Genetic Characterisation of Dog Personality Traits

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Genetics: Early Online, published on April 10, 2017 as 10.1534/genetics.116.192674 1 Genetic characterisation of dog personality traits 2 3 Joanna Ilska1 4 Marie J. Haskell1 5 Sarah C. Blott2 6 Enrique Sánchez-Molano3 7 Zita Polgar3 8 Sarah E. Lofgren4 9 Dylan N. Clements3 10 Pamela Wiener3 11 12 1. Scotland’s Rural College, Edinburgh, Scotland, UK 13 2. University of Nottingham, Sutton Bonington, England, UK 14 3. The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of 15 Edinburgh, Easter Bush, Scotland, UK 16 4. Youth Science Institute, Los Gatos, California, USA 17 1 Copyright 2017. 18 Abstract 19 The genetic architecture of behavioural traits in dogs is of great interest to owners, breeders 20 and professionals involved in animal welfare, as well as to scientists studying the genetics of 21 animal (including human) behaviour. The genetic component of dog behaviour is supported 22 by between-breed differences and some evidence of within-breed variation. However, it is a 23 challenge to gather sufficiently large datasets to dissect the genetic basis of complex traits 24 such as behaviour, which are both time-consuming and logistically difficult to measure, and 25 known to be influenced by non-genetic factors. In this study, we exploited the knowledge that 26 owners have of their dogs to generate a large dataset of personality traits in Labrador 27 Retrievers. While accounting for key environmental factors, we demonstrate that genetic 28 variance can be detected for dog personality traits assessed using questionnaire data. We 29 identified substantial genetic variance for several traits, including fetching tendency and fear 30 of loud noises, while other traits revealed negligibly small heritabilities. Genetic correlations 31 were also estimated between traits, however, due to fairly large standard errors, only a 32 handful of trait pairs yielded statistically significant estimates. Genomic analyses indicated 33 that these traits are mainly polygenic, such that individual genomic regions have small 34 effects, and suggested chromosomal associations for six of the traits. The polygenic nature of 35 these traits is consistent with previous behavioural genetics studies in other species, for 36 example in mouse, and confirms that large datasets are required to quantify the genetic 37 variance and to identify the individual genes that influence behavioural traits. 38 39 Key words: canine genetics, dog, temperament, personality, heritability, genome-wide 40 association 2 41 Introduction 42 Dogs play important roles as companions and helpers for humans and dog personality 43 influences their ability to carry out these functions (Jones & Gosling 2005), where personality 44 refers to individual consistency in behavioural responsiveness to stimuli and situations. The 45 distinct behavioural predispositions of individual dog breeds clearly indicate a strong genetic 46 component to dog personality, which is further strengthened by estimates of substantial 47 within-breed genetic variance found for a variety of dog behavioural traits across studies (e.g. 48 Wilsson & Sundgren 1997; Saetre et al. 2006; Meyer et al. 2012; Arvelius et al. 2014a; 49 Persson et al. 2015). 50 The majority of dog behaviour studies have been carried out on working dogs and have used 51 standardised tests, where the effects of the environment at the time of the test could be clearly 52 characterised. These standardised tests in controlled environments provide estimates of 53 moderate heritability for some tested behaviours, e.g. heritability of “gun shyness” has been 54 estimated at 0.56 (SE 0.09) in Labrador Retrievers (van der Waaij et al. 2008). However, the 55 majority of the reported heritability estimates for these traits fall below 0.4 (e.g. Wilsson & 56 Sundgren 1997; Saetre et al. 2006; van der Waaij et al. 2008; Arvelius et al. 2014b), with 57 various management and lifestyle factors (e.g. training practices, Haverbeke et al. 2010) 58 shown to affect behaviour. Thus, large datasets are required for accurate decomposition of the 59 variance in these traits into genetic and non-genetic components. Generating such datasets 60 requires substantial infrastructure which, in practice, may be unattainable for most pet dog 61 populations. Thus, even though personality traits are extremely important for the well-being 62 of both the dog and its owner, their heritabilities for pet dogs, usually not subjected to any 63 formalized behaviour testing, are still largely unknown. 64 Genomic methodologies like GWAS that assess markers across the genome have been used 65 to determine associations between traits and particular genetic variants. However, again 66 substantial datasets are required to identify genomic associations or to obtain genomic 67 predictions when a large number of small genetic effects are involved, as is expected to be 68 the case for behavioural traits (Willis-Owen & Flint 2006). As a result, few genomic analyses 69 have been applied to dog behaviour traits so far and thus, little is known about their genetic 70 architecture or the individual genes involved. Variation in a few functional candidate genes 71 (e.g. DRD4, TH, OXTR, SLC6A) has been shown to be associated with behaviour in dogs 72 (Våge et al. 2010; Kubinyi et al. 2012; Wan et al. 2013; Kis et al. 2014). However, these 3 73 detected associations are only a starting point in the process of understanding the molecular 74 genetic basis of dog behaviour. 75 Thus, the size of available datasets is a limiting factor to the dissection of the variance 76 components of behavioural traits as well as to the characterisation of their genetic 77 architecture. An alternative approach to using data from standardised tests would be to 78 exploit the knowledge that pet owners and dog breeders have of their own dogs in everyday 79 situations, in order to accumulate sufficiently large datasets. The size of these datasets could 80 then overcome the lack of standardised assessment and at the same time, avoid possible 81 interactions between the behaviour and the somewhat artificial conditions of the test 82 environment. 83 A survey-based approach has been now utilized in a number of studies on dog behaviour, 84 where the dog owner’s answers to validated questionnaires, such as Canine Behavioral 85 Assessment and Research Questionnaire (C-BARQ), were used to assess the personality traits 86 of the dog. C-BARQ was developed at the University of Pennsylvania originally as a method 87 for evaluating and predicting the success of guide dogs (Serpell & Hsu 2001). The reliability 88 and validity of C-BARQ demonstrated by the developers of the method and others (e.g. Hsu 89 & Serpell 2003; Svartberg 2005; Duffy & Serpell 2012) as well as the relationship between 90 C-BARQ responses and standardised test scores (Arvelius et al. 2014a) support its use as a 91 tool in behavioural research (Wiener & Haskell, 2016). Subsequently, it has been applied in 92 studies of dog behaviour by various groups (e.g. Liinamo et al. 2007; Kutsumi et al. 2013). 93 The C-BARQ survey contains 101 questions regarding the dog’s behavioural response to 94 various situations, with answers marked on a 5-step scale. The particular items of the 95 C-BARQ questionnaires are then typically grouped into factors describing a personality trait. 96 In most studies (e.g. Arvelius et al. 2014a; Asp et al. 2015), the grouping of questions and 97 number of resulting traits are largely based on the definitions derived by the developers of the 98 questionnaire (Hsu & Serpell 2003; Duffy & Serpell 2012), who used factor analysis to 99 define 11 (and later, 14) behavioural traits. In a previous study of Labrador Retrievers, we 100 used multivariate statistical techniques to define 12 personality traits from C-BARQ data 101 (Lofgren et al. 2014), some of which overlapped the previous grouping while others were 102 novel. 4 103 In this paper we used quantitative genetic and genomic approaches to investigate the genetic 104 contribution to everyday life behaviour, as assessed by C-BARQ data, in the Labrador 105 Retriever breed. 106 107 Methods 108 Personality trait characterisation 109 The data used in the study were a subset of a larger study on genetics of complex traits in 110 dogs, and consisted of owner-supplied responses to C-BARQ as well as a separate 111 demographic questionnaire. The dataset was limited to UK Kennel Club-registered Labrador 112 Retrievers. We previously applied a combination of Principal Components Analysis and 113 correlation structure to derive 12 behaviour traits (subsequently referred to as “SetA traits”): 114 Agitated when Ignored (Agitated), Attention-seeking (Attention), Barking Tendency 115 (Barking), Excitability, Fetching, Human and Object Fear (HOFear), Noise Fear (NoiseFear), 116 Non-owner-directed Aggression (NOAggression), Owner-directed Aggression 117 (OAggression), Separation Anxiety (SepAnxiety), Trainability and Unusual Behaviour 118 (Unusual) (Lofgren et al. 2014). The 12 trait values were calculated as averages of the 119 responses observed in each associated group, where the number of questions in the group 120 ranged from 1 (Barking, Fetching) to 20 (Unusual) (Supplementary Table 3 in Lofgren et al. 121 2014), as long as at least half of the questions were answered (otherwise, the dog’s record for 122 that trait was treated as missing). The final dataset used in the current analyses included 1,975 123 animals. The numbers of observations and the range of scores observed for each of the SetA 124 traits are presented in Table 1. Two of the traits (OAggression and SepAnxiety) showed 125 highly skewed distributions, with most dogs showing no evidence of these behavioural 126 characteristics. For comparison, we also calculated values for the 14 traits previously defined 127 for C-BARQ data (subsequently referred to as “SetB traits”) (Hsu & Serpell 2003; Duffy & 128 Serpell 2012), for the same dogs as in SetA.
Recommended publications
  • Mutation-Specific and Common Phosphotyrosine Signatures of KRAS G12D and G13D Alleles Anticipated Graduation August 1St, 2018

    Mutation-Specific and Common Phosphotyrosine Signatures of KRAS G12D and G13D Alleles Anticipated Graduation August 1St, 2018

    MUTATION-SPECIFIC AND COMMON PHOSPHOTYROSINE SIGNATURES OF KRAS G12D AND G13D ALLELES by Raiha Tahir A dissertation submitted to The Johns Hopkins University in conformity with the requirement of the degree of Doctor of Philosophy Baltimore, MD August 2018 © 2018 Raiha Tahir All Rights Reserved ABSTRACT KRAS is one of the most frequently mutated genes across all cancer subtypes. Two of the most frequent oncogenic KRAS mutations observed in patients result in glycine to aspartic acid substitution at either codon 12 (G12D) or 13 (G13D). Although the biochemical differences between these two predominant mutations are not fully understood, distinct clinical features of the resulting tumors suggest involvement of disparate signaling mechanisms. When we compared the global phosphotyrosine proteomic profiles of isogenic colorectal cancer cell lines bearing either G12D or G13D KRAS mutations, we observed both shared as well as unique signaling events induced by the two KRAS mutations. Remarkably, while the G12D mutation led to an increase in membrane proximal and adherens junction signaling, the G13D mutation led to activation of signaling molecules such as non-receptor tyrosine kinases, MAPK kinases and regulators of metabolic processes. The importance of one of the cell surface molecules, MPZL1, which found to be hyperphosphorylated in G12D cells, was confirmed by cellular assays as its knockdown led to a decrease in proliferation of G12D but not G13D expressing cells. Overall, our study reveals important signaling differences across two common KRAS mutations and highlights the utility of our approach to systematically dissect the subtle differences between related oncogenic mutants and potentially lead to individualized treatments.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • 1 Supporting Information for a Microrna Network Regulates

    1 Supporting Information for a Microrna Network Regulates

    Supporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia.
  • Convergent Functional Genomics of Schizophrenia: from Comprehensive Understanding to Genetic Risk Prediction

    Convergent Functional Genomics of Schizophrenia: from Comprehensive Understanding to Genetic Risk Prediction

    Molecular Psychiatry (2012) 17, 887 -- 905 & 2012 Macmillan Publishers Limited All rights reserved 1359-4184/12 www.nature.com/mp IMMEDIATE COMMUNICATION Convergent functional genomics of schizophrenia: from comprehensive understanding to genetic risk prediction M Ayalew1,2,9, H Le-Niculescu1,9, DF Levey1, N Jain1, B Changala1, SD Patel1, E Winiger1, A Breier1, A Shekhar1, R Amdur3, D Koller4, JI Nurnberger1, A Corvin5, M Geyer6, MT Tsuang6, D Salomon7, NJ Schork7, AH Fanous3, MC O’Donovan8 and AB Niculescu1,2 We have used a translational convergent functional genomics (CFG) approach to identify and prioritize genes involved in schizophrenia, by gene-level integration of genome-wide association study data with other genetic and gene expression studies in humans and animal models. Using this polyevidence scoring and pathway analyses, we identify top genes (DISC1, TCF4, MBP, MOBP, NCAM1, NRCAM, NDUFV2, RAB18, as well as ADCYAP1, BDNF, CNR1, COMT, DRD2, DTNBP1, GAD1, GRIA1, GRIN2B, HTR2A, NRG1, RELN, SNAP-25, TNIK), brain development, myelination, cell adhesion, glutamate receptor signaling, G-protein-- coupled receptor signaling and cAMP-mediated signaling as key to pathophysiology and as targets for therapeutic intervention. Overall, the data are consistent with a model of disrupted connectivity in schizophrenia, resulting from the effects of neurodevelopmental environmental stress on a background of genetic vulnerability. In addition, we show how the top candidate genes identified by CFG can be used to generate a genetic risk prediction score (GRPS) to aid schizophrenia diagnostics, with predictive ability in independent cohorts. The GRPS also differentiates classic age of onset schizophrenia from early onset and late-onset disease.
  • The Transition from Primary Colorectal Cancer to Isolated Peritoneal Malignancy

    The Transition from Primary Colorectal Cancer to Isolated Peritoneal Malignancy

    medRxiv preprint doi: https://doi.org/10.1101/2020.02.24.20027318; this version posted February 25, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY 4.0 International license . The transition from primary colorectal cancer to isolated peritoneal malignancy is associated with a hypermutant, hypermethylated state Sally Hallam1, Joanne Stockton1, Claire Bryer1, Celina Whalley1, Valerie Pestinger1, Haney Youssef1, Andrew D Beggs1 1 = Surgical Research Laboratory, Institute of Cancer & Genomic Science, University of Birmingham, B15 2TT. Correspondence to: Andrew Beggs, [email protected] KEYWORDS: Colorectal cancer, peritoneal metastasis ABBREVIATIONS: Colorectal cancer (CRC), Colorectal peritoneal metastasis (CPM), Cytoreductive surgery and heated intraperitoneal chemotherapy (CRS & HIPEC), Disease free survival (DFS), Differentially methylated regions (DMR), Overall survival (OS), TableFormalin fixed paraffin embedded (FFPE), Hepatocellular carcinoma (HCC) ARTICLE CATEGORY: Research article NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. 1 medRxiv preprint doi: https://doi.org/10.1101/2020.02.24.20027318; this version posted February 25, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY 4.0 International license . NOVELTY AND IMPACT: Colorectal peritoneal metastasis (CPM) are associated with limited and variable survival despite patient selection using known prognostic factors and optimal currently available treatments.
  • Computational Analyses of Small Molecules Activity from Phenotypic Screens

    Computational Analyses of Small Molecules Activity from Phenotypic Screens

    Computational analyses of small molecules activity from phenotypic screens Azedine Zoufir Hughes Hall This dissertation is submitted for the degree of Doctor of Philosophy July 2018 Declaration This thesis is submitted as the result of my own work and includes nothing which is the outcome of work done in collaboration except where specifically indicated in the text. It is not substantially the same as any that I have submitted, or, is being concurrently submitted for a degree or diploma or other qualification at the University of Cambridge or any other University or similar institution except as declared in the preface and specified in the text. I further state that no substantial part of my dissertation has already been submitted, or, is being concurrently submitted for any such degree, diploma or other qualification at the University of Cambridge or any other University or similar institution except as declared in the Preface and specified in the text. This dissertation does not exceed the word limit of 60,000 words. Azedine Zoufir July 2018 Summary Title: Computational analyses of small molecules activity from phenotypic screens Author: Azedine Zoufir Drug discovery is no longer relying on the one gene-one disease paradigm nor on target-based screening alone to discover new drugs. Phenotypic-based screening is regaining momentum to discover new compounds since those assays provide an environment closer to the physiological state of the disease and allow to better anticipate off-target effects and other factors that can limit the efficacy of the drugs. However, uncovering the mechanism of action of the compounds active in those assays relies on in vitro techniques that are expensive and time- consuming.
  • Network Organization of the Human Autophagy System

    Network Organization of the Human Autophagy System

    Vol 466 | 1 July 2010 | doi:10.1038/nature09204 ARTICLES Network organization of the human autophagy system Christian Behrends1, Mathew E. Sowa1, Steven P. Gygi2 & J. Wade Harper1 Autophagy, the process by which proteins and organelles are sequestered in autophagosomal vesicles and delivered to the lysosome/vacuole for degradation, provides a primary route for turnover of stable and defective cellular proteins. Defects in this system are linked with numerous human diseases. Although conserved protein kinase, lipid kinase and ubiquitin-like protein conjugation subnetworks controlling autophagosome formation and cargo recruitment have been defined, our understanding of the global organization of this system is limited. Here we report a proteomic analysis of the autophagy interaction network in human cells under conditions of ongoing (basal) autophagy, revealing a network of 751 interactions among 409 candidate interacting proteins with extensive connectivity among subnetworks. Many new autophagy interaction network components have roles in vesicle trafficking, protein or lipid phosphorylation and protein ubiquitination, and affect autophagosome number or flux when depleted by RNA interference. The six ATG8 orthologues in humans (MAP1LC3/GABARAP proteins) interact with a cohort of 67 proteins, with extensive binding partner overlap between family members, and frequent involvement of a conserved surface on ATG8 proteins known to interact with LC3-interacting regions in partner proteins. These studies provide a global view of the mammalian autophagy interaction landscape and a resource for mechanistic analysis of this critical protein homeostasis pathway. Protein homeostasis in eukaryotes is controlled by proteasomal turn- promote incorporation of Atg8p--PE into autophagosomes, allowing over of unstable proteins via the ubiquitin system and lysosomal turn- Atg8p to promote autophagosome closure and cargo recruitment.
  • CLINT1 (NM 001195556) Human Untagged Clone – SC331189 | Origene

    CLINT1 (NM 001195556) Human Untagged Clone – SC331189 | Origene

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC331189 CLINT1 (NM_001195556) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: CLINT1 (NM_001195556) Human Untagged Clone Tag: Tag Free Symbol: CLINT1 Synonyms: CLINT; ENTH; EPN4; EPNR Vector: pCMV6 series This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 CLINT1 (NM_001195556) Human Untagged Clone – SC331189 Fully Sequenced ORF: >NCBI ORF sequence for NM_001195556, the custom clone sequence may differ by one or more nucleotides ATGAATTATTCAGAGATCGAGTCTAAGGTTCGAGAGGCAACGAACGATGATCCTTGGGGACCTTCTGGGC AACTCATGGGAGAGATTGCCAAGGCTACATTTATGTATGAACAATTTCCAGAACTTATGAACATGCTTTG GTCACGAATGTTAAAAGACAACAAAAAGAATTGGAGAAGAGTTTATAAGTCGTTGCTGCTCCTAGCTTAC CTCATAAGGAATGGATCAGAGCGTGTTGTTACAAGTGCCAGAGAACACATTTATGATTTACGATCCCTGG AAAATTACCACTTTGTAGATGAGCATGGTAAGGATCAAGGTATAAATATTCGACAGAAGGTGAAGGAATT GGTTGAATTTGCCCAGGATGACGACAGGCTTCGTGAAGAGCGAAAGAAAGCAAAGAAGAACAAAGACAAG TATGTTGGGGTTTCCTCAGACAGTGTTGGAGGATTCAGATACAGTGAAAGATATGATCCTGAGCCCAAAT CAAAATGGGATGAGGAGTGGGATAAAAACAAGAGTGCTTTTCCATTCAGTGATAAATTAGGTGAGCTGAG TGATAAAATTGGAAGCACAATTGATGACACCATCAGCAAGTTCCGGAGGAAAGATAGAGAAGACTCTCCA GAAAGATGCAGCGACAGCGATGAGGAAAAGAAAGCGAGAAGAGGCAGATCTCCCAAAGGTGAATTCAAAG ATGAAGAGGAGACTGTGACGACAAAGCATATTCATATCACACAGGCCACAGAGACCACCACAACCAGACA
  • CLINT1 Mouse Monoclonal Antibody [Clone ID: OTI9E1] Product Data

    CLINT1 Mouse Monoclonal Antibody [Clone ID: OTI9E1] Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TA805981S CLINT1 Mouse Monoclonal Antibody [Clone ID: OTI9E1] Product data: Product Type: Primary Antibodies Clone Name: OTI9E1 Applications: WB Recommended Dilution: WB 1:2000 Reactivity: Human, Mouse, Rat Host: Mouse Isotype: IgG1 Clonality: Monoclonal Immunogen: Human recombinant protein fragment corresponding to amino acids 1-290 of human CLINT1(NP_055481) produced in E.coli. Formulation: PBS (PH 7.3) containing 1% BSA, 50% glycerol and 0.02% sodium azide. Concentration: 1 mg/ml Purification: Purified from mouse ascites fluids or tissue culture supernatant by affinity chromatography (protein A/G) Conjugation: Unconjugated Storage: Store at -20°C as received. Stability: Stable for 12 months from date of receipt. Predicted Protein Size: 68.1 kDa Gene Name: clathrin interactor 1 Database Link: NP_055481 Entrez Gene 9685 Human Q14677 Background: This gene encodes a protein with similarity to the epsin family of endocytic adapter proteins. The encoded protein interacts with clathrin, the adapter protein AP-1 and phosphoinositides. This protein may be involved in the formation of clathrin coated vesicles and trafficking between the trans-Golgi network and endosomes. Mutations in this gene are associated with a susceptibility to schizophrenia and psychotic disorders. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010] This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 CLINT1 Mouse Monoclonal Antibody [Clone ID: OTI9E1] – TA805981S Synonyms: CLINT; ENTH; EPN4; EPNR Product images: HEK293T cells were transfected with the pCMV6- ENTRY control (Left lane) or pCMV6-ENTRY CLINT1 ([RC202387], Right lane) cDNA for 48 hrs and lysed.
  • Tetracyclines Promote Survival and Fitness in Mitochondrial Disease Models

    Tetracyclines Promote Survival and Fitness in Mitochondrial Disease Models

    LETTERS https://doi.org/10.1038/s42255-020-00334-y Tetracyclines promote survival and fitness in mitochondrial disease models Elizabeth A. Perry1,2,3,5, Christopher F. Bennett 1,2,5, Chi Luo1,2, Eduardo Balsa1,2, Mark Jedrychowski1,2, Katherine E. O’Malley1,2, Pedro Latorre-Muro 1,2, Richard Porter Ladley 4, Kamar Reda4, Peter M. Wright4, Steven P. Gygi 2, Andrew G. Myers4 and Pere Puigserver 1,2 ✉ Mitochondrial diseases (MDs) are a heterogeneous group of and drugs that inhibit HSP90 and the mammalian target of disorders resulting from mutations in nuclear or mitochondrial rapamycin (mTOR; Fig. 1c). mTOR inhibitors improve lifespan DNA genes encoding mitochondrial proteins1,2. MDs cause in multiple models of MDs12–15, validating our screening platform pathologies with severe tissue damage and ultimately death3,4. for moving compounds towards in vivo testing. Top hits from the There are no cures for MDs and current treatments are only screen were retested in a non-high-throughput 7-d low-glucose palliative5–7. Here we show that tetracyclines improve fitness cell survival assay (Fig. 1d). Among the top-scoring compounds, of cultured MD cells and ameliorate disease in a mouse model tetracyclines such as doxycycline promoted the highest survival of Leigh syndrome. To identify small molecules that prevent and proliferation in MELAS cells (Fig. 1d). These effects were not cellular damage and death under nutrient stress conditions, exclusive to MELAS cybrids as other mitochondrial mutant cells we conduct a chemical high-throughput screen with cells car- such as Rieske (complex III) knockout (KO) mouse fibroblasts16 rying human MD mutations and discover a series of antibiotics and ND1 A3796G and ND6 G14459A (complex I)17 homoplasmic that maintain survival of various MD cells.
  • Rare Disruptive Variants in the DISC1 Interactome and Regulome: Association with Cognitive Ability and Schizophrenia

    Rare Disruptive Variants in the DISC1 Interactome and Regulome: Association with Cognitive Ability and Schizophrenia

    OPEN Molecular Psychiatry (2018) 23, 1270–1277 www.nature.com/mp ORIGINAL ARTICLE Rare disruptive variants in the DISC1 Interactome and Regulome: association with cognitive ability and schizophrenia S Teng1,2,10, PA Thomson3,4,10, S McCarthy1,10, M Kramer1, S Muller1, J Lihm1, S Morris3, DC Soares3, W Hennah5, S Harris3,4, LM Camargo6, V Malkov7, AM McIntosh8, JK Millar3, DH Blackwood8, KL Evans4, IJ Deary4,9, DJ Porteous3,4 and WR McCombie1 Schizophrenia (SCZ), bipolar disorder (BD) and recurrent major depressive disorder (rMDD) are common psychiatric illnesses. All have been associated with lower cognitive ability, and show evidence of genetic overlap and substantial evidence of pleiotropy with cognitive function and neuroticism. Disrupted in schizophrenia 1 (DISC1) protein directly interacts with a large set of proteins (DISC1 Interactome) that are involved in brain development and signaling. Modulation of DISC1 expression alters the expression of a circumscribed set of genes (DISC1 Regulome) that are also implicated in brain biology and disorder. Here we report targeted sequencing of 59 DISC1 Interactome genes and 154 Regulome genes in 654 psychiatric patients and 889 cognitively-phenotyped control subjects, on whom we previously reported evidence for trait association from complete sequencing of the DISC1 locus. Burden analyses of rare and singleton variants predicted to be damaging were performed for psychiatric disorders, cognitive variables and personality traits. The DISC1 Interactome and Regulome showed differential association across the phenotypes tested. After family-wise error correction across all traits (FWERacross), an increased burden of singleton disruptive variants in the Regulome was associated with SCZ (FWERacross P=0.0339).
  • Is Required for Egg Chamber Morphogenesis During Drosophila Oogenesis

    Is Required for Egg Chamber Morphogenesis During Drosophila Oogenesis

    Liquid facets-Related (lqfR) Is Required for Egg Chamber Morphogenesis during Drosophila Oogenesis Peter A. Leventis1,2, Tanya R. Da Sylva1, Nimerta Rajwans1, Sylwia Wasiak3, Peter S. McPherson3, Gabrielle L. Boulianne1,2,4* 1 Program in Developmental and Stem Cell Biology, Hospital for Sick Children, Toronto, Ontario, Canada, 2 Department of Cell and Systems Biology, University of Toronto, Toronto, Ontario, Canada, 3 Montreal Neurological Institute, McGill University, Montreal, Quebec, Canada, 4 Department of Molecular Genetics, University of Toronto, Toronto, Ontario, Canada Abstract Clathrin interactor 1 [CLINT1] (also called enthoprotin/EpsinR) is an Epsin N-terminal homology (ENTH) domain-containing adaptor protein that functions in anterograde and retrograde clathrin-mediated trafficking between the trans-Golgi network and the endosome. Removal of both Saccharomyces cerevisiae homologs, Ent3p and Ent5p, result in yeast that are viable, but that display a cold-sensitive growth phenotype and mistrafficking of various vacuolar proteins. Similarly, either knock- down or overexpression of vertebrate CLINT1 in cell culture causes mistrafficking of proteins. Here, we have characterized Drosophila CLINT1, liquid-facets Related (lqfR). LqfR is ubiquitously expressed throughout development and is localized to the Golgi and endosome. Strong hypomorphic mutants generated by imprecise P-element excision exhibit extra macrochaetae, rough eyes and are female sterile. Although essentially no eggs are laid, the ovaries do contain late-stage egg chambers that exhibit abnormal morphology. Germline clones reveal that LqfR expression in the somatic follicle cells is sufficient to rescue the oogenesis defects. Clones of mutant lqfR follicle cells have a decreased cell size consistent with a downregulation of Akt1. We find that while total Akt1 levels are increased there is also a significant decrease in activated phosphorylated Akt1.