YOURS TRULY the Postscript Anthology
Total Page:16
File Type:pdf, Size:1020Kb

Load more
Recommended publications
-
Excesss Karaoke Master by Artist
XS Master by ARTIST Artist Song Title Artist Song Title (hed) Planet Earth Bartender TOOTIMETOOTIMETOOTIM ? & The Mysterians 96 Tears E 10 Years Beautiful UGH! Wasteland 1999 Man United Squad Lift It High (All About 10,000 Maniacs Candy Everybody Wants Belief) More Than This 2 Chainz Bigger Than You (feat. Drake & Quavo) [clean] Trouble Me I'm Different 100 Proof Aged In Soul Somebody's Been Sleeping I'm Different (explicit) 10cc Donna 2 Chainz & Chris Brown Countdown Dreadlock Holiday 2 Chainz & Kendrick Fuckin' Problems I'm Mandy Fly Me Lamar I'm Not In Love 2 Chainz & Pharrell Feds Watching (explicit) Rubber Bullets 2 Chainz feat Drake No Lie (explicit) Things We Do For Love, 2 Chainz feat Kanye West Birthday Song (explicit) The 2 Evisa Oh La La La Wall Street Shuffle 2 Live Crew Do Wah Diddy Diddy 112 Dance With Me Me So Horny It's Over Now We Want Some Pussy Peaches & Cream 2 Pac California Love U Already Know Changes 112 feat Mase Puff Daddy Only You & Notorious B.I.G. Dear Mama 12 Gauge Dunkie Butt I Get Around 12 Stones We Are One Thugz Mansion 1910 Fruitgum Co. Simon Says Until The End Of Time 1975, The Chocolate 2 Pistols & Ray J You Know Me City, The 2 Pistols & T-Pain & Tay She Got It Dizm Girls (clean) 2 Unlimited No Limits If You're Too Shy (Let Me Know) 20 Fingers Short Dick Man If You're Too Shy (Let Me 21 Savage & Offset &Metro Ghostface Killers Know) Boomin & Travis Scott It's Not Living (If It's Not 21st Century Girls 21st Century Girls With You 2am Club Too Fucked Up To Call It's Not Living (If It's Not 2AM Club Not -
Begleitheft Heinz Von Hermann
Begleitheft zu „Standard Time” The Great American Songbook und seine Bedeutung im Jazz von Heinz von Hermann © Kurzes Vorwort: Mehrere Gründe haben mich veranlasst zu diesem Konzert/Workshop dieses kleine Begleitheft zu verfassen. Zum einen gibt es über das „Great American Songbook” (GAS) so viel zu erzählen, dass dies den Rahmen eines einzelnen Konzertes sprengen würde, wir kämen ja gar nicht mehr dazu auch Musik zu spielen. Allein über George Gershwin gibt es schon so viele Bücher, für Harold Arlen oder Cole Porter gilt Gleiches. Ursprünglich waren für „Standard Time” ja eine Anzahl von Konzerten geplant, aber um dieses Projekt zum Laufen zu bringen war es einfach nötig, erst einmal eine Art komprimiertes Pilotprojekt zu starten. Gleiches gilt natürlich auch für die Musik. Vom Œvre Harold Arlens oder George Gershwins allein ließen sich ja allein eine Unzahl von Konzerten bestreiten. In Folge dieser Kompression musste ich natürlich den Umfang der Textbeiträge wie leider auch die Musikbeiträge deutlich beschränken. Dieses Heftchen gibt mir damit die Möglichkeit die historischen und biografischen Zusammenhänge etwas ausführlicher zu behandeln als ich das verbal während des Konzerts machen könnte. Zum Anderen mag es für Sie als Konzert-/Workshopbesucher ja auch interessant sein, die von mir erzählten Geschichten später noch einmal nachlesen zu können. Was ist das „Great American Songbook” ? Als „Great American Songbook” (GAS) wird meist eine nicht genau festgelegte Anzahl herausragender Songs der amerikanischen Popularmusik bezeichnet, meistens aus der Zeit von den 1920er bis 1960er Jahren stammend. Sie sind Teil des stilistisch und zeitlich weiter ausgelegten „Classic Pop” oder „Traditional Pop” (für den die Grammy Awards vergeben werden), also vor der „Rock and Roll Aera”. -
Songs by Artist
Reil Entertainment Songs by Artist Karaoke by Artist Title Title &, Caitlin Will 12 Gauge Address In The Stars Dunkie Butt 10 Cc 12 Stones Donna We Are One Dreadlock Holiday 19 Somethin' Im Mandy Fly Me Mark Wills I'm Not In Love 1910 Fruitgum Co Rubber Bullets 1, 2, 3 Redlight Things We Do For Love Simon Says Wall Street Shuffle 1910 Fruitgum Co. 10 Years 1,2,3 Redlight Through The Iris Simon Says Wasteland 1975 10, 000 Maniacs Chocolate These Are The Days City 10,000 Maniacs Love Me Because Of The Night Sex... Because The Night Sex.... More Than This Sound These Are The Days The Sound Trouble Me UGH! 10,000 Maniacs Wvocal 1975, The Because The Night Chocolate 100 Proof Aged In Soul Sex Somebody's Been Sleeping The City 10Cc 1Barenaked Ladies Dreadlock Holiday Be My Yoko Ono I'm Not In Love Brian Wilson (2000 Version) We Do For Love Call And Answer 11) Enid OS Get In Line (Duet Version) 112 Get In Line (Solo Version) Come See Me It's All Been Done Cupid Jane Dance With Me Never Is Enough It's Over Now Old Apartment, The Only You One Week Peaches & Cream Shoe Box Peaches And Cream Straw Hat U Already Know What A Good Boy Song List Generator® Printed 11/21/2017 Page 1 of 486 Licensed to Greg Reil Reil Entertainment Songs by Artist Karaoke by Artist Title Title 1Barenaked Ladies 20 Fingers When I Fall Short Dick Man 1Beatles, The 2AM Club Come Together Not Your Boyfriend Day Tripper 2Pac Good Day Sunshine California Love (Original Version) Help! 3 Degrees I Saw Her Standing There When Will I See You Again Love Me Do Woman In Love Nowhere Man 3 Dog Night P.S. -
Lemonade Lyrics – Internet Money, Gunna & Don Toliver
Lemonade Lyrics – Internet Money, Gunna & Don Toliver | FunMeLoud Lemonade Lyrics : Internet Money, Gunna & Don Toliver : Album : B4 The Storm, This single was first previewed by Internet Money founderTaz Taylor during a June 2020 Instagram live. Gunna then previewed a snippet of his verse later that month. Song : Lemonade Artist : Internet Money, Gunna & Don Toliver Featuring : NAV Produced by : Nick Mira, Alec Wigdahl, E-Trou, Taz Taylor & Pharaoh Vice Album : B4 The Storm Lemonade Lyrics [Pre-Chorus: Don Toliver] Xanny bars, suicide door, brand new bag College girls give a nigga head in my Rafs Rockstar life, so much money it’ll make you laugh, hey These bitches, they hate, and you can’t miss what you never had, hey, hey [Chorus: Don Toliver] Off the juice (Juice), codeine got me trippin’ (Juice) Copped the coupe (Coupe), woke up, roof is missin’ (Yeah) Ice (Ice), lemonade, my neck was drippin’ Ice (Ice), lemonade, my neck was drippin’ [Verse 1: NAV] Addy boys, got some sixties in my bag (Yeah) Lips sealed, ain’t pillow talkin’, I’m no rat (No) In my earlobe, got two karats, VVS (Bling) Got a penthouse near Rodeo off of stress (Stress) All this money, when I grew up, I had nothing (Nothing) Filled with backstabbers, my old life was disgusting (Disgusting) Can’t believe it, gotta thank God that I’m livin’ comfortably (Thank God) Gettin’ checks, I don’t believe her, she say she done with me Burned some bridges and I let the fire light the way (Oh-woah) Kickin’ my feet up, left the PJ’s on a PJ (PJ) Yeah, I’m a big dawg, and I walk around -
Acme: a User Interface for Programmers Rob Pike [email protected]−Labs.Com
Acme: A User Interface for Programmers Rob Pike [email protected]−labs.com ABSTRACT A hybrid of window system, shell, and editor, Acme gives text-oriented applications a clean, expressive, and consistent style of interaction. Tradi tional window systems support interactive client programs and offer libraries of pre-defined operations such as pop-up menus and buttons to promote a consistent user interface among the clients. Acme instead pro vides its clients with a fixed user interface and simple conventions to encourage its uniform use. Clients access the facilities of Acme through a file system interface; Acme is in part a file server that exports device-like files that may be manipulated to access and control the contents of its win dows. Written in a concurrent programming language, Acme is structured as a set of communicating processes that neatly subdivide the various aspects of its tasks: display management, input, file server, and so on. Acme attaches distinct functions to the three mouse buttons: the left selects text; the middle executes textual commands; and the right com bines context search and file opening functions to integrate the various applications and files in the system. Acme works well enough to have developed a community that uses it exclusively. Although Acme discourages the traditional style of interaction based on typescript windowsߞteletypesߞits users find Acmeߣs other ser vices render typescripts obsolete. History and motivation The usual typescript style of interaction with Unix and its relatives is an old one. The typescriptߞan intermingling of textual commands and their outputߞoriginates with the scrolls of paper on teletypes. -
Artist Song Title N/A Swedish National Anthem 411 Dumb 702 I Still Love
Artist Song Title N/A Swedish National Anthem 411 Dumb 702 I Still Love You 911 A Little Bit More 911 All I Want Is You 911 How Do You Want Me To Love You 911 Party People (Friday Night) 911 Private Number 911 The Journey 911 More Than A Woman 1927 Compulsory Hero 1927 If I Could 1927 That's When I Think Of You Ariana Grande Dangerous Woman "Weird Al" Yankovic Ebay "Weird Al" Yankovic Men In Brown "Weird Al" Yankovic Eat It "Weird Al" Yankovic White & Nerdy *NSYNC Bye Bye Bye *NSYNC (God Must Have Spent) A Little More Time On You *NSYNC I'll Never Stop *NSYNC It's Gonna Be Me *NSYNC No Strings Attached *NSYNC Pop *NSYNC Tearin' Up My Heart *NSYNC That's When I'll Stop Loving You *NSYNC This I Promise You *NSYNC You Drive Me Crazy *NSYNC I Want You Back *NSYNC Feat. Nelly Girlfriend £1 Fish Man One Pound Fish 101 Dalmations Cruella DeVil 10cc Donna 10cc Dreadlock Holiday 10cc I'm Mandy 10cc I'm Not In Love 10cc Rubber Bullets 10cc The Things We Do For Love 10cc Wall Street Shuffle 10cc Don't Turn Me Away 10cc Feel The Love 10cc Food For Thought 10cc Good Morning Judge 10cc Life Is A Minestrone 10cc One Two Five 10cc People In Love 10cc Silly Love 10cc Woman In Love 1910 Fruitgum Co. Simon Says 1999 Man United Squad Lift It High (All About Belief) 2 Evisa Oh La La La 2 Pac Feat. Dr. Dre California Love 2 Unlimited No Limit 21st Century Girls 21st Century Girls 2nd Baptist Church (Lauren James Camey) Rise Up 2Pac Dear Mama 2Pac Changes 2Pac & Notorious B.I.G. -
Tiny Tools Gerard J
Tiny Tools Gerard J. Holzmann Jet Propulsion Laboratory, California Institute of Technology Many programmers like the convenience of integrated development environments (IDEs) when developing code. The best examples are Microsoft’s Visual Studio for Windows and Eclipse for Unix-like systems, which have both been around for many years. You get all the features you need to build and debug software, and lots of other things that you will probably never realize are also there. You can use all these features without having to know very much about what goes on behind the screen. And there’s the rub. If you’re like me, you want to know precisely what goes on behind the screen, and you want to be able to control every bit of it. The IDEs can sometimes feel as if they are taking over every last corner of your computer, leaving you wondering how much bigger your machine would have to be to make things run a little more smoothly. So what follows is for those of us who don’t use IDEs. It’s for the bare metal programmers, who prefer to write code using their own screen editor, and who do everything else with command-line tools. There are no real conveniences that you need to give up to work this way, but what you gain is a better understanding your development environment, and the control to change, extend, or improve it whenever you find better ways to do things. Bare Metal Programming Many developers who write embedded software work in precisely this way. -
Sequence Alignment/Map Format Specification
Sequence Alignment/Map Format Specification The SAM/BAM Format Specification Working Group 3 Jun 2021 The master version of this document can be found at https://github.com/samtools/hts-specs. This printing is version 53752fa from that repository, last modified on the date shown above. 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text format consisting of a header section, which is optional, and an alignment section. If present, the header must be prior to the alignments. Header lines start with `@', while alignment lines do not. Each alignment line has 11 mandatory fields for essential alignment information such as mapping position, and variable number of optional fields for flexible or aligner specific information. This specification is for version 1.6 of the SAM and BAM formats. Each SAM and BAMfilemay optionally specify the version being used via the @HD VN tag. For full version history see Appendix B. Unless explicitly specified elsewhere, all fields are encoded using 7-bit US-ASCII 1 in using the POSIX / C locale. Regular expressions listed use the POSIX / IEEE Std 1003.1 extended syntax. 1.1 An example Suppose we have the following alignment with bases in lowercase clipped from the alignment. Read r001/1 and r001/2 constitute a read pair; r003 is a chimeric read; r004 represents a split alignment. Coor 12345678901234 5678901234567890123456789012345 ref AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT +r001/1 TTAGATAAAGGATA*CTG +r002 aaaAGATAA*GGATA +r003 gcctaAGCTAA +r004 ATAGCT..............TCAGC -r003 ttagctTAGGC -r001/2 CAGCGGCAT The corresponding SAM format is:2 1Charset ANSI X3.4-1968 as defined in RFC1345. -
Indian Horse
Contents 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | 22 | 23 | 24 | 25 | 26 | 27 | 28 | 29 | 30 | 31 | 32 | 33 | 34 | 35 | 36 | 37 | 38 | 39 | 40 | 41 | 42 | 43 | 44 | 45 | 46 | 47 | 48 | 49 | 50 | 51 | 52 | 53 | 54 | 55 | 56 Acknowledgements | Copyright For my wife, Debra Powell, for allowing me to bask in her light and become more. I come into the peace of wild things who do not tax their lives with forethought of grief. I come into the presence of still water. And I feel above me the day-blind stars waiting with their light. For a time I rest in the grace of the world, and am free. WENDELL BERRY, “The Peace of Wild Things” 1 My name is Saul Indian Horse. I am the son of Mary Mandamin and John Indian Horse. My grandfather was called Solomon so my name is the diminutive of his. My people are from the Fish Clan of the northern Ojibway, the Anishinabeg, we call ourselves. We made our home in the territories along the Winnipeg River, where the river opens wide before crossing into Manitoba after it leaves Lake of the Woods and the rugged spine of northern Ontario. They say that our cheekbones are cut from those granite ridges that rise above our homeland. They say that the deep brown of our eyes seeped out of the fecund earth that surrounds the lakes and marshes. The Old Ones say that our long straight hair comes from the waving grasses that thatch the edges of bays. -
Song Catalogue February 2020 Artist Title 2 States Mast Magan 2 States Locha E Ulfat 2 Unlimited No Limit 2Pac Dear Mama 2Pac Changes 2Pac & Notorious B.I.G
Song Catalogue February 2020 Artist Title 2 States Mast Magan 2 States Locha_E_Ulfat 2 Unlimited No Limit 2Pac Dear Mama 2Pac Changes 2Pac & Notorious B.I.G. Runnin' (Trying To Live) 2Pac Feat. Dr. Dre California Love 3 Doors Down Kryptonite 3Oh!3 Feat. Katy Perry Starstrukk 3T Anything 4 Non Blondes What's Up 5 Seconds of Summer Youngblood 5 Seconds of Summer She's Kinda Hot 5 Seconds of Summer She Looks So Perfect 5 Seconds of Summer Hey Everybody 5 Seconds of Summer Good Girls 5 Seconds of Summer Girls Talk Boys 5 Seconds of Summer Don't Stop 5 Seconds of Summer Amnesia 5 Seconds of Summer (Feat. Julia Michaels) Lie to Me 5ive When The Lights Go Out 5ive We Will Rock You 5ive Let's Dance 5ive Keep On Movin' 5ive If Ya Getting Down 5ive Got The Feelin' 5ive Everybody Get Up 6LACK Feat. J Cole Pretty Little Fears 7Б Молодые ветра 10cc The Things We Do For Love 10cc Rubber Bullets 10cc I'm Not In Love 10cc I'm Mandy Fly Me 10cc Dreadlock Holiday 10cc Donna 30 Seconds To Mars The Kill 30 Seconds To Mars Rescue Me 30 Seconds To Mars Kings And Queens 30 Seconds To Mars From Yesterday 50 Cent Just A Lil Bit 50 Cent In Da Club 50 Cent Candy Shop 50 Cent Feat. Eminem & Adam Levine My Life 50 Cent Feat. Snoop Dogg and Young Jeezy Major Distribution 101 Dalmatians (Disney) Cruella De Vil 883 Nord Sud Ovest Est 911 A Little Bit More 1910 Fruitgum Company Simon Says 1927 If I Could "Weird Al" Yankovic Men In Brown "Weird Al" Yankovic Ebay "Weird Al" Yankovic Canadian Idiot A Bugs Life The Time Of Your Life A Chorus Line (Musical) What I Did For Love A Chorus Line (Musical) One A Chorus Line (Musical) Nothing A Goofy Movie After Today A Great Big World Feat. -
EPIC Dance Company Overall Studio C
Lancaster PA Regional Competition Mar 15-17, 2019 Studio Awards Winner of the Groove Award: EPIC Dance Company Overall Studio Technique Award: EPIC Dance Company Overall Studio Choreography Award: The Tate Academy Professionalism Award: Dance Dynamix ADCC Studio of Excellence Award: Lanzi Academy of Dance Inspired by Passion: Horizons Dance Conservatory Overalls Novice Mini Solo Place Entry Title Studio 1 Emperors New Clothes Adrenaline Dance Factory Intermediate Mini Solo Place Entry Title Studio 1 Slow Down Horizons Dance Conservatory Novice Mini Duo/Trio Place Entry Title Studio 1 Candy Cuties Lanzi Academy of Dance Intermediate Mini Duo/Trio Place Entry Title Studio 1 Baseball Babes Lanzi Academy of Dance Competitive Mini Duo/Trio Place Entry Title Studio 1 Route 66 Oxford Center for Dance Novice Mini Small Group Place Entry Title Studio 1 Rockin Robin Dance Dynamix Intermediate Mini Small Group Place Entry Title Studio 1 Going Bananas Oxford Center for Dance Competitive Mini Small Group Place Entry Title Studio 1 Im Gonna Wash That Man Out of My Hair Oxford Center for Dance Novice Petite Solo Place Entry Title Studio 1 A Dream is a Wish Dance Dynamix Intermediate Petite Solo Place Entry Title Studio Lancaster PA Regional Competition Mar 15-17, 2019 1 Satans Little Lamb Lanzi Academy of Dance 2 Shes gonna Shine Lanzi Academy of Dance 3 Little Bird Lanzi Academy of Dance 4 Lil Missy Adrenaline Dance Factory 5 Lovely The Tate Academy Competitive Petite Solo Place Entry Title Studio 1 Hallelujah Lanzi Academy of Dance 2 Unbroken Lanzi -
Marxman Mary Jane Girls Mary Mary Carolyne Mas
Key - $ = US Number One (1959-date), ✮ UK Million Seller, ➜ Still in Top 75 at this time. A line in red 12 Dec 98 Take Me There (Blackstreet & Mya featuring Mase & Blinky Blink) 7 9 indicates a Number 1, a line in blue indicate a Top 10 hit. 10 Jul 99 Get Ready 32 4 20 Nov 04 Welcome Back/Breathe Stretch Shake 29 2 MARXMAN Total Hits : 8 Total Weeks : 45 Anglo-Irish male rap/vocal/DJ group - Stephen Brown, Hollis Byrne, Oisin Lunny and DJ K One 06 Mar 93 All About Eve 28 4 MASH American male session vocal group - John Bahler, Tom Bahler, Ian Freebairn-Smith and Ron Hicklin 01 May 93 Ship Ahoy 64 1 10 May 80 Theme From M*A*S*H (Suicide Is Painless) 1 12 Total Hits : 2 Total Weeks : 5 Total Hits : 1 Total Weeks : 12 MARY JANE GIRLS American female vocal group, protégées of Rick James, made up of Cheryl Ann Bailey, Candice Ghant, MASH! Joanne McDuffie, Yvette Marine & Kimberley Wuletich although McDuffie was the only singer who Anglo-American male/female vocal group appeared on the records 21 May 94 U Don't Have To Say U Love Me 37 2 21 May 83 Candy Man 60 4 04 Feb 95 Let's Spend The Night Together 66 1 25 Jun 83 All Night Long 13 9 Total Hits : 2 Total Weeks : 3 08 Oct 83 Boys 74 1 18 Feb 95 All Night Long (Remix) 51 1 MASON Dutch male DJ/producer Iason Chronis, born 17/1/80 Total Hits : 4 Total Weeks : 15 27 Jan 07 Perfect (Exceeder) (Mason vs Princess Superstar) 3 16 MARY MARY Total Hits : 1 Total Weeks : 16 American female vocal duo - sisters Erica (born 29/4/72) & Trecina (born 1/5/74) Atkins-Campbell 10 Jun 00 Shackles (Praise You)