DOCSLIB.ORG

Comprehensive Identification and Analysis of Human Accelerated Regulatory DNA

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Comprehensive Identification and Analysis of Human Accelerated Regulatory DNA Downloaded from genome.cshlp.org on September 16, 2015 - Published by Cold Spring Harbor Laboratory Press Research Comprehensive identification and analysis of human accelerated regulatory DNA Rachel M. Gittelman,1 Enna Hun,2 Ferhat Ay,1 Jennifer Madeoy,1 Len Pennacchio,3 William S. Noble,1 R. David Hawkins,1,2 and Joshua M. Akey1 1Department of Genome Sciences, University of Washington, Seattle, Washington 98195, USA; 2Division of Medical Genetics, University of Washington, Seattle, Washington 98195, USA; 3Lawrence Berkeley National Laboratory, Genomics Division, Berkeley, California 94701, USA It has long been hypothesized that changes in gene regulation have played an important role in human evolution, but reg- ulatory DNA has been much more difficult to study compared with protein-coding regions. Recent large-scale studies have created genome-scale catalogs of DNase I hypersensitive sites (DHSs), which demark potentially functional regulatory DNA. To better define regulatory DNA that has been subject to human-specific adaptive evolution, we performed comprehensive evolutionary and population genetics analyses on over 18 million DHSs discovered in 130 cell types. We identified 524 DHSs that are conserved in nonhuman primates but accelerated in the human lineage (haDHS), and estimate that 70% of substi- tutions in haDHSs are attributable to positive selection. Through extensive computational and experimental analyses, we demonstrate that haDHSs are often active in brain or neuronal cell types; play an important role in regulating the expression of developmentally important genes, including many transcription factors such as SOX6, POU3F2, and HOX genes; and iden- tify striking examples of adaptive regulatory evolution that may have contributed to human-specific phenotypes. More gen- erally, our results reveal new insights into conserved and adaptive regulatory DNA in humans and refine the set of genomic substrates that distinguish humans from their closest living primate relatives. [Supplemental material is available for this article.] A number of traits distinguish humans from our closest primate Nonetheless, interpreting patterns of interspecific divergence relatives, including bipedalism, increased cognition, and complex and intraspecific polymorphism in noncoding DNA has been language and social systems (for review, see O’Bleness et al. 2012). considerably more challenging compared with those of protein- To date, the genetic basis of human-specific phenotypes remains coding sequences. An elegant and powerful way to identify evolu- largely unknown, complicated by the difficulties in distinguishing tionary changes in noncoding DNA of potential significance, orig- between phenotypically significant and benign variation. Thus, inally described by Pollard et al. (2006b) and extensively used evolutionary changes in protein-coding sequences have received thereafter (Pollard et al. 2006a,b; Prabhakar et al. 2006; Kim considerable attention, as the phenotypic consequences of these and Pritchard 2007; Bush and Lahn 2008; McLean et al. 2010; mutations have historically been easier to interpret (Clark et al. Lindblad-Toh et al. 2011; Pertea et al. 2011), focuses on the discov- 2003; Stedman et al. 2004; Chimpanzee Sequencing and Analysis ery of sequences that are rapidly evolving or lost on the human lin- Consortium 2005; Nielsen et al. 2005; Arbiza et al. 2006; Dennis eage but that are otherwise phylogenetically conserved and thus et al. 2012; Sudmant et al. 2013). Although protein-coding likely functional. This approach has led to the discovery of several evolution has clearly played a role in human evolution, proteins regions with species-specific enhancer activity (Prabhakar et al. account for only ∼1.5% of the human genome, most of which ex- 2008; Capra et al. 2013; Kamm et al. 2013), as well as human-spe- hibit high sequence similarity between humans and chimpanzees cific deletion of regulatory DNA (McLean et al. 2011). (Chimpanzee Sequencing and Analysis Consortium 2005). However, phylogenetic conservation is an imperfect proxy for However, between ∼2.5% and 15% of the human genome function, particularly for noncoding regulatory sequences that can is estimated to be functionally constrained (Chinwalla et al. exhibit significantly high rates of turnover (Dermitzakis and Clark 2002; Lunter et al. 2006; Asthana et al. 2007; Meader et al. 2010; 2002; Wray et al. 2003; Villar et al. 2014). To more directly identify Ponting and Hardison 2011). Thus, the mutational target size of regulatory DNA, recent studies such as the ENCODE (The ENCODE noncoding DNA is considerably larger than protein-coding se- Project Consortium 2012) and Roadmap Epigenomics Projects quences, suggesting that regulatory DNA is also an important sub- (Bernstein et al. 2010) have created genome-scale maps of DNase strate of evolutionary change, as originally proposed four decades I hypersensitive sites (DHSs) in a large number of cell types. ago (Britten and Davidson 1969; King and Wilson 1975). In some DNase I preferentially cleaves regions of open and active DNA, cases, detailed studies of individual genes have revealed human- making it a powerful assay to identify regulatory elements, regard- specific regulatory evolution, such as in FOXP2, which is thought less of their specific function (Galas and Schmitz 1978; Dorschner to have influenced traits related to speech and language in humans et al. 2004). Although high-resolution maps of DHSs now exist, not (Enard et al. 2002). © 2015 Gittelman et al. This article is distributed exclusively by Cold Spring Harbor Laboratory Press for the first six months after the full-issue publication date (see http://genome.cshlp.org/site/misc/terms.xhtml). After six months, it Corresponding author: [email protected] is available under a Creative Commons License (Attribution-NonCommercial Article published online before print. Article, supplemental material, and publi- 4.0 International), as described at http://creativecommons.org/licenses/by- cation date are at http://www.genome.org/cgi/doi/10.1101/gr.192591.115. nc/4.0/. 25:1245–1255 Published by Cold Spring Harbor Laboratory Press; ISSN 1088-9051/15; www.genome.org Genome Research 1245 www.genome.org Downloaded from genome.cshlp.org on September 16, 2015 - Published by Cold Spring Harbor Laboratory Press Gittelman et al. all experimentally defined regulatory elements are expected to be identify 113,577 DHSs that exhibit significant evolutionary con- functionally or phenotypically significant (Eddy 2012; Doolittle straint across primates, which manifest as regions of low sequence 2013; Graur et al. 2013; Niu and Jiang 2013). divergence compared with carefully defined putatively neutral Thus, we hypothesized that the synergistic combination of flanking sequence (FDR = 0.01) (Fig. 1). Next, for DHSs that are comparative and functional genomics would facilitate the high- conserved in primates, we performed a second likelihood ratio resolution identification of conserved and human accelerated reg- test (Pollard et al. 2010) and identified 524 regulatory sequences ulatory sequences. Here we describe the genome-wide architecture that have experienced a significant acceleration of evolution in and characteristics of 113,577 DHSs that are conserved in primates the human lineage and therefore exhibit an excess of human-spe- and 524 DHSs that exhibit significantly accelerated rates of evolu- cific substitutions (FDR = 0.05) (Fig. 1; Supplemental Table 2). tion in the human lineage (haDHSs). We estimate that ∼70% of Importantly, to avoid biasing ourselves against identifying human substitutions within haDHSs are attributable to positive selection; acceleration, we excluded the human sequence in the first test for we experimentally validated a large number of elements; and we conservation. perform extensive bioinformatics analyses that integrate informa- tion across multiple functional genomics data sets to better under- Characteristics of primate conserved regulatory DNA stand the functional and biological characteristics of haDHSs. We first characterized the set of DHSs conserved across primates. Approximately 93% of conserved DHSs overlap a phastCons con- Results served element, but many also contain short segments of less con- served sequence, making them overall less conserved than those Framework for identifying conserved and human accelerated identified by phastCons (Fig. 2A). We hypothesize that these less regulatory DNA conserved sequences interspersed within DHSs may facilitate the To identify human accelerated regulatory DNA, we leveraged ex- rapid acquisition of novel transcription factor binding sites, as perimentally defined maps of DHSs from 130 cell types identified these regions are already actionable (i.e., accessible to proteins) in the ENCODE and Roadmap Epigenomics Projects (Supplemen- and poised to evolve new functions compared with nonconserved tal Table 1). After merging DHSs across cell types into 2,093,197 sequences outside of DHSs. distinct loci (median size = 290 bp, SD = 159 bp), we used a Patterns of conservation varied significantly across cell type − whole-genome alignment of six primates from the EPO pipeline category (Kruskal–Wallis test; P = 5.08 × 10 8; Methods) (Fig. 2B), (Paten et al. 2008) to obtain separate alignments for each DHS, us- ranging from 5.0% of DHSs in chronic lymphocyte leukemia cells ing strict filtering criteria for alignment quality. We performed two to 20.4% in fetal brain cells. DHSs active in fetal cell types showed likelihood
Load more

Recommended publications
  • Mutation-Specific and Common Phosphotyrosine Signatures of KRAS G12D and G13D Alleles Anticipated Graduation August 1St, 2018
    MUTATION-SPECIFIC AND COMMON PHOSPHOTYROSINE SIGNATURES OF KRAS G12D AND G13D ALLELES by Raiha Tahir A dissertation submitted to The Johns Hopkins University in conformity with the requirement of the degree of Doctor of Philosophy Baltimore, MD August 2018 © 2018 Raiha Tahir All Rights Reserved ABSTRACT KRAS is one of the most frequently mutated genes across all cancer subtypes. Two of the most frequent oncogenic KRAS mutations observed in patients result in glycine to aspartic acid substitution at either codon 12 (G12D) or 13 (G13D). Although the biochemical differences between these two predominant mutations are not fully understood, distinct clinical features of the resulting tumors suggest involvement of disparate signaling mechanisms. When we compared the global phosphotyrosine proteomic profiles of isogenic colorectal cancer cell lines bearing either G12D or G13D KRAS mutations, we observed both shared as well as unique signaling events induced by the two KRAS mutations. Remarkably, while the G12D mutation led to an increase in membrane proximal and adherens junction signaling, the G13D mutation led to activation of signaling molecules such as non-receptor tyrosine kinases, MAPK kinases and regulators of metabolic processes. The importance of one of the cell surface molecules, MPZL1, which found to be hyperphosphorylated in G12D cells, was confirmed by cellular assays as its knockdown led to a decrease in proliferation of G12D but not G13D expressing cells. Overall, our study reveals important signaling differences across two common KRAS mutations and highlights the utility of our approach to systematically dissect the subtle differences between related oncogenic mutants and potentially lead to individualized treatments.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • 1 Supporting Information for a Microrna Network Regulates
    Supporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia.
    [Show full text]
  • Convergent Functional Genomics of Schizophrenia: from Comprehensive Understanding to Genetic Risk Prediction
    Molecular Psychiatry (2012) 17, 887 -- 905 & 2012 Macmillan Publishers Limited All rights reserved 1359-4184/12 www.nature.com/mp IMMEDIATE COMMUNICATION Convergent functional genomics of schizophrenia: from comprehensive understanding to genetic risk prediction M Ayalew1,2,9, H Le-Niculescu1,9, DF Levey1, N Jain1, B Changala1, SD Patel1, E Winiger1, A Breier1, A Shekhar1, R Amdur3, D Koller4, JI Nurnberger1, A Corvin5, M Geyer6, MT Tsuang6, D Salomon7, NJ Schork7, AH Fanous3, MC O’Donovan8 and AB Niculescu1,2 We have used a translational convergent functional genomics (CFG) approach to identify and prioritize genes involved in schizophrenia, by gene-level integration of genome-wide association study data with other genetic and gene expression studies in humans and animal models. Using this polyevidence scoring and pathway analyses, we identify top genes (DISC1, TCF4, MBP, MOBP, NCAM1, NRCAM, NDUFV2, RAB18, as well as ADCYAP1, BDNF, CNR1, COMT, DRD2, DTNBP1, GAD1, GRIA1, GRIN2B, HTR2A, NRG1, RELN, SNAP-25, TNIK), brain development, myelination, cell adhesion, glutamate receptor signaling, G-protein-- coupled receptor signaling and cAMP-mediated signaling as key to pathophysiology and as targets for therapeutic intervention. Overall, the data are consistent with a model of disrupted connectivity in schizophrenia, resulting from the effects of neurodevelopmental environmental stress on a background of genetic vulnerability. In addition, we show how the top candidate genes identified by CFG can be used to generate a genetic risk prediction score (GRPS) to aid schizophrenia diagnostics, with predictive ability in independent cohorts. The GRPS also differentiates classic age of onset schizophrenia from early onset and late-onset disease.
    [Show full text]
  • The Transition from Primary Colorectal Cancer to Isolated Peritoneal Malignancy
    medRxiv preprint doi: https://doi.org/10.1101/2020.02.24.20027318; this version posted February 25, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY 4.0 International license . The transition from primary colorectal cancer to isolated peritoneal malignancy is associated with a hypermutant, hypermethylated state Sally Hallam1, Joanne Stockton1, Claire Bryer1, Celina Whalley1, Valerie Pestinger1, Haney Youssef1, Andrew D Beggs1 1 = Surgical Research Laboratory, Institute of Cancer & Genomic Science, University of Birmingham, B15 2TT. Correspondence to: Andrew Beggs, [email protected] KEYWORDS: Colorectal cancer, peritoneal metastasis ABBREVIATIONS: Colorectal cancer (CRC), Colorectal peritoneal metastasis (CPM), Cytoreductive surgery and heated intraperitoneal chemotherapy (CRS & HIPEC), Disease free survival (DFS), Differentially methylated regions (DMR), Overall survival (OS), TableFormalin fixed paraffin embedded (FFPE), Hepatocellular carcinoma (HCC) ARTICLE CATEGORY: Research article NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. 1 medRxiv preprint doi: https://doi.org/10.1101/2020.02.24.20027318; this version posted February 25, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY 4.0 International license . NOVELTY AND IMPACT: Colorectal peritoneal metastasis (CPM) are associated with limited and variable survival despite patient selection using known prognostic factors and optimal currently available treatments.
    [Show full text]
  • Computational Analyses of Small Molecules Activity from Phenotypic Screens
    Computational analyses of small molecules activity from phenotypic screens Azedine Zoufir Hughes Hall This dissertation is submitted for the degree of Doctor of Philosophy July 2018 Declaration This thesis is submitted as the result of my own work and includes nothing which is the outcome of work done in collaboration except where specifically indicated in the text. It is not substantially the same as any that I have submitted, or, is being concurrently submitted for a degree or diploma or other qualification at the University of Cambridge or any other University or similar institution except as declared in the preface and specified in the text. I further state that no substantial part of my dissertation has already been submitted, or, is being concurrently submitted for any such degree, diploma or other qualification at the University of Cambridge or any other University or similar institution except as declared in the Preface and specified in the text. This dissertation does not exceed the word limit of 60,000 words. Azedine Zoufir July 2018 Summary Title: Computational analyses of small molecules activity from phenotypic screens Author: Azedine Zoufir Drug discovery is no longer relying on the one gene-one disease paradigm nor on target-based screening alone to discover new drugs. Phenotypic-based screening is regaining momentum to discover new compounds since those assays provide an environment closer to the physiological state of the disease and allow to better anticipate off-target effects and other factors that can limit the efficacy of the drugs. However, uncovering the mechanism of action of the compounds active in those assays relies on in vitro techniques that are expensive and time- consuming.
    [Show full text]
  • Network Organization of the Human Autophagy System
    Vol 466 | 1 July 2010 | doi:10.1038/nature09204 ARTICLES Network organization of the human autophagy system Christian Behrends1, Mathew E. Sowa1, Steven P. Gygi2 & J. Wade Harper1 Autophagy, the process by which proteins and organelles are sequestered in autophagosomal vesicles and delivered to the lysosome/vacuole for degradation, provides a primary route for turnover of stable and defective cellular proteins. Defects in this system are linked with numerous human diseases. Although conserved protein kinase, lipid kinase and ubiquitin-like protein conjugation subnetworks controlling autophagosome formation and cargo recruitment have been defined, our understanding of the global organization of this system is limited. Here we report a proteomic analysis of the autophagy interaction network in human cells under conditions of ongoing (basal) autophagy, revealing a network of 751 interactions among 409 candidate interacting proteins with extensive connectivity among subnetworks. Many new autophagy interaction network components have roles in vesicle trafficking, protein or lipid phosphorylation and protein ubiquitination, and affect autophagosome number or flux when depleted by RNA interference. The six ATG8 orthologues in humans (MAP1LC3/GABARAP proteins) interact with a cohort of 67 proteins, with extensive binding partner overlap between family members, and frequent involvement of a conserved surface on ATG8 proteins known to interact with LC3-interacting regions in partner proteins. These studies provide a global view of the mammalian autophagy interaction landscape and a resource for mechanistic analysis of this critical protein homeostasis pathway. Protein homeostasis in eukaryotes is controlled by proteasomal turn- promote incorporation of Atg8p--PE into autophagosomes, allowing over of unstable proteins via the ubiquitin system and lysosomal turn- Atg8p to promote autophagosome closure and cargo recruitment.
    [Show full text]
  • CLINT1 (NM 001195556) Human Untagged Clone – SC331189 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC331189 CLINT1 (NM_001195556) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: CLINT1 (NM_001195556) Human Untagged Clone Tag: Tag Free Symbol: CLINT1 Synonyms: CLINT; ENTH; EPN4; EPNR Vector: pCMV6 series This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 CLINT1 (NM_001195556) Human Untagged Clone – SC331189 Fully Sequenced ORF: >NCBI ORF sequence for NM_001195556, the custom clone sequence may differ by one or more nucleotides ATGAATTATTCAGAGATCGAGTCTAAGGTTCGAGAGGCAACGAACGATGATCCTTGGGGACCTTCTGGGC AACTCATGGGAGAGATTGCCAAGGCTACATTTATGTATGAACAATTTCCAGAACTTATGAACATGCTTTG GTCACGAATGTTAAAAGACAACAAAAAGAATTGGAGAAGAGTTTATAAGTCGTTGCTGCTCCTAGCTTAC CTCATAAGGAATGGATCAGAGCGTGTTGTTACAAGTGCCAGAGAACACATTTATGATTTACGATCCCTGG AAAATTACCACTTTGTAGATGAGCATGGTAAGGATCAAGGTATAAATATTCGACAGAAGGTGAAGGAATT GGTTGAATTTGCCCAGGATGACGACAGGCTTCGTGAAGAGCGAAAGAAAGCAAAGAAGAACAAAGACAAG TATGTTGGGGTTTCCTCAGACAGTGTTGGAGGATTCAGATACAGTGAAAGATATGATCCTGAGCCCAAAT CAAAATGGGATGAGGAGTGGGATAAAAACAAGAGTGCTTTTCCATTCAGTGATAAATTAGGTGAGCTGAG TGATAAAATTGGAAGCACAATTGATGACACCATCAGCAAGTTCCGGAGGAAAGATAGAGAAGACTCTCCA GAAAGATGCAGCGACAGCGATGAGGAAAAGAAAGCGAGAAGAGGCAGATCTCCCAAAGGTGAATTCAAAG ATGAAGAGGAGACTGTGACGACAAAGCATATTCATATCACACAGGCCACAGAGACCACCACAACCAGACA
    [Show full text]
  • CLINT1 Mouse Monoclonal Antibody [Clone ID: OTI9E1] Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TA805981S CLINT1 Mouse Monoclonal Antibody [Clone ID: OTI9E1] Product data: Product Type: Primary Antibodies Clone Name: OTI9E1 Applications: WB Recommended Dilution: WB 1:2000 Reactivity: Human, Mouse, Rat Host: Mouse Isotype: IgG1 Clonality: Monoclonal Immunogen: Human recombinant protein fragment corresponding to amino acids 1-290 of human CLINT1(NP_055481) produced in E.coli. Formulation: PBS (PH 7.3) containing 1% BSA, 50% glycerol and 0.02% sodium azide. Concentration: 1 mg/ml Purification: Purified from mouse ascites fluids or tissue culture supernatant by affinity chromatography (protein A/G) Conjugation: Unconjugated Storage: Store at -20°C as received. Stability: Stable for 12 months from date of receipt. Predicted Protein Size: 68.1 kDa Gene Name: clathrin interactor 1 Database Link: NP_055481 Entrez Gene 9685 Human Q14677 Background: This gene encodes a protein with similarity to the epsin family of endocytic adapter proteins. The encoded protein interacts with clathrin, the adapter protein AP-1 and phosphoinositides. This protein may be involved in the formation of clathrin coated vesicles and trafficking between the trans-Golgi network and endosomes. Mutations in this gene are associated with a susceptibility to schizophrenia and psychotic disorders. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010] This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 CLINT1 Mouse Monoclonal Antibody [Clone ID: OTI9E1] – TA805981S Synonyms: CLINT; ENTH; EPN4; EPNR Product images: HEK293T cells were transfected with the pCMV6- ENTRY control (Left lane) or pCMV6-ENTRY CLINT1 ([RC202387], Right lane) cDNA for 48 hrs and lysed.
    [Show full text]
  • Tetracyclines Promote Survival and Fitness in Mitochondrial Disease Models
    LETTERS https://doi.org/10.1038/s42255-020-00334-y Tetracyclines promote survival and fitness in mitochondrial disease models Elizabeth A. Perry1,2,3,5, Christopher F. Bennett 1,2,5, Chi Luo1,2, Eduardo Balsa1,2, Mark Jedrychowski1,2, Katherine E. O’Malley1,2, Pedro Latorre-Muro 1,2, Richard Porter Ladley 4, Kamar Reda4, Peter M. Wright4, Steven P. Gygi 2, Andrew G. Myers4 and Pere Puigserver 1,2 ✉ Mitochondrial diseases (MDs) are a heterogeneous group of and drugs that inhibit HSP90 and the mammalian target of disorders resulting from mutations in nuclear or mitochondrial rapamycin (mTOR; Fig. 1c). mTOR inhibitors improve lifespan DNA genes encoding mitochondrial proteins1,2. MDs cause in multiple models of MDs12–15, validating our screening platform pathologies with severe tissue damage and ultimately death3,4. for moving compounds towards in vivo testing. Top hits from the There are no cures for MDs and current treatments are only screen were retested in a non-high-throughput 7-d low-glucose palliative5–7. Here we show that tetracyclines improve fitness cell survival assay (Fig. 1d). Among the top-scoring compounds, of cultured MD cells and ameliorate disease in a mouse model tetracyclines such as doxycycline promoted the highest survival of Leigh syndrome. To identify small molecules that prevent and proliferation in MELAS cells (Fig. 1d). These effects were not cellular damage and death under nutrient stress conditions, exclusive to MELAS cybrids as other mitochondrial mutant cells we conduct a chemical high-throughput screen with cells car- such as Rieske (complex III) knockout (KO) mouse fibroblasts16 rying human MD mutations and discover a series of antibiotics and ND1 A3796G and ND6 G14459A (complex I)17 homoplasmic that maintain survival of various MD cells.
    [Show full text]
  • Rare Disruptive Variants in the DISC1 Interactome and Regulome: Association with Cognitive Ability and Schizophrenia
    OPEN Molecular Psychiatry (2018) 23, 1270–1277 www.nature.com/mp ORIGINAL ARTICLE Rare disruptive variants in the DISC1 Interactome and Regulome: association with cognitive ability and schizophrenia S Teng1,2,10, PA Thomson3,4,10, S McCarthy1,10, M Kramer1, S Muller1, J Lihm1, S Morris3, DC Soares3, W Hennah5, S Harris3,4, LM Camargo6, V Malkov7, AM McIntosh8, JK Millar3, DH Blackwood8, KL Evans4, IJ Deary4,9, DJ Porteous3,4 and WR McCombie1 Schizophrenia (SCZ), bipolar disorder (BD) and recurrent major depressive disorder (rMDD) are common psychiatric illnesses. All have been associated with lower cognitive ability, and show evidence of genetic overlap and substantial evidence of pleiotropy with cognitive function and neuroticism. Disrupted in schizophrenia 1 (DISC1) protein directly interacts with a large set of proteins (DISC1 Interactome) that are involved in brain development and signaling. Modulation of DISC1 expression alters the expression of a circumscribed set of genes (DISC1 Regulome) that are also implicated in brain biology and disorder. Here we report targeted sequencing of 59 DISC1 Interactome genes and 154 Regulome genes in 654 psychiatric patients and 889 cognitively-phenotyped control subjects, on whom we previously reported evidence for trait association from complete sequencing of the DISC1 locus. Burden analyses of rare and singleton variants predicted to be damaging were performed for psychiatric disorders, cognitive variables and personality traits. The DISC1 Interactome and Regulome showed differential association across the phenotypes tested. After family-wise error correction across all traits (FWERacross), an increased burden of singleton disruptive variants in the Regulome was associated with SCZ (FWERacross P=0.0339).
    [Show full text]
  • Genetic Characterisation of Dog Personality Traits
    Genetics: Early Online, published on April 10, 2017 as 10.1534/genetics.116.192674 1 Genetic characterisation of dog personality traits 2 3 Joanna Ilska1 4 Marie J. Haskell1 5 Sarah C. Blott2 6 Enrique Sánchez-Molano3 7 Zita Polgar3 8 Sarah E. Lofgren4 9 Dylan N. Clements3 10 Pamela Wiener3 11 12 1. Scotland’s Rural College, Edinburgh, Scotland, UK 13 2. University of Nottingham, Sutton Bonington, England, UK 14 3. The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of 15 Edinburgh, Easter Bush, Scotland, UK 16 4. Youth Science Institute, Los Gatos, California, USA 17 1 Copyright 2017. 18 Abstract 19 The genetic architecture of behavioural traits in dogs is of great interest to owners, breeders 20 and professionals involved in animal welfare, as well as to scientists studying the genetics of 21 animal (including human) behaviour. The genetic component of dog behaviour is supported 22 by between-breed differences and some evidence of within-breed variation. However, it is a 23 challenge to gather sufficiently large datasets to dissect the genetic basis of complex traits 24 such as behaviour, which are both time-consuming and logistically difficult to measure, and 25 known to be influenced by non-genetic factors. In this study, we exploited the knowledge that 26 owners have of their dogs to generate a large dataset of personality traits in Labrador 27 Retrievers. While accounting for key environmental factors, we demonstrate that genetic 28 variance can be detected for dog personality traits assessed using questionnaire data. We 29 identified substantial genetic variance for several traits, including fetching tendency and fear 30 of loud noises, while other traits revealed negligibly small heritabilities.
    [Show full text]