Cytokinin Oxidase/Dehydrogenase Family Genes Play Important Roles in the Growth and Development Of

bioRxiv preprint doi: https://doi.org/10.1101/2021.05.09.443313; this version posted May 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

1 Short title: Functions of CKXs in rice growth and development

2 Corresponding author: Chengqiang Ding ([email protected])

3 Cytokinin oxidase/dehydrogenase family genes play important roles in the growth and development of

4 rice1

5 Chenyu Rong,a Yuexin Liu,a,2 Zhongyuan Chang,a Ziyu Liu,a Yanfeng Ding,a,b,c and Chengqiang Dinga,b,c,3,4

6 aCollege of Agriculture, Nanjing Agricultural University, Nanjing 210095, People’s Republic of China

7 bKey Laboratory of Crop Physiology Ecology and Production Management, Ministry of Agriculture, Nanjing

8 210095, People’s Republic of China

9 cJiangsu Collaborative Innovation Center for Modern Crop Production, Nanjing 210095, People’s Republic of

10 China

11 1This work was supported by the National Natural Science Foundation of China (Grant number 31872855 and

12 31971842).

13 2Present address: National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University,

14 Wuhan 430070, People’s Republic of China

15 3Senior author.

16 4Author for contact: [email protected].

17 The author responsible for distribution of materials integral to the findings presented in this article in accordance

18 with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Chengqiang Ding

19 ([email protected]).

20 One sentence summary: Cytokinin oxidase/dehydrogenase family genes exhibit functional divergence and

21 overlap in rice growth and development.

22 Author contributions

23 C.D. and Y.D. conceived the original screening and research plans; C.R., Y.L., Z.C., Z.L., and C.D. performed

24 the experiments and analyzed the data; C.R. and C.D. wrote the article with contributions of all the authors; C.D.

25 agrees to serve as the author responsible for contact and ensures communication.

27 ABSTRACT

28 Cytokinin has important functions during plant growth and development; hence, many researchers have

29 extensively studied cytokinin biosynthesis and degradation. Cytokinin oxidase/dehydrogenases (CKXs) are a

30 group of enzymes that regulate oxidative cleavage to maintain cytokinin homeostasis. In rice, 11 OsCKX genes

31 have been identified to date; however, most of their functions remain unknown. Here, we comprehensively

32 analyzed the expression patterns of OsCKX genes and their genetic relationships using RNA sequencing

33 (RNA-seq) and β-glucuronidase (GUS) staining. Using CRISPR/Cas9 technology, we constructed nine osckx

34 mutants to determine the OsCKX function in rice development. Results revealed that each OsCKX gene has a

35 unique expression pattern. Furthermore, the single osckx and higher-order osckx4 osckx9 mutant lines showed

36 functional overlap and subfunctionalization. Mutant phenotypes associated with decreased CKX activity

37 exhibited changes in leaf and root growth, inflorescence architecture, fertilization, and grain weight. Notably, we

38 found that the osckx1 osckx2 and osckx4 osckx9 double mutants displayed contrasting phenotypic changes in

39 tiller number, culm diameter, and panicle size as compared to the wild-type (WT). Moreover, we identified

40 several genes that were significantly expressed in osckx4 and osckx9 single and double mutant plants. Many

41 differentially expressed genes, such as OsPIN2, OsRR4, and OsNRT2.3, were found to be associated with auxin,

42 cytokinin, and nitrogen pathways. Therefore, our findings provide new insights on the functions of OsCKX genes

43 in rice growth, that may be used as a foundation for future studies aimed at improving rice yield and initiating

44 green production.

46 INTRODUCTION

47 Cytokinin controls plant growth and development by promoting plant cell division, growth, and differentiation.

48 Specifically, it is responsible for stem enlargement and differentiation, organ development and structure,

49 nutrition absorption, senescence, and stress response. Cytokinin biosynthesis starts from the ADP, ATP, or tRNA

50 catalyzed by different adenosine phosphate isopentenyltransferases and activated by LONELY GUY enzymes

51 (Kurakawa et al., 2007; Osugi et al., 2017). Previous studies reported that in rice, overexpression of adenosine

52 phosphate isopentenyltransferase inhibited root formation (Sakamoto et al., 2006), while lonely guy mutants

53 developed smaller panicles with reduced branches and floral organ defects (Kurakawa et al., 2007).

54 After performing its function, cytokinin is inactivated by certain enzymes such as cytokinin

55 oxidase/dehydrogenases (CKXs) that induce cytokinin oxidative cleavage, which is an irreversible process.

56 Cytokinin can also be inactivated by combining with sugars, including O-glucosyltransferase (reversible process)

57 and N-glucosyltransferase (irreversible process) (Kudo et al., 2012). However, this inactivation process occurs at

58 different stages of plant development in various tissues and employs several enzymes with similar functions,

59 most of which remain unknown. CKXs are essential for maintaining cytokinin homeostasis during plant growth

60 and development. Therefore, extensive research on CKXs has been conducted and is still ongoing. Each plant

61 species has a group of CKX genes, for example, Arabidopsis has seven, rice has 11, and maize has 13. Most

62 CKXs in maize and Arabidopsis have putative N-terminal secretory peptides that assist in locating the

63 endoplasmic reticulum (ER) (Zalabak et al., 2016; Niemann et al., 2018). Previous studies have discovered

64 several functions of CKXs in Arabidopsis and other crops. In Arabidopsis, overexpression of AtCKX1 and

65 AtCKX2 resulted in smaller shoots, larger roots, and smaller shoot apical meristems (SAMs), while AtCKX7

66 overexpression resulted in shorter primary roots (Werner et al., 2001; Kollmer et al., 2014). Furthermore, ckx3

67 ckx5 mutants developed larger SAMs and more siliques (Bartrina et al., 2011). On the other hand, sextuple ckx3

68 ckx5 mutants of oilseed rape showed larger and more active inflorescence meristems (Schwarz et al., 2020). In

69 barley, HvCKX1 downregulation resulted in more spikes, more grains per spike, and higher 1,000-grain weight

70 (Zalewski et al., 2010). TaCKX6-D1 was found to be associated with grain filling and grain size in wheat (Zhang

71 et al., 2012).

72 In rice, OsCKX2/Gn1a was the first CKX gene identified. Rice varieties with low OsCKX2 expression

73 yielded more grains per panicle, while OsCKX2 downregulation or osckx2 mutation produced more tillers, more

74 grains per panicle, and heavier grains (Ashikari et al., 2005; Yeh et al., 2015). In contrast, OsCKX4

75 overexpression reduced the tiller number, grain number per panicle, grain weight, and plant height and increased

76 the number of roots (Gao et al., 2014). On the other hand, osckx9 mutants developed more tillers and smaller

77 panicles, while OsCKX9 overexpression mutants displayed more tillers, shorter culms, smaller panicles, and

78 lower setting rates (Duan et al., 2019). OsCKX11 was found to regulate leaf senescence and grain number, while

79 osckx11 mutation resulted in the increased number of spikelets per panicle and tillers (Zhang et al., 2020). The

80 expression of CKX genes is regulated by several transcription factors. For example, OsCKX2 expression is

81 controlled by zinc finger transcription factor DROUGHT AND SALT TOLERANCE and VIN3-LIKE 2 (Li et al.,

82 2013; Yang et al., 2018), while the rice NAC family transcription factor OsNAC2 regulates OsCKX4 expression

83 (Gao et al., 2014; Mao et al., 2020).

84 OsCKX genes play an important role in the crosstalk between cytokinin and other hormones by regulating

85 cytokinin content in plant tissues, maintaining plant hormone homeostasis, and controlling plant growth and

86 development. Most OsCKX genes are upregulated by exogenous cytokinins, such as the naturally-occurring

87 trans-zeatin (tZ) and N6-(Δ2-isopentenyl)adenine (iP) or the synthetic 6-benzylaminopurine (Duan et al., 2019).

88 OsCKX4 can also be induced by auxin, which plays a role in regulating the root system (Gao et al., 2014). The

89 auxin response factor OsARF25 and the type-B response regulators ORR2 and ORR3 regulate the expression of

90 OsCKX4 downstream of auxin and cytokinin activation, respectively. However, OsCKX4 overexpression can

91 downregulate the expression of auxin-biosynthesis gene OsYUCCA1 and auxin-transport genes PIN FORMED1b

92 (OsPIN1b) and OsPIN2 in the roots, showing the negative feedback between auxin and cytokinin. OsCKX9 acts

93 downstream of strigolactones (SLs) and plays a key role in the crosstalk between cytokinin and SLs. The

94 SL-induced activation of OsCKX9 relies on D53, which acts as a repressor of SL signaling and consequently

95 functions in the SL-induced regulation of tiller development (Duan et al., 2019). On the other hand, OsCKX11

96 has antagonistic roles between the cytokinin and abscisic acid (ABA) pathways during leaf senescence. In

97 osckx11 mutants, the downregulation of ABA biosynthesis genes and the upregulation of ABA degradation genes

98 result in the reduction of ABA content in flag leaves and subsequently regulate leaf senescence, which shows the

99 relationship between cytokinin and ABA. Thus, these findings demonstrate that OsCKX genes act as bridges

100 between cytokinin and other plant hormones (Zhang et al., 2020).

101 OsCKX genes also respond to environmental changes and stressors. For example, high-concentration

102 nitrogen treatment significantly increased OsCKX expression not only in nodes and leaves but also in young

103 panicles (Ding et al., 2014; Xu et al., 2015), which also affected the tiller number and spikelets per panicle.

104 Furthermore, OsCKX1 and OsCKX4 were found to be upregulated in nitrogen- and inorganic phosphate-starved

105 roots, potentially affecting root system formation and assisting in the absorption of more nutrients (Shin et al.,

106 2018). OsCKX4 also plays a role in zinc absorption (Gao et al., 2019), while OsCKX2 downregulation facilitates

107 the adaptation to saline stress (Joshi et al., 2018). However, it is unknown whether OsCKX genes play other roles

108 during rice growth and development. In rice breeding, OsCKX2 has been artificially selected from wild rice since

109 ancient times and can be divided into alleles from different geographic distributions (Ashikari et al., 2005; Wang

110 et al., 2015). Since most plants with downregulated CKX expression exhibit better phenotypes, researchers

111 believed that CKX is a potential target to improve yield or to initiate another “Green Revolution” (Ashikari et al.,

112 2005; Chen et al., 2020; Jameson and Song, 2020). Numerous studies have analyzed the structures of and genetic

113 relationships between OsCKXs. However, the expression patterns that may determine their functions during plant

114 growth, especially of OsCKXs with similar amino acid sequences, are yet to be elucidated.

115 In this study, we investigated the genetic relationships and expression patterns of OsCKX genes using RNA

116 sequencing (RNA-seq). We also evaluated the phenotypes of osckx single and double mutants produced using

117 CRISPR/Cas9 technology to determine the function of different OsCKXs. We also analyzed the transcriptomes of

118 the roots and shoot bases from Nipponbare (NIP), osckx4, osckx9, and osckx4/9 mutants to identify the genes

119 downstream of OsCKX4 and OsCKX9. Our findings may provide new insights regarding the potential

120 application of OsCKX genes for improving agricultural traits.

121

122

123 RESULTS

124 OsCKX family genes display different expression patterns

125 Similar to the findings of previous studies, the OsCKX phylogenetic tree consisted of four major clades (Figure

126 1A). OsCKX1, which is commonly expressed in the roots, flowers, and grains, and OsCKX2 were grouped

127 together in the first clade. The β-glucuronidase (GUS) staining results reveal that OsCKX1 had high expression

128 in the shoot base and top of axillary buds, but very low expression in the leaf blade (Figure 1B). On the other

129 hand, OsCKX2, usually expressed at high levels in the leaf sheath and inflorescence, was found to be highly

130 expressed in the lateral root primordium, leaf blade, shoot base and inflorescence. OsCKX6, OsCKX7, and

131 OsCKX10 were grouped together in the second clade and showed very low expression in all tissues. Thus, these

132 genes were excluded from future analysis.

133 The third clade was composed of OsCKX4, OsCKX5, and OsCKX9. OsCKX4, which is generally strongly

134 expressed in the vegetative organs, displayed extremely high expression in the roots and inflorescence. OsCKX9,

135 generally expressed at low levels in all tissues, showed high expression in the leaf blade, and whole axillary buds.

136 OsCKX5, usually highly expressed in all tissues, also exhibited high expression in the roots and leaves.

137 The fourth clade consisted of OsCKX3, OsCKX8, and OsCKX11. OsCKX3, which is expected to have the

138 highest expression in the stem and young panicles, , was found to have high expression in the shoot base and

139 young panicle . OsCKX8, commonly expressed at lower levels than OsCKX3 in all vegetative organs, was highly

140 expressed in the shoot base, flag leaf primordia, and inflorescence. Furthermore, OsCKX11, generally expressed

141 at a higher level than OsCKX3 and OsCKX8 in all tissues, specifically in the reproductive-stage root and

142 inflorescence, displaying high expression in the root, shoot base, and young inflorescence.

143 Cytokinins have many functions during plant growth and development in different organs, and the

144 biodegradation of cytokinins in different periods or tissues can help plants accurately regulate their growth and

145 development. In rice, we found all of eight of the OsCKX genes expressed at the shoot base and inflorescence

146 meristem at different stages and positions. However, each OsCKX gene was expressed in a distinct pattern. As

147 described above, certain OsCKX genes were highly expressed in certain organs, and we also found some tissues

148 with certain OsCKX gene expressed at low levels, such as OsCKX1 and OsCKX3, which were expressed at very

149 low levels in the roots and leaves, and OsCKX2, OsCKX3, and OsCKX11, which were expressed at very low

150 levels in the flag leaf primordia. Additionally, we also determined the expression patterns of OsCKX genes in

151 axillary buds: OsCKX1 was expressed in the top, OsCKX2, OsCKX3, OsCKX4 and OsCKX5 were expressed in

152 the base, and OsCKX9 was expressed throughout the buds. These distinct expression patterns stimulated our

153 interest in their functions.

154 OsCKX single mutants exhibit different phenotypes

155 RNA-Seq analysis and GUS staining assay provided a clear view of the expression levels of OsCKXs; however,

156 functional characterization of these genes is still lacking. Previous studies suggested that the knockdown of

157 specific OsCKXs may help improve rice production by influencing important agronomic traits, such as tillering,

158 development of organs facilitating nutrition, and panicle phenotype. To confirm this hypothesis, we analyzed

159 the phenotypes of nine OsCKX single mutants (except for OsCKX6 and OsCKX10, which were

160 expressed at very low levels during rice growth and development) created using the CRISPR/Cas9

161 system (Supplemental Figures S1 and S2; Supplemental Table S1).

162 Since leaf size affects the photosynthetic capacity of rice, we investigated this and discovered that the top

163 three leaves in the osckx1, osckx2, osckx8, and osckx11 mutants were distinctly longer and wider compared to

164 those of Zhonghua 11 (Supplemental Figures S3–S5; Supplemental Table S2). The osckx9 mutant also had

165 distinctly longer last three leaves, but there was no change in width compared to Zhonghua 11. The leaf length

166 and width of the other mutants did not significantly change (Supplemental Figures S4, A–D, and S5). On the

167 other hand, culm diameter and plant height are closely related to the lodging resistance of rice. We found that the

168 diameters of the basal internodes in osckx1, osckx2, osckx8, and osckx11 mutants were significantly wider than

169 those in the wild-type (WT), while the osckx3, osckx4, and osckx5 mutants had thinner basal internodes

170 (Supplemental Figure S4, E and F). Furthermore, the osckx3, osckx4, and osckx5 mutants showed significantly

171 decreased plant height compared to others (Supplemental Figure S4, G and H).

172 The panicle number is determined by the tiller number per plant and has a significant effect on rice yield.

173 In the field and pot experiments, the osckx4 and osckx9 mutants developed more tillers than the WT plants,

174 which is consistent with the results of previous studies (Supplemental Figures S3B and S4, I and J; Supplemental

175 Tables S2 and S3). Although the mutants produced more panicles per plant, the number of grains per panicle

176 decreased, resulting in no significant change in yield (Supplemental Figure S6, A and B; Supplemental Table S2).

177 In contrast, the osckx2 mutant showed significantly reduced tiller number in both the 2019 and 2020 field and

178 pot experiments (Supplemental Tables S2 and S3). On the other hand, no significant differences were observed

179 in the tiller numbers of the other osckx mutants. Additionally, there was no significant change in the yield per

180 plant of the osckx mutants, except for osckx1 and osckx11-1, which had significantly improved production. In

181 contrast, osckx3-1, osckx3-26, and osckx4-6 had significantly low yields (Supplemental Figures S6, A and B).

182 Despite this, we observed several agronomic traits that were improved in the mutants. For example, the osckx1,

183 osckx2, osckx7 and osckx8 mutants presented heavier grain weight, while the osckx11 mutant developed more

184 spikelets per panicle (Supplemental Figure S6, E–H).

185 The osckx1 osckx2 double mutants have significantly reduced tiller numbers

186 Since the phenotypes of osckx1 and osckx2 plants weresimilar, we created the new double mutant osckx1/2. In

187 the T1 generation, we obtained enough plants of the osckx1/2-19 line, which has 1-bp insertions in OsCKX1 and

188 OsCKX2 (Figure 2A; Supplemental Figure S2). The osckx1/2-19 mutant showed significantly reduced tiller

189 number per plant (Figure 2B), consequently leading to lower panicle number per plant (Figure 2C). Notably, the

190 osckx1/2-19 mutants have large panicle sizes and more spikelets per panicle because the number of primary

191 branches increased while the number of secondary branches remained the same (Figure 2, D–G). Furthermore,

192 the 1,000-grain weight and grain length were significantly increased in osckx1/2-19 compared with those in NIP

193 (Figure 2H– J). In contrast, the grain width and thickness did not show significant changes between osckx1/2-19

194 and NIP (Figure 2, I, K, and L). However, the total number of panicles and setting rate were lower in

195 osckx1/2-19 compared to those in NIP (Figure 2M), which resulted in a lower yield with no significant

196 differences (Figure 2N). Overall, the osckx1/2-19 plants showed better plant architecture than the WT. In

197 osckx1/2-19 plants, the flag leaf became wider (Figure 2, O and P) and the plants had thick basal internodes,

198 while the plant height did not noticeably change (Figure 2, Q and R). Considered together, these observations

199 suggest that the double knockout of OsCKX1 and OsCKX2 may have improved the lodging resistance and

200 optimized plant architecture in rice.

201 Double knockout of OsCKX4 and OsCKX9 significantly promotes tillering

202 Since the osckx4 and osckx9 single mutants developed more tillers, we created two new single mutants, namely

203 osckx4-6 and osckx9-1, and an osckx4/9 double mutant in NIP to verify if these will also produce more tillers

204 (Supplemental Figure S7, A and B). As expected, we discovered that the osckx4/9 double mutant had an

205 extremely higher tiller number compared to NIP and the two single mutants (Figure 3, A–D). In contrast, panicle

206 size was significantly reduced in the osckx4/9 mutant (Figure 3E). The osckx9-1 mutant had a high panicle

207 number per plant, but the number was markedly higher in the osckx4/9 mutant (Figure 3F). However, the number

208 of spikelets per panicle of osckx4 was significantly decreased, while that of osckx4/9 was even lower (Figure 3G).

209 The decreased number of spikelets per panicle of osckx4-6 was due to the low number of secondary branches per

210 panicle, while the low number of spikelets per panicle of osckx4/9 was caused by the reduced number of both the

211 primary and secondary branches (Figure 3, E, H, and I). On the other hand, seed setting rates were similar in the

212 single and double mutants, and were significantly lower than those in WT (Figure 3J). Despite the increase in

213 grain length, the osckx4-6 mutant presented decreased 1,000-grain weight due to reduced grain thickness (Figure

214 3K; Supplemental Figure S7, C–G). The 1,000-grain weight of osckx4/9 was lower than that of the osckx4-6

215 mutant due to reduced grain width and thickness (Figure 3I; Supplemental Figure S7). As a result of these

216 changes, the yield of osckx4/9 was significantly decreased (Figure 3L). Moreover, the root length, diameter of

217 basal internode, plant height, and flag leaf length and width were further decreased in the double mutant

218 compared to those in the two single mutants (Figure 3, A, M and N; Supplemental Figure S7, H–J).

219 We also conducted a hydroponic experiment to investigate the root phenotypes of the mutants (Figure 4A).

220 We verified that OsCKX4 and OsCKX9 have redundant roles in regulating tillering, plant height, and root length

221 (Figure 4 B and C). The osckx4/9 mutant not only had shorter roots, but also fewer crown roots and smaller root

222 diameter (Supplemental Figure S8, A and B). The length and width of the 8th leaf were also decreased in

223 osckx4-6 and osckx4/9 compared to those in NIP (Figure 4, D and E). These results indicate that the reduction in

224 the leaf size of osckx4/9 started at the vegetative stage. Overall, these results suggest that OsCKX4 and OsCKX9

225 have a functional overlap during rice growth and development.

226 RNA-seq analysis reveals the molecular functions of OsCKX4 and OsCKX9

227 To elucidate the functions of OsCKX4 and OsCKX9, we sampled the roots and shoot bases from NIP, osckx4,

228 osckx9, and osckx4/9 and performed RNA-seq analysis. Results revealed that osckx4 had 297 differentially

229 expressed genes (DEGs) in the shoot bases and 415 DEGs in the roots. There were 500 DEGs in the shoot bases

230 and 342 DEGs in the roots of the osckx9 mutant. The osckx4/9 double mutant had the highest number of DEGs,

231 with 806 DEGs in the shoot base and 4,556 DEGs in the roots (Figure 5A). To verify the accuracy and

232 reproducibility of the RNA-seq results, we randomly selected seven previously studied genes associated with the

233 phenotypes observed in this study for quantitative reverse-transcription PCR analysis. The expression profiles of

234 these genes were found to corroborate the RNA-seq results (Supplemental Figure S9).

235 However, although there were numerous DEGs between the WT and mutants, there were 71 DEGs in the

236 roots and 90 DEGs in the shoot bases that overlapped between the osckx4 vs. WT and osckx9 vs. WT

237 comparisons and occupied only a small fraction of the total DEGs (Figure 5B). These included some genes that

238 regulate the absorption of silicon (Lsi1, Lsi2), zinc (OsZIP16), and iron (OsIRO2) (Fig 5C). OsZIP9, OsTCP19,

239 OsHKT1;1, and OsNPF5.5 were upregulated in the shoots of osckx4, while OsLBD37, OsARF19, OsMYB61, and

240 MT1a were upregulated in the shoots of osckx9. In the roots, the downregulation of OsAAP5, OsAAP8, and

241 OsNLP6 and the upregulation of certain genes influenced the iron and phosphorus absorption in osckx4. We also

242 observed the downregulation of OsPUP1, OsPUP5, OsRR10, and OsNAAT4 in osckx9. These DEGs were also

243 revealed to be associated with the different pathways controlled by OsCKX4 and OsCKX9 (Figure 5C). However,

244 the functions of most DEGs remain unknown (Supplemental Dataset 1). The difference in the number of DEGs

245 identified may imply that OsCKX4 and OsCKX9 have different functions. Moreover, 87.1% and 78.2% of DEGs

246 in the roots and shoot bases, respectively, between the osckx4/9 and WT were identified only in the double

247 mutants, which may have been caused by the duplicate effect of the functional loss of OsCKX4 and OsCKX9

248 (Figure 5B).

249 Since we observed that osckx4/9 exhibited more severe phenotypes and possessed more DEGs, we analyzed

250 the DEGs identified in the roots and shoot bases between the WT and osckx4/9 plants by using Kyoto

251 Encyclopedia of Genes and Genomes (KEGG) enrichment analysis (Figure 5D). In both tissues, the top enriched

252 KEGG pathways included ‘glycolysis/gluconeogenesis,’ ‘biosynthesis of amino acids,’, and those related

253 to carbon and nitrogen metabolism. Since most of the DEGs were not functionally annotated, the relationship

254 between the DEGs and the enriched pathways and their influence on the growth and development of the mutant

255 plants were not fully understood. However, we identified several genes that may be associated with the

256 phenotypes observed in this study.

257 OsCKX4 and OsCKX9 regulate the metabolism and transport of hormones

258 First, we identified genes related to gibberellin metabolism. We found that the expression of OsKS1 and OsKS2

259 was significantly downregulated in the roots of osckx4/9 (Figure 6A; Supplemental Dataset 1). OsKS1 and

260 OsKS2 are enzymes involved in gibberellin biosynthesis. The expression of OsKS2 was downregulated in the

261 roots of the osckx9 mutant, while no changes were observed in the osckx4 mutant. Other genes for GA

262 biosynthesis and degradation, such as GA20ox and GA2ox, were markedly downregulated in the roots of the

263 osckx4/9 mutant. Some GA receptors were also downregulated in the roots of the osckx4/9 mutant. The changes

264 in the expression of gibberellin-related genes may explain the significantly reduced plant height of osckx4/9

265 double mutants.

266 Further, we examined the genes associated with SLs to investigate the cause of the increased tiller numbers

267 in the single and double mutants. We discovered that OsD17 was downregulated 1.20-fold, which was not

268 significant in the roots of osckx4/9 (Figure 6B; Supplemental Dataset 1), this may have been the cause of the

269 increased tiller number and another reason for reduced plant height of osckx4/9. However OsD10 was

270 upregulated 1.59-fold in the shoot base of osckx4/9, and OsD17 was upregulated 1.38-fold in the shoot base of

271 osckx9, neither of which reflect significant differences. This may have been caused by feedback regulation (Arite

272 et al., 2007). Furthermore, the SL-related transcription factors OsTB1 and OsMADS57 were upregulated

273 1.28-fold and 1.03-fold, respectively, in the shoot bases of osckx4, neither of which were significant changes.

274 Finally, OsTB1 and OsMADS57 were downregulated 1.71-fold and 2.29-fold in the roots of osckx4/9, and

275 OsMADS57 was downregulated 1.24-fold in the roots of osckx9, but their functions in roots remain unknown.

276 Additionally, investigation of several differentially expressed auxin-related genes revealed that auxin efflux

277 transporters OsPIN2 and OsPIN8 were upregulated in the shoot bases and the roots, respectively, of the mutants.

278 We found that the auxin primary response genes OsGH3-1, OsGH3-2, OsIAA9, and OsSAUR12 were

279 upregulated in the shoot bases of the osckx4/9 and single mutants. Additionally, OsGH3-2, nine OsIAA genes

280 (OsIAA1, 4, 9, 12, 14, 15, 19, 23, 24), and five OsSAUR genes (OsSAUR6, 20, 27, 28, 33) were downregulated in

281 the roots of osckx4/9; however, OsIAA16 was upregulated in the roots of osckx4/9.

282 Furthermore, the functional loss of OsCKX4 and OsCKX9 also affected the expression of genes associated

283 with cytokinin metabolism and signal transduction. The cytokinin-related genes OsCKX2, OsCKX5, OsRR4,

284 OsRR6, OsRR7, OsRR9, and OsRR10 were downregulated in the roots of osckx4/9, while OsCRL4 was

285 upregulated in the shoot bases of osckx4/9 (Supplemental Dataset 1). These results may have been caused by the

286 high cytokinin contents in the double mutants.

287 OsCKX4 and OsCKX9 are associated with nitrogen absorption

288 Many genes related to nitrogen absorption and assimilation, such as OsNRT1, OsNRT2.2, OsNRT2.3,

289 OsAMT1.3, OsNAR2.1, and OsNIR2, were also discovered to be significantly upregulated in the roots of the

290 osckx4/9 mutant (Figure 7; Supplemental Dataset 1). In contrast, we observed the downregulation of OsGS1;3 in

291 the roots and that of OsAS1 in the shoot bases of osckx4/9. Most of the genes related to nitrogen absorption and

292 assimilation also showed similar trends in osckx4, while some did not show significant differences compared to

293 NIP. However, OsAMT3.2 and OsGS1;3 were upregulated in the shoot bases of osckx9. The changes in the

294 expression of these genes were significantly different from those of the osckx4/9 double mutants. Several nitrate

295 and peptide transporter (OsNPF) family genes were also found to be differentially expressed.

296

297 DISCUSSION

298 Functional differences and redundancy between OsCKX genes

299 To systematically determine the functions of OsCKX genes, we analyzed theirexpression patterns and

300 investigated the phenotypes of osckx single and double mutants. Our study revealed the roles of most OsCKX

301 genes in the growth and development of rice. After two years of field experiments, we discovered that osckx4

302 and osckx9 developed more tillers at the vegetative stage, while osckx2 had fewer tillers. At the reproductive

303 stage, the top three leaves were longer and wider and the basal internodes were thicker in osckx1, osckx2, osckx8,

304 and osckx11 (Zhonghua11 [ZH11] background), while wider flag leaves and thicker basal internodes were

305 observed in osckx1/2 (NIP background) (Figure 8). The osckx9, osckx3, osckx4, and osckx5 mutants showed little

306 changes in flag leaf length and width compared to their background, while osckx3, osckx4, and osckx5 developed

307 thinner basal internodes. For yield-related phenotypes, osckx9 developed more panicles while osckx9 and osckx4

308 had fewer spikelets per panicle. Moreover, osckx1, osckx2, and osckx8 displayed increased 1,000-grain weight,

309 while osckx11 showed reduced 1,000-grain weight.

310 Previous studies have described the functions of OsCKX2, OsCKX4, OsCKX9, and OsCKX11. First,

311 researchers elucidated the function of OsCKX2 after observing that null mutants or plants with downregulation

312 of OsCKX2 developed more spikelets per panicle (Ashikari et al., 2005), more tillers, and larger grains (Yeh et

313 al., 2015). In the present study, we observed very little increase in the number of spikelets per panicle during the

314 two-year field experiment, with the observed increase being lower than that observed by the other researchers.

315 However, we found that the osckx2 mutant of ZH11 showed significantly reduced tiller number within the first

316 year of the field experiment. Another mutant, osckx1/2 of NIP, also showed reduced tiller number, which

317 supports the hypothesis that fewer tillers may be related to thicker culms. Furthermore, both the osckx2 mutant of

318 ZH and osckx1/2 mutant of NIP presented increased 1,000-grain weight. The discrepancies between our results

319 and previous findings regarding panicle size may be attributed to the different cultivated varieties or

320 environmental impact.

321 Furthermore, previous reports stated that OsCKX4 overexpression can cause the development of a larger

322 root system, but result in shorter plant height, fewer tillers, and smaller panicles (Gao et al., 2014). For example,

323 OsCKX4-RNAi or osckx4 mutants showed fewer crown roots and shorter root lengths (Gao et al., 2014; Mao et

324 al., 2020). Since OsCKX4 is commonly expressed in the root, previous studies were more focused on

325 investigating the relationships between OsCKX4 and the root system instead of the shoot system. Here, we

326 discovered that osckx4 mutants produced more tillers, especially at the early stages, but has fewer spikelets per

327 panicle. Additionally, osckx9 mutants have been reported to develop more tillers, fewer spikelets per panicle, and

328 shorter plant height (Duan et al., 2019). Since the null mutations of OsCKX4 and OsCKX9 can affect the tiller

329 number, we constructed osckx4/9 mutants, which distinctly showed more tillers, shorter plant height, and smaller

330 panicles. The increase in the tiller number of osckx4/9 double mutants was greater than those observed in osckx4

331 and osckx9 single mutants. Furthermore, the decrease in plant height and number of spikelets per panicle of

332 osckx4/9 double mutants was also higher than those observed in osckx4 and osckx9 single mutants. These results

333 suggest the partial functional overlap of OsCKX4 and OsCKX9 during rice growth and development. Moreover,

334 osckx11 mutants previously displayed more tillers, larger panicles, and lighter 1,000-grain weight (Zhang et al.,

335 2020); these were also observed in our study. In general, we found that each OsCKX gene had its own function

336 during rice growth and development as well as their own distinct characteristics, and each osckx single or double

337 mutant had a distinct phenotype.

338 Potential causes of the functional differences and redundancy in OsCKX genes

339 The main function of CKX enzymes is the biodegradation of cytokinins. Previous studies have reported that

340 CKXs catalyze different kinds of cytokinins. In maize, the ZmCKX enzyme activity has been systematically

341 analyzed, revealing that ZmCKX1 and ZmCKX12 specially targeted iP, tZ, and cis-zeatin (cZ). Furthermore,

342 ZmCKX5 was partial to iP and isopentenyladenosine 5'-monophosphate, while ZmCKX2, ZmCKX3, ZmCKX4a,

343 and ZmCKX4b preferred the biodegradation of iP-9-glucoside (iP9G) and cZ. Finally, ZmCKX8, ZmCKX9, and

344 ZmCKX10 showed preference for tZ and cZ (Zalabak et al., 2014). In Arabidopsis, AtCKX1 showed the highest

345 preference for tZ phosphates, iP phosphates, and iP9G, while AtCKX3 preferred iP phosphates and iPR, and

346 AtCKX7 preferred iP9G and tZ (Kowalska et al., 2010). However, little is known about the preference of

347 OsCKX enzymes, except OsCKX9 that is partial to tZ and OsCKX11 that specially targets tZ and cZ (Duan et

348 al., 2019; Zhang et al., 2020). OsCKX11 has the same substrate as its homolog protein, ZmCKX10, while other

349 OsCKX enzyme substrates may need to be inferred from endogenous hormone content data. Therefore, the

350 distinctive functions of OsCKXs may be caused by their different target substrates.

351 CKX proteins are mainly localized in the ER because most contain an N-terminal signal peptide sequence

352 (Zalabak et al., 2016; Niemann et al., 2018). In the ER, cytokinins combine with their receptors and initiate

353 signaling transduction, while most ER-localized CKXs regulate cytokinin concentrations to precisely adjust

354 cytokinin signals (Niemann et al., 2018; Romanov and Schmulling, 2021). Previous studies revealed that

355 OsCKX4 and OsCKX11 are localized in the cytosol, while OsCKX9 is localized in the cytosol and nuclei (Gao

356 et al., 2014; Duan et al., 2019; Zhang et al., 2020). These three CKXs potentially regulate the cytokinin balance

357 in other cellular organelles. However, the locations of the remaining OsCKXs remain unknown. Hence, we

358 hypothesize that the subcellular localization of OsCKXs may also influence their functional differentiation.

359 In this study, the OsCKX genes exhibited different expression patterns. For example, OsCKX1 and OsCKX2

360 were expressed in the inflorescences and grains, while OsCKX4 was highly expressed in the roots. In summary,

361 the differences in the nature of catalytic substrates, subcellular localization, and expression in tissues may

362 contribute to the different functions observed in OsCKX family genes.

363 Significantly altered transcriptome of the osckx4 osckx9 mutant

364 Although OsCKX4 and OsCKX9 have been extensively studied, we observed new phenotypes in the single

365 mutants, which have not been reported previously. Interestingly, these two genes were found to exhibit redundant

366 functions during rice growth and development. Hence, we first investigated the genes associated with plant

367 height and then identified the DEGs related to gibberellin metabolism between the NIP and mutants. OsKS1 and

368 OsKS2, which encode enzymes that catalyze the second step of the GA biosynthesis pathway (Ji et al., 2014;

369 Tezuka et al., 2015), were significantly downregulated in the roots of osckx4/9. On the other hand, possibly due

370 to the limited substrate, the expression of several GA20ox and GA2ox genes for gibberellin biosynthesis and

371 biodegradation, respectively, were downregulated in osckx4/9. We hypothesize that the disrupted biosynthesis of

372 gibberellin may have caused the reduction in osckx4/9 plant height. However, the mechanism by which OsCKX4

373 and OsCKX9 regulate the expression of OsKS1 and OsKS2 is unknown.

374 Since the double mutants exhibited semi-dwarf phenotypes with more tillers, we believed that the

375 expression of SL-related genes may have changed in the double mutants. However, we did not observe any

376 changes in the expression of SL-signaling genes but found that OsD17 was downregulated in the roots of

377 osckx4/9 mutants. This contradicts a previous report that stated d17 mutants developed dwarf plants and more

378 tillers (Zou et al., 2005). On the other hand, the SL-related transcript factors OsTB1 and OsMADS57 were only

379 downregulated in the roots. Furthermore, OsTB1 was upregulated in the shoot bases of osckx4. Previous studies

380 on tb1 mutants and OsMADS57 overexpression showed that these plants developed more tillers than the WT

381 (Takeda et al., 2003; Guo et al., 2013). Since SL directly activates OsCKX9 to regulate shoot architecture in rice,

382 we also determined whether OsCKX4 and OsCKX9 can regulate the tiller number phenotype through the SL

383 pathway by analyzing the expression of SL-related genes between WT and mutants. Based on these findings,

384 cytokinin may be located downstream of the SL pathway during rice tillering. During the outgrowth of tiller buds,

385 the auxin at the tip of the axillary bud is transported by auxin efflux carriers. In Arabidopsis, cytokinin response

386 factors regulate PIN expression (Simaskova et al., 2015; Waldie and Leyser, 2018). Here, we found that OsPIN2

387 was upregulated in the shoot bases of osckx4 and osckx4/9. In rice, OsPIN2 transports auxins from the shoot to

388 the root–shoot junction, and overexpression of OsPIN2 results in the increased number of tillers (Chen et al.,

389 2012). However, further research is needed to determine which cytokinin response factor regulates OsPIN2.

390 We also found that several type-A transcription factors, including OsRR4, OsRR6, OsRR7, OsRR9, and

391 OsRR10, showed lower expression in the roots of osckx4/9. Some were downregulated in single mutants.

392 However, these results were contradictory, since type-A RR genes are primary response genes for cytokinin

393 signaling, while OsRR4, OsRR9, and OsRR10 were previously found to be upregulated in

394 OsCKX4-overexpression lines (Gao et al., 2014). Since OsRR4, OsRR9, and OsRR10 share similar amino acid

395 sequences (Tsai et al., 2012; Wang et al., 2019) and osrr9 osrr10 mutant lines developed fewer spikelets per

396 panicle and higher tolerance to saline stress, we hypothesized that OsRR4, OsRR9, and OsRR10 may have

397 important functions during the cytokinin-induced inhibition of root growth. In the present study, we observed the

398 downregulation of OsWOX11 (Zhao et al., 2009) and OsMADS25 (Yu et al., 2015) in the roots of osckx4 and

399 osckx4/9, which may explain why osckx4 and osckx4/9 plants have smaller root systems. Furthermore, we

400 discovered that OsCKX4 and OsCKX9 influence several genes related to nitrogen absorption and utilization,

401 providing new potential targets for improving nitrogen usage efficiency in rice. However, the mechanisms

402 underlying this process are unknown; hence, further research is still required.

403 Interestingly, in addition to the genes regulated by both OsCKX4 and OsCKX9, we also identified several

404 genes that are regulated by OsCKX4 and OsCKX9 individually. In summary, the similar amino acid sequences

405 but different expression patterns of OsCKX4 and OsCKX9 enable them to functionally overlap in the regulation

406 of some pathways, while also individually regulating specific pathways.

407

408 CONCLUSION

409 Our systematic analysis of 11 genes in the OsCKX family reveals their complex expression patterns in rice. A

410 total of nine OsCKX mutants were produced using CRISPR/Cas9 technology. By examining the phenotypes of

411 the mutants throughout the rice growth period, we determined the functions of specific OsCKX genes in plant

412 development. In specific, we discovered that OsCKX4 and OsCKX9 inhibited tillering, while OsCKX1 and

413 OsCKX2 promoted tillering. Consideredtogether, our findings establish a community resource for fully

414 elucidating the function of OsCKXs, providing new insights that may be used for future studies to improve rice

415 yield and initiate green production.

416

417 MATERIALS AND METHODS

418 Plant materials and growth conditions

419 Oryza sativa L. ssp. japonica (cultivars: NIP and ZH11) was the WT rice material chosen for this

420 study. The mutants were comprised osckx1/2, osckx3, osckx4, osckx5, osckx9, and osckx4/9 from NIP

421 and osckx1, osckx2, osckx7, osckx8, osckx9, and osckx11 from ZH11. The target for osckx1/2 matches

422 OsCKX1 and OsCKX2 completely, and has a 1-bp mismatch for OsCKX11. The sequencing results

423 showed that the osckx1/2-19 line had a 1-bp insertion in OsCKX1 and OsCKX2, but no change was

424 observed in OsCKX11 (Supplemental Figure S2).

425 The rice plants were grown in a field in Danyang, Jiangsu Province, China (31.907° N 119.466°

2 2 2 426 E). We used 300 kg/hm nitrogen, 150 kg/hm P2O5, and 240 kg/hm K2O as base fertilizers for the

427 field experiment. For the pot experiment, in each pot, 4.28 g urea was added, while 1.92 g KH2PO4

428 and 1.49 g KCl were used during the whole growth period. For the hydroponic experiment, the nutrient

429 solution was composed of 2 mM KNO3, 2 mM NH4Cl, 0.32 mM NaH2PO4·2H2O, 0.011 mM MnCl2·4H2O,

430 0.0185 mM H3BO3, 0.0006 mM Na2MoO4·2H2O, 0.0014 mM ZnSO4·7H2O, 0.0016 mM CuSO4·5H2O, 0.3 mM

431 MgCl2·6H2O, 0.66 mM CaCl2, and 0.0448 mM Fe(II)-EDTA (pH = 5.5–6). The plants were grown in climate

432 chambers under long-day conditions (15 h light at 28 °C and 9 h dark at 24 °C) with a relative humidity of ~70%

433 and treated for 20 days.

434 Plasmid construction for genetic transformation

435 To construct the mutants for research by using CRISPR/Cas9 technology, as previously described, each OsCKX

436 gene was assigned one to two single guide RNA oligo targets by using CRISPR/Cas9 technology as previously

437 described (Mao et al., 2013). The primers used for vector construction and genotyping are shown in

438 Supplemental Table S1.

439 To construct pOsCKX::GUS, An upstream fragment of the OsCKX-encoding region (>3 kb) was amplified

440 by PCR, and the resulting amplicon was excised with the corresponding restriction endonuclease and ligated into

441 the pCAMBIA1300::GUS vector (Wang et al., 2020).

442 Analysis of GUS activity

443 The GUS reporter activity was assayed by histochemical staining using GUS Staining Kit (FCNCS,

444 https://www.fcncs.com). Various tissues were collected from pOsCKX::GUS transgenic plants at each

445 developmental stage. After dipping in the GUS staining solution, the samples were taken out and then incubated

446 in the staining solution for 6–48 h at 37 °C in the dark. The samples were destained thrice with 70% ethanol in a

447 water bath for 5 min. Images were taken using SZX16 microscope (Olympus, Tokyo, Japan;

448 https://www.olympus-lifescience.com/en/).

449 Sampling, RNA extraction and gene expression analysis

450 We collected roots from 2 cm under the tip and shoot bases (~5-mm segments from the first nodes)

451 containing the SAMs, axillary buds, young leaves, and tiller nodes from WT, osckx4, osckx9, and

452 osckx4/9 plants. The samples were stored at −80 °C until further use.

453 Total RNA was extracted using E.Z.N.A.® Plant RNA Kit (Omega Bio-tek Inc., Norcross, GA, USA;

454 https://www.omegabiotek.com/) and subjected to reverse-transcription using PrimeScript™ RT Reagent Kit

455 (Takara Biotechnology, Tokyo, Japan). Quantitative reverse-transcription PCR was performed on ABI PRISM

456 7300 Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA;

457 https://www.thermofisher.com/) with SYBR® Premix Ex Taq™ (Takara), following the manufacturer’s

458 instructions. Relative expression analysis was performed using the actin gene as internal control. The primers

459 used are listed in Supplemental Table S1.

460 Sequence alignment and phylogenetic analysis

461 The amino acid sequence alignment was performed using MUSCLE (Madeira et al., 2019), and phylogenetic

462 trees were generated using neighbor-joining method and 1,000 bootstrap iterations in MEGA X (Kumar et al.,

463 2018).

464 RNA-Seq and data analysis

465 Before library preparation, oligo(dT)-attached magnetic beads (Invitrogen, Cat. No. 61006) were used

466 to purify the mRNA. MGIEasy RNA Library preparation kit was used for library construction from

467 purified mRNA according to the manufacturer’s instruction (BGI, Cat. No. 1000006383). The quality

468 of the constructed library is checked and sequenced after passing. High-throughput sequencing was

469 paired-end sequenced on the BGISEQ-500 platform (BGI-Shenzhen, China). The obtained reads were

470 processed and analyzed, and genes with Q values < 0.05 and fold change values > 1 were considered

471 significantly differentially expressed. Based on the list of DEGs, we created and modified Venn

472 diagrams in Microsoft Excel. Furthermore, we performed KEGG enrichment analysis (Q < 0.05)

473 (Kanehisa, 2019), and generated a bubble chart using R.

474

475 ACCESSION NUMBERS

476 Sequence data from this article can be found in Rice Annotation Project database under the following accession

477 numbers: Actin (Os03g0718100), OsCKX1 (Os01g0187600), OsCKX2 (Os01g0197700), OsCKX3

478 (Os10g0483500), OsCKX4 (Os01g0940000), OsCKX5 (Os01g0775400), OsCKX7 (Os02g0220100), OsCKX8

479 (Os04g0523500), OsCKX9 (Os05g0374200), OsCKX11 (Os08g0460600), OsMADS25 (Os04g0304400),

480 OsMADS57 (Os02g0731200), OsD17 (Os04g0550600), OsPIN2 (Os06g0660200), OsWOX11 (Os07g0684900),

481 OsRR4 ( Os01g0952500), OsTB1 (Os03g0706500).

482 Supplemental data

483 The following supplemental materials are available.

484 Supplemental Figure S1. Gene structures and mutation details of OsCKXs.

485 Supplemental Figure S2. Chromatograms of the osckx mutant lines.

486 Supplemental Figure S3. The osckx mutants of Zhonghua11 from the 2020 field experiment.

487 Supplemental Figure S4. Phenotypic characterization of the vegetative organs in osckx mutants from the 2020

488 field experiment.

489 Supplemental Figure S5. Phenotypic characterization of the second and third top leaves in osckx mutants from

490 the 2020 field experiment.

491 Supplemental Figure S6. Phenotypic characterization of yield-related phenotypes in osckx mutants from the

492 2020 field experiment.

493 Supplemental Figure S7. Mutation details of OsCKX9, chromatograms of the osckx9 and osckx4/9 mutant lines,

494 and phenotypic characterization of the flag leaves and seeds in wild-type, osckx4, osckx9, and osckx4/9 plants.

495 Supplemental Figure S8. Phenotypic characterization of the leaf and root systems in wild-type and osckx4/9

496 plants.

497 Supplemental Figure S9. Relative expression levels and FPKM values of D17, RR4, WOX11, PIN2, TB1,

498 OsMADS25, and OsMADS57 in the roots and shoot bases (BP) of Nipponbare (NIP), osckx4, osckx9, and

499 osckx4/9.

500 Supplemental Table S1. Information of primers used in the study.

501 Supplemental Table S2. Characterization of the vegetative organs and yield-related phenotypes in osckx

502 mutants from the 2019 field experiment.

503 Supplemental Table S3. Tiller numbers in osckx mutants from the 2019 field experiment.

504 Supplemental Dataset 1. RNA sequencing data.

505 Acknowledgments

506 We thank Jiankang Zhu and Caixia Gao for providing the vectors of the CRISPR-Cas9 system. We also thank

507 Biogle and Biorun genome editing center for producing transgenic rice.

508 FIGURE LEGENDS

509 Figure 1. Genetic relationship and expression patterns of OsCKX genes based on RNA sequencing

510 data and GUS staining assay. A, Genetic relationship and expression patterns of OsCKX genes

511 investigated in the leaf blade at the vegetative stage (LBV), leaf sheath at the vegetative stage (LSV),

512 root at the vegetative stage (RV), leaf blade at the reproductive stage (LBR), leaf sheath at the

513 reproductive stage (LSR), root at the reproductive stage (RR), stem (S), inflorescence meristem (IM),

514 flower (F), and grain (G). The expression pattern was based on log2 Fragments Per Kilobase of exon

515 model per Million mapped fragments (FPKM) values. B, Histochemical GUS staining of pOsCKX::GUS

516 transgenic plants at various developmental stages. The scale bar in B was 1 mm.

517

518 Figure 2. Genetic and phenotypic characterization between wild-type (WT) and osckx1/2-19 mutant

519 plants. A, Mutation details of the coding sequences in the OsCKX1 and OsCKX2 of osckx1/2-19

520 mutant. Both OsCKX1 and OsCKX2 had functional loss due to the 1-bp insertion caused by frameshift

521 mutation. The solid yellow, blue, and red boxes represent the exons, untranslated regions, and target

522 sequences, respectively. The introns are shown as solid lines, while protospacer adjacent motif (PAM)

523 sequences are shown in red color and underlined with red. B, Number of tillers at the vegetative stage

524 70 days after sowing. C, Panicles at the reproductive stage (n = 20 for Nipponbare [NIP], n = 10 for

525 osckx1/2-19). D, Panicle phenotypes of NIP and osckx1/2 plants. The image was digitally extracted

526 and scaled for comparison (scale bar = 10 cm). E–H, Measurement of the spikelets per panicle (E),

527 primary branches per panicle (F), secondary branches per panicle (G), 1,000-grain weight (H) (n > 20

528 for E–G, n = 5 for H) and osckx1/2-19 (n > 10 for E–G, n = 5 for H) plants. I, Grain phenotypes of NIP

529 and osckx1/2 plants. The image was digitally extracted and scaled for comparison (scale bar = 1 cm).

530 J-R, Measurement of the grain length (J), grain weight (K), and grain thickness (L) , seed setting rate

531 (M), yield per plant (N), length of flag leaves (O), width of flag leaves (P), basal internode diameter

532 (Q), and plant height (R) of NIP (n > 50 for J–L, n > 20 for M–Q) and osckx1/2-19 ((n > 50 for J–L, n >

533 10 for M–Q) plants. The P-values indicate the significant differences between NIP and osckx1/2-19

534 determined by Student’s t-test.

535

536 Figure 3. Phenotypic characterization between wild-type (WT) and osckx4, osckx9, and osckx4/9 mutant plants

537 from the field experiment. A, Phenotypic features of Nipponbare (NIP), osckx4, osckx9 and osckx4/9 seedlings at

538 the vegetative stage 46 days after sowing. The image was digitally extracted and scaled for comparison (scale

539 bar = 10 cm). B–C, Number of tillers at the vegetative stage 46 days after sowing (B) and reproductive stage 70

540 days after sowing (C) (n > 20 for NIP, osckx4-6, and osckx9-1, n = 10 for osckx4/9). D–E, Habits (D) and panicle

541 phenotypes (E) of NIP, osckx4-6, osckx9-1, and osckx4/9 plants at the mature stage. The image was digitally

542 extracted and scaled for comparison (scale bar = 10 cm). F–N, Measurement of the panicle number (F), spikelets

543 per panicle (G), seed setting rate (H), 1,000-grain weight (I), yield per plant (J), plant height (K), primary

544 branches per panicle (L), secondary branches per panicle (M), and diameter of basal internode of NIP (N),

545 osckx4-6, osckx9-1 (n > 20 for F–H and J–N, n = 5 for I), and osckx4/9 (n > 10 for F–H and J–N, n = 5 for I).

546 Different capital letters represent significant differences (P < 0.01) determined by one-way ANOVA and shortest

547 significant ranges (SSR) test.

548

549 Figure 4. Phenotypic characterization between wild-type (WT) and osckx4, osckx9, and osckx4/9 mutant plants

550 from the hydroponic experiment. A, Phenotypic features of Nipponbare (NIP), osckx4, osckx9, and osckx4/9

551 seedlings 21 days after transferring to hydroponic solutions. The image was digitally extracted and scaled for

552 comparison (scale bar = 10 cm). B–E, Measurement of the shoot and root lengths (B), tiller numbers (C), length

553 of 8th leaf (D), and width of 8th leaf (E) of NIP, osckx4-6, osckx9-1, and osckx4/9 seedlings (n = 24 each).

554 Different capital letters represent significant differences (P < 0.01) determined by one-way ANOVA and SSR

555 test.

556

557 Figure 5. RNA-seq analysis of the roots and shoot bases (BP) between wild-type (WT) and osckx4, osckx9, and

558 osckx4/9 mutant plants. A, The number of differentially expressed genes (DEGs) identified in the roots and shoot

559 bases of the following pairwise comparisons: Nipponbare (NIP) vs. osckx4, NIP vs. osckx9, and NIP vs. osckx4/9.

560 The changes in gene expression levels were calculated using the log2 fold change and Q values from three

561 biological replicates. B, Overlapping DEGs in the roots and shoot bases (BP) of NIP vs. osckx4, NIP vs. osckx9,

562 and NIP vs. osckx4/9. C, DEGs in osckx4 and osckx9 specifically and in commonin the roots and shoots, genes in

563 magenta are upregulated; genes in sky blue are downregulated. D, Top enriched Kyoto Encyclopedia of Genes

564 and Genomes (KEGG) pathways of the DEGs identified in the roots and shoot bases of NIP vs. osckx4/9.

565

566 Figure 6. OsCKX4 and OsCKX9 are associated with several signal transduction pathways. A, Differentially

567 expressed genes (DEGs) related to gibberellin metabolism and signaling transduction. B, DEGs related to

568 strigolactone biosynthesis and signaling transduction. * Q < 0.05, ** Q < 0.01.

569

570 Figure 7. OsCKX4 and OsCKX9 associated with nitrogen absorption. Differentially expressed

571 genes related to nitrogen absorption, metabolism, and transportation. * Q < 0.05, ** Q < 0.01.

572

573 Figure 8. Patterns of OsCKX genes in rice.

574 Literature Cited

575 Arite T, Iwata H, Ohshima K, Maekawa M, Nakajima M, Kojima M, Sakakibara H, Kyozuka J (2007) 576 DWARF10, an RMS1/MAX4/DAD1 ortholog, controls lateral bud outgrowth in rice. Plant J 51: 577 1019-1029 578 Ashikari M, Sakakibara H, Lin S, Yamamoto T, Takashi T, Nishimura A, Angeles ER, Qian Q, Kitano H, 579 Matsuoka M (2005) Cytokinin oxidase regulates rice grain production. Science 309: 741-745 580 Bartrina I, Otto E, Strnad M, Werner T, Schmulling T (2011) Cytokinin regulates the activity of reproductive 581 meristems, flower organ size, ovule formation, and thus seed yield in Arabidopsis thaliana. Plant Cell 582 23: 69-80 583 Chen L, Zhao J, Song J, Jameson PE (2020) Cytokinin dehydrogenase: a genetic target for yield improvement in 584 wheat. Plant Biotechnol J 18: 614-630 585 Chen Y, Fan X, Song W, Zhang Y, Xu G (2012) Over-expression of OsPIN2 leads to increased tiller numbers, 586 angle and shorter plant height through suppression of OsLAZY1. Plant Biotechnol J 10: 139-149 587 Ding C, You J, Chen L, Wang S, Ding Y (2014) Nitrogen fertilizer increases spikelet number per panicle by 588 enhancing cytokinin synthesis in rice. Plant Cell Rep 33: 363-371 589 Duan J, Yu H, Yuan K, Liao Z, Meng X, Jing Y, Liu G, Chu J, Li J (2019) Strigolactone promotes cytokinin 590 degradation through transcriptional activation of CYTOKININ OXIDASE/DEHYDROGENASE 9 in 591 rice. Proc Natl Acad Sci U S A 116: 14319-14324 592 Gao S, Fang J, Xu F, Wang W, Sun X, Chu J, Cai B, Feng Y, Chu C (2014) CYTOKININ 593 OXIDASE/DEHYDROGENASE4 Integrates Cytokinin and Auxin Signaling to Control Rice Crown 594 Root Formation. Plant Physiol 165: 1035-1046 595 Gao S, Xiao Y, Xu F, Gao X, Cao S, Zhang F, Wang G, Sanders D, Chu C (2019) Cytokinin-dependent 596 regulatory module underlies the maintenance of zinc nutrition in rice. New Phytol 224: 202-215 597 Guo S, Xu Y, Liu H, Mao Z, Zhang C, Ma Y, Zhang Q, Meng Z, Chong K (2013) The interaction between 598 OsMADS57 and OsTB1 modulates rice tillering via DWARF14. Nat Commun 4: 1566 599 Jameson PE, Song J (2020) Will cytokinins underpin the second 'Green Revolution'? J Exp Bot 71: 6872-6875 600 Ji SH, Gururani MA, Lee JW, Ahn BO, Chun SC (2014) Isolation and characterisation of a dwarf rice mutant 601 exhibiting defective gibberellins biosynthesis. Plant Biol (Stuttg) 16: 428-439 602 Joshi R, Sahoo KK, Tripathi AK, Kumar R, Gupta BK, Pareek A, Singla-Pareek SL (2018) Knockdown of an 603 inflorescence meristem-specific cytokinin oxidase - OsCKX2 in rice reduces yield penalty under 604 salinity stress condition. Plant Cell Environ 41: 936-946 605 Kanehisa M (2019) Toward understanding the origin and evolution of cellular organisms. Protein Science 28: 606 1947-1951 607 Kollmer I, Novak O, Strnad M, Schmulling T, Werner T (2014) Overexpression of the cytosolic cytokinin 608 oxidase/dehydrogenase (CKX7) from Arabidopsis causes specific changes in root growth and xylem 609 differentiation. Plant J 78: 359-371 610 Kowalska M, Galuszka P, Frebortova J, Sebela M, Beres T, Hluska T, Smehilova M, Bilyeu KD, Frebort I (2010) 611 Vacuolar and cytosolic cytokinin dehydrogenases of Arabidopsis thaliana: heterologous expression, 612 purification and properties. Phytochemistry 71: 1970-1978 613 Kudo T, Makita N, Kojima M, Tokunaga H, Sakakibara H (2012) Cytokinin activity of cis-zeatin and phenotypic 614 alterations induced by overexpression of putative cis-Zeatin-O-glucosyltransferase in rice. Plant Physiol 615 160: 319-331 616 Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular Evolutionary Genetics Analysis

617 across Computing Platforms. Mol Biol Evol 35: 1547-1549 618 Kurakawa T, Ueda N, Maekawa M, Kobayashi K, Kojima M, Nagato Y, Sakakibara H, Kyozuka J (2007) Direct 619 control of shoot meristem activity by a cytokinin-activating enzyme. Nature 445: 652-655 620 Li S, Zhao B, Yuan D, Duan M, Qian Q, Tang L, Wang B, Liu X, Zhang J, Wang J, Sun J, Liu Z, Feng YQ, Yuan 621 L, Li C (2013) Rice zinc finger protein DST enhances grain production through controlling 622 Gn1a/OsCKX2 expression. Proc Natl Acad Sci U S A 110: 3167-3172 623 Madeira F, Park YM, Lee J, Buso N, Gur T, Madhusoodanan N, Basutkar P, Tivey ARN, Potter SC, Finn RD, 624 Lopez R (2019) The EMBL-EBI search and sequence analysis tools APIs in 2019. Nucleic Acids Res 625 47: W636-W641 626 Mao C, He J, Liu L, Deng Q, Yao X, Liu C, Qiao Y, Li P, Ming F (2020) OsNAC2 integrates auxin and cytokinin 627 pathways to modulate rice root development. Plant Biotechnol J 18: 429-442 628 Mao Y, Zhang H, Xu N, Zhang B, Gou F, Zhu JK (2013) Application of the CRISPR-Cas system for efficient 629 genome engineering in plants. Mol Plant 6: 2008-2011 630 Niemann MCE, Weber H, Hluska T, Leonte G, Anderson SM, Novak O, Senes A, Werner T (2018) The 631 Cytokinin Oxidase/Dehydrogenase CKX1 Is a Membrane-Bound Protein Requiring 632 Homooligomerization in the Endoplasmic Reticulum for Its Cellular Activity. Plant Physiol 176: 633 2024-2039 634 Osugi A, Kojima M, Takebayashi Y, Ueda N, Kiba T, Sakakibara H (2017) Systemic transport of trans-zeatin and 635 its precursor have differing roles in Arabidopsis shoots. Nat Plants 3: 17112 636 Romanov GA, Schmulling T (2021) Opening Doors for Cytokinin Trafficking at the ER Membrane. Trends Plant 637 Sci 638 Sakamoto T, Sakakibara H, Kojima M, Yamamoto Y, Nagasaki H, Inukai Y, Sato Y, Matsuoka M (2006) Ectopic 639 expression of KNOTTED1-like homeobox protein induces expression of cytokinin biosynthesis genes 640 in rice. Plant Physiol 142: 54-62 641 Schwarz I, Scheirlinck MT, Otto E, Bartrina I, Schmidt RC, Schmulling T (2020) Cytokinin regulates the 642 activity of the inflorescence meristem and components of seed yield in oilseed rape. J Exp Bot 643 Shin SY, Jeong JS, Lim JY, Kim T, Park JH, Kim JK, Shin C (2018) Transcriptomic analyses of rice (Oryza 644 sativa) genes and non-coding RNAs under nitrogen starvation using multiple omics technologies. BMC 645 Genomics 19: 532 646 Simaskova M, O'Brien JA, Khan M, Van Noorden G, Otvos K, Vieten A, De Clercq I, Van Haperen JMA, Cuesta 647 C, Hoyerova K, Vanneste S, Marhavy P, Wabnik K, Van Breusegem F, Nowack M, Murphy A, Friml J, 648 Weijers D, Beeckman T, Benkova E (2015) Cytokinin response factors regulate PIN-FORMED auxin 649 transporters. Nat Commun 6: 8717 650 Takeda T, Suwa Y, Suzuki M, Kitano H, Ueguchi-Tanaka M, Ashikari M, Matsuoka M, Ueguchi C (2003) The 651 OsTB1 gene negatively regulates lateral branching in rice. Plant J 33: 513-520 652 Tezuka D, Ito A, Mitsuhashi W, Toyomasu T, Imai R (2015) The rice ent-KAURENE SYNTHASE LIKE 2 653 encodes a functional ent-beyerene synthase. Biochem Biophys Res Commun 460: 766-771 654 Tsai YC, Weir NR, Hill K, Zhang W, Kim HJ, Shiu SH, Schaller GE, Kieber JJ (2012) Characterization of genes 655 involved in cytokinin signaling and metabolism from rice. Plant Physiol 158: 1666-1684 656 Waldie T, Leyser O (2018) Cytokinin Targets Auxin Transport to Promote Shoot Branching. Plant Physiol 177: 657 803-818 658 Wang J, Xu H, Li N, Fan F, Wang L, Zhu Y, Li S (2015) Artificial Selection of Gn1a Plays an Important role in 659 Improving Rice Yields Across Different Ecological Regions. Rice (N Y) 8: 37 660 Wang WC, Lin TC, Kieber J, Tsai YC (2019) Response Regulators 9 and 10 Negatively Regulate Salinity

661 Tolerance in Rice. Plant Cell Physiol 60: 2549-2563 662 Wang Y, Lu Y, Guo Z, Ding Y, Ding C (2020) RICE CENTRORADIALIS 1, a TFL1-like Gene, Responses to 663 Drought Stress and Regulates Rice Flowering Transition. Rice (N Y) 13: 70 664 Werner T, Motyka V, Strnad M, Schmulling T (2001) Regulation of plant growth by cytokinin. Proc Natl Acad 665 Sci U S A 98: 10487-10492 666 Xu J, Zha M, Li Y, Ding Y, Chen L, Ding C, Wang S (2015) The interaction between nitrogen availability and 667 auxin, cytokinin, and strigolactone in the control of shoot branching in rice (Oryza sativa L.). Plant Cell 668 Rep 34: 1647-1662 669 Yang J, Cho LH, Yoon J, Yoon H, Wai AH, Hong WJ, Han M, Sakakibara H, Liang W, Jung KH, Jeon JS, Koh 670 HJ, Zhang D, An G (2018) Chromatin interacting factor OsVIL2 increases biomass and rice grain yield. 671 Plant Biotechnol J 672 Yeh SY, Chen HW, Ng CY, Lin CY, Tseng TH, Li WH, Ku MS (2015) Down-Regulation of Cytokinin Oxidase 2 673 Expression Increases Tiller Number and Improves Rice Yield. Rice (N Y) 8: 36 674 Yu C, Liu Y, Zhang A, Su S, Yan A, Huang L, Ali I, Liu Y, Forde BG, Gan Y (2015) MADS-box transcription 675 factor OsMADS25 regulates root development through affection of nitrate accumulation in rice. PLoS 676 One 10: e0135196 677 Zalabak D, Galuszka P, Mrizova K, Podlesakova K, Gu R, Frebortova J (2014) Biochemical characterization of 678 the maize cytokinin dehydrogenase family and cytokinin profiling in developing maize plantlets in 679 relation to the expression of cytokinin dehydrogenase genes. Plant Physiol Biochem 74: 283-293 680 Zalabak D, Johnova P, Plihal O, Senkova K, Samajova O, Jiskrova E, Novak O, Jackson D, Mohanty A, 681 Galuszka P (2016) Maize cytokinin dehydrogenase isozymes are localized predominantly to the 682 vacuoles. Plant Physiol Biochem 104: 114-124 683 Zalewski W, Galuszka P, Gasparis S, Orczyk W, Nadolska-Orczyk A (2010) Silencing of the HvCKX1 gene 684 decreases the cytokinin oxidase/dehydrogenase level in barley and leads to higher plant productivity. J 685 Exp Bot 61: 1839-1851 686 Zhang L, Zhao YL, Gao LF, Zhao GY, Zhou RH, Zhang BS, Jia JZ (2012) TaCKX6-D1, the ortholog of rice 687 OsCKX2, is associated with grain weight in hexaploid wheat. New Phytol 195: 574-584 688 Zhang W, Peng KX, Cui FB, Wang DL, Zhao JZ, Zhang YJ, Yu NN, Wang YY, Zeng DL, Wang YH, Cheng ZK, 689 Zhang KW (2020) Cytokinin oxidase/dehydrogenase OsCKX11 coordinates source and sink 690 relationship in rice by simultaneous regulation of leaf senescence and grain number. Plant 691 Biotechnology Journal 692 Zhao Y, Hu Y, Dai M, Huang L, Zhou DX (2009) The WUSCHEL-related homeobox gene WOX11 is required to 693 activate shoot-borne crown root development in rice. Plant Cell 21: 736-748 694 Zou J, Chen Z, Zhang S, Zhang W, Jiang G, Zhao X, Zhai W, Pan X, Zhu L (2005) Characterizations and fine 695 mapping of a mutant gene for high tillering and dwarf in rice (Oryza sativa L.). Planta 222: 604-612

32 bioRxiv preprint doi: https://doi.org/10.1101/2021.05.09.443313; this version posted May 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is A made available under aCC-BY 4.0 International license. LBV LSV RVLBRLSR RR S IM F G 92 OsCKX1 OsCKX2 99 100 OsCKX6 OsCKX7 74 100 OsCKX10 100 OsCKX4 OsCKX9 8.00 6.00 85 OsCKX5 4.00 100 OsCKX3 2.00 OsCKX8 0.00 -2.00 OsCKX11 -4.00

Axillary Flag leaf IM IM IM B Root Leaf Shoot base bud I primordia ~stage III ~stage VI heading

pOsCKX1::GUS

pOsCKX2::GUS

pOsCKX3::GUS

pOsCKX4::GUS

pOsCKX5::GUS

pOsCKX8::GUS

pOsCKX9::GUS

pOsCKX11::GUS

Figure 1. Genetic relationship and expression patterns of OsCKX genes based on RNA sequencing data and GUS staining assay. A, Genetic relationship and expression patterns of OsCKX genes investigated in the leaf blade at the vegetative stage (LBV), leaf sheath at the vegetative stage (LSV), root at the vegetative stage (RV), leaf blade at the reproductive stage (LBR), leaf sheath at the reproductive stage (LSR), root at the reproductive stage (RR), stem (S), inflorescence meristem (IM), flower (F), and grain

(G). The expression pattern was based on log2 Fragments Per Kilobase of exon model per Million mapped fragments (FPKM) values. B, Histochemical GUS staining of pOsCKX::GUS transgenic plants at various developmental stages. The scale bar in B was 1 mm. bioRxiv preprint doi: https://doi.org/10.1101/2021.05.09.443313; this version posted May 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is A made available under aCC-BY 4.0 International license. B 20 WT: 713 GACTACCTCCACCTCAC - CGTCGG 735 osckx1/2-19: 713 GACTACCTCCACCTCACACGTCGG 735 (1-bp insertion) p=0.0013 OsCKX1 ATG 10 WT: 691 GACTACCTCCACCTCAC - CGTCGG 713 osckx1/2-19: 691 GACTACCTCCACCTCACACGTCGG 713 (1-bp insertion)

OsCKX2 Tiller number ATG 0 1kb exon UTR intron target NGG PAM NIP osckx1/2-19

C D E F 20 200 15 p=0.0064 p=0.044 p=0.013 10 10 100 5 Panicle number Spikelets Per panicle 0 0 0 NIP osckx1/2-19 NIP osckx1/2-19 NIP osckx1/2-19 NIP osckx1/2-19 Primary branches Primary Per panicle

G H I J

40 30 NIP 10 p=1.8E-4 p=0.16 p=5.0E-6 osckx1/2-19

20 20 NIP 5 10 osckx1/2-19 Grain length (mm) 1000-grain 1000-grain weight (g) 0 0 0 NIP osckx1/2-19 NIP osckx1/2-19 NIP osckx1/2-19 Secondarybranches Per panicle K L M N 4 p=0.14 3 1.0 40 p=0.89 p=0.023 p=0.052 2 2 0.5 20

1 Seed settingSeed rate Grain width (mm) Yield per plant (g) Grain thickness (mm) 0 0 0.0 0 NIP osckx1/2-19 NIP osckx1/2-19 NIP osckx1/2-19 NIP osckx1/2-19 O P Q R 50 2 p=2.5E-4 6 p=8.8E-7 120

p=0.74 p=0.69

25 1 3 60 Plant height (cm) Flag leaf width(cm) Flag leaf length (cm) 0 0 0 0 NIP osckx1/2-19 NIP osckx1/2-19 NIP osckx1/2-19 NIP osckx1/2-19 Basal internodeBasal diameter (mm) Figure 2. Genetic and phenotypic characterization between wild-type (WT) and osckx1/2-19 mutant plants. A, Mutation details of the coding sequences in the OsCKX1 and OsCKX2 of osckx1/2-19 mutant. Both OsCKX1 and OsCKX2 had functional loss due to the 1-bp insertion caused by frameshift mutation. The solid yellow, blue, and red boxes represent the exons, untranslated regions, and target sequences, respectively. The introns are shown as solid lines, while protospacer adjacent motif (PAM) sequences are shown in red color and underlined with red. B, Number of tillers at the vegetative stage 70 days after sowing. C, Panicles at the reproductive stage (n = 20 for Nipponbare [NIP], n = 10 for osckx1/2-19). D, Panicle phenotypes of NIP and osckx1/2-19 plants. The image was digitally extracted and scaled for comparison (scale bar = 10 cm). E–H, Measurement of the spikelets per panicle (E), primary branches per panicle (F), secondary branches per panicle (G), 1,000-grain weight (H) (n > 20 for E–G, n = 5 for H) and osckx1/2-19 (n > 10 for E–G, n = 5 for H) plants. I, Grain phenotypes of NIP and osckx1/2-19 plants. The image was digitally extracted and scaled for comparison (scale bar = 1 cm). J-R, Measurement of the grain length (J), grain weight (K), and grain thickness (L) , seed setting rate (M), yield per plant (N), length of flag leaves (O), width of flag leaves (P), basal internode diameter (Q), and plant height (R) of NIP (n > 50 for J–L, n > 20 for M–Q) and osckx1/2-19 ((n > 50 for J–L, n > 10 for M–Q) plants. The P-values indicate the significant differences between NIP and osckx1/2-19 determined by Student’s t-test. bioRxiv preprint doi: https://doi.org/10.1101/2021.05.09.443313; this version posted May 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is A madeB available under aCC-BY 4.0 InternationalC license. 60 60 A

A 40 40 B B B C C C 20 20

0 0

NIP NIP NIP NIP NIP osckx4-6 osckx9-1 osckx4/9 osckx4-6 osckx9-1 osckx4/9 Tiller numbers at 46 days after sowingTiller after days numbers at 46 osckx4-6 osckx9-1 osckx4/9 sowingTiller after days numbers at 70 D E

NIP NIP

osckx4-6 osckx9-1 osckx4/9 osckx4-6 osckx9-1 osckx4/9 F G NIP H 50 160 A 15 A A B A A A 10 B B C 25 C C 80 5 Panicles Panicles per plant 0 Spikelets per panicle 0 0 Primary branches per paniclebranches Primary NIP NIP NIP I osckx4-6 osckx9-1 osckx4/9 J osckx4-6 osckx9-1 osckx4/9 K osckx4-6 osckx9-1 osckx4/9 30 A 1.0 30 A A A B A B B B B 20 20 C

C 0.5 10 10 Seed Seed setting rate 1000-grain weight1000-grain (g) 0 0.0 0

Secondary branches per panicle Secondaryper branches NIP NIP NIP

L osckx4-6 osckx9-1 osckx4/9 M osckx4-6 osckx9-1 osckx4/9 N osckx4-6 osckx9-1 osckx4/9 40 6 120 A A A B AB B B A A C C 80 20 B 3 40 Plant height (cm) Yield per plant (g) 0 0 0

NIP internode (mm) Basal diameter NIP NIP

osckx4-6 osckx9-1 osckx4/9 osckx4-6 osckx9-1 osckx4/9 osckx4-6 osckx9-1 osckx4/9 Figure 3. Phenotypic characterization between wild-type (WT) and osckx4, osckx9, and osckx4/9 mutant plants from the field experiment. A, Phenotypic features of Nipponbare (NIP), osckx4-6, osckx9-1 and osckx4/9 seedlings at the vegetative stage 46 days after sowing. The image was digitally extracted and scaled for comparison (scale bar = 10 cm). B–C, Number of tillers at the vegetative stage 46 days after sowing (B) and reproductive stage 70 days after sowing (C) (n > 20 for NIP, osckx4-6, and osckx9-1, n = 10 for osckx4/9). D–E, Habits (D) and panicle phenotypes (E) of NIP, osckx4-6, osckx9-1, and osckx4/9 plants at the mature stage. The image was digitally extracted and scaled for comparison (scale bar = 10 cm). F–N, Measurement of the panicle number (F), spikelets per panicle (G), seed setting rate (H), 1,000-grain weight (I), yield per plant (J), plant height (K), primary branches per panicle (L), secondary branches per panicle (M), and diameter of basal internode of NIP (N), osckx4-6, osckx9-1 (n > 20 for F–H and J–N, n = 5 for I), and osckx4/9 (n > 10 for F–H and J–N, n = 5 for I). Different capital letters represent significant differences (P < 0.01) determined by one-way ANOVA and shortest significant ranges (SSR) test. bioRxiv preprint doi: https://doi.org/10.1101/2021.05.09.443313; this version posted May 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

NIP

osckx4-6 osckx9-1 osckx4/9

B C NIP osckx9-1 NIP osckx9-1 osckx4-6 osckx4/9 osckx4-6 osckx4/9 60 A 10 B A A C B 30 C 5 C

0 Tiller number at B B Shoot and root length atShoot A A 21 days after hydroponics -30 0 21 days after hydroponics (cm)

D E

1.0 40 A A A A B B B C leaf (cm) leaf (cm) th th 0.5 20 The width of 8 of width The The length of 8 of length The 0.0 0 A A NIP NIP

osckx4-6 osckx9-1 osckx4/9 osckx4-6 osckx9-1 osckx4/9

Figure 4. Phenotypic characterization between wild-type (WT) and osckx4, osckx9, and osckx4/9 mutant plants from the hydroponic experiment. A, Phenotypic features of Nipponbare (NIP), osckx4-6, osckx9-1, and osckx4/9 seedlings 21 days after transferring to hydroponic solutions. The image was digitally extracted and scaled for comparison (scale bar = 10 cm). B–E, Measurement of the shoot and root lengths (B), tiller numbers (C), length of 8th leaf (D), and width of 8th leaf (E) of NIP, osckx4-6, osckx9-1, and osckx4/9 seedlings (n = 24 each). Different capital letters represent significant differences (P < 0.01) determined by one-way ANOVA and SSR test. bioRxiv preprint doi: https://doi.org/10.1101/2021.05.09.443313; this version posted May 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

A B NIP -vs- osckx4/9 NIP -vs- osckx4 5000 Down Up 4000

3000 DEGs in root

2000 NIP -vs- osckx9

NIP -vs- osckx4/9 NIP -vs- osckx4

Number of DEGs 1000

0 DEGs in shoot osckx4 vs NIPosckx9 vs NIP osckx4 vs NIPosckx9 vs NIP osckx4/9 vs NIP osckx4/9 vs NIP Root Shoot base NIP -vs- osckx9

C DEGs in osckx4 single DEGs in osckx4 and osckx9 DEGs in osckx9 single mutant specially single mutant in common mutant specially

OsD4; OsHKT1;1; OsHKT2;1; OsGH3-2; IRO2; Lsi1; OsLBD37; OsFRDL1; OsRab6a; OsZIP9; OsNPF5.5; OsTCP19; OsIAA9; OsNPF7.3; OsSAUR12; OsMYB61; CYB734A6; OsGH3-8; OsPIN2... ACO5; OsZIP16; OsHT; OsMADS27; OsIPT4; OsAMT1;3; DAO; Pht1;8... OsHAK1; NRR; OsZIP8; OsARF19; OsRR10; VIT2; OsGS1;3 ...

Shoot OsCKX4 OsCKX9 Root

OsSAUR2; OsSAUR6; Oself6;2; IRO2; Lsi1; Lsi2; OsACO7; OsKAT3; OsNPF7.3; OsPUP1; OsAAP5; OsAAP8; OsAAP15; OsSweet12; OsZIP16; OsNAAT4; OsAAP3; OsACO2; OsPUP5; OsNLP6; OsNRT1.1C; GID1; OsZIP9; Pht1;2... OsRR10; OsAMT3;2 ... OsRR24; OsSPX2; OsIRT1; OsNAS3; OsARF10; miR156h...

WT vs osckx4/9 root WT vs osckx4/9 shoot base

Enriched KEGG Pathway Enriched KEGG Pathway Gene Number Gene Number Amino sugar and nucleotide sugar metabolism Ribosome Tyrosine metabolism 20 7 14 Phosphatidylinositol signaling system 59 Cysteine and methionine metabolism Carotenoid biosynthesis 98 21 Glycolysis / Gluconeogenesis Galactose metabolism 28 Glutathione metabolism 137 Carbon metabolism Plant hormone signal transduction Q-value Q-value Arginine and proline metabolism Pyruvate metabolism 0.00 0.00 Alanine, aspartate and glutamate metabolism Citrate cycle (TCA cycle) Fructose and mannose metabolism Biosynthesis of amino acids 0.01 Biosynthesis of amino acids 0.01 Inositol phosphate metabolism Glycine, serine and threonine metabolism Glycolysis / Gluconeogenesis 0.02 0.02

0.0 0.1 0.2 0.3 0.03 0.00 0.04 0.08 0.12 0.03 Rich Ratio Rich Ratio

Figure 5. RNA-seq analysis of the roots and shoot bases (BP) between wild-type (WT) and osckx4, osckx9, and osckx4/9 mutant plants. A, The number of differentially expressed genes (DEGs) identified in the roots and shoot bases of the following pairwise comparisons: Nipponbare (NIP) vs. osckx4, NIP vs. osckx9, and NIP vs. osckx4/9. The changes in gene expression levels were calculated using the log2 fold change and Q values from three biological replicates. B, Overlapping DEGs in the roots and shoot bases (BP) of NIP vs. osckx4, NIP vs. osckx9, and NIP vs. osckx4/9. C, DEGs in osckx4 and osckx9 specifically and in commonin the roots and shoots, genes in magenta are upregulated; genes in sky blue are downregulated. D, Top enriched Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways of the DEGs identified in the roots and shoot bases of NIP vs. osckx4/9. bioRxiv preprint doi: https://doi.org/10.1101/2021.05.09.443313; this version posted May 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

* OsKS1 GGCP KS (geranylgeranyl diphosphate) ** OsKS2 CPS * GA20ox2 ent-CDP Os03g0618300 GA20ox (ent-copalyl diphosphate) * ** Os08g0560000 KS * * GA2ox2 ent-kaurene ** GA2ox3 GA2ox KO ** GA2ox7 ** GA2ox9 ent-kaurenoic acid down-stream genes GA2ox10 KAO ** DELLA ** Os02g0567800 ** Os03g0258200 * Os03g0790500 GA GA ** 53 GA13ox 12 * Os06g0214800 GID-LIKE Os07g0162400 GA20ox ** ** GA3ox ** Os07g0643100 * * Os07g0643700 GA1 GA4 lower bioactivity higher bioactivity

osckx4osckx9-R -R osckx4osckx9-BP -BP GA2ox GID osckx4/9-R osckx49-BP

inactive -4.00 -2.00 0.00 2.00 4.00

OsD10 MADS57 TB1 MADS57 TB1 OsD17 D3 D3 D14 D14 D53BZR OsTB1 D53BZR1 D53BZR1 ** OsMADS57

osckx4osckx9-R -R osckx4/9osckx4-Rosckx9-BPosckx49-BP -BP Shoot

-4.00 -2.00 0.00 2.00 4.00 Root D27 D17 D10 SLs all trans-β-carotene

Figure 6. OsCKX4 and OsCKX9 are associated with several signal transduction pathways. A, Differentially expressed genes (DEGs) related to gibberellin metabolism and signaling transduction. B, DEGs related to strigolactone biosynthesis and signaling transduction. * Q < 0.05, ** Q < 0.01. bioRxiv preprint doi: https://doi.org/10.1101/2021.05.09.443313; this version posted May 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

transport by Gln/Asn Oranic nitrogen for use OsNPF OsNPF transport by assimilate by GS/GOGAT/AS

+ NiR - NR - NH4 NO2 NO3

reduction OsAMT OsNRT absorb by

absorb by

partners Signal transduction

+ - NH4 NO3

** * OsNRT1 * NRT2.2 OsNRT ** OsNRT2.3 * ** OsNRT1.1C ** NBIP1 partner ** OsNAR2.1 ** NIR2 reduction ** OsAMT3;2 * OsAMT1;2 OsAMT ** OsAMT1;3 ** OsAS1 assimilate ** ** ** GS1;3 * NPF1.2 * NPF5.10 * NPF8.1 ** Os01g0871800 ** Os01g0871900 ** NPF7.2 ** ** NPF5.2 OsNPF OsNPF7.4 * 4.00 ** OsNPF3.1 * OsNPF5.10 ** OsNPF4.4 2.00 ** OsNPF4.6 * NPF8.3 0.00 ** OsNPF8.20 * OsNPF5.5 -2.00 ** OsNPF4.5

-4.00 osckx4osckx9-R -R osckx4osckx9-BP-BP osckx4/9-Rosckx49-BP

Figure 7. OsCKX4 and OsCKX9 associated with nitrogen absorption. Differentially expressed genes related to nitrogen absorption, metabolism, and transportation. * Q < 0.05, ** Q < 0.01. bioRxiv preprint doi: https://doi.org/10.1101/2021.05.09.443313; this version posted May 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Grain OsCKX1, OsCKX2, OsCKX4, OsCKX7, OsCKX8, OsCKX9, OsCKX11

Flag leaf OsCKX1, OsCKX2, Panicle OsCKX4, OsCKX8, OsCKX2, OsCKX4, OsCKX11 OsCKX9, OsCKX11

Internode diameter OsCKX1, OsCKX2 OsCKX3, OsCKX4, OsCKX8, OsCKX11 Tiller number OsCKX2, OsCKX4, OsCKX9

Root system OsCKX4

Figure 8. Patterns of OsCKX genes in rice. bioRxiv preprint doi: https://doi.org/10.1101/2021.05.09.443313; this version posted May 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Parsed Citations Arite T, Iwata H, Ohshima K, Maekawa M, Nakajima M, Kojima M, Sakakibara H, Kyozuka J (2007) DWARF10, an RMS1/MAX4/DAD1 ortholog, controls lateral bud outgrowth in rice. Plant J 51: 1019-1029 Google Scholar: Author Only Title Only Author and Title Ashikari M, Sakakibara H, Lin S, Yamamoto T, Takashi T, Nishimura A, Angeles ER, Qian Q, Kitano H, Matsuoka M (2005) Cytokinin oxidase regulates rice grain production. Science 309: 741-745 Google Scholar: Author Only Title Only Author and Title Bartrina I, Otto E, Strnad M, Werner T, Schmulling T (2011) Cytokinin regulates the activity of reproductive meristems, flower organ size, ovule formation, and thus seed yield in Arabidopsis thaliana. Plant Cell 23: 69-80 Google Scholar: Author Only Title Only Author and Title Chen L, Zhao J, Song J, Jameson PE (2020) Cytokinin dehydrogenase: a genetic target for yield improvement in wheat. Plant Biotechnol J 18: 614-630 Google Scholar: Author Only Title Only Author and Title Chen Y, Fan X, Song W, Zhang Y, Xu G (2012) Over-expression of OsPIN2 leads to increased tiller numbers, angle and shorter plant height through suppression of OsLAZY1. Plant Biotechnol J 10: 139-149 Google Scholar: Author Only Title Only Author and Title Ding C, You J, Chen L, Wang S, Ding Y (2014) Nitrogen fertilizer increases spikelet number per panicle by enhancing cytokinin synthesis in rice. Plant Cell Rep 33: 363-371 Google Scholar: Author Only Title Only Author and Title Duan J, Yu H, Yuan K, Liao Z, Meng X, Jing Y, Liu G, Chu J, Li J (2019) Strigolactone promotes cytokinin degradation through transcriptional activation of CYTOKININ OXIDASE/DEHYDROGENASE 9 in rice. Proc Natl Acad Sci U S A 116: 14319-14324 Google Scholar: Author Only Title Only Author and Title Gao S, Fang J, Xu F, Wang W, Sun X, Chu J, Cai B, Feng Y, Chu C (2014) CYTOKININ OXIDASE/DEHYDROGENASE4 Integrates Cytokinin and Auxin Signaling to Control Rice Crown Root Formation. Plant Physiol 165: 1035-1046 Google Scholar: Author Only Title Only Author and Title Gao S, Xiao Y, Xu F, Gao X, Cao S, Zhang F, Wang G, Sanders D, Chu C (2019) Cytokinin-dependent regulatory module underlies the maintenance of zinc nutrition in rice. New Phytol 224: 202-215 Google Scholar: Author Only Title Only Author and Title Guo S, Xu Y, Liu H, Mao Z, Zhang C, Ma Y, Zhang Q, Meng Z, Chong K (2013) The interaction between OsMADS57 and OsTB1 modulates rice tillering via DWARF14. Nat Commun 4: 1566 Google Scholar: Author Only Title Only Author and Title Jameson PE, Song J (2020) Will cytokinins underpin the second 'Green Revolution'? J Exp Bot 71: 6872-6875 Google Scholar: Author Only Title Only Author and Title Ji SH, Gururani MA, Lee JW, Ahn BO, Chun SC (2014) Isolation and characterisation of a dwarf rice mutant exhibiting defective gibberellins biosynthesis. Plant Biol (Stuttg) 16: 428-439 Google Scholar: Author Only Title Only Author and Title Joshi R, Sahoo KK, Tripathi AK, Kumar R, Gupta BK, Pareek A, Singla-Pareek SL (2018) Knockdown of an inflorescence meristem- specific cytokinin oxidase - OsCKX2 in rice reduces yield penalty under salinity stress condition. Plant Cell Environ 41: 936-946 Google Scholar: Author Only Title Only Author and Title Kanehisa M (2019) Toward understanding the origin and evolution of cellular organisms. Protein Science 28: 1947-1951 Google Scholar: Author Only Title Only Author and Title Kollmer I, Novak O, Strnad M, Schmulling T, Werner T (2014) Overexpression of the cytosolic cytokinin oxidase/dehydrogenase (CKX7) from Arabidopsis causes specific changes in root growth and xylem differentiation. Plant J 78: 359-371 Google Scholar: Author Only Title Only Author and Title Kowalska M, Galuszka P, Frebortova J, Sebela M, Beres T, Hluska T, Smehilova M, Bilyeu KD, Frebort I (2010) Vacuolar and cytosolic cytokinin dehydrogenases of Arabidopsis thaliana: heterologous expression, purification and properties. Phytochemistry 71: 1970-1978 Google Scholar: Author Only Title Only Author and Title Kudo T, Makita N, Kojima M, Tokunaga H, Sakakibara H (2012) Cytokinin activity of cis-zeatin and phenotypic alterations induced by overexpression of putative cis-Zeatin-O-glucosyltransferase in rice. Plant Physiol 160: 319-331 Google Scholar: Author Only Title Only Author and Title Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol Biol Evol 35: 1547-1549 Google Scholar: Author Only Title Only Author and Title Kurakawa T, Ueda N, Maekawa M, Kobayashi K, Kojima M, Nagato Y, Sakakibara H, Kyozuka J (2007) Direct control of shoot meristem bioRxiv preprint doi: https://doi.org/10.1101/2021.05.09.443313; this version posted May 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

activity by a cytokinin-activating enzyme. Nature 445: 652-655 Google Scholar: Author Only Title Only Author and Title Li S, Zhao B, Yuan D, Duan M, Qian Q, Tang L, Wang B, Liu X, Zhang J, Wang J, Sun J, Liu Z, Feng YQ, Yuan L, Li C (2013) Rice zinc finger protein DST enhances grain production through controlling Gn1a/OsCKX2 expression. Proc Natl Acad Sci U S A 110: 3167-3172 Google Scholar: Author Only Title Only Author and Title Madeira F, Park YM, Lee J, Buso N, Gur T, Madhusoodanan N, Basutkar P, Tivey ARN, Potter SC, Finn RD, Lopez R (2019) The EMBL- EBI search and sequence analysis tools APIs in 2019. Nucleic Acids Res 47: W636-W641 Google Scholar: Author Only Title Only Author and Title Mao C, He J, Liu L, Deng Q, Yao X, Liu C, Qiao Y, Li P, Ming F (2020) OsNAC2 integrates auxin and cytokinin pathways to modulate rice root development. Plant Biotechnol J 18: 429-442 Google Scholar: Author Only Title Only Author and Title Mao Y, Zhang H, Xu N, Zhang B, Gou F, Zhu JK (2013) Application of the CRISPR-Cas system for efficient genome engineering in plants. Mol Plant 6: 2008-2011 Google Scholar: Author Only Title Only Author and Title Niemann MCE, Weber H, Hluska T, Leonte G, Anderson SM, Novak O, Senes A, Werner T (2018) The Cytokinin Oxidase/Dehydrogenase CKX1 Is a Membrane-Bound Protein Requiring Homooligomerization in the Endoplasmic Reticulum for Its Cellular Activity. Plant Physiol 176: 2024-2039 Google Scholar: Author Only Title Only Author and Title Osugi A, Kojima M, Takebayashi Y, Ueda N, Kiba T, Sakakibara H (2017) Systemic transport of trans-zeatin and its precursor have differing roles in Arabidopsis shoots. Nat Plants 3: 17112 Google Scholar: Author Only Title Only Author and Title Romanov GA, Schmulling T (2021) Opening Doors for Cytokinin Trafficking at the ER Membrane. Trends Plant Sci Google Scholar: Author Only Title Only Author and Title Sakamoto T, Sakakibara H, Kojima M, Yamamoto Y, Nagasaki H, Inukai Y, Sato Y, Matsuoka M (2006) Ectopic expression of KNOTTED1- like homeobox protein induces expression of cytokinin biosynthesis genes in rice. Plant Physiol 142: 54-62 Google Scholar: Author Only Title Only Author and Title Schwarz I, Scheirlinck MT, Otto E, Bartrina I, Schmidt RC, Schmulling T (2020) Cytokinin regulates the activity of the inflorescence meristem and components of seed yield in oilseed rape. J Exp Bot Google Scholar: Author Only Title Only Author and Title Shin SY, Jeong JS, Lim JY, Kim T, Park JH, Kim JK, Shin C (2018) Transcriptomic analyses of rice (Oryza sativa) genes and non-coding RNAs under nitrogen starvation using multiple omics technologies. BMC Genomics 19: 532 Google Scholar: Author Only Title Only Author and Title Simaskova M, O'Brien JA, Khan M, Van Noorden G, Otvos K, Vieten A, De Clercq I, Van Haperen JMA, Cuesta C, Hoyerova K, Vanneste S, Marhavy P, Wabnik K, Van Breusegem F, Nowack M, Murphy A, Friml J, Weijers D, Beeckman T, Benkova E (2015) Cytokinin response factors regulate PIN-FORMED auxin transporters. Nat Commun 6: 8717 Google Scholar: Author Only Title Only Author and Title Takeda T, Suwa Y, Suzuki M, Kitano H, Ueguchi-Tanaka M, Ashikari M, Matsuoka M, Ueguchi C (2003) The OsTB1 gene negatively regulates lateral branching in rice. Plant J 33: 513-520 Google Scholar: Author Only Title Only Author and Title Tezuka D, Ito A, Mitsuhashi W, Toyomasu T, Imai R (2015) The rice ent-KAURENE SYNTHASE LIKE 2 encodes a functional ent- beyerene synthase. Biochem Biophys Res Commun 460: 766-771 Google Scholar: Author Only Title Only Author and Title Tsai YC, Weir NR, Hill K, Zhang W, Kim HJ, Shiu SH, Schaller GE, Kieber JJ (2012) Characterization of genes involved in cytokinin signaling and metabolism from rice. Plant Physiol 158: 1666-1684 Google Scholar: Author Only Title Only Author and Title Waldie T, Leyser O (2018) Cytokinin Targets Auxin Transport to Promote Shoot Branching. Plant Physiol 177: 803-818 Google Scholar: Author Only Title Only Author and Title Wang J, Xu H, Li N, Fan F, Wang L, Zhu Y, Li S (2015) Artificial Selection of Gn1a Plays an Important role in Improving Rice Yields Across Different Ecological Regions. Rice (N Y) 8: 37 Google Scholar: Author Only Title Only Author and Title Wang WC, Lin TC, Kieber J, Tsai YC (2019) Response Regulators 9 and 10 Negatively Regulate Salinity Tolerance in Rice. Plant Cell Physiol 60: 2549-2563 Google Scholar: Author Only Title Only Author and Title Wang Y, Lu Y, Guo Z, Ding Y, Ding C (2020) RICE CENTRORADIALIS 1, a TFL1-like Gene, Responses to Drought Stress and Regulates Rice Flowering Transition. Rice (N Y) 13: 70 Google Scholar: Author Only Title Only Author and Title bioRxiv preprint doi: https://doi.org/10.1101/2021.05.09.443313; this version posted May 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Google Scholar: Author Only Title Only Author and Title Werner T, Motyka V, Strnad M, Schmulling T (2001) Regulation of plant growth by cytokinin. Proc Natl Acad Sci U S A 98: 10487-10492 Google Scholar: Author Only Title Only Author and Title Xu J, Zha M, Li Y, Ding Y, Chen L, Ding C, Wang S (2015) The interaction between nitrogen availability and auxin, cytokinin, and strigolactone in the control of shoot branching in rice (Oryza sativa L.). Plant Cell Rep 34: 1647-1662 Google Scholar: Author Only Title Only Author and Title Yang J, Cho LH, Yoon J, Yoon H, Wai AH, Hong WJ, Han M, Sakakibara H, Liang W, Jung KH, Jeon JS, Koh HJ, Zhang D, An G (2018) Chromatin interacting factor OsVIL2 increases biomass and rice grain yield. Plant Biotechnol J Google Scholar: Author Only Title Only Author and Title Yeh SY, Chen HW, Ng CY, Lin CY, Tseng TH, Li WH, Ku MS (2015) Down-Regulation of Cytokinin Oxidase 2 Expression Increases Tiller Number and Improves Rice Yield. Rice (N Y) 8: 36 Google Scholar: Author Only Title Only Author and Title Yu C, Liu Y, Zhang A, Su S, Yan A, Huang L, Ali I, Liu Y, Forde BG, Gan Y (2015) MADS-box transcription factor OsMADS25 regulates root development through affection of nitrate accumulation in rice. PLoS One 10: e0135196 Google Scholar: Author Only Title Only Author and Title Zalabak D, Galuszka P, Mrizova K, Podlesakova K, Gu R, Frebortova J (2014) Biochemical characterization of the maize cytokinin dehydrogenase family and cytokinin profiling in developing maize plantlets in relation to the expression of cytokinin dehydrogenase genes. Plant Physiol Biochem 74: 283-293 Google Scholar: Author Only Title Only Author and Title Zalabak D, Johnova P, Plihal O, Senkova K, Samajova O, Jiskrova E, Novak O, Jackson D, Mohanty A, Galuszka P (2016) Maize cytokinin dehydrogenase isozymes are localized predominantly to the vacuoles. Plant Physiol Biochem 104: 114-124 Google Scholar: Author Only Title Only Author and Title Zalewski W, Galuszka P, Gasparis S, Orczyk W, Nadolska-Orczyk A (2010) Silencing of the HvCKX1 gene decreases the cytokinin oxidase/dehydrogenase level in barley and leads to higher plant productivity. J Exp Bot 61: 1839-1851 Google Scholar: Author Only Title Only Author and Title Zhang L, Zhao YL, Gao LF, Zhao GY, Zhou RH, Zhang BS, Jia JZ (2012) TaCKX6-D1, the ortholog of rice OsCKX2, is associated with grain weight in hexaploid wheat. New Phytol 195: 574-584 Google Scholar: Author Only Title Only Author and Title Zhang W, Peng KX, Cui FB, Wang DL, Zhao JZ, Zhang YJ, Yu NN, Wang YY, Zeng DL, Wang YH, Cheng ZK, Zhang KW (2020) Cytokinin oxidase/dehydrogenase OsCKX11 coordinates source and sink relationship in rice by simultaneous regulation of leaf senescence and grain number. Plant Biotechnology Journal Google Scholar: Author Only Title Only Author and Title Zhao Y, Hu Y, Dai M, Huang L, Zhou DX (2009) The WUSCHEL-related homeobox gene WOX11 is required to activate shoot-borne crown root development in rice. Plant Cell 21: 736-748 Google Scholar: Author Only Title Only Author and Title Zou J, Chen Z, Zhang S, Zhang W, Jiang G, Zhao X, Zhai W, Pan X, Zhu L (2005) Characterizations and fine mapping of a mutant gene for high tillering and dwarf in rice (Oryza sativa L.). Planta 222: 604-612 Google Scholar: Author Only Title Only Author and Title