Biochemistry and Cell Biology
Role of syndecan-1 and exogenous heparin in hepatoma sphere formation
Journal: Biochemistry and Cell Biology
Manuscript ID bcb-2018-0246.R1
Manuscript Type: Article
Date Submitted by the 29-Mar-2019 Author:
Complete List of Authors: Lin, Shih-Chiang; Far Eastern Memorial Hospital Wu, Ching-Po; Fu Jen Catholic University, School of Medicine Tseng, TingTing; FuJen Catholic University, School of Medicine Jhang, Yaoyun; Fu Jen Catholic University, School of Medicine Lee, ShaoChen;Draft Fu Jen Catholic University, School of Medicine Glycosaminoglycans, cancer stem-like cells, disaccharide composition Keyword: analysis, Syndecan-1, CD13
Is the invited manuscript for consideration in a Special Not applicable (regular submission) Issue? :
https://mc06.manuscriptcentral.com/bcb-pubs Page 1 of 31 Biochemistry and Cell Biology
1 Role of syndecan-1 and exogenous heparin in hepatoma sphere formation
2 Shih-Chiang Lin1, Ching-Po Wu2, TingTing Tseng2, Yaoyun Jhang2, and ShaoChen Lee2
3 1Far Eastern Memorial Hospital, Banciao Dist., New Taipei City
4 2School of Medicine, FuJen Catholic University, Xinzhuang Dist., New Taipei City,
5 Taiwan;
6
7 Correspondence to: Shao-Chen Lee, School of Medicine, FuJen Catholic University,
8 Xinzhuang, New Taipei City 242 Taiwan. Tel: +886-2-29053961; Fax: +886-2-29052096;
9 E-mail: [email protected] Draft 10
11 Abstract
12 Glycosaminoglycan-modified proteoglycans played important roles in many cell
13 activities, including cell differentiation and stem cell development. Tumor sphere formation
14 ability is one of properties in cancer stem cells (CSCs). The correlation between CSC marker
15 and proteoglycan remained to be clarified.
16 Upon hepatoma sphere formation, expression of CSC marker CD13, CD90, CD133, and
17 CD44, as well the syndecan family protein syndecan-1 (SDC1), were increased as analyzed
18 by PCR. Further examination by suppression of CD13 expression showed downregulation
19 of SDC1 and CD44 gene expression, while suppression of SDC1 gene expression
20 downregulated CD13 and CD44 gene expression. Suppression of SDC1 gene expression also
1
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 2 of 31
1 suppressed sphere development, as analyzed by a novel “sphereocrit assay” to quantify the
2 level of sphere formation. The heparin disaccharide components, but not those of chondroitin
3 disaccharide, changed with hepatoma sphere development revealing the increased levels of
4 N-sulfation and 2-O-sulfation. These explained the inhibition of hepatoma sphere formation
5 by exogenous heparin.
6 In conclusion, we found that SDC1 affected CSC marker CD13 and CD44 expression.
7 SDC1 proteoglycan and heparin components changed and affected hepatoma sphere
8 development. Application of heparin mimics in reduction of hepatoma stem cells might be
9 potential. Draft
10
11 Keywords
12 Glycosaminoglycans, cancer stem-like cells, heparan sulfate proteoglycans, disaccharide
13 composition analysis
14
15 Abbreviations
16 CSC, cancer stem cells; GAGs, glycosaminoglycans; HS, heparan sulfate; HSPG, heparin
17 sulfate proteoglycan; CS, chondroitin sulfate; SDC1, syndecan-1.
18
19
2
https://mc06.manuscriptcentral.com/bcb-pubs Page 3 of 31 Biochemistry and Cell Biology
1 Introduction
2 Hepatocellular carcinoma is primary liver malignancy with low prognosis and high
3 reoccurrence. It was accepted that the presence of cancer stem cells (CSCs) made tumor
4 difficult to be detected and be eradicated (Frank et al. 2010; Shackleton et al. 2009). It was
5 reported that subpopulations of sphere-forming hepatoma cells contained CSC properties,
6 such as low-proliferation or dormant feature (increased G0/G1 phase), enhanced
7 chemoresistance, capable to form xenograft tumor with small number of cells, and
8 overexpression of CSC markers (Cao et al. 2011; Uchida et al. 2010). However, detection
9 and identification of CSC markers Draftin liver cancer stem cells remained to be controversial. It
10 is likely that some CSCs need the appropriate microenvironment to provide the stimuli for
11 uncontrolled self-renewal. The interaction of CSCs with their microenvironment or
12 acceptance of extracellular stimulus will be of great importance to modulate their activities.
13 Proteoglycans are major components of extracellular matrix and participate in several
14 biological processes, such as cell proliferation, differentiation, adhesion, migration,
15 apoptosis, angiogenesis, and tumor metastasis. The oligosaccharide components modified
16 on proteoglycans are called glycosaminoglycans (GAGs). They are highly negative-charged
17 and heterogeneous in their chemical structures. Many literatures had reported that two major
18 GAGs, heparan sulfate (HS) or chondroitin sulfate (CS) and the constituting proteoglycans
19 might regulate self-renewal and pluripotency of embryonic stem cells or cancer stem cells
3
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 4 of 31
1 through intracellular signaling, and the GAG patterns would change upon stem cell
2 differentiation (Chen et al. 2016; Kraushaar et al. 2015; Oikari et al. 2016; Okolicsanyi et al.
3 2018; Papy-Garcia and Albanese 2017; Wang and Yang 2017).
4 In this study, we investigated the roles of SDC1 proteoglycan on CSC marker expression,
5 sphere formation, and effect of exogenous GAG addition in inhibition of hepatoma sphere
6 formation.
7
8 Material and methods
9 Cell culture and plasmid transfectionDraft
10 Hepatoma Huh-7 and HepG2 cells are maintained in culture dish (Corning Incorporated
11 Life Sciences, Glendale, Arizona, USA) supplemented with DMEM medium containing 10
12 (v/v) % fetal bovine serum (FBS; Thermo Fisher Scientific Inc., Pittsburgh, PA, USA), 100
13 units/ml penicillin, and 100 g/ml streptomycin at 37 degree under 100% humidity.
14 The CD13-specific shRNAs (TRCN0000050238 and TRCN0000050239) or SDC1-
15 specific shRNAs (TRCN0000072580 and TRCN0000072582) were purchased from RNAi
16 core, Sinica, Taiwan. Plasmid transfection was done using Turbofect transfection reagent
17 (Thermo Fisher Scientific Inc., Pittsburgh, PA, USA) according to the manufacturer’s
18 instruction. Transfected cells were selected and enriched under growth medium with 0.5
19 μg/ml puromycin.
4
https://mc06.manuscriptcentral.com/bcb-pubs Page 5 of 31 Biochemistry and Cell Biology
1
2 Sphere formation and quantification by spherocrit assay
3 For sphere formation, 1 x 105 hepatoma cells were seeded in 10-cm sterile plastic dish
4 (Alpha-plus, Inc., TaoYuan, Taiwan) supplemented with 10 mL culture medium. The cell
5 sphere were formed and enlarged for 1 or 2 weeks with medium renewal every 2-3 days.
6 The cell spheres (rigid-packed cells) or cell aggregates (loose-packed cells) were
7 collected with conditioned medium into 15-mL tube. The cell spheres/aggregates were
8 sedimented by gravity for 10 min, and the upper medium was removed with 1.5 mL medium
9 left. The sedimented cells were pipettedDraft 5 times with 1-mL pipetman to disrupt loose-packed
10 cell aggregates. The cell suspension was sedimented again, while rigid-packed cells (spheres)
11 were fast-precipitated in 3-mins and were collected into a Pasteur pipette (VWR
12 international, USA) as constituted in Figure 3C. Cell spheres were drawn into the capillary
13 tube using a pipetman and a tip connected with a silicon tube. The sphere column was
14 bottom-sealed using a silicon-tube connected stopper composed of a cut plastic toothstick
15 and a short silicon tube. The vertically precipitated spheres were photographed and the
16 lengths of sphere columns were measured accordingly.
17
18 PCR
5
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 6 of 31
1 The levels of mRNA in hepatoma cells were analyzed by PCR or qPCR. The total RNA
2 was extracted from ~ 1 x 106 cells using Trizol reagent (Thermo Fisher Scientific Inc.,
3 Pittsburgh, PA, USA). The cDNAs were synthesized by MMLV HP reverse transcriptase
4 (Epicentre, Madison, WI, USA) and random primer using freshly prepared RNA (1 μg) as
5 template. The samples were incubated as following procedure: 70 degree to denature DNA
6 for 10 min, 42 degree to perform reverse transcription for 1 hr, and 95 degree to inactivate
7 reverse transcriptase for 5 min. The PCR was then done using 2X SuperRed PCR Master
8 Mix (BioTools Biotech Inc., XiZhi, NewTaipei City, Taiwan), freshly prepared cDNA pools,
9 and specific primers. PCR reactionsDraft were carried out with the following parameters: one
10 cycle at 95 degree for 5 min; 30 cycles at 95 degree for 30 sec, 55 degree for 30 sec, 72
11 degree for 30 sec; and a final elongation step at 72 degree for 5 min. The gene expression
12 levels were quantified at each PCR bands using ImageJ 1.51J8(Schneider et al. 2012).
13 Quantitative real-time PCR were performed using VeriQuest Fast SYBR green qPCR
14 reagent (Affymetrix Inc., Santa Clara, CA, USA) in a StepOne Plus real-time PCR system
15 (Thermo Fisher Scientific Inc., Pittsburgh, PA, USA). The 2-CT method was used to
16 determine the relative gene expression using GAPDH as control. The p-value of < 0.05 or <
17 0.01 was statistically significant and was indicated in each figures.
18 The forward and reverse primers used in this study were: CD13, gccgtgtgca
19 caatcatcgcact and caccagggagcccttgaggtg; CD90, cccagtgaagatgcaggttt and
6
https://mc06.manuscriptcentral.com/bcb-pubs Page 7 of 31 Biochemistry and Cell Biology
1 gacagcctgagagggtcttg; CD133, tctctatgtggtacagccg and tgatccgggttcttacctg; CD44,
2 tccaaaggttttccatcctg and agggccagcctctatgaaat; CD24, tccaaggcacccagcatcctgctaga and
3 tagaagacgtttcttggcctgagtct; ABCG2, ggaactcagtttatccgtgg and cgaggctgat gaatggagaag;
4 EpCAM, ctccacgtgctggtgtgt and tgttttagttcaatgatgatccagta; SDC1, gctctggggatgactctgac and
5 gtattctcccccgaggtttc; SDC2, ccagccgaagaggatacaaa and gcgttctccaaggtcatagc; SDC4,
6 gtctggctctggagatctgg and tgggggctttcttgtagatg; EXT1, atcgccgaaagttaccaaaaca and
7 catactgaggtgacaactggtc; GAPDH, gagtcaacggatttggtcgt and gatctcgctcctggaagatg;.
8 9 Western blot and antibodies Draft 10 To harvest cell lysate for western blot analysis, cells were washed and disrupted by lysis
11 buffer (10 mM Tris-HCl, 5 mM EDTA, pH 8.0, 1% TritonX-100, and protease inhibitors) and
12 kept on ice for 30 min. The lysate was then centrifuged at maximum speed using a desktop
13 centrifuge at 4oC for 10 min. Protein concentrations were quantified by protein assay kit (Bio-
14 Rad Laboratories Inc., Hercules, California, USA). For characterization of SDC1 protein, a
15 pretreatment to remove glycosaminoglycan chain by digestion enzymes (all purchased from
16 Sigma-Aldrich China, Inc., Shanghai, PR China) was done. 50 μg cell lysate was pretreated
17 with 0.83 mIU heparinase I, 0.83 mIU heparinase II, 0.83 mIU heparinase III, and 0.83 mIU
18 chondroitinase in 200 uL reaction buffer (20 mM Tris-HCl, pH 7.5, 4 mM CaCl2, and 0.1 %
19 (w/v) BSA) at 37 oC for 16 hr. The proteins were precipitated by trichloroacetic acid and
20 solubilized by solubilizing solution (10 mM Tris-HCl, pH8.0, 5 mM EDTA, and 2 M urea) 7
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 8 of 31
1 then subjected to SDS-PAGE.
2 Western blot was performed according to standard protocol. Briefly, protein mixture was
3 subjected to SDS-PAGE and transferred onto a PVDF membrane followed by blocking with
4 5% (w/v) skim-milk. The membrane was then incubated in primary antibodies (1:1000 in 5%
5 skim-milk in TBST) for 2 hr at room temperature, and HRP-conjugated secondary antibody
6 (1:20000) for 1 hr at room temperature followed by enhance chemiluminescent (Millipore
7 Co., Massachusetts, USA) detection.
8 The monoclonal antibody against CD13 protein (clone 3D8) was purchased from Santa
9 Cruz Biotechnology, Inc., Dallas, TX,Draft USA. The monoclonal antibody against SDC1 (B-A38)
10 was purchased from Novus Biologicals LLC., Littleton, CO, USA. The primary antibody
11 against CD44 was purchased from Abgent, Inc. San Diego, California, USA. The primary
12 antibodies against CD44 and β-actin were purchased from GeneTex Inc., Hsinchu, Taiwan.
13
14 Isolation, labeling and identification of glycosaminoglycan disaccharides from culture cells
15 The hepatoma cells in either adherent culture or sphere culture were harvested and
16 washed by PBS twice. The cells were disrupted and the membrane proteins were extracted
17 by lysis buffer of 2 %(w/v) TritonX-100 in PBS and incubated at for 1 hr 4 oC. The mixtures
18 were then centrifuged and the supernatant were then digested sequentially by mixture of 0.2
19 mg/mL DNaseI, 0.2 mg/mL RNase A, and 0.1 mg/mL pronase for 1 hr at 37 oC. After
8
https://mc06.manuscriptcentral.com/bcb-pubs Page 9 of 31 Biochemistry and Cell Biology
1 centrifugation at 14,000xg, the glycosaminoglycans in the solution were then precipitated
2 by 1% (w/v) cetylpyridinium chloride for 1 hr at 37 oC. The pellet after centrifugation was
3 then dissolved at 0.5 M sodium acetate and re-precipitated by 100% cold ethanol. The sample
4 was then air-dryed and keep in -20 oC until use. The glycosaminoglycans concentration were
5 quantified by 1,9-dimethylmethylene assay (Barbosa et al. 2003).
6 The isolated glycosaminoglycans were digested by heparinase mixture or chondroitinase
7 ABC for following heparin disaccharide analysis of chondroitin disaccharide analysis,
8 respectively. Basically, 10 ng of glycosaminoglycan was dissolved in 200 uL digestion
9 solution of 20 mM Tris-HCl, pH7.5,Draft 4 mM CaCl2, 0.01% (w/v) BSA. After adding
10 heparinase mixture (0.5 mIU/mL of heparinase I, heparinase II, and heparinase III) or
11 chondroitinase ABC (0.5 mIU/mL), the reaction mixture was incubated overnight at 37 oC.
12 The reaction mixture was inactivated at 95 oC and then lyophilized.
13 The glycosaminoglycan disaccharides were reducing end-labelled by fluorophore 2-
14 aminoacridone according(Ambrosius et al. 2008). The lyophilized sample was dissolved by
15 20 uL ddH2O. 30 uL of 2-aminoacridone (10 mg/mL) and 10 uL of acetic acid were then
16 added and incubated for 20 min at room temperature. 20 uL of sodium cyanoborohydride
17 was then added and incubated overnight at room temperature.
18 For disaccharide composition analysis, 20 uL of labelled sample was injected into an
19 analytical Zorbax Eclipse XDB-C18 column (3.0x100mm; Angilent Technology Inc., Santa
9
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 10 of 31
1 Clara, CA, USA) on one Agilent 1100 HPLC system (Angilent Technology Inc., Santa Clara,
2 CA, USA) with fluorescence detector (425 nm excitation / 540 nm emission) was used. A
3 gradient elution was performed using a binary solvent system (solution A: 0.1 M ammonium
4 acetate, solution B: 100% methanol) with a profile of 0-10% solution B for 2 min and 10-
5 30% solution B.
6
7 Results
8 Change of gene expression for CSC markers and syndecan family proteins upon hepatoma
9 sphere development Draft
10 It was reported that hepatoma spheres had liver CSC properties (Cao et al. 2011). The
11 cancer cell spheres resembled the embryonic bodies of stem cells that represented cell
12 differentiation. It was shown that heparan sulfate proteoglycans (HSPGs) played roles in
13 several human stem cell lineages, were used as surface markers of CSCs, and heparin mimics
14 would be used to treat cancer cells.
15 It was demonstrated that CD13 was a marker for semiquiescent CSCs in human liver
16 cancer cell lines (Haraguchi et al. 2010). In order to investigate whether HSPGs were
17 associated with sphere formation, we performed PCR analysis on expressions of different
18 CSC markers or HSPGs at different stages of sphere development. The hepatoma spheres
19 from Huh7 or HepG2 cells were prepared and collected at 3, 7, and 12 days, respectively.
10
https://mc06.manuscriptcentral.com/bcb-pubs Page 11 of 31 Biochemistry and Cell Biology
1 Total RNAs were isolated from adherent hepatoma cells or spheres, and expressions of
2 various genes were characterized by PCR and quantified by ImageJ. As seen in Figure 1A,
3 upon hepatoma sphere development, the expressions of CD13, CD90, CD133, and CD44 in
4 Huh7 spheres were significantly increased, while those of CD24, ABCG2, and EpCAM
5 remained unchanged. We also analyzed syndecan family proteins and EXT1. EXT1 is
6 exostosin glycosyltransferase 1 responsible for chain extensions of glycosaminoglycans,
7 which had reported to be important in mouse embryonic stem cell differentiation (Holley et
8 al. 2011). Of all the syndecan family, only SDC1 changed with sphere development, while
9 syndecan-2 (SDC2) and syndecan-4Draft (SDC4), as well EXT1 gene, remained no change.
10 For HepG2 spheres, the expressions of CD13, CD90, and CD44 were significantly
11 increased. However, CD133 mRNA expression remained unchanged, and CD24, ABCG2,
12 and EpCAM mRNA expressions were slightly decreased. SDC1 level, but not SDC2 or
13 SDC4 level, was increased upon HepG2 sphere formation. These results suggested the
14 mRNA levels of CSC markers (CD13, CD90, and CD44) and HSPG (SDC1) were all
15 increased upon sphere formations.
16
17 Suppression of CD13 expression downregulated SDC1 and CD44 expression
18 In order to investigate the correlation of CD13 with other hepatoma CSC markers and
19 SDC1 during sphere formation, we suppressed CD13 expression by transfection of shRNAs
11
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 12 of 31
1 against CD13 gene. As seen in Figure 2A, CD13 expression were downregulated by CD13-
2 specific shRNA_a or _b. Since CD13-positive hepatoma cells exhibited quiescent/dormant
3 features that showed slower cell proliferation (Haraguchi et al. 2010), we examined the effect
4 of CD13 suppression on cell growth. As shown in Figure 2B, suppression of CD13
5 expression increased cell growth. Since we observed the change of CSC marker expression
6 and syndecan expression upon sphere formation, we examined the effect on CD13
7 suppression on these gene expression. As shown in Figure 2C, CD13 suppression reduced
8 SDC1 and CD44 mRNA expression as investigated by qPCR. The mRNA expression of
9 CD90, CD24, ABCG2, and EpCAMDraft remained unchanged by suppression of CD13
10 expression. For CD133, since two different shRNAs had opposite effects, we could not
11 conclude the effect of CD13 suppression at CD133 expression level. Thus, we performed
12 western blot analysis for the protein expression upon suppression of CD13 expression. As
13 seen in Figure 2D, reduced CD13 protein expression were achieved by CD13-specific
14 shRNAs. They also reduced the protein expression of SDC1 and CD44. CD133 protein
15 expression remained inconclusive. These results suggested CD13 expression level would
16 affect SDC1 and CD44 expressions.
17
18 Suppression of SDC1 expression upregulated CD133 and CD44 expression
19 The SDC1 expression changed with sphere development and might be downregulated
12
https://mc06.manuscriptcentral.com/bcb-pubs Page 13 of 31 Biochemistry and Cell Biology
1 by CD13 suppression. Since SDC1 was membrane-bound acceptor and involved in several
2 cellular pathways, we inversely examined whether SDC1 level would affect sphere
3 formation and regulate CSC marker expression. We reduced the levels of SDC1 by
4 transfection of SDC1-specific shRNAs. As seen in Figure 3A, SDC1 expression were
5 downregulated by SDC1-specific shRNA_a or _b. Upon suppression of SDC1 expression
6 by shRNAs, the cell proliferation was increased (Figure 3B), which suggested SDC1 may
7 involve in CD13-associated cell quiescence.
8 In further, we analyzed the effect of SDC1 suppression at hepatoma sphere
9 development. Here we design a novelDraft “spherocrit assay” to quantify the level of cell spheres.
10 The size and total number of cell spheres should be considered, so that the overall volume
11 occupied by cell sphere were measured. This idea is similar to conventional hematocrit assay,
12 for both the size and the number of erythrocytes precipitated will be used to calculate
13 hematocrit value. Hepatoma cells transfected with control vector shLacZ or SDC1-specific
14 shRNAs were seeded for sphere formation and cultured for 2 weeks. As described in
15 Material and Methods, cell spheres derived from transfected hepatoma cells were collected
16 into capillary tubes. The capillaries with cell spheres were photographed and the lengths of
17 sphere columns were measured. As seen in Figure 3C, SDC1-specific shRNA-transfected
18 hepatoma cells had shorter lengths sphere column than control. This implied SDC1
19 participated in sphere formation of hepatoma cells. In addition, upon suppression of SDC1
13
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 14 of 31
1 expression, CD13 mRNA level did not change (Figure 3D), while CD13 protein level were
2 reduced (Figure 3E). As checking the CSC markers, CD133, CD44, and CD90 were highly
3 upregulated by SDC1 suppression, however, the western blot analysis at CD44 showed
4 reduced CD44 protein expression (Figure 3E). The SDC1 level would not associated with
5 CD133 level. The mRNA levels of CD24, ABCG2, and EpCAM didn’t not changed by
6 SDC1 suppression. These results suggested SDC1 expression levels would also affected the
7 levels of CD13 and CD44, as well the sphere formation ability.
8
9 Change of heparin composition uponDraft hepatoma sphere development
10 Syndecan is the transmembrane protein acting as membrane acceptor of various protein
11 ligands through its glycosaminoglycan chains. Since SDC1 level affected hepatoma sphere
12 development, we suspected exogenous heparin might affect sphere formation. First, we
13 characterized whether heparin disaccharide composition were different between parental
14 hepatoma Huh7 cells or the derived cell spheres. The heparin disaccharides were prepared
15 from enzymatic digestion of oligosaccharide isolated from hepatoma cells and they were
16 characterized by HPLC. As seen in Figure 4A, various peaks corresponding to heparin
17 disaccharides was displayed. The first two peaks around 11~13 min corresponded to the
18 disaccharides with the structures of "UA2OS-[14]-GlcNS6OS" and "-UA-[14]-
19 GlcNS6OS", respectively. It was obviously the relative percentage of fully sulfated heparin
14
https://mc06.manuscriptcentral.com/bcb-pubs Page 15 of 31 Biochemistry and Cell Biology
1 disaccharide was elevated upon cell sphere formation, while N-sulfated/6-O-sulfated heparin
2 disaccharide was decreased. This suggested the increased 2-O-sulfation in Huh7 cell sphere.
3 The relative percentages of each displayed disaccharide were calculated and listed in Table
4 1. The overall pattern of sulfation was estimated and the change by cell sphere was shown.
5 Overally, the modification at amine of glucosamine was majorly N-sulfation (57~60 %). The
6 increased N-sulfation was compensated with decreased N-acetylation, which implied the
7 increased activity of N-deacetylase/N-sulfatase might be presented at Huh-7 cell sphere. On
8 the other side, the patterns of chondroitin sulfate disaccharide generated by chondroitinase
9 ABC were equivalent in parental hepatomaDraft Huh7 cells and the derived cell spheres. The only
10 change in heparan sulfate, but not chondroitin sulfate, suggested the importance in heparan
11 sulfate in cell sphere development.
12 Since the percentage of heparin disaccharide I-S in hepatoma sphere was higher than
13 parental hepatoma cells that implied increased sulfated disaccharide upon sphere formation,
14 we investigated whether exogenous heparin could interfere hepatoma sphere formation. As
15 seen in Figure 4C, addition of heparin (1 mg/mL) did inhibit sphere formation, while
16 addition of chondroitin sulfate A (1 mg/mL) enhanced sphere formation. Components of
17 chondroitin disaccharides were not changed upon sphere formation. The enhancement of
18 sphere formation by chondroitin sulfate A could be explained as the complexation of
19 exogenous ligands with chondroitin sulfate A, which contributed sphere development.
15
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 16 of 31
1 Discussion
2 The detection and identification of liver cancer stem cells were dependent on the
3 examination of specific marker expressions. These included CD133, CD90, CD44, EpCAM,
4 ABCG2, and CD13. CD133 was firstly recognized as important marker in hematopoietic
5 stem cells (Miraglia et al. 1997; Yin et al. 1997), and applied to different solid tumors
6 including hepatoma stem cells (Suetsugu et al. 2006). CD13 was demonstrated as a novel
7 surface marker in dormant CSCs of HCC (Haraguchi et al. 2010). CD13 was enriched in
8 side population in spite of the CD133 and CD90 presence from different hepatoma cells. The
9 drawback of these specific markerDraft applications in CSC identification is that one single
10 marker was not sufficient to be validated in different hepatoma cells. The clinical specimens
11 from hepatocellular carcinoma metastases suggested the markers might not be the single
12 prognostic markers (Salnikov et al. 2009). Sphere formation was used to enrich the stem
13 cells or CSCs in anchorage-independent condition. Several literature on hepatoma sphere
14 gave slightly different conclusion. Uchida et.al suggested the sphere formation of HepG2,
15 Hep3B, PLC/PRF/5 cells, but not in Huh-7 cells under general culture condition (Uchida et
16 al. 2010), however, we did success in generation of Huh-7 sphere in this study. In this study,
17 we also showed that CD44 expression would be positively-regulated by CD13 but
18 negatively-regulated by SDC1 (Figure 2C and 3D).
19 Many literatures had reported that heparan sulfate (HS) or chondroitin sulfate (CS)
16
https://mc06.manuscriptcentral.com/bcb-pubs Page 17 of 31 Biochemistry and Cell Biology
1 might regulate self-renewal and pluripotency of embryonic stem cells through different cell
2 signaling. The change in proteoglycan expression and GAG components might be of
3 importance in CSC activities and gains potential application. HS proteoglycan expression is
4 induced during early erythroid differentiation of multipotent hematopoietic stem cells
5 (Drzeniek et al. 1999). Neurosphere formation of human mesenchymal stem cells showed
6 distinctly localized HS proteoglycans and altered gene expression of HS proteoglycans
7 (Okolicsanyi et al. 2018). Differentiation of multipotent neural stem cells upregulated SDC4,
8 GPC1, GPC2, GPC3 and GPC6 expression that indicated the involvement of HS
9 proteoglycans in mediating maintenanceDraft and lineage differentiation of stem cells (Oikari et
10 al. 2016). RNA interference-mediated knockdown of HS chain elongation inhibited mouse
11 ES cell self-renewal and induced spontaneous differentiation of the cells into extraembryonic
12 endoderm (Sasaki et al. 2008). Recent paper showed that heparan sulfate hexasaccharide
13 selectively inhibited cancer stem cells self-renewal by activating p38 MAP kinase (Patel et
14 al. 2016). Another paper showed that exogenous HS enhanced TGF-beta3-induced
15 chondrogenic differentiation of human mesenchymal stem cells by activating TGF-
16 beta/Smad2/3 signaling(Chen et al. 2016).
17 Some papers described the specific roles of SDC1 involved in CSCs. SDC1 acts as a
18 novel tissue biomarker and a modulator of CSC phenotype of triple negative IBC via the IL-
19 6/STAT3, Notch and EGFR signaling pathways (Ibrahim et al. 2017; Ibrahim et al. 2013).
17
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 18 of 31
1 For prostate cancer, SDC1 was the key molecule to maintain the stability of tumor-initiating
2 cells in prostate cancer (Shimada et al. 2013). Selective expression of heparan sulfate (HS)
3 proteoglycans syndecan-1 and perlecan in the AG2 colon cancer-initiating cell line suggests
4 these PGs as potential biomarkers for cancer stem cells(Suhovskih et al. 2015). In this paper,
5 we showed the change of SDC1 expression upon hepatoma sphere development (Figure 1)
6 and its suppression reduced sphere formation (Figure 3C).
7 Exogenous treatment of glycosaminoglycans would be potential in regulating activities
8 of stem cells or CSCs. Heparin sulfate saccharides might effect at hematopoietic
9 differentiation of mouse embryonicDraft stem cells (Holley et al. 2011). Hematopoietic
10 differentiation can be restored by the addition of soluble heparin with chain length of 12
11 saccharides and with critically N- and 6-O-sulfate groups were essential. Recent paper
12 describe that CS-containing hydrogels enhanced chondrogenesis of mesenchymal stem cells
13 in soft hydrogels (Wang and Yang 2017). These evidence suggested the exogenous addition
14 of GAGs may be applicable to affect CSC or stem cell activities. In this paper, the heparin
15 disaccharide components, but not chondroitin disaccharide components, changed by sphere
16 development (Figure 4A). Exogenously added heparin inhibited hepatoma sphere formation
17 (Figure 4B). Interestingly, the presence of CSA enhanced sphere formation. It was possible
18 that the blockade of specific protein binding to CD44 by exogenous CSA promoted
19 hepatoma sphere development. Interestingly, suppression of SDC1 expression upregulated
18
https://mc06.manuscriptcentral.com/bcb-pubs Page 19 of 31 Biochemistry and Cell Biology
1 CD44 mRNA expression but downregulated CD44 protein expression, as well the effects on
2 CD13 mRNA and CD13 protein expression were different. We suggested that SDC1 regulate
3 CD13 and CD44 protein level through the mechanism of posttranslational transport with
4 dynamic behavior of different cell activities(Stepp et al. 2015).
5 In this study, we demonstrated the importance of SDC1 in hepatoma sphere formation
6 and CSC marker CD13 and CD44 expression. Application of highly-sulfated heparin mimics
7 in blockade of hepatoma CSCs would be potential.
8
9 Acknowledgments Draft
10 This work was supported by project MOST106-2311-B-030-001 from Minister of
11 Science and Technology, and 104-FEMH-FJU-06 from Far Eastern Memorial Hospital. We
12 thank the National RNAi Core Facility at Academia Sinica in Taiwan for providing shRNA
13 reagents and related services.
14
15 References
16 Ambrosius, M., Kleesiek, K., and Gotting, C. 2008. Quantitative determination of the
17 glycosaminoglycan Delta-disaccharide composition of serum, platelets and granulocytes by
18 reversed-phase high-performance liquid chromatography. J Chromatogr A 1201(1): 54-60.
19 doi: 10.1016/j.chroma.2008.06.007.
19
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 20 of 31
1 Barbosa, I., Garcia, S., Barbier-Chassefiere, V., Caruelle, J.P., Martelly, I., and Papy-Garcia,
2 D. 2003. Improved and simple micro assay for sulfated glycosaminoglycans quantification
3 in biological extracts and its use in skin and muscle tissue studies. Glycobiology 13(9): 647-
4 653. doi: 10.1093/glycob/cwg082
5 cwg082 [pii].
6 Cao, L., Zhou, Y., Zhai, B., Liao, J., Xu, W., Zhang, R., Li, J., Zhang, Y., Chen, L., Qian,
7 H., Wu, M., and Yin, Z. 2011. Sphere-forming cell subpopulations with cancer stem cell
8 properties in human hepatoma cell lines. BMC gastroenterology 11: 71. doi: 10.1186/1471-
9 230X-11-71. Draft
10 Chen, J., Wang, Y., Chen, C., Lian, C., Zhou, T., Gao, B., Wu, Z., and Xu, C. 2016.
11 Exogenous Heparan Sulfate Enhances the TGF-beta3-Induced Chondrogenesis in Human
12 Mesenchymal Stem Cells by Activating TGF-beta/Smad Signaling. Stem Cells Int 2016:
13 1520136. doi: 10.1155/2016/1520136.
14 Drzeniek, Z., Stocker, G., Siebertz, B., Just, U., Schroeder, T., Ostertag, W., and Haubeck,
15 H.D. 1999. Heparan sulfate proteoglycan expression is induced during early erythroid
16 differentiation of multipotent hematopoietic stem cells. Blood 93(9): 2884-2897.
17 Frank, N.Y., Schatton, T., and Frank, M.H. 2010. The therapeutic promise of the cancer stem
18 cell concept. The Journal of clinical investigation 120(1): 41-50. doi: 10.1172/JCI41004.
19 Haraguchi, N., Ishii, H., Mimori, K., Tanaka, F., Ohkuma, M., Kim, H.M., Akita, H.,
20
https://mc06.manuscriptcentral.com/bcb-pubs Page 21 of 31 Biochemistry and Cell Biology
1 Takiuchi, D., Hatano, H., Nagano, H., Barnard, G.F., Doki, Y., and Mori, M. 2010. CD13 is
2 a therapeutic target in human liver cancer stem cells. The Journal of clinical investigation
3 120(9): 3326-3339. doi: 10.1172/JCI42550.
4 Holley, R.J., Pickford, C.E., Rushton, G., Lacaud, G., Gallagher, J.T., Kouskoff, V., and
5 Merry, C.L. 2011. Influencing hematopoietic differentiation of mouse embryonic stem cells
6 using soluble heparin and heparan sulfate saccharides. J Biol Chem 286(8): 6241-6252. doi:
7 M110.178483 [pii]
8 10.1074/jbc.M110.178483.
9 Ibrahim, S.A., Gadalla, R., El-Ghonaimy,Draft E.A., Samir, O., Mohamed, H.T., Hassan, H.,
10 Greve, B., El-Shinawi, M., Mohamed, M.M., and Gotte, M. 2017. Syndecan-1 is a novel
11 molecular marker for triple negative inflammatory breast cancer and modulates the cancer
12 stem cell phenotype via the IL-6/STAT3, Notch and EGFR signaling pathways. Mol Cancer
13 16(1): 57. doi: 10.1186/s12943-017-0621-z.
14 Ibrahim, S.A., Hassan, H., Vilardo, L., Kumar, S.K., Kumar, A.V., Kelsch, R., Schneider,
15 C., Kiesel, L., Eich, H.T., Zucchi, I., Reinbold, R., Greve, B., and Gotte, M. 2013. Syndecan-
16 1 (CD138) modulates triple-negative breast cancer stem cell properties via regulation of
17 LRP-6 and IL-6-mediated STAT3 signaling. PloS one 8(12): e85737. doi:
18 10.1371/journal.pone.0085737.
19 Kraushaar, D.C., Yamaguchi, Y., and Wang, L. 2015. Heparan sulfate is required for
21
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 22 of 31
1 embryonic stem cells to exit from self-renewal. J Biol Chem 290(38): 23023. doi:
2 10.1074/jbc.A109.066837.
3 Miraglia, S., Godfrey, W., Yin, A.H., Atkins, K., Warnke, R., Holden, J.T., Bray, R.A.,
4 Waller, E.K., and Buck, D.W. 1997. A novel five-transmembrane hematopoietic stem cell
5 antigen: isolation, characterization, and molecular cloning. Blood 90(12): 5013-5021.
6 Oikari, L.E., Okolicsanyi, R.K., Qin, A., Yu, C., Griffiths, L.R., and Haupt, L.M. 2016. Cell
7 surface heparan sulfate proteoglycans as novel markers of human neural stem cell fate
8 determination. Stem Cell Res 16(1): 92-104. doi: 10.1016/j.scr.2015.12.011.
9 Okolicsanyi, R.K., Oikari, L.E., Yu,Draft C., Griffiths, L.R., and Haupt, L.M. 2018. Heparan
10 Sulfate Proteoglycans as Drivers of Neural Progenitors Derived From Human Mesenchymal
11 Stem Cells. Front Mol Neurosci 11: 134. doi: 10.3389/fnmol.2018.00134.
12 Papy-Garcia, D., and Albanese, P. 2017. Heparan sulfate proteoglycans as key regulators of
13 the mesenchymal niche of hematopoietic stem cells. Glycoconj J 34(3): 377-391. doi:
14 10.1007/s10719-017-9773-8.
15 Patel, N.J., Sharon, C., Baranwal, S., Boothello, R.S., Desai, U.R., and Patel, B.B. 2016.
16 Heparan sulfate hexasaccharide selectively inhibits cancer stem cells self-renewal by
17 activating p38 MAP kinase. Oncotarget 7(51): 84608-84622. doi:
18 10.18632/oncotarget.12358.
19 Salnikov, A.V., Kusumawidjaja, G., Rausch, V., Bruns, H., Gross, W., Khamidjanov, A.,
22
https://mc06.manuscriptcentral.com/bcb-pubs Page 23 of 31 Biochemistry and Cell Biology
1 Ryschich, E., Gebhard, M.M., Moldenhauer, G., Buchler, M.W., Schemmer, P., and Herr, I.
2 2009. Cancer stem cell marker expression in hepatocellular carcinoma and liver metastases
3 is not sufficient as single prognostic parameter. Cancer Lett 275(2): 185-193. doi: S0304-
4 3835(08)00823-9 [pii]
5 10.1016/j.canlet.2008.10.015.
6 Sasaki, N., Okishio, K., Ui-Tei, K., Saigo, K., Kinoshita-Toyoda, A., Toyoda, H., Nishimura,
7 T., Suda, Y., Hayasaka, M., Hanaoka, K., Hitoshi, S., Ikenaka, K., and Nishihara, S. 2008.
8 Heparan sulfate regulates self-renewal and pluripotency of embryonic stem cells. J Biol
9 Chem 283(6): 3594-3606. doi: M705621200Draft [pii]
10 10.1074/jbc.M705621200.
11 Schneider, C.A., Rasband, W.S., and Eliceiri, K.W. 2012. NIH Image to ImageJ: 25 years
12 of image analysis. Nat Methods 9(7): 671-675.
13 Shackleton, M., Quintana, E., Fearon, E.R., and Morrison, S.J. 2009. Heterogeneity in cancer:
14 cancer stem cells versus clonal evolution. Cell 138(5): 822-829. doi: S0092-8674(09)01030-
15 7 [pii]
16 10.1016/j.cell.2009.08.017.
17 Shimada, K., Anai, S., Fujii, T., Tanaka, N., Fujimoto, K., and Konishi, N. 2013. Syndecan-1
18 (CD138) contributes to prostate cancer progression by stabilizing tumour-initiating cells. J
19 Pathol 231(4): 495-504. doi: 10.1002/path.4271.
23
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 24 of 31
1 Stepp, M.A., Pal-Ghosh, S., Tadvalkar, G., and Pajoohesh-Ganji, A. 2015. Syndecan-1 and
2 Its Expanding List of Contacts. Adv Wound Care (New Rochelle) 4(4): 235-249. doi:
3 10.1089/wound.2014.0555.
4 Suetsugu, A., Nagaki, M., Aoki, H., Motohashi, T., Kunisada, T., and Moriwaki, H. 2006.
5 Characterization of CD133+ hepatocellular carcinoma cells as cancer stem/progenitor cells.
6 Biochem Biophys Res Commun 351(4): 820-824. doi: S0006-291X(06)02324-2 [pii]
7 10.1016/j.bbrc.2006.10.128.
8 Suhovskih, A.V., Aidagulova, S.V., Kashuba, V.I., and Grigorieva, E.V. 2015.
9 Proteoglycans as potential microenvironmentalDraft biomarkers for colon cancer. Cell Tissue Res
10 361(3): 833-844. doi: 10.1007/s00441-015-2141-8.
11 Uchida, Y., Tanaka, S., Aihara, A., Adikrisna, R., Yoshitake, K., Matsumura, S., Mitsunori,
12 Y., Murakata, A., Noguchi, N., Irie, T., Kudo, A., Nakamura, N., Lai, P.B., and Arii, S. 2010.
13 Analogy between sphere forming ability and stemness of human hepatoma cells. Oncology
14 reports 24(5): 1147-1151.
15 Wang, T., and Yang, F. 2017. A comparative study of chondroitin sulfate and heparan sulfate
16 for directing three-dimensional chondrogenesis of mesenchymal stem cells. Stem Cell Res
17 Ther 8(1): 284. doi: 10.1186/s13287-017-0728-6.
18 Yin, A.H., Miraglia, S., Zanjani, E.D., Almeida-Porada, G., Ogawa, M., Leary, A.G.,
19 Olweus, J., Kearney, J., and Buck, D.W. 1997. AC133, a novel marker for human
24
https://mc06.manuscriptcentral.com/bcb-pubs Page 25 of 31 Biochemistry and Cell Biology
1 hematopoietic stem and progenitor cells. Blood 90(12): 5002-5012.
2
3 Figure legends
4 Figure 1. PCR analysis for expression of CSC markers and HS proteoglycans in hepatoma
5 sphere development at (A) Huh7 cells or (B) HepG2 cells in 3, 7, and 12 days. The relative
6 levels of mRNA expressions were presented as average values of repeats (n=2) quantified
7 by ImageJ.
8
9 Figure 2. Effect of CD13 suppressionDraft at cell proliferation, mRNA expressions of SDC1 and
10 various CSC markers. (A) Suppression of CD13 mRNA expression by CD13-specific
11 shRNAs. (B) Suppression of CD13 expression enhanced cell proliferation. (C) Suppression
12 of CD13 expression had no effect on CD90, CD24, ABCG2, and EpCAM expressions, but
13 inhibited SDC1 and CD44 expressions. Data were mean ±S.E. **, p < 0.01, *, p < 0.05. (D)
14 Suppression of CD13 protein expression inhibited SDC1 and CD44 protein expressions.
15
16 Figure 3. Effect of SDC1 suppression at cell proliferation, sphere formation, mRNA
17 expressions of CD13 and various CSC markers. (A) Suppression of SDC1 mRNA expression
18 by SDC1-specific shRNAs. (B) Suppression of SDC1 expression enhanced cell proliferation.
19 (C) Construction of capillary tube for spherocrit assay. The details were described in material
25
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 26 of 31
1 and methods. In average, lengths of cell spheres were reduced upon SDC1 suppression. (D)
2 Suppression of SDC1 expression had no effect on CD13, CD24, ABCG2, and EpCAM
3 mRNA expression, but upregulated CD90, CD133, and CD44 expression. Data were mean
4 ±S.E. **, p < 0.01, *, p < 0.05. (E) Suppression of SDC1 protein expression also inhibited
5 CD13 and CD44 protein expressions.
6
7 Figure 4. Heparin components were changed with sphere development and exogenous
8 heparin addition blocked sphere formation. (A) HPLC analysis of heparin disaccharides
9 from Huh7 cells or Huh7 cell spheres.Draft Retention peaks corresponded to each disaccharide
10 standards were shown. The arrow head-labeled peaks at retention time of 8-9 min and 22-24
11 min were the remained fluorescent dye. (B) HPLC analysis of chondroitin disaccharides
12 from Huh7 cells or Huh7 cell spheres. (C) Effect of exogenous heparin addition (1 mg/mL)
13 or exogenous CSA addition (1 mg/mL) at hepatoma sphere formation.
26
https://mc06.manuscriptcentral.com/bcb-pubs Page 27 of 31 Biochemistry and Cell Biology
Table 1. Disaccharide compositions of heparin sulfate isolated from hepatoma Huh7 cells and Huh7 cell spheres. Disaccharide Disaccharide Percentage (%) Percentage (%) ID structure in Huh-7 cells in Huh-7 spheres I-S α-UA2OS -[14]- GlcNS6OS 9.67 11.64 II-S α-UA -[14]- GlcNS6OS 7.20 4.77 III-S α-UA2OS -[14]- GlcNS 22.48 24.71 IV-S α-UA -[14]- GlcNS 17.99 19.60 I-H α-UA2OS -[14]- GlcN6OS 3.33 2.43 I-A α-UA2OS -[14]- GlcNAc6OS 1.83 2.13 III-H α-UA2OS -[14]- GlcN 7.29 5.93 III-A α-UA2OS -[14]- GlcNAc 9.05 8.80 IV-H α-UA -[14]- GlcN 2.68 2.12 IV-A α-UA -[14]- GlcNAc 18.49 17.87 N-sulfation 57.34 60.72 N-acetylation 29.37 28.8 Free NH2 13.3 10.48 2-O-sulfation 53.65 55.64 6-O-sulfation 18.7 18.54
Draft
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 28 of 31
Draft
Figure 1. PCR analysis for expression of CSC markers and HS proteoglycans in hepatoma sphere development at (A) Huh7 cells or (B) HepG2 cells in 3, 7, and 12 days. The relative levels of mRNA expressions were presented as average values of repeats (n=2) quantified by ImageJ.
https://mc06.manuscriptcentral.com/bcb-pubs Page 29 of 31 Biochemistry and Cell Biology
Draft
Figure 2. Effect of CD13 suppression at cell proliferation, mRNA expressions of SDC1 and various CSC markers. (A) Suppression of CD13 mRNA expression by CD13-specific shRNAs. (B) Suppression of CD13 expression enhanced cell proliferation. (C) Suppression of CD13 expression had no effect on CD90, CD24, ABCG2, and EpCAM expressions, but inhibited SDC1 and CD44 expressions. Data were mean ±S.E. **, p < 0.01, *, p < 0.05. (D) Suppression of CD13 protein expression inhibited SDC1 and CD44 protein expressions.
https://mc06.manuscriptcentral.com/bcb-pubs Biochemistry and Cell Biology Page 30 of 31
Draft
Figure 3. Effect of SDC1 suppression at cell proliferation, sphere formation, mRNA expressions of CD13 and various CSC markers. (A) Suppression of SDC1 mRNA expression by SDC1-specific shRNAs. (B) Suppression of SDC1 expression enhanced cell proliferation. (C) Construction of capillary tube for spherocrit assay. The details were described in material and methods. In average, lengths of cell spheres were reduced upon SDC1 suppression. (D) Suppression of SDC1 expression had no effect on CD13, CD24, ABCG2, and EpCAM mRNA expression, but upregulated CD90, CD133, and CD44 expression. Data were mean ±S.E. **, p < 0.01, *, p < 0.05. (E) Suppression of SDC1 protein expression also inhibited CD13 and CD44 protein expressions.
https://mc06.manuscriptcentral.com/bcb-pubs Page 31 of 31 Biochemistry and Cell Biology
Draft
Figure 4. Heparin components were changed with sphere development and exogenous heparin addition blocked sphere formation. (A) HPLC analysis of heparin disaccharides from Huh7 cells or Huh7 cell spheres. Retention peaks corresponded to each disaccharide standards were shown. The arrow head-labeled peaks at retention time of 8-9 min and 22-24 min were the remained fluorescent dye. (B) HPLC analysis of chondroitin disaccharides from Huh7 cells or Huh7 cell spheres. (C) Effect of exogenous heparin addition (1 mg/mL) or exogenous CSA addition (1 mg/mL) at hepatoma sphere formation.
https://mc06.manuscriptcentral.com/bcb-pubs