DOCSLIB.ORG

University of California, San Diego

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
University of California, San Diego UNIVERSITY OF CALIFORNIA, SAN DIEGO Regulation of Target Gene Expression in Sensory Neurons by Brn3a A Dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Biomedical Sciences by Jason James Lanier Committee in charge: Professor Eric Turner, Chair Professor Jerold Chun Professor Joseph Gleeson Professor William McGinnis Professor Bing Ren 2007 Copyright Jason James Lanier, 2007 All rights reserved The Dissertation of Jason James Lanier is approved, and it is acceptable in quality and form for publication on microfilm. _________________________________________________________ _________________________________________________________ _________________________________________________________ _________________________________________________________ _________________________________________________________ Chair UNIVERSITY OF CALIFORNIA, SAN DIEGO 2007 iii TABLE OF CONTENTS Signature page ........................................................................................ iii Table of contents ..................................................................................... iv List of Figures ......................................................................................... vi List of Tables .......................................................................................... viii Acknowledgements ................................................................................. ix Vita ......................................................................................................... x Abstract ................................................................................................... xii I. Introduction ............................................................................................. 1 Induction and development of the nervous system...................................................................................... 1 Tissue-specific transcription factors in neural development ............................................................. 3 Mechanisms of transcriptional regulation .............................. 5 Transcription factor target gene specificity ............................ 7 Epigenetic influence on transcription factor binding .................................................................................... 10 Brn3a is a critical regulator of sensory neural development ............................................................................ 13 References ............................................................................... 17 II. Coordinated regulation of gene expression by Brn3a in the developing trigeminal ganglion .............................................................. 23 Abstract ................................................................................... 23 Introduction ............................................................................. 24 Materials and methods ............................................................ 27 Results ..................................................................................... 29 Discussion ............................................................................... 39 Figures..................................................................................... 49 Tables ...................................................................................... 57 References ............................................................................... 62 Acknowledgements ................................................................. 66 iv III. Brn3a target gene recognition in embryonic sensory neurons ................ 67 Abstract ................................................................................... 67 Introduction ............................................................................. 68 Materials and methods ........................................................... 72 Results ..................................................................................... 80 Discussion ............................................................................... 92 Figures..................................................................................... 100 References ............................................................................... 113 Acknowledgements ................................................................. 118 IV. POU-domain factor Brn3a regulates both distinct and common programs of gene expression in the spinal and trigeminal sensory ganglia ...................................................................... 119 Abstract ................................................................................... 119 Background ............................................................................. 121 Results ..................................................................................... 124 Discussion ............................................................................... 133 Materials and methods ........................................................... 138 Figures .................................................................................... 145 Tables ...................................................................................... 155 References ............................................................................... 161 Acknowledgements ................................................................. 165 V. Conclusions ............................................................................................ 166 Programs of gene regulation in the nervous system. .............. 166 Direct vs indirect regulation.................................................... 167 Context-dependent binding and activity of transcription factors. ............................................................... 169 Cell-specific functions of transcription factors. ...................... 172 References ............................................................................... 175 v LIST OF FIGURES Chapter 2 Figure 2.1 Expression array analysis of E13.5 trigeminal ganglia. .................................................................................... 50 Figure 2.2 Brn3a regulates sensory neurotransmitter systems. ................................................................................... 52 Figure 2.3 Coordinated regulation of transcription factor expression in sensory ganglia by Brn3a. ................................ 54 Figure 2.4 Cellular expression of Brn3a target genes in the CNS. ........................................................................................ 56 Chapter 3 Figure 3.1 Cellular expression of Brn3a in the embryonic trigeminal ganglion. ................................................................ 100 Figure 3.2. Brn3a is a direct regulator of the NeuroD4 gene in the embryonic trigeminal ganglion. .................................... 102 Figure 3.3 ChIP analysis of Brn3a binding to the NeuroD1 and Msc loci in E13.5 trigeminal ganglia. .............................. 104 Figure 3.4 Brn3a binding to the Pou4f1 locus in vitro and in embryonic trigeminal ganglia. ............................................ 106 Figure 3.5 Markers of chromatin modification at the Pou4f1 locus. .......................................................................... 108 Figure 3.6 Acetylated histone H3 ChIP assays of the NeuroD4 and NeuroD1 loci. ................................................... 110 Figure 3.7 Analysis of Brn3a binding sites identified in the promoters of genes not expressed in the developing trigeminal ganglion. ............................................. 112 vi Chapter 4 Figure 4.1 Analysis of global gene expression in embryonic neural tissue. ......................................................... 145 Figure 4.2 Selective expression of proprioceptor markers in the DRG and trigeminal system. ......................................... 147 Figure 4.3 Target genes with increased expression in the DRG of Brn3a null mice. ........................................................ 148 Figure 4.4 Target genes with decreased expression in the DRG of Brn3a null mice. ........................................................ 150 Figure 4.5 Brn3a regulation of Hox gene expression in the DRG. ................................................................................. 151 Figure 4.6 Trigeminal-specific targets of Brn3a regulation. .................... 152 Figure 4.7 Acetyl-histone H3 profiling of Brn3a target gene loci. ................................................................................. 154 vii LIST OF TABLES Chapter 2 Table 2.1 Increased transcripts in the trigeminal ganglion of Brn3a mutant mouse embryos. ........................................... 57 Table 2.2 Decreased transcripts in the trigeminal ganglion of Brn3a mutant mouse embryos. ........................................... 58 Table 2.3 Significantly changed ESTs in Brn3a mutant mice. ............... 59 Table 2.4 Relative expression of previously reported Brn3a target genes in the trigeminal ganglia of Brn3a mutant embryos. ...................................................................... 61 Chapter 4 Table 4.1 Transcripts differentially expressed in the DRG and TG. ................................................................................... 155 Table 4.2 Increased transcripts in the DRG of Brn3a knockout mice. ........................................................................ 157 Table 4.3 Transcripts decreased in the DRG of Brn3a
Load more

Recommended publications
  • High-Affinity Binding Sites for the Deformed Protein Are Required for the Function of an Autoregulatory Enhancer of the Deformed Gene
    Downloaded from genesdev.cshlp.org on October 9, 2021 - Published by Cold Spring Harbor Laboratory Press High-affinity binding sites for the Deformed protein are required for the function of an autoregulatory enhancer of the Deformed gene Michael Regulski,*'^ Scott Dessain/ Nadine McGinnis/ and William McGinnis*'^ Departments of Biology' and Molecular Biophysics and Biochemistry^ Yale University, New Haven, Connecticut 06511 USA The homeotic selector gene Deformed [Dfd) is required to specify the identity of head segments during Drosophila development. Previous experiments have shown that for the Dfd segmental identity function to operate in epidermal cells, the Dfd gene must be persistently expressed. One mechanism that provides persistent embryonic expression of Dfd is an autoregulatory circuit. Here, we show that the control of this autoregulatory circuit is likely to be directly mediated by the binding of Dfd protein to an upstream enhancer in Dfd locus DNA. In a 25-kb region around the Dfd transcription unit, restriction fragments with the highest binding affinity for Dfd protein map within the limits of the upstream autoregulatory element at approximately -5 kb. A minimal autoregulatory element, within a 920-bp segment of upstream DNA, has four moderate- to high-affinity binding sites for Dfd protein, with the two highest affinity sites sharing an ATCATTA consensus sequence. Site-specific mutagenesis of these four sites results in an element that has low affinity for Dfd protein when assayed in vitro and is nonfunctional when assayed in embryos. \Key Words: Deformed; autoregulatory circuit; homeo domain, homeotic protein] Received October 26, 1990; revised version accepted December 13, 1990.
    [Show full text]
  • Perspectives
    Copyright 0 1994 by the Genetics Society of America Perspectives Anecdotal, Historical and Critical Commentaries on Genetics Edited by James F. Crow and William F. Dove A Century of Homeosis, A Decade of Homeoboxes William McGinnis Department of Molecular Biophysics and Biochemistry, Yale University, New Haven, Connecticut 06520-8114 NE hundred years ago, while the science of genet- ing mammals, and were proposed to encode DNA- 0 ics still existed only in the yellowing reprints of a binding homeodomainsbecause of a faint resemblance recently deceased Moravian abbot, WILLIAMBATESON to mating-type transcriptional regulatory proteins of (1894) coined the term homeosis to define a class of budding yeast and an even fainter resemblance to bac- biological variations in whichone elementof a segmen- terial helix-turn-helix transcriptional regulators. tally repeated array of organismal structures is trans- The initial stream of papers was a prelude to a flood formed toward the identity of another. After the redis- concerning homeobox genes and homeodomain pro- coveryof MENDEL’Sgenetic principles, BATESONand teins, a flood that has channeled into a steady river of others (reviewed in BATESON1909) realized that some homeo-publications, fed by many tributaries. A major examples of homeosis in floral organs and animal skel- reason for the continuing flow of studies is that many etons could be attributed to variation in genes. Soon groups, working on disparate lines of research, have thereafter, as the discipline of Drosophila genetics was found themselves swept up in the currents when they born and was evolving into a formidable intellectual found that their favorite protein contained one of the force enriching many biologicalsubjects, it gradually be- many subtypes of homeodomain.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • A Screen for Modifiers of Dejin-Med Function in Drosophila
    Copyright Q 1995 by the Genetics Society of America A Screen for Modifiers of Dejin-med Function in Drosophila Katherine W. Hardjng,* Gabriel Gellon? Nadine McGinnis* and William M~Ginnis*~~ *Departwnt of Molecular Biophysics and Biochemistry and iDepartment of Biology, Yak University, New Haven Connecticut 06520-8114 Manuscript received February 16, 1995 Accepted for publication May 13, 1995 ABSTRACT Proteins produced by the homeotic genes of the Hox family assign different identities to cells on the anterior/posterior axis. Relatively little is known about the signalling pathways that modulate their activities or the factors with which they interact to assign specific segmental identities. To identify genes that might encode such functions, we performed a screen for second site mutations that reduce the viability of animals carrying hypomorphic mutant alleles of the Drosophila homeotic locus, Deformed. Genes mapping to six complementation groups on the third chromosome were isolatedas modifiers of Defolmd function. Productsof two of these genes, sallimus and moira, have been previously proposed as homeotic activators since they suppress the dominant adult phenotype of Polycomb mutants. Mutations in hedgehog, which encodes secreted signalling proteins, were also isolated as Deformed loss-of-function enhancers. Hedgehog mutant alleles also suppress the Polycomb phenotype. Mutations were also isolated in a few genes that interact with Deformed but not with Polycomb, indicating that the screen identified genes that are not general homeotic activators. Twoof these genes, cap ‘n’collarand defaced, have defects in embryonic head development that are similar to defects seen in loss of functionDefmed mutants. OMEOTIC proteinsencoded in the Anten- in embryos, and some evidence exists to support this H napedia and bithorax complexes of Drosophila, view.
    [Show full text]
  • The Evolution of Function in the Rab Family of Small Gtpases
    The Evolution of Function in the Rab Family of small GTPases Yoan Diekmann Dissertation presented to obtain the Ph.D. degree in Computational Biology Instituto de Tecnologia Química e Biológica | Universidade Nova de Lisboa Research work coordinated by: Oeiras, April, 2014 Cover: “The Rab Universe”. A circular version of Figure 2.5. The Evolution of Function in the Rab Family of small GTPases Yoan Diekmann, Computational Genomics Laboratory, Instituto Gulben- kian de Ciˆencia Declara¸c˜ao: Esta disserta¸c˜ao´eo resultado do meu pr´opriodesenvolvido entre Outubro de 2009 e Outubro de 2013 no laborat´oriodo Jos´eB. Pereira-Leal, PhD, Instituto Gulbenkian de Ciˆeciaem Oeiras, Portugal, no ˆambito do Programa de Doutoramento em Biologia Computacional (edi¸c˜ao2008-2009). Apoio financeiro: Apoio financeiro da FCT e do FSE no ˆambito do Quadro Comunit´ariode Apoio, bolsa de doutoramento SFRH/BD/33860/2009 e projectos HMSP-CT/SAU-ICT/0075/2009 e PCDC/EBB-BIO/119006/2010. Acknowledgements “Alors que vous achevez la lecture de mon expos´e,il est n´ecessaire de souligner le fait que ce que j’en ai retir´eest bien plus cons´equent.” Mit diesen Worten, die ich meinem Freund Axel schulde, begann was in der vorliegenden Arbeit seinen vorl¨aufigenH¨ohepunktfindet. So wahr wie damals ist der Satz auch heute, und das verdanke ich einer Reihe von Men- schen welche unerw¨ahnt zu lassen unm¨oglich ist. Obwohl das Schreiben die folgenden Namen notwendigerweise in eine Reihenfolge zw¨angt,so geb¨uhrt doch allen ihr g¨anzlich eigener Dank. Ich lasse der M¨udigkeit freien Lauf und schreibe einfach drauf los.
    [Show full text]
  • Proquest Dissertations
    RICE UNIVERSITY Molecular Basis of Gene Dosage Sensitivity by Jianping Chen A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE Doctor of Philosophy APPROVED, THESIS COMMITTEE: Ariel Fernandez, Chair Karl F. Hasselmann Professor Department of Bioengineering Rice University rn'idtfP h.tQsJUW*- Michael W. Deem, John W. Cox Professor Department of Bioengineering Department of Physics and Astronomy Rice Universit ^engineering at Rice University Jiochemistry at Baylor College of Medicine Axxttig- «J^gb/uv Laura Segaton, T.N. Law Assistant Professor Chemical and Biomolecular Engineering Rice University HOUSTON, TEXAS JANUARY 2009 UMI Number: 3362141 INFORMATION TO USERS The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleed-through, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion. UMI® UMI Microform 3362141 Copyright 2009 by ProQuest LLC All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code. ProQuest LLC 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, Ml 48106-1346 ABSTRACT Molecular Basis of Gene Dosage Sensitivity by JianpingChen Deviation of gene expression from normal levels has been associated with diseases. Both under- and overexpression of genes could lead to deleterious biological consequences. Dosage balance has been proposed to be a key issue of determining gene expression pheno- type.
    [Show full text]
  • A Three-Dimensional Organoid Model Recapitulates Tumorigenic Aspects
    www.nature.com/scientificreports OPEN A three-dimensional organoid model recapitulates tumorigenic aspects and drug responses of Received: 22 June 2018 Accepted: 10 October 2018 advanced human retinoblastoma Published: xx xx xxxx Duangporn Saengwimol1, Duangnate Rojanaporn2, Vijender Chaitankar3, Pamorn Chittavanich4, Rangsima Aroonroch5, Tatpong Boontawon4, Weerin Thammachote4, Natini Jinawath4, Suradej Hongeng6 & Rossukon Kaewkhaw4 Persistent or recurrent retinoblastoma (RB) is associated with the presence of vitreous or/and subretinal seeds in advanced RB and represents a major cause of therapeutic failure. This necessitates the development of novel therapies and thus requires a model of advanced RB for testing candidate therapeutics. To this aim, we established and characterized a three-dimensional, self-organizing organoid model derived from chemotherapy-naïve tumors. The responses of organoids to drugs were determined and compared to relate organoid model to advanced RB, in terms of drug sensitivities. We found that organoids had histological features resembling retinal tumors and seeds and retained DNA copy-number alterations as well as gene and protein expression of the parental tissue. Cone signal circuitry (M/L+ cells) and glial tumor microenvironment (GFAP+ cells) were primarily present in organoids. Topotecan alone or the combined drug regimen of topotecan and melphalan efectively targeted proliferative tumor cones (RXRγ+ Ki67+) in organoids after 24-h drug exposure, blocking mitotic entry. In contrast, methotrexate showed the least efcacy against tumor cells. The drug responses of organoids were consistent with those of tumor cells in advanced disease. Patient-derived organoids enable the creation of a faithful model to use in examining novel therapeutics for RB. Retinoblastoma (RB) is a serious childhood retinal tumor that, if lef untreated, can cause death within 1–2 years.
    [Show full text]
  • Single Cell Derived Clonal Analysis of Human Glioblastoma Links
    SUPPLEMENTARY INFORMATION: Single cell derived clonal analysis of human glioblastoma links functional and genomic heterogeneity ! Mona Meyer*, Jüri Reimand*, Xiaoyang Lan, Renee Head, Xueming Zhu, Michelle Kushida, Jane Bayani, Jessica C. Pressey, Anath Lionel, Ian D. Clarke, Michael Cusimano, Jeremy Squire, Stephen Scherer, Mark Bernstein, Melanie A. Woodin, Gary D. Bader**, and Peter B. Dirks**! ! * These authors contributed equally to this work.! ** Correspondence: [email protected] or [email protected]! ! Supplementary information - Meyer, Reimand et al. Supplementary methods" 4" Patient samples and fluorescence activated cell sorting (FACS)! 4! Differentiation! 4! Immunocytochemistry and EdU Imaging! 4! Proliferation! 5! Western blotting ! 5! Temozolomide treatment! 5! NCI drug library screen! 6! Orthotopic injections! 6! Immunohistochemistry on tumor sections! 6! Promoter methylation of MGMT! 6! Fluorescence in situ Hybridization (FISH)! 7! SNP6 microarray analysis and genome segmentation! 7! Calling copy number alterations! 8! Mapping altered genome segments to genes! 8! Recurrently altered genes with clonal variability! 9! Global analyses of copy number alterations! 9! Phylogenetic analysis of copy number alterations! 10! Microarray analysis! 10! Gene expression differences of TMZ resistant and sensitive clones of GBM-482! 10! Reverse transcription-PCR analyses! 11! Tumor subtype analysis of TMZ-sensitive and resistant clones! 11! Pathway analysis of gene expression in the TMZ-sensitive clone of GBM-482! 11! Supplementary figures and tables" 13" "2 Supplementary information - Meyer, Reimand et al. Table S1: Individual clones from all patient tumors are tumorigenic. ! 14! Fig. S1: clonal tumorigenicity.! 15! Fig. S2: clonal heterogeneity of EGFR and PTEN expression.! 20! Fig. S3: clonal heterogeneity of proliferation.! 21! Fig.
    [Show full text]
  • Pou4f1 and Pou4f2 Are Dispensable for the Long-Term Survival of Adult Retinal Ganglion Cells in Mice
    Pou4f1 and Pou4f2 Are Dispensable for the Long-Term Survival of Adult Retinal Ganglion Cells in Mice Liang Huang1,2, Fang Hu1,2, Xiaoling Xie1, Jeffery Harder1, Kimberly Fernandes1, Xiang-yun Zeng2, Richard Libby1, Lin Gan1,3* 1 Flaum Eye Institute and Department of Ophthalmology, University of Rochester School of Medicine and Dentistry, Rochester, New York, United States of America, 2 Department of Ophthalmology, First Affiliated Hospital of Gannan Medical University, Ganzhou, Jiangxi, China, 3 College of Life and Environmental Sciences, Hangzhou Normal University, Hangzhou, Zhejiang, China Abstract Purpose: To investigate the role of Pou4f1 and Pou4f2 in the survival of adult retinal ganglion cells (RGCs). Methods: Conditional alleles of Pou4f1 and Pou4f2 were generated (Pou4f1loxP and Pou4f2loxP respectively) for the removal of Pou4f1 and Pou4f2 in adult retinas. A tamoxifen-inducible Cre was used to delete Pou4f1 and Pou4f2 in adult mice and retinal sections and flat mounts were subjected to immunohistochemistry to confirm the deletion of both alleles and to quantify the changes in the number of RGCs and other retinal neurons. To determine the effect of loss of Pou4f1 and Pou4f2 on RGC survival after axonal injury, controlled optic nerve crush (CONC) was performed and RGC death was assessed. Results: Pou4f1 and Pou4f2 were ablated two weeks after tamoxifen treatment. Retinal interneurons and Mu¨ller glial cells are not affected by the ablation of Pou4f1 or Pou4f2 or both. Although the deletion of both Pou4f1 and Pou4f2 slightly delays the death of RGCs at 3 days post-CONC in adult mice, it does not affect the cell death progress afterwards.
    [Show full text]
  • Scientific American Paper
    The Molecular Architects of Body Design Putting a human gene into a fly may sound like the basis for a science fiction film, but it demonstrates that nearly identical molecular mechanisms define body shapes in all animals by William McGinnis and Michael Kuziora ll animals develop from a single tems that mold our form, we humans Antennapedia adults are rare excep- fertilized egg cell that goes may be much more similar to our far tions, because most mutations in ho- A through many rounds of divi- distant worm and insect relatives than meotic genes cause fatal birth defects sion, often yielding millions of embry- we might like to think. So similar, in in Drosophila. Nevertheless, even those onic cells. In a dazzling and still myste- fact, thatÑas our work has shownÑcu- dying embryos can be quite instructive. rious feat of self-organization, these rious experimenters can use some hu- For instance, Ernesto Sanchez-Herrero cells arrange themselves into a com- man and mouse Hox genes to guide the and Gines Morata of the Independent plete organism, in which bone, muscle, development of fruit-ßy embryos. University of Madrid found that elimi- brain and skin integrate into a harmo- The story of these universal molecu- nation of three genes in the bithorax nious whole. The fundamental process lar architects actually begins with the complexÑUltrabithorax, abdominal-A is constant, but the results are not: hu- pioneering genetic studies of Edward and Abdominal-BÑis lethal. Yet such mans, mice, ßies and worms represent B. Lewis of the California Institute of mutant embryos survive long enough a wide range of body designs.
    [Show full text]