(Kronstad and Staben, 1997). Each haploid spore/cell germinates to create new haploid hyphae.

A B

Figure 2: (A) The fungal body structure (http://www.mtchs.org/BIO/text/chapter18/ concept18.1.html) (B) The fungal life cycle (Boundless, 2016).

Fungi are heterotrophic and unable to fix carbon by themselves. There are a few ways that fungi acquire nutrients. For example, fungi secrete a variety of extracellular digestive enzymes such as cellulase, lignin peroxidase, hemicellulase, and keratinase into the environment and they breakdown macromolecules such as cellulose, lignin, hemicellulose which are prominent in plant cell walls (Kracher et al., 2016; Valaškova &

Baldrian, 2006) and keratin that can be found associated with animal hair and nails

(Purves et al., 2003) via hydrolysis into smaller molecules. The broken down nutrients are absorbed by mycelia via diffusion (Cole, 1996).These type of fungi are known as saprobes. Most saprobes are major decomposers and nutrient cyclists of the organic material in the environment (Purves et al., 2003).

Over 80% of higher vascular plants have established symbiotic relationships with either ectomycorrhizal or endomycorrhizal fungi (Landeweert et al., 2001). The fungi grow within the roots of vesicular plants and are known as 'arbuscular mycorrhizal fungi’ or endomycorrhizal fungi. Arbuscular mycorrhizal fungi are obligate symbionts and thus depend on carbon generated by plants (Koide & Mosse, 2004). In exchange, the fungus is known to increase the uptake of the phosphorous, nitrogen, sulfur and trace elements such as zinc and copper from the surrounding soil (Bücking & Kafle, 2015). Fungal mycelia cover the plant roots in ectomycorrhizal relationships and help in nutrient, mineral and water absorption by increasing the area to mass ratio (Landeweert et al.,

2001). Some of mycorrhizal fungi secrete organic acids such as oxalic acid into the surrounding environment to solubilize molecules such as phosphorous, potassium, calcium prior to absorption (Landeweert et al., 2001; Wallander, 2000). Also, inorganic and organic phosphorous, ammonia, nitrate, amino acids and some of the other nutrients either solubilized in organic acids or water are taken across the fungal mycelium membrane by either passive transport, active transport or through specialized molecule transporters on the membrane by facilitated diffusion (Becquer et al., 2014; Bonfante &

Genre, 2010).Yet, some of the mechanisms associated with mycorrhizal fungal membrane molecule transporters remain poorly understood (Bücking & Kafle, 2015). In exchange, the fungus receives oxygen, fixed carbon, shelter and a favorable environment for reproduction (Bonfante & Genre, 2010).

Fossil records of fungi are rare. The oldest recovered fossil record of fungi belongs to the mid Ordovician period, approximately 460 million years old (Redecker et

al., 2000). The “Ordovician” fungus showed strong resemblance to modern day arbuscular mycorrhizal fungi (Redecker et al., 2000). Based on the fossil record, it is evident that fungus could have existed long before vesicular plants were developed. It is fair to assume that fungus also could have had strong symbiotic relationships with ancient bacteria to survive.

Genus Pisolithus:

Pisolithus is a fungus that belongs to the order Basidiomycota and class

Gasteromycetes (Singla et al., 2004). The genus Pisolithus currently contains eighteen different species: P. abditus, P. albus, P. arenarius, P. arhizus, P. aurantioscabrosus, P. australis, P. boorabiensis, P. calongei, P. capsulifer, P. croceorrhizus, P. hypogaeus, P. indicus, P. kisslingii, P. marmoratus, P. microcarpus, P. orientalis, P. pisiformis and P. tinctorius (indexfungorum, http://www.indexfungorum.org/names/ Names.asp). All the above Pisolithus species are widely distributed among various parts of the world (Marx,

1977; Moyersoen & Beever, 2004). Most Pisolithus species have formed ectomycorrhizal symbiotic relationships with large woody trees such as, Pine, Eucalyptus, Oak, Douglas- fir, Western hemlock and small shrubs such as, Rock rose, Prostrate kanuka (Cairney et al., 1999; Martin et al., 2002) and are characterized as a puffball shape fungus (Figure 3).

Pisolithus tinctorius:

My thesis research was focused on Pisolithus tinctorius also known as "Dead

Man's toe." While Pisolithus tinctorius is widely distributed among many parts of the

world (Marx, 1977), P. tinctorius has also been found growing in hydrothermal areas of

Yellowstone National park, USA and New Zealand. Until two decades ago, P. tinctorius was thought to be a homogeneous species due to fungal morphological similarities.

Random Amplified Polymorphic DNA technique (RAPD) and Internal Transcribed

Spacer-Restriction Fragment Length Polymorphism (ITS-RFLP) showed that there is a higher genetic diversity among P. tinctorius species within the group (Cairney et al.,

1999; Junghans et al., 1998). Per Junghans et al., (1998), the causative agents of the higher diversity could be the geographic origin of the fungus, host specificity and sharing of the distant ancestors (Junghans et al., 1998).

Some P. tinctorius strains have been found to be forming ectomycorrhizal relationships with seedlings of large woody trees and stimulate the successful growth of trees in acidic, nutrient deprived soil (Garbaye et al., 1988; Marx & Artman, 1979). As mentioned earlier, P. tinctorius has been found to inhabit extreme environments such as those found in Yellowstone National Park.

Yellowstone National Park:

Yellowstone National park (YNP) has an elevation of 9203 feet (2805 m) above sea level and is one of the largest national parks in northern America. Yellowstone was created by three caldera forming eruptions that took placed within last two million years

(Pelton & Smith, 1979). Yellowstone remains an active volcano and hot magma lies beneath the crust (Lowenstern et al., 2006). Volcanic activity has participated in creating a unique environment with many hydrothermal vents in the form of hot springs and

geysers. The geothermal soil in YNP has fluctuating temperatures between 3º C - 107º C and is exceedingly acidic and have pH levels low as 2.7 (Henson et al., 2005). Low pH is due to sulfuric acid production through oxidation of hydrogen sulfide (H2S) and pyrite

(FeS2) by microbial community (Henson et al., 2005). The soil contain high levels of heavy metal ions such as lead, iron (Henson et al., 2005) and lower levels of potassium, phosphorous, aluminum and total nitrogen (Cullings & Makhija, 2001).

Under high temperature and low pH soil environmental conditions, P. tinctorius thrive beyond the threshold of survivability for most other organisms. Most Pisolithus spp. create ectomycorrhizal relationships with giant woody trees such as, Eucalyptus,

Pines, Douglas-fir, Western hemlock (Marx, 1977) or with small shrubs like Prostrate kanuka (Moyersoen & Beever, 2004) in order to get the nutritional support. However, P. tinctorius found in YNP does not form mycorrhiza, even when potential plant hosts are living within just a few meters of Pisolithus fruiting bodies (Cullings & Makhija, 2001).

In contrast, the same species found in New Zealand do form mycorrhizal relationships with Prostrate kanuka shrubs found in geothermal areas (Moyersoen & Beever, 2004).

Again, this shows that there is a considerable amount of variation between P. tinctorius species (Burgess et al., 1995).

If P. tinctorius has no known symbiotic relationship with plants in YNP then how does P. tinctorius survive and thrive in Yellowstone soil? Where does it get nutrients and energy? Could endosymbiotic relationships with bacteria be the answer? My thesis research involves a bacteriological survey of P. tinctorius from YNP to begin to answer these questions.

Objectives:

My thesis research involves three objectives.

1. To determine and confirm the presence of eubacterial endosymbionts living

within the tissues of P. tinctorius using bacterial culture methods and

molecular techniques.

2. To determine the taxonomic position of isolates that give a gene similarity

score < 97 % using phylogenetic analysis.

3. To determine the relative abundance of eubacteria and archaea within the

tissues of P. tinctorius using Fluorescent in situ Hybridization (FISH).

References:

Antonio, M.A., Hawes, S.E., & Hillier, S.L. (1999). The identification of vaginal

Lactobacillus species and the demographic and microbiologic characteristics of

women colonized by these species. Journal of Infectious Diseases 180, 1950-1956.

Barr, D. (2001). Chytridiomycota. In Systematics and Evolution (Springer), pp. 93-112.

Bates, S.T., Cropsey, G.W., Caporaso, J.G., Knight, R., & Fierer, N. (2011). Bacterial

communities associated with the lichen symbiosis. Applied and Environmental

Microbiology 77, 1309-1314.

Becquer, A., Trap, J., Irshad, U., Ali, M.A., & Claude, P. (2014). From soil to plant, the

journey of P through trophic relationships and ectomycorrhizal association.

Frontiers in Plant Science 5.

Belkin, S., Wirsen, C.O., & Jannasch, H.W. (1986). A new sulfur-reducing, extremely

thermophilic eubacterium from a submarine thermal vent. Applied and

Environmental Microbiology 51, 1180-1185.

Bonfante, P., & Genre, A. (2010). Mechanisms underlying beneficial plant–fungus

interactions in mycorrhizal symbiosis. Nature Communications 1, 48.

Brulé, C., Frey-Klett, P., Pierrat, J., Courrier, S., Gérard, F., Lemoine, M., Rousselet, J.,

Sommer, G., & Garbaye, J. (2001). Survival in the soil of the ectomycorrhizal

fungus Laccaria bicolor and the effects of a mycorrhiza helper Pseudomonas

fluorescens. Soil Biology and Biochemistry 33, 1683-1694.

Bücking, H., & Kafle, A. (2015). Role of arbuscular mycorrhizal fungi in the nitrogen

uptake of plants: current knowledge and research gaps. Agronomy 5, 587-612.

Burgess, T., Malajczuk, N., & Dell, B. (1995). Variation in Pisolithus based on

basidiome and basidiospore morphology, culture characteristics and analysis of

polypeptides using 1D SDS-PAGE. Mycological Research 99, 1-13.

Cairney, J.W., Chambers, S.M., & Anderson, I.C. (1999). Pisolithus systematics—

molecular methods provide fresh insights. Mycologist 13, 31-35.

Chen, R.-S., & McDonald, B.A. (1996). Sexual reproduction plays a major role in the

genetic structure of populations of the fungus Mycosphaerella graminicola.

Genetics 142, 1119-1127.

Cole, G.T. (1996). Basic Biology of Fungi.

Croft, M.T., Lawrence, A.D., Raux-Deery, E., Warren, M.J., & Smith, A.G. (2005).

Algae acquire vitamin B12 through a symbiotic relationship with bacteria. Nature

438, 90-93.

Cullings, K., & Makhija, S. (2001). Ectomycorrhizal fungal associates of Pinus contorta

in soils associated with a hot spring in Norris Geyser Basin, Yellowstone National

Park, Wyoming. Applied and Environmental Microbiology 67, 5538-5543.

Follett, R.F., & Hatfield, J.L. (2001). Nitrogen in the environment: sources, problems,

and management. The Scientific World Journal 1, 920-926.

Frey-Klett, P., Burlinson, P., Deveau, A., Barret, M., Tarkka, M., & Sarniguet, A. (2011).

Bacterial-fungal interactions: hyphens between agricultural, clinical,

environmental, and food microbiologists. Microbiology and Molecular Biology

Reviews 75, 583-609.

Garbaye, J., Delwaulle, J., & Diangana, D. (1988). Growth response of eucalypts in the

Congo to ectomycorrhizal inoculation. Forest Ecology and Management 24, 151-

157.

Gardes, M., & Bruns, T.D. (1993). ITS primers with enhanced specificity for

basidiomycetes‐application to the identification of mycorrhizae and rusts.

Molecular Ecology 2, 113-118.

Grube, M., Cardinale, M., de Castro, J.V., Müller, H., & Berg, G. (2009). Species-

specific structural and functional diversity of bacterial communities in lichen

symbioses. The ISME Journal 3, 1105-1115.

Guarner, F., & Malagelada, J.-R. (2003). Gut flora in health and disease. The Lancet 361,

512-519.

Hart, M.H. (1978). The evolution of the atmosphere of the Earth. Icarus 33, 23-39.

Henson, J., Redman, R., Rodriguez, R., & Stout, R. (2005). Fungi in Yellowstone’s

geothermal soils and plants. Yellowstone Science 13, 25-30.

Herskowitz, I. (1988). Life cycle of the budding yeast Saccharomyces cerevisiae.

Microbiological Reviews 52, 536.

Index fungorum. indexfungorum , http://www.indexfungorum.org/names/ Names.asp

James, T.Y., Letcher, P.M., Longcore, J.E., Mozley-Standridge, S.E., Porter, D., Powell,

M.J., Griffith, G.W., & Vilgalys, R. (2006). A molecular phylogeny of the

flagellated fungi (Chytridiomycota) and description of a new phylum

(Blastocladiomycota). Mycologia 98, 860-871.

Janeway, C.A., Travers, P., Walport, M., & Shlomchik, M.J. (1997). Immunobiology: the

immune system in health and disease. Current Biology, Vol 1.

Jones, W., Leigh, J.A., Mayer, F., Woese, C., & Wolfe, R. (1983). Methanococcus

jannaschii sp. nov., an extremely thermophilic methanogen from a submarine

hydrothermal vent. Archives of Microbiology 136, 254-261.

Junghans, D., Gomes, E., Guimarães, W., Barros, E., & Araújo, E. (1998). Genetic

diversity of the ectomycorrhizal fungus Pisolithus tinctorius based on RAPD-

PCR analysis. Mycorrhiza 7, 243-248.

Kasting, J.F. (1993). Earth's early atmosphere. Science New York then Washington - 259,

920-920.

Kawamura, K. (2014). Oligomerization of nucleic acids and peptides under the primitive

earth conditions.

Kazamia, E., Czesnick, H., Nguyen, T.T.V., Croft, M.T., Sherwood, E., Sasso, S.,

Hodson, S.J., Warren, M.J., & Smith, A.G. (2012). Mutualistic interactions

between vitamin B12 dependent algae and heterotrophic bacteria exhibit

regulation. Environmental Microbiology 14, 1466-1476.

Kelley, D.S. (2001). Black smokers: incubators on the seafloor. Earth: Inside and Out,

183-189.

Kluge, M., Mollenhauer, D., & Mollenhauer, R. (1991). Photosynthetic carbon

assimilation in Geosiphon pyriforme (Kützing) F. v. Wettstein, an endosymbiotic

association of fungus and cyanobacterium. Planta 185, 311-315.

Koide, R.T., & Mosse, B. (2004). A history of research on arbuscular mycorrhiza.

Mycorrhiza 14, 145-163.

Kracher, D., Scheiblbrandner, S., Felice, A.K., Breslmayr, E., Preims, M., Ludwicka, K.,

Haltrich, D., Eijsink, V.G., & Ludwig, R. (2016). Extracellular electron transfer

systems fuel cellulose oxidative degradation. Science 352, 1098-1101.

Kronstad, J., & Staben, C. (1997). Mating type in filamentous fungi. Annual Review of

Genetics 31, 245-276.

Lackner, G., Moebius, N., Partida-Martinez, L.P., Boland, S., & Hertweck, C. (2011).

Evolution of an endofungal lifestyle: deductions from the Burkholderia

rhizoxinica genome. BMC genomics 12, 1.

Lal, A.K. (2008). Origin of life. Astrophysics and Space Science 317, 267-278.

Landeweert, R., Hoffland, E., Finlay, R.D., Kuyper, T.W., & van Breemen, N. (2001).

Linking plants to rocks: ectomycorrhizal fungi mobilize nutrients from minerals.

Trends in Ecology & Evolution 16, 248-254.

Li, M., Wang, B., Zhang, M., Rantalainen, M., Wang, S., Zhou, H., Zhang, Y., Shen, J.,

Pang, X., & Zhang, M. (2008). Symbiotic gut microbes modulate human

metabolic phenotypes. Proceedings of the National Academy of Sciences 105,

2117-2122.

Lowenstern, J.B., Smith, R.B., & Hill, D.P. (2006). Monitoring super-volcanoes:

geophysical and geochemical signals at Yellowstone and other large caldera

systems. Philosophical Transactions of the Royal Society of London A:

Mathematical, Physical and Engineering Sciences 364, 2055-2072.

Madigan, M.T., Martinko, J.M., & Parker, J. (1997). Brock biology of Microorganisms,

Vol 514 (prentice hall Upper Saddle River, NJ).

Martin, F., Díez, J., Dell, B., & Delaruelle, C. (2002). Phylogeography of the

ectomycorrhizal Pisolithus species as inferred from nuclear ribosomal DNA ITS

sequences. New Phytologist 153, 345-357.

Martin, W., Baross, J., Kelley, D., & Russell, M.J. (2008). Hydrothermal vents and the

origin of life. Nature Reviews Microbiology 6, 805-814.

Marx, D.H. (1977). Tree host range and world distribution of the ectomycorrhizal fungus

Pisolithus tinctorius. Canadian Journal of Microbiology 23, 217-223.

Marx, D.H., & Artman, J.D. (1979). Pisolithus tinctorius ectomycorrhizae improve

survival and growth of pine seedlings on acid coal spoils in Kentucky and

Virginia. Reclam Rev; (United States) 2.

Mazmanian, S.K., Liu, C.H., Tzianabos, A.O., & Kasper, D.L. (2005). An

immunomodulatory molecule of symbiotic bacteria directs maturation of the host

immune system. Cell 122, 107-118.

McNamara, K., & Awramik, S. (1992). Stromatolites: a key to understanding the early

evolution of life. Science Progress (1933-), 345-364.

Miller, S.L. (1953). A production of amino acids under possible primitive earth

conditions. Science 117, 528-529.

Miller, S.L. (1974). The atmosphere of the primitive earth and the prebiotic synthesis of

amino acids. In Cosmochemical Evolution and the Origins of Life (Springer), pp.

139-151.

Moyersoen, B., & Beever, R.E. (2004). Abundance and characteristics of Pisolithus

ectomycorrhizas in New Zealand geothermal areas. Mycologia 96, 1225-1232.

Nicholson, J.K., Holmes, E., Kinross, J., Burcelin, R., Gibson, G., Jia, W., & Pettersson,

S. (2012). Host-gut microbiota metabolic interactions. Science 336, 1262-1267.

Pelton, J., & Smith, R. (1979). Recent crustal uplift in Yellowstone National Park.

Science 206, 1179-1182.

Partida-Martinez, L.P., Monajembashi, S., Greulich, K.-O., & Hertweck, C. (2007).

Endosymbiont-dependent host reproduction maintains bacterial-fungal mutualism.

Current Biology 17, 773-777.

Purves, W.K., Orians, G.H., Sadava, D., & Heller, H.C. (2003). Life: The Science of

Biology: Volume III: Plants and Animals, Vol 3 (Macmillan).

Raven, P.H., & Johnson, G.B. (2002). Biology, 6th edition (McGraw-Hill, London).

Reddy, M.S., Singla, S., Natarajan, K., & Senthilarasu, G. (2005). Pisolithus indicus, a

new species of ectomycorrhizal fungus associated with Dipetrocarps in India.

Mycologia 97, 838-843.

Redecker, D., Kodner, R., & Graham, L.E. (2000). Glomalean fungi from the Ordovician.

Science 289, 1920-1921.

Redman, R.S., Litvintseva, A., Sheehan, K.B., Henson, J.M., & Rodriguez, R.J. (1999).

Fungi from geothermal soils in Yellowstone National Park. Applied and

Environmental Microbiology 65, 5193-5197

Schoch, C.L., Sung, G.-H., López-Giráldez, F., Townsend, J.P., Miadlikowska, J.,

Hofstetter, V., Robbertse, B., Matheny, P.B., Kauff, F., & Wang, Z. (2009). The

Ascomycota tree of life: a phylum-wide phylogeny clarifies the origin and

evolution of fundamental reproductive and ecological traits. Systematic Biology,

syp020.

Schopf, J.W., & Packer, B.M. (1987). Early Archean (3.3-billion to 3.5-billion-year-old)

microfossils from Warrawoona Group, Australia. Science 237, 70-73.

Shearer, C.A., Descals, E., Kohlmeyer, B., Kohlmeyer, J., Marvanová, L., Padgett, D.,

Porter, D., Raja, H.A., Schmit, J.P., & Thorton, H.A. (2007). Fungal biodiversity

in aquatic habitats. Biodiversity and Conservation 16, 49-67.

Singla, S., Reddy, M., Marmeisse, R., & Gay, G. (2004). Genetic variability and

taxonomic position of ectomycorrhizal fungus Pisolithus from India.

Microbiological Research 159, 203-210.

Stajich, J.E., Berbee, M.L., Blackwell, M., Hibbett, D.S., James, T.Y., Spatafora, J.W., &

Taylor, J.W. (2009). The fungi. Current Biology 19, R840-R845.

Valaškova, V., & Baldrian, P. (2006). Degradation of cellulose and hemicelluloses by the

brown rot fungus Piptoporus betulinus–production of extracellular enzymes and

characterization of the major cellulases. Microbiology 152, 3613-3622.

Van Der Heijden, M.G., Bakker, R., Verwaal, J., Scheublin, T.R., Rutten, M., Van

Logtestijn, R., & Staehelin, C. (2006). Symbiotic bacteria as a determinant of

plant community structure and plant productivity in dune grassland. FEMS

Microbiology Ecology 56, 178-187.

Wackett, L.P. (2008). Microbes on human skin. Environmental Microbiology 10, 2469-

2470.

Wallander, H. (2000). Uptake of P from apatite by Pinus sylvestris seedlings colonised by

different ectomycorrhizal fungi. Plant and Soil 218, 249-256.

White, M.M., James, T.Y., O’Donnell, K., Cafaro, M.J., Tanabe, Y., & Sugiyama, J.

(2006). Phylogeny of the Zygomycota based on nuclear ribosomal sequence data. .

Woese, C.R. (1987). Bacterial evolution. Microbiological Reviews 51, 221.

Yamamoto, M., & Takai, K. (2011). Sulfur metabolisms in epsilon-and gamma-

Proteobacteria in deep-sea hydrothermal fields. Frontiers in Microbiology 2, 192.

Yellowstone Volcano Observatory. U.S. Geological Survey. Questions About Future

Volcanic Activity. 2007. https://www.nps.gov/yell/learn/nature/volcanoqa.htm

Zahran, H.H. (1999). Rhizobium-legume symbiosis and nitrogen fixation under severe

conditions and in an arid climate. Microbiology and molecular biology reviews 63,

968-989.

Figures

Figure 1: Kingdom fungi four main divisions. http://faculty.collegeprep.

org/~bernie/sciproject/project/Kingdoms/Fungi5/Fungi_Evolution.htm

Figure 2A: The fungal body structure. http://www.mtchs.org/BIO/text/chapter18/

concept18.1.html.

Figure 2B: Boundless (2016). Boundless Biology. Retrieved from

https://www.boundless.com/biology/textbooks/boundless-biology-textbook/fungi-

24/characteristics-of-fungi-149/fungi-reproduction-591-11810/

CHAPTER 2

Bacterial Culturing

Introduction:

Yellowstone National Park is residence to a diverse community of thermophilic fungal and bacterial species (Henson et al., 2005; Redman et al., 1999). Pisolithus tinctorius that has been found growing in edges of hydrothermal pools in the park and does not form any mycorrhizal symbioses, yet it continues to thrive (Cullings & Makhija,

2001).

Internal tissues of the P. tinctorius fruiting body provide an environment that would theoretically could support the growth of variety of microorganisms and preliminary molecular and phylogenetic studies have shown that bacteria are present within the tissues of the P. tinctorius (Cullings et al., unpublished), although bacteria have not been cultured from P. tinctorius resident in Yellowstone National Park. Despite, elemental sulfur is present in the sporocarps of P. tinctorius (Muncie et al., 1975) and anaerobic sulfur- reducing bacteria have been found around hydrothermal vents and are capable of oxidizing elemental sulfur as a source of energy (Dhillon et al., 2003). As part of my thesis research, I surveyed for culturable heterotrophic eubacteria within the tissues of P. tinctorius collected from Yellowstone National Park, and used molecular methods to determine bacterial inhabitants/DNA within P. tinctorius.

Bacterial Culture Media:

Nutrient, minimal, enriched, and selective and/or differential media were used to isolate chemoheterotrophic bacteria from P. tinctorius. Nutrient media support the growth of a wide variety of heterotrophic bacteria. Minimal media was used to culture bacteria in physiological states that reflect stress and low nutrient environments, and an enriched medium (soil extract) was used to mimic nutrients typical of the environment to which P. tinctorius resides. Selective and /or differential media were used to target specific groups of bacteria and gain catabolic data that facilitate bacterial identification. Some of the media were modified, i.e., contained high levels of sulfur and/or iron to reflect again the environment that P. tinctorius resides. In this study, bacteria were routinely subcultured to obtain and maintain a pure, viable culture

The 16S rRNA Gene:

The 16S rRNA gene is approximately1550 base pairs long and is conserved among both eubacteria and archaea bacteria (Dhillon et al., 2003). The gene codes for ribosomal RNA (rRNA) that help to make the part of the small ribosomal subunit (30S) in prokaryotes. The 16S rRNA gene sequencing method is widely used to identify and differentiate bacterial strains in biological samples (Dhillon et al., 2003; Song et al.,

2005) based on the variable sites on the gene (Clarridge, 2004). In GenBank, there are over 90,000 deposited 16S rRNA gene sequences which can be compared against 16S rRNA quarry sequence to identify an unknown bacteria (Clarridge, 2004). In comparison to conventional bacterial identification methods, 16S rRNA gene sequencing is fast,

inexpensive, and can be used to identify slow growers (Woo et al., 2008). Even though

16S rRNA sequences are widely used to identify unknown bacteria, this approach still poses serious limitations and results can be ambiguous. For example, sequences for unknown bacteria are limited in the database and in some occasions sequence programs cannot distinguish between closely related species/strains (Poretsky et al., 2014), or the output does not match with the biochemical profiles. Thus, it is prudent to implement caution when identifying unknowns using 16S rRNA databases.

Materials and Methods:

(1) Sample Selection:

All Pisolithus tinctorius fungal samples were extracted from Norris Geyser Basin in Yellowstone National Park, USA. Fungal isolates were transported in dry ice and upon arrival to California State University, East Bay were immediately stored at -20 º C until used.

Figure 3: (A) Landscape of Norris Geyser Basin in Yellowstone National Park.

(B) and (C) Pisolithus tinctorius in Norris Geyser Basin. (D) and (E) Interior of the

P. tinctorius fruiting body.

(2) Media Used to Culture Heterotrophic Bacteria:

Standard media “as is” and modified were used in attempts to isolate bacterial inhabitants within P. tinctorius. Below is list of media that were used in this study. See

Appendix A for complete media recipes.

 Minimal media agar (DIFCO manual; BACTO minimal broth Davis w/o Dextrose

dehydrated)

 Minimal media broth (DIFCO manual; BACTO minimal broth Davis w/o

Dextrose dehydrated)

 MH Salt agar (Handbook of microbiological media by Ronald M. Atlas)

 MH Salt broth (Handbook of microbiological media by Ronald M. Atlas)

 Reasoner’s 2 agar (R2A) (Becton, Dickinson and Company, New Jersey, USA)

 R2A broth

 Soil extract agar

 Soil extract broth

 Tryptic Soy Agar (TSA) (agar 15g/1L)

 Tryptic Soy Broth (TSB) (30g/L) (Oxoid Ltd, England)

 TSA with or without Cycloheximide (0.5g/1L) (Sigma Aldrich, Missouri, USA)

 TSA pH adjusted 3.4, pH 4.5 and pH5.0 (pH was adjusted using 6M HCl)

 TSA pH adjusted 10 (pH was adjusted using 1M NaOH)

 TSA + Thioglycolic acid (3g/1L)

 TSA+MgSO4.7H2O (10g/1L) + Fe(NH4)2SO2.6H2O (2g/1L)

 TSB with or without Cycloheximide (0.5g/L) (Sigma Aldrich, Missouri, USA)

 TSB pH adjusted 3.4, pH 4.5 and pH 5.0 (pH was adjusted using 6M HCl)

 TSB pH adjusted 10 (pH was adjusted using 1M NaOH)

 TSB + Thioglycolic acid (3g/1L)

 TSB +MgSO4.7H2O (10g/1L) + Fe(NH4)2SO2.6H2O (2g/1L)

(3) Bacterial Isolation:

Approximately two grams from 6 individual P. tinctorius samples were aseptically removed and placed into presterilized broths and incubated at 25º C or 30º C for 48 hours. See Appendix C for list of growth media associated with each individual P. tinctorius samples. Once growth was visible, 300 μl of the culture were plated onto solid media to obtain isolated colonies. Bacterial colonies with different morphologies were selected and subcultured onto solid media. These isolates were maintained and

subcultured onto respective solid media until pure cultures were obtained (Ahmad et al.,

2008). Both broths and agar plates were incubated at 25º C or 30º C for approximately

24-48 hours. Pure bacterial isolates were stored in 80% glycerol for future applications.

(4) Identification of Gram Positive and Gram Negative Bacteria:

Isolates were Gram stained and examined microscopically. In addition, all samples were streaked onto MacConkey agar as a confirmation method of Gram reaction status. MacConkey agar is a selective medium that inhibits Gram positive bacterial growth and encourages Gram negative bacterial growth.

(5) Bacterial Genomic DNA Extraction:

Individual, pure broth cultures were subcultured into TSB medium and incubated at 25º C or 30º C for 3-5 days at which time visible growth occurred. Both Gram negative and Gram positive bacterial cells were harvested separately from 350 μl broth cultures by centrifuging for 15 minutes at 8000 rpm. The following bacterial pre-treatment and genomic DNA extraction methods were utilized with minor volume modification.

 Protocol # 1: bacterial Gram positive/Gram negative pre-treatment: Standard

Operating Procedure for DNA Extraction for PCR-based Detection of

Renibacterium salmoninarum, Western Fisheries Research Center (http://wfrc.

usgs.gov/research_resources/protocols/BACT5_DNA_extraction_gram_positive

_V1.pdf).

 Protocol # 2: extraction of genomic DNA from pretreated bacteria: purification of

total DNA from animal tissues (spin column method- Qiagen handbook). A

Qiagen DNeasy Blood and Tissue Kit (Valencia, CA).

Gram negative bacteria: Pure cultures containing Gram negative bacteria were centrifuged for 15 minutes at 8000 rpm. Supernatants were removed and the cell pellets were resuspended in 200 μl of Buffer ATL and 20 μl of Proteinase K. The samples were subsequently incubated at 55º C for 50 minutes (Protocol #1 with modifications). After the incubation, 200 μl of Buffer AL and 200 μl of 200 proof (99.5%) ethanol (Fisher scientific, Pittsburg, PA) were added to each sample. The samples were thoroughly mixed by vortexing and contents were transferred individually onto a Qiagen spin columns and centrifuged for 1 minute at 8000 rpm. The columns were separately washed with 500 μl of wash buffers AW1 and AW2. After addition of each buffer, samples were centrifuged for 1 minute at 8000 rpm and then the flow through was discarded. Sample columns were additionally centrifuged for 3 minutes at 13,000 rpm to exonerate ethanol residues. Flow through was then discarded. One hundred microliters of Buffer AE

(elution buffer) were added to each sample column and the columns were incubated for 1 minute at room temperature. Samples were centrifuge for 1 minute at 8000 rpm to elute total DNA (Protocol # 2).

Gram positive bacteria: The supernatant was removed and pellets were resuspended in

200 μl of Buffer ATL and 20 μl of Proteinase K. The samples were subsequently

incubated at 55º C for 90 minutes. Fifty microliters of 4X lysozyme lysis buffer (Tris-

HCl pH 8.0; 80 mM , EDTA 8 mM ,Triton X-100 4.8%, Lysozyme 80 mg/ml, molecular grade water ) were added to lyse the Gram positive bacterial cells and incubated at 37º C for 1 hour. Samples were reincubated at 70º C for 10 minutes after addition of 250 μl of

Buffer AL. After the final incubation, 250 ul of 200 proof (99.5%) ethanol was added to each sample and mixed thoroughly by vortexing (Protocol # 1 with modifications).

Contents were then transferred individually onto a Qiagen spin column and centrifuged for 1 minute at 8000 rpm. The columns were separately washed with 500 μl of wash buffers AW1 and AW2. After addition of each buffer, samples were centrifuged for 1 minute at 8000 rpm and then the flow through from each was discarded. Sample columns were additionally centrifuged for 3 minutes at 13,000 rpm to exonerate ethanol residues.

Flow through was then discarded. One hundred microliters of Buffer AE (elution buffer) were added to each sample column and the columns were incubated for 1 minute at room temperature. Samples were centrifuged for 1 minute at 8000 rpm to elute total DNA

(Protocol # 2).

(6) Polymerase Chain Reaction Amplification (PCR):

The 16S rRNA gene (rDNA) is conserved among bacteria (Klindworth et al.,

2012) and the gene is (approx. 1550 bp) large enough for informatics purposes (Janda &

Abbott, 2007). The universal 16S rRNA forward primer B27 F (5′-AGAGTTTG

GATCMTGGCTCAG-3′ where M is A or C) and universal reverse primer 1492 R (5′-

CGGTTACC TTGTTACGACTT-3) (Bouju et al., 2012; Jiang et al., 2006) were used in

my study. A PCR mixture (30 μl in volume) of bacterial genomic DNA, 10 μM concentration of each primer and Platinum PCR supermix high fidelity (Invitrogen,

Grand Island, NY). The following thermocycler parameters were used to amplify the targeted region: initial denature at 95º C for 3 minutes, 35 cycles of denature (95º C for 1 minute), annealing (55º C for 1 minute), elongation (72º C for 1 minute) and final elongation at 72º C for 3 minutes. To detect and confirm the size of the PCR products, samples were subjected to agarose gel electrophoresis. Samples were run on 1% agarose gel at 100V for 60 -90 minutes. As a standard, 100 bp molecular weight marker

(Invitrogen, Grand Island, NY) was used. The agarose gels were stained with ethidium bromide and visualized under UV lamp (McIntosh et al., 1996).

(7) Sequencing and Analysis of Data:

PCR amplified fragments were sent to ELIM BIOPHARM (Hayward, CA) for sequence identification. All the fragments were sequenced separately using either B27F or 1492R primers. See Appendix B for edited sequence information for each sample. The sequences were subjected to nucleotide BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi)

(Bouju et al., 2012). Each query sequenced was blasted against the 16S rRNA, bacteria and archaea database (Tables 1, 2, 3, Appendix B and C).

(8) Replica Plating:

Replica Plating Technique was used to isolate bacterial species in a mixed culture that could grow on a nutrient medium that would not grow specifically on a soil extract

medium and vice versa. This technique was used to get an idea of the nutritional preferences and/or requirements of bacterial inhabitants inside of P. tinctorius.

Two grams of P. tinctorius were grown individually in TSB at 30º C for 24 hours.

An aliquot of sample was ten-fold diluted serially through 10-12, and 0.1 ml aliquots were spread evenly using a sterile glass rod onto the TSA agar surface. All samples were incubated for 24 hours at 30º C (Heitkamp et al., 1988). An imprinted master plate from all original plates was replicated on to Reasoner's 2A agar (R2A), Soil Extract agar and

TSA. Plates were incubated at 30º C for 24 hours (Figure 4).

Results:

(1) Bacterial Isolation:

Thirty-four different eubacteria from three phyla were isolated from within the fruiting body of P. tinctorius. Five are members of the phylum Actinobacteria, four are members of the phylum Proteobacteria and twenty-five are members of the phylum

Firmicutes (Tables 1, 2, 3 and Appendix C). Among the Proteobacterial species, two of the species belong to class Gamma Proteobacteria and two belong to class Beta

Proteobacteria.

(2) Replica Plating:

Replica plating technique revealed four colonies that grew on TSA but did not grow either on R2A or Soil Extract agar. Three colonies grew on R2A agar did not grow on either TSA or Soil Extract agar. One colony grew on Soil Extract agar but did not grow

on R2A or TSA (Figure 4). The sequencing data revealed that Herbiconiux flava only grew on R2A agar. Paenibacillus tylopili only grew on TSA but Bacillus atrophaeus were found growing on both TSA and R2A plates.

Table 1: Identification of isolated Actinobacteria from P. tinctorius internal tissue samples based on partial 16S rRNA gene sequence. Bacterial isolate Gram General description name reaction and cellular morphology Corynebacterium Gram Phylum: Actinobacteria mucifaciens positive rod C. mucifaciens was described as a novel bacterium isolated from human nasal discharged patients with chronic sinusitis (Morinaka et al., 2006). Herbiconiux flava Gram Phylum: Actinobacteria positive rod H. flava was described as a novel bacterium isolated from phyllosphere of a sedge plant (Hamada et al., 2012). Total of only four species are known from this genus (Hamada et al., 2012). Micrococcus Gram Phylum: Actinobacteria yunnanensis positive coccus M. yunnanensis was described as a novel bacterium isolated from Polyspora axillaris roots (fried egg tree, evergreen shrub that is native to southeast Asia) in south-west China (Zhao et al., 2009). Rhodococcus Gram Phylum: Actinobacteria, qingshengii positive rods R. qingshengii was isolated from carbendazim- contaminated soil sample from the Jiangsu province in China (Xu et al., 2007). Rhodococcus Gram Phylum: Actinobacteria, erythropolis positive rods R. erythropolis is capable of using dibenzothiophene (DBT), one of the organic sulfur compounds presented in fossil fuel as sole sulfur source (Izumi et al., 1994).

Table 2: Identification of isolated Proteobacteria from P. tinctorius internal tissue samples based on partial 16S rRNA gene sequence. Bacterial isolate Gram General description name reaction and cellular morphology Burkholderia Gram Phylum: Proteobacteria Class: Beta fungorum negative rods proteobacteria

B. fungorum was described as a novel bacterium isolated from white-rot fungi, roots of the plants, animals, and human cystic fibrosis samples (Coenye et al., 2001; Coenye & Vandamme, 2003; Lim et al., 2003). Burkholderia Gram Phylum: Proteobacteria Class: Beta phenazinium negative rods proteobacteria

B. phenazinium has been isolated from peat (partially decomposing plant material) obtained from Sphagnum bogs in tundra zones of Russia, Canada, and Estonia (Belova et al., 2006). Yet, full ecological impact of B. phenazinium is unknown (Coenye & Vandamme, 2003). Ewingella Gram Phylum: Proteobacteria Class: Gamma americana negative rods proteobacteria

E. americana is the only member in this genus. The natural habitat of this organism is unknown. The bacterium is commonly associated with nosocomial infections. Per Reyes et. al. (2004) the bacterium was found to be a usual inhabitant in healthy button mushrooms (Reyes et al., 2004) Stenotrophomonas Gram Phylum: Proteobacteria Class: Gamma rhizophila negative rods proteobacteria

S. rhizophila is associated with plant rhizospheres and help plant growth by controlling fungal diseases (Wolf et al., 2002). In general, Stenotrophomonas spp. play a major role in element cycling and bioremediation in the environment (Wolf et al., 2002).

Table 3: Identification of isolated Firmicutes from P. tinctorius internal tissue samples based on partial 16S rRNA gene sequence. Bacterial isolate Gram General description name reaction and cellular morphology Bacillus Gram Phylum: Firmicutes Class: Bacilli amyloliquefaciens positive rods B. amyloliquefaciens is a soil bacterium. Some strains of B. amyloliquefaciens are plant rhizosphere associated and induce the plant growth. Also, the bacteria are capable of suppressing pathogenic bacteria and fungal growth (Qiao et al., 2014). Bacillus Gram Phylum: Firmicutes Class: Bacilli atrophaeus positive rods B. atrophaeus is a soil bacterium and commonly use in the industry as a sterilization control (Burke et al., 2004). B. atrophaeus also served as a biological warfare simulant (Gibbons et al., 2011). Bacillus Gram Phylum: Firmicutes Class: Bacilli bataviensis positive or gram B. bataviensis was described as a novel variable rods. bacterium isolated from soil in an agricultural research area, Netherlands (Heyrman et al., 2004). Bacillus eiseniae Gram Phylum: Firmicutes Class: Bacilli positive rods B. eiseniae was described as a novel bacterium isolated from internal digestive tract of earthworm Eisenia fetida L.(Hong et al., 2012). Bacillus Gram Phylum: Firmicutes Class: Bacilli licheniformis positive rods B. licheniformis is a plant growth promoting rhizobacteria that produce metabolite gibberellin which promotes the host plant's stem elongation (Gutiérrez‐Mañero et al., 2001). The bacterium is a facultative anaerobe and some strains are denitrifiers (Rey et al., 2004).

Table 3 cont.: Identification of isolated Firmicutes from P. tinctorius internal tissue samples based on partial 16S rRNA gene sequence. Bacterial isolate Gram General description name reaction and cellular morphology Bacillus Gram Phylum: Firmicutes Class: Bacilli mojavensis positive rods B. mojavensis was described as a novel bacterium isolated form soil samples taken from Mojave Desert, California (Roberts et al., 1994). B. mojavensis produce antibiotics in the environment (Bacon & Hinton, 2011). All strains of this species are hostile towards fungus but still an endosymbiont (Bacon and Hinton, 2011). Bacillus safensis Gram Phylum: Firmicutes Class: Bacilli positive rods B. safensis was originally isolated from NASA spacecraft-assembly facility at the Jet Propulsion Laboratory, Pasadena, California (Satomi et al., 2006). The B. safensis strain MS11 isolated from Mongolian dessert soil showed higher resistant towards arsenic, boron (plant micronutrient) and high salt levels (Raja & Omine, 2012). Another strain of B. safensis (strain VK) has been isolated from the rhizosphere of a cumin plant growing in the saline desert of Gujarat, India (Kothari et al., 2013). Bacillus Gram Phylum: Firmicutes Class: Bacilli sonorensis positive rods B. sonorensis was described as a novel bacterium isolated from Sonoran desert, Arizona and closely related to B. licheniformis (Palmisano et al., 2001). In a recent study hyperthermostable (80º C) alkaline (pH 9.0) Lipase from B. sonorensis strain has been purified (Bhosale et al., 2016). Lipases are important in both biological and industrial systems.

Table 3 cont.: Identification of isolated Firmicutes from P. tinctorius internal tissue samples based on partial 16S rRNA gene sequence. Bacterial isolate Gram General description name reaction and cellular morphology Bacillus Gram Phylum: Firmicutes Class: Bacilli thermoamylovorans positive rods B. thermoamylovorans was described as a novel bacterial species that is moderately thermophilic and isolated from palm wine (Combet-Blanc et al., 1995). Bacillus Gram Phylum: Firmicutes Class: Bacilli vallismortis positive rods B. vallismortis was described as a novel bacterium isolated from soil, Death Valley, California. The species is closely related to B. subtilis (Roberts et al., 1996). Cohnella Gram Phylum: Firmicutes Class: Bacilli nanjingensis positive rods C. nanjingensis was described as a novel bacterium isolated from soil, Nanjing, China (Huang et al., 2014). Paenibacillus Gram Phylum: Firmicutes Class: Bacilli chibensis positive rods P. chibensis was describes as a novel bacterium and natural habitats associates with this organism is not well known. This bacterium shows antimicrobial properties (Lorentz et al., 2006). Paenibacillus Gram Phylum: Firmicutes Class: Bacilli cineris positive rods P. cineris was described as a novel bacterium and was isolated from ashy soil of an inactive fumarole at the foot of a volcano in South Sandwich archipelago, Antarctica (Logan et al., 2004)

Table 3 cont.: Identification of isolated Firmicutes from P. tinctorius internal tissue samples based on partial 16S rRNA gene sequence. Bacterial isolate Gram General description name reaction and cellular morphology Paenibacillus Gram Phylum: Firmicutes Class: Bacilli ginsengisoli positive rods P. ginsengisoli was described as a novel bacterium and was isolated from soil samples taken from Ginseng field in South Korea (Lee et al., 2007). Paenibacillus Gram Phylum: Firmicutes Class: Bacilli humicus positive rods P. humicus was described as a novel bacterium and was isolated from poultry compost soil (Vaz-Moreira et al., 2007). Paenibacillus Gram Phylum: Firmicutes Class: Bacilli lautus positive rods P. lautus is a soil bacterium. P.lautus strains have also been isolated from Obsidian Hot Spring water, Yellowstone National Park, Montana, USA (Mead et al., 2012) . Paenibacillus Gram Phylum: Firmicutes Class: Bacilli pabuli positive rods P. pabuli has been isolated from soil showed antimicrobial properties (Lorentz et al., 2006). P. pabuli isolated from crab shells, east sector of central Tyrrhenian Sea have shown to secrete chitinolytic enzymes that degrades chitin (Juarez-Jimenez et al., 2008). Paenibacillus Gram Phylum: Firmicutes Class: Bacilli profundus positive rods P. profundus was described as a novel species isolated from deep surface sediment sample obtained from the Sea of Japan (Romanenko et al., 2013).

Table 3 cont.: Identification of isolated Firmicutes from P. tinctorius internal tissue samples based on partial 16S rRNA gene sequence. Bacterial isolate Gram General description name reaction and cellular morphology Paenibacillus Gram Phylum: Firmicutes Class: Bacilli taichungensis positive rods P. taichungensis was described as a novel species isolated from soil in Taiwan (Lee et al., 2008) Paenibacillus Gram Phylum: Firmicutes Class: Bacilli tundrae positive rods P. tundrae is a psychrophilic, novel species isolated from soil samples beneath acidic and non-acidic northern Alaskan tundra (Nelson et al., 2009). Paenibacillus Gram Phylum: Firmicutes Class: Bacilli tylopili positive rods P. tylopili was described as a novel bacterium isolated from mycorhizosphere of Tylopilus felleus fungus and capable of degrading chitin by secreting chitinolytic enzymes (Kuisiene et al., 2008). Paenibacillus Gram Phylum: Firmicutes Class: Bacilli wooponensis positive rods P. wooponensis was described as a novel bacterium isolated from fresh water samples, Woopo wetland, Korea (Baik et al., 2011). Paenisporosarcina Gram Phylum: Firmicutes Class: Bacilli indica positive rods P. indica was described as a novel psychrophile that was isolated from soil sample collected from near Pindari glacier (Reddy et al., 2013). Staphylococcus Gram Phylum: Firmicutes Class: Bacilli cohnii positive coccus S. cohnii is a member of the skin microbiota (Schleifer & Kloos, 1975). Terribacillus Gram Phylum: Firmicutes Class: Bacilli saccharophilus positive rods T. saccharophilus was described as a novel bacterium isolated from field soil in Japan (An et al., 2007).

B C D

Figure 4: Replica plating (A) An original TSA plate (10-5 dilution after 24-hour incubation) (B) Replica on soil extract agar (after 72 hours) (C) Replica on R2A agar

(D) Replica on TSA after 24 hour incubation. The circles show the bacteria that grew on one medium but not the other.

Discussion:

I recovered 34 different bacterial species that belong to three different phyla from internal tissues of P. tinctorius. Out of 34 species, five were Actinobacteria, four were

Proteobacteria and twenty-five different Firmicutes (Tables 1, 2, 3 and Appendix C).

The preliminary molecular and phylogenetic studies done by Ken Cullings and his team at NASA Astrobiology department have found chemotropic aerobic and anaerobic bacterial lineages within the tissues of P. tinctorius (Cullings et al., 2014). P. tinctorius fruiting bodies are rich with elemental sulfur, hydrocarbons and moist with water produce by cellular respiration (Cullings et al., 2014, unpublished; Muncie et al., 1975). These internal environmental conditions have created an environment that can support a diverse group of endosymbiotic bacteria.

Few studies have shown that Burkholderia spp. are common endosymbiotic inhabitants in arbuscular-mycorrhizal fungi such as, Gigaspora margarita and in saprophytic fungi such as, Rhizopus microsporus, and Phanerochaete spp. the white rot fungus (Bianciotto et al., 2000; Lim et al., 2003; Partida-Martinez et al., 2007a; Seigle-

Murandi et al., 1996). Burkholderia rhizoxinica, Burkholderia endofungorum are two of the endosymbionts that have been isolated from Rhizopus microsporus while,

Burkholderia sordidicola and Burkholderia fungorum have been isolated from two different species of white rot fungus (Coenye et al., 2001; Lim et al., 2003; Partida-

Martinez et al., 2007a). Burkholderia fungorum is one of the species I isolated from low pH (pH4.5 and pH 5) TSA media and Burkholderia phenazinium was isolated from the neutral pH TSA media. A limited number of Burkholderia spp. are capable of growth in

acidic soils that have a pH of 2.9 (Curtis et al., 2002). Both B. phenazinium and B. fungorum are two of the bacteria that have been previously isolated from acidic peat from

Sphagnum bogs in tundra zones of Russia, Canada, and Estonia (Belova et al., 2006).

Some Burkholderia members have strict symbiotic relationships with fungus. For example, the relationship between Burkholderia rhizoxinica and the fungus Rhizopus microsporus is noteworthy. B. rhizoxinica produce rhizoxin , a toxin which is used by the fungus to kill rice seedlings (Lackner et al., 2011). The bacterium fully controls fungal reproduction because fungal spores only arise in the presence of B. rhizoxinica (Partida-

Martinez et al., 2007b). In return, fungal spores act as vector for bacterial distribution.

Perhaps a similar endosymbiotic relationship has evolved between bacteria and fungus P. tinctorius thriving in YNP geothermal soil.

Other endosymbiotic Burkholderia species have been reported to exist within cytoplasm of arbuscular-mycorrhizal fungi Gigaspora margarita and the mycelium of the fungi Mortierella elongata (Bianciotto et al., 1996; Sato et al., 2010). It is has been reported that an endosymbiotic Burkholderia strain residing within the Gigaspora margarita contains nitrogen fixation genes (nifH, nifD and nifK) that coded for nitrogenase enzyme (Minerdi et al., 2001) and nitrogen fixation capability of this paticular Burkholderia strain have not yet been fully studied. P. tinctorius growing in acidic thermal soil would benefit having endosymbionts such as Burkholderia species that are capable of fixing nitrogen and can tolerate high acidic levels.

Stenotrophomonas rhizophila and Ewingella americana belong to the gamma

Proteobacteria. Some evolutionary studies argue that mitochondria arose from ancient

alpha Proteobacteria (Brindefalk et al., 2011; Gray et al., 1999) and these bacterial species have been isolated from above and near hydrothermal vents. Further information on these bacteria and their fungal partners could potentially provide some insight into symbioses and cellular evolution on early Earth. For example, S. rhizophila have been previously isolated from plant rhizospheres and shown to help plant growth by controlling the fungal diseases (Wolf et al., 2002). E. americana is the only known species in this genus. This bacterium has been reported as a common inhabitant of healthy button mushrooms (Agaricus bisporus) and yet it’s role is currently unknown

(Reyes et al., 2004). E. americana has been reported to use phenol as a carbon source

(Khleifat, 2006) and phenolics often display antifungal activity.

Both Rhodococcus qingshengii and Rhodococcus erythropolis are capable degrading hydrocarbon compounds such as the fungicide carbendazim (C9H9N3O2) and use it as sole source of carbon and nitrogen (Xu et al., 2007; Zhang et al., 2013).

Rhodococcus erythropolis also produces large variety of enzymes such as dehydrogenases, epoxide hydrolases, and oxygenases, and perform bioconversions and degradations in the environment (Gray et al., 1999). Also, R. erythropolis can use dibenzothiophene (DBT), one of the organic sulfur compounds presented in fossil fuel as sole sulfur source (Izumi et al., 1994). The fruiting body of P. tinctorius is full of hydrocarbons and sulfur (Cullings et al., 2014; Muncie et al., 1975). Accumulation of elemental sulfur inside the fruiting body for extended period could lead to sulfur toxicity and having bacterial species that can utilize sulfur could be an advantage for P. tinctorius.

Further metabolic studies are needed to confirm the role of R. erythropolis and R.

qingshengii 's role in sulfur utilization and hydrocarbon degradation within the fungal tissue.

Both Micrococcus yunnanensis and Herbiconiux flava have previously been isolated from vascular plant roots and plant phyllosphere, yet their roles are unknown

(Hamada et al., 2012; Zhao et al., 2009). In the past decade, certain Micrococcus species have been used as bacterial biofertilizers in agriculture and these bacterial species are known to solubilize phosphate and induce siderophore production (Bhardwaj et al., 2014).

Also, Micrococcus species have a higher tolerance to heavy metals chromium and nickel, and can remove these metals from the contaminated environmental samples

(Congeevaram et al., 2007). Perhaps, similar Micrococcus spp. attenuate the toxicity of metals in P. tinctorius.

Not all the bacteria isolated from P. tinctorius were identified with confidence.

One of the Actinobacterial isolates showed 88% similarity to Corynebacterium mucifaciens. Eighty-eight percent similarity is a low percentage, and bacterial identity cannot be fully trusted. Phylogenetic analysis (Figure 7) clustered the isolate with other

Corynebacterium species. In future, molecular and biochemical assays will be performed to characterize this bacterial isolate.

I isolated twenty-five different Firmicutes species within the fruiting body tissues of P. tinctorius. Eleven of them belong to the genus Paenibacillus: P. chibensis, P. cineris, P. ginsengisoli, P. humicus, P. lautus, P. pabuli, P. profundus, P. tundra, P. taichungensis, P. tylopili and P. wooponensis. Ten belong to the genus Bacillus: B. amyloliquefaciens, B. atrophaeus, B. bataviensis, B. eiseniae, B. licheniformis, B.

mojavensis, B. safensis B. sonorensis, B. thermoamylovorans and B. vallismortis and other five species belong to five different genera and they were Cohnella nanjingensis,

Staphylococcus cohnii, Paenisporosarcina indica and Terribacillus saccharophilus. The members of Bacillus and Paenibacillus were common among all six individual P. tinctorius samples (Appendix C).

Gram positive spore formers, such as Bacillus and Paenibacillus species can be found in many natural ecosystems such as, soil, volcanic/arctic soil, marine sediments, fresh water ponds, desserts, hot springs, plant roots, ocean and in ice cores (Zeigler,

2013). Many of the Firmicutes are capable of producing endospores that are resistant to high heat and ultraviolet radiation (Traag et al., 2013). The spores can survive without water or nutrients thousands of years and germinate when the conditions are favorable which is an advantageous trait for bacteria living in harsh environment condition such as, hydrothermal sites (Setlow, 2006). Even though many Paenibacillus and Bacillus members are known soil bacteria, it has been reported that these genera contain members that form endosymbiotic interactions with certain fungi. For example, Paenibacillus spp. were shown to live intracellularly in the ectomycrohizzal fungus, Laccaria bicolor

(Bertaux et al., 2003). Another study reported that the Paenibacillus validus can stimulate the growth of the arbuscular mycorrhizal Glomus intraradices to form fertile spores

(Hildebrandt et al., 2002; Hildebrandt et al., 2006). Paenibacillus tylopili is one of bacterial species that I isolated from interior tissues of P. tinctorius. This facultative anaerobe has been isolated from the mycorhizosphere of Tylopilus felleus (Kuisiene et al.,

2008). Another facultative anaerobe isolated from P. tinctorius was B. licheniformis that

is known to participate in the denitrification processes (Rey et al., 2004). Both P. tylopili and P. pabuli secrete chitinolytic enzyme that capable of degrading chitin which is a common component in exoskeleton of insects and fungal cell walls (Kuisiene et al.,

2008). A fungus growing in an environment such as YNP that has limited access to nutrients could benefit having bacteria that possess nutrient-acquiring capabilities such as those mentioned above.

Several of the bacterial species (mentioned below) I isolated from P. tintorius are classified as mesophiles, but also can grow in temperatures that are near thermophilic ranges (Burke et al., 2004). In addition, I did isolate bacteria that are considered to be thermophiles. Thermophiles possess stable enzymes that help to carry out variety of metabolic processes at high temperatures (Zeikus, 1979). For example, some of the thermophilic Bacillus species living in or near thermal hot springs are capable of degrading NO3 to NO2 by secreting thermostable nitrate reductase enzymes that enable proper cellular function without interruption (Burr et al., 2005; Imanaka et al., 1982). I isolated Paenibacillus lautus and this bacterium has also been isolated from obsidian, hot spring waters in Yellowstone (Mead et al., 2012). P. cineris, also isolated, is a facultative anaerobe that has been previously isolated from ashy soil of a cold inactive fumarole at the foot of a volcano in South Sandwich archipelago, Antarctica and the bacteria can grow in temperatures between 8º C - 50º C (Logan et al., 2004). Bacillus atrophaeus is a thermotolerent bacterium used in sterilization studies (Burke et al., 2004) and B. thermoamylovorans is a moderately thermophilic, facultative anaerobic bacterium isolated from palm wine (Combet-Blanc et al., 1995). It is possible that thermophilic

endosymbiotic bacteria are an advantage to a fungus living in volcanic regions but also, they may be existing within the fungus as spores and culturing conditions awaken these bacteria.

Desert soils are often subjected to fluctuating temperatures during day/night and are typically deprived of any organic material and water (Fuller, 1924; Makhalanyane et al., 2015). Many of the Bacillus species that I isolated, such as Bacillus sonorensis, B. mojavensis and B. safensis, and B. vallismortis have been isolated from dessert soils

(Makhalanyane et al., 2015). B. safensis was originally isolated from a clean room area of a NASA spacecraft-assembly facility at the Jet Propulsion Laboratory in Pasadena,

California (Satomi et al., 2006). Clean room areas virtually lack any microorganism but somehow B. safensis spores survived even after thorough cleaning.

I also isolated psychrophiles: P. tundrae and Paenisporosarcina indica (Nelson et al., 2009; Reddy et al., 2013). Yellowstone National Park undergoes seasonal weather changes throughout the year with temperatures typically ranging from -5º C to 20º C. For

P. tinctorius, having psychrophiles could be an assurance for survival during the winter because some psychrophilic bacteria are capable of degrading organic matter.

Interestingly, others synthesize DNA only under subzero conditions (Tuorto et al., 2014).

Two of the Bacillus spp. that I isolated, B. amyloliquefaciens and B. licheniformis, have also been reported to inhabit the rhizosphere of plants and promote growth of the plant (Gutiérrez‐Mañero et al., 2001; Qiao et al., 2014). Many symbiotic rhizobacteria promote the growth of plants by controlling diseases, nutrient availability, water absorption, by siderophores and other metabolites production (Bhardwaj et al., 2014). B.

amyloliquefaciens has been reported to suppress pathogenic bacterial, fungal, and viral growth (Bhardwaj et al., 2014; Qiao et al., 2014). Also, P. chibensis and P. profundus possess antimicrobial properties (Lorentz et al., 2006; Romanenko et al., 2013).

The remaining bacterial species that I isolated, such as, B. bataviensis, P. humicus,

P. ginsengisoli, P. taichungensis, Terribacillus saccharophilus and Cohnella nanjingensis have previously been isolated from soils from varies regions (An et al.,

2007; Heyrman et al., 2004; Huang et al., 2014; Lee et al., 2007; Vaz-Moreira et al.,

2007), freshwaters and organism that are intimately associated with each. For example, P. wooponensis has been isolated previously from freshwater wetland in Korea, (Baik et al.,

2011) and Bacillus eiseniae from the digestive tract of the earthworm inhabiting sludge

(Hong et al., 2012).

In total, I isolated 34 different bacterial species from inside P. tinctorius growing in Yellowstone National Park, USA. At this point, any role(s) of any of these bacteria is speculative and metabolic studies are needed to determine any role, if any, each of the bacteria play within the tissues of P. tinctorius. My work provides candidates that should be examined to understand bacteria - P. tintorious interactions.

References:

Ahmad, F., Ahmad, I., & Khan, M. (2008). Screening of free-living rhizospheric bacteria

for their multiple plant growth promoting activities. Microbiological Research

163, 173-181.

An, S.-Y., Asahara, M., Goto, K., Kasai, H., & Yokota, A. (2007). Terribacillus

saccharophilus gen. nov., sp. nov. and Terribacillus halophilus sp. nov., spore-

forming bacteria isolated from field soil in Japan. International Journal of

Systematic and Evolutionary Microbiology 57, 51-55.

Bacon, C.W., & Hinton, D.M. (2011). Bacillus mojavensis: its endophytic nature, the

surfactins, and their role in the plant response to infection by Fusarium

verticillioides. In Bacteria in Agrobiology: Plant Growth Responses (Springer),

pp. 21-39.

Baik, K.S., Choe, H.N., Park, S.C., Kim, E.M., & Seong, C.N. (2011). Paenibacillus

wooponensis sp. nov., isolated from wetland freshwater. International Journal of

Systematic and Evolutionary Microbiology 61, 2763-2768.

Belova, S., Pankratov, T., & Dedysh, S. (2006). Bacteria of the genus Burkholderia as a

typical component of the microbial community of Sphagnum peat bogs.

Microbiology 75, 90-96.

Bertaux, J., Schmid, M., Prevost-Boure, N.C., Churin, J., Hartmann, A., Garbaye, J., &

Frey-Klett, P. (2003). In situ identification of intracellular bacteria related to

Paenibacillus spp. in the mycelium of the ectomycorrhizal fungus Laccaria

bicolor S238N. Applied and Environmental Microbiology 69, 4243-4248.

Bhardwaj, D., Ansari, M.W., Sahoo, R.K., and Tuteja, N. (2014). Biofertilizers function

as key player in sustainable agriculture by improving soil fertility, plant tolerance

and crop productivity. Microbial Cell Factories 13, 1.

Bhosale, H., Shaheen, U., and Kadam, T. (2016). Characterization of a

Hyperthermostable Alkaline Lipase from Bacillus sonorensis 4R. Enzyme

Research 2016.

Bianciotto, V., Bandi, C., Minerdi, D., Sironi, M., Tichy, H.V., & Bonfante, P. (1996).

An obligately endosymbiotic mycorrhizal fungus itself harbors obligately

intracellular bacteria. Applied and Environmental Microbiology 62, 3005-3010.

Bianciotto, V., Lumini, E., Lanfranco, L., Minerdi, D., Bonfante, P., & Perotto, S. (2000).

Detection and identification of bacterial endosymbionts in arbuscular mycorrhizal

fungi belonging to the family Gigasporaceae. Applied and Environmental

Microbiology 66, 4503-4509.

Bouju, H., Ricken, B., Beffa, T., Corvini, P.F.-X., & Kolvenbach, B.A. (2012). Isolation

of bacterial strains capable of sulfamethoxazole mineralization from an

acclimated membrane bioreactor. Applied and Environmental Microbiology 78,

277-279.

Brindefalk, B., Ettema, T.J., Viklund, J., Thollesson, M., & Andersson, S.G. (2011). A

phylometagenomic exploration of oceanic alphaproteobacteria reveals

mitochondrial relatives unrelated to the SAR11 clade. PLoS One 6, e24457.

Burke, S., Wright, J., Robinson, M., Bronk, B., & Warren, R. (2004). Detection of

molecular diversity in Bacillus atrophaeus by amplified fragment length

polymorphism analysis. Applied and Environmental Microbiology 70, 2786-2790.

Burr, M.D., Botero, L.M., Young, M.J., Inskeep, W.P., & McDermott, T.R. (2005).

Observations concerning nitrogen cycling in a Yellowstone thermal soil

environment. Geothermal Biology and Geochemistry in Yellowstone National

Park, 171-182.

Clarridge, J.E. (2004). Impact of 16S rRNA gene sequence analysis for identification of

bacteria on clinical microbiology and infectious diseases. Clinical Microbiology

Reviews 17, 840-862.

Coenye, T., Laevens, S., Willems, A., Ohlén, M., Hannant, W., Govan, J., Gillis, M.,

Falsen, E., & Vandamme, P. (2001). Burkholderia fungorum sp. nov. and

Burkholderia caledonica sp. nov., two new species isolated from the environment,

animals and human clinical samples. International Journal of Systematic and

Evolutionary Microbiology 51, 1099-1107.

Coenye, T., & Vandamme, P. (2003). Diversity and significance of Burkholderia species

occupying diverse ecological niches. Environmental Microbiology 5, 719-729.

Combet-Blanc, Y., Ollivier, B., Streicher, C., Patel, B., Dwivedi, P., Pot, B., Prensier, G.,

& Garcia, J.-L. (1995). Bacillus thermoamylovorans sp. nov., a moderately

thermophilic and amylolytic bacterium. International Journal of Systematic and

Evolutionary Microbiology 45, 9-16.

Congeevaram, S., Dhanarani, S., Park, J., Dexilin, M., & Thamaraiselvi, K. (2007).

Biosorption of chromium and nickel by heavy metal resistant fungal and bacterial

isolates. Journal of Hazardous Materials 146, 270-277.

Cullings, K., & Makhija, S. (2001). Ectomycorrhizal fungal associates of Pinus contorta

in soils associated with a hot spring in Norris Geyser Basin, Yellowstone National

Park, Wyoming. Applied and Environmental Microbiology 67, 5538-5543.

Cullings, K.C., Lauzon, C., Marinkovich, N., &Truong, T. (2014). Pisolithus tinctorius,

Fungal Extremophile and Modern Analog to an Early Earth Environment; An

Unlikely Harbor for Deeply Diverging and Novel Chemoautrophic Microbes.

Paper presented at: AGU Fall Meeting Abstracts.

Curtis, P., Nakatsu, C.H., & Konopka, A. (2002). Aciduric Proteobacteria isolated from

pH 2.9 soil. Archives of Microbiology 178, 65-70.

Dhillon, A., Teske, A., Dillon, J., Stahl, D.A., & Sogin, M.L. (2003). Molecular

characterization of sulfate-reducing bacteria in the Guaymas Basin. Applied and

Environmental Microbiology 69, 2765-2772.

Fuller, G.D. (1924). Soil Temperature in Deserts. Botanical Gazette 78, 360-360.

Gibbons, H.S., Broomall, S.M., McNew, L.A., Daligault, H., Chapman, C., Bruce, D.,

Karavis, M., Krepps, M., McGregor, P.A., & Hong, C. (2011). Genomic

signatures of strain selection and enhancement in Bacillus atrophaeus var.

globigii, a historical biowarfare simulant. PLoS One 6, e17836.

Gutiérrez‐Mañero, F.J., Ramos‐Solano, B., Probanza, A., Mehouachi, J., R Tadeo, F.,

& Talon, M. (2001). The plant‐growth‐promoting rhizobacteria Bacillus

pumilus and Bacillus licheniformis produce high amounts of physiologically

active gibberellins. Physiologia Plantarum 111, 206-211.

Gray, M.W., Burger, G., & Lang, B.F. (1999). Mitochondrial evolution. Science 283,

1476-1481

Hamada, M., Komukai, C., Tamura, T., Evtushenko, L.I., Vinokurova, N.G., & Suzuki,

K.-i. (2012). Description of Herbiconiux flava sp. nov. and emended description

of the genus Herbiconiux. International Journal of Systematic and Evolutionary

Microbiology 62, 795-799.

Heitkamp, M.A., Franklin, W., & Cerniglia, C.E. (1988). Microbial metabolism of

polycyclic aromatic hydrocarbons: isolation and characterization of a pyrene-

degrading bacterium. Applied and Environmental Microbiology 54, 2549-2555.

Henson, J., Redman, R., Rodriguez, R., & Stout, R. (2005). Fungi in Yellowstone’s

geothermal soils and plants. Yellowstone Science 13, 25-30.

Heyrman, J., Vanparys, B., Logan, N.A., Balcaen, A., Rodríguez-Díaz, M., Felske, A., &

De Vos, P. (2004). Bacillus novalis sp. nov., Bacillus vireti sp. nov., Bacillus soli

sp. nov., Bacillus bataviensis sp. nov. and Bacillus drentensis sp. nov., from the

Drentse A grasslands. International Journal of Systematic and Evolutionary

Microbiology 54, 47-57.

Hildebrandt, U., Janetta, K., & Bothe, H. (2002). Towards growth of arbuscular

mycorrhizal fungi independent of a plant host. Applied and Environmental

Microbiology 68, 1919-1924.

Hildebrandt, U., Ouziad, F., Marner, F.-J., & Bothe, H. (2006). The bacterium

Paenibacillus validus stimulates growth of the arbuscular mycorrhizal fungus

Glomus intraradices up to the formation of fertile spores. FEMS Microbiology

Letters 254, 258-267.

Hong, S.W., Park, J.M., Kim, S.-J., & Chung, K.S. (2012). Bacillus eiseniae sp. nov., a

swarming, moderately halotolerant bacterium isolated from the intestinal tract of

an earthworm (Eisenia fetida L.). International Journal of Systematic and

Evolutionary Microbiology 62, 2077-2083.

Huang, Z., Yu, Y.-j., Bao, Y.-y., Xia, L., Sheng, X.-f., & He, L.-y. (2014). Cohnella

nanjingensis sp. nov., an extracellular polysaccharide-producing bacterium

isolated from soil. International Journal of Systematic and Evolutionary

Microbiology 64, 3320-3324.

Imanaka, T., Fujii, M., Aramori, I., & Aiba, S. (1982). Transformation of Bacillus

stearothermophilus with plasmid DNA and characterization of shuttle vector

plasmids between Bacillus stearothermophilus and Bacillus subtilis. Journal of

Bacteriology 149, 824-830.

Izumi, Y., Ohshiro, T., Ogino, H., Hine, Y., & Shimao, M. (1994). Selective

desulfurization of dibenzothiophene by Rhodococcus erythropolis D-1. Applied

and Environmental Microbiology 60, 223-226.

Janda, J.M., & Abbott, S.L. (2007). 16S rRNA gene sequencing for bacterial

identification in the diagnostic laboratory: pluses, perils, and pitfalls. Journal of

Clinical Microbiology 45, 2761-2764.

Jiang, H., Dong, H., Zhang, G., Yu, B., Chapman, L.R., & Fields, M.W. (2006).

Microbial diversity in water and sediment of Lake Chaka, an athalassohaline lake

in northwestern China. Applied and Environmental Microbiology 72, 3832-3845.

Juarez-Jimenez, B., Rodelas, B., Martinez-Toledo, M.V., Gonzalez-Lopez, J., Crognale,

S., Gallo, A.M., Pesciaroli, C., & Fenice, M. (2008). Production of chitinolytic

enzymes by a strain (BM17) of Paenibacillus pabuli isolated from crab shells

samples collected in the east sector of central Tyrrhenian Sea. International

Journal of Biological Macromolecules 43, 27-31.

Khleifat, K.M. (2006). Biodegradation of phenol by Ewingella americana: Effect of

carbon starvation and some growth conditions. Process Biochemistry 41, 2010-

2016.

Klindworth, A., Pruesse, E., Schweer, T., Peplies, J., Quast, C., Horn, M., & Glöckner,

F.O. (2012). Evaluation of general 16S ribosomal RNA gene PCR primers for

classical and next-generation sequencing-based diversity studies. Nucleic Acids

Research, gks808.

Kothari, V., Kothari, R., Kothari, C., Bhatt, V., Nathani, N., Koringa, P., Joshi, C., &

Vyas, B. (2013). Genome sequence of salt-tolerant Bacillus safensis strain VK,

isolated from saline desert area of Gujarat, India. Genome Announcements 1,

e00671-00613.

Kuisiene, N., Raugalas, J., Spröer, C., Kroppenstedt, R., Stuknyte, M., & Chitavichius, D.

(2008). Paenibacillus tylopili sp. nov., a chitinolytic bacterium isolated from the

mycorhizosphere of Tylopilus felleus. Folia Microbiologica 53, 433-437.

Lackner, G., Moebius, N., Partida-Martinez, L.P., Boland, S., & Hertweck, C. (2011).

Evolution of an endofungal lifestyle: deductions from the Burkholderia

rhizoxinica genome. BMC Genomics 12, 1.

Lee, F.-L., Tien, C.-J., Tai, C.-J., Wang, L.-T., Liu, Y.-C., & Chern, L.-L. (2008).

Paenibacillus taichungensis sp. nov., from soil in Taiwan. International Journal of

Systematic and Evolutionary Microbiology 58, 2640-2645.

Lee, M., Ten, L.N., Baek, S.-H., Im, W.-T., Aslam, Z., & Lee, S.-T. (2007).

Paenibacillus ginsengisoli sp. nov., a novel bacterium isolated from soil of a

ginseng field in Pocheon province, South Korea. Antonie van Leeuwenhoek 91,

127-135.

Lim, Y.W., Baik, K.S., Han, S.K., Kim, S.B., & Bae, K.S. (2003). Burkholderia

sordidicola sp. nov., isolated from the white-rot fungus Phanerochaete sordida.

International Journal of Systematic and Evolutionary Microbiology 53, 1631-

1636.

Logan, N.A., De Clerck, E., Lebbe, L., Verhelst, A., Goris, J., Forsyth, G., Rodríguez-

Díaz, M., Heyndrickx, M., & De Vos, P. (2004). Paenibacillus cineris sp. nov.

and Paenibacillus cookii sp. nov., from Antarctic volcanic soils and a gelatin-

processing plant. International Journal of Systematic and Evolutionary

Microbiology 54, 1071-1076.

Lorentz, R., Artico, S., Da Silveira, A., Einsfeld, A., & Corcao, G. (2006). Evaluation of

antimicrobial activity in Paenibacillus spp. strains isolated from natural

environment. Letters in Applied Microbiology 43, 541-547.

Makhalanyane, T.P., Valverde, A., Gunnigle, E., Frossard, A., Ramond, J.-B., & Cowan,

D.A. (2015). Microbial ecology of hot desert edaphic systems. FEMS

Microbiology Reviews 39, 203-221.

McIntosh, D., Meaden, P., & Austin, B. (1996). A simplified PCR-based method for the

detection of Renibacterium salmoninarum utilizing preparations of rainbow trout

(Oncorhynchus mykiss, Walbaum) lymphocytes. Applied and Environmental

Microbiology 62, 3929-3932.

Mead, D.A., Lucas, S., Copeland, A., Lapidus, A., Cheng, J.-F., Bruce, D.C., Goodwin,

L.A., Pitluck, S., Chertkov, O., & Zhang, X. (2012). Complete genome sequence

of Paenibacillus strain Y4. 12MC10, a novel Paenibacillus lautus strain isolated

from Obsidian Hot Spring in Yellowstone National Park. Standards in Genomic

sciences 6, 366-385.

Minerdi, D., Fani, R., Gallo, R., Boarino, A., & Bonfante, P. (2001). Nitrogen fixation

genes in an endosymbiotic Burkholderia strain. Applied and Environmental

Microbiology 67, 725-732.

Morinaka, S., Kurokawa, M., Nukina, M., & Nakamura, H. (2006). Unusual

Corynebacterium mucifaciens isolated from ear and nasal specimens.

Otolaryngology-Head and Neck Surgery 135, 392-396.

Muncie, J.G., Rothwell, F.M., & Kessel, W.G. (1975). Elemental sulfur accumulation in

Pisolithus. Mycopathologia 55, 95-96.

Nelson, D.M., Glawe, A.J., Labeda, D.P., Cann, I.K., & Mackie, R.I. (2009).

Paenibacillus tundrae sp. nov. and Paenibacillus xylanexedens sp. nov.,

psychrotolerant, xylan-degrading bacteria from Alaskan tundra. International

Journal of Systematic and Evolutionary Microbiology 59, 1708-1714.

Palmisano, M.M., Nakamura, L.K., Duncan, K.E., Istock, C.A., & Cohan, F.M. (2001).

Bacillus sonorensis sp. nov., a close relative of Bacillus licheniformis, isolated

from soil in the Sonoran Desert, Arizona. International Journal of Systematic and

Evolutionary Microbiology 51, 1671-1679.

Partida-Martinez, L.P., Groth, I., Schmitt, I., Richter, W., Roth, M., & Hertweck, C.

(2007a). Burkholderia rhizoxinica sp. nov. and Burkholderia endofungorum sp.

nov., bacterial endosymbionts of the plant-pathogenic fungus Rhizopus

microsporus. International Journal of Systematic and Evolutionary Microbiology

57, 2583-2590.

Partida-Martinez, L.P., Monajembashi, S., Greulich, K.-O., & Hertweck, C. (2007b).

Endosymbiont-dependent host reproduction maintains bacterial-fungal mutualism.

Current Biology 17, 773-777.

Poretsky, R., Rodriguez-R, L.M., Luo, C., Tsementzi, D., & Konstantinidis, K.T. (2014).

Strengths and limitations of 16S rRNA gene amplicon sequencing in revealing

temporal microbial community dynamics. PLoS One 9, e93827.

Qiao, J.-Q., Wu, H.-J., Huo, R., Gao, X.-W., & Borriss, R. (2014). Stimulation of plant

growth and biocontrol by Bacillus amyloliquefaciens subsp. plantarum FZB42

engineered for improved action. Chemical and Biological Technologies in

Agriculture 1, 1.

Raja, C.E., & Omine, K. (2012). Arsenic, boron and salt resistant Bacillus safensis MS11

isolated from Mongolia desert soil. African Journal of Biotechnology 11, 2267-

2275.

Reddy, G., Manasa, B.P., Singh, S.K., & Shivaji, S. (2013). Paenisporosarcinaindica sp.

nov., a psychrophilic bacterium from a glacier, and reclassification of

Sporosarcina antarctica Yu et al., 2008 as Paenisporosarcinaantarctica comb.

nov. and emended description of the genus Paenisporosarcina. International

Journal of Systematic and Evolutionary Microbiology 63, 2927-2933.

Redman, R.S., Litvintseva, A., Sheehan, K.B., Henson, J.M., & Rodriguez, R.J. (1999).

Fungi from geothermal soils in Yellowstone National Park. Applied and

environmental Microbiology 65, 5193-5197.

Rey, M.W., Ramaiya, P., Nelson, B.A., Brody-Karpin, S.D., Zaretsky, E.J., Tang, M., de

Leon, A.L., Xiang, H., Gusti, V., & Clausen, I.G. (2004). Complete genome

sequence of the industrial bacterium Bacillus licheniformis and comparisons with

closely related Bacillus species. Genome Biology 5, 1-12.

Reyes, J.E., Venturini, M.E., Oria, R., & Blanco, D. (2004). Prevalence of Ewingella

americana in retail fresh cultivated mushrooms (Agaricus bisporus, Lentinula

edodes and Pleurotus ostreatus) in Zaragoza (Spain). FEMS Microbiology

Ecology 47, 291-296.

Roberts, M. S., Nakamura, L. K., & Cohan, F. M. (1994). Bacillus mojavensis sp. nov.,

distinguishable from Bacillus subtilis by sexual isolation, divergence in DNA

sequence, and differences in fatty acid composition. International Journal of

Systematic and Evolutionary Microbiology, 44(2), 256-264.

Roberts, M.S., Nakamura, L.K., & Cohan, F.M. (1996). Bacillus vallismortis sp. nov., a

close relative of Bacillus subtilis, isolated from soil in Death Valley, California.

International Journal of Systematic and Evolutionary Microbiology 46, 470-475.

Romanenko, L.A., Tanaka, N., Svetashev, V.I., & Kalinovskaya, N.I. (2013).

Paenibacillus profundus sp. nov., a deep sediment bacterium that produces

isocoumarin and peptide antibiotics. Archives of Microbiology 195, 247-254.

Sato, Y., Narisawa, K., Tsuruta, K., Umezu, M., Nishizawa, T., Tanaka, K., Yamaguchi,

K., Komatsuzaki, M., & Ohta, H. (2010). Detection of Betaproteobacteria inside

the mycelium of the fungus Mortierella elongata. Microbes and Environments 25,

321-324.

Satomi, M., La Duc, M.T., & Venkateswaran, K. (2006). Bacillus safensis sp. nov.,

isolated from spacecraft and assembly-facility surfaces. International Journal of

Systematic and Evolutionary Microbiology 56, 1735-1740.

Schleifer, K.H., & Kloos, W.E. (1975). Isolation and characterization of Staphylococci

from human skin I. Amended descriptions of Staphylococcus epidermidis and

Staphylococcus saprophyticus and descriptions of three new species:

Staphylococcus cohnii, Staphylococcus haemolyticus, and Staphylococcus xylosus.

International Journal of Systematic and Evolutionary Microbiology 25, 50-61.

Seigle-Murandi, F., Guiraud, P., Croize, J., Falsen, E., & Eriksson, K. (1996). Bacteria

Are Omnipresent on Phanerochaete chrysosporium Burdsall. Applied and

Environmental Microbiology 62, 2477-2481.

Setlow, P. (2006). Spores of Bacillus subtilis: their resistance to and killing by radiation,

heat and chemicals. Journal of Applied Microbiology 101, 514-525.

Song, Y., Liu, C., Bolaňos, M., Lee, J., McTeague, M., & Finegold, S.M. (2005).

Evaluation of 16S rRNA sequencing and reevaluation of a short biochemical

scheme for identification of clinically significant Bacteroides species. Journal of

Clinical Microbiology 43, 1531-1537.

Traag, B.A., Pugliese, A., Eisen, J.A., & Losick, R. (2013). Gene conservation among

endospore-forming bacteria reveals additional sporulation genes in Bacillus

subtilis. Journal of Bacteriology 195, 253-260.

Tuorto, S.J., Darias, P., McGuinness, L.R., Panikov, N., Zhang, T., Häggblom, M.M., &

Kerkhof, L.J. (2014). Bacterial genome replication at subzero temperatures in

permafrost. The ISME Journal 8, 139-149.

Vaz-Moreira, I., Faria, C., Nobre, M.F., Schumann, P., Nunes, O.C., & Manaia, C.M.

(2007). Paenibacillus humicus sp. nov., isolated from poultry litter compost.

International Journal of Systematic and Evolutionary Microbiology 57, 2267-

2271.

Western Fisheries Research Center (2011). Standard Operating Procedure for DNA

Extraction for PCR-based Detection of Renibacterium salmoninarum,.

http://wfrc.usgs.gov/research_resources/protocols/BACT5_DNA_extraction_gra

m_positive_V1.pdf.

Wolf, A., Fritze, A., Hagemann, M., & Berg, G. (2002). Stenotrophomonas rhizophila sp.

nov., a novel plant-associated bacterium with antifungal properties. International

Journal of Systematic and Evolutionary Microbiology 52, 1937-1944.

Woo, P., Lau, S., Teng, J., Tse, H., & Yuen, K.Y. (2008). Then and now: use of 16S

rDNA gene sequencing for bacterial identification and discovery of novel bacteria

in clinical microbiology laboratories. Clinical Microbiology and Infection 14,

908-934.

Xu, J.-L., He, J., Wang, Z.-C., Wang, K., Li, W.-J., Tang, S.-K., & Li, S.-P. (2007).

Rhodococcus qingshengii sp. nov., a carbendazim-degrading bacterium.

International Journal of Systematic and Evolutionary Microbiology 57, 2754-

2757.

Zeigler, D. R. (2013). The Family Paenibacillaceae. Bacillus genetic stock center catalog

of strains. Chapter 5. http://bgsc.org/_catalogs/Catpart5.pdf.

Zeikus, J. (1979). Thermophilic bacteria: ecology, physiology and technology. Enzyme

and Microbial Technology 1, 243-252.

Zhang, X., Huang, Y., Harvey, P.R., Li, H., Ren, Y., Li, J., Wang, J., & Yang, H. (2013).

Isolation and characterization of carbendazim-degrading Rhodococcus

erythropolis djl-11. PloS One 8, e74810.

Zhao, G.-Z., Li, J., Qin, S., Zhang, Y.-Q., Zhu, W.-Y., Jiang, C.-L., Xu, L.-H., & Li, W.-J.

(2009). Micrococcus yunnanensis sp. nov., a novel actinobacterium isolated from

surface-sterilized Polyspora axillaris roots. International Journal of Systematic

and Evolutionary Microbiology 59, 2383-2387.

CHAPTER 3

Phylogenetics

Introduction:

Phylogenetics is the study of the evolutionary relationships between decedents and their ancestors. Ancestry is determined by either using morphological or genomic data. Obtaining the morphological data is virtually impossible for most of the organisms, especially for microorganisms due to lack of fossil information (Sleator, 2011). Recent advanced molecular and computer software technologies have developed bioinformatics programs yielding an infinite amount of sequencing data (Reddy, 2011). These genomic data are easier to obtain than fossils and lend assist with determination of ancestry.

Phylogenetic trees are graphical representations of relationships between species and their ancestors (Hall, 2011; Wiley & Lieberman, 2011) and generating one provides many advantages. For example, a phylogenetic tree can show relationships between living and extinct species, assist in understanding the genomics of speciation within and outside of a population, and can help in predict protein function (Barraclough & Nee,

2001; Hall, 2005). The genetic information provides valuable details about an organism and due to that reason, evolutionary relationships are established using genes (nucleotide or protein sequence) that are homologs (descendants from a common ancestor) (Page &

Holmes, 2009; Reddy, 2011).

One of the turning points in history of science was when Carol Woese in the

1970s constructed a phylogenetic tree using conserved 16S rRNA data and showed that two different groups of prokaryotes exist (Page & Holmes, 2009), Eubacteria and

Archaea. A few decades’ worth of molecular information have contributed in generating tree of life as we know it today (Figure 5).

Figure 5: Tree of life (Page & Holmes, 2009).

Basic Concepts:

A phylogenetic tree is drawn as either a phylogram or as a cladogram. Branch length represents the evolutionary deviation between descendants and ancestors. Interior nodes represent common ancestors while external tips represent existing taxa/descendants

(Hall, 2011). In cladogramic phylogenetic trees, while all branches line up, the focus of the tree is the taxa at the end of the branch. In phylogramic phylogenetic trees, branch lengths are proportional to the genetic variation (Hall, 2011). The groups that branch out from the same common ancestor are called a sister group or a clade, and a branch that is completely separated from other groups and coming out from the base of the tree is called

an out group which is distantly related to the rest of the group (Hall, 2011; Kim &

Warnow, 1999).

When designing a phylogenetic tree, it is important to have an outgroup which contains several species from a different genus but from the same family. The trees can be rooted or unrooted (Reddy, 2011). Rooted trees show the common ancestor that all the other taxons were evolved, and an evolutionary pathway. Unrooted trees do not show the common ancestor, instead they emphasize relationships among taxa (Hall, 2011).

Polytomy/multifurcation (more than two descendants evolved from a common ancestor) branches in rooted trees occur for two reasons: (1) a lack of sufficient data where the program was unable to resolve the relationships among the organisms in question, (2) an event took place where simultaneously all organisms in question diverted from the common ancestor (Lin et al., 2011).

Phylogenetic Tree Construction Methods:

A phylogenetic tree can be built using one of the three methods: The Distance

Method, the Maximum Parsimony Method (MP) and Maximum Likelihood Method

(ML). The two most popular Distance Methods are Neighbor Joining (NJ) and the

Unweighted Paired Group Method with Arithmetic Averages (UPGMA) (Sleator, 2011).

The distance method is an algorithmic method that accounts the mismatches/dissimilarity between each pair of sequences and uses that information to build the evolutionary tree that best explains the distance between two organisms (Sleator, 2011). This method gives an estimate of branch lengths and generates a single tree. Maximum parsimony is a

character based method and considers the entire multiple sequence alignment in search of fewest evolutionary changes (Kim & Warnow, 1999). The generated tree will have the minimum changes/substitutions of nucleotides or amino acids in the sequence. More than one tree is generated and they can be used to calculate the consensus tree (Sleator, 2011).

Only the topology of the tree matters not the branch lengths (Sleator, 2011). The

Maximum Likelihood Method is a statistical method which chooses the tree based on the highest probability of producing the observed data (Felsenstein, 1981).

The generated trees can be bootstrapped. Bootstrapping is a statistical way of calculating the redundancy of a certain characters among a set of data and uses that redundancy to estimate the reliability of a generated tree (Wiesemüller & Rothe, 2006).

The higher the number of bootstrap replicates, the higher confidence in the generated trees (Hedges, 1992). The confidence level is shown as a percentage at each node. An internal branch bootstrap value that is greater than 95%, is seen as a more trusted presentation, and any value below 70% is regarded as unsatisfactory and the topology of that branch cannot be trusted (Hillis & Bull, 1993; Soltis & Soltis, 2003).

When assessing phylogenetic trees, it is necessary to consider the interference that occurred through the evolution. Some lineages undergo more changes/mutations than others in a very short period of time, and some other species acquire new genetic information through horizontal gene transfer (Koonin et al., 2002). Parallel evolution of certain traits which lead to homoplasy (similarities are not due to a common ancestor)

(Barton, 2007) is another type of interference. Evolutionary interference is not the only

factor that can affect the validity of a phylogenetic tree, but also the quality of the data used during tree construction is an important factor.

In phylogenetic analysis, use of 16S rRNA and 23S rRNA gene sequences are more popular due to their conservative nature (Bavykin et al., 2004; Lane et al.,

1985).Over evolutionary time, the function of 16S rRNA has remained unchanged

compared to most of the other genes (i.e. i.e., genes of HIV) which evolved in much faster rate (Page and Holmes, 2009).The use of the 23S rRNA gene provides the same advantages as the 16S rRNA gene but due to extensive length of 23S rRNA gene (>2000 bp) provides additional diagnostic and identification information about species and can be used to generate phylogenetic trees (Hunt et al., 2006).

Materials and Methods:

(1) Sample Selection:

Isolation, DNA extraction, PCR amplification and 16S rRNA sequencing were performed per protocols mentioned in Chapter 2. Two isolates were selected for further analysis based on similarity scores. The two isolates selected based on the low similarity scores (percentage) were Piso NP3-KT 25 (Corynebacterium mucifaciens, 88%) and Piso

NA-SE-3 (Paenibacillus chibensis, 96%).

(2) Multiple Sequence Alignment:

The homologues for each isolate based on 16S rRNA gene sequences were obtained from the National Center for Biotechnology Information (NCBI) (Tables 4 and

5). Multiple sequence alignments were carried out using CLUSTAL OMEGA

(http://www.ebi.ac.uk/Tools/msa/clustalo/).

(3) Phylogenetic Tree Construction:

The phylogenetic trees were constructed using the Neighbor-Joining Method by using the program PAPU version 4.0a150. The topology of the trees was evaluated by using a bootstrap resampling method with 2000 replicates (Figures 6 and 7) (Coenye et al., 2001; Zhao et al., 2009).

Results:

Piso NA-SE-3 is closer to Paenibacillus cookii (LMG 18419) and Paenibacillus chibensis (NBRC 15958) but they did not share the most recent common ancestor (Figure

6). The phylogenetic tree clustered the Piso-NA-SE-3 with Paenibacillus species with a bootstrap value of 82 % (Figure 6).

Piso NP3-KT-25 is closer to Corynebacterium mucifaciens (DMMZ 2278) but they did not share the most recent common ancestor. The phylogenetic tree clustered the

Piso-NP3-KT-25 with Corynebacterium species with a poor bootstrap value of 74 %

(Figure 7).

Table 4: Homologous 16S rRNA sequences, with their accession numbers for isolate

Piso NA-SE-3.

Domain Phylum Organism Strain Genbank/ NCBI Accession Number Acetonema A. longum DSM 6540 NR_041951.1 Bacillus B. carboniphilus JCM9731 NR_024690.1 B. lehensis MLB2 NR_036940.1 Cohnella C. arctica M9-62 NR_109077.1 C. rhizosphaerae CSE-5610 NR_133731.1 Fontibacillus F. phaseoli BAPVE7B NR_118633.1 F. solani A4STR04 NR_136839.1 Paenibacillus P. anaericanus DSM 15890 NR_117034.1 Bacteria Firmicutes P. alvei IFO 3343 NR_115584.1 P. cellulositrophicus P2-1 NR_116564.1 P. chibensis NBRC 15958 NR_113827.1 P. cineris LMG 18439 NR_042189.1 P. cookii LMG 18419 NR_025372.1 P. favisporus GMP01 NR_029071.1 P. macerans NBRC 15307 NR_112729.1 P. peoriae DSM 8320 NR_117741.1 P. polymyxa DSM 36 NR_117731.2 P. siamensis S5-3 NR_041578.1 Paenisporosarcina P. indica PN2 NR_108473.1 Thermoanaerobacter T. brockii DSM 1457 NR_117610.1

Figure 6: Phylogenetic tree based on 16S rRNA sequences showing the relationships between isolate PisoNA-SE-3 and related taxa. The tree was generated using Neighbor- Joining method. Acetonema longum, strain DSM 6540 and Thermoanaerobacter brockii, strain, DSM 1457 were used as outgroups. Numbers at nodes are bootstrap percentages (based on 2000 resamplings). Only bootstrap values greater than 50 % are shown. Bar, 0.01 substitutions per nucleotide site.

Table 5: Homologous 16S rRNA sequences, with their accession numbers for isolate Piso-NP3-KT-25.

Domain Phylum Organism Strain Genbank/ NCBI Accession Number Corynebacterium C. appendicis IMMIB R-3491 NR_028951.1 C. aquatimens IMMIB L-2475 NR_108857.1 C. ciconiae BS13 NR_029007.1 C. macginleyi JCL-2 NR_042138.1 C. mucifaciens DMMZ 2278 NR_026396.1 C. phocae M408/89/1 NR_026379.1 C. pilbarense strain IMMIB WACC- NR_116953.1 658 C. striatum Minnett NR_037041.1 Bacteria Actinobacteria C. thomssenii DSM 44276 NR_024849.1 C. ureicelerivorans IMMIB RIV-2301 NR_042558.1 Gordonia G. hydrophobica DSM 44015 NR_118597.1 G. bronchialis DSM 43247 NR_027594.1 Mycobacterium M. boenickei strain W5998 NR_029036.1 M. kubicae CDC 941078 NR_025000.1 Streptomyces S. avellaneus NBRC 13451 NR_041138.1

Figure 7: Phylogenetic tree based on 16S rRNA sequences showing the relationships between isolate Piso-NP3-KT-25 and related taxa. The tree was generated using the

Neighbor-Joining method. Corynebacterium ciconiae, strain BS13 was used as outgroups.

Numbers at nodes are bootstrap percentages (based on 2000 resamplings). Only bootstrap values greater than 50 % are shown. Bar, 0.01 substitutions per nucleotide site.

Discussion: The phylogenetic tree constructed suggested that Piso NA-SE-3 was found to be related to Paenibacillus cookii (LMG 18419) and Paenibacillus chibensis (NBRC 15958) but the isolate and above two species did not share the most recent common ancestor

(Figure 6). From the tree, it is evident that at earlier in evolutionary time, all three were shared a common ancestor and diverted later. Since the phylogenetic tree does not provide any information regarding timeline, it is impossible to state when the divergence occurred. The phylogenetic tree clustered the Piso-NA-SE-3 with Paenibacillus species with a bootstrap value of 82 % (Figure 6). The 16S rRNA gene sequence similarities for

Paenibacillus chibensis was 96 % and Paenibacillus cookii, 94 %. The top hit given by the blastn was Paenibacillus cineris (LMG 18439) with a 96 % similarity. The

Paenibacillus cineris was isolated for the first time was from ashy soil of an inactive fumarole at the foot of a volcano in Antarctica (Logan et al., 2004).

The 16S rRNA gene sequence is conserved among bacteria and the strength of the identity of an unknown organism is assessed by DNA pairing (Stackebrandt & Goebel,

1994). The fewer mismatches during the pairing of an unknown sequence to a known sequence, the higher the similarity score. An unknown species having ≥ 97% similarity score is an indication that the two organisms are related and the identity can be trusted

(Stackebrandt & Goebel, 1994). Any similarity score below 97% is regarded as a potential new species. The isolate Piso NP3- KT-25 showed 16S rRNA gene sequence similarities for Corynebacterium mucifaciens at 88 %. Piso NP3-KT-25 was found to be related to Corynebacterium mucifaciens (DMMZ 2278) but they do not share a most recent common ancestor. The phylogenetic tree clustered the Piso-NP3-KT-25 with

Corynebacterium species with a poor bootstrap value of 74 % (Figure 7). Based on the phylogenetic analysis, perhaps the isolate Piso NP3-KT-25 could be considered a novel

Corynebacterium species.

References:

Barraclough, T.G., & Nee, S. (2001). Phylogenetics and speciation. Trends in Ecology &

Evolution 16, 391-399.

Barton, N. H., Briggs, D. K., Jonathan, A., Eisen, J. A., Goldstein, D., & Patel, N. H

(2007) Evolution; Cold Spring Harbor (New York).

http://www.evolution-textbook.org/content/free/contents/ch27.html.

Bavykin, S.G., Lysov, Y.P., Zakhariev, V., Kelly, J.J., Jackman, J., Stahl, D.A., & Cherni,

A. (2004). Use of 16S rRNA, 23S rRNA, and gyrB gene sequence analysis to

determine phylogenetic relationships of Bacillus cereus group microorganisms.

Journal of Clinical Microbiology 42, 3711-3730.

Coenye, T., Laevens, S., Willems, A., Ohlén, M., Hannant, W., Govan, J., Gillis, M.,

Falsen, E., & Vandamme, P. (2001). Burkholderia fungorum sp. nov. and

Burkholderia caledonica sp. nov., two new species isolated from the environment,

animals and human clinical samples. International Journal of Systematic and

Evolutionary Microbiology 51, 1099-1107.

Felsenstein, J. (1981). Evolutionary trees from DNA sequences: a maximum likelihood

approach. Journal of Molecular Evolution 17, 368-376.

Hall, B.G. (2011). Phylogenetic trees made easy: A how to manual (Sinauer).

Hall, B.G. (2005). Comparison of the accuracies of several phylogenetic methods using

protein and DNA sequences. Molecular Biology and Evolution 22, 792-802.

Hedges, S.B. (1992). The number of replications needed for accurate estimation of the

bootstrap P value in phylogenetic studies. Molecular Biology and Evolution 9,

366-369.

Hillis, D.M., & Bull, J.J. (1993). An empirical test of bootstrapping as a method for

assessing confidence in phylogenetic analysis. Systematic Biology 42, 182-192.

Hunt, D.E., Klepac-Ceraj, V., Acinas, S.G., Gautier, C., Bertilsson, S., & Polz, M.F.

(2006). Evaluation of 23S rRNA PCR primers for use in phylogenetic studies of

bacterial diversity. Applied and Environmental Microbiology 72, 2221-2225.

Kim, J., & Warnow, T. (1999). Tutorial on phylogenetic tree estimation (ISMB).

Koonin, E.V., Makarova, K.S., & Aravind, L. (2002). Horizontal gene transfer in

prokaryotes: quantification and classification.

Lane, D.J., Pace, B., Olsen, G.J., Stahl, D.A., Sogin, M.L., & Pace, N.R. (1985). Rapid

determination of 16S ribosomal RNA sequences for phylogenetic analyses.

Proceedings of the National Academy of Sciences 82, 6955-6959.

Lin, G.N., Zhang, C., & Xu, D. (2011). Polytomy identification in microbial phylogenetic

reconstruction. BMC Systems Biology 5, 1.

Logan, N.A., De Clerck, E., Lebbe, L., Verhelst, A., Goris, J., Forsyth, G., Rodríguez-

Díaz, M., Heyndrickx, M., & De Vos, P. (2004). Paenibacillus cineris sp. nov.

and Paenibacillus cookii sp. nov., from Antarctic volcanic soils and a gelatin-

processing plant. International Journal of Systematic and Evolutionary

Microbiology 54, 1071-1076.

Page, R.D., & Holmes, E.C. (2009). Molecular evolution: a phylogenetic approach (John

Wiley & Sons).

Reddy, B.N. (2011). Basics for the construction of phylogenetic trees.

Sleator, R.D. (2011). Phylogenetics. Archives of Microbiology 193, 235-239.

Soltis, P.S., & Soltis, D.E. (2003). Applying the bootstrap in phylogeny reconstruction.

Statistical Science 18, 256-267.

Stackebrandt, E., & Goebel, B. (1994). Taxonomic note: a place for DNA-DNA

reassociation and 16S rRNA sequence analysis in the present species definition in

bacteriology. International Journal of Systematic and Evolutionary Microbiology

44, 846-849.

Wiesemüller, B., & Rothe, H. (2006). Interpretation of bootstrap values in phylogenetic

analysis. Anthropologischer Anzeiger, 161-165.

Wiley, E.O., & Lieberman, B.S. (2011). Phylogenetics: theory and practice of

phylogenetic systematics (John Wiley & Sons).

Zhao, G.-Z., Li, J., Qin, S., Zhang, Y.-Q., Zhu, W.-Y., Jiang, C.-L., Xu, L.-H., & Li, W.-J.

(2009). Micrococcus yunnanensis sp. nov., a novel actinobacterium isolated from

surface-sterilized Polyspora axillaris roots. International Journal of Systematic

and Evolutionary Microbiology 59, 2383-2387.

CHAPTER 4

Fluorescent in situ Hybridization (FISH)

Introduction:

The molecular technique, in situ hybridization (ISH) has been used for over 30 years to detect mRNA expression and localization studies in cells (Langdale, 1994;

Zordan, 2011). With ISH, a radioactively labeled DNA or RNA probe is hybridized with a complementary strand of DNA or RNA and then autoradiographs are taken using an electron scanning microscope (Jensen, 2014; Langdale, 1994). The introduction of fluorescently labeled probes decreased the use of radioactive probes drastically and fluorescent probes were safer, cheaper and easier to use than radioactive probes (Moter &

Göbel, 2000). Most current in situ hybridizations are done using fluorescently labeled probes and the technique is called Fluorescent in situ Hybridization (FISH) (O'Connor,

2008).

Fluorescent in situ Hybridization (FISH):

FISH has become one of the most popular techniques in medical, molecular, and microbial research fields. Due to high specificity of complementary binding, FISH is used in the detection of cancer cells, cancer-related proteins, novel cancer genes (Bishop,

2010; Kim et al., 2011), chromosome abnormalities, karyotyping, identification of specific species (Moter & Göbel, 2000; O'Connor, 2008), and detection of gene expressions and gene deletions (Gozzetti & Le Beau, 2000; Hirsch et al., 2008). FISH typically involves fluorescently labeled single stranded DNA or RNA, usually 15-30 base

pairs long, that are hybridized with a complementary strand DNA or RNA inside of cells/tissues/organs (Wallner et al., 1993). The expression of the targeted sites can be identified using a fluorescent microscopy or Confocal Laser Scanning Microscopy

(CLSM). A few additional advantageous of FISH verses ISH and other immunocytochemistry methods are, ease of the identification and quantification of target molecules due to high specificity of binding, multiple probes can be used simultaneously in localization experiments, visualization of dynamic functions in real time, and faster assay time (Gozzetti & Le Beau, 2000; Moter & Göbel, 2000). In comparison to FISH,

ISH cannot be used on targets that have low DNA or RNA copies (low specificity), only a single probe can be used, longer assay preparation time exist, and the inherent risk of exposure to radioactive materials (Jensen, 2014).

FISH in Microbiology:

The use of FISH is becoming more popular in environmental microbial ecology.

Staining, PCR, sequencing and bacterial culture methods do not provide adequate information about a distribution or quantitative analysis of bacterial species in their natural habitats (Moter & Göbel, 2000). Also, some microorganisms grow slowly or do not grow well under laboratory conditions and can be missed during traditional culturing.

FISH can be directly used to detect and quantify microbial presence, such as biofilms on tissues and soil samples (Moter & Göbel, 2000), regardless of physiological state.

Both 16S rRNA and 23S rRNA genes contain conserved and variable regions.

These variable regions show considerable diversity among bacteria and can be used to

differentiate among bacterial genera (Chakravorty et al., 2007; Hunt et al., 2006). Often, oligonucleotide probes are design complementary to the 16S rRNA or 23S (Giovannoni et al., 1988; Manz et al., 1993; Sunde et al., 2003). In a healthy log phase, prokaryotic cell contains approximately 10000 ribosomes, which increase the chance of target probe binding sites (Giovannoni et al., 1988).

Prior to hybridization, tissue samples are fixed with a strong fixative to preserve the morphological structure, limit protease and RNAase activity to prevent degradation of biomolecules and to disrupt the bacterial cell membrane for probes to enter (Nordentoft et al., 1997; Thavarajah et al., 2012). During fixation, cells are essentially captured in real- time. The oligonucleotide probes sequences are typically 15 - 25 bp (Hugenholtz et al.,

2002). These sequences can then be tagged either using a direct or indirect method. In the direct method of tagging, a fluorochrome is attached to either 5' or 3' end of a short sequence (Moter & Göbel, 2000). In indirect tagging, a primary antibody is attached to the oligonucleotide sequence and is not conjugated with a fluorescent probe. The secondary antibody that recognizes and binds to primary antibody is labeled with a fluorescent probe (Moter & Göbel, 2000).

In Fluorescent in situ hybridization, DNA oligonucleotide primers are designed complementary to the region of interest on a specific gene or rRNA. In this study, I used both 16S rRNA and 23S rRNA - targeted oligonucleotide probes. The oligonucleotide probes were hybridized with a sample and washed with buffer and/or distilled water to remove excess or unbound probes. Then, the samples are mounted and visualized under a fluorescent microscope or using CLSM. In general, mounting media contain antifade

agents to prevent fluorochromes from bleaching (Moter & Göbel, 2000). In FISH, a positive signal is identified as presence of an organism or another target of interest.

Confocal Laser Scanning Microscopy

The use of microscopy has evolved tremendously within the last few generations.

Confocal Laser Scanning Microscopy (CLSM) is one of the popular members of the microscope family and have been using for routine imagine of specimens (Paddock,

1999). The images obtained from CLSM provide better resolution than the images obtain from conventional light or fluorescence microscopes (Boyle, 2008). CLSM is used with fluorescent optics and can be used to image live cells, quantify cells, generate 3D images by optical sectioning, and include colocalization studies using multiple probes

(Matsumoto, 2003). Lasers are focused through a pinhole onto a single point on a sample.

The photons are excited and the emission from that focal point is collected through a second pinhole size aperture, and directed towards a detector. Any out of focus light is eliminated and therefore it does not contribute and lessen a final image (Amos & White,

2003). The result is a higher resolution image.

Autofluorescence:

FISH is not suitable for all types of samples. When an expected result is dependent on fluorescence, it is crucial to remember that some prokaryotes and eukaryotes in nature produce fluorescence naturally, known as autofluorescence. The organisms can autofluorescence under normal conditions, stress conditions, presence of

metabolite(s) such as flavoproteins, toxins, or due structural components such as lipofuscins and pigments (Bao et al., 2008). Some fungal spores and mycelia also produce autofluorescence in nature (Wu & Warren, 1984). Kojic acid, a chelating agent that inhibits pigmentation in some plants, produced by Aspergillus flavus and Aspergillus parasiticus is autofluorescent (Truite & Scott, 1978). Kojic acid combines with the host plant seed enzyme peroxidase and develops a bright greenish-yellow fluorescence (Truite

& Scott, 1978). Some pathogenic bacteria such as, Listeria monocytogenes , Salmonella enterica, Escherichia coli and environmental bacteria such as, Pseudomonas fluorescens and Cyanobacteria spp. have been shown to emit autofluorescence (Bao et al., 2008).

In this study, I used Fluorescent in situ hybridization (FISH) to determine and/or confirm the presence of archaea and eubacterial endosymbionts present within the tissues of the fruiting body P. tinctorius. FISH also provided a virtual idea of the localization and abundance of endosymbionts within the tissues of P. tinctorius.

Materials and Methods:

(1) Fluorescent Probes and Labeling:

All fluorescent probes were obtained from Invitrogen, Life Technologies/

Molecular Probes (Invitrogen by Life technologies, Carlsbad, California). All oligonucleotide probes were labeled at the 5' end with ALEXA 405 or ALEXA 488. The targeted sequences, hybridization conditions, and references for the probes used are listed in Table 6. To control for possible non-specific binding of EUB 338, a NONEUB 338 probe was also used. NONEUB 338 probe is complementary (antisense) to the EUB338

probe and served as a negative control (Wallner et al., 1993). To determine the presence of any autofluorescence, separate samples were prepared without the addition of any probes. The hybridization protocols were based on previously published protocols In:

Advanced Methods in Molecular Microbial Ecology (Daims et al., 2005), Fredriksson et al. (Fredriksson et al., 2012) and Eickhorst and Tippkötter (Eickhorst & Tippkötter,

2008).

Table 6: FISH probes used in this study targeting 16S rRNA or 23S rRNA.

Probe and target Target sequence E. coli positions (rRNA target site) ARC915 GTGCTCCCCCGCCAATTCCT 16 S, Archaea 915-934 EUB338 GCAGCCACCCGTAGGTGT 16S Eubacteria 338-355 NON EUB388 ACATCCTACGGGAGGC negative control MB1174 TACCGTCGTCCACTCCTTCCTC 16S Methano-bacteriaceae 1175-1196 SRB385 CGGCGTTGCTGCGTCAGG 16S, Most 385-402 Desulfovibrionales HGC69a TATAGTTACCACCGCCGT 23S Actinobacteria 1901-1918 Actino 2 GGC CTT CGG GTT GTA AAC C N/A Actinobacteria MS821 CGCCATGCCTGACACCTAGCGAGC 16S Methanosarcinaceae 821 -844

(2) Sample Preparation and Hybridization:

P. tinctorius fruiting body tissue from three individual samples (Piso 10, Piso

NA4, Piso NP-2-6) were aseptically sliced into thin, ~1 cm x 1 cm sections to expose the internal regions. The samples were fixed using 1.5 ml of 4 % paraformaldehyde solution and held at 4º C for 3 hours. The fixed samples were washed (3X) with phosphate buffer saline (PBS) and centrifuged at 10,000 xg for 5 minutes at 4º C to remove residual paraformaldehyde. Samples were placed individually into wells of epoxy- coated 10- hole diagnostic glass slides and dehydrated using a series of ethanol at: 50 % for 5 minutes,

80 % for 1 minute and 98 % for 1 minute. Thirty microliters of hybridization buffer containing a probe either EUB338, ARC915, HGC69a, MB1174, SRB385, MS821,

Actino 2 or NON-EUB338 were applied to each sample and subsequently held in a humidity chamber for 2 hours at 46º C. Slides were washed with 1x PBS 3 times, and once with ice cold nuclease free water (Invitrogen by Life technologies, Carlsbad,

California). After the samples were air dried, Slow fade™ light antifade reagent without glycerol (Molecular probes, Eugene, Oregon) was applied to prevent fluorochrome bleaching. Samples were covered with slide cover slips and sealed with a clear sealer. All the samples were prepared in triplicate. FISH images were collected for each sample using a Leica TCS SP8 confocal laser scanning microscopy (CLSM) (Leica, Wetzlar,

Germany).

(3) Confocal Parameters:

Spectral scans were performed on all samples that were prepared without any probes at different laser wavelengths (405 nm, 488 nm or 638 nm) to determine the emission range that autofluorescence (Table 7 and Appendix D) at minimum. Any autofluorescence was deducted during the scanning of the probed samples. Probed samples were scanned using excitation wavelengths 405 nm or 488 nm under 40X objective (oil). Images were scanned at 1024 x1024 pixels at 400 Hz speed and 3 average frames per slice. Confocal images were collected and analyzed using Leica Application

Suite Advanced Fluorescence (LAS AF 3) software and ImageJ.

Table 7: Spectral scan parameters

Excitation wave Emission spectra before Emission spectra length autofluorescence deduction autofluorescence at minimum (nm) (nm) (nm) 405 420 - 600 420 - 473 488 498 - 676 537 - 557 638 650 - 754 698 - 740

Results:

The non-probed samples showed autofluorescence when excited with laser lines 405 nm, 488 nm and 638 nm (Figures 8, 12 and 18). The NONEUB 338 probe was designed complementary to EUB 338 and should not bind to any sequences thus, NONEUB 338 was used as the negative control. The samples hybridized with NONEUB 338 showed minimum nonspecific binding (Figures 8D, 12D and 18D). All Pisolithus samples showed positive signals for presence of Eubacteria (EUB 338), Archaea (ARC915),

Actinobacteria (HGC69a, Actino 2), Methanobacteria (MB1174), Methanosarcinaceae

(MS821) and Desulfovibrionales (SRB385) (Figures 9- 11, 13 -17, 19 - 21).

A B

C D

Figure 8: P. tinctorius 10 sample, no probes (to detect autofluorescence)

(A) Laser 405nm (excitation), Emission spectra :420 - 600 nm

(B) Laser 488 nm (excitation), Emission spectra :498 -676 nm.

with probe (D) NONEUB338 (negative control) with ALEXA 405.

Laser 405 nm (excitation) Emission spectra :420 - 473 nm

A B

Figure 9: P. tinctorius sample 10, EUB338 with ALEXA 488. Laser 488 nm (excitation),

Emission spectra :537 -557 nm. (A) Replicate 1 (B) Replicate 2 and (C) Replicate 3

A B

Figure 10: P. tinctorius sample 10, SRB385 with ALEXA 488. Laser 488 nm

(excitation), Emission spectra: 537 -557 nm. (A) Replicate 1 (B) Replicate 2 and (C)

Replicate 3

A B

Figure 11: P. tinctorius sample 10, HGC69a with ALEXA 405. Laser 405 nm

(excitation), Emission spectra: 420 -473 nm. (A) Replicate 1 (B) Replicate 2 and (C)

Replicate 3

A B

C D

Figure 12: P. tinctorius NA4 sample, no probes (to detect autofluorescence)

(A) Laser 405nm (excitation), Emission spectra :420 -600 nm

(B) Laser 488 nm (excitation), Emission spectra :498 -676 nm

With probe (D) NONEUB338 (negative control) with ALEXA 405. Laser 405 nm (excitation) Emission spectra: 420 - 473 nm

A B

Figure 13: P. tinctorius sample NA4, EUB338 with ALEXA 488. Laser 488 nm

(excitation), Emission spectra: 537 -557 nm. (A) Replicate 1 (B) Replicate 2 and (C)

Replicate 3

A B

Figure 14: P. tinctorius sample NA4, SRB385 with ALEXA 488. Laser 488 nm

(excitation), Emission spectra: 537 -557 nm. (A) Replicate 1 (B) Replicate 2 (C)

Replicate 3

A B

Figure 15: P. tinctorius sample NA4, HGC69a with ALEXA 405. Laser 405 nm

(excitation), Emission spectra: 420 -473 nm. (A) Replicate 1 (B) Replicate 2 and (C)

Replicate 3

A B

Figure 16: P. tinctorius sample NA4, Actino 2 with ALEXA 405. Laser 405 nm

(excitation), Emission spectra: 420 -473 nm. (A) Replicate 1 (B) Replicate 2 and (C)

Replicate 3

A B

Figure 17: P. tinctorius sample NA4, MB1174 with ALEXA 488. Laser 488 nm

(excitation), Emission spectra: 537 -557 nm. (A) Replicate 1 (B) Replicate 2 and (C)

Replicate 3

100

A B

C D

Figure 18: P. tinctorius NP-2-6 sample, no probes (to detect autofluorescence)

(A) Laser 405nm (excitation), Emission spectra :420 -600 nm

(B) Laser 488 nm (excitation), Emission spectra :498 -676 nm

With probe (D) NONEUB338 (negative control) with ALEXA 405. Laser 405 nm

(excitation) Emission spectra: 420 - 473 nm

101

A B

Figure 19: P. tinctorius sample NP 2-6, EUB338 with ALEXA 488. Laser 488 nm

(excitation), Emission spectra: 537 -557 nm. (A) Replicate 1 (B) Replicate 2 and (C)

Replicate 3

102

A B

Figure 20: P. tinctorius sample NP 2-6, ARC915 with ALEXA 488. Laser 488 nm

(excitation), Emission spectra: 537 -557 nm. (A) Replicate 1 (B) Replicate 2 and (C)

Replicate 3

103

A B

Figure 21: P. tinctorius sample NP 2-6, MS821 with ALEXA 488. Laser 488 nm

(excitation), Emission spectra: 537 -557 nm. (A) Replicate 1 (B) Replicate 2 and (C)

Replicate 3

104

Discussion:

The P. tinctorius samples (Piso 10, Piso NA4, Piso NP-2-6) that were prepared without any probes demonstrated the presence of autofluorescence at different excitation and emission spectra. In nature, many prokaryotes and eukaryotes produce autofluorescence (Wu & Warren, 1984). As mentioned earlier, organisms can autofluorescence under normal conditions, stress conditions, due to production of varies metabolites (ex: flavoproteins, toxins), their own structural components such as lipofuscins and chlorophyll pigments (Bao et al., 2008; Wu & Warren, 1984) and autofluorescence for P. tinctorious could be caused by any of these scenarios. Intensity and emission of autofluorescence varies at different excitation wavelengths, between different species of fungi and different parts of the fungal structure. For an example, when excited by blue light, fruiting body cells on the pileus surface (cap of the mushroom) of Macrolepiota rhacodes, a saprophytic fungus showed high intensity levels of autofluorescence compared to clusters of spherical cells underneath the pileus of the fruiting body (Žižka & Gabriel, 2008). Accumulation of heavy metal inside the fruiting bodies of wood-rotting fungi (Gabriel et al., 1997) greatly affect the levels of autofluorescence by discoloration of fungal internal structures (Gabriel et al., 2016). P. tinctorius does accumulate sulfur in the sporocarps (Muncie et al., 1975), and perhaps sulfur discoloration might be contributing to the autofluorescence. Also autofluorescence is used as a measurement of fungal cellular viability (Muncie et al., 1975). The production of autofluorescence by organisms in diverse ecological habits have not yet

105

been fully explored. To identify and characterize the bacteria that produce autofluorescence within P. tinctorius tissues would be a future study for this project.

The samples hybridized with NONEUB338 probe (negative control) showed minimum nonspecific binding. Nonspecific binding of probes could have happened due to few reasons (1) excess probes were not completely removed during the washed steps and contributed to the overall fluorescence, (2) during the probe purification process, unattached dye molecules were not removed properly and causing these dye molecules to covalently bind to proteins on the sample, (3) primer concentration was too high, promoting nonspecific binding (Wallner et al., 1993), and (4) the probes were bound to low affinity sites within the rRNA (Amann et al., 1990b). The amount of fluorescence produce by the nonspecific binding was low and essentially can be ignored.

Based on the density of the fluorescence given off by each sample, I confirmed that within the tissues of fungus P. tinctorius, Eubacteria (EUB338), Archaea (ARC915),

Actinobacteria (HGC69a, Actino 2), Methano bacteria (MB1174), Methanosarcinaceae

(MS821) and Desulfovibrionales (SRB385) were present. The current universal phylogenetic tree is build based on 16S rRNA sequences (18S for eukaryotes) and out of three domains, two domains are composed with prokaryotes (Doolittle, 1999). In this study, either prokaryotic domain, phylum or genus- specific oligonucleotide probes were created based on distinct regions (conserved or variable) on16S rNA or 23S rRNA.

(Amann et al., 1990b). The two domains -specific probes used were EUB338 and

ARC915. The EUB338 oligonucleotide probe was targeted to identify members in the

106

eubacterial domain (Eickhorst & Tippkötter, 2008) and ARC915 probe was targeted members of archaea (Raskin et al., 1994).

Eubacteria is the largest prokaryotic domain (Woese & Fox, 1977). A large quantity of eubacteria was present within the tissues of P. tinctorius based on the amount of fluorescence seen throughout samples. The Phylum Actinobacteria and genus

Desulfovibrionales were detected and are specific groups of bacteria that falls within the eubacterial domain. Desulfovibrionales are within a group of delta Proteobacteria that are capable of reducing sulfur (Sorokin et al., 2008). Some of these eubacterial sulfur reducers are associated with above ground volcanic hydrothermal vents (Stott et al.,

2008) and some are associated with deep sea hydrothermal vents where minimal amount of oxygen and abundant sulfur can be found (Dick et al., 2013). The Oligonucleotide probe SRB385 was used and binds to a specific region on 16S rRNA which is conserved among most species of sulfur reducing purple bacteria (delta group Proteobacteria)

(Amann et al., 1990a). Based on the FISH images, a large quantity of δ-Proteobacterial species reside within the fungus P. tinctorius. P. tinctorius accumulates elemental sulfur in sporocarps (Muncie et al., 1975) and it is possible that some of these endosymbiotic bacteria are utilizing sulfur and contributing to decrease the sulfur toxicity. The HGC69a oligonucleotide probe is designed to identify Actinobacterial species and the target site is on 23S rRNA (Sekar et al., 2003). FISH images showed the presence of Actinobacteria within the tissues but it was appeared slightly lower compared to Desulfovibrionales.

Observations are speculative because all samples cannot be equated and more samples need to be viewed to be more certain quantitatively.

107

Bacterial culturing results supported the FISH results for eubacteria. Many eubacterial species that belong to phylum Firmicutes, phylum Actinobacteria and phylum

Proteobacteria (beta and gamma) were cultured. However, I was unable to isolate any δ -

Proteobacterial species. Advancement of molecular studies and microscopy have suggested that a higher diversity of bacteria are living in natural environments that haven’t been able to be isolated using standard bacterial culture methods (Moter & Göbel,

2000; Takai & Horikoshi, 1999).

Archaea live in extreme environments and this group is practically composed of methanogens, extreme halophiles, thermoacidophiles and sulfur-dependent bacteria

(Fewson, 1986). The ARC915 oligonucleotide probe targets members of the domain

Archaea (Raskin et al., 1994). The probes MB1174 and MS821 probes targeted methanogens and Methanosarcina specie respectively (Raskin et al., 1994). Methanogens are a diverse group of methane- producing archaea that have isolated from environments such as submarine hydrothermal vents, geothermal pools, and geothermally heated sea sediments (Huber et al., 1982; Jones et al., 1983; Stetter et al., 1981; Ver Eecke et al.,

2012). Methanosarcina members can produce methane from fermenting acetate, formic acid, methanol or methylamines as substrate (Raskin et al., 1994). Methane produced by methanogens can be metabolize as carbon source by other methanotrophic eubacterial

(Lieberman & Rosenzweig, 2004). Also, Lenhart et al. (2012) showed that some

Basidiomycetes are capable of producing methane without any involvement of methanogenic bacteria (Lenhart et al., 2012). Yet, methane production by P. tinctorius or

Pisolithus spp. has not been reported. It would be an interesting to evaluate methane

108

production by P. tinctorius in future. FISH images for Methanosarcina showed a higher intensity of fluorescence than images with methanogens.

Small round structures on some fungal samples were likely fungal spores and measured to be between 7.5 – 10 µm. The size of the fungal spores are regulated by the geography and the climate conditions, such as temperature, humidity and wind patterns

(Kauserud et al., 2011). These structures fluoresced but fluorescence appeared more robust in scattered places on the surface of spores. It is possible that the added fluorescence were bacteria. Companion examination of these structures using Scanning

Electron Microscopy would be useful to determine if this is the case. If so, it might suggest that bacteria are distributed from P. tinctorius to nature and possibly to another P. tinctorius.

Reference:

Amann, R.I., Binder, B.J., Olson, R.J., Chisholm, S.W., Devereux, R., & Stahl, D.A.

(1990a). Combination of 16S rRNA-targeted oligonucleotide probes with flow

cytometry for analyzing mixed microbial populations. Applied and Environmental

Microbiology 56, 1919-1925.

Amann, R.I., Krumholz, L., & Stahl, D.A. (1990b). Fluorescent-oligonucleotide probing

of whole cells for determinative, phylogenetic, and environmental studies in

microbiology. Journal of Bacteriology 172, 762-770.

109

Amos, W., & White, J. (2003). How the confocal laser scanning microscope entered

biological research. Biology of the Cell 95, 335-342.

Bao, N., Jagadeesan, B., Bhunia, A.K., Yao, Y., & Lu, C. (2008). Quantification of

bacterial cells based on autofluorescence on a microfluidic platform. Journal of

Chromatography A 1181, 153-158.

Bishop, R. (2010). Applications of fluorescence in situ hybridization (FISH) in detecting

genetic aberrations of medical significance. Bioscience Horizons, hzq009.

Boyle, J. (2008). Molecular biology of the cell, by B. Alberts, A. Johnson, J. Lewis, M.

Raff, K. Roberts, and P. Walter (Wiley Online Library).

Chakravorty, S., Helb, D., Burday, M., Connell, N., & Alland, D. (2007). A detailed

analysis of 16S ribosomal RNA gene segments for the diagnosis of pathogenic

bacteria. Journal of Microbiological Methods 69, 330-339.

Daims, H., Stoecker, K., & Wagner, M. (2005). Fluorescence in situ hybridization for the

detection of prokaryotes. Molecular Microbial Ecology 213, 239.

Dick, G.J., Anantharaman, K., Baker, B.J., Li, M., Reed, D.C., & Sheik, C.S. (2013). The

microbiology of deep-sea hydrothermal vent plumes: ecological and

biogeographic linkages to seafloor and water column habitats.

Doolittle, W.F. (1999). Phylogenetic classification and the universal tree. Science 284,

2124-2128.

Eickhorst, T., & Tippkötter, R. (2008). Detection of microorganisms in undisturbed soil

by combining fluorescence in situ hybridization (FISH) and micropedological

methods. Soil Biology and Biochemistry 40, 1284-1293.

110

Fewson, C.A. (1986). Archaebacteria. Biochemical Education 14, 103-115.

Fredriksson, N.J., Hermansson, M., & Wilén, B.-M. (2012). Diversity and dynamics of

Archaea in an activated sludge wastewater treatment plant. BMC Microbiology

12, 140.

Gabriel, J., Baldrian, P., Rychlovský, P., & Krenželok, M. (1997). Heavy Metal Content

in Wood-Decaying Fungi Collected in Prague and in the National Park Šumavain.

the Czech Republic. Bulletin of Environmental Contamination and Toxicology 59,

595-602.

Giovannoni, S.J., DeLong, E.F., Olsen, G.J., & Pace, N.R. (1988). Phylogenetic group-

specific oligodeoxynucleotide probes for identification of single microbial cells.

Journal of Bacteriology 170, 720-726.

Gozzetti, A., & Le Beau, M.M. (2000). Fluorescence in situ hybridization: uses and

limitations. Paper presented at: Seminars in hematology (Elsevier).

Hirsch, F.R., Herbst, R.S., Olsen, C., Chansky, K., Crowley, J., Kelly, K., Franklin, W.A.,

Bunn, P.A., Varella-Garcia, M., & Gandara, D.R. (2008). Increased EGFR gene

copy number detected by fluorescent in situ hybridization predicts outcome in

non–small-cell lung cancer patients treated with cetuximab and chemotherapy.

Journal of Clinical Oncology 26, 3351-3357.

Huber, H., Thomm, M., König, H., Thies, G., & Stetter, K.O. (1982). Methanococcus

thermolithotrophicus, a novel thermophilic lithotrophic methanogen. Archives of

Microbiology 132, 47-50.

111

Hunt, D.E., Klepac-Ceraj, V., Acinas, S.G., Gautier, C., Bertilsson, S., & Polz, M.F.

(2006). Evaluation of 23S rRNA PCR primers for use in phylogenetic studies of

bacterial diversity. Applied and Environmental Microbiology 72, 2221-2225.

Hugenholtz, P., Tyson, G.W., & Blackall, L.L. (2002). Design and evaluation of 16S

rRNA-targeted oligonucleotide probes for fluorescence in situ hybridization.

Gene Probes: Principles and Protocols, 29-42.

Jensen, E. (2014). Technical review: In situ hybridization. The Anatomical Record 297,

1349-1353.

Jones, W., Leigh, J.A., Mayer, F., Woese, C., & Wolfe, R. (1983). Methanococcus

jannaschii sp. nov., an extremely thermophilic methanogen from a submarine

hydrothermal vent. Archives of Microbiology 136, 254-261.

Kim, J., & Warnow, T. (1999). Tutorial on phylogenetic tree estimation (ISMB).

Kauserud, H., Heegaard, E., Halvorsen, R., Boddy, L., Høiland, K., & Stenseth, N.C.

(2011). Mushroom's spore size and time of fruiting are strongly related: is

moisture important? Biology Letters 7, 273-276.

Langdale, J.A. (1994). In situ hybridization. In the maize handbook (Springer), pp. 165-

180.

Manz, W., Szewzyk, U., Ericsson, P., Amann, R., Schleifer, K., & Stenström, T. (1993).

In situ identification of bacteria in drinking water and adjoining biofilms by

hybridization with 16S and 23S rRNA-directed fluorescent oligonucleotide probes.

Applied and Environmental Microbiology 59, 2293-2298.

112

Matsumoto, B. (2003). Cell biological applications of confocal microscopy, Vol 70

(Academic Press).

Moter, A., & Göbel, U.B. (2000). Fluorescence in situ hybridization (FISH) for direct

visualization of microorganisms. Journal of Microbiological Methods 41, 85-112.

Muncie, J.G., Rothwell, F.M., & Kessel, W.G. (1975). Elemental sulfur accumulation in

Pisolithus. Mycopathologia 55, 95-96.

Nordentoft, S., Christensen, H., & Wegener, H.C. (1997). Evaluation of a fluorescence-

labelled oligonucleotide probe targeting 23S rRNA for in situ detection of

Salmonella serovars in paraffin-embedded tissue sections and their rapid

identification in bacterial smears. Journal of Clinical Microbiology 35, 2642-2648.

O'Connor, C. (2008). Fluorescence in situ hybridization (FISH). Nature Education 1, 171.

Paddock, S.W. (1999). Confocal laser scanning microscopy. Biotechniques 27, 992-1007.

Poulsen, L.K., Ballard, G., & Stahl, D.A. (1993). Use of rRNA fluorescence in situ

hybridization for measuring the activity of single cells in young and established

biofilms. Applied and Environmental Microbiology 59, 1354-1360.

Raskin, L., Stromley, J.M., Rittmann, B.E., & Stahl, D.A. (1994). Group-specific 16S

rRNA hybridization probes to describe natural communities of methanogens.

Applied and Environmental Microbiology 60, 1232-1240.

Sekar, R., Pernthaler, A., Pernthaler, J., Warnecke, F., Posch, T., & Amann, R. (2003).

An improved protocol for quantification of freshwater Actinobacteria by

fluorescence in situ hybridization. Applied and Environmental Microbiology 69,

2928-2935.

113

Sorokin, D.Y., Tourova, T., Mußmann, M., and Muyzer, G. (2008). Dethiobacter

alkaliphilus gen. nov. sp. nov., & Desulfurivibrio alkaliphilus gen. nov. sp. nov.:

two novel representatives of reductive sulfur cycle from soda lakes.

Extremophiles 12, 431-439.

Stetter, K.O., Thomm, M., Winter, J., Wildgruber, G., Huber, H., Zillig, W., Jané-Covic,

D., König, H., Palm, P., & Wunderl, S. (1981). Methanothermus fervidus, sp. nov.,

a novel extremely thermophilic methanogen isolated from an Icelandic hot spring.

Zentralbl. Bakteriol. Parasitenkd. Infektionskr. Hyg. Abt. 1 Orig. Reihe C 22,

166-178.

Stott, M.B., Saito, J.A., Crowe, M.A., Dunfield, P.F., Hou, S., Nakasone, E., Daughney,

C.J., Smirnova, A.V., Mountain, B.W., & Takai, K. (2008). Culture-independent

characterization of a novel microbial community at a hydrothermal vent at

Brothers volcano, Kermadec arc, New Zealand. Journal of Geophysical Research:

Solid Earth 113, n/a-n/a.

Sunde, P.T., Olsen, I., Göbel, U.B., Theegarten, D., Winter, S., Debelian, G.J., Tronstad,

L., & Moter, A. (2003). Fluorescence in situ hybridization (FISH) for direct

visualization of bacteria in periapical lesions of asymptomatic root-filled teeth.

Microbiology 149, 1095-1102.

Takai, K., & Horikoshi, K. (1999). Genetic diversity of Archaea in deep-sea

hydrothermal vent environments. Genetics 152, 1285-1297.

114

Thavarajah, R., Mudimbaimannar, V.K., Elizabeth, J., Rao, U.K., & Ranganathan, K.

(2012). Chemical and physical basics of routine formaldehyde fixation. Journal of

Oral and Maxillofacial Pathology 16, 400.

Truite, J., & Scott, D.H. (1978). Rapid screening methods for aflatoxin in corn.

Ver Eecke, H.C., Butterfield, D.A., Huber, J.A., Lilley, M.D., Olson, E.J., Roe, K.K.,

Evans, L.J., Merkel, A.Y., Cantin, H.V., & Holden, J.F. (2012). Hydrogen-limited

growth of hyperthermophilic methanogens at deep-sea hydrothermal vents.

Proceedings of the National Academy of Sciences 109, 13674-13679.

Wallner, G., Amann, R., & Beisker, W. (1993). Optimizing fluorescent in situ

hybridization with rRNA‐targeted oligonucleotide probes for flow cytometric

identification of microorganisms. Cytometry 14, 136-143.

Woese, C.R., & Fox, G.E. (1977). Phylogenetic structure of the prokaryotic domain: the

primary kingdoms. Proceedings of the National Academy of Sciences 74, 5088-

5090.

Wu, C.H., & Warren, H. (1984). Natural autofluorescence in fungi, and its correlation

with viability. Mycologia, 1049-1058.

Zordan, A. (2011). Fluorescence in situ hybridization on formalin-fixed, paraffin-

embedded tissue sections. Cancer Cytogenetics: Methods and Protocols, 189-202.

Žižka, Z., and Gabriel, J. (2008). Autofluorescence of the fruiting body of the fungus

Macrolepiota rhacodes. Folia Microbiologica 53, 537-539.

115

CHAPTER 5

Thesis Summary

The fungus Pisolithus tinctorius is a common inhabitant of Yellowstone National

Park geothermal soils. P. tinctorius does not form any mycorrhizal relationships with vascular plants, instead they appeared to form symbiotic relationships with a diverse group of bacterial species in order to satisfy their nutritional and energy needs. The three main objectives of my study were:

1. To determine and confirm the presence of eubacterial endosymbionts living

within the tissues of P. tinctorius using bacterial culture methods and molecular

techniques.

2. To determine the taxonomic position of isolates that gave gene similarity score

<97 % using phylogenetic analysis.

3. To determine the relative abundance of eubacteria and archaea within the tissues

of P. tinctorius using Fluorescent in situ Hybridization (FISH).

Bacterial Culturing:

I recovered 34 different bacterial species that belong to three different phyla from internal tissues of P. tinctorius. Out of 34 species, five were Actinobacterial species, four were Proteobacterial species and twenty-five different Firmicutes species (Tables 1, 2 and

3).

The internal environment of P. tinctorius fruiting bodies are rich with elemental sulfur, hydrocarbons and moist with water produce by cellular respiration (Cullings et al.,

116

2014; Muncie et al., 1975). These internal environmental conditions have created an ultimate environment for diverse group of endosymbiotic bacteria. To my knowledge, to date, there is little information available regarding endosymbiotic relationships between bacterial species and fungus P. tinctorius, however; there are a number of examples explaining symbiotic relationships between bacteria and arbuscular-mycorrhizal, saprophytic, and/or ectomycorrhizal fungi. Burkholderia members are common endosymbiotic inhabitants in arbuscular-mycorrhizal fungi and in saprophytic white rot fungi (Bianciotto et al., 2000; Lim et al., 2003; Partida-Martinez et al., 2007a; Seigle-

Murandi et al., 1996). Some of these species are known to contained nitrogen fixation genes and also, capable of tolerating lower pH levels (Minerdi et al., 2001). Not only

Burkholderia members but also some Paenibacillus and Bacillus spp. were shown to live intracellularly in ectomycrohizzal fungus, Laccaria bicolor (Bertaux et al., 2003). Reyes et al., (2004) reported that E. americana as a common bacterial inhabitant of healthy button mushrooms and yet the role of this bacterial species is unknown (Reyes et al.,

2004). P. tinctorius growing in acidic thermal soil would benefit from having endosymbionts such as Burkholderia species that is capable of fixing nitrogen and can tolerate high acidic levels. Some Burkholderia spp. such as Burkholderia rhizoxinica and

Paenibacillus spp. , such as Paenibacillus validus are essential for the formation and maturation of fungal spores (Partida-Martinez et al., 2007b). In return, fungal spores act as vector for bacterial distribution. Proteobacterial members are found to be commonly associating with active hydrothermal vents (Nakagawa et al., 2004; Sievert et al., 2008;

Stott et al., 2008) and as well as deep sea inactive hydrothermal vents (Sylvan et al.,

117

2012). Some of these proteobacterial species are sulfur oxidizers and reducers (Nakagawa et al., 2004; Sievert et al., 2008). It comes as no surprise, that I was able to isolate some proteobacterial species from my culturing.

Rhodococcus erythropolis is one of the well-studied members of the genus

Rhodococcus and produces large variety of enzymes such as dehydrogenases, epoxide hydrolases, oxygenases and perform enzymatic bioconversions, biodesulfurization and hydrocarbon degradations in the environment (Gray et al., 1999; Xu et al., 2007; Zhang et al., 2013). The fruiting body of P. tinctorius is full of hydrocarbons and sulfur (Cullings et al., 2014; Muncie et al., 1975). Having Actinobacteria such as Rhodococcus spp. could be an asset to P. tinctorius growing in nutrient deficient, toxic environment. Further metabolic studies are needed to confirm the role of Rhodococcus species in sulfur utilization and hydrocarbon degradation within the tissues of P. tinctorius.

From culturing, I recovered mesophilic, thermophilic, thermotolerant and psychrophilic Firmicutes species. Thermophile and/or thermotolerant bacteria were previously isolated from dessert soils, Yellowstone National Park hot spring and in inactive fumarole from Antarctica (Makhalanyane et al., 2015; Mead et al., 2012).

Thermophiles possess stable enzymes that help to carry out variety of metabolic processes (Zeikus, 1979) and make possible for gene expression at higher temperatures by enabling proper cellular function without interruptions (Imanaka et al., 1982). The psychrophilic bacteria are capable of degrading organic matter and others synthesized

DNA only under subzero conditions (Tuorto et al., 2014). Yellowstone National Park undergoes seasonal weather changes throughout the year. It is possible that thermophilic

118

and psychrophilic endosymbiotic bacteria provide advantages to a fungus such as P. tinctorius living in volcanic regions that subjected to constant temperature fluctuations.

In general, and based on previous studies, some of the genus Bacillus family members can promote the growth of the plants by controlling diseases, nutrient availability, water absorption, by increase secretion of siderophores and other metabolites production (Bhardwaj et al., 2014; Gutiérrez‐Mañero et al., 2001; Qiao et al., 2014).

Perhaps, such Bacillus species as above act by eliminating the pathogenic invaders and help in symbiotic microbial population control within the fungal tissues.

Many other bacterial species could be present within the fungus, but they were not detected using standard culture methods. It is possible some bacteria had longer lag time, needed special nutrient requirements or some inhibited the growth of another species.

Having a diverse range of endosymbiotic bacterial species within the P. tinctorius may ensure the viability of each other. Future studies are needed to determine any role(s) if any of these bacterial species within P. tinctorius. Full genome sequencing of bacterial isolates would also be useful to determine nutrient or growth requirements.

Phylogenetic Analysis:

Neighbor joining (NJ) method was used to build the phylogenetic trees and topology of the trees were evaluated by using bootstrap resampling method with 2000 replicates. The two isolates evaluated in this study were chosen based on 16S rRNA gene sequence similarity percentages. Piso NA-SE-3 was found to be related to Paenibacillus cookii and Paenibacillus chibensis but the isolate and two bacterial species did not share

119

the most recent common ancestor. From the tree, it is evident that at earlier in evolution all three were shared a common ancestor and diverted later. Piso-NA-SE-3 clustered with

Paenibacillus species with a bootstrap value of 82 % (Figure 6). The phylogenetic tree clustered the Piso NP3-KT-25 Corynebacterium species with a poor bootstrap value of

74 % (Figure 7). The 16S rRNA similarity score was 88% with an identity as

Corynebacterium mucifaciens. Piso NP-KT-25 could indeed be a novel Corynebacterium sp. Further analysis is needed to confirm.

Fluorescence in situ Hybridization:

Fluorescently- tagged rRNA oligonucleotide sequences are useful in microbial identification (Moter & Göbel, 2000). FISH is an excellent technique to identify the bacterial species that is unable to isolate using standard culture methods (Moter & Göbel,

2000). Samples prepared without any probes demonstrated the presence of autofluorescence. Autofluorescence is common among many prokaryotes and eukaryotes

(Wu & Warren, 1984). Perhaps the autofluorescence I observed on the samples can be due to sulfur discoloration, metabolites produce by both bacteria and fungus.

(Bao et al., 2008; Gabriel et al., 1997; Gabriel et al., 2016). To identify and characterize the bacteria that produce autofluorescence within P. tinctorius tissues would be a future study for this project.

Based on the FISH results for eubacteria, it is likely that large quantity of eubacteria exist within the tissues of P. tinctorius, including sulfur reducing purple bacteria (delta group Proteobacteria) and Actinobacteria. It is know, that P. tinctorius

120

accumulate elemental sulfur in sporocarps (Muncie et al., 1975) and it is a possibility that some of these endosymbiotic bacteria including Desulfovibrionales utilizing sulfur and contribute to a decrease in sulfur toxicity. Desulfovibrionales are obligate anaerobes (Foti et al., 2007). FISH images showed the presence of Actinobacteria within the tissues but it appeared significantly lower compared to Desulfovibrionales. The bacterial culturing results confirmed the FISH results for eubacteria. Through bacterial culturing I was able to isolate many eubacterial species that belong to phyla Firmicutes, Actinobacteria and

Proteobacteria (beta and gamma). The probes ARC915, MB1174 and MS821 probes were targeted Archaea, Methanogens and Methanosarcina species respectively (Raskin et al., 1994). Methanogens are a diverse group of methane producing archaea that are commonly associated with hydrothermal vents and capable of producing methane (Huber et al., 1982; Jones et al., 1983; Stetter et al., 1981; Ver Eecke et al., 2012). Methane produced by methanogens can be metabolize as carbon source by other methanotrophic eubacteria (Lieberman & Rosenzweig, 2004). Also, Lenhart et al. (2012) showed that some Basidiomycetes family members are capable of producing methane without any involvement of methanogenic bacteria (Lenhart et al., 2012). Yet, no methane production by P. tinctorius has been reported and it would be an interesting aspect to evaluate methane production by P. tinctorius.

In summary, I investigated for the first time, eubacterial endosymbiotic communities within the tissues of P. tinctorius using standard bacterial culture methods, molecular methods, and FISH. I was able to isolate 34 different bacterial species from six individual P. tinctorius samples. Through FISH, I confirmed the presence of eubacteria,

121

archaea, Actinobacteria, Methanobacteria, Methanosarcinaceae and Desulfovibrionales.

Overall, my study demonstrated the presence of endosymbiotic bacteria within the fungus

P. tinctorius.

122

Complete References

Ahmad, F., Ahmad, I., & Khan, M. (2008). Screening of free-living rhizospheric bacteria

for their multiple plant growth promoting activities. Microbiological Research

163, 173-181.

Amann, R.I., Binder, B.J., Olson, R.J., Chisholm, S.W., Devereux, R., & Stahl, D.A.

(1990a). Combination of 16S rRNA-targeted oligonucleotide probes with flow

cytometry for analyzing mixed microbial populations. Applied and Environmental

Microbiology 56, 1919-1925.

Amann, R.I., Krumholz, L., & Stahl, D.A. (1990b). Fluorescent-oligonucleotide probing

of whole cells for determinative, phylogenetic, and environmental studies in

microbiology. Journal of Bacteriology 172, 762-770.

Amos, W., & White, J. (2003). How the confocal laser scanning microscope entered

biological research. Biology of the Cell 95, 335-342.

An, S.-Y., Asahara, M., Goto, K., Kasai, H., & Yokota, A. (2007). Terribacillus

saccharophilus gen. nov., sp. nov. and Terribacillus halophilus sp. nov., spore-

forming bacteria isolated from field soil in Japan. International Journal of

Systematic and Evolutionary Microbiology 57, 51-55.

Antonio, M.A., Hawes, S.E., & Hillier, S.L. (1999). The identification of vaginal

Lactobacillus species and the demographic and microbiologic characteristics of

women colonized by these species. Journal of Infectious Diseases 180, 1950-1956.

Bacon, C.W., & Hinton, D.M. (2011). Bacillus mojavensis: its endophytic nature, the

surfactins, and their role in the plant response to infection by Fusarium

123

verticillioides. In Bacteria in Agrobiology: Plant Growth Responses (Springer),

pp. 21-39.

Baik, K.S., Choe, H.N., Park, S.C., Kim, E.M., & Seong, C.N. (2011). Paenibacillus

wooponensis sp. nov., isolated from wetland freshwater. International Journal of

Systematic and Evolutionary Microbiology 61, 2763-2768.

Bao, N., Jagadeesan, B., Bhunia, A.K., Yao, Y., & Lu, C. (2008). Quantification of

bacterial cells based on autofluorescence on a microfluidic platform. Journal of

Chromatography A 1181, 153-158.

Barton, N. H., Briggs, D. K., Jonathan, A., Eisen, J. A., Goldstein, D., and Patel, N. H

(2007) Evolution; Cold Spring Harbor (New York). http://www.evolution-

textbook.org/content/free/contents/ch27.html.

Barr, D. (2001). Chytridiomycota. In Systematics and Evolution (Springer), pp. 93-112.

Barraclough, T.G., and Nee, S. (2001). Phylogenetics and speciation. Trends in Ecology

& Evolution 16, 391-399.

Bates, S.T., Cropsey, G.W., Caporaso, J.G., Knight, R., & Fierer, N. (2011). Bacterial

communities associated with the lichen symbiosis. Applied and Environmental

Microbiology 77, 1309-1314.

Bavykin, S.G., Lysov, Y.P., Zakhariev, V., Kelly, J.J., Jackman, J., Stahl, D.A., & Cherni,

A. (2004). Use of 16S rRNA, 23S rRNA, and gyrB gene sequence analysis to

determine phylogenetic relationships of Bacillus cereus group microorganisms.

Journal of Clinical Microbiology 42, 3711-3730.

124

Becquer, A., Trap, J., Irshad, U., Ali, M.A., & Claude, P. (2014). From soil to plant, the

journey of P through trophic relationships and ectomycorrhizal association.

Frontiers in Plant Science 5.

Belkin, S., Wirsen, C.O., & Jannasch, H.W. (1986). A new sulfur-reducing, extremely

thermophilic eubacterium from a submarine thermal vent. Applied and

Environmental Microbiology 51, 1180-1185.

Belova, S., Pankratov, T., & Dedysh, S. (2006). Bacteria of the genus Burkholderia as a

typical component of the microbial community of Sphagnum peat bogs.

Microbiology 75, 90-96.

Bertaux, J., Schmid, M., Prevost-Boure, N.C., Churin, J., Hartmann, A., Garbaye, J., &

Frey-Klett, P. (2003). In situ identification of intracellular bacteria related to

Paenibacillus spp. in the mycelium of the ectomycorrhizal fungus Laccaria

bicolor S238N. Applied and Environmental Microbiology 69, 4243-4248.

Bhardwaj, D., Ansari, M.W., Sahoo, R.K., & Tuteja, N. (2014). Biofertilizers function as

key player in sustainable agriculture by improving soil fertility, plant tolerance

and crop productivity. Microbial Cell Factories 13, 1.

Bhosale, H., Shaheen, U., & Kadam, T. (2016). Characterization of a Hyperthermostable

Alkaline Lipase from Bacillus sonorensis 4R. Enzyme Research 2016.

Bianciotto, V., Bandi, C., Minerdi, D., Sironi, M., Tichy, H.V., & Bonfante, P. (1996).

An obligately endosymbiotic mycorrhizal fungus itself harbors obligately

intracellular bacteria. Applied and Environmental Microbiology 62, 3005-3010.

125

Bianciotto, V., Lumini, E., Lanfranco, L., Minerdi, D., Bonfante, P., and Perotto, S.

(2000). Detection and identification of bacterial endosymbionts in arbuscular

mycorrhizal fungi belonging to the family Gigasporaceae. Applied and

Environmental Microbiology 66, 4503-4509.

Bishop, R. (2010). Applications of fluorescence in situ hybridization (FISH) in detecting

genetic aberrations of medical significance. Bioscience Horizons, hzq009.

Bonfante, P., & Genre, A. (2010). Mechanisms underlying beneficial plant–fungus

interactions in mycorrhizal symbiosis. Nature Communications 1, 48.

Bouju, H., Ricken, B., Beffa, T., Corvini, P.F.-X., & Kolvenbach, B.A. (2012). Isolation

of bacterial strains capable of sulfamethoxazole mineralization from an

acclimated membrane bioreactor. Applied and Environmental Microbiology 78,

277-279.

Boundless (2016). Boundless Biology. Retrieved from

https://www.boundless.com/biology/textbooks/boundless-biology-textbook/fungi-

24/characteristics-of-fungi-149/fungi-reproduction-591-11810/

Boyle, J. (2008). Molecular biology of the cell, by B. Alberts, A. Johnson, J. Lewis, M.

Raff, K. Roberts, & P. Walter (Wiley Online Library).

Brindefalk, B., Ettema, T.J., Viklund, J., Thollesson, M., & Andersson, S.G. (2011). A

phylometagenomic exploration of oceanic alphaproteobacteria reveals

mitochondrial relatives unrelated to the SAR11 clade. PLoS One 6, e24457.

Brulé, C., Frey-Klett, P., Pierrat, J., Courrier, S., Gérard, F., Lemoine, M., Rousselet, J.,

Sommer, G., & Garbaye, J. (2001). Survival in the soil of the ectomycorrhizal

126

fungus Laccaria bicolor and the effects of a mycorrhiza helper Pseudomonas

fluorescens. Soil Biology and Biochemistry 33, 1683-1694.

Bücking, H., & Kafle, A. (2015). Role of arbuscular mycorrhizal fungi in the nitrogen

uptake of plants: Current knowledge and research gaps. Agronomy 5, 587-612.