The E3 Ubiquitin Ligase MARCHF6 Is a Critical Regulator of Cholesterol Metabolism

The E3 ubiquitin ligase MARCHF6 is a critical regulator of cholesterol metabolism

Nicola Anne Scott

Supervisor: Professor Andrew J. Brown

School of Biotechnology and Biomolecular Sciences

Faculty of Science

UNSW

Sydney, Australia

A thesis submitted in fulfilment of the requirements for the degree Doctor of Philosophy in Biochemistry and Molecular Genetics

May 2021

Thesis Dissertation Sheet

Surname/Family Name : Scott Given Name/s : Nicola Anne Abbreviation for degree as give in the University : PhD calendar Faculty : Faculty of Science School : School of Biotechnology and Biomolecular Sciences The E3 ubiquitin ligase MARCHF6 is a critical Thesis Title : regulator of cholesterol metabolism

Abstract Cholesterol is a vital lipid required for many biological processes including the maintenance of cell membranes, the formation of lipid rafts to aid in signalling, and acts as a precursor to important compounds such as bile acids and steroid hormones. Excess cholesterol can lead to numerous diseases including cardiovascular disease, neurological diseases, and many cancers. Conversely, too little cholesterol often leads to developmental disorders. Therefore, cholesterol levels are tightly controlled through several broad processes: cellular uptake, synthesis, and efflux. Transcriptional and post-translational control of these different pathways further fine-tunes cholesterol levels.

Prior research into the cholesterol synthesis pathway has primarily focused on 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGCR) the target of statins, a cholesterol lowering drug. In more recent years focus on other enzymes in the pathway such as squalene monooxygenase (SM) have increased the foundational knowledge of control within this pathway. One known regulator of the cholesterol synthesis pathway is the E3 ubiquitin ligase membrane associated RING C3HC4 finger 6 (MARCHF6), which targets both HMGCR and SM for degradation, as well as other cholesterol and lipid metabolism proteins. In this thesis, the post-translational control of MARCHF6 was investigated, with a particular focus on the role of cholesterol in these processes. However other factors were also considered. MARCHF6 protein levels are increased when cholesterol levels are elevated, leading to the rapid shutdown of the cholesterol synthesis pathway.

Next, MARCHF6 substrates were identified and candidates tested through a variety of low and high throughput methods. Finally, four additional candidate MARCHF6 substrates in the cholesterol synthesis pathway were identified, two of which were verified. Additionally, the post-translational regulation of the cholesterol synthesis enzyme lanosterol 14α-demethylase (LDM) was thoroughly investigated. Overall, these findings uncover a new mode of post-translational regulation for MARCHF6 by cholesterol and implicate MARCHF6 as having far greater control of the cholesterol synthesis pathway than previously thought.

Declaration relating to disposition of project thesis/dissertation

I hereby grant to the University of New South Wales or its agents a non-exclusive licence to archive and to make available (including to members of the public) my thesis or dissertation in whole or in part in the University libraries in all forms of media, now or here after known. I acknowledge that I retain all intellectual property rights which subsist in my thesis or dissertation, such as copyright and patent rights, subject to applicable law. I also retain the right to use all or part of my thesis or dissertation in future works (such as articles or books).

………………………………………………………………Signature …….……………………...12/05/2021 ...... Date

The University recognises that there may be exceptional circumstances requiring restrictions on copying or conditions on use. Requests for restriction for a period of up to 2 years can be made when submitting the final copies of your thesis to the UNSW Library. Requests for a longer period of restriction may be considered in exceptional circumstances and require the approval of the Dean of Graduate Research.

‘I hereby grant the University of New South Wales or its agents a non-exclusive licence to archive and to make available (including to members of the public) my thesis or dissertation in whole or part in the University libraries in all forms of media, now or here after known. I acknowledge that I retain all intellectual property rights which subsist in my thesis or dissertation, such as copyright and patent rights, subject to applicable law. I also retain the right to use all or part of my thesis or dissertation in future works (such as articles or books).’

‘For any substantial portions of copyright material used in this thesis, written permission for use has been obtained, or the copyright material is removed from the final public version of the thesis.’

Signed ……………………………………………......

Date ……………………………………………...... 12/05/2021 ......

Authenticity Statement

‘I certify that the Library deposit digital copy is a direct equivalent of the final officially approved version of my thesis.’

Signed ……………………………………………......

Date ……………………………………………...... 12/05/2021 ......

iii Originality Statement

‘I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of material which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the thesis. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project's design and conception or in style, presentation and linguistic expression is acknowledged.’

Signed ……………………………………………......

Date ……………………………………………...... 12/05/2021 ......

iv Inclusion of Publications

Statement

UNSW is supportive of candidates publishing their research results during their candidature as detailed in the UNSW Thesis Examination Procedure.

Publications can be used in their thesis in lieu of a Chapter if: • The candidate contributed greater than 50% of the content in the publication and is the “primary author”, ie. the candidate was responsible primarily for the planning, execution and preparation of the work for publication • The candidate has approval to include the publication in their thesis in lieu of a Chapter from their supervisor and Postgraduate Coordinator. • The publication is not subject to any obligations or contractual agreements with a third party that would constrain its inclusion in the thesis

Please indicate whether this thesis contains published material or not:

This thesis contains no publications, either published or submitted for ☐ publication

Some of the work described in this thesis has been published and it has ☒ been documented in the relevant Chapters with acknowledgement

This thesis has publications (either published or submitted for publication) incorporated into it in lieu of a chapter and the details are presented ☐ below

CANDIDATE’S DECLARATION I declare that: • I have complied with the UNSW Thesis Examination Procedure • where I have used a publication in lieu of a Chapter, the listed publication(s) below meet(s) the requirements to be included in the thesis. Candidate’s Name Signature Date (dd/mm/yy)

Nicola Anne Scott 12/05/2021

v vi Acknowledgements

There are many I would like to thank for their continued support and encouragement throughout my PhD.

Firstly, I would like to thank my supervisor Prof. Andrew Brown. You have been incredibly patient and supportive of me in all my scientific endeavours, particularly in those that I struggled with the most. Your advice and encouragement to not just me but to the whole lab is inspiring and I have been glad to have had such a wonderful experience in your lab.

To Laura, the beloved post-doc. I’m not sure how the lab would ever function without you. We’ve worked on several projects together and you have always been open to casual chats to plan our next move.

To Winnie and Vicky, you have both been patient and kind during your training of me at various points since I joined the lab and were incredibly important in starting and finalising various works throughout this thesis.

To Jake, I honestly don’t know how I would have ever finished my PhD without you. You were there in my first year as a PhD student during the chaos of moving buildings, all three senior members of the lab falling pregnant, and Andrew stepping down from his Head of School position. You were always happy for me to bounce ideas off you and provided incredible input during these discussions.

To Isabelle, who has been one of the most supportive friends and lab buddies. We met all the way back in undergrad, did Honours together with Andrew and now I’m finishing my PhD with you as well. You are one of my closest friends and greatest champions. You will be sorely missed, and I wish you the best in finishing your PhD.

To Hudson, what a rollercoaster. When I first met you, you were incredibly quiet. Now, you have come out of your shell and I am so glad to have known you. I can see that you will go far if you try.

vii To Lydia, it’s been great to see you grow as a scientist and I look forward to seeing your work in the future. I always valued our conversations on wildlife and our favourite shows.

To all other members of the Brown lab, past and present. It has been a pleasure working with you all and I could not have asked for a better bunch of people to work with.

To Jen and Ryan, our evenings out at the Chinese Dumpling and Noodle House with a couple of bottles of wine with the rest of the “Chop Chop” were what I looked forward to most after our long days in the lab. You will both do brilliantly in your PhDs.

To Alice, we started our Honour’s projects at the same time and now we are finishing our PhD’s together. I could not have asked for a better person to go through this process with.

To Beth and Gabbie, I couldn’t have asked for more supportive people during the last year of my PhD. You have both been encouraging during an incredibly difficult year and have given me plenty of your time to help with the job search process. I wish you both the best of luck with your post-docs.

To all other friends, none of this could have been done without your continued support. Our dinners out or a jaunt around to the bar for some drinks at the end of a long week were some of the most enjoyable times throughout my PhD. Many of you are conducting your own PhDs and I wish you the very best with all of your future endeavours.

To my family, I never could have done this without you. To my Mum, you are dearly loved. You worry too much, but I know it’s because you want the best for me. To my brothers, Peter and Matthew, we have had an absolute blast. To my extended family, you have all been supportive of me throughout this journey and taken time to read my publications even if you had no idea what any of it meant. And finally, to my Dad, you taught me patience and perseverance. You always thought education was incredibly important and I hope you would have been proud of the work I have done. I wish you were here to share this moment with me and the rest of the family.

viii

Abstract

Cholesterol is a vital lipid required for many biological processes including the maintenance of cell membranes, the formation of lipid rafts to aid in signalling, and acts as a precursor to important compounds such as bile acids and steroid hormones. Excess cholesterol can lead to numerous diseases including cardiovascular disease, neurological diseases, and many cancers. Conversely, too little cholesterol often leads to developmental disorders. Therefore, cholesterol levels are tightly controlled through several broad processes: cellular uptake, synthesis, and efflux. Transcriptional and post-translational control of these different pathways further fine-tunes cholesterol levels.

In this thesis, the post-translational control of MARCHF6 was investigated, with a particular focus on the role of cholesterol in these processes. However other factors were also considered. MARCHF6 protein levels are increased when cholesterol levels are elevated, leading to the rapid shutdown of the cholesterol synthesis pathway.

Overall, these findings uncover a new mode of post-translational regulation for MARCHF6 by cholesterol and implicate MARCHF6 as having far greater control of the cholesterol synthesis pathway than previously thought.

List of Publications

Throughout candidature, the following manuscripts were published:

Primary Articles

Sharpe, L. J.*, Howe, V.*, Scott, N. A., Luu, W., Phan, L., Berk, J.M., Hochstrasser, M., and Brown, A. J. (2019) Cholesterol increases protein levels of the E3 ligase MARCH6 and thereby stimulates protein degradation. J. Biol. Chem. 294 (7) 2436-2448 doi: 10.1074/jbc.RA118.005069.

Chua, N.K, Scott, N. A., and Brown, A. J. (2019) Valosin-containing protein mediates the ERAD of squalene monooxygenase and its cholesterol- responsive degron. Biochem. J. 476 (18) 2545-2560 doi: 10.1042/BCJ20190418.

Scott, N. A., Sharpe, L. J., Capell-Hattam, I. M., Gullo, S. J., Luu, W., and Brown, A.J. (2020) The cholesterol synthesis enzyme lanosterol 14α- demethylase is post-translationally regulated by the E3 ubiquitin ligase MARCH6, Biochem. J. 477 (2) 541-555 doi: 10.1042/BCJ20190647.

Review Articles

Scott, N. A., Sharpe, L.J., and Brown, A.J., (2021) The E3 ubiquitin ligase MARCHF6 as a metabolic integrator in cholesterol synthesis and beyond, BBA- Mol Cell Biol L 1866 (1) 158837 doi: 10.1016/j.bbalip.2020.158837.

* Equal first author

List of Presentations

The work described in this thesis has been presented at the following conferences:

Oral Presentations

• Scott, N. A. (2018) Gone fishing: the search for new prey for a protein munching monster. One Minute Thesis Competition, University of New South Wales, Sydney NSW. • Scott, N. A. (2020) The cholesterol synthesis enzyme lanosterol 14α- demethylase is post-translationally regulated by the E3 ubiquitin ligase MARCH6. Experimental Biology, San Diego, USA. * • Scott, N. A. (2020) Science in a Flash Competition, American Society for Biochemistry and Molecular Biology (ASBMB). • Scott, N. A. (2020) One Minute Thesis Competition, University of New South Wales, Sydney NSW.

Poster Presentations

• Scott, N. A., and Brown, A. J. (2018) Gone fishing: the search for new prey for a protein munching monster. One Minute Thesis Competition, University of New South Wales, Sydney NSW. • Scott, N. A., and Brown, A. J. (2018) The use of BioID to identify new substrates of the E3 ubiquitin ligase MARCH6. ComBio, Sydney, Australia. • Scott, N. A., Sharpe, L. J., Capell-Hattam, I. M., Gullo, S. J., Luu, W., Brown, A. J. (2020) The cholesterol synthesis enzyme lanosterol 14α- demethylase is post-translationally regulated by the E3 ubiquitin ligase MARCH6. Experimental Biology, San Diego, USA. * • Scott, N. A., Sharpe, L. J., Capell-Hattam, I. M., Gullo, S. J., Luu, W., Brown, A. J. (2020) The cholesterol synthesis enzyme lanosterol 14α- demethylase is post-translationally regulated by the E3 ubiquitin ligase MARCH6. EMBL Australia Postgraduate Symposium, Australia.

* The Experimental Biology 2020 Conference and associated presentations were made virtual due to COVID-19 pandemic. xii

Table of Contents

Thesis Dissertation Sheet ...... i Copyright Statement ...... iii Authenticity Statement ...... iii Originality Statement ...... iv Inclusion of Publications Statement ...... v Acknowledgements ...... vii Abstract ...... ix List of Publications ...... xi Primary Articles ...... xi Review Articles...... xi List of Presentations ...... xii Oral Presentations ...... xii Poster Presentations ...... xii Table of Contents ...... xiii List of Figures ...... xvii List of Tables ...... xix Abbreviations ...... xxi Chapter 1 General Introduction ...... 1 1.1 Importance of cholesterol ...... 3 1.2 Cholesterol synthesis...... 3 1.3 Protein turnover ...... 5 1.3.1 Endoplasmic reticulum associated degradation ...... 7 1.4 MARCHF6 ...... 8 1.4.1 The MARCHF6 gene and transcriptional regulation ...... 9 1.4.2 The MARCHF6 protein ...... 11 1.4.3 Interaction of ERAD components with MARCHF6 ...... 12 1.5 Substrates of MARCHF6 ...... 13 1.5.1 Cholesterol synthesis enzymes as MARCHF6 substrates ...... 14 1.5.2 Indirect transcriptional regulation of cholesterol by MARCHF6 ...... 15 1.5.3 Other lipid metabolism substrates of MARCHF6 ...... 15 1.5.4 Other substrates of MARCHF6 ...... 17 1.6 Aims and hypothesis ...... 18 Chapter 2 General Materials and Methods ...... 19 2.1 General Materials ...... 21 2.1.1 Commercial reagents ...... 21 2.1.2 Buffers and solutions ...... 26 2.1.3 Equipment ...... 27 xiii

2.1.4 Software ...... 28 2.2 General Methods ...... 29 2.2.1 Preparation of lipoprotein deficient serum ...... 29 2.2.2 Preparation of sterol/cyclodextrin complexes ...... 29 2.2.3 Cell lines and cell culture ...... 30 2.2.4 Cloning and Plasmids ...... 32 2.2.5 Transfections ...... 32 2.2.6 Quantitative real-time PCR (qRT-PCR) ...... 33 2.2.7 Protein harvest ...... 36 2.2.8 Western blotting ...... 36 2.2.9 Data presentation and statistical analysis ...... 38 Chapter 3 Post-translational regulation of MARCHF6 ...... 39 3.1 Introduction ...... 41 3.2 Methods ...... 43 3.2.1 Plasmids ...... 43 3.2.2 Site directed mutagenesis ...... 44 3.2.3 Cloning by restriction enzymes ...... 45 3.3 Results ...... 46 3.3.1 Cholesterol stabilises MARCHF6 protein levels ...... 46 3.3.2 Cholesterol inhibits the degradation of MARCHF6 ...... 48 3.3.3 ERAD associated E3 ubiquitin ligases may play a role in the degradation of MARCHF6 ...... 50 3.3.4 MARCHF6 may contain a sterol sensing domain ...... 52 3.3.5 Insigs are unlikely to be involved in the stabilisation of MARCHF6 by cholesterol ...... 54 3.3.6 Reactive oxygen species result in the rapid turnover of MARCHF6 56 3.3.7 The microprotein CASIMO1 that regulates the MARCHF6 substrate SM is transcriptionally responsive to steroid hormones ...... 58 3.3.8 The role of CASIMO1 in cholesterol homeostasis ...... 60 3.3.9 The ER membrane protein complex may be involved in the membrane insertion of MARCHF6 ...... 62 3.4 Discussion ...... 64 Chapter 4 Identification of new substrates of MARCHF6 ...... 69 4.1 Introduction ...... 71 4.2 Methods ...... 73 4.2.1 Plasmids ...... 73 4.2.2 Cloning by restriction enzymes ...... 74 4.2.3 Cloning by polymerase incomplete primer extension (PIPE) ...... 74 4.2.4 BioID ...... 76 4.2.5 Comparison of Mass Spectrometry Data ...... 78

xiv

4.3 Results ...... 79 4.3.1 Malic enzyme 2 is unlikely to be a MARCHF6 substrate ...... 79 4.3.2 A mutant form of Fat specific protein 27 may be a MARCHF6 substrate ...... 83 4.3.3 Physical characterisation of the FSP27 linker region ...... 85 4.3.4 The potential use of BioID to identify MARCHF6 substrates ...... 87 4.3.5 Mass spectrometry data fails to identify likely MARCHF6 substrate candidates ...... 91 4.4 Discussion ...... 93 Chapter 5 MARCHF6 extensively regulates the cholesterol synthesis pathway .. 95 5.1 Introduction ...... 97 5.2 Materials and Methods ...... 99 5.2.1 Plasmids ...... 99 5.2.2 Generation of stable cell lines ...... 101 5.2.3 Immunoprecipitation ...... 101 5.2.4 Quantitative real-time PCR ...... 102 5.3 Results ...... 103 5.3.1 LDM protein is turned over, whilst LSS remains stable ...... 103 5.3.2 Ectopic LDM differentiates between transcriptional and post- translational effects ...... 105 5.3.3 LDM is not degraded in response to excess sterols ...... 107 5.3.4 LDM is not degraded in response to hypoxia ...... 108 5.3.5 LDM is degraded in response to nitric oxide ...... 108 5.3.6 The E3 ubiquitin ligase MARCHF6 affects LDM levels...... 110 5.3.7 MARCHF6 does not control the nitric oxide triggered degradation of LDM ...... 112 5.3.8 MARCHF6 regulates LDM in a liver cell line ...... 112 5.3.9 MARCHF6 controls levels of another cholesterol synthesis enzyme, DHCR24...... 114 5.3.10 LDM and DHCR24 are ubiquitinated and interact with MARCHF6 116 5.3.11 SC4MOL and SC5D are turned over, whilst NSDHL remains stable ...... 118 5.3.12 SC4MOL and SC5D are likely MARCHF6 substrates ...... 120 5.4 Discussion ...... 123 Chapter 6 General Discussion ...... 127 6.1 Summary of Findings ...... 129 6.2 Regulation of MARCHF6 ...... 131 6.2.1 Transcriptional regulation of MARCHF6 ...... 131 6.2.2 Cholesterol mediated stabilisation of MARCHF6 ...... 132 6.2.3 Reactive oxygen species mediated degradation of MARCHF6 ..... 133 6.2.4 The role of CASIMO1 in the regulation of cholesterol metabolism 134 xv

6.2.5 The ER membrane protein complex for MARCHF6 membrane insertion ...... 135 6.3 Identification of new MARCHF6 substrates ...... 137 6.4 The role of MARCHF6 in cholesterol and lipid metabolism ...... 139 6.5 Mechanisms of action of MARCHF6 ...... 143 6.5.1 Cooperation of MARCHF6 with E2 conjugating enzymes ...... 144 6.5.2 Chaperones and retrotranslocation ...... 145 6.5.3 N-end rule protein degradation ...... 146 6.5.4 Degron architecture of MARCHF6 substrates ...... 147 6.6 Broader Implications and Future Directions ...... 149 6.7 Concluding remarks ...... 153 Chapter 7 References ...... 155 Chapter 8 Appendix ...... 179

xvi

List of Figures

Figure 1.1 Schematic of the cholesterol synthesis pathway ...... 4 Figure 1.2 Simplified overview of the ubiquitin proteasome system ...... 6 Figure 1.3. Genomic configuration of MARCHF6 ...... 10 Figure 1.4. Topology and structures of MARCHF6 ...... 12 Figure 1.5 Substrates of MARCHF6...... 16 Figure 3.1 Schematic representation of constructs utilised in Chapter 3 ...... 43 Figure 3.2 MARCHF6 is stabilised by cholesterol ...... 47 Figure 3.3 MARCHF6 degradation is inhibited by cholesterol ...... 49 Figure 3.4 gp78 may play a role in the basal regulation of MARCHF6 ...... 51 Figure 3.5 MARCHF6 may contain a sterol sensing domain ...... 53 Figure 3.6 Insigs are unlikely to be involved in the cholesterol mediated stabilisation of MARCHF6 ...... 55 Figure 3.7 Reactive oxygen species result in the degradation of MARCHF6 ...... 57 Figure 3.8 The microprotein CASIMO1 is transcriptionally regulated by steroid hormones ...... 59 Figure 3.9 CASIMO1 is minimally involved in cholesterol metabolism ...... 61 Figure 3.10 The ER membrane protein complex may be involved in the insertion of MARCHF6 into the ER membrane ...... 63 Figure 4.1 MARCHF6 knockdown increases the size of lipid droplets ...... 72 Figure 4.2. Schematic representation of constructs utilised in Chapter 4 ...... 73 Figure 4.3 Method overview of BioID ...... 77 Figure 4.4 Experimental design for the identification of MARCHF6 substrates using SILAC ...... 80 Figure 4.5 Malic Enzyme 2 is unlikely to be a MARCHF6 substrate ...... 82 Figure 4.6 Fat specific protein 27 mutant may be a MARCHF6 substrate ...... 84 Figure 4.7 Physical characteristics of FSP27 linker region ...... 86 Figure 4.8 Optimisation for release of biotinylated proteins from streptavidin coated beads ...... 88 Figure 4.9 Sterol optimisation of BioID for the identification of the MARCHF6 substrate SM N100-GFP-V5 ...... 90 Figure 4.10 Analysis of shared proteins identified between mass spectrometry datasets at differing thresholds ...... 92 Figure 5.1 Cholesterol synthesis enzymes investigated in Chapter 5 ...... 98 Figure 5.2 Plasmids utilised in Chapter 5 ...... 100

xvii

Figure 5.3. LDM protein is turned over, whilst LSS remains stable ...... 104 Figure 5.4 Ectopic LDM differentiates between transcriptional and post-translational effects ...... 106 Figure 5.5 LDM is not degraded in response to sterols ...... 107 Figure 5.6 Nitric oxide, but not hypoxia, trigger LDM for degradation ...... 109 Figure 5.7 LDM levels are increased with MARCHF6 knockdown ...... 111 Figure 5.8 MARCHF6 is unlikely to be the sole E3 ubiquitin ligase for LDM ...... 113 Figure 5.9 LDM and DHCR24 are likely MARCHF6 substrates ...... 115 Figure 5.10 LDM and DHCR24 are ubiquitinated and interact with MARCHF6 ...... 117 Figure 5.11 SC5D and SC4MOL are turned over, whilst NSDHL remains stable ...... 119 Figure 5.12 Quantitative real time PCR for MARCHF6 knockdown in NSDHL, SC4MOL and SC5D cell lines ...... 121 Figure 5.13 SC4MOL and SC5D are likely MARCHF6 substrates ...... 122 Figure 6.1 Summary of major findings in this thesis ...... 130 Figure 6.2 Overview of MARCHF6 targets in cholesterol synthesis ...... 142

xviii

List of Tables

Table 1.1 ERAD components in mammals with yeast counterparts ...... 7 Table 1.2 List of currently verified MARCHF6 substrates ...... 14 Table 2.1 List of reagents, consumables and materials used in this thesis ...... 21 Table 2.2 Common buffers recipes ...... 26 Table 2.3 Equipment used in this thesis ...... 27 Table 2.4 List of software used in this thesis ...... 28 Table 2.5 List of cell lines used in this thesis ...... 31 Table 2.6 List of commonly used primers in this thesis ...... 32 Table 2.7 List of primer sequences for qRT-PCR used in this thesis ...... 35 Table 2.8 List of antibodies used in this thesis ...... 37 Table 3.1 Site directed mutagenesis primers for MARCHF6 ...... 44 Table 3.2 Primers used for subcloning CASIMO1 ...... 45 Table 4.1 Primers used to generate constructs for BioID ...... 75 Table 4.2 Mass spectrometry data from in-house MARCHF6 knockdown ...... 81 Table 4.3 Mass spectrometry data from in-house MARCHF6 overexpression ...... 81 Table 8.1 Mass spectrometry data from in-house MARCHF6 knockdown using SILAC ...... 181 Table 8.2 Mass spectrometry data from in-house MARCHF6 overexpression using SILAC ...... 219

xix

Abbreviations

BSEP Bile salt export pump CASIMO1 Cancer-associated small integral membrane open reading frame 1 CD Methyl-β-cyclodextrin cDNA Complementary DNA CHO Chinese hamster ovary Chol/CD Cholesterol/methyl-β-cyclodextrin CHX Cycloheximide CIDE Cell death-inducing DNA fragmentation factor α-like effector CPN Compactin CRISPR Clustered regularly interspaced short palindromic repeats CTE C-terminal element DF-12 Dulbecco’s modified eagle medium/Ham’s F12 DHCR7 7-dehydrocholesterol reductase DHCR14 14-dehydrocholesterol reductase DHCR24 24-dehydrocholesterol reductase DHT Dihydrotestosterone DIO2 Type II iodothyronine deiodinase DMEM Dulbecco’s modified eagle medium DMSO Dimethylsulfoxide DNA Deoxyribose nucleic acid dNTP Deoxynucleoside triphosphate DPTA Dipropylenetriamine DUB Deubiquitinase E1 E1 ubiquitin activating enzyme E2 E2 ubiquitin conjugating enzyme E3 E3 ubiquitin ligase EBP Emopamil binding protein EDTA Ethylenediaminetetraacetic acid EMC Endoplasmic reticulum membrane protein complex ER Endoplasmic reticulum ERAD Endoplasmic reticulum associated degradation EV Empty vector FCLPDS Foetal calf lipoprotein deficient serum FCS Foetal calf serum FRT Flp-recombination target Fsp27 Fat specific protein 27 GFP Green fluorescent protein HEK Human embryonic kidney

xxi

HMGCR 3-hydroxy-3-methylglutaryl-CoA reductase HO-1 Heme oxygenase-1 Hrd1 3-hydroxy-3-methylglutaryl-CoA reductase degradation protein 1 HSD17B7 17-β-hydroxysteroid dehydrogenase HSP Heat shock protein IDOL Inducible degrader of the low-density lipoprotein receptor IgG Immunoglobulin G Insig Insulin-induced gene LBR Lamin B receptor LDL Low density lipoprotein LDLR Low density lipoprotein receptor LDM Lanosterol 14α-demethylase LNCaP Lymph node carcinoma of the prostate LPDS Lipoprotein deficient serum LSS Lanosterol synthase LXR Liver X receptor MARCHF6 Membrane associated RING C3HC4 finger 6 MCF Michigan cancer foundation ME2 Malic enzyme 2 mRIPA Modified radioimmunoprecipitation assay buffer mRNA Messenger RNA NAD(P) Nicotinamide adenine dinucleotide phosphate NBS Newborn calf serum NPC1 Niemann-Pick disease type C intracellular cholesterol transporter 1 NSDHL NAD(P) dependent steroid dehydrogenase-like PBGD Porphobilinogen deaminase PBS Phosphate buffered saline PBST Phosphate buffered saline tween PCR Polymerase chain reaction PIPE Polymerase incomplete primer extension PLIN2 Perilipin-2 PROTAC Proteolysis-targeting chimera PS Penicillin Streptomycin qRT-PCR Quantitative real-time PCR RGS2 Regulator of G protein signaling protein RING Really interesting new gene RIPA Radioimmunoprecipitation assay buffer RNA Ribonucleic acid ROS Reactive oxygen species RPMI Roswell Park Memorial Institute

xxii

SC4MOL Sterol-C4-methyl oxidase-like SC5D Sterol-C5-desaturase SCAP Sterol regulatory element-binding protein cleavage-activating protein SDS Sodium dodecyl sulphate SDS-PAGE Sodium dodecyl sulphate polyacrylamide gel electrophoresis S.E.M. Standard error of the mean SILAC Stable isotope labelling with amino acids in cell culture siRNA Small interfering ribonucleic acid SM Squalene monooxygenase SOAT Sterol O-acyltransferase Sp1 Specificity protein 1 SQS Squalene synthase SREBP Sterol regulatory element binding protein SSD Sterol sensing domain TA Tail anchored TMD Transmembrane domain Ub Ubiquitin VCP Valosin-containing protein WT Wild-type

xxiii

xxiv

Chapter 1

Chapter 1 General Introduction

Parts of this chapter have been published and were modified from Biochemica et Biophysica Acta – Molecular and Cell Biology of Lipids:

Scott, N. A., Sharpe, L.J., and Brown, A.J., (2021) The E3 ubiquitin ligase MARCHF6 as a metabolic integrator in cholesterol synthesis and beyond, BBA – Mol Cell Biol L 1866 (1) 158837 doi: 10.1016/j.bbalip.2020.158837

Chapter 1

1.1 Importance of cholesterol

Cholesterol is an essential lipid that is required for several biological functions including being an integral part of the cell membrane, contributing to its structural integrity (1–3), and modulating lipid rafts to aid in signalling (4). Furthermore, cholesterol is itself a precursor for many important compounds including bile acids (5), steroid hormones (6) and oxysterols (7). Whilst cholesterol is essential for development and growth (8, 9), elevated levels can contribute to the development of several diseases including cardiovascular disease (10, 11), neurological diseases (12, 13) and many cancers (14, 15). Cholesterol levels therefore must be tightly controlled through a series of broad processes such as cellular influx, synthesis, and efflux.

This thesis examines the post-translational regulation of the E3 ubiquitin ligase MARCHF6 and its role in the control of cholesterol metabolism.

1.2 Cholesterol synthesis

Cholesterol synthesis is an energetically expensive process in regards to ATP consumption and redox equivalents, so needs to be tightly controlled (16). The formation of cholesterol from acetyl-CoA requires more than 20 enzymatic reactions, and essential branch pathways also exist including those that produce isoprenoids for protein prenylation (17) and vitamin D (18). The early part of the pathway contains the notable rate-limiting enzyme 3-hydroxy-3-methylglutaryl- CoA reductase (HMGCR) (19, 20) which is the target of the cholesterol lowering drug class statins (21), and the second rate-limiting enzyme squalene monooxygenase (SM) (22). Post-lanosterol there are two major alternative routes to cholesterol via the Bloch or Kandutsch-Russell pathways (Figure 1.1). There is a proposed divergent point that shuttles flux from the Bloch to the Kandutsch- Russell pathway at zymosterol and is referred to as the Modified Kandutsch- Russell pathway (23).

Chapter 1

Figure 1.1 Schematic of the cholesterol synthesis pathway The cholesterol synthesis pathway consists of over 20 enzymatic reactions. HMGCR is the first-rate limiting enzyme within the pathway which is targeted by the drug class statins (red). The second rate-limiting enzyme is SM. The divergent pathways, Bloch (yellow) and Kandutsch-Russell (blue), then lead to the formation of cholesterol. The Modified Kandutsch-Russell pathway is also indicated (green). Dotted arrows indicate multiple steps not shown. 4

Chapter 1

1.3 Protein turnover

Proteins are tightly regulated through several key processes. This includes their initial synthesis, their folding into correct three-dimensional structures, post- translational modifications to alter regulation and function, and ultimately the protein’s destruction. One of the major ways protein degradation occurs is through the ubiquitin proteasome system which acts in several distinct stages (24). Ubiquitin is first activated through the hydrolysis of ATP to create a thiol- ester bond between ubiquitin and the E1 ubiquitin activating enzyme. The ubiquitin is then transferred to the E2 ubiquitin conjugating enzyme, then passed or works in conjunction with the E3 ubiquitin ligase enzyme to attach ubiquitin to the substrate. Once the initial ubiquitin (monoubiquitin) has been added to the target protein, further ubiquitin molecules can be attached, and the chain extended (polyubiquitination). The polyubiquitinated protein is then susceptible to several different fates (25), with degradation by the proteasome a well understood outcome (Figure 1.2) (26, 27). The ubiquitination machinery encompasses hundreds of different proteins working in precise combinations to regulate protein degradation. While this is an elaborate and highly specific network, some redundancy occurs within these systems (28). Specificity for the target substrate is believed to occur through the E3 ubiquitin ligase (29).

Approximately 600 E3 ligases exist in humans with mutations in some of these enzymes causing disease. For example, parkin mutations in Parkinson’s disease (30), and the infamous BRCA1 in breast cancer (31). E3 ligases are being successfully targeted for therapeutic purposes (32), and therefore represent an attractive area of research.

Chapter 1

Figure 1.2 Simplified overview of the ubiquitin proteasome system Proteins can undergo several modifications including ubiquitination, to alter their function. (1) Ubiquitin is passed along a cascade of E1 ubiquitin activating, E2 ubiquitin conjugating and (2) E3 ubiquitin ligase enzymes to fuse ubiquitin (Ub) onto target substrates. (3) This process can be reversed through the actions of deubiquitinases (DUB) (4) Alternatively, the monoubiquitinated substrate can have the ubiquitin chain extended and (5) signal for degradation via the proteasome. Not shown here are additional proteins that may be required for ubiquitination and membrane extraction or alternative fates for ubiquitinated substrates.

Chapter 1

1.3.1 Endoplasmic reticulum associated degradation

Protein quality control is a complex process with much occurring in the hub of protein synthesis, the endoplasmic reticulum (ER). The associated degradation network is known as endoplasmic reticulum associated degradation (ERAD). Most work to elucidate the ERAD system has been completed in yeast, with more recent bodies of work identifying the mammalian equivalents (Table 1.1) (33, 34). However, the mammalian ERAD system is more numerous and complex compared with yeast. Where there are only three ERAD E3 ligases in the yeast system there are at least 19 ERAD E3 ligases in mammals (35). Some of the most well studied E3 ubiquitin ligases in the mammalian system studied include HRD1 and MARCHF6, the counterparts to the dominant ERAD E3 ligases in yeast Hrd1 and Doa10 respectively (36, 37). These mammalian E3 ligases are known to interact with a range of E2 conjugating enzymes however their most well-studied counterparts are Ube2G2 and Ube2J2 (37–39).

In addition to the ubiquitination cascade that must occur to substrates for degradation, those that undergo ERAD must undertake additional processes to be removed from the ER lumen or membrane (40). This process typically requires the use of chaperones and extraction machinery where the complex recognises and extracts substrates into the cytosol where they then undergo degradation (33, 41). Some of the most common chaperones include the Derlins (42) which interact with the key retrotranslocase, valosin-containing protein (VCP, also known as p97) (43, 44).

Table 1.1 ERAD components in mammals with yeast counterparts

Mammalian Yeast Function Ref. Component Homolog MARCHF6 Doa10 ER transmembrane E3 ubiquitin ligase (37)

HRD1 Hrd1 ER transmembrane E3 ubiquitin ligase (36)

Ube2G2 Ubc7 E2 ubiquitin conjugating enzyme (37, 38)

Ube2J2 Ubc6 E2 ubiquitin conjugating enzyme (38, 39)

Derlins Dfm1 Chaperones (42)

VCP Cdc48 AAA+ ATPase Retrotranslocase (45)

Chapter 1

1.4 MARCHF6

Membrane associated RING C3HC4 finger 6 (MARCHF6, also known as MARCH6, Teb4 and RNF176) is a member of the MARCHF protein family. The gene and protein recently underwent a nomenclature change from MARCH6 to MARCHF6 due to data handling in Microsoft Excel where MARCH6 auto-converted to the date (46). The MARCHF protein family is a subset of E3 ubiquitin ligases that are largely categorised by their transmembrane domains and RING-CH domain (47). Additionally, this class of proteins has varied structures and localisations, with some participating in non-canonical ubiquitination of residues other than lysine (47–49).

MARCHF6 was first characterised as an E3 ligase that is embedded in the membrane of the ER (37). MARCHF6 is homologous to the well-studied yeast E3 ligase Doa10 which is one of only three E3 ligases in yeast that participates in ERAD (41). Thus, MARCHF6 is situated as a potential key regulator of ERAD in humans. However, humans possess a more plentiful and complex ERAD network of E3 ligases than yeast. This incorporates additional intricacies and potential redundancy for substrate selectivity (50).

Chapter 1

1.4.1 The MARCHF6 gene and transcriptional regulation

The MARCHF6 gene is located at chromosome 5p15.2 and spans approximately 86,800 nucleotides (51). The gene is comprised of 26 exons and 25 introns with a coding sequence of 2,733 nucleotides for the predominant isoform (Figure 1.3). Transcriptionally, MARCHF6 is ubiquitously expressed across various tissues (GTEx Portal).

The MARCHF6 gene maps to the cri-du-chat critical region (52) where large deletions typically lead to mental retardation and delayed development (53). Patients who have Cri-du-chat syndrome may present with differing degrees of severity depending upon which genes are affected by these deletions. Disruption of MARCHF6 causes haploinsufficiency, where insufficient amounts of MARCHF6 are produced resulting in the reduced capacity of MARCHF6 to perform its normal function. Disruption of MARCHF6 may contribute to the classical “cat-like cry” associated with the disease (54), likely as a result of the consequent dysregulation of yet to be identified MARCHF6 substrates.

Furthermore, TTTTA/TTTCA repeat expansions in the first intron of MARCHF6 are associated with familial adult myoclonic epilepsy (Figure 1.3) (55, 56). MARCHF6 may consequently have an important role in the brain that has yet to be properly investigated. In addition to this, a single nucleotide polymorphism (rs2607292) in the first intron of MARCHF6 is associated with an increased risk of obesity (57) (Figure 1.3). Both intronic changes need to be further investigated to understand the underlying mechanism of action for how MARCHF6 is involved in the onset of familial adult myoclonic epilepsy and obesity.

The transcriptional regulation of MARCHF6 is only superficially understood with the common transcription factor specificity protein 1 (Sp1) confirmed as being involved (58). Additionally, the post-transcriptional control of MARCHF6 has yet to be investigated.

Chapter 1

Figure 1.3. Genomic configuration of MARCHF6 MARCHF6 is located at 5p15.2 and contains 26 exons (vertical lines) and 25 introns. The arrow indicates the MARCHF6 transcriptional start site. Disease causing mutations are marked below the MARCHF6 gene. TTTTA intronic repeats in the first intron are associated with familial adult myoclonic epilepsy (red). The single nucleotide polymorphism rs2607292 is associated with increased body mass index (green). The 5p15.2 deletion which spans the entirety of the MARCHF6 gene is associated with Cri-du-chat syndrome (blue). Figure from our recent review (59).

Chapter 1

1.4.2 The MARCHF6 protein

The main isoform of MARCHF6 consists of 910 amino acids (103 kDa) and is an evolutionarily conserved protein. Most research conducted has been on its yeast homolog, Doa10, which shares 25% identity and 42% similarity with human MARCHF6. Like Doa10, MARCHF6 is a polytopic protein that resides in the endoplasmic reticulum (37). Early research into the membrane topology of MARCHF6 proposed a thirteen transmembrane domain model (37). However, successive work revealed an extra transmembrane domain, with both the N- and C-termini cytosolic facing (Figure 1.4) (60). Fourteen transmembrane domains are the most described for any E3 ligase to date (61), thus making MARCHF6 a particularly hydrophobic protein. The structure of MARCHF6 has yet to be resolved, and this is largely due to these properties.

MARCHF6 contains two functional domains: the catalytic N-terminal RING domain (37) and the C-terminal element (CTE) (62). The RING domain is critical for the ubiquitination of MARCHF6 substrates. Disruption of the zinc finger in the RING domain via a cysteine mutation (C9A) leads to MARCHF6 having an inability to ubiquitinate substrates, including itself (37). Moreover, mutations in the conserved CTE, (G885L and N890A) cause MARCHF6 to lose its ability to autoregulate and result in increased protein levels comparable to that of the wild-type enzyme (62). However, these mutations in the CTE only affect the ability of MARCHF6 to self regulate, while other substrates can still be ubiquitinated (62). These mutations in both domains provide valuable tools in understanding MARCHF6’s ability to regulate itself and its targets.

In Doa10, the region comprising three transmembrane domains (TMD5 to TMD7) may play a role in regulating the E2 conjugating enzyme Ubc6 (63). While this region is conserved with MARCHF6 in humans it is unknown whether the functionality of this region is transferred between species. Together these transmembrane domains have been referred to as the Teb4/Doa10 domain (Figure 1.4). Furthermore, due to its size, MARCHF6 may be involved in the dislocation of proteins from the ER (50), similar to that of its yeast counterpart Doa10 (64), and another ER E3 ligase Hrd1 (65, 66).

Chapter 1

Beyond this, very little is known about the post-translation regulation of MARCHF6 and so Aim 1 of this thesis explores the post-translational regulation of MARCHF6 (Chapter 3).

Figure 1.4. Topology and structures of MARCHF6 MARCHF6 is an endoplasmic reticulum membrane-embedded protein with fourteen transmembrane domains. It contains two critical domains: the RING domain for ubiquitination of itself and its substrates and the C-terminal element (CTE) which regulates auto-degradation. There is one theorised internal domain in MARCHF6, the Teb4/Doa10 domain with as yet unknown function. Figure adapted from our recent review (59).

1.4.3 Interaction of ERAD components with MARCHF6

The MARCHF6 protein both regulates and is regulated by several factors. It is a highly labile protein, mainly due to its degradation through autoubiquitination and proteasomal degradation (37).

Much of what we know of MARCHF6 is based on the analogous system in yeast (Table 1.1). As a RING E3 ubiquitin ligase, MARCHF6 works in conjunction with E2 conjugating enzymes to attach ubiquitin onto its target substrates. MARCHF6 currently has two well characterised E2s that it works with: Ube2G2 (37) and Ube2J2 (39). The respective yeast homologues Ubc7 and Ubc6

Chapter 1

are also partnered with Doa10 (38). Ube2G2 regulates MARCHF6’s autoubiquitination (37), whilst Ube2J2 participates in the ubiquitination of non- canonical residues of substrates (67). At least one other E2, Ube2W (68), interacts with MARCHF6, but what substrates it targets are currently unknown. Ube2W also participates in non-canonical ubiquitination on the N-terminus of substrates and perhaps plays a role in the degradation of substrates by the N- end rule pathway (69, 70). By interacting with a broad range of E2 enzymes, MARCHF6 can target a diverse range of substrates but also have enhanced specificity in substrate selection.

Substrates can also be regulated in several different ways including having their poly-ubiquitin chains modified through deubiquitinases (71). MARCHF6 is deubiquitinated by USP19, protecting it from degradation. Consequently, MARCHF6 activity is enhanced, increasing the degradation of its substrates (72).

Together, these proteins help shed light on the post-translational regulation of MARCHF6 and its substrates. However, MARCHF6 likely requires many other ERAD components for the regulation of itself and its substrates that are yet to be discovered.

1.5 Substrates of MARCHF6

Understanding the different substrates of an E3 ubiquitin ligase is important to appreciate the likely physiological functions. The first substrate identified for MARCHF6 was itself (37). This is a common mode of regulation for E3 ligases where they keep themselves under control through autoubiquitination (73).

Most substrates identified for MARCHF6 have either Doa10 target homologues or have been identified through siRNA or more recently MARCHF6 knockout experiments. All substrates of MARCHF6 are localised to the ER except two; however, all pass through the ER for protein synthesis.

Chapter 1

Table 1.2 lists currently verified MARCHF6 substrates. Aim 2 of this thesis investigates additional MARCHF6 substrates (Chapter 4 and Chapter 5).

Table 1.2 List of currently verified MARCHF6 substrates

Evidence Substrate Function MARCHF6 MARCHF6 MARCHF6 Ref. knockdown/out overexpression Co-IP * E3 ubiquitin ligase MARCHF6 Yes (37) (Autoubiquitination) Cholesterol (74, SM Yes Yes synthesis 75) Cholesterol HMGCR Yes (74) synthesis Cholesterol LDM Yes Yes synthesis This Cholesterol Thesis DHCR24 Yes Yes synthesis Lipid droplet PLIN2 Yes Yes (76) formation NPC1 Cholesterol Yes (77) (mutant) trafficking BSEP Bile salt transport Yes Yes (78) (mutant) Thyroid hormone DIO2 Yes Yes Yes (79) activation Regulates G RGS2 Yes Yes (80) protein signalling * Co-IP = co-immunoprecipitation

1.5.1 Cholesterol synthesis enzymes as MARCHF6 substrates

A key controller of cholesterol homeostasis is the ubiquitin proteasome system (81); and MARCHF6 appears to play a particularly important role in this. The cholesterol synthesis pathway contains two well defined rate limiting enzymes: HMGCR and SM (19, 20, 22). Importantly, both of these undergo proteasomal degradation by MARCHF6 (Figure 1.5) (74, 75), although other E3 ligases likely play a greater role in sterol-dependent HMGCR degradation (82, 83). SM is widely considered the canonical substrate for MARCHF6 (84). Both HMGCR and SM are both turned over rapidly in response to the presence of excess sterols (22, 85, 86).

Chapter 1

1.5.2 Indirect transcriptional regulation of cholesterol by MARCHF6

MARCHF6 controls cholesterol metabolism beyond cholesterol biosynthetic enzymes. Both of the master transcription factors controlling cholesterol levels – sterol regulatory element binding proteins (SREBP) and liver X receptor (LXR) – are indirectly affected by MARCHF6 in liver cell lines (Figure 1.5) (87). MARCHF6 knockdown induces the expression of both SREBP-2 and LXR target genes, although the mechanism this occurs through has yet to be elucidated. SREBP-2 upregulates cholesterol synthesis enzymes to increase synthesis and the low-density lipoprotein receptor (LDLR) to increase cholesterol uptake. However, low density lipoprotein (LDL) uptake was not increased due to the upregulation of inducible degrader of the LDLR (IDOL) which is an E3 ligase (87) that degrades LDLR. This circuit likely favours cholesterol uptake rather than cholesterol synthesis as it is a more energy efficient process (87).

1.5.3 Other lipid metabolism substrates of MARCHF6

There are three other lipid-related substrates of MARCHF6: Perilipin-2 (PLIN2), and mutant versions of NPC intracellular cholesterol transporter 1 (NPC1) and the bile salt export pump (BSEP, also known as ABCB11) (Figure 1.5).

Chapter 1

Figure 1.5 Substrates of MARCHF6 The currently known substrates of MARCHF6 can be grouped into five broad categories. Cholesterol synthesis enzymes (yellow), cholesterol sensing transcription factors (light orange) and the cholesterol and lipid metabolism proteins (dark orange). MARCHF6 is also known to autoubiquitinate itself (purple) and regulate other metabolism (green) proteins as well. * indicates mutant proteins. Figure adapted from our recent review (59).

One of the earliest identified substrates of MARCHF6 was mutated BSEP (78). Typically, BSEP facilitates the main bile salt transport system within hepatocytes (88), with bile acids/salts being a derivative of cholesterol. Mutations within BSEP result in partial cellular mislocalisation and loss of function (89) and can contribute to the pathogenesis of progressive familial intrahepatic cholestasis type II (PFIC II) (90). MARCHF6 targets the BSEP G238V mutant for degradation which is mislocalised to the ER, with little being trafficked to the plasma membrane (78). This implies that BSEP G238V becomes stuck in the ER possibly

Chapter 1

through misfolding and is flagged for degradation by MARCHF6. Cholestasis then occurs due to the accumulation of bile salts because of the defective BSEP.

Similarly, MARCHF6 targets a mutant form of NPC1 (77). NPC1 is involved in the trafficking of cholesterol within the cell, with mutations in this transporter accounting for most cases of Niemann-Pick type C disease. This disease is a fatal neurodegenerative disorder characterised by the intracellular accumulation of unesterified cholesterol (91). While MARCHF6 does not target the wild-type NPC1, it does target the most common disease-causing mutation in NPC1 (I1061T) (77). This particular mutation in NPC1 is still functional but is mislocalised to the ER rather than correctly trafficking to the late endosome or lysosome. Mislocalisation of NPC1 I1061T can be corrected through increasing available chaperones (92). Analogous to the case of mutant BSEP, MARCHF6 may be targeting mutant NPC1 as part of the quality control process in the ER rather than as trigger mediated degradation that is observed for other substrates such as SM.

Whilst NPC1 is involved in the trafficking of cholesterol, PLIN2 is involved in the formation of lipid droplets which act as a cholesterol reservoir (76). Loss of PLIN2 is considered protective against the development of diabetes (93). Both mice and human work identified MARCHF6’s role in the degradation of PLIN2 via the N-end rule pathway (76, 94). Furthermore, when MARCHF6 was knocked out lipid droplet abundance increased (76). Whether this is solely because of the interaction between MARCHF6 and PLIN2 or if other lipid droplet associated proteins are also targets of MARCHF6 is still unknown.

1.5.4 Other substrates of MARCHF6

MARCHF6 also targets proteins outside of cholesterol and lipid metabolism. However, these additional substrates are still embedded in metabolism processes (Figure 1.5).

Type II iodothyronine deiodinase (DIO2) is the main thyroid hormone activating deiodinase which converts the pre-hormone T4 to T3, which is the biologically active thyroid hormone (95). Thyroid hormones, particularly T3, are

Chapter 1

key regulators of several cellular processes including cholesterol, triglyceride, and carbohydrate metabolism. Regulation of these processes through DIO2 ultimately controls body weight through thermogenesis (96). DIO2 was initially investigated in humans as a MARCHF6 substrate based on the homologous yeast system, where the deletion of Doa10 resulted in the accumulation of yeast DIO2 (97). Like many proteins, DIO2 is controlled by more than one E3 ligase (79, 98). The other E3 ligase, WSB-1, is suggested to have dissimilar tissue expression to that of MARCHF6, suggesting a possibility for the differential regulation of DIO2 (98).

MARCHF6 also targets a regulator of G protein signalling protein (RGS2) (80).

RGS2 regulates G proteins through its binding to Gαq (99) and participates in a number of processes including hormone and cardiovascular homeostasis (100). RGS2 knockout mice and human patients with decreased RGS2 signalling exhibit hypertension (100, 101). RGS2 was also the first substrate of MARCHF6 characterised as a substrate of the Ac/N-end rule pathway (80). This was the first instance of MARCHF6 acting as an Ac/N-recognin, much like its yeast Doa10 counterpart (102).

1.6 Aims and hypothesis

This thesis investigates the broader role of MARCHF6 in the regulation of cholesterol metabolism. It is hypothesised that MARCHF6 disproportionately targets cholesterol and lipid metabolism proteins as substrates and is itself regulated post-translationally by sterols.

The main aims of this thesis are:

Aim 1: To investigate the post-translational regulation of MARCHF6 (Chapter 3).

Aim 2: To identify new MARCHF6 substrates (Chapter 4), with a particular focus on cholesterol synthesis enzymes (Chapter 5).

Chapter 2

Chapter 2 General Materials and Methods

This chapter describes the materials and methods used throughout this thesis. Materials and methods specific to a particular chapter have been detailed in each additional chapter specific materials and methods section.

Chapter 2

2.1 General Materials

2.1.1 Commercial reagents

Materials purchased are listed in alphabetical order along with their commercial supplier in Table 2.1.

Table 2.1 List of reagents, consumables and materials used in this thesis Use Product Company Tissue Culture Cholesterol Sigma-Aldrich Cholesterol-water soluble Sigma-Aldrich Compactin Sigma-Aldrich Dimethylsulfoxide (DMSO) Chem-supply Dulbecco’s phosphate- buffered UNSW Sydney saline (PBS) Dulbecco's modified eagle Thermo Fisher Scientific medium: nutrient mixture F- 12 (DF12) Dulbecco's modified eagle's Sigma-Aldrich medium - high glucose (DMEM HG) EVE cell counting slides NanoEnTek Foetal bovine serum Bovogen Hygromycin B Thermo Fisher Scientific Lipofectamine 2000 Thermo Fisher Scientific Lipofectamine 3000 Thermo Fisher Scientific Lipofectamine LTX Thermo Fisher Scientific Lipofectamine RNAiMAX Thermo Fisher Scientific Methyl-β-cyclodextrin Sigma-Aldrich Newborn calf serum (NBS), Heat Thermo Fisher Scientific Inactivated Opti-MEM I Reduced Serum Thermo Fisher Scientific Medium Penicillin-streptomycin Thermo Fisher Scientific Polyethyleneimine solution Sigma-Aldrich Sodium hydrogen carbonate Ajax FineChem Stericap PLUS Universal Bottle- Millipore top filter device Stripette serological pipettes Corning 10 ml Stripette serological pipettes Corning 25 ml Stripette serological pipettes 5 ml Corning Stripette serological pipettes Corning 50 ml Syringe filter Unit, 0.22 µm Millex- Millipore GP Syringe filters, 15 mm 0.2 µm Corning Tissue culture dish 100 mm Corning

Chapter 2

Use Product Company Tissue culture dish 150 mm Corning Tissue culture-treated multiple Corning well plates 6-well TrypLE express enzyme, no Thermo Fisher Scientific phenol red Cloning Ampicillin sodium salt Sigma-Aldrich BamHI New England BioLabs BigDye sequencing buffer Thermo Fisher Scientific BigDye terminator v3.1 Thermo Fisher Scientific DH5α competent cells Thermo Fisher Scientific DNA ladder 100 bp New England BioLabs dNTP Bioline DpnI New England BioLabs Gel loading buffer New England BioLabs HindIII New England BioLabs HiYield plasmid mini kit Real Biotech Corporation HyperLadder 1kb Bioline Inoculation spreader Sarstedt Luria broth UNSW Sydney Luria broth agar UNSW Sydney Luria broth base Thermo Fisher Scientific MangoTaq colored reaction buffer Bioline NEB 2.1 reaction buffer New England BioLabs NucleoBond Xtra Midi Plus Macherey-Nagel PCR tube 8-strip SSIbio PCR tube thin wall Corning Phusion GC buffer pack New England BioLabs Phusion HF buffer pack New England BioLabs Phusion high-fidelity DNA New England BioLabs polymerase Phusion high-fidelity PCR kit New England BioLabs Primers Sigma-Aldrich QIAprep spin miniprep kit Qiagen QIAquick PCR purification kit Qiagen Round bottom polypropylene Sarstedt 13 ml Tube S.O.C. medium Thermo Fisher Scientific T4 DNA ligase New England BioLabs T4 DNA ligase reaction buffer New England BioLabs Taq polymerase New England BioLabs UltraPure agarose Thermo Fisher Scientific XL10-Gold ultracompetent cells Agilent Technologies General and Amplex Red cholesterol Assay Kit Thermo Fisher Scientific Other Amplex Red reagent Thermo Fisher Scientific Cholesterol oxidase Sigma-Aldrich Dialysis tubing cellulose Sigma-Aldrich membrane Ethylenediaminetetra-acetic acid Ajax FineChem (EDTA) disodium salt 22

Chapter 2

Hydrochloric acid (HCl) Ajax FineChem Use Product Company Hypodermic needle 23G BD Microcentrifuge tube 0.6 mL Corning Microcentrifuge tube 1.5 mL Sarstedt Potassium bromide Sigma-Aldrich Seal tube 40PA Hitachi Koki Sodium chloride Ajax FineChem Syringe 1 mL BD Tip 0.1 - 10 μL unfiltered Sarstedt stackpack Tip MAXYMum Recovery Corning 1000 μL filter tip Tip MAXYMum Recovery 20 μL Corning filter tip Tip MAXYMum Recovery 200 μL Corning filter tip Protein Reagents Ammonium persulphate Sigma-Aldrich Ammonium sulphate Ajax Finechem Anti-α-Tubulin antibody Sigma-Aldrich Anti-FLAG antibody Sigma-Aldrich Anti-HA antibody Cell Signalling Technologies Anti-LDM antibody Protein Tech Anti-ME2 antibody AbCam Anti-myc antibody Santa-Cruz Anti-myc antibody AbCam Anti-PentaHis-HRP antibody Qiagen Anti-SM antibody Protein Tech Anti-V5 antibody Thermo Fisher Scientific Anti-Vinculin antibody AbCam Biotin Sigma-Aldrich Bovine serum albumin standard Thermo Fisher Scientific Bromophenol blue Sigma-Aldrich Calcium chloride Ajex Finechem Chromatography paper reel GE Healthcare Chromatography paper sheets GE Healthcare Clarity max Western ECL Bio-Rad substrate cOmplete™ ULTRA tablets Merck EASYpack protease inhibitor cocktail Copper (II) sulfate pentahydrate Chem-supply n-Dodecyl β-D-maltoside Sigma-Aldrich Dynabeads Protein G for Thermo Fisher Scientific immunoprecipitation Ethylene glycol-bis(β-aminoethyl Sigma-Aldrich ether)-N,N,N′,N′-tetraacetic acid tetrasodium salt (EGTA) Glycine Ajax Finechem Glycerol Ajax Finechem 23

Chapter 2

HEPES 99% ACROS Organics Use Product Company IGEPAL CA-630 Ajax Finechem Immobilon Western Merck chemiluminescent HRP substrate IRDye 680RD Donkey Anti-Rabbit LI-COR Biosciences IgG IRDye 800CW Donkey Anti- LI-COR Biosciences Mouse IgG Lambda protein phosphatase New England Biolabs Magnesium chloride Ajax Finechem Methanol Ajax Finechem β-mercaptoethanol Sigma-Aldrich Mini-PROTEAN TGX precast Bio-Rad protein gels Multiple well plate 96-well Sarstedt N,N,N′,N′- Sigma-Aldrich Tetramethylethylenediamine N-Ethylmaleimide Sigma-Aldrich Nitrocellulose membrane Bio-Rad Peroxidase AffiniPure Donkey Jackson ImmunoResearch Anti-Mouse IgG (H+L) Peroxidase AffiniPure Donkey Jackson ImmunoResearch Anti-Rabbit IgG (H+L) Pierce BCA Protein Assay Thermo Fisher Scientific Reagent A Ponceau S stain Sigma-Aldrich Potassium chloride Ajax Finechem Potassium phosphate dibasic Ajax Finechem Potassium phosphate monobasic Ajax Finechem Precision plus protein Bio-Rad kaleidoscope pre-stained protein standards Protease inhibitor cocktail Sigma-Aldrich PureProteome Streptavidin Millipore Magnetic Beads Skim milk (Diploma) Fonterra Brand Sodium chloride Ajax FineChem Sodium deoxycholate Sigma-Aldrich Sodium dodecyl sulfate (SDS) Sigma-Aldrich Sodium orthovanadate Sigma-Aldrich Sodium phosphate dibasic Sigma-Aldrich Sodium phosphate monobasic Sigma-Aldrich Sodium sulphate Ajax FineChem Sucrose Ajax FineChem Tetramethylethylenediamine Sigma-Aldrich (TEMED) TGX FastCast acrylamide kit Bio-Rad Tris-(hydroxy)methylamine Ajax Finechem Triton X-100 Sigma-Aldrich Tween20 Sigma-Aldrich 24

Chapter 2

Use Product Company RNA Extraction 1-bromo-3-chloro-propane Sigma-Aldrich and quantitative Ethanol 70% (w/w) Ajax FineChem PCR Ethanol denatured Ajax FineChem Isopropanol Ajax FineChem QuantiNova SYBR green PCR kit Qiagen RNaseOUT recombinant Thermo Fisher Scientific ribonuclease inhibitor SensiMix SYBR Hi-ROX kit Bioline Strip tubes and caps Qiagen SuperScript III reverse Thermo Fisher Scientific transcriptase TRI reagent Sigma-Aldrich

Chapter 2

2.1.2 Buffers and solutions

Buffers and solutions produced in-house are listed in Table 2.2, including their names, composition and use.

Table 2.2 Common buffers recipes Buffers Composition Main Use 250 mM Tris-HCl (pH 6.8) 10% (w/v) SDS, Laemmli buffer (5 ×) 25% (v/v) glycerol SDS-PAGE 0.2% (w/v) bromophenol blue 5% (v/v) β-mercaptoethanol 50 mM Tris-HCl (pH 8.0) 150 mM NaCl Modified RIPA 0.1% (w/v) SDS Protein lysate (mRIPA) buffer 1.5% (w/v) IGEPAL CA-630 preparation 0.5% (w/v) sodium deoxycholate 2 mM MgCl2 137 mM NaCl 2.7 mM KCl PBS Cell culture 8 mM Na2HPO4 1.5 mM KH2PO4 137 mM NaCl 2.7 mM KCl PBST 8 mM Na2HPO4 Western blot 1.5 mM KH2PO4 0.1% (v/v) Tween20 25 μg/ml polyethyleneimine 150 mM NaCl Coating cell culture Polyethyleneimine 3 mM KCl plate surfaces 8.8 mM Na2HPO4 1.6 mM KH2PO4 20 mM Tris-HCl (pH 7.4) 0.1% (w/v) SDS 1% (w/v) IGEPAL CA-630 Protein lysate RIPA buffer 0.5% (w/v) sodium deoxycholate preparation 150 mM NaCl 5 mM EDTA 1 mM sodium orthovanadate 3% (w/v) SDS Protein lysate SDS lysis buffer 10 mM Tris-HCl (pH 7.6) preparation 100 mM NaCl 25 mM Glycine Stripping Buffer Western blot 1.5% (w/v) SDS (pH 2) 2 M Tris(hydroxy)methylamine Agarose gel TAE buffer 1 M acetic acid electrophoresis 50 mM EDTA 25 mM Tris(hydroxy)methylamine Tris-Glycine SDS 192 mM glycine SDS-PAGE running buffer 0.1% (w/v) SDS

Chapter 2

Buffers Composition Main Use 18 mM Tris(hydroxy)methylamine Transfer buffer Western blot 150 mM glycine

2.1.3 Equipment

Equipment used throughout this thesis is listed in Table 2.3, including the usage, equipment name and manufacturer.

Table 2.3 Equipment used in this thesis Use Equipment Company Research Plus Pipettes Eppendorf Centrifuge 5242R Eppendorf Centrifuge 5702 Eppendorf Centrifuge 580R Eppendorf Easypet3 pipette controller Eppendorf General PIPETBOY acu 2 pipette Integra Biosciences controller Savant refrigerator vapor trap Thermo Fisher Scientific SpeedVac concentrator Thermo Fisher Scientific SPD121P-230 Bead bath Lab Armour EVOS FL Cell Imaging System Thermo Fisher Scientific Cell Culture EVOS M5000 Imaging System Thermo Fisher Scientific Heraeus CO2 Incubator BB15 Thermo Fisher Scientific Laminar flow cabinet Gelaire C1000 thermal cycler Bio-Rad Gel Doc XR+ imager Bio-Rad Cloning Mastercycler nexus Eppendorf Nanodrop ND-1000 Thermo Fisher Scientific CLARIOstar microplate reader BMG LabTech Spectroscopy MultiSkan FC Microplate Thermo Fisher Scientific Photometer Koki himac CP100WX Ultracentrifugation Koki Holdings ultracentrifuge rotor GE Healthcare Life ImageQuant LAS 500 Sciences Mini-PROTEAN electrophoresis Bio-Rad system Odyssey CLx LI-COR Biosciences Western Blot PowerPac Basic power supply Bio-Rad PowerPac Universal power Bio-Rad supply Tube Revolver Thermo Fisher Scientific UltraRocker rocking platform Bio-Rad Quantitative PCR Rotor Gene Q Qiagen

Chapter 2

2.1.4 Software

Software utilised for this thesis is listed in Table 2.4, including use, company or supplier.

Table 2.4 List of software used in this thesis Use Software Company Geneious Prime (version 2020.2.4) Biomatters Cloning Image Lab (version 6.0.1) Bio-Rad SnapGene Viewer (version 5.2.2) GSL Biotech Densitometry Image Studio Lite (version 5.2.5) LI-COR Biosciences Illustrator (2020) Adobe Figure Preparation PowerPoint (2020) Microsoft Rotor-Gene Q Series Software qRT-PCR Analysis Qiagen (version 2.3.5) Prism (version 9.0.0) GraphPad Software Statistical Analysis Excel (2020) Microsoft Writing Word (2020) Microsoft

Chapter 2

2.2 General Methods

2.2.1 Preparation of lipoprotein deficient serum

FCS and NBS were heat-inactivated at 56°C for 30 min with agitation every 5 min; if heat-inactivated serum was not purchased. A detailed protocol for the preparation of lipoprotein deficient serum is available (103). Briefly, heat- inactivated serum underwent ultracentrifugation to separate lipoproteins from the serum, followed by dialysis of the lipoprotein deficient serum layer using 150 mM NaCl. The protein concentration was determined by bicinchoninic acid assay and normalised to 50 mg/mL for LPDS and 30 mg/mL for FCLPDS using 150 mM NaCl, then filter sterilised. The reduced cholesterol content was confirmed via an Amplex red cholesterol assay.

2.2.2 Preparation of sterol/cyclodextrin complexes

To deliver cholesterol and other sterols through the plasma membrane, they are complexed to methyl-β-cyclodextrin (CD), a cyclic oligosaccharide that encapsulates the sterol and can fuse with the plasma membrane allowing the sterol to enter the cell (104, 105). Briefly, 5% (w/v) CD, with 15 mg/mL of the indicated sterol was dissolved in 100% ethanol by agitation and heating to 80°C until a clear solution formed. The solution was lyophilized, and the dried sterol/CD complex reconstituted in 375 µL Milli-Q water to a final concentration of 2 mg/mL and filter sterilised. If pre-complexed cholesterol/CD (Chol/CD) was utilised (Sigma-Aldrich) it was reconstituted in Milli-Q water to a final concentration of 2 mg/mL. Cells were treated with sterol/CD complexes as indicated in the figure legends. How much sterol/CD is delivered to the ER is unknown, however effective trafficking from the plasma membrane to the ER has been verified (106– 108).

Chapter 2

2.2.3 Cell lines and cell culture

All cell lines (Table 2.5) were grown as a monolayer in a humidified incubator at 37°C in a 5% CO2 atmosphere.

Chinese hamster ovary (CHO-7) cells and cell line variants were grown in Dulbecco’s modified eagle medium/Ham’s F12 (DF12) medium supplemented with 5% (v/v) LPDS and containing penicillin (100 U/mL) and streptomycin (100 μg/mL) (PS). Preparation of LPDS was done in-house from commercially available NBS as described in Section 2.2.1.

Michigan cancer foundation-7 (MCF-7), Human embryonic kidney 293 (HEK-293) cells and cell line variants were grown in Dulbecco’s modified eagle medium high glucose (DMEM HG) medium supplemented with 10% (v/v) FCS and PS. All cell culture plates for HEK-293 cells and cell line variants were coated in 25 μg /mL polyethyleneimine for better adherence.

Lymph node carcinoma of the prostate (LNCaP) cells were grown in Roswell park memorial institute (RPMI) medium supplemented with 10% (v/v) FCS and containing PS.

Chapter 2

Table 2.5 List of cell lines used in this thesis Cell line Description Source Chinese hamster ovary (CHO) Drs. Michael Brown and cells grown in sterol depleted Joseph Goldstein (UT CHO-7 media, which allows for Southwestern Medical manipulation of sterol status Centre, USA) (109) CHO cells used to generate Generated previously by CHO-Flp-In stable cell lines Dr. Gorjana Mitic Generated previously CHO cell line stably expressing CHO-DHCR24-V5 inhouse by Dr. Eser DHCR24 with a V5 epitope tag Zerenturk CHO cell line stably expressing Generated previously by CHO-EBP-V5 EBP with a V5 epitope tag Dr. Winnie Luu CHO cell line stably expressing Generated previously by CHO-LDM-V5 LDM with a V5 epitope tag Dr. Winnie Luu CHO cell line stably expressing Generated previously by CHO-LSS-V5 LSS with a V5 epitope tag Dr. Winnie Luu CHO cell line stably expressing Generated in this thesis CHO-NSDHL-V5 NSDHL with a V5 epitope tag (Chapter 5) CHO cell line stably expressing Generated in this thesis CHO-SC4MOL-V5 SC4MOL with a V5 epitope tag (Chapter 5) CHO cell line stably expressing Generated in this thesis CHO-SC5D-V5 SC5D with a V5 epitope tag (Chapter 5) Drs. Michael S. Brown and Human embryonic kidney (HEK) Joseph L. Goldstein (UT HEK-293 cells Southwestern Medical Centre, USA) Obtained from the School HEK-293T Highly transfectable HEK cells of Medical Science (UNSW, Sydney) HEK-Flp-In 293 HEK cells used to generate Purchased from Thermo T-REx stable cell lines Fisher Scientific HEK-MARCHF6- HEK cell line stably expressing Generated previously by V5 MARCHF6 with a V5 epitope tag Dr. Laura Sharpe HEK cell line stably expressing HEK-MARCHF6- Generated previously by MARCHF6 with a C9A mutation C9A-V5 Dr. Vicky Howe and a V5 epitope tag HEK cell line stably expressing HEK-MARCHF6- Generated previously by MARCHF6 with a Y340F Y340F-V5 Dr. Vicky Howe mutation and a V5 epitope tag HEK cell line stably expressing HEK-MARCHF6- Generated previously by MARCHF6 with a N890A L366A-V5 Dr. Vicky Howe mutation and a V5 epitope tag HEK-Flp-In 293 T-Rex cell line HEK-MARCHF6- Generated previously by with a partial MARCHF6 knock CRISPR Dr. Winnie Luu out using CRISPR-Cas9 HEK cell line stably expressing Generated previously by HEK-SM N100- the first 100 amino acids of SM Dr. Julian Stevenson and GFP-V5 fused to a GFP with a V5 epitope Lisa Phan tag

Chapter 2

Cell line Description Source Androgen sensitive cell line from Dr. Pamela Russell (Prince LNCaP lymph node carcinoma of the of Wales Hospital, Sydney) prostate Oestrogen and progesterone Dr. Kyle Hoehn (UNSW, MCF-7 sensitive breast cancer cell line Sydney)

2.2.4 Cloning and Plasmids

Plasmids used throughout this thesis were either purchased, gifted or generated in-house. Cloning methods utilised in this thesis are addressed in the relevant chapters, with common primers listed in Table 2.6. Briefly, PCR products were transformed into XL-10 Gold ultracompetent Escherichia coli (E. coli) cells for amplification according to manufacturer’s instructions, and a single colony selected for inoculation in 3 mL Luria broth with 100 µg/mL Ampicillin. Plasmids were isolated using the HiYield Plasmid Mini kit, then verified via Sanger sequencing at the Ramaciotti Centre for Genomics (UNSW), and analysed using Geneious Prime. Once verified, plasmids were propagated using DH5α cells and grown in 100 mL Luria broth with 100 µg/mL Ampicillin, and plasmids extracted with the NucleoBond Xtra Midi Plus kit. Plasmids were re-sequenced to ensure they were correct before being utilised for transfection in experiments.

Table 2.6 List of commonly used primers in this thesis Primer Sequence CMV CGCAAATGGGCGGTAGGCGTG T7 TAATACGACTCACTATAGGG BGHR2 GCGATGCAATTTCCTCATTT M6_Sequencing CACTGCAATACGATATTGGT

2.2.5 Transfections

For plasmid transfections, cell lines were seeded into 6-well plates and transfected for 24 h as follows. Plasmid transfections were completed using one of three reagents: Lipofectamine LTX, Lipofectamine 2000, or Lipofectamine 3000. All transfections were set up in Opti-MEM I reduced serum media for complexing before transfection. For Lipofectamine LTX transfections, a ratio of 1 µg plasmid DNA with 4 µL Lipofectamine LTX was used. For Lipofectamine 2000 transfections, a ratio of 1 µg plasmid DNA with 4 µL Lipofectamine 2000 reagent

Chapter 2

was used. For Lipofectamine 3000 transfections, a ratio of 1 µg plasmid DNA with 1.5 µL Lipofectamine 3000 reagent and 2 µL P3000 supplemental reagent was used. The incubation was carried out as per the manufacturer’s directions. Complexed plasmids were delivered to cells with appropriate maintenance media without antibiotics.

For siRNA transfections, cell lines were seeded into 6-well plates and transfected with 25 nM siRNA for 24 h as follows. 1.5 μL of 25 μM stock siRNA and 5 μL Lipofectamine RNAiMAX were complexed in 400 μL Opti-MEM I reduced serum media and delivered to cells to achieve a final concentration of 25 nM siRNA in maintenance medium without antibiotics.

For co-transfections of siRNA and plasmid DNA, Lipofectamine 2000 was used. A ratio of 1 µg of plasmid DNA, 2 µL 25 µM stock siRNA and 4.5 µL Lipofectamine 2000 were complexed in 500 µL Opti-MEM I reduced serum media. Complexed plasmids/RNA were delivered to cells with appropriate maintenance media without antibiotics.

2.2.6 Quantitative real-time PCR (qRT-PCR)

At the end of each experiment, cells were washed twice with PBS and lysed in 800 μL TRI reagent to isolate total RNA. 80 μL 1-bromo-3-chloropropane was added and samples were mixed and allowed to stand at room temperature for 10 min. The phases were separated by centrifuging at 16,200 g for 20 min at 4°C. 200 μL of the upper phase was removed and an equal volume of isopropanol was added to the extracted phase. Samples were mixed and RNA precipitated for at least 1 h at -20°C. Samples were then centrifuged at 16,200 g for 20 min at 4°C. The supernatant was removed, and the pellet was washed with 400 μL 70% (w/w) ethanol. The sample was then centrifuged at 16,200 g for 20 min at 4°C and the supernatant removed. The RNA pellet was left to dry and dissolved in 20 μL diethylpyrocarbonate (DEPC) treated water.

RNA yield was quantified with a Nanodrop ND 1000. Reverse transcription was as follows: the denaturation step was carried out with 5 μM Oligo dT, 1 mM dNTP, 1 μg total RNA in 10.5 μL total volume at 65°C for 5 min and 4°C for 5 min. For cDNA synthesis, 100 U SuperScript III reverse transcriptase, 40 U

Chapter 2

RNAseOUT, 5 mM MgCl2, 1 × RT buffer and 10 mM DTT were added to the 10.5 μL total RNA / Oligo dT / dNTPs mixture. The thermal cycler was set to 42°C for 50 min, 72°C for 15 min, and then held at 10°C. One RNA sample was always used as a negative control for genomic DNA contamination by excluding SuperScript III reverse transcriptase. The resultant cDNA was used for the qRT-PCR amplification template.

qRT-PCR was performed using a Rotor-Gene Q and analysed using Rotor-Gene Q Software. Reactions were carried out in 20 μL volumes containing 0.25 μM forward and reverse primers, 10 μL SensiMix SYBR No-ROX and 8.2 μL autoclaved Milli-Q water. Primer sequences used to amplify the genes of interest are detailed in Table 2.7. The thermal cycling protocols for qRT-PCR were 95°C for 10 min, (95°C for 15 s and 56°C or 60°C for 60 s) × 40 cycles, and the 56 or 60°C extension period was set to acquire data. Changes in gene expression levels were normalized to the housekeeping control porphobilinogen deaminase (PBGD) for each sample by the ΔΔCt method.

Chapter 2

Table 2.7 List of primer sequences for qRT-PCR used in this thesis Gene Direction* Sequence Ref. CASIMO1 F TTCCAGTCCACATGGGACACT (110) (human) R CAGCACGGTGCCCATGA F TGTGTGGCAAGATCAGCTTTGAGC Present CHIP (hamster) R CCCAGCCATTCTCAGAGATGAATGC Study F CTGCGCAGCATCGTTCTTAT EMC5 (human) (111) R GCCGGAAAAGTACTCGACCA F GCCGCCGTCCTGGATTATT EMC6 (human) (111) R GGAGGCGAGCAGGTAGAAGA F TTCGTCGGCACAAGAACTATC gp78 (human) (74) R GCACAGTCGTCATTGTTGACAG F TACACAGGCAAGCAACTCCC Present gp78 (hamster) R CACGCTCCGTCTGAAGAGAA Study F ACATGCTCTACACGGAGCTG Present Hrd1 (hamster) R CAGGGCAGTCTCTTAGCACC Study F CGCCTGTTGCAGAGGAGCC Insig-1 (human) (112) R CGAGGTGACTGTCGATACAGGG F CGCTCTTTCCACCTGATGTG Insig-2 (human) (112) R CAGTCCAATGGATAGTGCAGCC F GAGGTACTTCGACCTGGTGTC KLK3 (human) (113) R CACTGTAGAGCATGACATTG MARCHF6 F GAGGTACTTCGACCTGGTGTC (74) (human/hamster) R CACTGTAGAGCATGACATTG F AAAATGCGAGTGGGTCATTC MYBL1 (human) (114) R CCAGGACATGTGTTGAAAAACT F GAGTGATTCGCGTGGGTACC PBGD (human) (115) R GGCTCCGATGGTGAAGCC F AGATTCTTGATACTGCACTC PBGD (hamster) (116) R TGAAAGACAACAGCATCACA F GGTATATGGCCTTCTCGCCTTGGG Present RNF145 (human) R GTAAGGAGTGCTGCAGCATTCCGC Study CCTGAYCGMTACTTACAGGATAACC F Total CYP51A1 CAGC Present (human/hamster) RTATCCATYRATGAGRTCAAATTCAT Study R ATAAACGAAGC F CTGTTAGCTGCAACTTCAGTG TRC8 (human) (74) R GGTAGCTCTGTGATTAAGCC F GGAAGCGTATCGACCCATCC Present VCP (human) R CTCGTTTGATAGGCTCCCCTT Study * F = forward primer, R = reverse primer

Chapter 2

2.2.7 Protein harvest

Two protein harvest methods were utilised. Firstly, cells were washed twice with PBS, then lysed in mRIPA buffer supplemented with 2% (v/v) protease inhibitor cocktail. The cell lysate was then passed through a 23-gauge needle 20 times, rotated at 4 °C for 30 min, and then centrifuged at 17,000 g at 4 °C for 15 min. Alternatively, cells were washed twice with PBS, then lysed in SDS lysis buffer supplemented with 2% (v/v) protease inhibitor cocktail. The cell lysate was then passed through a 23-gauge needle 20 times, then vortexed for 30 min. The protein lysates were then normalised using a bicinchoninic acid assay.

2.2.8 Western blotting

Normalised whole protein lysates were boiled at 100°C for 5 min if necessary, mixed and then spun down. Equal amounts of protein were loaded onto a 10% (w/v) SDS-PAGE and electrophoresis was carried out typically with a constant current of 200 V for 40 min, followed by transfer of proteins from the SDS-PAGE onto a nitrocellulose membrane under a constant current of 200 V for 35 min – 60 min. Membranes were stained with Ponceau to ensure equal loading before blocking for at least 1 h in 5% (w/v) skim milk dissolved in PBST whilst rocking. Appropriate primary antibodies were incubated based on the description in Table 2.8. Membranes were then washed three times in PBST for 10 min whilst rocking at room temperature. Appropriate secondary antibodies were applied to membranes for 1 h whilst rocking at room temperature and the wash procedure repeated. Western blots were imaged with either Odyssey CLx Imager (LI-COR Biosciences) or ImageQuant LAS 500 (GE Healthcare). All Western blot analysis was carried out with Image Studio Lite (LI-COR Biosciences).

Chapter 2

Table 2.8 List of antibodies used in this thesis Antibody Dilution Diluent Incubation Secondary 5% (w/v) BSA in 1 h at room Anti-α-tubulin 1:50,000 Anti-Mouse PBST temperature 5% (w/v) BSA in 1 h at room Anti-FLAG 1:2,000 Anti-Mouse PBST temperature 5% (w/v) BSA in Overnight Anti-HA 1:5,000 Anti-Rabbit PBST at 4°C 5% (w/v) BSA in Overnight Anti-LDM 1:5,000 Anti-Rabbit PBST at 4°C 5% (w/v) BSA in 1 h at room Anti-ME2 1:5,000 Anti-Rabbit PBST temperature 5% (w/v) BSA in Overnight Anti-myc 1:1,000 Anti-Mouse PBST at 4°C 5% (w/v) BSA in Overnight Anti-myc 1:1,000 Anti-Rabbit PBST at 4°C 5% (w/v) skim milk 1 h at room Not Anti-PentaHis-HRP 1:10,000 in PBST temperature Applicable 5% (w/v) BSA in Overnight Anti-SM 1:2,500 Anti-Rabbit PBST at 4°C 1 h at room Anti-V5 1:5,000 PBST Anti-Mouse temperature 5% (w/v) BSA in Overnight Anti-Vinculin 1:10,000 Anti-Rabbit PBST at 4°C Peroxidase AffiniPure Donkey 5% (w/v) skim milk 1 h at room Not 1:10,000 Anti-Mouse or in PBST temperature Applicable Anti-Rabbit IgG IRDye 680RD Donkey Anti- 5% (w/v) skim milk 1 h at room Not Rabbit IgG or 1:10,000 in PBST temperature Applicable 800CW Donkey Anti-Mouse IgG

Chapter 2

2.2.9 Data presentation and statistical analysis

All qRT-PCR data is representative of at least three independent experiments, each performed in triplicate unless otherwise stated in the figure legend. Relative changes in gene expression levels were normalized to the housekeeping PBGD for each sample by the ΔΔCt method. Data are presented in the form of bar graphs as mean + S.E.M. unless otherwise stated in the figure legend.

All Western blots are representative of at least three independent experiments unless otherwise indicated in the Figure legends. Relative protein levels were determined by normalising to the control and/or vehicle which was set to 1. For data presented as percentage protein remaining, the ratio between the two conditions at each time point was calculated. Densitometry data are presented as bar graphs or line graphs with mean + S.E.M. unless otherwise stated in the Figure legend.

Statistical differences were determined by two-tailed Student’s paired t-test, where P values of < 0.05 (*) and < 0.01 (**) were considered statistically significant.

Chapter 3

Chapter 3 Post-translational regulation of MARCHF6

Some of the work presented in this chapter has been published (Sections 3.3.1 - 3.3.5) in the Journal of Biological Chemistry:

Sharpe, L.J., Howe, V., Scott, N. A., Luu, W., Phan, L., Berk, J.M., Hochstrasser, M., and Brown, A. J. (2019) Cholesterol increases protein levels of the E3 ligase MARCH6 and thereby stimulates protein degradation. J. Biol. Chem. 294 (7) 2436-2448 doi: 10.1074/jbc.RA118.005069.

Nicola A. Scott performed the majority of the experiments presented in all figures of Chapter 3 including cloning, sequence alignments, microscopy, Western blots, and quantitative real-time PCR.

Dr. Laura J. Sharpe contributed to the Western data presented in Figure 3.2A.

Dr. Winnie Luu contributed to the Western data presented in Figure 3.2A and B.

Dr. Vicky Howe contributed to the Western data presented in Figure 3.3A and Figure 3.5B, and the quantitative real-time PCR and Western data in Figure 3.4 for RNF145 and TRC8.

Isabelle M. Capell-Hattam performed the cell work for Figure 3.9A.

Chapter 3

3.1 Introduction

Most of the work conducted on the E3 ligase MARCHF6 has investigated its substrates. However, a largely unexplored area is the post-translational regulation of MARCHF6 itself, beyond its requirements for E2 conjugating enzymes (37) and deubiquitinases (72).

MARCHF6 is a known regulator of cholesterol metabolism with targets including the notable cholesterol synthesis rate-limiting enzymes HMGCR and SM (22, 75), the mutant cholesterol trafficker NPC1 (77), the mutant bile salt transporter BSEP (78), and the lipid droplet associated PLIN2 for cholesterol storage (76). Furthermore, MARCHF6 indirectly regulates the master transcription factors for cholesterol metabolism, SREBP and LXR (87).

Our lab hypothesised that cholesterol may regulate MARCHF6 to facilitate the increased degradation of these cholesterol metabolism proteins. This would not be the first described incidence of cholesterol manipulating the levels of an E3 ubiquitin ligase. Excess sterols transcriptionally upregulate IDOL and RNF145 through the sterol responsive nuclear receptor LXR (117, 118). Additionally, RNF145 and TRC8 are post-translationally downregulated by sterols through their sterol-sensing domains (83, 119, 120). This process is facilitated through the binding of the sterol-sensing domain binding proteins, Insigs, which prevents SREBP processing and the transcription of cholesterol synthesis genes. Additionally, the binding of RNF145 and TRC8 with Insigs through the sterol-sensing domain increases the degradation of the cholesterol synthesis enzyme HMGCR (83, 119, 120).

In addition to exploring cholesterol as a post-translational regulator of MARCHF6, three other factors were also considered. Firstly, reactive oxygen species (ROS) were investigated as there are precedents of cholesterol metabolism proteins being protected from degradation by oxidation of their ubiquitination sites (121, 122). Secondly, the microprotein, cancer-associated small integral membrane open reading frame 1 (CASIMO1), was investigated due to its regulation of the canonical MARCHF6 target SM (110). Finally, the ER membrane protein complex (EMC) which inserts membrane proteins, including

Chapter 3

sterol metabolism enzymes (111), into the ER was investigated in regards to polytopic MARCHF6.

In this chapter, we aim to identify factors that post-translationally regulate MARCHF6, with a particular focus on sterols.

Chapter 3

3.2 Methods

The majority of the materials and methods are described in Chapter 2; those that are particular to this chapter are described here.

3.2.1 Plasmids

Plasmids utilised in Chapter 3 are described below and schematic representations included in Figure 3.1.

The labs previously published MARCHF6-myc plasmid (74) was subcloned into the pcDNA5-FRT construct, and the myc epitope was exchanged for a V5 tag yielding pcDNA5-MARCHF6-V5. Site directed mutagenesis was performed to generate the pcDNA5-MARCHF6-C9A-V5, pcDNA5-MARCHF6- Y340A-V5, pcDNA5-MARCHF6-L366F-V5, and pcDNA5-MARCHF6-N890A-V5 (Section 3.2.2).

The pUC19-CASIMO1-HA plasmid (GenScript) was subcloned into the pcDNA5-FRT construct (Section 3.2.3).

Figure 3.1 Schematic representation of constructs utilised in Chapter 3 All constructs are attached to a C-terminal myc, V5 or HA epitope tag: MARCHF6 (103 kDa) wild-type, C9A, Y340A, L366F or N890A mutations or CASIMO1 (15 kDa). 43

Chapter 3

3.2.2 Site directed mutagenesis

Mutations in the pcDNA5-MARCHF6-V5 plasmid were created using site directed mutagenesis by megaprimer mutagenesis performed in two steps. Primers utilised are listed in Table 2.6 and Table 3.1. In the first step 20 µL reactions used 1 ng of template, 0.5 µM forward and reverse primers, 200 µM dNTPs, 5% (v/v) DMSO, 1 × HF Buffer, 1 U Phusion High-Fidelity DNA Polymerase with the volume made up to 20 µL in autoclaved Milli-Q water. Cycling conditions were: initial denaturation at 98°C 3 min, followed by (98°C 30 sec, 60°C 30 sec, 72°C 30 sec) × 35 cycles. Megaprimers generated were verified by agarose gel electrophoresis. The second step was in 20 µL reactions using 10 ng of template, 1.5 µL of products from the first amplification, 5% (v/v) DMSO, 1 × HF Buffer, 1 U of Phusion High-Fidelity DNA Polymerase with the volume made up to 20 µL in autoclaved Milli-Q water. Cycling conditions were: initial denaturation at 98°C 3 min, followed by 30 cycles of (98°C 30 sec, 68°C 4.5 min). The 20 µL mixture was digested overnight at 37°C with 20 U of DpnI. Products then followed transformation and verification as per Section 2.2.4.

Table 3.1 Site directed mutagenesis primers for MARCHF6 Plasmid Direction* Sequence MARCHF6 F CMV † C9A R CTTCTGACCGACACACTCTAGCTATGTCTTCCTCCGCG F CMV † MARCHF6 CAAATTATCAGTGTTATTGCTAAAAGTATGGCCCCAAC Y340A R TATGGTTGTGATTAGG MARCHF6 F CMV † L366F R GCAGACTCCGAATAAGCGACG MARCHF6 F CAACGACTCGTGGCCTACGAACGG N890A R BGHR2 †

* F = forward primer, R = reverse primer † = Primer sequence listed in Table 2.6

Chapter 3

3.2.3 Cloning by restriction enzymes

To subclone CASIMO1-HA into the pcDNA5-FRT plasmid, restriction enzymes were used. The amplification of the insert was conducted in 50 µL reactions using 2 ng template, 0.5 µM forward and reverse primers (Table 3.2), 200 µM dNTPs, 5% (v/v) DMSO, 1 × HF Buffer, 1 U of the Phusion Hot Start II High-Fidelity DNA Polymerase with the volume made up to 50 µL in Milli-Q water. Cycling conditions for the insert amplification were: initial denaturation at 98°C for 3 min, followed by (98°C for 30 sec, 60°C for 45 sec, 72°C for 15 sec) × 35 cycles, and a final extension at 72°C for 7 min. Equal volumes of amplicon products were separated by agarose gel electrophoresis to check the correct size of the amplicon and cleaned up using the QIAquick PCR Purification Kit (Qiagen) as per the manufacturer’s directions. The amplicon insert and pcDNA5-FRT vector were both digested with KpnI-HF and EcoRV-HF restriction enzymes for 30 min as follows: 30 µL insert amplicon or 2 µg pcDNA5-FRT, 1 × CutSmart, 1% (v/v) BSA, 2 U KpnI-HF and 2 U EcoRV-HF. Digested insert and vector were then ligated together over 6 h at 16°C as follows: 50 ng digested vector, 150 ng digested insert, 1 × T4 DNA Ligase Reaction Buffer, 200 U T4 DNA Ligase, and made up to 20 µL with Milli-Q water. The plasmid was then transformed into XL 10 Gold ultracompetent cells and verified by Sanger sequencing as described in Section 2.2.4.

Table 3.2 Primers used for subcloning CASIMO1 Plasmid Direction* Sequence F GCTTGGTACCATGGCTGTGTCCACAGAG CASIMO1 R GTGCTGGATATCTCAAGCGTAATCTGGAACATC *F = forward primer, R = reverse primer

Chapter 3

3.3 Results

Initial work conducted by our laboratory identified that MARCHF6 is not transcriptionally responsive to changing sterol status (123), unlike many other cholesterol homeostasis proteins (124).

3.3.1 Cholesterol stabilises MARCHF6 protein levels

Past work in our laboratory indicates that transient overexpression of proteins does not always capture the normal post-translational regulation of proteins (22). Furthermore, prior transient work demonstrated sterols did not affect MARCHF6 post-translationally (74). Therefore, to appropriately investigate the post-translational regulation of MARCHF6 by cholesterol, the use of stable cell lines expressing MARCHF6 with either a myc or V5 epitope tag were utilised.

To thoroughly investigate the role of cholesterol in modulating MARCHF6 protein levels, HEK-MARCHF6-myc cells were cultured with or without statin to induce sterol starvation which in turn favours the transcriptional upregulation of cholesterol synthesis enzymes including our control substrate SM. MARCHF6-myc was increased when treated with cholesterol, irrespective of statin treatment (Figure 3.2). Furthermore, MARCHF6 was more abundant in the absence of statin. The converse was observed for our control cholesterol synthesis enzyme SM, whereby it decreased when treated with cholesterol, and increased in the statin treated cells.

The rate at which MARCHF6 accumulated when treated with cholesterol was investigated through the use of time-course experiments, covering a duration of 8 h. MARCHF6-V5 protein levels increased steadily over the period of 8 h and this was statistically significant at all tested timepoints (Figure 3.2).

Chapter 3

Figure 3.2 MARCHF6 is stabilised by cholesterol A HEK-MARCHF6-myc cells were pre-treated with or without statin overnight, then treated with proteasomal inhibitor (10 µM MG132) for 2 h to increase basal MARCHF6 levels. Cells were finally treated with or without 20 µg/mL Chol/CD (Chol) for 6 h. B HEK-MARCHF6-V5 cells were treated with or without 20 µg/mL Chol/CD (Chol)for the indicated time. Protein levels were analysed by Western blotting with myc, V5, endogenous SM or vinculin antibodies. Data are presented as mean + or - S.E.M. from A n = 3, B n = 4 independent experiments, where * P < 0.05 and ** P < 0.01. Relative protein levels were measured using ImageStudio Lite and normalised to the vehicle condition of the 8 h timepoint which was set to 1.

Chapter 3

3.3.2 Cholesterol inhibits the degradation of MARCHF6

Initial work in our lab identified MARCHF6 as highly labile in the absence of cholesterol (Figure 3.2A). Building upon this, the machinery and mechanisms behind this stabilisation were investigated with a focus on whether the cholesterol mediated stabilisation of MARCHF6 was due to a decrease in degradation rather than an increase in synthesis. Inhibition of the proteasome with MG132, or inhibition of the retrotranslocation machinery, valosin-containing protein (VCP, also known as p97) with CB5083, increased the basal levels of MARCHF6-V5 levels significantly, but cholesterol did not further increase these levels (Figure 3.3). Similar to enzyme inhibition, the knockdown of VCP using siRNA increased MARCHF6-V5 protein levels, with cholesterol treatment not increasing these levels further (Figure 3.3). Together these results indicate that cholesterol is key to preventing the extraction of MARCHF6 from the ER membrane by VCP and ultimately degradation by the proteasome.

Chapter 3

Figure 3.3 MARCHF6 degradation is inhibited by cholesterol A HEK-MARCHF6-V5 cells were treated with or without 20 μg/mL Chol/CD (Chol) and proteasomal (10 µM MG132) or VCP (5 µM CB5083) inhibitors for 4 h. B HEK-MARCHF6-V5 cells were transfected with 25 nM control (Ctrl) or VCP siRNA for 24 h, then mRNA levels measured using qRT-PCR and normalised to the housekeeping gene PBGD. mRNA levels were normalised to the vehicle (Veh.) control siRNA condition which was set to 1. Data are presented as mean + S.E.M. from n = 4 independent experiments each performed in triplicate, where * P < 0.05. C HEK-MARCHF6-V5 cells were transfected with 25 nM control (Ctrl) or VCP siRNA for 24 h, then treated with or without 20 μg/mL Chol/CD (Chol) for 4 h. A, C Protein levels were analysed by Western blotting with V5, endogenous SM and vinculin antibodies. Data are representative of at least three independent experiments (A n = 3-6, C n = 4).

Chapter 3

3.3.3 ERAD associated E3 ubiquitin ligases may play a role in the

degradation of MARCHF6

The role of other E3 ligases involved in ERAD were investigated to identify whether they may play a role in the cholesterol stabilisation of MARCHF6. The E3 ubiquitin ligases gp78, RNF145 and TRC8 were investigated due to their role in regulating cholesterol metabolism (82, 83). Furthermore, RNF145 and TRC8 undergo post-translational control by sterols (83, 119, 120).

All E3 ligases were knocked down significantly by at least 63% (Figure 3.4A). The knockdown of TRC8 or RNF145 resulted in minimal change to MARCHF6-V5 protein levels, whereas the basal level of MARCHF6 was elevated with gp78 knockdown. Cholesterol stabilisation was not ablated in any knockdown condition (Figure 3.4B), suggesting that these ERAD associated E3 ubiquitin ligases are not involved in the stabilisation of MARCHF6 by cholesterol.

gp78 was the only E3 ubiquitin ligase that resulted in a statistically significant increase in MARCHF6-V5 protein levels, however only in the basal condition. This is indicative that gp78 may play a minor role in the basal degradation of MARCHF6.

Chapter 3

Figure 3.4 gp78 may play a role in the basal regulation of MARCHF6 A HEK-MARCHF6-V5 cells were transfected with 25 nM indicated siRNA for 24 h, then mRNA levels measured using qRT-PCR and normalised to the housekeeping gene PBGD. mRNA levels were normalised to the control siRNA vehicle condition which was set to 1. Data are presented as mean + S.E.M. from at least three (gp78 n = 3, RNF145 and TRC8 n = 4) independent experiments each performed in triplicate, where ** P < 0.01. B HEK-MARCHF6-V5 cells were transfected with 25 nM indicated siRNA for 24 h, then treated with or without 20 μg/mL Chol/CD (Chol) for 4 h. Protein levels were analysed by Western blotting with V5 and vinculin antibodies. Data are presented as mean + S.E.M. from at least three (gp78 n = 6, RNF145 and TRC8 n = 3) independent experiments, where * P < 0.05. Relative protein levels were measured using ImageStudio Lite and normalised to the control vehicle condition which was set to 1.

Chapter 3

3.3.4 MARCHF6 may contain a sterol sensing domain

As MARCHF6 is sensitive to sterol status, we predicted that it may contain a sterol sensing domain (SSD). These are regions within proteins consisting of five transmembrane domains (TMDs) capable of sensing the sterol environment (125, 126). Preliminary work conducted by the laboratory determined the MARCHF6 putative SSD contained similar transmembrane domain spacing and orientation compared with bona fide SSD-containing proteins. The predicted MARCHF6 SSD (amino acids 330-543; TMD4 to TMD8), shared sequence homology with three proteins that possessed a classical SSD: HMGCR (127), NPC1 (128) and SCAP (126).

Furthermore, the critical tyrosine residue in the classical YIYF motif in the first transmembrane domain of the putative SSD of MARCHF6 was conserved (Tyr-340) (129). While initial reports of SSDs characterised this conserved motif as YIYF, some SSD containing proteins have variations. NPC1 and NPC1L1 proteins contain YISL, which is similar to that of the putative SSD of MARCHF6 which contains YILL (Figure 3.5A). MARCHF6 also has a critical lysine residue (Lys-366) within the second transmembrane domain of the putative SSD that is generally conserved between the SSD containing proteins (Figure 3.5A) (129).

Mutation of these critical residues of the putative SSD to residues that abolished the function of the SCAP SSD (Y340A, L366F) did not significantly alter stabilisation by cholesterol compared with the wild-type version. Whilst the Y340A mutant had a repeatable increase in MARCHF6 stabilisation by cholesterol, this was attributed to a greater spread in the data rather than a biological phenomenon. Furthermore, the expression of these constructs under basal conditions was only slightly elevated compared with the wild-type (Figure 3.5B). This indicates that the SSD in MARCHF6 probably does not play a role in the whole protein’s stabilisation by cholesterol.

Chapter 3

Figure 3.5 MARCHF6 may contain a sterol sensing domain A Alignment of MARCHF6’s Tyr-340 and Leu-366 with the indicated proteins that contain sterol sensing domains. The YILL motif is localised in transmembrane domain 4 of MARCHF6. B HEK-MARCHF6-V5 wild-type (WT) or indicated mutant cell lines were treated with or without 20 μg/mL Chol/CD (Chol) for 4 h. Protein levels were analysed by Western blotting with V5 and vinculin antibodies. Data are presented as mean + S.E.M. from n = 4 independent experiments. Relative protein levels were measured using ImageStudio Lite and normalised to the control vehicle condition which was set to 1.

Chapter 3

3.3.5 Insigs are unlikely to be involved in the stabilisation of MARCHF6 by

cholesterol

As MARCHF6 contains a possible SSD, and SSDs have been proposed as Insig binding domains (126), the potential involvement of Insigs in the cholesterol stabilisation of MARCHF6 was investigated. MARCHF6 was stabilised in response to the oxysterol 25-hydroxycholesterol (123), which also binds Insigs (130). The knockdown of Insig-1, Insig-2 or both using siRNA showed at least a 60% decrease in their respective mRNA levels (Figure 3.6A). Furthermore, this knockdown resulted in a 2.2-fold increase in MARCHF6-V5 at the basal level when Insig-2 was knocked down, however, Insig-1 had little effect. The dual knockdown of Insig-1/2 had minimal effect on MARCHF6 levels. In all knockdown conditions, MARCHF6 was still stabilised by cholesterol (Figure 3.6B). This indicated that Insig-2 may play a role in the basal degradation of MARCHF6, but neither Insig plays a major role in the cholesterol dependent stabilisation of MARCHF6.

Chapter 3

Figure 3.6 Insigs are unlikely to be involved in the cholesterol mediated stabilisation of MARCHF6 A HEK-MARCHF6-V5 cells were transfected with 25 nM indicated siRNA for 24 h, then mRNA levels measured using qRT-PCR and normalised to the housekeeping gene PBGD. mRNA levels were normalised to the control siRNA vehicle condition which was set to 1. Data are presented as mean + S.E.M. from n = 4 independent experiments each performed in triplicate. B HEK-MARCHF6- V5 cells were transfected with 25 nM indicated siRNA for 24 h, then treated with or without 20 μg/mL Chol/CD (Chol) for 4 h. Protein levels were analysed by Western blotting with V5 and vinculin antibodies. Data are presented as mean + S.E.M. from n = 9 independent experiments, where * P < 0.05. Relative protein levels were measured using ImageStudio Lite and normalised to the control vehicle condition which was set to 1. 55

Chapter 3

3.3.6 Reactive oxygen species result in the rapid turnover of MARCHF6

In recent years, ROS have been shown to prevent the degradation of cholesterol storage (SOAT2, also known as ACAT2) and regulatory proteins (Insig-2) through the oxidation of cysteine residues, which can act as ubiquitination sites (121, 122). ROS was investigated as a potential post- translational regulator of MARCHF6 for two reasons: Insig-2 may participate in the basal regulation of MARCHF6 (Section 3.3.5) and is sensitive to ROS (122), and MARCHF6 participates in non-canonical ubiquitination (131).

As little is known about the regulated degradation of MARCHF6, the oxidant Menadione was used to investigate whether MARCHF6 was affected by ROS. When cells were treated with Menadione, MARCHF6-V5 levels decreased significantly, and in a dose dependent manner (Figure 3.7). Whether the use of ROS had a reciprocal effect on the canonical MARCHF6 substrate SM was also investigated. Whilst SM remained stable when subjected to low concentrations of ROS, higher concentrations did reduce its levels (Figure 3.7B). However, this may be due to the potentially toxic effects exerted by ROS. Consequently, the possible counter effect that cholesterol may play on this system was not investigated.

These data indicate that MARCHF6 does not undergo stabilisation through the protection of a cysteine ubiquitination site via oxidation. Moreover, assuming the results are not compromised by toxicity issues, MARCHF6 could be highly susceptible to degradation when exposed to ROS, while SM is somewhat protected. This remains a possible avenue of investigation for SM but was beyond the scope of this project.

Chapter 3

Figure 3.7 Reactive oxygen species result in the degradation of MARCHF6 A HEK-MARCHF6-V5 cells were treated with 20 μg/mL Chol/CD (Chol) or 12.5 μM Menadione (Men) for 8 h. B HEK-MARCHF6-V5 cells were treated with the indicated concentrations of Menadione for 4 h. Protein levels were analysed by Western blotting with V5, endogenous SM and vinculin antibodies. Data are presented as mean + S.E.M. from A n = 3 and B n = 2 independent experiments, where ** P < 0.01. Relative protein levels were measured using ImageStudio Lite and normalised to the vehicle condition which was set to 1.

Chapter 3

3.3.7 The microprotein CASIMO1 that regulates the MARCHF6 substrate

SM is transcriptionally responsive to steroid hormones

During my PhD, a microprotein called CASIMO1 was identified as a regulator of the canonical substrate of MARCHF6, SM, in breast cancer cell lines (110). CASIMO1 levels were elevated in oestrogen and progesterone receptor positive breast cancer cell lines and decreased in receptor negative cells. Furthermore, when CASIMO1 levels were increased, SM levels were also elevated, and vice versa for when CASIMO1 levels were decreased. An increase in CASIMO1 levels also increased the number and size of lipid droplets and was exacerbated with fatty acid treatment, which is known to stabilise SM (110). It was hypothesised that CASIMO1 may regulate SM through MARCHF6, and this is addressed in Section 3.3.8.

Considering the link with oestrogen and progesterone, it was also hypothesised that CASIMO1 may be regulated by steroid hormones. As several relevant sample sets existed within the lab, the role of steroid hormones in the transcriptional regulation of CASIMO1 was investigated.

cDNA samples from Coates et al. (58) were utilised to test the androgen responsiveness of CASIMO1, whereby androgen sensitive LNCaP cells were treated with the androgen, dihydrotestosterone (DHT), or co-treated with DHT and the androgen receptor agonist bicalutamide. Furthermore, cDNA samples from Krycer et al. (114) were utilised to test the oestrogen responsiveness of CASIMO1, whereby the oestrogen sensitive MCF-7 cells were treated with the oestrogen, 17β-estradiol. CASIMO1 expression was reduced when treated with either testosterone or oestrogen in prostate and breast cell lines respectively (Figure 3.8). Furthermore, in the LNCaP cells, the suppression of CASIMO1 could be partially reversed upon treatment with the androgen receptor agonist bicalutamide (Figure 3.8A), like that of the positive control KLK3. Therefore, CASIMO1 is likely to be transcriptionally controlled by steroid hormones, but further studies should be conducted to analyse the promoter. This was beyond the scope of this project and so we instead focused on the role of CASIMO1 in cholesterol homeostasis in the next section.

Chapter 3

Figure 3.8 The microprotein CASIMO1 is transcriptionally regulated by steroid hormones A cDNA from (58) was utilised, where LNCaP cells were starved of steroid hormones for 24 h, then treated with 1 nM dihydrotestosterone (DHT) in the presence or absence of 10 µM bicalutamide (Bic.) for 24 h. B cDNA from (114) was utilised, where MCF-7 cells were starved of steroid hormones for 24 h, then treated with 1 nM 17β-estradiol (E2) for 24 h. mRNA levels were measured using qRT-PCR and normalised to the housekeeping gene PBGD and vehicle (Veh.) conditions which were set to 1. Data are presented as mean + S.E.M. from n = 3 independent experiments each performed in triplicate.

Chapter 3

3.3.8 The role of CASIMO1 in cholesterol homeostasis

Due to the role of CASIMO1 in the regulation of SM and potential wider reaching implications in cholesterol homeostasis, we sought to identify whether CASIMO1 was responsive to sterols transcriptionally like many cholesterol metabolism proteins (124). MCF-7 cells were treated with statins to inhibit cholesterol synthesis, or with sterols (25-hydroxycholesterol and 24(S),25-epoxycholesterol) to increase sterol status, or the LXR agonist TO-01317 to upregulate LXR targets. CASIMO1 was minimally responsive to sterols (Figure 3.9A) compared with canonical sterol responsive targets (132), indicating it is unlikely to be an SREBP or LXR target in MCF-7 cells.

Lastly, the role of CASIMO1 in the cholesterol mediated regulation of MARCHF6 and its substrate SM was investigated. Firstly, CASIMO1 was knocked down in MCF-7 cells to determine whether cholesterol may play a role in decreased SM levels through CASIMO1. From this, CASIMO1 mRNA levels were reduced by 78% (Figure 3.9B), which resulted in a minimal decrease in SM protein levels (Figure 3.9C). Furthermore, cholesterol treatment still leads to the degradation of SM (Figure 3.9C), whereas the knockdown of MARCHF6 ablated cholesterol mediated degradation of SM. Furthermore, investigation into the effect of CASIMO1 via its overexpression or knockdown minimally affected the levels of MARCHF6 and did not affect its cholesterol stabilisation (Figure 3.9D, F). This indicates that CASIMO1 is unlikely to participate in the regulated degradation of SM by cholesterol nor the cholesterol stabilisation of MARCHF6. In addition to this, CASIMO1 knockdown reduced the growth of HEK-MARCHF6-V5 cells compared to the control (Figure 3.9E) and is in line with previous observations and published work (110).

Chapter 3

Figure 3.9 CASIMO1 is minimally involved in cholesterol metabolism A MCF-7 cells were treated for 24 h with 5 µM compactin (Statin), 10 µM 25-hydroxycholesterol (25HC), 10 µM 24(S),25-epoxycholesterol (24,25 EC) or 10 µM TO-901317 (T-0, LXR agonist) as previously described (132). B MCF-7 cells were transfected with 25 nM indicated siRNA for 24 h, then mRNA levels were measured using qRT-PCR and normalised to the housekeeping gene PBGD and control siRNA vehicle conditions which were set to 1. Data are presented as mean + half range from A n = 2, B n = 1 experiments each performed in triplicate. C MCF-7, D, E HEK-MARCHF6-V5 cells were transfected with 25 nM indicated siRNA for 24 h then treated with 20 µg/mL Chol/CD (Chol) for 8 h. E Image taken with EVOS M5000 Imaging System of vehicle treated cells with indicated siRNA. F HEK-MARCHF6-V5 cells were transfected with 1 µg indicated plasmid for 24 h then treated with 20 µg/mL Chol/CD (Chol) for 8 h. Protein levels were analysed by Western blotting with V5, HA, endogenous SM, α-tubulin and vinculin antibodies. Data for C, D, E and F are presented from n = 1 experiment. 61

Chapter 3

3.3.9 The ER membrane protein complex may be involved in the membrane

insertion of MARCHF6

The EMC is involved in the regulation and insertion of a number of ER membrane bound enzymes, and in particular cholesterol synthesis and regulatory enzymes (111, 133), including SM. As MARCHF6 is heavily involved in the degradation and regulation of cholesterol synthesis, we hypothesised that the EMC may be involved in the insertion of MARCHF6 into the ER membrane, as it is a large multi-transmembrane domain protein. Knockdown of the core EMC component proteins (EMC5 and EMC6) resulted in reduced mRNA levels, however, the siRNA for EMC6 also knocked down EMC5 significantly but not to the same extent (Figure 3.10A).

Only the knockdown of EMC5 resulted in alterations to MARCHF6 protein levels with a 2.4-fold increase observed (Figure 3.10B). This increase was similar to that of the control, SM for EMC6 knockdown. Whilst the knockdown of EMC6 does affect EMC5, the reduced amount of EMC5 knockdown could account for the absence of increased MARCHF6 protein levels.

However, both of these observations appear to be anomalies in the field, with the knockout of EMC components typically increasing the rate of degradation of proteins (133). The results for MARCHF6 and SM suggest that they are not inserted properly into the ER membrane. However, instead of being degraded through typical ERAD processes, both MARCHF6 and SM are protected. Whether this is due to MARCHF6 being unable to target SM for degradation has yet to be determined and warrants further investigation. However, due to conflicting results regarding EMC5 and EMC6, we did not pursue this further.

Chapter 3

Figure 3.10 The ER membrane protein complex may be involved in the insertion of MARCHF6 into the ER membrane A HEK-MARCHF6-V5 cells were transfected with 25 nM indicated siRNA for 24 h, then mRNA levels were measured using qRT-PCR and normalised to the housekeeping gene PBGD and control siRNA vehicle conditions which were set to 1. Data are presented as mean + S.E.M. from n = 3 independent experiments each performed in triplicate. B HEK-MARCHF6-V5 cells were transfected with 25 nM indicated siRNA for 24 h. Protein levels were analysed by Western blotting with V5, endogenous SM and vinculin antibodies. Data are presented as mean + S.E.M. from n = 3 independent experiments, where * P < 0.05. Relative protein levels were measured using ImageStudio Lite and normalised to the control condition which was set to 1.

Chapter 3

3.4 Discussion

In this chapter, a novel mode of post-translational control for the E3 ubiquitin ligase MARCHF6 by cholesterol was uncovered. Cholesterol also regulates three other E3 ligases: IDOL, TRC8 and RNF145 (117, 118). IDOL and RNF145 are LXR target genes that are transcriptionally upregulated in response to an increase in sterols (117, 118). Additionally, TRC8 and RNF145 are post- translationally downregulated in response to excess sterols (83, 119, 120). However, MARCHF6 is the first example of an E3 ligase being boosted by cholesterol post-translationally, rather than being decreased. The stabilisation of MARCHF6 is purely a post-translational response, as its transcription is unaffected by changes to sterol status (Figure 3.2, (123)). Previous work has demonstrated that cholesterol binds MARCHF6 (134), however where this interaction takes place in the large fourteen transmembrane domain containing protein has yet to be clarified.

Besides investigating sterol specificity for MARCHF6 stabilisation, the mechanism of how this occurred was investigated. MARCHF6 undergoes turnover through autodegradation (37), but little is known about this mechanism. The chaperones that MARCHF6 engages to facilitate the attachment of ubiquitin are unidentified, with USP19 the only deubiquitinase known to protect MARCHF6 from degradation (72). Furthermore, whether MARCHF6 undergoes cis or trans autoubiquitination is undetermined but could prove an interesting field of investigation. We investigated whether cholesterol may inhibit this autodegradation process. Inhibition or knockdown of the ER membrane retrotranslocator VCP identified a critical unknown regulator of MARCHF6 (Figure 3.3), in addition to its degradation by the proteasome. Cholesterol inhibited the extraction and degradation of MARCHF6 (Figure 3.3). Subsequently, mutations in the critical RING (37) and the CTE (62) domains of MARCHF6, substantially elevated the levels of MARCHF6 with cholesterol not causing further stabilisation (123). We, therefore, propose that cholesterol inhibits the degradation of MARCHF6 through its autodegradation. This mechanism has been further clarified using molecular chaperones, which assist in protein folding and direct proteins to adapt to their natural conformation (135). Typically, MARCHF6

Chapter 3

favours a conformation that leads to its rapid degradation likely through autodegradation, but cholesterol likely induces a conformational change in MARCHF6 that favours a more stable conformation and inhibits its autodegradation (123).

Of particular interest was the potential for MARCHF6 to contain an SSD which are domains of conserved regions within proteins consisting of five transmembrane domains that possess a wide variety of functions (125). Several cholesterol related proteins including HMGCR (136, 137), NPC1(128, 138, 139) and SCAP (127) contain SSDs. Notably, the first ER luminal loop before the SSD within SCAP can bind cholesterol and causes conformational changes inhibiting SREBP processing (126). Alternatively, the SSD in HMGCR binds Insig and aids the interaction with the E3 ubiquitin ligase gp78 to facilitate the degradation of HMGCR (140). Based on the predicted orientation of the transmembrane domains and the presence of critical motifs, MARCHF6 may contain a putative SSD (Figure 3.5). However, mutation of critical residues within signature motifs of the SSD did not impact upon basal expression of MARCHF6, nor the cholesterol stabilisation effect.

As SSDs have been proposed as Insig binding domains for several SSD containing proteins including SCAP (141, 142), HMGCR (140) and the E3 ligase RNF145 (143) which regulates HMGCR; we investigated whether Insigs played a role in the cholesterol stabilisation of MARCHF6. Neither Insig-1 nor Insig-2 affected the cholesterol stabilisation of MARCHF6, however, Insig-2 may control basal levels of MARCHF6 (Figure 3.6). However, dual knockdown of both Insigs blunted this effect, suggesting that they may play a complex role in the regulation of protein quality control machinery. This may also incorporate the E3 ligase gp78, which as previously mentioned regulates HMGCR through Insig-1 (140). gp78 may play a minor role in the degradation of MARCHF6 (Figure 3.4), and whether this may have occurred through Insig-2 is a potential avenue for further investigation. Alternatively, in the absence of both Insigs, gp78 may be more freely available to degrade MARCHF6, blunting the increase in MARCHF6 levels observed with Insig-2 knockdown alone. Verification of the MARCHF6 SSD and the potential role that Insigs, particularly that of Insig-2, play in the regulation of MARCHF6 is an interesting area for future work. Whether this may affect its 65

Chapter 3

activity or specificity towards substrates is also something that could come to light through these investigations.

As some substrates of MARCHF6 are decreased with increased sterol levels (22, 85, 86, 144), cholesterol may affect the specificity of MARCHF6 for its substrates. The role of ubiquitin in this process, particularly in how it regulates MARCHF6 following the addition of cholesterol could prove an interesting area of future investigation. The cholesterol stabilisation of MARCHF6 not only affects cholesterol metabolism enzymes, but other substrates (DIO2 and RGS2) also undergo increased rates of degradation in the presence of cholesterol as well (123). This proposes an interesting mode of regulation for ERAD substrates, as some E3 ligases are upregulated in low sterol conditions, while MARCHF6 is upregulated in high sterol conditions. For example, both MARCHF6 and TRC8 can regulate some of the same substrates (39), however, favour differing sterol environments (Chapter 3, (119, 120)). Furthermore, both MARCHF6 and TRC8 are ubiquitously expressed across cell lines and tissue types (GTEx Portal). This opens up a fascinating avenue for investigation where different E3 ligases could change their substrate specificity based on the conditions surrounding them and are not just cell or tissue type specific.

In addition to characterising the cholesterol mediated stabilisation of MARCHF6, additional factors were also considered. ROS was identified as a potential trigger for the degradation of MARCHF6 but had a minimal effect on its canonical substrate SM (Figure 3.7). ROS is often a by-product when lipid accumulation of cholesterol or fatty acids occurs and causes dysfunction of the mitochondria (145–147). Most recently, ROS has been implicated in preventing the degradation of Insig-2 and SOAT2 through the oxidation of critical cysteine residues required for their ubiquitination and ultimately prevents degradation (121, 122). Furthermore, MARCHF6 is known to participate in non-canonical ubiquitination of serine residues in SM (131) likely through its cognate E2 conjugating enzyme Ube2J2 (67). Together this suggests that MARCHF6 itself is unlikely to utilise ROS protectively, however, leaves the possibility that SM may undergo similar processes to Insig-2 and SOAT2 in response to ROS. This leaves an interesting area for future investigation due to the complex regulation that SM undergoes (84). 66

Chapter 3

A novel regulator of SM was uncovered during my PhD, whereby the microprotein CASIMO1 regulates SM levels in breast cancer cell lines (110). Consequently, lipid droplet growth is partially induced through CASMIO1 and stimulated upon feeding cells fatty acids (110), which stabilise SM (148). Two critical mechanisms were preliminarily investigated: steroid hormone and sterol mediated transcriptional regulation of CASIMO1, and whether CASIMO1 plays a role in the cholesterol mediated degradation of SM via MARCHF6. As steroid hormones are a secondary product of cholesterol and CASIMO1 is upregulated in cell lines that are responsive to oestrogen and progesterone this was a logical area to explore. Consequently, it was demonstrated that CASIMO1 was downregulated upon treatment with oestrogen in breast cancer cells, with similar results observed with androgens in prostate cancer cell lines (Figure 3.8). Furthermore, CASIMO1 was minimally affected by sterols at the transcriptional level (Figure 3.9). Whether CASIMO1 may assist MARCHF6 in the degradation of SM was also considered, but CASIMO1 did not alter the cholesterol mediated degradation of SM, nor the protein levels of MARCHF6 (Figure 3.9). The exact role that CASIMO1 plays in the regulation of SM and cholesterol metabolism is unknown. There is very little known about CASIMO1 generally and the potential for it to modulate a number of processes, particularly those within hormone sensitive cancers is an attractive area for further investigation.

Finally, the EMC was investigated as it has an expanding role in sterol and lipid metabolism (111, 149). The effect of EMC knockdown on SM was replicated from previous literature (111, 133). Knockdown of one of the core EMC components prevented the degradation of MARCHF6 (Figure 3.10). Likely this is due to the inability of MARCHF6 to be properly inserted into the membrane of the ER. Correct insertion of MARCHF6 is likely critical due to it being such a large hydrophobic protein with fourteen transmembrane domains. Possibly, MARCHF6 becomes trapped in the ER lumen when the EMC is unavailable. However, this raises the question as to why it is not removed as a misfolded protein through other processes. The role of the EMC and ERAD is an expanding area of investigation (50, 150, 151) and is likely to yield important discoveries with far reaching implications in the regulation of metabolism and disease.

Chapter 3

In conclusion, MARCHF6 is post-translationally regulated in several ways including its stabilisation by cholesterol, its possible degradation by ROS and likely its requirement of the EMC to be properly inserted into the membrane of the ER. Moreover, the microprotein CASIMO1 is transcriptionally responsive to steroid hormones and may help to facilitate the degradation of SM.

Chapter 4

Chapter 4 Identification of new substrates of MARCHF6

Nicola A. Scott performed all experiments presented in the figures of Chapter 4 including cloning, BioID, Western blots, and bioinformatic analyses.

Dr. Winnie Luu performed the mass spectrometry data presented in Table 4.2, Table 4.3, Appendix (Table 8.1 and Table 8.2) and analysed in Section 4.3.5.

Chapter 4

4.1 Introduction

Identification of substrates that an E3 ubiquitin ligase targets is crucial in understanding its physiological role, including the metabolic processes and pathways it is involved in. Additionally, by analysing each substrate and its degron features the mechanisms by which E3s act and regions they target can be uncovered.

The majority of MARCHF6 substrates have been identified through small- scale laborious experimentation, whereby research groups typically identified MARCHF6 as the E3 ubiquitin ligase for their protein of interest. Chapter 4 sought to expand upon the current list of known MARCHF6 substrates, totalling six at the time of investigation (37, 74, 75, 78–80). Identification of additional MARCHF6 substrates could further elaborate upon the metabolic pathways that MARCHF6 is already known to target, including sterol and lipid metabolism (59). Furthermore, understanding the impacts that MARCHF6 could have on whole body metabolism could shed light on potential roles this E3 ligase may play in disease.

This chapter aimed to identify new substrates of MARCHF6 through three broad methodologies. Firstly, two candidate substrates were identified and investigated. The first candidate was identified from previously generated mass spectrometry data from our lab, and the second from collaborators’ data that observed enlarged lipid droplets with MARCHF6 knockdown (Figure 4.1). Secondly, preliminary experiments were conducted with a new high throughput method (BioID) to identify MARCHF6 substrates. Finally, the existing literature was consulted and mass spectrometry datasets from our laboratory and others were compared to identify common and high confidence MARCHF6 candidate substrates. Greater details for each approach are given at the beginning of the corresponding sections.

Chapter 4

Figure 4.1 MARCHF6 knockdown increases the size of lipid droplets Adipocyte 3T3-L1 cells were transfected for 48 h with control (Ctrl) or MARCHF6 siRNA, then treated with fatty acid overnight to induce lipid droplet (LD) formation. Cells were stained with BODIPY for lipid droplets and the sizes quantified. Representative cells are shown, bar = 10 µm. Experiments performed by Dr. Robin Du from Prof. Rob Yang’s lab (unpublished data).

Chapter 4

4.2 Methods

The majority of the materials and methods are described in Chapter 2; those that are particular to this chapter are described here.

4.2.1 Plasmids

Plasmids utilised in Chapter 4 are described below and schematic representations included in Figure 4.2.

The mouse protein coding sequence of Fat specific protein 27 (FSP27, also known as CIDEC) with a C-terminal FLAG epitope tag (pCMV5-FSP27- FLAG), and a mutant form with the linker region removed (pCMV-FSP27 Δ120- 135-FLAG) was a gift from Dr. Peng Li (152).

The bacterial E. coli protein coding sequence of BirA was subcloned into the pcDNA5-FRT expression vector (Life Technologies) with a C-terminal FLAG epitope tag (pcDNA5-BirA-FLAG) (Section 4.2.2). The pcDNA5-MARCHF6-V5- FRT plasmid was used as a template to insert BirA-FLAG between MARCHF6 and the V5 epitope tag via polymerase incomplete primer extension (PIPE) (Section 4.2.3).

Figure 4.2. Schematic representation of constructs utilised in Chapter 4 Illustrated are the constructs utilised in Chapter 4, all attached to a C-terminal FLAG epitope tag: FSP27 (27 kDa), FSP27 Δ120-135 (25 kDa), BirA (35 kDa), and MARCHF6 fused with BirA (138 kDa).

Chapter 4

4.2.2 Cloning by restriction enzymes

To generate the BirA-FLAG construct used in Chapter 4, restriction enzymes were utilized to subclone BirA-FLAG into the pcDNA5-FRT plasmid. The amplification of the insert was conducted in 50 µL reactions using 10 ng template, 0.5 µM forward and reverse primers (Table 4.1), 200 µM dNTPs, 5% (v/v) DMSO, 1 × HF Buffer, 1 U of the Phusion Hot Start II High-Fidelity DNA Polymerase with the volume made up to 50 µL in Milli-Q water. Cycling conditions for the insert amplification were: initial denaturation at 98°C for 3 min, followed by (98°C for 30 sec, 63°C for 30 sec, 72°C for 1 min) × 35 cycles. Equal volumes of amplicon products were separated by agarose gel electrophoresis to check the correct size of the amplicon and cleaned up using the QIAquick PCR Purification Kit (Qiagen) as per the manufacturer’s directions. The insert and vector were both digested with BamHI and HindIII restriction enzymes for 1 h as follows: 30 µL insert amplicon or 2 ng pcDNA5-FRT, 1 × NEBuffer 2.1, 1% (v/v) BSA, 2 U BamHI and 2 U HindIII. Digested insert and vector were then ligated together over 2 h at 25°C as follows: 50 ng digested vector, 150 ng digested insert, 1 × T4 DNA Ligase Reaction Buffer, 200 U T4 DNA Ligase, and made up to 20 µL with Milli-Q water. The plasmid was then transformed into XL 10 Gold ultracompetent cells and verified by Sanger sequencing as described in Section 2.2.4.

4.2.3 Cloning by polymerase incomplete primer extension (PIPE)

To generate the MARCHF6-BirA-FLAG construct used in Chapter 4, polymerase incomplete primer extension (PIPE), with modifications (153), was performed to subclone BirA-FLAG onto the C-terminus of MARCHF6 in the pcDNA5-MARCHF6-V5 plasmid. The amplification was conducted in 50 µL reactions using 10 ng template, 0.5 µM forward and reverse primers (Table 4.1), 200 µM dNTPs, 5% (v/v) DMSO, 1 × HF Buffer, 1 U of the Phusion Hot Start II High-Fidelity DNA Polymerase with the volume made up to 50 µL in Milli-Q water. Cycling conditions for the amplification were: initial denaturation at 98°C for 3 min, followed by (98°C for 30 sec, 63°C for 30 sec, 72°C for 8 min for the vector and 1.5 min for the insert) × 35 cycles. Equal volumes of amplicon products were separated by agarose gel electrophoresis and the band intensity analysed with Image Lab. Based on the band intensity, amplicons were mixed in a ratio of 1 part

Chapter 4

vector and 5 parts insert to a volume of 20 µL, then digested overnight at 37°C with 10 U of DpnI to remove methylated DNA template. The plasmid was then transformed into XL 10 Gold ultracompetent cells and verified by Sanger sequencing as described in Section 2.2.4.

Table 4.1 Primers used to generate constructs for BioID Plasmid Direction* Sequence Protocol F AAACTTAAGCTTATGAAGGACAACACCG Restriction BirA-FLAG GAGTAGTGGATCCTTTATCGTCATCGTC R Enzyme TTTG GTCATCCCAAGAAATGAAGGACAACACC F GTGCCC PIPE CCTCTAGACTCTTTATCGTCATCGTCTTT (insert) R MARCHF6- GTAGTCTGG BirA-FLAG GAGTCTAGAGGGCCCGCGGTTCCAAGA F AGG PIPE TTCTTGGGATGACTGTGGAGGTGGTGG (vector) R AGATGAGC *F = forward primer, R = reverse primer

Chapter 4

4.2.4 BioID

HEK-293 cell lines were seeded at 3 × 106 cells per 10 cm dish then transfected using 24 μL Lipofectamine LTX with 6 μg of either pcDNA5-BirA-FLAG or pcDNA5-MARCHF6-BirA-FLAG for 48 h in 10% (v/v) FCS DMEM HG with no antibiotics. Cells were then treated in media supplemented with or without 50 μM biotin for 24 h. Cells were washed twice, then scraped in 5 mL ice cold PBS and pelleted at 2,500 g for 5 min at 4°C. The pellets were then resuspended in 1 mL mRIPA with 2% (v/v) protease inhibitor, passed through a cold 23 G needle 20 times, then rotated for 30 min and pelleted at 17,000 g for 15 min at 4°C. The lysate supernatant was transferred to a new tube and adjusted (via bicinchoninic acid assay) to the same concentration of protein in 1 mL of mRIPA. Streptavidin beads were prepared, by washing 3 × 2 min in mRIPA, then 40 μL was added to each normalised protein lysate sample and rotated overnight at 4°C. The supernatant was then removed, and the beads were resuspended in 1 mL mRIPA with 0.005% (v/v) protease inhibitor cocktail and rotated for 1 h at 4°C. This process was repeated for 30 min and then 15 min. The supernatant was then removed, and the samples resuspended in 50 μL IP buffer (20 µL mRIPA, 20 µL 10% (w/v) SDS and 10 µL fresh 5 × laemmli buffer) before being heated at 95°C for 10 min with vortexing intermittently. Samples were then separated by 10% SDS-PAGE and a Western Blot performed (Section 2.2.8).

Chapter 4

Figure 4.3 Method overview of BioID Experimental methodology for BioID, whereby cells were transfected with various BirA constructs, then labelled with 50 µM biotin supplemented media for 24 h. BirA constructs ligate biotin to adjacent proteins. Cells were lysed, and the protein content normalised before biotinylated proteins were pulled down via streptavidin beads. Protein lysate and streptavidin pulled down content were analysed via Western blot.

Chapter 4

4.2.5 Comparison of Mass Spectrometry Data

Unpublished mass spectrometry data previously generated within our laboratory (where MARCHF6 was knocked down using siRNA) (Appendix: Table 8.1) and data from Stefanovic-Barrett et al. (39) (where MARCHF6 was knocked out via CRISPR) were used and the protein identities converted to gene names to ensure appropriate comparisons. Hits identified above 1.5- and 2-fold increases in the MARCHF6 knockdown/out compared to control samples were isolated and compared using http://bioinformatics.psb.ugent.be/webtools/Venn/ between the two datasets to identify identical proteins between the datasets.

Chapter 4

4.3 Results

Prior to commencing my PhD, our laboratory performed mass spectrometry experiments which identified a candidate MARCHF6 substrate malic enzyme 2 (ME2). Collaborators (Drs. Robin Du and Hongyuan (Rob) Yang, UNSW) performed microscopy experiments with MARCHF6 knockdown in 3T3 adipocytes and showed increased lipid droplet size (Figure 4.1). The lipid droplet associated protein, Fat specific protein 27 (FSP27, also known as CIDEC), was proposed as a candidate MARCHF6 substrate due to this phenotype (Peng Li, Tsinghua University). Here, these two candidate substrates were investigated further.

4.3.1 Malic enzyme 2 is unlikely to be a MARCHF6 substrate

Preliminary experiments conducted in our laboratory before the commencement of my PhD utilised stable isotope labelling with amino acids in cell culture (SILAC) and mass spectrometry. From this, ME2 was identified as a potential substrate.

Briefly, HEK-293 cells were cultured in light or heavy SILAC media, and HEK-MARCHF6-myc cells were cultured in medium or heavy SILAC media to incorporate isotopic amino acids into proteins. HEK-293 cells were then subjected to control or MARCHF6 knockdown for 24 h to increase MARCHF6 substrates; while HEK-MARCHF6-myc cells were treated with or without cholesterol for 8 h to increase MARCHF6 levels and decrease MARCHF6 substrates (Figure 4.4). Proteins were harvested and prepared for liquid chromatography-mass spectrometry using Q Exactive Orbitrap (Thermo Fisher). Complete datasets can be found in the Appendix in Table 8.1 and Table 8.2.

Chapter 4

Figure 4.4 Experimental design for the identification of MARCHF6 substrates using SILAC HEK-293 cells were grown in either light or heavy SILAC media and then transfected with control (Ctrl) or MARCHF6 siRNA for 24 h, respectively. HEK- MARCHF6-myc cells were grown in either medium or heavy SILAC media and then treated with vehicle (Veh.) or 20 µg/mL Chol/CD (Chol) for 8 h, respectively. Proteins were then harvested and prepared for liquid chromatography-mass spectrometry (LC-MS).

Knockdown of MARCHF6 in HEK-293 cells resulted in an 8-fold increase in the Heavy to Light peptides for ME2 (Table 4.2), and ME2 protein levels were decreased by 30% when in the HEK-MARCHF6-myc overexpression cells that were treated with cholesterol (Table 4.3). This suggests that ME2 may be a MARCHF6 substrate. Furthermore, ME2 is a biologically plausible candidate substrate of MARCHF6, as it replenishes NAD(P)H, a critical co-factor for many steps throughout cholesterol synthesis (154).

Chapter 4

Table 4.2 Mass spectrometry data from in-house MARCHF6 knockdown Unique Number of Accession Description Coverage Heavy/Light Ratio* Peptides Peptides NAD-dependent malic enzyme, mitochondrial OS=Homo P23368 3.60% 1 2 8.123 sapiens GN=ME2 PE=1 SV=1 - [MAOM_HUMAN] *Light = control siRNA transfected HEK-293 cells; Heavy = MARCHF6 siRNA transfected HEK-293 cells

Table 4.3 Mass spectrometry data from in-house MARCHF6 overexpression Unique Number of Accession Description Coverage Medium/Heavy Ratio* Peptides Peptides NAD-dependent malic enzyme, mitochondrial OS=Homo P23368 5.99% 3 4 0.709 sapiens GN=ME2 PE=1 SV=1 - [MAOM_HUMAN] *Medium = vehicle treated HEK-MARCHF6-myc cells; Heavy = cholesterol treated HEK-MARCHF6-myc cells

Chapter 4

Due to this preliminary evidence and reasoning, MARCHF6 was knocked down in HEK-293T cells for 24 h and the effect on endogenous ME2 was observed via Western blot. ME2 protein levels remained unchanged when MARCHF6 was knocked down compared to the control (Figure 4.5), and therefore is unlikely to be a MARCHF6 substrate. Consequently, the next candidate MARCHF6 substrate was investigated.

Figure 4.5 Malic Enzyme 2 is unlikely to be a MARCHF6 substrate A HEK-293T cells were transfected with 25 nM indicated siRNA for 24 h. Protein levels were analysed by Western blotting with endogenous ME2, SM and α-tubulin antibodies. Data are presented as mean + S.E.M. from n = 4 independent experiments, where * P < 0.05. B Relative protein levels were measured using ImageStudio Lite and normalised to the control condition which was set to 1. * indicates endogenous ME2 on the endogenous SM blot remaining after the blot was stripped.

Chapter 4

4.3.2 A mutant form of Fat specific protein 27 may be a MARCHF6

substrate

Preliminary experiments performed by our collaborators, Drs. Robin Du and Hongyuan (Rob) Yang, UNSW, demonstrated knockdown of MARCHF6 significantly increased the size of lipid droplets in 3T3 adipocytes (Figure 4.1). It was hypothesised that this may be due to FSP27 which mediates lipid droplet fusion and growth through contact sites (155). Therefore, the effect of MARCHF6 on wild-type FSP27, and a mutant form of FSP27 was investigated. The mutant form of FSP27 removed the critical linker region (amino acids 120-135) between the conserved CIDE-N and CIDE-C domains (Figure 4.6A). The linker region is important for maintaining proper lipid droplet fusion and growth, and disruption to this region results in uncontrolled lipid droplet fusion and growth (156).

Control or MARCHF6 siRNA were co-transfected with pCMV5-FSP27- FLAG or pCMV5-FSP27 Δ120-135-FLAG into HEK-293T cells for 24 h (Section 2.2.5). FSP27-FLAG protein levels remained unchanged when MARCHF6 was knocked down compared to the control (Figure 4.6B), and therefore it is unlikely to be a MARCHF6 substrate. However, knockdown of MARCHF6 resulted in a 3.2-fold increase when the linker region of FSP27 was removed (Figure 4.6C). This indicates that this mutant form of FSP27 may be a MARCHF6 substrate, however, whether this is physiologically relevant has yet to be fully established. Therefore, the linker region was further investigated as its absence is seemingly critical for MARCHF6 regulation.

Chapter 4

Figure 4.6 Fat specific protein 27 mutant may be a MARCHF6 substrate A Schematic of the domains in FSP27, the CIDE-N domain interacts with its counterpart to link lipid droplets during fusion. The CIDE-C domain forms an amphipathic helix and associates with the membrane of lipid droplets. B, C HEK-293T cells were co-transfected with 25 nM control (Ctrl) or MARCHF6 siRNA and 0.5 µg B FSP27-FLAG or C FSP27 Δ120-135-FLAG and 0.5 µg EV for 24 h. Protein levels were analysed by Western blotting with FLAG, endogenous SM, vinculin and α-tubulin antibodies. Data are presented as mean + S.E.M. from B n = 4 and C n = 3 independent experiments, where ** P < 0.01. Relative protein levels were measured using ImageStudio Lite and normalised to the control condition which was set to 1.

Chapter 4

4.3.3 Physical characterisation of the FSP27 linker region

Since the mutant FSP27 lacking the linker region was a potential MARCHF6 substrate, we next looked more closely at the characteristics of the linker region. Previous work suggests that it controls the growth and fusion of lipid droplets (155). In particular, the polybasic RKKR motif associates with acidic phospholipids in the membrane of lipid droplets to facilitate normal lipid droplet fusion. Disruption of this motif leads to increased lipid droplet fusion and results in significantly enlarged lipid droplet formation (156).

While the physical characteristics of the linker region of FSP27 have not been investigated, the CIDE-C domain contains an amphipathic helix and hydrophobic region which associates with the membrane of lipid droplets (155). A similar mechanism occurs with SM, the canonical MARCHF6 substrate. SM contains an amphipathic helix that senses the cholesterol environment in the membrane of the ER and dissociates when cholesterol is in abundance exposing a disordered region and triggering degradation (157).

Through bioinformatic analysis, the linker region (amino acids 120-135) of FSP27 demonstrates a propensity to form an α-helix between residues 120-132, but does not appear to be amphipathic (Figure 4.7) unlike that of SM (157). Of note are the basic residues – lysine and arginine – within the critical RKKR motif which become equally distributed across the helix. However, as the helix in FSP27 is not amphipathic and the RKKR motif associates with the membrane, potential disorder in the linker region was investigated. Predictions utilising DISOPRED indicated that the linker region of FSP27 may be disordered compared to the ordered regions of the CIDE-N and CIDE-C domains (Figure 4.7D). Potentially the linker region possesses a propensity to form an α-helix under normal circumstances and then transitions into a disordered region for the RKKR motif to associate with the acidic phospholipids to regulate lipid droplet fusion and growth. This poses an interesting mechanism of action to control lipid droplet fusion and growth. Likely, MARCHF6 targets FSP27 Δ120-135 as a damaged or misfolded protein, like that of BSEP and NPC1. Consequently, targeting of FSP27 Δ120-135 by MARCHF6 would likely prevent the formation of supersized lipid droplets.

Chapter 4

Figure 4.7 Physical characteristics of FSP27 linker region A Secondary structure prediction of full length FSP27 by PSIPRED version 4 with results displayed covering the linker region (amino acids 120-135). The confidence level for the predictions is indicated by blue bars, and the prediction indicated by the helices (pink) and coils (grey). Amino acid residues are indicated below. B Secondary structure prediction of the linker region by PEP-FOLD3, where the helical structure is highlighted in blue. C Helical wheel representation of the predicted helix demonstrated in A, B encompassing linker region residues 120-132 generated by HeliQuest. The amphipathic helix for SM (amino acids 62-73) has been included as a positive control. The hydrophobicity (H) and hydrophobic moment (µH) from HeliQuest have also been shown. D Prediction of intrinsically disordered regions within FSP27 using DISOPRED. The linker region is highlighted in red. 86

Chapter 4

4.3.4 The potential use of BioID to identify MARCHF6 substrates

As investigation into our top candidate MARCHF6 substrates – ME2 and FSP27 – suggested they were not in fact substrates, a new approach was considered. Interactions between E3 ubiquitin ligases and their substrates are often short lived, and therefore difficult to capture through pull-down experiments. There have been several advances in the development of methods to capture these transient interactions including the use of BioID. This methodology utilises a mutant biotin ligase from E. coli fused to a protein of interest (158), in this case MARCHF6. The biotin ligase fusion protein can then attach biotin to nearby (10 nm) proteins which can then be pulled down via streptavidin coated beads (159).

As a preliminary experiment, HEK-293 cells were transfected with either the BirA-FLAG or MARCHF6-BirA-FLAG construct for 48 h then treated with or without biotin for 24 h. Biotinylated proteins were pulled down and two methods were attempted to dissociate the proteins from the streptavidin coated beads. Beads were either vortexed for 20 min at room temperature or heated to 95°C with occasional vortexing for 10 min. Supernatants were then separated by SDS- PAGE. Very little of either BirA construct was identified in the conditions where samples were only vortexed, with the addition of heating releasing the highest protein yield for both constructs (Figure 4.8). Both BirA-FLAG and MARCHF6- BirA-FLAG were pulled down in the biotin treated conditions, but not in conditions without biotin. Additionally, there is a non-specific band observed at the same size as the MARCHF6-BirA-FLAG construct, which is particularly obvious in the BirA-FLAG conditions which only underwent vortexing for the pull down and can also be observed in the lysate. Furthermore, the canonical MARCHF6 substrate, SM was not observed in any of the pull-down conditions, suggesting further optimisation of the experiment is needed.

Chapter 4

Figure 4.8 Optimisation for release of biotinylated proteins from streptavidin coated beads HEK-293 cells were seeded into 10 cm plates then transfected with 6 µg BirA-FLAG or MARCHF6-BirA-FLAG for 48 h. Cells were treated with or without 50 µM biotin supplemented media for 24 h. Protein lysates were precipitated using streptavidin coated beads. Protein levels were analysed by Western blotting with FLAG and endogenous SM antibodies. Data are from n = 1 experiment. * non-specific band at the same size as MARCHF6-BirA-FLAG.

Chapter 4

To further optimise the use of BioID to identify MARCHF6 substrates, HEK cells stably overexpressing the SM degron (SM N100-GFP-V5) were used. Briefly, HEK-SM N100-GFP-V5 cells were transfected with BirA-FLAG or MARCHF6-BirA-FLAG constructs for 48 h and then treated with or without biotin for 24 h in media containing either full serum or lipoprotein deficient serum. Full serum conditions typically favour increased MARCHF6 protein levels (Chapter 3), whereas lipoprotein deficient conditions favour increased SM protein levels (22). Biotin-labelled proteins were pulled down with streptavidin coated beads and a Western blot performed.

This revealed that MARCHF6-BirA-FLAG was able to pull down the known MARCHF6 substrate, SM N100-GFP-V5, however, attempts to identify endogenous SM failed (Figure 4.9). Furthermore, MARCHF6-BirA-FLAG was not visible in any conditions, and the negative control, BirA-FLAG, also seemingly pulled down SM N100-GFP-V5. However, an alternative explanation may be that as both BirA-FLAG and SM N100-GFP-V5 run at very similar sizes, the Western was insufficiently stripped and there is bleed through signal of BirA on the SM N100 blot. Therefore, the experiment either needed further optimisation or was unlikely to work as an unbiased screen for the identification of MARCHF6 substrates. Due to several reasons, the use of BioID for the detection of MARCHF6 substrates was discontinued at this point. These include difficulties in optimising the BioID methodology for MARCHF6; the inability to detect the canonical MARCHF6 substrate SM in its endogenous form; and finally the publication of a high throughput screen of MARCHF6 substrates (39). With the publication of this high throughput screen, a new approach was undertaken.

Chapter 4

Figure 4.9 Sterol optimisation of BioID for the identification of the MARCHF6 substrate SM N100-GFP-V5 HEK-SM N100-GFP-V5 cells were seeded into 10 cm plates then transfected with 6 µg BirA-FLAG or MARCHF6-BirA-FLAG for 48 h. Cells were treated with or without 50 µM Biotin for 24 h in either full serum (FCS) or lipoprotein depleted serum (FCLPDS) media. Protein lysates were precipitated using streptavidin. Protein levels were analysed by Western blotting with FLAG, V5 and endogenous SM antibodies. Data are from n = 1 experiment. * indicates potential bleed through signal of the BirA on the SM N100 blot.

Chapter 4

4.3.5 Mass spectrometry data fails to identify likely MARCHF6 substrate

candidates

During my PhD, research into MARCHF6 and identification of its substrates has become an increasingly popular area. However, what has become clear over this time is the difficulty researchers have in identifying candidate substrates via knockdown or knockout experiments and comparing the differential increase in proteins with the control conditions. By comparing the available datasets, Stefanovic-Barret et al. (39), as well as in-house data (Appendix: Table 8.1), Venn diagrams were generated to identify common proteins between them.

Two thresholds were set (1.5- and 2-fold) to identify proteins that were enriched when MARCHF6 levels were reduced. By cross-referencing datasets at increasing thresholds, identification of MARCHF6 candidate substrates would be maximised (Figure 4.10). Only one protein was commonly identified between the datasets at both thresholds, the canonical MARCHF6 substrate SM. The comparison between datasets highlights the difficulty in identifying robust effects, with few proteins being significantly increased in reduced MARCHF6 conditions, and no new candidate MARCHF6 substrates identified.

Chapter 4

Figure 4.10 Analysis of shared proteins identified between mass spectrometry datasets at differing thresholds Mass spectrometry data from Stefanovic-Barret et al. (39) (blue) where MARCHF6 was knocked out, and Luu and Brown (Appendix: Table 8.1) (yellow) where MARCHF6 was knocked down were compared at thresholds of 2- and 1.5-fold increases compared to control conditions. Only squalene monooxygenase (SM), a known MARCHF6 substrate was commonly identified in both datasets above a 1.5-fold threshold.

Chapter 4

4.4 Discussion

In Chapter 4, three core approaches were utilised to investigate and identify MARCHF6 substrates.

Firstly, two candidate MARCHF6 substrates were screened that were previously identified through mass spectrometry data (ME2) or collaborator’s data (FSP27). Neither wild-type ME2 nor FSP27 were responsive to the knockdown of MARCHF6, indicating that they were unlikely to be MARCHF6 substrates (Figure 4.5 and Figure 4.6). However, a mutant form of FSP27 was responsive to MARCHF6 knockdown and so may be a MARCHF6 substrate (Figure 4.6). In some of the blots containing the control for MARCHF6 knockdown, SM, there are multiple bands visible on the Western blot. This has most recently been attributed to a truncated form of SM which MARCHF6 has been implicated in producing and regulating under basal conditions (160).

The mutant form of FSP27 removed the critical linker region that resides between the CIDE-N and CIDE-C domains. Perhaps this FSP27 mutant is analogous to the other MARCHF6 substrates BSEP and NPC1 where the wild- type versions of the proteins are unaffected by MARCHF6 (77, 78). Stefanovic- Barrett et al. (39) found that for a subset of substrates, both MARCHF6 and TRC8 needed to be knocked out for protein levels to rise ((39), discussed in greater detail in Chapter 6). This may be the case for FSP27. Furthermore, the linker region within FSP27 associates with the membrane, like the MARCHF6 substrate SM, however, does not form an amphipathic helix (Figure 4.7, (157)). This could prove to be an interesting area of investigation but was beyond the scope of our project. Additionally, our hypothesis was founded on the discovery that MARCHF6 deficiency results in enlarged lipid droplets. This phenotype may not be due to FSP27 like first hypothesised, but rather an alternate lipid droplet associated protein PLIN2 which was later identified as a MARCHF6 substrate (76).

The second approach utilised was our preliminary experiments carried out using a newer method called BioID (Figure 4.8 and Figure 4.9). However, our initial work faced several major issues. These include an inability to identify the canonical MARCHF6 substrate SM, the canonical MARCHF6 substrate; and 93

Chapter 4

negative control samples not behaving as expected. It is also possible that biotinylated proteins were not entirely eluted off the streptavidin beads which would reduce yield and diversity of MARCHF6 interacting proteins. Due to these experimental issues, this aspect of the project was discontinued, however, if resolved the project would have progressed onto mass spectrometry analysis to identify novel MARCHF6 candidate substrates. Furthermore, a number of MARCHF6 publications were released identifying new MARCHF6 substrates, including one paper that released some high throughput data (39, 77).

Therefore, our third approach utilised in this chapter was the comparative analysis of available proteomics data. By combining all available data and cross- referencing the samples, only the known MARCHF6 substrate SM was identified (Figure 4.10). This suggests that boutique methods may be needed to identify MARCHF6 substrates in the future (further discussed in Chapter 6).

Our final approach in the identification of MARCHF6 substrates was more directed and focused on the specialty of our lab: characterising enzymes in the cholesterol synthesis pathway (Chapter 5).

Chapter 5

Chapter 5 MARCHF6 extensively regulates the

cholesterol synthesis pathway

Most of the following work (Sections 5.3.1 - 5.3.10) has been published in the Biochemical Journal:

Scott, N. A., Sharpe, L. J., Capell-Hattam, I. M., Gullo, S. J., Luu, W., Brown, A.J. (2020) The cholesterol synthesis enzyme lanosterol 14α- demethylase is post-translationally regulated by the E3 ubiquitin ligase MARCH6, Biochem. J. 477 (2) 541-555 doi: 10.1042/BCJ20190647

Nicola A. Scott performed the majority of experiments presented in all figures of Chapter 5 including Western blots, quantitative real-time PCR, immunoprecipitation, and produced the CHO-NSDHL-V5, CHO-SC4MOL-V5 and CHO-SC5D-V5 stable cell lines.

Dr. Winnie Luu performed the Western blot data in Figure 5.3A.

Dr. Laura J. Sharpe performed the quantitative real-time PCR in Figure 5.7A, and contributed to the Western blot data presented in Figure 5.6B, Figure 5.7 and Figure 5.8.

Chapter 5

5.1 Introduction

The search for MARCHF6 substrates has become an increasing area of interest as evidenced by our work in Chapter 4. However, high throughput methods need to be refined to more accurately capture substrates for MARCHF6. Previously, our laboratory identified two MARCHF6 substrates in cholesterol synthesis, HMGCR and SM (74, 75), as well as two indirect targets the master transcription factors that regulate cholesterol homeostasis, SREBP-2 and LXR (87). Furthermore, MARCHF6 targets several proteins related to cholesterol and sterol metabolism including a mutant bile salt exporter (BSEP) (78), a mutant cholesterol trafficker (NPC1) (77), and a lipid droplet associated protein (PLIN2). Therefore, our approach was refocussed and narrowed to the enriched area of MARCHF6 substrates, those in cholesterol and lipid metabolism.

This chapter investigated the post-translational regulation of lanosterol synthase (LSS) and lanosterol 14α-demethylase (LDM, also known as CYP51A1), consecutive enzymes that act midway through the cholesterol synthesis pathway. Furthermore, turnover of several additional enzymes within the later part of the pathway were also carried out (Figure 5.1). In addition to this characterisation, the potential role of MARCHF6 in regulating the cholesterol synthesis pathway beyond that of HMGCR and SM was investigated. This was achieved through a variety of biochemical methods including the use of a range of inhibitors, sterols and targeted siRNA knockdowns.

This chapter aimed to investigate the post-translational regulation of enzymes in the cholesterol synthesis pathway (post 2,3-oxidosqualene), with a particular focus on the role of MARCHF6.

Chapter 5

Figure 5.1 Cholesterol synthesis enzymes investigated in Chapter 5 The cholesterol synthesis pathway consists of over 20 enzymatic reactions. Those circled in red have been investigated in Chapter 5. HMGCR and SM are the two rate-limiting enzymes early in the pathway. The alternate pathways, Bloch (yellow) and Kandutsch-Russell (blue), then lead to the formation of cholesterol. The Modified Kandutsch-Russell pathway is also indicated (green). Dotted arrows indicate multiple steps not shown. 98

Chapter 5

5.2 Materials and Methods

The majority of the materials and methods are described in Chapter 2; those that are particular to this chapter are described here.

5.2.1 Plasmids

Plasmids utilised in Chapter 5 are described below and schematic representations included in Figure 5.2.

The human protein coding sequence of ubiquitin (Ub) with an N-terminal HA epitope tag (pEF1a-HA-Ubiquitin) was a gift from Dr. Bao-Liang Song (121).

Constructs described in Chapter 3 were utilised, as well as previously cloned constructs from our lab, some of which have been previously published (74, 161). Briefly, the human protein coding sequence of lanosterol synthase (LSS), was subcloned into the pcDNA5-FRT expression vector (Life Technologies) that contains a myc epitope tag at the C-terminus. Alternatively, the human protein coding sequence of lanosterol 14α-demethylase (LDM), sterol- C5-desaturase (SC5D), NAD(P) dependent steroid dehydrogenase-like (NSDHL), and sterol-C4-methyl oxidase–like (SC4MOL, also known as MSMO1) were subcloned into the pcDNA5-FRT expression vector (Life Technologies) that contains a V5 epitope tag at the C-terminus (Figure 5.2). The pcDNA5-LSS-myc- FRT, and pcDNA5-LDM-V5-FRT plasmids were previously used to generate stable cell lines in CHO-Flp-In cells (Table 2.5). The pcDNA5-SC5D-V5-FRT, pcDNA5-SC4MOL-V5-FRT, and pcDNA5-NSDHL-V5-FRT plasmids were used to generate stable cell lines in CHO-Flp-In cells in the next section.

Chapter 5

Figure 5.2 Plasmids utilised in Chapter 5 Illustrated are the constructs utilised in Chapter 5. All are attached to a C-terminal myc or V5 epitope tag except one which is attached to an N-terminal HA epitope tag: MARCHF6 wild-type and C9A mutant (103 kDa), lanosterol synthase (LSS) (83 kDa), lanosterol 14α-demethylase (LDM) (56 kDa), NAD(P) dependent steroid dehydrogenase-like (NSDHL) (42 kDa), sterol-C4-methyl oxidase-like (SC4MOL) (35 kDa), sterol-C5-desaturase (SC5D) (35 kDa), 24-dehydrocholesterol reductase (DHCR24) (60 kDa), and ubiquitin (Ub) (8.6 kDa).

100

Chapter 5

5.2.2 Generation of stable cell lines

The CHO-Flp-In cell line containing a single integrated Flp recombinase target (FRT) site (162) were grown in 5% (v/v) LPDS DF12 with PS and 50 µg/mL Zeocin. The cells were used to generate stable cell lines that express a single copy of wild-type SC5D, SC4MOL, or NSDHL with a C-terminal V5 epitope tag. CHO-Flp-In cells were seeded in a 6-well plate and left to adhere overnight. Cells were then refreshed in media without zeocin and antibiotics, then co-transfected with 0.9 μg pOG44 (Flp-recombinase expression vector) and 0.1 μg FRT expression constructs encoding the gene of interest, using 1.5 μL Lipofectamine 3000 and 2 µL P3000 supplemental reagent for 24 h. As a negative control during hygromycin B selection, a single well was transfected with 1 μg pOG44 expression vector. The cells were then split into a 10 cm dish, allowed to adhere and then treated with media containing 300 μg/mL hygromycin B for 24 h to apply a selection pressure for stable expression. The concentration was then reduced to 100 μg/mL hygromycin B, and the cells were refreshed every 3-4 days. When distinct colonies had formed, the cells were washed once with PBS, then 5 mL 5% (v/v) TrypLE in PBS was added to the dishes. Colonies were then picked and transferred to individual wells in a 24-well plate containing media with 100 μg/mL hygromycin B. Cells were refreshed every 3-4 days with media containing 100 μg/mL hygromycin B until sufficiently confluent to transfer into a 6-well plate. This process was repeated whereby the cells were then split into two 6-well plates. One of the 6-well plates was then expanded to a 10 cm dish for cryopreservation and the other used for testing protein expression using Western blotting (Section 2.2.8).

5.2.3 Immunoprecipitation

For immunoprecipitation experiments, CHO-7 cells were seeded into 10 cm plates and transfected the following day with 5.8 µg DNA in a ratio of 2:2:1 of the following plasmids: pcDNA5-LDM-V5-FRT or pcDNA5-DHCR24-V5-FRT, with pcDNA5-MARCHF6-myc-FRT or pcDNA5-MARCHF6-C9A-V5-FRT, pEF1a- HA-Ubiquitin, and pcDNA5-EV to make up the necessary total as required. Plasmids were transfected with 8.7 µL Lipofectamine 3000 transfection reagent and 11.6 µL P3000 supplemental reagent.

101

Chapter 5

Following transfection, the cells were treated with proteasomal inhibitor (50 µM MG132) in 5% (v/v) LPDS DF12 with PS for 6 h. Cells were washed twice, then scraped in cold PBS and pelleted by centrifugation at 2,500 g for 5 min at 4°C. Pellets were lysed in RIPA buffer containing 10 mM N-ethylmaleimide, 50 µM MG132 and cOmpleteTM ULTRA Protease Inhibitor Mixture Tablets (one tablet per 10 mL RIPA buffer). Lysates were passed through a 23-gauge needle 20 times, before centrifugation at 17 000 g for 15 min at 4°C. The protein concentration of the supernatant was determined using a bicinchoninic acid assay and the samples normalised. The lysates were then precleared with normal mouse IgG (Santa-Cruz Biotechnology) conjugated to magnetic Protein G Dynabeads. The supernatant was then immunoprecipitated overnight at 4°C with 5 µg anti-V5 antibody conjugated to magnetic Protein G Dynabeads. Beads were then washed three times in RIPA buffer by rotating at 4°C. The bound proteins were then eluted by heating at 65°C for 15 min in elution buffer (1× laemmli buffer, 0.4× RIPA buffer, 4% (w/v) SDS), before being Western blotted as per Section 2.2.8.

5.2.4 Quantitative real-time PCR

qRT-PCR was performed using a Rotor-Gene Q and analysed using Rotor-Gene Q Software. All qRT-PCR performed prior to Section 5.3.12 was described as per Section 2.2.6. For qRT-PCR performed in Section 5.3.12, the final reaction buffer was changed from the SensiMix SYBR No-ROX reagent previously utilised throughout this thesis. Instead, reactions were carried out in 20 μL volumes containing 0.7 μM forward and reverse primers, 10 μL QuantiNova SYBR Green PCR Master Mix and 6.2 μL RNase free water. Primer sequences used to amplify the genes of interest are detailed in Table 2.7. The thermal cycling protocols for qRT-PCR were 95°C for 2 min, (95°C for 5 s and 60°C for 60 s) × 40 cycles, and the 60°C extension period was set to acquire data. Changes in gene expression levels were normalized to the housekeeping control PBGD for each sample by the ΔΔCt method.

102

Chapter 5

5.3 Results

Initial work conducted in our lab investigated the transcriptional regulation of the cholesterol synthesis enzymes LSS and LDM. Both LSS and CYP51A1 were transcriptionally responsive to sterols in a variety of cell lines (HeLaT, HuH7 and Be(2)C) (163). Here, the post-translational regulation of these two enzymes was investigated.

5.3.1 LDM protein is turned over, whilst LSS remains stable

The cholesterol synthesis pathway contains numerous enzymes that undergo similar transcriptional regulation but differential post-translational regulation (112, 164, 165). Therefore, the turnover of the enzyme which produces the first official sterol in the pathway (LSS) and a gateway enzyme into the Bloch pathway (LDM) was investigated. Firstly, CHO-7 cells that stably expressed a single copy of LSS with a myc epitope tag (CHO-LSS-myc) (166) were transiently transfected with LDM-V5 plasmid for 24 h, then treated with or without the protein synthesis inhibitor cycloheximide over various timepoints up to 8 h. LSS-myc remained stable, whilst LDM-V5 was significantly turned over by 2 h, with increased degradation over 4 h and 8 h (Figure 5.3A). To minimise variability, CHO-7 cells that stably expressed a single copy of LDM with a V5 epitope tag (CHO-LDM-V5) underwent the same cycloheximide treatment over time. LDM- V5 levels displayed almost identical turnover in the stable expression system compared to the transient system, with significant turnover observed at 2 h and increased turnover over 4 h and 8 h (Figure 5.3B). Finally, the turnover of endogenous LDM was investigated to ensure that our ectopic system reflected what would normally occur in a cell. CHO-7 cells were therefore treated with cycloheximide as per previous experiments and demonstrated that endogenous LDM underwent increased turnover over time, the same as our ectopic system (Figure 5.3C).

103

Chapter 5

Figure 5.3. LDM protein is turned over, whilst LSS remains stable A CHO-LSS-myc cells were transfected with pTK-LDM-V5 plasmid for 24 h then treated with or without 10 µg/ml cycloheximide (CHX) for the indicated time. B CHO-LDM-V5 cells were treated with or without 10 µg/mL cycloheximide (CHX) for the indicated time. C CHO-7 cells were treated with or without 10 µg/mL cycloheximide (CHX) for the indicated time. Protein levels were analysed by Western blotting with myc, V5, endogenous LDM or vinculin antibodies. Data are presented as mean ± S.E.M. from at least three independent experiments (A n = 4, B n = 3-6, C n = 4), where * P < 0.05 and ** P < 0.01. Relative protein levels were measured using ImageStudio Lite (version 5.2) and normalised to the vehicle condition which was set to 100% at each timepoint.

104

Chapter 5

5.3.2 Ectopic LDM differentiates between transcriptional and post-

translational effects

The use of endogenous antibodies is generally considered preferable when examining the regulation of proteins. However, many cholesterol synthesis and regulatory proteins are transcriptionally regulated by sterols (124, 164, 165). Therefore, the advantage of utilising a stable cell line is that it eliminates potential confounding effects between transcriptional and post-translational control. The manipulation of cellular sterol status reflects the changes to CYP51A1 transcript levels, where treatment with statin increases and 25-hydroxycholesterol decreases both transcript and endogenous LDM protein levels (Figure 5.4). However, exogenous LDM minimally decreased with statin treatment and had a small increase when treated with 25-hydroxycholesterol (Figure 5.4).

Furthermore, the CHO-LDM-V5 cell line contains comparable levels of LDM at the protein and transcript levels, suggesting that this cell line is an ectopically low expressing cell line, reflective of endogenous protein levels. Therefore, the CHO-LDM-V5 cell line was utilised moving forward when investigating the post-translational regulation of LDM.

105

Chapter 5

Figure 5.4 Ectopic LDM differentiates between transcriptional and post- translational effects A, B CHO-7 and CHO-LDM-V5 cells were treated with vehicle (Veh.), 5 µM compactin (Statin) or 1 µg/ml 25-hydroxycholesterol (25HC) for 24 h. A Columns are representative of endogenous LDM (n = 4) protein levels and red lines are representative of ectopic LDM-V5 (n = 1) protein levels. Protein levels were analysed by Western blotting with V5, endogenous LDM, or vinculin antibodies. Relative protein levels were measured using ImageStudio Lite and normalised to the vehicle condition which was set to 1. B Total CYP51A1 mRNA levels were measured using qRT-PCR and normalised to the housekeeping gene PBGD. mRNA levels were normalised to vehicle conditions in the CHO-7 cell line which were set to 1. Data are presented as mean + S.E.M. from at least three independent experiments (A n = 1-4, B n = 3), where * P < 0.05 and ** P < 0.01. 106

Chapter 5

5.3.3 LDM is not degraded in response to excess sterols

The trigger for the degradation of LDM was next considered. Many cholesterol synthesis enzymes are turned over in response to excess cholesterol (22, 112), oxysterols (85), or other intermediates within the pathway (22, 86, 112). To test this, CHO-LDM-V5 cells were treated with cholesterol or 25- hydroxycholestrol for 8 h, but neither treatment resulted in the degradation of LDM-V5 (Figure 5.5A). To test the potential broader role of sterols in the degradation of LDM, cells were subjected to treatment with or without statin to inhibit the cholesterol synthesis pathway in either lipoprotein-deficient serum (LPDS) or full serum (NBS) media. Treatment with statin had no significant effect on LDM-V5, with no decrease in LDM-V5 observed in the NBS conditions compared to the LPDS conditions (Figure 5.5B). This indicates that sterols do not play a role in the degradation of LDM.

Figure 5.5 LDM is not degraded in response to sterols A CHO-LDM-V5 cells were treated with 10 µg/mL cycloheximide (CHX), 20 µg/mL Chol/CD (Chol) or 1 µg/mL 25-hydroxycholesterol (25HC) for 8 h. B CHO-LDM- V5 cells were treated in 5% (v/v) lipoprotein deficient serum (LPDS) or full serum (NBS) based media with or without 5 µM compactin and 50 µM mevalonate (Statin) for 16 h. Protein levels were analysed by Western blotting with V5 and vinculin antibodies. Data are presented as mean + S.E.M. from at least three independent experiments (A n = 3, B n = 5), where ** P < 0.01. Relative protein levels were measured using ImageStudio Lite and normalised to the vehicle (Veh.) condition in each blot, which was set to 1. 107

Chapter 5

5.3.4 LDM is not degraded in response to hypoxia

Since sterols did not trigger the degradation of LDM, other factors were considered. LDM performs one of the most oxygen intensive reactions within the cholesterol synthesis pathway. Furthermore, hypoxia leads to the accumulation of lanosterol, the substrate of LDM (167), and CYP51A1 is transcriptionally responsive to hypoxia (168). Therefore, depletion of oxygen was tested to see whether it would reduce LDM levels. LDM protein levels were compared in normoxic (21% oxygen) or hypoxic (2% oxygen) conditions for 4 h from commercial cell lysates in HeLaT and HepG2 cells (Novus Biologicals). Endogenous LDM levels did not change in response to hypoxia in either cell line (Figure 5.6A), indicating hypoxia does not trigger LDM for degradation.

5.3.5 LDM is degraded in response to nitric oxide

During the course of our work, another study identified that nitric oxide stimulates the degradation of LDM (169). To test whether this remained true in our cell system, CHO-LDM-V5 cells were treated with the same nitric oxide donor, DPTA NONOate (DPTA) over the course of 4 h. Our cell system behaved in a similar way to the previously published data, with LDM-V5 being degraded in response to nitric oxide in a time dependent manner, with LDM levels reduced by half at 1 h and increased turnover at 2 h and 4 h (Figure 5.6B). Whilst the vehicle condition increased LDM-V5 protein levels over time this is likely due to increased protein synthesis as previously observed in other studies from our lab (112, 164).

108

Chapter 5

Figure 5.6 Nitric oxide, but not hypoxia, trigger LDM for degradation A HeLaT and HepG2 cells were exposed to 21% (normoxic) or 2% (hypoxic) oxygen conditions for 4 h; the lysates were obtained from Novus Biologicals. B CHO-LDM-V5 cells were treated with or without 500 µM DPTA NONOate (DPTA) for the indicated time. Protein levels were analysed by Western blotting with V5, endogenous LDM and vinculin antibodies. Except in A, data are presented as mean ± S.E.M. from at least three independent experiments (A n = 1, B n = 4), where ** P < 0.01. Relative protein levels were measured using ImageStudio Lite and normalised to the vehicle (Veh) or control condition in each blot, which was set to A 1 or B 100% at each time point.

109

Chapter 5

5.3.6 The E3 ubiquitin ligase MARCHF6 affects LDM levels

During the course of our work, another study identified that the turnover of LDM is likely mediated via the proteasome, although calpains may also play a role (169). However, the E3 ubiquitin ligase involved in the degradation of LDM has not been identified. Therefore we considered several candidates: Hrd1 and MARCHF6 are two major ER E3 ubiquitin ligases that target sterol synthesis enzymes (74, 83); and the E3 ubiquitin ligases gp78 and CHIP have previously been identified to target cytochrome P450 enzymes (170). Knockdown of each of these E3 ubiquitin ligases using siRNA substantially reduced their transcript levels (Figure 5.8A). The knockdown of MARCHF6 significantly increased LDM-V5 protein levels by 2.8-fold compared to the control (Figure 5.8B). All other E3 ubiquitin ligase knockdowns had no significant effect on LDM-V5 (Figure 5.8B). This indicates that LDM is likely a MARCHF6 substrate.

110

Chapter 5

Figure 5.7 LDM levels are increased with MARCHF6 knockdown A CHO-LDM-V5 cells were transfected for 24 h with 25 nM of the indicated siRNA (M6: MARCHF6), then mRNA levels were measured using qRT-PCR and normalised to the housekeeping gene PBGD. mRNA levels were then normalised to the control condition which was set to 1. Data are presented as mean + half range from a single experiment performed in triplicate. B CHO-LDM-V5 cells were transfected for 24 h with 25 nM of the indicated siRNA (M6: MARCHF6). Protein levels were analysed by Western blotting with V5 and vinculin antibodies. Data are presented as mean + S.E.M. from n = 3–7 independent experiments, where ** P < 0.01. Relative protein levels were measured using ImageStudio Lite and normalised to the control condition which was set to 1.

111

Chapter 5

5.3.7 MARCHF6 does not control the nitric oxide triggered degradation of

LDM

After identifying MARCHF6 as a potential E3 ubiquitin ligase for LDM, we investigated its role in the nitric oxide triggered turnover of LDM. To do this, CHO-LDM-V5 cells were transfected with control or MARCHF6 siRNA and then treated with or without DPTA for 2 h. The knockdown of MARCHF6 increased LDM-V5 protein levels, but the nitric oxide mediated degradation of LDM was not blunted (Figure 5.8A). Whilst there was a significant increase in LDM-V5 between the two DPTA treated conditions, MARCHF6 knockdown was only able to rescue LDM-V5 to basal levels (Figure 5.8A). Together, this implies that MARCHF6 is not solely responsible for the nitric oxide mediated degradation of LDM.

5.3.8 MARCHF6 regulates LDM in a liver cell line

To verify our findings that MARCHF6 is involved in the regulation of LDM we employed a physiologically relevant liver cell line. Following the treatment of cycloheximide HepG2 cells, endogenous LDM levels decreased, and MARCHF6 knockdown significantly increased endogenous LDM levels (Figure 5.8B). However, similarly to that observed with DPTA treatment, combined knockdown of MARCHF6 and treatment with cycloheximide resulted in decreased endogenous LDM protein levels (Figure 5.8B). This suggests that MARCHF6 is unlikely to be the sole E3 ubiquitin ligase for LDM.

112

Chapter 5

Figure 5.8 MARCHF6 is unlikely to be the sole E3 ubiquitin ligase for LDM A CHO-LDM-V5 cells were transfected for 24 h with 25 nM control (Ctrl) or MARCHF6 siRNA, then treated with or without 500 µM DPTA NONOate (DPTA) for 2 h. B HepG2 cells were transfected for 24 h with 25 nM control (Ctrl) or MARCHF6 siRNA, then treated with or without 10 µg/mL cycloheximide (CHX) for 8 h. Protein levels were analysed by Western blotting with V5, endogenous LDM and vinculin antibodies. Data are presented as mean + S.E.M. from A n = 6, B n = 3 independent experiments, where * P < 0.05 and ** P < 0.01. Relative protein levels were measured using ImageStudio Lite and normalised to the control vehicle condition which was set to 1.

113

Chapter 5

5.3.9 MARCHF6 controls levels of another cholesterol synthesis enzyme,

DHCR24.

Due to the established role of MARCHF6 in sterol and lipid metabolism, and difficulty identifying novel substrates through alternative methods (Chapter 4), our lab hypothesised that MARCHF6 may target other enzymes in the cholesterol synthesis pathway. Therefore, several enzymes – aside from LDM – within the pathway were investigated. These include LSS, the enzyme that acts after SM but before LDM; 24-dehydrocholesterol reductase (DHCR24), a terminal enzyme in the Bloch pathway and an entry point into the Kandutsch- Russell pathway; and emopamil-binding protein (EBP), which acts at the branch point into the modified Kandutsch-Russell pathway. Knockdown of MARCHF6 using siRNA did not affect LSS or EBP protein levels but resulted in a 2- and 2.5- fold increase in LDM and DHCR24 protein levels respectively (Figure 5.9). This indicates that MARCHF6 may target the cholesterol synthesis enzymes LDM and DHCR24 for degradation, but not LSS or EBP.

114

Chapter 5

Figure 5.9 LDM and DHCR24 are likely MARCHF6 substrates CHO-LSS-myc, CHO-LDM-V5, CHO-EBP-V5 or CHO-DHCR24-V5 cells were transfected for 24 h with 25 nM control (Ctrl) or MARCHF6 (M6) siRNA. Bands for the ectopic cholesterol synthesis enzymes migrated close to the expected size; LSS-myc: 83 kDa, LDM-V5: 57 kDa, EBP-V5: 26 kDa, DHCR24-V5: 60 kDa. Protein levels were analysed by Western blotting with V5, myc, endogenous SM and vinculin antibodies. Data are presented as mean + S.E.M. from at least three independent experiments (LSS-myc: n = 4, LDM-V5: n = 6, EBP-V5: n = 3, DHCR24-V5 n = 4), where * P < 0.05 and ** P < 0.01. Relative protein levels were measured using ImageStudio Lite and normalised to the control condition which was set to 1.

115

Chapter 5

5.3.10 LDM and DHCR24 are ubiquitinated and interact with MARCHF6

As MARCHF6 controlled protein levels of LDM and DHCR24, their physical interaction with MARCHF6 was next examined. To do this, LDM-V5 or DHCR24-V5 plasmids were co-transfected with a functional (WT) or non- functional (C9A) MARCHF6-myc plasmid, and HA-Ubiquitin plasmid in combination. LDM-V5 or DHCR24-V5 were then immunoprecipitated against a V5 antibody. Both MARCHF6-WT-myc and MARCHF6-C9A-myc were pulled down with LDM-V5 and DHCR24-V5 (Figure 5.10). This indicates a physical interaction between the E3 ubiquitin ligase, MARCHF6, and the substrates, LDM and DHCR24. Additionally, the non-functional MARCHF6-C9A accumulates due to an inability to promote autodegradation. Hence MARCHF6-C9A can still interact with its substrates as previously shown with the canonical MARCHF6 substrate SM (74).

Furthermore, HA-Ubiquitin was pulled down with both LDM-V5 and DHCR24-V5 (Figure 5.10), indicating both are ubiquitinated. Of note, a band that migrated roughly 8 kDa above DHCR24-V5, which is consistent with monoubiquitination, was more intense in the MARCHF6-WT immunoprecipitation compared to the other conditions. This further implicates the role of MARCHF6 in the ubiquitination of DHCR24.

Together, these immunoprecipitation experiments provide additional evidence for the role of MARCHF6 in the ubiquitination and degradation of LDM and DHCR24.

116

Chapter 5

Figure 5.10 LDM and DHCR24 are ubiquitinated and interact with MARCHF6 CHO-7 cells were seeded then co-transfected the next day for 24 h with 5.8 μg DNA (2:2:1 ratio of A LDM-V5 or B DHCR24-V5 : MARCHF6-myc : HA-Ub), then treated for 6 h with 50 μM MG132 and immunoprecipitated (IP) using anti-V5 antibody. Protein levels were analysed by Western blotting with Penta-His, V5, myc, vinculin and HA antibodies. Data are representative of n = 2 independent experiments for both A and B. 117

Chapter 5

5.3.11 SC4MOL and SC5D are turned over, whilst NSDHL remains stable

Due to the success in identifying two novel substrates of MARCHF6 through our screening of cholesterol synthesis enzymes (Sections 5.3.6 – 5.3.10), we expanded the scope of our search within the cholesterol synthesis pathway. This was achieved by generating three new cell lines that stably overexpress a single copy of either NAD(P) dependent steroid dehydrogenase-like (NSDHL), sterol-C4-methyl oxidase–like (SC4MOL), and sterol-C5-desaturase (SC5D) with a V5 epitope tag. Two attempts were made to generate a stable cell line for 17-β-hydroxysteroid dehydrogenase 7 (HSD17B7), the third enzyme in the C-4 demethylation complex with NSDHL and SC4MOL, however, both failed.

Firstly, each cell line needed to be characterised and the turnover of the ectopic enzyme examined. Three clones for each cell line were selected and treated with or without the protein synthesis inhibitor cycloheximide for 8 h. While all clones of NSDHL-V5 remained stable (Figure 5.11A), SC4MOL-V5 and SC5D-V5 underwent significant degradation over 8 h with less than 50% of the protein remaining in all clones (Figure 5.11B, C).

118

Chapter 5

Figure 5.11 SC5D and SC4MOL are turned over, whilst NSDHL remains stable Three clones from each of A CHO-NSDHL-V5, B CHO-SC4MOL-V5, and C CHO-SC5D-V5 were treated with or without 10 µg/mL cycloheximide (CHX) for 8 h. Protein levels were analysed by Western blotting with V5, endogenous SM and α-tubulin antibodies. Data are presented as mean + S.E.M. from n = 3 independent experiments for each clone. Relative protein levels were measured using ImageStudio Lite and normalised to the vehicle condition which was set to 1.

119

Chapter 5

5.3.12 SC4MOL and SC5D are likely MARCHF6 substrates

As investigation into cholesterol synthesis enzymes previously identified candidate MARCHF6 substrates (Section 5.3.9), a similar approach was undertaken to explore whether NSDHL, SC4MOL, and SC5D are affected by MARCHF6. Therefore, MARCHF6 was knocked down in three clones of each cell line. qRT-PCR revealed highly significant knockdown of MARCHF6 in all clones, with a reduction of 95% observed (Figure 5.12). On the protein level, the knockdown of MARCHF6 using siRNA did not affect NSDHL (Figure 5.13A), but, resulted in an average 2.4-fold increase across clones for SC4MOL and SC5D protein levels (Figure 5.13B, C). This indicates a promising future avenue of investigation, suggesting that MARCHF6 may target SC4MOL and SC5D, two additional steps in cholesterol synthesis, beyond HMGCR (74), SM (74, 75) and the identification of LDM and DHCR24 in this chapter.

120

Chapter 5

Figure 5.12 Quantitative real time PCR for MARCHF6 knockdown in NSDHL, SC4MOL and SC5D cell lines Three clones from each of A CHO-NSDHL-V5, B CHO-SC4MOL, and C CHO- SC5D-V5 were transfected for 24 h with 25 nM of control (Ctrl) or MARCHF6 siRNA. mRNA levels were measured using qRT-PCR and normalised to the housekeeping gene PBGD and control conditions which was set to 1. Data are presented as mean + S.E.M. from n = 3 independent experiments each performed in triplicate for each clone.

121

Chapter 5

Figure 5.13 SC4MOL and SC5D are likely MARCHF6 substrates Three clones from each of A CHO-NSDHL-V5, B CHO-SC4MOL, and C CHO-SC5D-V5 were transfected for 24 h with 25 nM of control (-) or MARCHF6 (+) siRNA. Protein levels were analysed by Western blotting with V5, endogenous SM and α-tubulin antibodies. Data are presented as mean + S.E.M. from n = 3 independent experiments, where * P < 0.05 and ** P < 0.01. Relative protein levels were measured using ImageStudio Lite and normalised to the control condition which was set to 1.

122

Chapter 5

5.4 Discussion

In Chapter 5, the post-translational regulation of cholesterol synthesis enzymes was investigated, with a particular focus on LDM. Firstly, it was uncovered that LSS and LDM underwent distinct post-translational regulation whereby LSS was a stable protein, and LDM was rapidly turned over (Figure 5.3). Investigation into triggers that accelerate the degradation of LDM demonstrated that sterols did not post-translationally affect LDM (Figure 5.4 and Figure 5.5). Additionally, hypoxia did not affect LDM post-translationally, however, nitric oxide triggered the degradation of LDM (Figure 5.6). Furthermore, MARCHF6 was identified as an E3 ubiquitin ligase involved in the degradation of LDM in addition to another cholesterol synthesis enzyme, DHCR24 (Figure 5.7 – Figure 5.10). Due to our success in identifying MARCHF6 substrates through this screening process, stable cell lines for other enzymes in the pathway were generated and the enzymes characterised. NSDHL was a stable protein, whilst SC4MOL and SC5D underwent turnover (Figure 5.11). Additionally, SC4MOL and SC5D are likely MARCHF6 substrates (Figure 5.13).

Previous work conducted in our lab characterised the post-translational regulation of the pre-lanosterol enzyme SM (22, 74, 131, 148, 157, 171), and the post-lanosterol enzymes DHCR14 and LBR (164), and the terminal enzymes DHCR7 (18, 112, 165, 172), and DHCR24 (132, 173, 174) in cholesterol synthesis. However, little research had been conducted on the majority of the other enzymes within the pathway. Therefore, we investigated the enzyme that acts immediately after SM, LSS, which forms the first official sterol (lanosterol) in the pathway. The enzyme following LSS was also investigated as it acts at the divergent point in the pathway and is a gateway enzyme into the Bloch pathway, and the second enzyme in the Kandutsch-Russell pathway. Our findings suggest that both LSS and LDM undergo differential regulation and could have implications in the accumulation of intermediates under altered physiological conditions. This could have particularly important implications as the substrates for LDM, lanosterol and 24,25-dihydrolanosterol, have key regulatory functions including triggering degradation of the rate-limiting cholesterol synthesis enzyme HMGCR (144) and modulating immune responses (175). As LSS retains its

123

Chapter 5

stability, flux would be pushed through the pathway and lead to the accumulation of these LDM substrates which could then be fed back onto these processes. Additionally, LDM may act as a switch to alter which post-lanosterol pathway is utilised.

Surprisingly, unlike other cholesterol synthesis enzymes that are degraded by increased sterol levels, LDM was unaffected by changes to sterol status. This is similar to the yeast system where ERG11 also demonstrates a lack of degradation in response to changing sterol levels (176). Since LDM was rapidly degraded, alternative degradation triggers were considered. As LDM is an oxygen intensive step within the pathway, hypoxia was considered as a potential limiting factor, however, LDM protein levels were unaffected. This is despite evidence suggesting that hypoxia leads to the accumulation of the LDM substrate lanosterol (167), and being transcriptionally responsive to hypoxia (168).

During the course of our work, nitric oxide was identified as a trigger for the degradation of LDM and was likely facilitated via the proteasome (Figure 5.6, (169)), much like other cytochrome P450s (177, 178). However, the mechanism for the degradation of LDM remains unclear, with reports of both the proteasome and possibly calpains being involved (169, 179) (mechanisms of LDM degradation are further discussed in Chapter 6). Nitric oxide has previously been linked to cholesterol, with it being protective by lowering circulating cholesterol and reducing the risk of atherosclerotic lesions (180). Furthermore, nitric oxide is responsible for numerous protein modifications including oxidation of thiols in cysteine residues (181), nitration of tyrosine residues (182), and ligation to the heme group (183). Whether nitric oxide acts through indirect changes through signalling cascades or a direct protein modification on LDM could be explored in future work.

In addition to investigating the triggers involved in the degradation of LDM, the E3 ubiquitin ligase that facilitates its degradation was also investigated. Our work identified MARCHF6 as the E3 responsible for the degradation of LDM, like many other cholesterol and lipid metabolism proteins (74, 76, 77, 87). Furthermore, MARCHF6 itself is stabilised in high sterol conditions, allowing for an increase in activity and rapid shut down of its substrates (Chapter 3, (123)). It 124

Chapter 5

is currently unclear why cholesterol stabilises MARCHF6 protein and promotes degradation of SM (123), but does not affect LDM levels, despite MARCHF6’s involvement in its degradation. Additional regulation mechanisms are likely involved. For example, prior research has found that SM undergoes a conformational change in response to cholesterol (157, 171), which may be required in conjunction with the increase in MARCHF6 levels for its degradation to occur.

Although MARCHF6 plays a role in the basal control of LDM levels, nitric oxide dependent degradation of LDM was not ablated by MARCHF6 knockdown (Figure 5.8), suggesting the involvement of other E3 ubiquitin ligases. This is also the first time that MARCHF6 has been implicated in the degradation of a cytochrome P450. Therefore, MARCHF6 could play an important role in the regulation of other proteins in the cytochrome P450 class.

MARCHF6 regulates the cholesterol synthesis enzymes HMGCR (for which several E3 ubiquitin ligases have been identified (83, 140)) and SM (74), but not DHCR7 (112) or DHCR14 (164). Therefore, we tested whether MARCHF6 might be involved in the degradation of other enzymes at key points in the pathway. Our work suggested that MARCHF6 does not control the levels of LSS which produces the first sterol of the pathway, nor does it affect EBP, the enzyme at the branch point to the Modified Kandutsch-Russell pathway (Figure 5.9). However, MARCHF6 knockdown affected the levels of DHCR24. DHCR24 is the gateway enzyme to the Kandutsch-Russell pathway, the terminal enzyme in the Bloch pathway, and can theoretically act on any intermediate in the Bloch pathway to transfer to the Kandutsch-Russell pathway (23). Surprisingly, this stable yet highly regulated enzyme is also controlled by MARCHF6 (Figure 5.9, (184)). The involvement of MARCHF6 in the control of LDM and DHCR24 was verified through co-immunoprecipitation experiments where both enzymes physically interact with MARCHF6 and are ubiquitinated (Figure 5.10).

Although sterols do not affect DHCR24 protein levels (161), the steroid hormone pregnenolone, and the tyrosine kinase inhibitors masitinib and ponatinib decrease DHCR24 protein levels (185). The enzyme activity of DHCR24 can also be reduced by progestin steroid hormones (progesterone and pregnenolone)

125

Chapter 5

(186) and phosphorylation of tyrosine residues (173). This suggests that DHCR24 is highly regulated, and more work is needed to elucidate this further including the role that MARCHF6 may play in these processes.

Due to the success of identifying MARCHF6 substrates via screening cholesterol synthesis enzymes, we extended our search to other enzymes in the pathway. This included two of the three enzymes in the C-4 demethylation complex (NSDHL and SC4MOL), and the C-5 desaturase (SC5D). Currently, limited research has been conducted on these enzymes and so we characterised their turnover and whether they were responsive to MARCHF6 knockdown. NSDHL was stable and was unlikely to be a MARCHF6 substrate, however, both SC4MOL and SC5D were basally turned over and increased with MARCHF6 knockdown, suggesting that they are likely MARCHF6 substrates (Figure 5.11 and Figure 5.13). It is perhaps unsurprising that SC4MOL is a likely MARCHF6 substrate as its yeast counterpart, ERG25, possesses genetic interactions with Doa10 (187–190). Additionally, the yeast counterpart for NSDHL, ERG26, does not appear to have interactions with Doa10. However, deletion of Doa10’s cognate E2 conjugating enzyme, Ubc7, inhibits the degradation of ERG26 (191). Finally, the yeast counterpart for SC5D, ERG3, also demonstrates no interaction with Doa10, however is degraded via the Hrd1 complex (192). This discrepancy could be explained by the enhanced functional redundancy that occurs in the mammalian system.

In conclusion, the turnover of several cholesterol synthesis enzymes has been investigated with the post-translational regulation of LDM extensively characterised. Finally, other enzymes in the cholesterol synthesis pathway have been screened to test whether there are additional MARCHF6 substrates beyond HMGCR and SM. This work has verified an additional two novel MARCHF6 substrates (LDM and DHCR24) and proposed two additional candidate substrates (SC4MOL and SC5D). Remarkably, we believe MARCHF6 is the first example of an E3 ubiquitin ligase that targets multiple steps in a single biochemical pathway.

126

Chapter 6

Chapter 6 General Discussion

Chapter 6 summarises the main findings in this thesis and discusses their broader implications beyond what was covered throughout Chapters 3 to 5. Furthermore, we suggest new areas of investigation for the future based on our findings.

Many of the ideas presented in this chapter have previously been explored in the following publications:

Scott, N. A., Sharpe, L.J., Brown, A.J. (2021) The E3 ubiquitin ligase MARCHF6 as a metabolic integrator in cholesterol synthesis and beyond, BBA - Mol Cell Biol L 1866 (1) 158837 doi: 10.1016/j.bbalip.2020.158837

127

Chapter 6

128

Chapter 6

6.1 Summary of Findings

This thesis identified mechanisms for the post-translational regulation of the E3 ubiquitin ligase MARCHF6 and identified novel substrates of MARCHF6 (Figure 6.1). This thesis has significantly advanced the knowledge on the functioning of MARCHF6, with a particular focus on its role in cholesterol metabolism as described below.

A new mode of post-translational control of an E3 ubiquitin ligase was identified through the cholesterol stabilisation of MARCHF6 (Chapter 3), and this occurred through the inhibition of its degradation. Whilst MARCHF6 contains a putative SSD, the SSD binding protein Insig does not play a role in the cholesterol stabilisation of MARCHF6. The stabilisation of MARCHF6 by cholesterol increases its activity. Furthermore, additional modes of post-translational regulation were investigated including the involvement of other proteins and ROS.

Several approaches were utilised to identify new MARCHF6 substrates (Chapter 4), and a couple of candidate MARCHF6 substrates were discounted through the utilisation of MARCHF6 knockdown. Furthermore, BioID was attempted in a bid to identify MARCHF6 candidates. Finally, mass spectrometry datasets were compared to enhance the chance to identify MARCHF6 substrates. However, these approaches did not yield positive hits for MARCHF6 candidate substrates.

Finally, the post-translational regulation of cholesterol synthesis enzymes, particularly LDM, was investigated and the cholesterol synthesis pathway was screened for further MARCHF6 substrates (Chapter 5). Two novel MARCHF6 substrates within the cholesterol synthesis pathway were confirmed and verified, whilst an additional two MARCHF6 candidate substrates were identified.

129

Chapter 6

Figure 6.1 Summary of major findings in this thesis MARCHF6 plays a central role in the regulation of cholesterol metabolism. (1) Cholesterol stabilises MARCHF6 and (2) increases its activity to target enzymes in the cholesterol synthesis pathway (dark purple are verified substrates (74, 75, 163), light purple are candidate substrates, those circled in red were identified in this study) for degradation via the proteasome. (3) Cholesterol triggers the degradation of SM, whilst nitric oxide (NO) triggers the degradation of LDM. (4) A by-product of the activity of LDM is reactive oxygen species (ROS), which can trigger the degradation of MARCHF6. (5) Additional regulators of MARCHF6 include the EMC for correct insertion into the ER membrane and (6) the microprotein CASIMO1 which is transcriptionally suppressed by androgens, oestrogen, and sterols. Inhibitory or degradation signals are in red, upregulation and positive signals are in blue.

130

Chapter 6

6.2 Regulation of MARCHF6

Here the multilayered regulation of MARCHF6 is discussed in relation to the work conducted in this thesis and the work of others.

6.2.1 Transcriptional regulation of MARCHF6

The current knowledge of the transcriptional regulation of MARCHF6 is incredibly limited. MARCHF6 is ubiquitously expressed across tissues (GTEx Portal). However, there is no knowledge about possible epigenetic modifications which may be involved in the regulation of the MARCHF6 gene and could prove to be an interesting field of investigation.

Work from our laboratory has ruled out MARCHF6 being transcriptionally responsive to sterols (123) and androgens (58). However, the common basal transcription factor Sp1 is involved in the transcription of MARCHF6 (58). Whilst MARCHF6 is unaffected by sterols, Sp1, is known to partner with a number of diverse transcription factors including SREBP-2 and LXR to increase cholesterol uptake and efflux (193, 194). However, Sp1 does not seem to upregulate cholesterol synthesis (124), but rather increase transcription of MARCHF6 to accelerate the shutdown of this pathway (58). This may be an energy saving measure, as synthesis of cholesterol is an energy intensive process (16).

Therefore, control of the MARCHF6 beyond that of basal transcription is not understood and is an open field for investigation.

131

Chapter 6

6.2.2 Cholesterol mediated stabilisation of MARCHF6

In Chapter 3, the post-translational regulation of MARCHF6 was investigated. Several aspects of this regulation were explored including the cholesterol mediated stabilisation of MARCHF6, our major area of interest.

The degradation of MARCHF6 was inhibited in the presence of excess cholesterol and may occur through a putative sterol sensing domain (SSD). Unlike many SSD containing proteins, if MARCHF6 contains one it does not require the SSD binding protein Insig for its cholesterol stabilisation. However, Insig-2 and gp78 may be involved in the basal regulation of MARCHF6.

Additionally, the cholesterol mediated stabilisation of MARCHF6 results in its increased activity with a resultant decrease in substrate levels (123). However, this raises the question, are all MARCHF6 substrates cholesterol sensitive, and how do we differentiate between increased degradation activity and cholesterol sensitivity? This can partially be answered through work conducted in Chapter 5 where the cholesterol synthesis enzymes LDM and DHCR24 were identified as MARCHF6 substrates that are not degraded in response to excess sterols (163, 173). However, two substrates that are not involved in cholesterol synthesis, DIO2 and RGS2, undergo post-translational degradation in response to excess cholesterol (123). While it is likely that MARCHF6 is responsible for this increased rate of degradation of these enzymes more direct evidence is needed to conclusively account for the role of MARCHF6.

Although cholesterol is known to stabilise MARCHF6 through broad conformational changes to its structure (123), nothing is known about the precise molecular actions of this process. Whether conformational change is driven by cholesterol directly binding MARCHF6 (134), or broad changes to the phospholipid membrane structure (e.g. increased rigidity) in the presence of excess cholesterol has yet to be concluded. Likely it is a combination of the two and altering the positioning of the many transmembrane domains of MARCHF6 will influence both its function and activity.

132

Chapter 6

6.2.3 Reactive oxygen species mediated degradation of MARCHF6

Aside from the regulation of MARCHF6 by cholesterol, we investigated a source of ER stress: ROS. The ER is highly susceptible to redox stress as it is the major hub of protein synthesis (195), with oxidative stress commonly resulting in the oxidation of cysteine residues and disruption to disulfide bond formation within proteins during protein folding (196). This can then lead to activation of the unfolded protein response to try and restore protein homeostasis (197). Consequently, ERAD proteins and processes are upregulated to cope with the accumulation of misfolded proteins (198). ROS is therefore implicated in several diseases including cancer, diabetes, atherosclerosis and neurodegenerative diseases (199).

ROS can be generated endogenously in a number of ways including through the electron transport chain in the mitochondria (200) and cytochrome P450 enzymes in the ER (201). Dysregulation in ROS production is associated with lipotoxicity (145), where sterols, oxysterols and saturated fatty acids cause mitochondrial dysfunction leading to the production of ROS (146, 147, 202, 203). While ROS is often considered toxic, there are a couple of instances where it is considered protective: SOAT2 (121) and Insig-2 (122). SOAT2 converts cholesterol and fatty acids into cholesterol esters - a less toxic lipid - which are then stored in lipid droplets (204). Insig-2 on the other hand is involved in the processing of the master transcription factor SREBP via SCAP (205) and is lowly and constitutively expressed to activate cholesterol influx and synthesis (206). Both SOAT2 and Insig-2 undergo competition for modifications of key cysteine residues where they will either undergo ubiquitination and trigger their degradation, or undergo oxidation and be stabilised (121, 122). Competitive oxidation is a relatively novel mode of regulation, with studies only recently investigating its role in cholesterol metabolism.

Chapter 3 uncovered a possible new regulatory mode where MARCHF6 appears to be decreased in the presence of ROS. However, as discussed in Chapter 3, Insig-2 regulates MARCHF6 basally through unclear mechanisms, and since Insig-2 is regulated by ROS this may provide a missing link. Furthermore, the newly verified substrate of MARCHF6, LDM (Chapter 5), is a

133

Chapter 6

cytochrome P450 enzyme that belongs to the well characterised ROS generator class as mentioned earlier. All these lines of evidence suggest that ROS could be a regulator of MARCHF6 and its substrates and is an interesting area for future work, particularly considering the role that ROS plays in numerous diseases.

6.2.4 The role of CASIMO1 in the regulation of cholesterol metabolism

CASIMO1 is one of a few microproteins that has been identified and described. CASIMO1 has been investigated in the context of breast cancer and the cholesterol synthesis enzyme SM (110). In breast cancer, CASIMO1 expression was elevated in oestrogen and progesterone receptor positive cancer cell lines but reduced in receptor negative cell lines (110). Whilst this study did not investigate prostate cancer, the finding suggested that CASIMO1 may be transcriptionally responsive to changes to steroid hormone levels. We demonstrated that CASIMO1 was transcriptionally downregulated in response to androgen and oestrogen in LNCaP and MCF-7 cell lines respectively (Chapter 3) which are both receptor positive cell lines for either androgens or oestrogen and progesterone.

The finding that CASIMO1 was downregulated in response to steroid hormones was unexpected due to prior data suggesting its expression was increased in oestrogen and progesterone receptor positive cell lines (110). However, work conducted in Chapter 3 was the first to investigate the potential role that steroid hormones played in the regulation of CASIMO1. Additionally, whether CASIMO1 is post-translationally regulated by steroid hormones has yet to be investigated and could be an interesting area of research, especially as its role in cancer becomes better understood.

Like in the initial study conducted on CASIMO1, we observed reduced cell growth when CASIMO1 was knocked down (Chapter 3), suggesting that CASIMO1 influences proliferation and cell cycle progression (110). This further embeds CASIMO1 as a potential critical regulator for cancer progression and development.

134

Chapter 6

CASIMO1 has also been linked to the regulation of the MARCHF6 substrate SM (110). Our initial findings suggest that CASIMO1 is minimally transcriptionally responsive to changes in sterol status (Chapter 3). Furthermore, CASIMO1 does not affect the cholesterol mediated turnover of SM and has a minimal effect on the cholesterol stabilisation of MARCHF6 (Chapter 3). Microproteins likely possess little activity on their own but facilitate interactions between other proteins, in a sense acting as a scaffold (207–209). Whether CASIMO1 is acting in this way between SM and MARCHF6 has yet to be investigated. Furthermore, as SM has increasingly been considered as an oncogene in numerous cancers (210–212), investigation into the potential regulation between MARCHF6, SM and CASIMO1 could prove fruitful.

6.2.5 The ER membrane protein complex for MARCHF6 membrane

insertion

A large proportion of all proteins synthesised are localised to membranes either through association or transmembrane domains (213). The process of inserting transmembrane domains into the membrane is energetically costly (214). Furthermore, the length of transmembrane domains does not always complement the thickness of the membrane (215). Many transmembrane domains contain critical residues that are destabilising during their insertion but are necessary for function when correctly folded (216). The understanding of how proteins became inserted into the ER membrane was first uncovered in yeast where deletion of a multipart complex, the ER membrane protein complex (EMC), resulted in the accumulation of misfolded proteins (151). Subsequent studies then identified the mammalian counterpart (150) and demonstrated that it is evolutionarily conserved (217). However, it is only recently that scientists have begun to understand the processes and selectivity that the EMC uses for membrane insertion.

There are currently only a few proteins that have been described to utilise the EMC for insertion into the ER membrane. Most are tail anchored (TA) or signal anchor peptide containing proteins (149). However, some polytopic membrane

135

Chapter 6

proteins have been identified to use the EMC for insertion (218–220). This suggests a much broader role for the EMC than previously thought.

One of the first described targets of the EMC was TA squalene synthase (SQS), the enzyme that acts directly before SM in the cholesterol synthesis pathway (111). Additionally, sterol O-acyltransferase 1 (SOAT1, also known as ACAT1) a polytopic enzyme that esterifies free cholesterol for storage in lipid droplets, was also identified as an EMC target (111). Loss of the EMC core components which are required for maintaining the structural integrity of the whole EMC results in the degradation of SQS and SOAT1 (111). Likely these proteins are degraded rapidly through processes triggered by the unfolded protein response. EMC deficient cells do not affect the total free cellular cholesterol levels, but reduces cholesteryl ester storage capabilities through SOAT1 (111). However, when challenged with sterol depletion or exogenous cholesterol, EMC deficiency becomes lethal (111). This is likely due to the dysregulation of SQS, SOAT1, and many other sterol metabolism proteins that reside in the ER membrane being improperly inserted.

Interestingly, the same study identified that loss of EMC core components increased SM levels (111), and our work in Chapter 3 suggests that loss of the EMC also increases MARCHF6 levels. This raises the question of why these two important enzymes do not undergo degradation like many other proteins that are not correctly inserted into the ER membrane. This is particularly relevant for MARCHF6 as it contains fourteen transmembrane domains and is therefore extremely hydrophobic and thus likely unstable in the ER lumen. Whether MARCHF6 is therefore protected or utilises other machinery for insertion into the ER membrane is an avenue for further investigation. If this is the case, it is likely that MARCHF6 and possibly its target SM are inserted into the membrane cotranslationally through the ribosome and its association with the translocon Sec61 complex (111, 149, 218, 221), rather than through post-translational processes.

136

Chapter 6

6.3 Identification of new MARCHF6

substrates

In Chapter 4, various methods were utilised to identify novel MARCHF6 substrates. Three broad approaches were undertaken: 1) analysis of previously generated mass spectrometry data to identify likely MARCHF6 substrates, 2) use of a new methodology, BioID, to identify novel MARCHF6 targets, and 3) comparison of mass spectrometry datasets to identify common proteins that may be MARCHF6 substrates. By adopting these various approaches, we hoped to identify new MARCHF6 candidate substrates. Unfortunately, the identification of new substrates using these methods was unsuccessful (as discussed in Chapter 4).

The identification of new substrates for E3 ubiquitin ligases is often difficult due to the transient nature of the interaction between the E3 and the target; as demonstrated by work that has yet to show a physical interaction between Doa10 and yeast SM, Erg1 (75). Work conducted by our lab and others has suggested the endeavour to characterise these interactions is particularly difficult for MARCHF6. Our first approach utilised SILAC to isotopically label proteins with either light, medium or heavy amino acids. The differences were then measured through mass spectrometry and the data compared between the different conditions. The output produced relatively few hits and even fewer that possessed confident hits. While our approach identified ME2 as a candidate substrate of MARCHF6, when MARCHF6 was knocked down endogenous ME2 was unaffected. Whilst the use of SILAC in our hands was not fruitful, SILAC has been previously used to identify targets of Doa10 in several different experimental setups (222, 223). This suggests that SILAC has the potential to identify MARCHF6 targets, but likely needs to be further optimised. Furthermore, as our most confident hit was a negative result it was necessary to rethink our strategy.

Our next approach to identify MARCHF6 substrates was to use BioID. This methodology was first published in 2012 and used a proximity labelling system whereby a biotin ligase from E. coli was fused to a protein of interest, MARCHF6 in our case, to tag proteins with biotin (158, 224). This is particularly useful in

137

Chapter 6

mammalian systems as biotinylation of proteins is a rare post-translational modification, and often is irreversible (225). Therefore, this method presents an ideal way to identify proximal and interacting proteins for MARCHF6. Our work suggested that it may be possible to utilise BioID for the identification of novel substrates, however, the conditions needed to be further optimised. While we were able to demonstrate that our control construct SM N100-GFP-V5 interacted with MARCHF6-BirA, we were unable to pull down native SM. There are several potential reasons for this including difference in expression, and the additional regulatory measures that endogenous SM undergoes, i.e. transcriptional control by sterols. While attempts were made to account for the sterol profiles needed for MARCHF6 and SM expression, it is difficult to balance. MARCHF6 is rapidly turned over and requires a sterol rich environment to be stable (Chapter 3, (123)), whilst SM is rapidly degraded in the presence of excess sterols (22). Furthermore, it is not just sterol metabolism proteins that MARCHF6 may target; and so, a broad range of conditions beyond what was utilised should be considered when undertaking varying approaches in the identification of MARCHF6 substrates. Additionally, future investigations using BioID to identify MARCHF6 substrates could utilise the RING dead mutant, MARCHF6-C9A, fused with BirA. This construct would bind to MARCHF6 substrates for biotinylation but not ubiquitinate them. This tool may be beneficial in the identification of MARCHF6 substrates by decreasing the amount of degradation that the target substrates undergo.

Finally, proteomic datasets generated by others were interrogated, in particular that of Stefanovic-Barrett et al. (39). This study utilised MARCHF6, TRC8, and combined knockout HeLa cells to investigate the quality control of cytosolic facing and TA proteins. The work identified an additional MARCHF6 substrate as the TA, heme oxygenase-1 (HO-1) and the reporter degron construct CL-1. To further investigate that body of work, we compared the MARCHF6 knockout data with our in-house knockdown mass spectrometry data. However, the initial hope to identify high confidence hits between multiple datasets was quashed when only the well-known MARCHF6 substrate SM was commonly identified between them. Most recently, interaction mapping strategies using overexpression systems to identify key components of ERAD (e.g. chaperones and retrotranslocation machinery) for many of the E3 ligases in the ER struggled 138

Chapter 6

to identify components for MARCHF6, whereas other E3s such as Hrd1 and RNF185 had a significantly higher number of hits (50).

Combined, this data suggests that the identification of MARCHF6 substrates and ERAD machinery is difficult to capture. Therefore, a combinatorial approach is needed in the identification of MARCHF6 substrates, particularly when utilising high throughput methods. The success in identifying new substrates of MARCHF6 is likely to improve in the coming years as technologies and methodologies develop. Recently, ligase-trapping has been used to identify substrates of other E3 ligases (226). The ligase-trapping method fuses a ubiquitin associated (UBA) domain to the E3 ligase of interest with an epitope tag. During ubiquitination of the substrate, the UBA domain binds the polyubiquitin chain of the substrate delaying its release from the E3 ligase. The complex can then be isolated by pulling down the fusion protein via an epitope tag (227). New methods are always being identified to document these protein-protein interactions. One of the most recent methods is TurboID, which utilises a similar approach to BioID via proximity based labelling of proteins but acts significantly quicker (10 min of labelling rather than 24 h) with faster enzyme kinetics (228, 229).

Overall, it is likely that a varied and extensive approach is needed to identify MARCHF6 substrates into the future, especially when using high throughput techniques.

6.4 The role of MARCHF6 in cholesterol

and lipid metabolism

The role and function of MARCHF6 has most well been studied and characterised regarding cholesterol and lipid metabolism. As discussed earlier in Chapter 6, while MARCHF6 itself is controlled through changes in sterol levels (Chapter 3, (123)), the hypothesis was based on numerous substrates that are involved in cholesterol synthesis (74, 75), trafficking (77), lipid droplet formation (76) and bile salt transport (78) – a downstream process from cholesterol synthesis.

139

Chapter 6

The role of MARCHF6 in the regulation of cholesterol synthesis has been the largest area of investigation by far, with work throughout this thesis contributing substantially to the current knowledge base (Chapter 5). Prior to work conducted in this thesis, only three enzymes in the pathway had been investigated in regard to MARCHF6: HMGCR (74), SM (74, 75) and DHCR7 (112). Whilst all undergo proteasomal degradation, only HMGCR and SM are MARCHF6 substrates. Furthermore, both HMGCR and SM are considered critical rate-limiting enzymes within the pathway (19, 20, 22). SM is widely considered the canonical substrate of MARCHF6, and is often used as a control readout when MARCHF6 is knocked out, due to limited endogenous antibody availability (39, 123). HMGCR on the other hand possesses complex control via E3 ubiquitin ligases with five known to target it for degradation including, Hrd1 (83), gp78 (140, 230), TRC8 (230) and RNF145 (83, 143) in addition to MARCHF6 (74). How these all coordinate the regulation of HMGCR and whether this is differential is still an avenue that warrants further investigation.

Our work in Chapter 5, identified four new substrates within the cholesterol synthesis pathway for MARCHF6 with two being verified. The two newly verified substrates, LDM and DHCR24, act as gateway enzymes into the post-lanosterol pathways (Figure 6.2). DHCR42 also acts as a terminal enzyme in the cholesterol synthesis pathway. Additionally, the candidate MARCHF6 substrate SC4MOL acts before the Modified Kandutsch Russell pathway in the Bloch pathway, whilst SC5D acts after EBP in both the Bloch and Kandutsch-Russell pathways (Figure 6.2).

Compared to previously identified substrates, the ability for MARCHF6 to shut down the pathway at multiple points by targeting several different substrates is novel. The question then arises, why does this occur? Likely there are several reasons for this including the rapid shut down of cholesterol production. Moreover, these enzymes may be targeted by multiple E3 ligases and are differentially regulated by them, i.e. different physiological conditions will require alternate E3 ligases for degradation. This theory is supported as knockdown of MARCHF6 does not necessarily blunt the triggered degradation of these enzymes (163). For example, MARCHF6 is responsible for the basal turnover of LDM but does not blunt its turnover in the presence of nitric oxide (Chapter 5). 140

Chapter 6

Meanwhile, the cholesterol mediated degradation of SM is diminished when MARCHF6 is knocked down (74). Subsequently, MARCHF6 may play a role in controlling flux through the pathway and the accumulation of intermediates. This may consequently lead to larger changes than currently anticipated as many intermediates within the pathway regulated processes outside of cholesterol synthesis.

Aside from cholesterol synthesis, MARCHF6 is known to regulate the other areas of cholesterol and lipid metabolism. MARCHF6 controls the transcription factors, SREBP and LXR, in liver cells (87). The knockdown of MARCHF6 induced the expression of both transcription factor target genes, yet the mechanism for this is unclear. While cholesterol uptake should increase with SREBP induction of LDLR. However, its respective E3 ligase, IDOL, is also upregulated through the induction of LXR. This circuit likely favours the uptake of cholesterol rather than its synthesis due to it being a more energy efficient process (87). However, the exact target and role MARCHF6 plays in this circuit has yet to be uncovered and requires further investigation.

Finally, MARCHF6 has been linked to cholesterol trafficking and its storage in lipid droplets by its substrates mutant NPC1 (77) and PLIN2 (76). Whether MARCHF6 targets more proteins in these processes has not been explored however could be an interesting area of investigation. Particularly, as the reduction in MARCHF6 increases lipid droplet size and numbers (Figure 4.1 , (76)). This phenotype has only been observed in cell-based systems, so it would be interesting to perform in vitro and see if this effect can be recapitulated in mice. This may shed light on the broad role that MARCHF6 may play in obesity, or other cholesterol related diseases.

141

Chapter 6

Figure 6.2 Overview of MARCHF6 targets in cholesterol synthesis The cholesterol synthesis pathway contains over 20 enzymes with three alternate pathways utilised: Bloch, Kandutsch–Russell, and Modified Kandutsch-Russell. Enzymes that are verified MARCHF6 targets are indicated in dark purple, candidate targets are indicated in light purple and enzymes that are not MARCHF6 targets in grey. Enzymes that have not been tested as MARCHF6 substrates are in white. Those tested in this thesis are outlined in red. 142

Chapter 6

6.5 Mechanisms of action of MARCHF6

While the work conducted throughout this thesis has focused on the regulation of cholesterol metabolism by MARCHF6, little is known about how it specifically recognises its substrates for degradation. Much of what is known about MARCHF6 mechanisms has been translated from the homologous yeast system of Doa10. However, the human ERAD network is significantly more complex with around twenty-five E3 ligases currently identified (50, 231), compared to yeast’s three: Hrd1, Doa10 and the Asi complex (33). However, most of the human E3s have been minimally characterised. One well understood mechanism for substrate recognition in yeast is the detection of regional misfolding, i.e. luminal, membrane or cytosolic (33). Luminal misfolding of proteins (ERAD-L) is recognised by the Hrd1 complex (232), whilst cytosolic misfolding (ERAD-C) is recognised by the Doa10 complex (52). The Hrd1 complex is also able to recognise membrane misfolding (ERAD-M) within substrates (233); whilst the Asi complex is an additional ERAD-M regulator but is localised to the inner nuclear membrane rather than the ER (176).

Of particular interest here is how the Doa10 complex recognises its substrates. Unlike the Hrd1 complex, Doa10 is exceptionally promiscuous in its specificity. It not only targets proteins with cytosolic misfolding and degrons (97, 234), but also ERAD-M proteins (235), nuclear proteins (236, 237), and those that are not inserted into the ER in a timely manner (238). Whether MARCHF6 strictly targets cytosolic misfolding of proteins or possesses the same flexibility as Doa10 is still unknown. Likely, MARCHF6 is at least somewhat promiscuous as some of its substrates are known to aberrantly become stuck in the ER (77, 78) where MARCHF6 promotes their degradation. Additionally, with the more elaborate ERAD network that humans possess, there is probably considerable overlap between the different E3 ligases and how they recognise their substrates. This is perhaps best characterised through the numerous E3 ligases that target HMGCR for degradation: Hrd1 (83), gp78 (140, 230), TRC8 (230) and RNF145 (83, 143) and of course MARCHF6 (74).

143

Chapter 6

6.5.1 Cooperation of MARCHF6 with E2 conjugating enzymes

As a RING E3 ubiquitin ligase, MARCHF6 works in combination with E2 conjugating enzymes. E2s have become increasingly recognised for their role in aiding in substrate selection and recognition (239). In yeast, Doa10 requires the E2s Ubc6 and Ubc7 to carry out its activity (38, 97, 240). Ubc6 acts as a primer with Doa10 to monoubiquitinate the substrate on lysine or hydroxylated side chain amino acids (38, 241), and this action may be facilitated through the Teb4/Doa10 domain (63). The monoubiquitinated substrate is then susceptible to K48 ubiquitin chain extension by Doa10 with Ubc7 and its ER membrane anchor Cue1 (38, 241).

In contrast to this, the current understanding of E2 requirements for MARCHF6 is limited. Both the mammalian homologous proteins of Ubc6 and Ubc7 – Ube2J2 and Ube2G2 respectively – are known to work with MARCHF6 (37, 39, 242, 243). Ube2G2 enables the autodegradation of MARCHF6 (37), whilst Ube2J2 participates in the non-canonical ubiquitination of SM (131). Whether the orthologs Ube2G1 and Ube2J1 also have a role in mediating substrate selection for MARCHF6 has not yet been adequately explored. Additionally, whether E2s work in combination to target a single substrate for degradation like with Doa10 has not been explored in mammalian ERAD, at least for MARCHF6. This could add another layer of regulation to substrate selection, but also change the chain linkages formed between ubiquitin molecules and alter the substrate’s fate, aside from degradation via the proteasome. At least two other E2 conjugating enzymes – Ube2D2 (244) and Ube2W (68) – have been identified to interact with MARCHF6, however, the substrates that they regulate are currently unknown. Ube2W is of particular interest as it participates in non-canonical ubiquitination of the N-terminus of substrates (69, 70). This unique ubiquitination event may become particularly relevant as MARCHF6 participates in the degradation of some of its substrates via the N-end rule pathway (further discussed in Section 6.5.3).

144

Chapter 6

Overall, there is little known about the E2 requirements for MARCHF6 to carry out its ligase activity. However, it is an area that should be expanded upon to further understand substrate recognition and build a better picture of how the MARCHF6 complex works.

6.5.2 Chaperones and retrotranslocation

MARCHF6 is a critical regulator in ERAD, but not much is known about the chaperones and other ERAD machinery needed to deal with MARCHF6 substrates, unlike that of yeasts Doa10. Like all ERAD pathways in yeast, substrates need to be removed from the ER lumen or membrane and translocated into the cytosol so they can be degraded by the proteasome. To do so, Doa10 requires the cytosolic heat shock proteins (Hsp70 and Hsp40) to assist in the recognition of the misfolded protein (234, 245, 246) and facilitates the interaction with the AAA+ ATPase Cdc48 (245). A scaffold is built around Cdc48 with Ufd1 and Npl4 to protect the hydrophobic substrates (247, 248), and Dfm1 and/or Ubx2 to anchor the complex to the ER membrane (42, 249, 250). Cdc48 then unfolds and extracts ubiquitinated substrates from the ER to the cytosol (43, 44). Most recently, Doa10 has been described to also carry out retrotranslocation of substrates much like Cdc48 (64).

Unlike the well understood system of yeast described above, there remain many gaps in the knowledge of the MARCHF6 complex. Currently, the chaperones that MARCHF6 requires remain elusive, however like in yeast MARCHF6 requires the Cdc48 homolog, VCP, to extract its substrates (123, 163, 243). Gaining an understanding of the chaperones needed to help facilitate this process of substrate recognition and assisting during the extraction process is vital to fully understand the role of MARCHF6 in ERAD. Consequently, whether MARCHF6 can retrotranslocate substrates without VCP has yet to be investigated and could partially explain why MARCHF6 is such a large polytopic protein (50). Finally, the role of deubiquitinase enzymes in the modulation of MARCHF6 and its substrates is poorly understood. While USP19 can deubiquitinate MARCHF6 and protect it from degradation (72), the modification

145

Chapter 6

of ubiquitin chains on itself or its substrates could be an interesting avenue for investigation.

6.5.3 N-end rule protein degradation

How MARCHF6 recognises its substrates is still relatively unknown, though two major degradation signals have been investigated. One of the degrons that Doa10 and MARCHF6 recognise are destabilising residues at the N-terminus of target proteins (76, 80, 102). This process is commonly referred to as the N-end rule pathway and consists of two branches: Ac/N-end rule and Arg/N-end rule (251, 252). For either variant of the N-end rule pathways, it is the second amino acid within the protein that determines the E3 ligase that targets the protein for degradation (251, 252). For the Ac/N-end rule, this second residue undergoes acetylation (252).

Currently, MARCHF6 targets two substrates for degradation via the Ac/N- end rule pathway: RGS2 and PLIN2 (76, 80). MARCHF6 preferentially targets N- terminally acetylated versions of both RGS2 and PLIN2 (76, 80). For RGS2, it is not only the wild-type version of the protein but also the hypertension associated variants which undergo MARCHF6 facilitated Ac/N-end rule degradation (80, 253). PLIN2 was first discovered as an Ac/N-end rule substrate in mice where mutation of critical alanine residues in the N-terminus prevented the degradation of PLIN2 (94). It was later confirmed in humans, where similarly to RGS2, MARCHF6 preferentially targeted the N-terminally acetylated residues of PLIN2 (76).

Presently, it is unknown whether the MARCHF6 substrate SM undergoes N-terminal acetylation or degradation via the N-end rule. However, the N- terminus has been implicated in the regulation of SM, as the insertion of myc epitope tags prevents its regulated degradation by cholesterol (171).

Whether the use of the Ac/N-end rule is a more widespread mode of substrate recognition for MARCHF6 substrates has yet to be determined. The possibility that the Ac/N-end rule could be coupled with N-terminal ubiquitination via the E2 conjugating enzyme Ube2W (69, 70) is an interesting notion that has

146

Chapter 6

yet to be investigated for any substrate of MARCHF6, and would pose new regulatory insights.

6.5.4 Degron architecture of MARCHF6 substrates

In addition to MARCHF6 acting as an N-recognin, it also recognises other degron architecture within its known substrates.

One of the best understood degron architectures recognised by MARCHF6 is that required for the degradation of SM. The first 100 amino acids of SM (termed SM N100) are sufficient to signal for its cholesterol mediated degradation (22). This N100 region contains a re-entrant loop to help anchor the protein to the ER membrane with the catalytic domain being cytosolic facing (171), and an amphipathic helix that is bound to the ER membrane (157). Changing the cholesterol status of the ER membrane alters the conformation of SM by changing the exposure within the re-entrant loop and ejecting the amphipathic helix from the membrane (157). The release of the amphipathic helix from the membrane exposes a long disordered hydrophobic patch, a known degradation signal (157). Accessibility to this region is critical for MARCHF6, as it is then able to ubiquitinate a series of serine residues on either side of the hydrophobic patch (131). This then facilitates the extraction of SM from the membrane by VCP, so it can undergo degradation via the proteasome (243).

The degrons of several other MARCHF6 substrates have increasingly been investigated. Like SM, RGS2 possesses a range of degron features. As mentioned in Section 6.5.3, RGS2 undergoes degradation via the Ac/N-end rule (80). However, RGS2 requires a string of hydrophobic residues near the N- terminus for degradation (253). Removal of this hydrophobic region impairs the degradation of RGS2 in both the wild-type and hypertensive associated mutants (253). Furthermore, these hydrophobic residues coordinate with a distal amphipathic helix to ensure complete turnover of RGS2 (253). This work indicated several ways in which MARCHF6 could facilitate the degradation of RGS2: 1) through the Ac/N end rule, 2) the recognition of a long hydrophobic region at the N-terminus, 3) the recognition of the amphipathic helix, 4) indirect

147

Chapter 6

recognition through the use of chaperones. Current evidence suggests that all of these are logical recognition modes for MARCHF6 and all of them may be required to facilitate complete degradation of RGS2. In vitro work has demonstrated that MARCHF6 binds to the first ten residues within RGS2 which is required for both the Ac/N-end rule and also contains the hydrophobic patch (80). Recognition by MARCHF6 of the amphipathic helix is also likely due to SM sharing the same feature (157) and the homolog Doa10 targeting exposed hydrophobic regions of amphipathic helices (254). Lastly, as described in Section 6.5.2, Doa10 can utilise Hsp70 and Hsp40 chaperones to assist in substrate selection (246) and whether MARCHF6 could use a similar mechanism for substrate recognition is still unknown.

A recent proteomics study investigating the coordination of the ERAD E3 ligases MARCHF6 and TRC8 uncovered differential modes for substrate recognition requirements (39). Both E3 ligases were required for the complete degradation of the TA CL1 degron reporter and HO-1 (39). If only one of either MARCHF6 or TRC8 were knocked out the other E3 was able to compensate and still degrade CL1 and HO-1, but the removal of both E3 ligases ablated both CL1 and HO-1 degradation (39). Investigation into the CL1 degron uncovered that the E3s preferentially target different types of degrons. Mutations in the CL1 degron that made it more hydrophobic favoured substrate recognition by MARCHF6, but reducing the hydrophobicity within the region favoured recognition by TRC8 (39). This is perhaps unsurprising as the CL1 degron construct originated from yeast and is targeted by Doa10 for degradation (255).

The most recent work investigating degrons targeted by MARCHF6 was on LDM and its yeast homolog Erg11. It focussed on a conserved N-terminal region (termed LDM-TM and Erg11-TM) of these proteins which contains a transmembrane domain and an ER luminal facing amphipathic helix (256, 257). Erg11-TM was stabilised when MARCHF6, Ube2G2 and Ube2J2 were knocked down, whilst LDM-TM was unaffected by these knockdowns (179). Rather LDM-TM was responsive to knockdown of the E2s Ube2K, Ube2D3, Ube3C, and the E3 ligase RNF185 and the ERAD component Membralin (MBRL) suggesting differing modes of regulation between yeast and humans (179). To further investigate this, the amphipathic helix or the transmembrane domain of Erg11-TM 148

Chapter 6

were swapped for those in LDM-TM. Swapping of the amphipathic helix prevented the degradation of LDM-TM, whilst swapping of the transmembrane domain in LDM-TM resulted in its degradation (179). In addition to this, the swapping of transmembrane domains in LDM-TM shifted the ERAD machinery involved in its degradation to that of the E3 ligase MARCHF6 and the E2 Ube3C (179). Together, this suggests that MARCHF6 recognises something intrinsic within the transmembrane domains of some substrates. While the amphipathic helix in LDM-TM was uninvolved in the MARCHF6 mediated degradation, it is not particularly surprising as the RING domain of MARCHF6 is cytosolic facing while the amphipathic helix of LDM is luminal. Additionally, while this finding appears to contradict our work where LDM was identified as a MARCHF6 target (Chapter 5, (163)), two very different constructs were utilised. Our work utilised a full-length construct and endogenous LDM, whist the work investigating degrons only looked at the first 70 amino acids of LDM. Our work also suggested that LDM required more than one E3 ligase for its regulated degradation by nitric oxide. Whether RNF185/MBRL is involved in this is a possibility and could be investigated further in the future.

In summary, the degron architecture of MARCHF6 substrates is an area that is expanding rapidly. Some key features that MARCHF6 commonly targets are long exposed hydrophobic regions, particularly that of disordered amphipathic helices. This is somewhat similar to ERAD-C processes observed in yeast. Additionally, MARCHF6 can recognise substrates through transmembrane domains, however, this is yet to be well understood.

6.6 Broader Implications and Future

Directions

The work conducted throughout this thesis has greatly contributed to the knowledge of MARCHF6 as a critical E3 ubiquitin ligase in ERAD. Minimal work has been conducted on its transcriptional regulation and Chapter 3 investigated multiple modes of post-translational regulation with a particular focus on sterols. But what other factors control MARCHF6? This is a promising field of

149

Chapter 6

investigation as other cellular stressors or signalling cascades often have far reaching implications.

One of the great unsolved mysteries of MARCHF6 is its protein structure due to it being such a large transmembrane domain protein. However, determining its structure has become more tractable with the advent of revolutionary Cryo-EM technology (258). Of particular interest is solving the structure of MARCHF6 in association with ERAD co-factors, substrates, and/or cholesterol. This would provide useful biological information and could bring to light some key features of MARCHF6, including whether or not it is feasible to act as a retrotranslocon like its counterpart Doa10 (64) or Hrd1 (65, 66). Other key questions include: where does MARCHF6 bind cholesterol for stabilisation? Do all substrates interact with MARCHF6 in the same way, or are there distinct recognition domains? Moreover, do E2s or other chaperones play a critical role by aiding in substrate targeting for MARCHF6? Structural studies have recently been done with the ER bound E3 ligase Hrd1 and several of its components for ERAD demonstrating the feasibility of this approach (259).

Our work in Chapters 4 and 5 attempted to identify MARCHF6 substrates using large scale and more directed approaches, respectively. The identification of new substrates of MARCHF6 is a critical avenue for future investigation to understand its overarching role. The first MARCHF6 substrate was identified in 2005 and since that time only eleven other substrates have been verified and published. Most recently the work in Chapter 5 contributed two substrates of this list LDM and DHCR24, being cholesterol synthesis enzymes with a further two candidates established, SC5D and SC4MOL. Furthermore, a pre-print article has identified DHX9 as another MARCHF6 substrate. DHX9 is an RNA helicase that has been implicated in numerous cancers including thyroid and liver cancers (260). All substrates so far have been identified by researchers screening E3 ligases against their protein of interest and identifying MARCHF6. Furthermore, our own and other’s attempts at generating a high throughput method to identify MARCHF6 substrates has demonstrated how difficult it can be to accurately capture interacting proteins. This is likely due to the transient nature of the interactions between MARCHF6, its associated complex counterparts and the

150

Chapter 6

substrates. However, as new technologies and methodologies evolve, and it may be possible to identify MARCHF6 substrates on a larger scale.

The identification of new substrates of MARCHF6 will enable a better understanding of its role in metabolic pathways. As sterol and lipid metabolism itself plays a critical role in the development of several diseases, a greater understanding of MARCHF6 is desirable. MARCHF6 is already known to regulate two well documented disease-causing substrates – mutant NPC1 and mutant BSEP (77, 78). Additionally, MARCHF6 may activate the AKT/mTOR signalling pathway via suppression of DHX9 (260). Dysregulation of the AKT/mTOR pathway plays a crucial in the regulation of cell proliferation, migration, cell survival and apoptosis (261–263). This pathway has also previously been linked to the regulation of lipid metabolism through the AKT-SREBP nexus (116, 162). Whether this may be part of the missing link between MARCHF6 and its regulation of SREBP and LXR is an intriguing concept that could be investigated further into the future. Gaining an appreciation and understanding of these complex networks allows for an increased ability to develop treatments and to understand the possible consequences of them.

While understanding the protein networks that MARCHF6 forms and regulates, the physiological effects that occur due to changes in MARCHF6 levels and activity are vital. We postulate that MARCHF6 may have an overarching role in energy utilisation via the cholesterol synthesis pathway (SM, HMGCR, LDM and DHCR24) and storage by the way of lipid droplets (PLIN2) (59). Furthermore, bile acids which are transported by BSEP induce energy expenditure by promoting thyroid hormone activation via induction of DIO2 (264). Additionally, polymorphisms in RGS2 are associated with weight gain and an increased risk of developing metabolic syndrome (265).

Most recently, the axis between MARCHF6 and SM has been linked to endothelial function and angiogenic sprouting (266). Loss of MARCHF6 in endothelial cells increased SM and ultimately cholesterol levels, consequently altering membrane properties (266). Additionally, the loss of MARCHF6 does not affect the abundance of the cell-cell adhesion molecule, vascular endothelial cadherin, but results in the disorganisation of these junctions between endothelial

151

Chapter 6

cells due to altered cholesterol levels by SM (266). Due to this, endothelial barrier function and angiogenesis are impaired. This work further implies that MARCHF6 may play an important role in cancer development, as angiogenesis is required to support tumour growth (267).

Looking beyond these processes, the role of MARCHF6 in the development and progression of disease is poorly understood. Research into MARCHF6 has been relatively minimal, with most studies being conducted in the last five years. While this work has laid the foundation for our understanding of MARCHF6 in disease, it leaves a wide field open for exploration. Hopefully, moving forward MARCHF6 will be increasingly recognised in these large datasets and its potential role in disease better understood. As previously mentioned, there are suggestions that MARCHF6 may play a role in neurological development and diseases, cancers, and obesity. How MARCHF6 contributes to the pathology of these diseases and the potential role it plays in other diseases has yet to be fully elucidated and an area that must be explored further.

One major weakness of work carried out so far on MARCHF6 is the lack of in vitro work. For instance, the use of general or tissue specific knockout of MARCHF6 in mice could uncover several metabolic processes that MARCHF6 could impact upon. Furthermore, these mice models could be utilised to study the role of MARCHF6 in diseases associated with these pathways.

Finally, many diseases are incredibly complex and multifaceted and therefore are difficult to treat. Some have even been classed as undruggable. A relatively new field in therapeutics called proteolysis-targeting chimaeras (PROTACs) hijacks the ubiquitin proteasome system and force a diseased protein of interest to interact with its cognate E3 ligase via a linker (268, 269). This ultimately triggers the protein of interest for degradation by the proteasome. Whilst this research is still in its infancy there have been promising developments in the early stages and could prove useful in numerous diseases. While MARCHF6 has not been investigated in its potential use in conjunction with PROTACs it is feasible that in the future it may be an avenue to explore further, especially with our expanding knowledge of MARCHF6 and its role in disease.

152

Chapter 6

6.7 Concluding remarks

The results of this thesis not only uncovered novel modes of post- translational regulation for MARCHF6, but also identified several new MARCHF6 substrates. This work has firmly established MARCHF6 as a key regulator of sterol and lipid metabolism with a particularly important role in the regulation of cholesterol synthesis.

In Chapter 3 we identified new post-translational regulatory processes for MARCHF6, with cholesterol stabilising MARCHF6 and increasing its activity.

In Chapter 4 we utilised several approaches to identify MARCHF6 substrates.

In Chapter 5 we characterised the later part of the cholesterol synthesis pathway and investigated the role of MARCHF6 in its regulation. Two novel substrates for MARCHF6 were verified, and an additional two were identified as candidate MARCHF6 substrates.

This work further opens the field to investigation and raises many more questions that have been discussed throughout this chapter.

153

Chapter 6

154

Chapter 7

Chapter 7 References

1. Chakraborty, S., Doktorova, M., Molugu, T. R., Heberle, F. A., Scott, H. L., Dzikovski, B., Nagao, M., Stingaciu, L. R., Standaert, R. F., Barrera, F. N., Katsaras, J., Khelashvili, G., Brown, M. F., and Ashkar, R. (2020) How cholesterol stiffens unsaturated lipid membranes. Proc. Natl. Acad. Sci. U. S. A. 117, 21896–21905 2. Evans, E., Rawicz, W., and Smith, B. A. (2012) Concluding remarks back to the future: Mechanics and thermodynamics of lipid biomembranes. Faraday Discuss. 161, 591–611 3. Doktorova, M., Symons, J. L., and Levental, I. (2020) Structural and functional consequences of reversible lipid asymmetry in living membranes. Nat. Chem. Biol. 16, 1321–1330 4. Sezgin, E., Levental, I., Mayor, S., and Eggeling, C. (2017) The mystery of membrane organization: Composition, regulation and roles of lipid rafts. Nat. Rev. Mol. Cell Biol. 18, 361–374 5. Björkheim, I., Danielsson, H., Einarsson, K., and Johansson, G. (1968) Formation of bile acids in man: conversion of cholesterol into 5-beta- cholestane-3-alpha, 7-alpha, 12-alpha-triol in liver homogenates. J. Clin. Invest. 47, 1573–1582 6. Hu, J., Zhang, Z., Shen, W. J., and Azhar, S. (2010) Cellular cholesterol delivery, intracellular processing and utilization for biosynthesis of steroid hormones. Nutr. Metab. 7, 47 7. Olkkonen, V. M., Béaslas, O., and Nissilä, E. (2012) Oxysterols and their cellular effectors. Biomolecules. 2, 76–103 8. Kelley, R. I., and Herman, G. E. (2001) Inborn errors of sterol biosynthesis. Annu. Rev. Genomics Hum. Genet. 2, 299–341 9. Porter, F. D., and Herman, G. E. (2011) Malformation syndromes caused by disorders of cholesterol synthesis. J. Lipid Res. 52, 6–34 10. Gordon, D. J., Probstfield, J. L., Garrison, R. J., Neaton, J. D., Castelli, W. P., Knoke, J. D., Jacobs, D. R., Bangdiwala, S., and Tyroler, H. A. (1989) High-density lipoprotein cholesterol and cardiovascular disease. Four prospective American studies. Circulation. 79, 8–15 11. Kathiresan, S., Melander, O., Anevski, D., Guiducci, C., Burtt, N. P., Roos, C., Hirschhorn, J. N., Berglund, G., Hedblad, B., Groop, L., Altshuler, D. M., Newton-Cheh, C., and Orho-Melander, M. (2008) Polymorphisms Associated with Cholesterol and Risk of Cardiovascular Events. N. Engl. J. Med. 358, 1240–1249 12. Di Paolo, G., and Kim, T. W. (2011) Linking lipids to Alzheimer’s disease: Cholesterol and beyond. Nat. Rev. Neurosci. 12, 284–296 13. Martin, M. G., Pfrieger, F., and Dotti, C. G. (2014) Cholesterol in brain disease: sometimes determinant and frequently implicated. EMBO Rep. 155

Chapter 7

15, 1036–1052 14. Kuzu, O. F., Noory, M. A., and Robertson, G. P. (2016) The role of cholesterol in cancer. Cancer Res. 76, 2063–2070 15. Riscal, R., Skuli, N., and Simon, M. C. (2019) Even Cancer Cells Watch Their Cholesterol! Mol. Cell. 76, 220–231 16. Brown, A. J., and Sharpe, L. J. (2016) Cholesterol Synthesis. in Biochemistry of Lipids, Lipoproteins and Membranes:, 6th Ed., pp. 327– 358 17. Hoffmann, G. F., Wiesmann, U. N., Brendel, S., Kennedy Keller, R., and Michael Gibson, K. (1997) Regulatory adaptation of isoprenoid biosynthesis and the LDL receptor pathway in fibroblasts from patients with mevalonate kinase deficiency. Pediatr. Res. 41, 541–546 18. Prabhu, A. V., Luu, W., Li, D., Sharpe, L. J., and Brown, A. J. (2016) DHCR7: A vital enzyme switch between cholesterol and vitamin D production. Prog. Lipid Res. 64, 138–151 19. Jo, Y., and De Bose-Boyd, R. A. (2010) Control of cholesterol synthesis through regulated ER-associated degradation of HMG CoA reductase. Crit. Rev. Biochem. Mol. Biol. 45, 185–198 20. Burg, J. S., and Espenshade, P. J. (2011) Regulation of HMG-CoA reductase in mammals and yeast. Prog. Lipid Res. 50, 403–410 21. Endo, A. (2008) A gift from nature: The birth of the statins. Nat. Med. 14, 1050–1052 22. Gill, S., Stevenson, J., Kristiana, I., and Brown, A. J. (2011) Cholesterol- dependent degradation of squalene monooxygenase, a control point in cholesterol synthesis beyond HMG-CoA reductase. Cell Metab. 13, 260– 273 23. Mitsche, M. A., McDonald, J. G., Hobbs, H. H., and Cohen, J. C. (2015) Flux analysis of cholesterol biosynthesis in vivo reveals multiple tissue and cell-type specific pathways. Elife. 4, 7999 24. Amm, I., Sommer, T., and Wolf, D. H. (2014) Protein quality control and elimination of protein waste: The role of the ubiquitin-proteasome system. Biochim. Biophys. Acta - Mol. Cell Res. 1843, 182–196 25. Akutsu, M., Dikic, I., and Bremm, A. (2016) Ubiquitin chain diversity at a glance. J. Cell Sci. 129, 875–880 26. Komander, D., and Rape, M. (2012) The Ubiquitin Code. Annu. Rev. Biochem. 81, 203–229 27. Pickart, C. M., and Eddins, M. J. (2004) Ubiquitin: Structures, functions, mechanisms. Biochim. Biophys. Acta - Mol. Cell Res. 1695, 55–72 28. Varshavsky, A. (2017) The Ubiquitin System, Autophagy, and Regulated Protein Degradation. Annu. Rev. Biochem. 86, 123–128 29. Chaugule, V. K., and Walden, H. (2016) Specificity and disease in the 156

Chapter 7

ubiquitin system. Biochem. Soc. Trans. 44, 212–227 30. Kitada, T., Asakawa, S., Hattori, N., Matsumine, H., Yamamura, Y., Minoshima, S., Yokochi, M., Mizuno, Y., and Shimizu, N. (1998) Mutations in the parkin gene cause autosomal recessive juvenile parkinsonism. Nature. 392, 605–608 31. Densham, R. M., and Morris, J. R. (2017) The BRCA1 Ubiquitin ligase function sets a new trend for remodelling in DNA repair. Nucleus. 8, 116– 125 32. Skaar, J. R., Pagan, J. K., and Pagano, M. (2014) SCF ubiquitin ligase- targeted therapies. Nat. Rev. Drug Discov. 13, 889–903 33. Berner, N., Reutter, K. R., and Wolf, D. H. (2018) Protein Quality Control of the Endoplasmic Reticulum and Ubiquitin-Proteasome-Triggered Degradation of Aberrant Proteins: Yeast Pioneers the Path. Annu. Rev. Biochem. 87, 751–782 34. Meusser, B., Hirsch, C., Jarosch, E., and Sommer, T. (2005) ERAD: The long road to destruction. Nat. Cell Biol. 7, 766–772 35. Preston, G. M., and Brodsky, J. L. (2017) The evolving role of ubiquitin modification in endoplasmic reticulum-associated degradation. Biochem. J. 474, 445–469 36. Kikkert, M., Doolman, R., Dai, M., Avner, R., Hassink, G., Van Voorden, S., Thanedar, S., Roitelman, J., Chau, V., and Wiertz, E. (2004) Human HRD1 is an E3 ubiquitin ligase involved in degradation of proteins from the endoplasmic reticulum. J. Biol. Chem. 279, 3525–3534 37. Hassink, G., Kikkert, M., Van Voorden, S., Lee, S. J., Spaapen, R., Van Laar, T., Coleman, C. S., Bartee, E., Früh, K., Chau, V., and Wiertz, E. (2005) TEB4 is a C4HC3 RING finger-containing ubiquitin ligase of the endoplasmic reticulum. Biochem. J. 388, 647–655 38. Weber, A., Cohen, I., Popp, O., Dittmar, G., Reiss, Y., Sommer, T., Ravid, T., and Jarosch, E. (2016) Sequential Poly-ubiquitylation by Specialized Conjugating Enzymes Expands the Versatility of a Quality Control Ubiquitin Ligase. Mol. Cell. 63, 827–839 39. Stefanovic‐Barrett, S., Dickson, A. S., Burr, S. P., Williamson, J. C., Lobb, I. T., Boomen, D. J., Lehner, P. J., and Nathan, J. A. (2018) MARCH6 and TRC8 facilitate the quality control of cytosolic and tail‐anchored proteins. EMBO Rep. 19, 45603 40. Zattas, D., and Hochstrasser, M. (2015) Ubiquitin-dependent protein degradation at the yeast endoplasmic reticulum and nuclear envelope. Crit. Rev. Biochem. Mol. Biol. 50, 1–17 41. Mehrtash, A. B., and Hochstrasser, M. (2019) Ubiquitin-dependent protein degradation at the endoplasmic reticulum and nuclear envelope. Semin. Cell Dev. Biol. 93, 111–124 42. Goder, V., Carvalho, P., and Rapoport, T. A. (2008) The ER-associated 157

Chapter 7

degradation component Der1p and its homolog Dfm1p are contained in complexes with distinct cofactors of the ATPase Cdc48p. FEBS Lett. 582, 1575–1580 43. Ye, Y., Tang, W. K., Zhang, T., and Xia, D. (2017) A mighty “protein extractor” of the cell: Structure and function of the p97/CDC48 ATPase. Front. Mol. Biosci. 4, 00039 44. Rapoport, T., and Bodnar, N. (2017) Toward an understanding of the Cdc48/p97 ATPase. F1000Research. 6, 1318 45. Wolf, D. H., and Stolz, A. (2012) The Cdc48 machine in endoplasmic reticulum associated protein degradation. Biochim. Biophys. Acta - Mol. Cell Res. 1823, 117–124 46. Bruford, E. A., Braschi, B., Denny, P., Jones, T. E. M., Seal, R. L., and Tweedie, S. (2020) Guidelines for human gene nomenclature. Nat. Genet. 52, 754–758 47. Lin, H., Li, S., and Shu, H. B. (2019) The Membrane-Associated MARCH E3 Ligase Family: Emerging Roles in Immune Regulation. Front. Immunol. 10, 1751 48. Han, S. oh, Xiao, K., Kim, J., Wu, J. H., Wisler, J. W., Nakamura, N., Freedman, N. J., and Shenoy, S. K. (2012) MARCH2 promotes endocytosis and lysosomal sorting of carvedilol-bound β2-adrenergic receptors. J. Cell Biol. 199, 817–830 49. Bauer, J., Bakke, O., and Morth, J. P. (2017) Overview of the membrane- associated RING-CH (MARCH) E3 ligase family. N. Biotechnol. 38, 7–15 50. Fenech, E. J., Lari, F., Charles, P. D., Fischer, R., Laétitia-Thézénas, M., Bagola, K., Paton, A. W., Paton, J. C., Gyrd-Hansen, M., Kessler, B. M., and Christianson, J. C. (2020) Interaction mapping of endoplasmic reticulum ubiquitin ligases identifies modulators of innate immune signalling. Elife. 9, 1–29 51. Nagase, T., Ishikawa, K. I., Miyajima, N., Tanaka, A., Kotani, H., Nomura, N., and Ohara, O. (1998) Prediction of the coding sequences of unidentified human genes. IX. The complete sequences of 100 new cDNA clones from brain which can code for large proteins in vitro. DNA Res. 5, 31–39 52. Swanson, R., Locher, M., and Hochstrasser, M. (2001) A conserved ubiquitin ligase of the nuclear envelope/endoplasmic reticulum that functions in both ER-associated and Matα2 repressor degradation. Genes Dev. 15, 2660–2674 53. Cerruti Mainardi, P. (2006) Cri du Chat syndrome. Orphanet J. Rare Dis. 1, 33 54. Nguyen, J. M., Qualmann, K. J., Okashah, R., Reilly, A., Alexeyev, M. F., and Campbell, D. J. (2015) 5p deletions: Current knowledge and future directions. Am. J. Med. Genet. Part C Semin. Med. Genet. 169, 224–238 55. Florian, R. T., Kraft, F., Leitão, E., Kaya, S., Klebe, S., Magnin, E., van

158

Chapter 7

Rootselaar, A. F., Buratti, J., Kühnel, T., Schröder, C., Giesselmann, S., Tschernoster, N., Altmueller, J., Lamiral, A., Keren, B., Nava, C., Bouteiller, D., Forlani, S., Jornea, L., Kubica, R., Ye, T., Plassard, D., Jost, B., Meyer, V., Deleuze, J. F., Delpu, Y., Avarello, M. D. M., Vijfhuizen, L. S., Rudolf, G., Hirsch, E., Kroes, T., Reif, P. S., Rosenow, F., Ganos, C., Vidailhet, M., Thivard, L., Mathieu, A., Bourgeron, T., Kurth, I., Rafehi, H., Steenpass, L., Horsthemke, B., Berkovic, S. F., Bisulli, F., Brancati, F., Canafoglia, L., Casari, G., Guerrini, R., Ishiura, H., Licchetta, L., Mei, D., Pippucci, T., Sadleir, L., Scheffer, I. E., Striano, P., Tinuper, P., Tsuji, S., Zara, F., LeGuern, E., Klein, K. M., Labauge, P., Bennett, M. F., Bahlo, M., Gecz, J., Corbett, M. A., Tijssen, M. A. J., van den Maagdenberg, A. M. J. M., and Depienne, C. (2019) Unstable TTTTA/TTTCA expansions in MARCH6 are associated with Familial Adult Myoclonic Epilepsy type 3. Nat. Commun. 10, 4919 56. Terasaki, A., Nakamura, M., Urata, Y., Hiwatashi, H., Yokoyama, I., Yasuda, T., Onuma, T., Wada, K., Kaneko, S., Kan, R., Niwa, S. ichi, Hashimoto, O., Komure, O., Goto, Y. ichi, Yamagishi, Y., Nakano, M., Furusawa, Y., and Sano, A. (2020) DNA analysis of benign adult familial myoclonic epilepsy reveals associations between the pathogenic TTTCA repeat insertion in SAMD12 and the nonpathogenic TTTTA repeat expansion in TNRC6A. J. Hum. Genet. 10.1038/s10038-020-00855-0 57. Wang, K. S., Liu, X., Zheng, S., Zeng, M., Pan, Y., and Callahan, K. (2012) A novel locus for body mass index on 5p15.2: A meta-analysis of two genome-wide association studies. Gene. 500, 80–84 58. Coates, H. W., Chua, N. K., and Brown, A. J. (2019) Consulting prostate cancer cohort data uncovers transcriptional control: Regulation of the MARCH6 gene. Biochim. Biophys. Acta - Mol. Cell Biol. Lipids. 1864, 1656– 1668 59. Scott, N. A. N. A., Sharpe, L. J. L. J., and Brown, A. J. A. J. (2021) The E3 ubiquitin ligase MARCHF6 as a metabolic integrator in cholesterol synthesis and beyond. Biochim. Biophys. Acta - Mol. Cell Biol. Lipids. 1866, 158837 60. Kreft, S. G., Wang, L., and Hochstrasser, M. (2006) Membrane topology of the yeast endoplasmic reticulum-localized ubiquitin ligase Doa10 and comparison with its human ortholog TEB4 (MARCH-VI). J. Biol. Chem. 281, 4646–4653 61. Nakamura, N. (2011) The role of the transmembrane RING finger proteins in cellular and organelle function. Membranes (Basel). 1, 354–393 62. Zattas, D., Berk, J. M., Kreft, S. G., and Hochstrasser, M. (2016) A conserved c-terminal element in the yeast doa10 and human MARCH6 ubiquitin ligases required for selective substrate degradation. J. Biol. Chem. 291, 12105–12118 63. Kreft, S. G., and Hochstrasser, M. (2011) An unusual transmembrane helix in the endoplasmic reticulum ubiquitin ligase Doa10 modulates degradation of its cognate E2 enzyme. J. Biol. Chem. 286, 20163–20174 159

Chapter 7

64. Schmidt, C. C., Vasic, V., and Stein, A. (2020) Doa10 is a membrane protein retrotranslocase in er-associated protein degradation. Elife. 9, 1–31 65. Vasic, V., Denkert, N., Schmidt, C. C., Riedel, D., Stein, A., and Meinecke, M. (2020) Hrd1 forms the retrotranslocation pore regulated by autoubiquitination and binding of misfolded proteins. Nat. Cell Biol. 22, 274–281 66. Peterson, B. G., Glaser, M. L., Rapoport, T. A., and Baldridge, R. D. (2019) Cycles of autoubiquitination and deubiquitination regulate the erad ubiquitin ligase hrd1. Elife. 8, 50903 67. Wang, X., Herr, R. A., Rabelink, M., Hoeben, R. C., Wiertz, E. J. H. J., and Hansen, T. H. (2009) Ube2j2 ubiquitinates hydroxylated amino acids on ER-associated degradation substrates. J. Cell Biol. 187, 655–668 68. Huttlin, E. L., Ting, L., Bruckner, R. J., Gebreab, F., Gygi, M. P., Szpyt, J., Tam, S., Zarraga, G., Colby, G., Baltier, K., Dong, R., Guarani, V., Vaites, L. P., Ordureau, A., Rad, R., Erickson, B. K., Wühr, M., Chick, J., Zhai, B., Kolippakkam, D., Mintseris, J., Obar, R. A., Harris, T., Artavanis-Tsakonas, S., Sowa, M. E., De Camilli, P., Paulo, J. A., Harper, J. W., and Gygi, S. P. (2015) The BioPlex Network: A Systematic Exploration of the Human Interactome. Cell. 162, 425–440 69. Tatham, M. H., Plechanovová, A., Jaffray, E. G., Salmen, H., and Hay, R. T. (2013) Ube2W conjugates ubiquitin to α-amino groups of protein N- termini. Biochem. J. 453, 137–145 70. Scaglione, K. M., Basrur, V., Ashraf, N. S., Konen, J. R., Elenitoba- Johnson, K. S. J., Todi, S. V., and Paulson, H. L. (2013) The ubiquitin- conjugating enzyme (E2) ube2w ubiquitinates the N terminus of substrates. J. Biol. Chem. 288, 18784–18788 71. Clague, M. J., Urbé, S., and Komander, D. (2019) Breaking the chains: deubiquitylating enzyme specificity begets function. Nat. Rev. Mol. Cell Biol. 20, 338–352 72. Nakamura, N., Harada, K., Kato, M., and Hirose, S. (2014) Ubiquitin- specific protease 19 regulates the stability of the E3 ubiquitin ligase MARCH6. Exp. Cell Res. 328, 207–216 73. De Bie, P., and Ciechanover, A. (2011) Ubiquitination of E3 ligases: Self- regulation of the ubiquitin system via proteolytic and non-proteolytic mechanisms. Cell Death Differ. 18, 1393–1402 74. Zelcer, N., Sharpe, L. J., Loregger, A., Kristiana, I., Cook, E. C. L., Phan, L., Stevenson, J., and Brown, A. J. (2014) The E3 ubiquitin ligase MARCH6 degrades squalene monooxygenase and affects 3-hydroxy-3-methylglutaryl coenzyme A reductase and the cholesterol synthesis pathway. Mol. Cell. Biol. 34, 1262–1270 75. Foresti, O., Ruggiano, A., Hannibal-Bach, H. K., Ejsing, C. S., and Carvalho, P. (2013) Sterol homeostasis requires regulated degradation of squalene monooxygenase by the ubiquitin ligase Doa10/Teb4. Elife. 2013, 00953

160

Chapter 7

76. Nguyen, K. T., Lee, C. S., Mun, S. H., Truong, N. T., Park, S. K., and Hwang, C. S. (2019) N-terminal acetylation and the N-end rule pathway control degradation of the lipid droplet protein PLIN2. J. Biol. Chem. 294, 379–388 77. Schultz, M. L., Krus, K. L., Kaushik, S., Dang, D., Chopra, R., Qi, L., Shakkottai, V. G., Cuervo, A. M., and Lieberman, A. P. (2018) Coordinate regulation of mutant NPC1 degradation by selective ER autophagy and MARCH6-dependent ERAD. Nat. Commun. 9, 3671 78. Wang, L., Dong, H., Soroka, C. J., Wei, N. W., Boyer, J. L., and Hochstrasser, M. (2008) Degradation of the Bile salt export pump at endoplasmic reticulum in progressive familial Intrahepatic cholestasis type II. Hepatology. 48, 1558–1569 79. Zavacki, A. M., Arrojo e Drigo, R., Freitas, B. C. G., Chung, M., Harney, J. W., Egri, P., Wittmann, G., Fekete, C., Gereben, B., and Bianco, A. C. (2009) The E3 Ubiquitin Ligase TEB4 Mediates Degradation of Type 2 Iodothyronine Deiodinase. Mol. Cell. Biol. 29, 5339–5347 80. Park, S. E., Kim, J. M., Seok, O. H., Cho, H., Wadas, B., Kim, S. Y., Varshavsky, A., and Hwang, C. S. (2015) Control of mammalian g protein signaling by N-terminal acetylation and the N-end rule pathway. Science. 347, 1249–1252 81. van den Boomen, D. J. H., Volkmar, N., and Lehner, P. J. (2020) Ubiquitin- mediated regulation of sterol homeostasis. Curr. Opin. Cell Biol. 65, 103– 111 82. Luo, J., Yang, H., and Song, B. L. (2020) Mechanisms and regulation of cholesterol homeostasis. Nat. Rev. Mol. Cell Biol. 21, 225–245 83. Menzies, S. A., Volkmar, N., van den Boomen, D. J. H., Timms, R. T., Dickson, A. S., Nathan, J. A., and Lehner, P. J. (2018) The sterol- responsive RNF145 E3 ubiquitin ligase mediates the degradation of HMG- CoA reductase together with gp78 and hrd1. Elife. 7, 40009 84. Chua, N. K., Coates, H. W., and Brown, A. J. (2020) Squalene monooxygenase: a journey to the heart of cholesterol synthesis. Prog. Lipid Res. 79, 101033 85. Faust, J. R., Luskey, K. L., Chin, D. J., Goldstein, J. L., and Brown, M. S. (1982) Regulation of synthesis and degradation of 3-hydroxy-3- methylglutaryl-coenzyme A reductase by low density lipoprotein and 25- hydroxycholesterol in UT-1 cells. Proc. Natl. Acad. Sci. 79, 5205–5209 86. Roitelman, J., and Simoni, R. D. (1992) Distinct sterol and nonsterol signals for the regulated degradation of 3- hydroxy-3-methylglutaryl-CoA reductase. J. Biol. Chem. 267, 25264–25273 87. Loregger, A., Cook, E. C. L., Nelson, J. K., Moeton, M., Sharpe, L. J., Engberg, S., Karimova, M., Lambert, G., Brown, A. J., and Zelcer, N. (2015) A MARCH6 and IDOL E3 ubiquitin ligase circuit uncouples cholesterol synthesis from lipoprotein uptake in hepatocytes. Mol. Cell. Biol. 36, 285–

161

Chapter 7

294 88. Stieger, B. (2010) Role of the bile salt export pump, BSEP, in acquired forms of cholestasis. Drug Metab. Rev. 42, 437–445 89. Van Mil, S. W. C., Van Der Woerd, W. L., Van Der Brugge, G., Sturm, E., Jansen, P. L. M., Bull, L. N., Van Den Berg, I. E. T., Berger, R., Houwen, R. H. J., and Klomp, L. W. J. (2004) Benign recurrent intrahepatic cholestasis type 2 is caused by mutations in ABCB11. Gastroenterology. 127, 379–384 90. Jansen, P. L. M., Strautnieks, S. S., Jacquemin, E., Hadchouel, M., Sokal, E. M., Hooiveld, G. J. E. J., Koning, J. H., De Jager-Krikken, A., Kuipers, F., Stellaard, F., Bijleveld, C. M. A., Gouw, A., Van Goor, H., Thompson, R. J., and Muller, M. (1999) Hepatocanalicular bile salt export pump deficiency in patients with progressive familial intrahepatic cholestasis. Gastroenterology. 117, 1370–1379 91. Geberhiwot, T., Moro, A., Dardis, A., Ramaswami, U., Sirrs, S., Marfa, M. P., Vanier, M. T., Walterfang, M., Bolton, S., Dawson, C., Héron, B., Stampfer, M., Imrie, J., Hendriksz, C., Gissen, P., Crushell, E., Coll, M. J., Nadjar, Y., Klünemann, H., Mengel, E., Hrebicek, M., Jones, S. A., Ory, D., Bembi, B., and Patterson, M. (2018) Consensus clinical management guidelines for Niemann-Pick disease type C. Orphanet J. Rare Dis. 13, 50 92. Gelsthorpe, M. E., Baumann, N., Millard, E., Gale, S. E., Langmade, S. J., Schaffer, J. E., and Ory, D. S. (2008) Niemann-Pick type C1 I1061T mutant encodes a functional protein that is selected for endoplasmic reticulum- associated degradation due to protein misfolding. J. Biol. Chem. 283, 8229–8236 93. Libby, A. E., Bales, E. S., Monks, J., Orlicky, D. J., and McManaman, J. L. (2018) Perilipin-2 deletion promotes carbohydrate-mediated browning of white adipose tissue at ambient temperature. J. Lipid Res. 59, 1482–1500 94. Takahashi, Y., Shinoda, A., Kamada, H., Shimizu, M., Inoue, J., and Sato, R. (2016) Perilipin2 plays a positive role in adipocytes during lipolysis by escaping proteasomal degradation. Sci. Rep. 6, 20975 95. Maia, A. L., Kim, B. W., Huang, S. A., Harney, J. W., and Larsen, P. R. (2005) Type 2 iodothyronine deiodinase is the major source of plasma T3 in euthyroid humans. J. Clin. Invest. 115, 2524–2533 96. Mullur, R., Liu, Y. Y., and Brent, G. A. (2014) Thyroid hormone regulation of metabolism. Physiol. Rev. 94, 355–382 97. Ravid, T., Kreft, S. G., and Hochstrasser, M. (2006) Membrane and soluble substrates of the Doa10 ubiquitin ligase are degraded by distinct pathways. EMBO J. 25, 533–543 98. Dentice, M., Bandyopadhyay, A., Gereben, B., Callebaut, I., Christoffolete, M. A., Kim, B. W., Nissim, S., Mornon, J.-P. P., Zavacki, A. M., Zeöld, A., Capelo, L. P., Curcio-Morelli, C., Ribeiro, R., Harney, J. W., Tabin, C. J., and Bianco, A. C. (2005) The Hedgehog-inducible ubiquitin ligase subunit

162

Chapter 7

WSB-1 modulates thyroid hormone activation and PTHrP secretion in the developing growth plate. Nat. Cell Biol. 7, 698–705 99. Kimple, A. J., Bosch, D. E., Giguère, P. M., and Siderovski, D. P. (2011) Regulators of G-protein signaling and their Gα substrates: Promises and challenges in their use as drug discovery targets. Pharmacol. Rev. 63, 728– 749 100. Yang, J., Kamide, K., Kokubo, Y., Takiuchi, S., Tanaka, C., Banno, M., Miwa, Y., Yoshii, M., Horio, T., Okayama, A., Tomoike, H., Kawano, Y., and Miyata, T. (2005) Genetic variations of regulator of G-protein signaling 2 in hypertensive patients and in the general population. J. Hypertens. 23, 1497–1505 101. Heximer, S. P., Knutsen, R. H., Sun, X., Kaltenbronn, K. M., Rhee, M. H., Peng, N., Oliveira-dos-Santos, A., Penninger, J. M., Muslin, A. J., Steinberg, T. H., Wyss, J. M., Mecham, R. P., and Blumer, K. J. (2003) Hypertension and prolonged vasoconstrictor signaling in RGS2-deficient mice. J. Clin. Invest. 111, 445–452 102. Hwang, C. S., Shemorry, A., and Varshavsky, A. (2010) N-terminal acetylation of cellular proteins creates specific degradation signals. Science. 327, 973–977 103. Luu, W., Gelissen, I. C., and Brown, A. J. (2017) Manipulating cholesterol status within cells. in Methods in Molecular Biology, pp. 41–52, 1583, 41– 52 104. De Caprio, J., Yun, J., and Javitt, N. B. (1992) Bile acid and sterol solubilization in 2-hydroxypropyl-β-cyclodextrin. J. Lipid Res. 33, 441–443 105. Kilsdonk, E. P. C., Yancey, P. G., Stoudt, G. W., Bangerter, F. W., Johnson, W. J., Phillips, M. C., and Rothblat, G. H. (1995) Cellular cholesterol efflux mediated by cyclodextrins. J. Biol. Chem. 270, 17250–17256 106. Trinh, M. N., Brown, M. S., Goldstein, J. L., Han, J., Vale, G., McDonald, J. G., Seemann, J., Mendell, J. T., and Lu, F. (2020) Last step in the path of LDL cholesterol from lysosome to plasma membrane to ER is governed by phosphatidylserine. Proc. Natl. Acad. Sci. U. S. A. 117, 18521–18529 107. Neufeld, E. B., Cooney, A. M., Pitha, J., Dawidowicz, E. A., Dwyer, N. K., Pentchev, P. G., and Joan Blanchette-Mackie, E. (1996) Intracellular trafficking of cholesterol monitored with a cyclodextrin. J. Biol. Chem. 271, 21604–21613 108. Abi-Mosleh, L., Infante, R. E., Radhakrishnan, A., Goldstein, J. L., and Brown, M. S. (2009) Cyclodextrin overcomes deficient lysosome-to- endoplasmic reticulum transport of cholesterol in Niemann-Pick type C cells. Proc. Natl. Acad. Sci. U. S. A. 106, 19316–19321 109. Metherall, J. E., Goldstein, J. L., Luskey, K. L., and Brown, M. S. (1989) Loss of transcriptional repression of three sterol-regulated genes in mutant hamster cells. J. Biol. Chem. 264, 15634–15641 110. Polycarpou-Schwarz, M., Groß, M., Mestdagh, P., Schott, J., Grund, S. E., 163

Chapter 7

Hildenbrand, C., Rom, J., Aulmann, S., Sinn, H. P., Vandesompele, J., and Diederichs, S. (2018) The cancer-associated microprotein CASIMO1 controls cell proliferation and interacts with squalene epoxidase modulating lipid droplet formation. Oncogene. 37, 4750–4768 111. Volkmar, N., Thezenas, M. L., Louie, S. M., Juszkiewicz, S., Nomura, D. K., Hegde, R. S., Kessler, B. M., and Christianson, J. C. (2019) The ER membrane protein complex promotes biogenesis of sterol-related enzymes maintaining cholesterol homeostasis. J. Cell Sci. 132, 223453 112. Prabhu, A. V., Luu, W., Sharpe, L. J., and Brown, A. J. (2016) Cholesterol- mediated degradation of 7-dehydrocholesterol reductase switches the balance from cholesterol to Vitamin D synthesis. J. Biol. Chem. 291, 8363– 8373 113. Bièche, I., Parfait, B., Tozlu, S. L., Lidereau, R., and Vidaud, M. (2001) Quantitation of androgen receptor gene expression in sporadic breast tumors by real-time RT-PCR: Evidence that MYC is an AR-regulated gene. Carcinogenesis. 22, 1521–1526 114. Krycer, J. R., and Brown, A. J. (2011) Cross-talk between the androgen receptor and the liver X receptor: Implications for cholesterol homeostasis. J. Biol. Chem. 286, 20637–20647 115. Kielar, D., Dietmaier, W., Langmann, T., Aslanidis, C., Probst, M., Naruszewicz, M., and Schmitz, G. (2001) Rapid quantification of human ABCA1 mRNA in various cell types and tissues by real-time reverse transcription-PCR. Clin. Chem. 47, 2089–2097 116. Du, X., Kristiana, I., Wong, J., and Brown, A. J. (2006) Involvement of Akt in ER-to-Golgi transport of SCAP/SREBP: A link between a key cell proliferative pathway and membrane synthesis. Mol. Biol. Cell. 17, 2735– 2745 117. Cook, E. C. L., Nelson, J. K., Sorrentino, V., Koenis, D., Moeton, M., Scheij, S., Ottenhoff, R., Bleijlevens, B., Loregger, A., and Zelcer, N. (2017) Identification of the ER-resident E3 ubiquitin ligase RNF145 as a novel LXR-regulated gene. PLoS One. 12, 0172721 118. Zelcer, N., Hong, C., Boyadjian, R., and Tontonoz, P. (2009) LXR regulates cholesterol uptake through idol-dependent ubiquitination of the LDL receptor. Science. 325, 100–104 119. Irisawa, M., Inoue, J., Ozawa, N., Mori, K., and Sato, R. (2009) The sterol- sensing endoplasmic reticulum (ER) membrane protein TRC8 hampers ER to golgi transport of sterol regulatory element-binding protein-2 (SREBP- 2)/SREBP cleavage-activated protein and reduces SREBP-2 cleavage. J. Biol. Chem. 284, 28995–29004 120. Lee, J. P., Brauweiler, A., Rudolph, M., Hooper, J. E., Drabkin, H. A., and Gemmill, R. M. (2010) The TRC8 ubiquitin ligase is sterol regulated and interacts with lipid and protein biosynthetic pathways. Mol. Cancer Res. 8, 93–106

164

Chapter 7

121. Wang, Y. J., Bian, Y., Luo, J., Lu, M., Xiong, Y., Guo, S. Y., Yin, H. Y., Lin, X., Li, Q., Chang, C. C. Y., Chang, T. Y., Li, B. L., and Song, B. L. (2017) Cholesterol and fatty acids regulate cysteine ubiquitylation of ACAT2 through competitive oxidation. Nat. Cell Biol. 19, 808–819 122. Zhou, Z. Sen, Li, M. X., Liu, J., Jiao, H., Xia, J. M., Shi, X. J., Zhao, H., Chu, L., Liu, J., Qi, W., Luo, J., and Song, B. L. (2020) Competitive oxidation and ubiquitylation on the evolutionarily conserved cysteine confer tissue- specific stabilization of Insig-2. Nat. Commun. 11, 379 123. Sharpe, L. J., Howe, V., Scott, N. A., Luu, W., Phan, L., Berk, J. M., Hochstrasser, M., and Brown, A. J. (2019) Cholesterol increases protein levels of the E3 ligase MARCH6 and thereby stimulates protein degradation. J. Biol. Chem. 294, 2436–2448 124. Howe, V., Sharpe, L. J., Prabhu, A. V., and Brown, A. J. (2017) New insights into cellular cholesterol acquisition: promoter analysis of human HMGCR and SQLE, two key control enzymes in cholesterol synthesis. Biochim. Biophys. Acta - Mol. Cell Biol. Lipids. 1862, 647–657 125. Kuwabara, P. E., and Labouesse, M. (2002) The sterol-sensing domain: Multiple families, a unique role? Trends Genet. 18, 193–201 126. Brown, M. S., Radhakrishnan, A., and Goldstein, J. L. (2018) Retrospective on Cholesterol Homeostasis: The Central Role of Scap. Annu. Rev. Biochem. 87, 783–807 127. Hua, Xianxin; Nohturfft, Axel; Goldstein, Joseph L; Brown, M. S., Hua, X., Nohturfft, A., Goldstein, J. L., and Brown, M. S. (1996) Sterol resistance in CHO cells traced to point mutation in SREBP cleavage-activating protein. Cell. 87, 415–426 128. Davies, J. P., and Ioannou, Y. A. (2000) Topological analysis of Niemann- Pick C1 protein reveals that the membrane orientation of the putative sterol- sensing domain is identical to those of 3-hydroxy-3-methylglutaryl-CoA reductase and sterol regulatory element binding protein cleavage- activating. J. Biol. Chem. 275, 24367–24374 129. Yabe, D., Xia, Z. P., Adams, C. M., and Rawson, R. B. (2002) Three mutations in sterol-sensing domain of SCAP block interaction with insig and render SREBP cleavage insensitive to sterols. Proc. Natl. Acad. Sci. U. S. A. 99, 16672–16677 130. Radhakrishnan, A., Ikeda, Y., Hyock, J. K., Brown, M. S., and Goldstein, J. L. (2007) Sterol-regulated transport of SREBPs from endoplasmic reticulum to Golgi: Oxysterols block transport by binding to Insig. Proc. Natl. Acad. Sci. U. S. A. 104, 6511–6518 131. Chua, N. K., Hart-Smith, G., and Brown, A. J. (2019) Non-canonical ubiquitination of the cholesterol-regulated degron of squalene monooxygenase. J. Biol. Chem. 294, 8134–8147 132. Zerenturk, E. J., Sharpe, L. J., and Brown, A. J. (2012) Sterols regulate 3β- hydroxysterol Δ24-reductase (DHCR24) via dual sterol regulatory

165

Chapter 7

elements: Cooperative induction of key enzymes in lipid synthesis by Sterol Regulatory Element Binding Proteins. Biochim. Biophys. Acta - Mol. Cell Biol. Lipids. 1821, 1350–1360 133. Guna, A., Volkmar, N., Christianson, J. C., and Hegde, R. S. (2018) The ER membrane protein complex is a transmembrane domain insertase. Science. 359, 470–473 134. Hulce, J. J., Cognetta, A. B., Niphakis, M. J., Tully, S. E., and Cravatt, B. F. (2013) Proteome-wide mapping of cholesterol-interacting proteins in mammalian cells. Nat. Methods. 10, 259–264 135. Wangeline, M. A., and Hampton, R. Y. (2018) “Mallostery”—ligand- dependent protein misfolding enables physiological regulation by ERAD. J. Biol. Chem. 293, 14937–14950 136. Sever, N., Yang, T., Brown, M. S., Goldstein, J. L., and DeBose-Boyd, R. A. (2003) Accelerated Degradation of HMG CoA Reductase Mediated by Binding of Insig-1 to Its Sterol-Sensing Domain. Mol. Cell. 11, 25–33 137. Sever, N., Song, B. L., Yabe, D., Goldstein, J. L., Brown, M. S., and DeBose-Boydb, R. A. (2003) Insig-dependent Ubiquitination and Degradation of Mammalian 3-Hydroxy-3-methylglutaryl-CoA Reductase Stimulated by Sterols and Geranylgeraniol. J. Biol. Chem. 278, 52479– 52490 138. Ohgami, N., Ko, D. C., Thomas, M., Scott, M. P., Chang, C. C. Y., and Chang, T.-Y. (2004) Binding between the Niemann-Pick C1 protein and a photoactivatable cholesterol analog requires a functional sterol-sensing domain. Proc. Natl. Acad. Sci. U. S. A. 101, 12473–12478 139. Li, X., Wang, J., Coutavas, E., Shi, H., Hao, Q., and Blobel, G. (2016) Structure of human Niemann-Pick C1 protein. Proc. Natl. Acad. Sci. U. S. A. 113, 8212–8217 140. Song, B. L., Sever, N., and DeBose-Boyd, R. A. (2005) Gp78, a membrane- anchored ubiquitin ligase, associates with Insig-1 and couples sterol- regulated ubiquitination to degradation of HMG CoA reductase. Mol. Cell. 19, 829–840 141. Nohturfft, A., Brown, M. S., and Goldstein, J. L. (1998) Sterols regulate processing of carbohydrate chains of wild-type SREBP cleavage-activating protein (SCAP), but not sterol-resistant mutants Y298C or D443N. Proc. Natl. Acad. Sci. U. S. A. 95, 12848–12853 142. Adams, C. M., Goldstein, J. L., and Brown, M. S. (2003) Cholesterol- induced conformational change in SCAP enhanced by Insig proteins and mimicked by cationic amphiphiles. Proc. Natl. Acad. Sci. U. S. A. 100, 10647–10652 143. Jiang, L. Y., Jiang, W., Tian, N., Xiong, Y. N., Liu, J., Wei, J., Wu, K. Y., Luo, J., Shi, X. J., and Song, B. L. (2018) Ring finger protein 145 (RNF145) is a ubiquitin ligase for sterol-induced degradation of HMG-CoA reductase. J. Biol. Chem. 293, 4047–4055

166

Chapter 7

144. Song, B. L., Javitt, N. B., and DeBose-Boyd, R. A. (2005) Insig-mediated degradation of HMG CoA reductase stimulated by lanosterol, an intermediate in the synthesis of cholesterol. Cell Metab. 1, 179–189 145. Boden, G. (2011) Obesity, insulin resistance and free fatty acids. Curr. Opin. Endocrinol. Diabetes Obes. 18, 139–143 146. Anavi, S., Hahn-Obercyger, M., Madar, Z., and Tirosh, O. (2014) Mechanism for HIF-1 activation by cholesterol under normoxia: A redox signaling pathway for liver damage. Free Radic. Biol. Med. 71, 61–69 147. Poli, G., Biasi, F., and Leonarduzzi, G. (2013) Oxysterols in the pathogenesis of major chronic diseases. Redox Biol. 1, 125–130 148. Stevenson, J., Luu, W., Kristiana, I., and Brown, A. J. (2014) Squalene mono-oxygenase, a key enzyme in cholesterol synthesis, is stabilized by unsaturated fatty acids. Biochem. J. 461, 435–442 149. Volkmar, N., and Christianson, J. C. (2020) Squaring the EMC - How promoting membrane protein biogenesis impacts cellular functions and organismal homeostasis. J. Cell Sci. 133, 243519 150. Christianson, J. C., Olzmann, J. A., Shaler, T. A., Sowa, M. E., Bennett, E. J., Richter, C. M., Tyler, R. E., Greenblatt, E. J., Wade Harper, J., and Kopito, R. R. (2012) Defining human ERAD networks through an integrative mapping strategy. Nat. Cell Biol. 14, 93–105 151. Jonikas, M. C., Collins, S. R., Denic, V., Oh, E., Quan, E. M., Schmid, V., Weibezahn, J., Schwappach, B., Walter, P., Weissman, J. S., and Schuldiner, M. (2009) Comprehensive characterization of genes required for protein folding in the endoplasmic reticulum. Science. 323, 1693–1697 152. Nian, Z., Sun, Z., Yu, L., Toh, S. Y., Sang, J., and Li, P. (2010) Fat-specific protein 27 undergoes ubiquitin-dependent degradation regulated by triacylglycerol synthesis and lipid droplet formation. J. Biol. Chem. 285, 9604–9615 153. Stevenson, J., Krycer, J. R., Phan, L., and Brown, A. J. (2013) A practical comparison of ligation-independent cloning techniques. PLoS One. 8, 83888 154. Pongratz, R. L., Kibbey, R. G., Shulman, G. I., and Cline, G. W. (2007) Cytosolic and mitochondrial malic enzyme isoforms differentially control insulin secretion. J. Biol. Chem. 282, 200–207 155. Gong, J., Sun, Z., Wu, L., Xu, W., Schieber, N., Xu, D., Shui, G., Yang, H., Parton, R. G., and Li, P. (2011) Fsp27 promotes lipid droplet growth by lipid exchange and transfer at lipid droplet contact sites. J. Cell Biol. 195, 953– 963 156. Wang, J., Yan, C., Xu, C., Chua, B. T., Li, P., and Chen, F. J. (2018) Polybasic RKKR motif in the linker region of lipid droplet (LD)–associated protein CIDEC inhibits LD fusion activity by interacting with acidic phospholipids. J. Biol. Chem. 293, 19330–19343

167

Chapter 7

157. Chua, N. K., Howe, V., Jatana, N., Thukral, L., and Brown, A. J. (2017) A conserved degron containing an amphipathic helix regulates the cholesterol-mediated turnover of human squalene monooxygenase, a rate- limiting enzyme in cholesterol synthesis. J. Biol. Chem. 292, 19959–19973 158. Roux, K. J., Kim, D. I., Raida, M., and Burke, B. (2012) A promiscuous biotin ligase fusion protein identifies proximal and interacting proteins in mammalian cells. J. Cell Biol. 196, 801–810 159. Kim, D. I., Birendra, K. C., Zhu, W., Motamedchaboki, K., Doye, V., and Roux, K. J. (2014) Probing nuclear pore complex architecture with proximity-dependent biotinylation. Proc. Natl. Acad. Sci. U. S. A. 111, 2453–2461 160. Coates, H. W., Capell-Hattam, I. M., and Brown, A. J. (2021) The mammalian cholesterol synthesis enzyme squalene monooxygenase is proteasomally truncated to a constitutively active form. J. Biol. Chem. 10.1016/j.jbc.2021.100731 161. Zerenturk, E. J., Kristiana, I., Gill, S., and Brown, A. J. (2012) The endogenous regulator 24(S),25-epoxycholesterol inhibits cholesterol synthesis at DHCR24 (Seladin-1). Biochim. Biophys. Acta - Mol. Cell Biol. Lipids. 1821, 1269–1277 162. Luu, W., Sharpe, L. J., Stevenson, J., and Brown, A. J. (2012) Akt acutely activates the cholesterogenic transcription factor SREBP-2. Biochim. Biophys. Acta - Mol. Cell Res. 1823, 458–464 163. Scott, N. A., Sharpe, L. J., Capell-Hattam, I. M., Gullo, S. J., Luu, W., and Brown, A. J. (2020) The cholesterol synthesis enzyme lanosterol 14α- demethylase is post-translationally regulated by the E3 ubiquitin ligase MARCH6. Biochem. J. 477, 541–555 164. Capell-Hattam, I. M., Sharpe, L. J., Qian, L., Hart-Smith, G., Prabhu, A. V., and Brown, A. J. (2020) Twin enzymes, divergent control: The cholesterogenic enzymes DHCR14 and LBR are differentially regulated transcriptionally and post-translationally. J. Biol. Chem. 295, 2850–2865 165. Prabhu, A. V., Sharpe, L. J., and Brown, A. J. (2014) The sterol-based transcriptional control of human 7-dehydrocholesterol reductase (DHCR7): Evidence of a cooperative regulatory program in cholesterol synthesis. Biochim. Biophys. Acta - Mol. Cell Biol. Lipids. 1841, 1431–1439 166. Wong, J., Quinn, C. M., Gelissen, I. C., and Brown, A. J. (2008) Endogenous 24(S),25-epoxycholesterol fine-tunes acute control of cellular cholesterol homeostasis. J. Biol. Chem. 283, 700–707 167. Nguyen, A. D., McDonald, J. G., Bruick, R. K., and DeBose-Boyd, R. A. (2007) Hypoxia stimulates degradation of 3-hydroxy-3-methylglutaryl- coenzyme A reductase through accumulation of lanosterol and hypoxia- inducible factor-mediated induction of insigs. J. Biol. Chem. 282, 27436– 27446 168. Zhu, J., Jiang, X., and Chehab, F. F. (2014) FoxO4 interacts with the sterol

168

Chapter 7

regulatory factor SREBP2 and the hypoxia inducible factor HIF2α at the CYP51 promoter. J. Lipid Res. 55, 431–442 169. Park, J. W., Byrd, A., Lee, C., and Morgan, E. T. (2017) Nitric oxide stimulates cellular degradation of human CYP51A1, the highly conserved lanosterol 14α-demethylase. Biochem. J. 474, 3241–3252 170. Kim, S. M., Wang, Y. Q., Nabavi, N., Liu, Y., and Correia, M. A. (2016) Hepatic cytochromes P450: structural degrons and barcodes, posttranslational modifications and cellular adapters in the ERAD- endgame. Drug Metab. Rev. 48, 405–433 171. Howe, V., Chua, N. K., Stevenson, J., and Brown, A. J. (2015) The regulatory domain of squalene monooxygenase contains a re-entrant loop and senses cholesterol via a conformational change. J. Biol. Chem. 290, 27533–27544 172. Prabhu, A. V., Luu, W., Sharpe, L. J., and Brown, A. J. (2017) Phosphorylation regulates activity of 7-dehydrocholesterol reductase (DHCR7), a terminal enzyme of cholesterol synthesis. J. Steroid Biochem. Mol. Biol. 165, 363–368 173. Luu, W., Zerenturk, E. J., Kristiana, I., Bucknall, M. P., Sharpe, L. J., and Brown, A. J. (2014) Signaling regulates activity of DHCR24, the final enzyme in cholesterol synthesis. J. Lipid Res. 55, 410–20 174. Luu, W., Hart-Smith, G., Sharpe, L. J., and Brown, A. J. (2015) The terminal enzymes of cholesterol synthesis, DHCR24 and DHCR7, interact physically and functionally. J. Lipid Res. 56, 888–897 175. Araldi, E., Fernández-Fuertes, M., Canfrán-Duque, A., Tang, W., Cline, G. W., Madrigal-Matute, J., Pober, J. S., Lasunción, M. A., Wu, D., Fernández- Hernando, C., and Suárez, Y. (2017) Lanosterol modulates TLR4-mediated innate immune responses in macrophages. Cell Rep. 19, 2743–2755 176. Foresti, O., Rodriguez-Vaello, V., Funaya, C., and Carvalho, P. (2014) Quality control of the inner nuclear membrane proteins by the Asi complex. Science. 346, 751–755 177. Lee, C.-M. M., Kim, B.-Y. Y., Li, L., and Morgan, E. T. (2008) Nitric oxide- dependent proteasomal degradation of cytochrome P450 2B proteins. J. Biol. Chem. 283, 889–98 178. Lee, C. M., Pohl, J., and Morgan, E. T. (2009) Dual mechanisms of CYP3A protein regulation by proinflammatory cytokine stimulation in primary hepatocyte cultures S. Drug Metab. Dispos. 37, 865–872 179. van de Weijer, M. L., Krshnan, L., Liberatori, S., Guerrero, E. N., Robson- Tull, J., Hahn, L., Lebbink, R. J., Wiertz, E. J. H. J., Fischer, R., Ebner, D., and Carvalho, P. (2020) Quality Control of ER Membrane Proteins by the RNF185/Membralin Ubiquitin Ligase Complex. Mol. Cell. 79, 768–781 180. Van Haperen, R., De Waard, M., Van Deel, E., Mees, B., Kutryk, M., Van Aken, T., Hamming, J., Grosveld, F., Duncker, D. J., and De Crom, R. (2002) Reduction of blood pressure, plasma cholesterol, and 169

Chapter 7

atherosclerosis by elevated endothelial nitric oxide. J. Biol. Chem. 277, 48803–48807 181. Kovacs, I., and Lindermayr, C. (2013) Erratum to: Nitric oxide-based protein modification: Formation and site-specificity of protein S-nitrosylation (Front. Plant Sci., 4, 10.3389/fpls.2013.00137). Front. Plant Sci. 4, 137 182. Abello, N., Kerstjens, H. A. M., Postma, D. S., and Bischoff, R. (2009) Protein tyrosine nitration: Selectivity, physicochemical and biological consequences, denitration, and proteomics methods for the identification of tyrosine-nitrated proteins. J. Proteome Res. 8, 3222–3238 183. Minamiyama, Y., Takemura, S., Imaoka, S., Funae, Y., and Inoune, M. (2008) Inhibition of cytochrome P450 by nitric oxide. Folia Pharmacol. Jpn. 112, 33–41 184. Zerenturk, E. J., Sharpe, L. J., Ikonen, E., and Brown, A. J. (2013) Desmosterol and DHCR24: Unexpected new directions for a terminal step in cholesterol synthesis. Prog. Lipid Res. 52, 666–680 185. Wages, P. A., Kim, H. Y. H., Korade, Z., and Porter, N. A. (2018) Identification and characterization of prescription drugs that change levels of 7-dehydrocholesterol and desmosterol. J. Lipid Res. 59, 1916–1926 186. Lindenthal, B., Holleran, A. L., Aldaghlas, T. A., Ruan, B., Schroepfer, G. J., Wilson, W. K., and Kelleher, J. K. (2001) Progestins block cholesterol synthesis to produce meiosis-activating sterols. FASEB J. 15, 775–784 187. Schuldiner, M., Collins, S. R., Thompson, N. J., Denic, V., Bhamidipati, A., Punna, T., Ihmels, J., Andrews, B., Boone, C., Greenblatt, J. F., Weissman, J. S., and Krogan, N. J. (2005) Exploration of the function and organization of the yeast early secretory pathway through an epistatic miniarray profile. Cell. 123, 507–519 188. Surma, M. A., Klose, C., Peng, D., Shales, M., Mrejen, C., Stefanko, A., Braberg, H., Gordon, D. E., Vorkel, D., Ejsing, C. S., Farese, R., Simons, K., Krogan, N. J., and Ernst, R. (2013) A lipid E-MAP identifies Ubx2 as a critical regulator of lipid saturation and lipid bilayer stress. Mol. Cell. 51, 519–530 189. Costanzo, M., Baryshnikova, A., Bellay, J., Kim, Y., Spear, E. D., Sevier, C. S., Ding, H., Koh, J. L. Y., Toufighi, K., Mostafavi, S., Prinz, J., St. Onge, R. P., Vandersluis, B., Makhnevych, T., Vizeacoumar, F. J., Alizadeh, S., Bahr, S., Brost, R. L., Chen, Y., Cokol, M., Deshpande, R., Li, Z., Lin, Z. Y., Liang, W., Marback, M., Paw, J., Luis, B. J. S., Shuteriqi, E., Tong, A. H. Y., Van Dyk, N., Wallace, I. M., Whitney, J. A., Weirauch, M. T., Zhong, G., Zhu, H., Houry, W. A., Brudno, M., Ragibizadeh, S., Papp, B., Pál, C., Roth, F. P., Giaever, G., Nislow, C., Troyanskaya, O. G., Bussey, H., Bader, G. D., Gingras, A. C., Morris, Q. D., Kim, P. M., Kaiser, C. A., Myers, C. L., Andrews, B. J., and Boone, C. (2010) The genetic landscape of a cell. Science. 327, 425–431 190. Costanzo, M., VanderSluis, B., Koch, E. N., Baryshnikova, A., Pons, C., Tan, G., Wang, W., Usaj, M., Hanchard, J., Lee, S. D., Pelechano, V., 170

Chapter 7

Styles, E. B., Billmann, M., Van Leeuwen, J., Van Dyk, N., Lin, Z. Y., Kuzmin, E., Nelson, J., Piotrowski, J. S., Srikumar, T., Bahr, S., Chen, Y., Deshpande, R., Kurat, C. F., Li, S. C., Li, Z., Usaj, M. M., Okada, H., Pascoe, N., Luis, B. J. S., Sharifpoor, S., Shuteriqi, E., Simpkins, S. W., Snider, J., Suresh, H. G., Tan, Y., Zhu, H., Malod-Dognin, N., Janjic, V., Przulj, N., Troyanskaya, O. G., Stagljar, I., Xia, T., Ohya, Y., Gingras, A. C., Raught, B., Boutros, M., Steinmetz, L. M., Moore, C. L., Rosebrock, A. P., Caudy, A. A., Myers, C. L., Andrews, B., and Boone, C. (2016) A global genetic interaction network maps a wiring diagram of cellular function. Science. 353, 1420 191. Loertscher, J., Larson, L. L., Matson, C. K., Parrish, M. L., Felthauser, A., Sturm, A., Tachibana, C., Bard, M., and Wright, R. (2006) Endoplasmic reticulum-associated degradation is required for cold adaptation and regulation of sterol biosynthesis in the yeast Saccharomyces cerevisiae. Eukaryot. Cell. 5, 712–722 192. Jaenicke, L. A., Brendebach, H., Selbach, M., and Hirsch, C. (2011) Yos9p assists in the degradation of certain nonglycosylated proteins from the endoplasmic reticulum. Mol. Biol. Cell. 22, 2937–2945 193. Sanchez, H. B., Yieh, L., and Osborne, T. F. (1995) Cooperation by sterol regulatory element-binding protein and Sp1 in sterol regulation of low density lipoprotein receptor gene. J. Biol. Chem. 270, 1161–1169 194. Thymiakou, E., Zannis, V. I., and Kardassis, D. (2007) Physical and functional interactions between liver X receptor/retinoid X receptor and Sp1 modulate the transcriptional induction of the human ATP binding cassette transporter A1 gene by oxysterols and retinoids. Biochemistry. 46, 11473– 11483 195. Wang, M., and Kaufman, R. J. (2016) Protein misfolding in the endoplasmic reticulum as a conduit to human disease. Nature. 529, 326–335 196. Malhotra, J. D., and Kaufman, R. J. (2007) Endoplasmic reticulum stress and oxidative stress: A vicious cycle or a double-edged sword? Antioxidants Redox Signal. 9, 2277–2293 197. Hetz, C. (2012) The unfolded protein response: Controlling cell fate decisions under ER stress and beyond. Nat. Rev. Mol. Cell Biol. 13, 89– 102 198. Redza-Dutordoir, M., and Averill-Bates, D. A. (2016) Activation of apoptosis signalling pathways by reactive oxygen species. Biochim. Biophys. Acta - Mol. Cell Res. 1863, 2977–2992 199. Kehrer, J. P., and Klotz, L. O. (2015) Free radicals and related reactive species as mediators of tissue injury and disease: Implications for Health. Crit. Rev. Toxicol. 45, 765–798 200. Liu, Y., Fiskum, G., and Schubert, D. (2002) Generation of reactive oxygen species by the mitochondrial electron transport chain. J. Neurochem. 80, 780–787

171

Chapter 7

201. Hrycay, E. G., and Bandiera, S. M. (2015) Involvement of Cytochrome P450 in Reactive Oxygen Species Formation and Cancer. in Advances in Pharmacology, pp. 35–84, 74, 35–84 202. Maloney, E., Sweet, I. R., Hockenbery, D. M., Pham, M., Rizzo, N. O., Tateya, S., Handa, P., Schwartz, M. W., and Kim, F. (2009) Activation of NF-κB by palmitate in endothelial cells: A key role for NADPH oxidase- derived superoxide in response to TLR4 activation. Arterioscler. Thromb. Vasc. Biol. 29, 1370–1375 203. Brodeur, M. R., Bouvet, C., Barrette, M., and Moreau, P. (2013) Palmitic acid increases medial calcification by inducing oxidative stress. J. Vasc. Res. 50, 430–441 204. Chang, T. Y., Chang, C. C. Y., and Cheng, D. (1997) Acyl-coenzyme A: Cholesterol acyltransferase. Annu. Rev. Biochem. 66, 613–638 205. Yabe, D., Brown, M. S., and Goldstein, J. L. (2002) Insig-2, a second endoplasmic reticulum protein that binds SCAP and blocks export of sterol regulatory element-binding proteins. Proc. Natl. Acad. Sci. U. S. A. 99, 12753–12758 206. Goldstein, J. L., DeBose-Boyd, R. A., and Brown, M. S. (2006) Protein sensors for membrane sterols. Cell. 124, 35–46 207. Staudt, A. C., and Wenkel, S. (2011) Regulation of protein function by “microProteins.” EMBO Rep. 12, 35–42 208. Couso, J. P., and Patraquim, P. (2017) Classification and function of small open reading frames. Nat. Rev. Mol. Cell Biol. 18, 575–589 209. Cabrera-Quio, L. E., Herberg, S., and Pauli, A. (2016) Decoding sORF translation – from small proteins to gene regulation. RNA Biol. 13, 1051– 1059 210. Liu, D., Wong, C. C., Fu, L., Chen, H., Zhao, L., Li, C., Zhou, Y., Zhang, Y., Xu, W., Yang, Y., Wu, B., Cheng, G., Lai, P. B. S., Wong, N., Sung, J. J. Y., and Yu, J. (2018) Squalene epoxidase drives NAFLD-induced hepatocellular carcinoma and is a pharmaceutical target. Sci. Transl. Med. 10, 9840 211. Jun, S. Y., Brow, A. J., Chua, N. K., Yoon, J.-Y., Lee, J.-J., Yang, J. O., Jang, I., Jeon, S.-J., Choi, T.-I., Kim, C.-H., and Kim, N.-S. (2020) Reduction of Squalene Epoxidase by Cholesterol Accumulation Accelerates Colorectal Cancer Progression and Metastasis. Gastroenterology. 10.1053/j.gastro.2020.09.009 212. Brown, D. N., Caffa, I., Cirmena, G., Piras, D., Garuti, A., Gallo, M., Alberti, S., Nencioni, A., Ballestrero, A., and Zoppoli, G. (2016) Squalene epoxidase is a bona fide oncogene by amplification with clinical relevance in breast cancer. Sci. Rep. 6, 19435 213. Krogh, A., Larsson, B., Von Heijne, G., and Sonnhammer, E. L. L. (2001) Predicting transmembrane protein topology with a hidden Markov model: Application to complete genomes. J. Mol. Biol. 305, 567–580 172

Chapter 7

214. Cymer, F., Von Heijne, G., and White, S. H. (2015) Mechanisms of integral membrane protein insertion and folding. J. Mol. Biol. 427, 999–1022 215. Sharpe, H. J., Stevens, T. J., and Munro, S. (2010) A Comprehensive Comparison of Transmembrane Domains Reveals Organelle-Specific Properties. Cell. 142, 158–169 216. Tector, M., and Hartl, F. U. (1999) An unstable transmembrane segment in the cystic fibrosis transmembrane conductance regulator. EMBO J. 18, 6290–6298 217. Wideman, J. G. (2015) The ubiquitous and ancient ER membrane protein complex (EMC): Tether or not? F1000Research. 10.12688/f1000research.6944.2 218. Shurtleff, M. J., Itzhak, D. N., Hussmann, J. A., Schirle Oakdale, N. T., Costa, E. A., Jonikas, M., Weibezahn, J., Popova, K. D., Jan, C. H., Sinitcyn, P., Vembar, S. S., Hernandez, H., Cox, J., Burlingame, A. L., Brodsky, J. L., Frost, A., Borner, G. H. H., and Weissman, J. S. (2018) The ER membrane protein complex interacts cotranslationally to enable biogenesis of multipass membrane proteins. Elife. 7, 37018 219. Coelho, J. P. L., Stahl, M., Bloemeke, N., Meighen-Berger, K., Alvira, C. P., Zhang, Z. R., Sieber, S. A., and Feige, M. J. (2019) A network of chaperones prevents and detects failures in membrane protein lipid bilayer integration. Nat. Commun. 10, 672 220. Chitwood, P. J., Juszkiewicz, S., Guna, A., Shao, S., and Hegde, R. S. (2018) EMC Is Required to Initiate Accurate Membrane Protein Topogenesis. Cell. 175, 1507–1519 221. Lang, S., Pfeffer, S., Lee, P. H., Cavalié, A., Helms, V., Förster, F., and Zimmermann, R. (2017) An update on Sec 61 channel functions, mechanisms, and related diseases. Front. Physiol. 8, 00887 222. Ruggiano, A., Mora, G., Buxó, L., and Carvalho, P. (2016) Spatial control of lipid droplet proteins by the ERAD ubiquitin ligase Doa10 . EMBO J. 35, 1644–1655 223. Christiano, R., Arlt, H., Kabatnik, S., Mejhert, N., Lai, Z. W., Farese, R. V., and Walther, T. C. (2020) A Systematic Protein Turnover Map for Decoding Protein Degradation. Cell Rep. 33, 108378 224. Roux, K. J., Kim, D. I., and Burke, B. (2013) BioID: A screen for protein- protein interactions. in Current Protocols in Protein Science, pp. 19.23.1- 19.23.14, 2013, 19.23.1-19.23.14 225. Chapman-Smith, A., and Cronan, J. E. (1999) Molecular biology of biotin attachment to proteins. J. Nutr. 129, 477S–484S 226. Watanabe, M., Saeki, Y., Takahashi, H., Ohtake, F., Yoshida, Y., Kasuga, Y., Kondo, T., Yaguchi, H., Suzuki, M., Ishida, H., Tanaka, K., and Hatakeyama, S. (2020) A substrate-trapping strategy to find E3 ubiquitin ligase substrates identifies Parkin and TRIM28 targets. Commun. Biol. 3, 592 173

Chapter 7

227. Mark, K. G., Loveless, T. B., and Toczyski, D. P. (2016) Isolation of ubiquitinated substrates by tandem affinity purification of E3 ligase- polyubiquitin-binding domain fusions (ligase traps). Nat. Protoc. 11, 291– 301 228. Cho, K. F., Branon, T. C., Rajeev, S., Svinkina, T., Udeshi, N. D., Thoudam, T., Kwak, C., Rhee, H. W., Lee, I. K., Carr, S. A., and Ting, A. Y. (2020) Split-TurboID enables contact-dependent proximity labeling in cells. Proc. Natl. Acad. Sci. U. S. A. 117, 12143–12154 229. Cho, K. F., Branon, T. C., Udeshi, N. D., Myers, S. A., Carr, S. A., and Ting, A. Y. (2020) Proximity labeling in mammalian cells with TurboID and split- TurboID. Nat. Protoc. 15, 3971–3999 230. Jo, Y., Lee, P. C. W., Sguigna, P. V., and DeBose-Boyd, R. A. (2011) Sterol-induced degradation of HMG CoA reductase depends on interplay of two Insigs and two ubiquitin ligases, gp78 and Trc8. Proc. Natl. Acad. Sci. U. S. A. 108, 20503–20508 231. Neutzner, A., Neutzner, M., Benischke, A. S., Ryu, S. W., Frank, S., Youle, R. J., and Karbowski, M. (2011) A systematic search for endoplasmic reticulum (ER) membrane-associated RING finger proteins identifies nixin/ZNRF4 as a regulator of calnexin stability and ER homeostasis. J. Biol. Chem. 286, 8633–8643 232. Wu, X., and Rapoport, T. A. (2018) Mechanistic insights into ER-associated protein degradation. Curr. Opin. Cell Biol. 53, 22–28 233. Carvalho, P., Goder, V., and Rapoport, T. A. (2006) Distinct Ubiquitin- Ligase Complexes Define Convergent Pathways for the Degradation of ER Proteins. Cell. 126, 361–373 234. Huyer, G., Piluek, W. F., Fansler, Z., Kreft, S. G., Hochstrasser, M., Brodsky, J. L., and Michaelis, S. (2004) Distinct machinery is required in Saccharomyces cerevisiae for the endoplasmic reticulum-associated degradation of a multispanning membrane protein and a soluble luminal protein. J. Biol. Chem. 279, 38369–38378 235. Habeck, G., Ebner, F. A., Shimada-Kreft, H., and Kreft, S. G. (2015) The yeast ERAD-C ubiquitin ligase Doa10 recognizes an intramembrane degron. J. Cell Biol. 209, 261–273 236. Boban, M., Pantazopoulou, M., Schick, A., Ljungdahl, P. O., and Foisner, R. (2014) A nuclear ubiquitin-proteasome pathway targets the inner nuclear membrane protein Asi2 for degradation. J. Cell Sci. 127, 3603–3613 237. Deng, M., and Hochstrasser, M. (2006) Spatially regulated ubiquitin ligation by an ER/nuclear membrane ligase. Nature. 443, 827–831 238. Ast, T., Aviram, N., Chuartzman, S. G., and Schuldiner, M. (2014) A cytosolic degradation pathway, prERAD, monitors pre-inserted secretory pathway proteins. J. Cell Sci. 127, 3017–3023 239. Stewart, M. D., Ritterhoff, T., Klevit, R. E., and Brzovic, P. S. (2016) E2 enzymes: More than just middle men. Cell Res. 26, 423–440 174

Chapter 7

240. Chen, P., Johnson, P., Sommer, T., Jentsch, S., and Hochstrasser, M. (1993) Multiple ubiquitin-conjugating enzymes participate in the in vivo degradation of the yeast MATα2 repressor. Cell. 74, 357–369 241. Lips, C., Ritterhoff, T., Weber, A., Janowska, M. K., Mustroph, M., Sommer, T., and Klevit, R. E. (2020) Who with whom: functional coordination of E2 enzymes by RING E3 ligases during poly‐ubiquitylation. EMBO J. 39, 104863 242. Tan, J. M. E., Cook, E. C. L., van den Berg, M., Scheij, S., Zelcer, N., and Loregger, A. (2019) Differential use of E2 ubiquitin conjugating enzymes for regulated degradation of the rate-limiting enzymes HMGCR and SQLE in cholesterol biosynthesis. Atherosclerosis. 281, 137–142 243. Chua, N. K., Scott, N. A., and Brown, A. J. (2019) Valosin-containing protein mediates the ERAD of squalene monooxygenase and its cholesterol-responsive degron. Biochem. J. 476, 2545–2560 244. Xie, Y., Kerscher, O., Kroetz, M. B., McConchie, H. F., Sung, P., and Hochstrasser, M. (2007) The yeast Hex3·Slx8 heterodimer is a ubiquitin ligase stimulated by substrate sumoylation. J. Biol. Chem. 282, 34176– 34184 245. Nakatsukasa, K., Huyer, G., Michaelis, S., and Brodsky, J. L. (2008) Dissecting the ER-Associated Degradation of a Misfolded Polytopic Membrane Protein. Cell. 132, 101–112 246. Han, S., Liu, Y., and Chang, A. (2007) Cytoplasmic Hsp70 promotes ubiquitination for endoplasmic reticulum-associated degradation of a misfolded mutant of the yeast plasma membrane ATPase, PMA1. J. Biol. Chem. 282, 26140–26149 247. Neal, S., Mak, R., Bennett, E. J., and Hampton, R. (2017) A Cdc48 “retrochaperone” function is required for the solubility of retrotranslocated, integral membrane Endoplasmic Reticulum-associated Degradation (ERAD-M) substrates. J. Biol. Chem. 292, 3112–3128 248. Neal, S. E., Mak, R., Bennett, E. J., and Hampton, R. (2017) A “retrochaperone” function for Cdc48: The Cdc48 complex is required for retrotranslocated ERAD-M substrate solubility. J. Biol. Chem. 292, 3112– 3128 249. Sato, B. K., and Hampton, R. Y. (2006) Yeast Derlin Dfm I interacts with Cdc48 and functions in ER homeostasis. Yeast. 23, 1053–1064 250. Stolz, A., Schweizer, R. S., Schäfer, A., and Wolf, D. H. (2010) Dfm1 Forms Distinct Complexes with Cdc48 and the ER Ubiquitin Ligases and Is Required for ERAD. Traffic. 11, 1363–1369 251. Tasaki, T., Sriram, S. M., Park, K. S., and Kwon, Y. T. (2012) The N-End rule pathway. Annu. Rev. Biochem. 81, 261–289 252. Lee, K. E., Heo, J. E., Kim, J. M., and Hwang, C. S. (2016) N-terminal acetylation-targeted N-end rule proteolytic system: The Ac/N-end rule pathway. Mol. Cells. 39, 169–178 175

Chapter 7

253. Kanai, S. M., Edwards, A. J., Rurik, J. G., Osei-Owusu, P., and Blumer, K. J. (2017) Proteolytic degradation of regulator of G protein signaling 2 facilitates temporal regulation of Gq/11 signaling and vascular contraction. J. Biol. Chem. 292, 19266–19278 254. Johnson, P. R., Swanson, R., Rakhilina, L., and Hochstrasser, M. (1998) Degradation signal masking by heterodimerization of MATα2 and MATa1 blocks their mutual destruction by the ubiquitin-proteasome pathway. Cell. 94, 217–227 255. Metzger, M. B., Maurer, M. J., Dancy, B. M., and Michaelis, S. (2008) Degradation of a cytosolic protein requires endoplasmic reticulum- associated degradation machinery. J. Biol. Chem. 283, 32302–32316 256. Natarajan, N., Foresti, O., Wendrich, K., Stein, A., and Carvalho, P. (2020) Quality Control of Protein Complex Assembly by a Transmembrane Recognition Factor. Mol. Cell. 77, 108–119 257. Monk, B. C., Tomasiak, T. M., Keniya, M. V., Huschmann, F. U., Tyndall, J. D. A., O’Connell, J. D., Cannon, R. D., McDonald, J. G., Rodriguez, A., Finer-Moore, J. S., and Stroud, R. M. (2014) Architecture of a single membrane spanning cytochrome P450 suggests constraints that orient the catalytic domain relative to a bilayer. Proc. Natl. Acad. Sci. U. S. A. 111, 3865–3870 258. Fernandez-Leiro, R., and Scheres, S. H. W. (2016) Unravelling biological macromolecules with cryo-electron microscopy. Nature. 537, 339–346 259. Wu, X., Siggel, M., Ovchinnikov, S., Mi, W., Svetlov, V., Nudler, E., Liao, M., Hummer, G., and Rapoport, T. A. (2020) Structural basis of ER- associated protein degradation mediated by the Hrd1 ubiquitin ligase complex. Science. 368, 1–13 260. Liu, Y., Xu, S., Huang, Y., Liu, S., Xu, Z., Wei, M., and Liu, J. (2020) MARCH6 Encourages Thyroid Cancer Development by Destabilization of DHX9 and Activation of AKT/mTOR. SSRN Electron. J. 10.2139/ssrn.3696833 261. Liu, R., Chen, Y., Liu, G., Li, C., Song, Y., Cao, Z., Li, W., Hu, J., Lu, C., and Liu, Y. (2020) PI3K/AKT pathway as a key link modulates the multidrug resistance of cancers. Cell Death Dis. 11, 797 262. Xu, F., Na, L., Li, Y., and Chen, L. (2020) Roles of the PI3K/AKT/mTOR signalling pathways in neurodegenerative diseases and tumours. Cell Biosci. 10, 54 263. Saxton, R. A., and Sabatini, D. M. (2017) mTOR Signaling in Growth, Metabolism, and Disease. Cell. 168, 960–976 264. Watanabe, M., Houten, S. M., Mataki, C., Christoffolete, M. A., Kim, B. W., Sato, H., Messaddeq, N., Harney, J. W., Ezaki, O., Kodama, T., Schoonjans, K., Bianco, A. C., and Auwerx, J. (2006) Bile acids induce energy expenditure by promoting intracellular thyroid hormone activation. Nature. 439, 484–489

176

Chapter 7

265. Sartori, M., Ceolotto, G., Dorigatti, F., Mos, L., Santonastaso, M., Bratti, P., Papparella, I., Semplicini, A., and Palatini, P. (2008) RGS2 C1114G polymorphism and body weight gain in hypertensive patients. Metabolism. 57, 421–427 266. Tan, J. M. E., van der Stoel, M. M., van den Berg, M., van Loon, N. M., Moeton, M., Scholl, E., van der Wel, N. N., Kovačević, I., Hordijk, P. L., Loregger, A., Huveneers, S., and Zelcer, N. (2020) The MARCH6-SQLE Axis Controls Endothelial Cholesterol Homeostasis and Angiogenic Sprouting. Cell Rep. 32, 107944 267. Li, X., Sun, X., and Carmeliet, P. (2019) Hallmarks of Endothelial Cell Metabolism in Health and Disease. Cell Metab. 30, 414–433 268. Burslem, G. M., and Crews, C. M. (2020) Proteolysis-Targeting Chimeras as Therapeutics and Tools for Biological Discovery. Cell. 181, 102–114 269. Sun, X., Gao, H., Yang, Y., He, M., Wu, Y., Song, Y., Tong, Y., and Rao, Y. (2019) PROTACs: Great opportunities for academia and industry. Signal Transduct. Target. Ther. 4, 64

177

Chapter 7

178

Chapter 8

Chapter 8 Appendix

179

Chapter 8

180

Chapter 8

Table 8.1 Mass spectrometry data from in-house MARCHF6 knockdown using SILAC

Number Unique Heavy/Light Accession Description Coverage of Peptides Ratio* Peptides

NAD-dependent malic enzyme, mitochondrial OS=Homo sapiens GN=ME2 PE=1 P23368 3.60% 1 2 8.123 SV=1 - [MAOM_HUMAN] NEDD8-conjugating enzyme Ubc12 OS=Homo sapiens GN=UBE2M PE=1 SV=1 - P61081 4.37% 1 1 2.809 [UBC12_HUMAN] Q15019 Septin-2 OS=Homo sapiens GN=SEPT2 PE=1 SV=1 - [SEPT2_HUMAN] 5.54% 2 2 2.089 Nuclear pore complex protein Nup155 OS=Homo sapiens GN=NUP155 PE=1 SV=1 O75694 0.50% 1 1 2.03 - [NU155_HUMAN] Tryptophan--tRNA ligase, cytoplasmic OS=Homo sapiens GN=WARS PE=1 SV=2 - P23381 3.40% 1 1 1.776 [SYWC_HUMAN] T-complex protein 1 subunit epsilon OS=Homo sapiens GN=CCT5 PE=1 SV=1 - P48643 7.02% 2 2 1.752 [TCPE_HUMAN] Probable serine carboxypeptidase CPVL OS=Homo sapiens GN=CPVL PE=1 SV=2 Q9H3G5 1.68% 1 1 1.723 - [CPVL_HUMAN] Cleavage and polyadenylation specificity factor subunit 6 OS=Homo sapiens Q16630 1.63% 1 1 1.712 GN=CPSF6 PE=1 SV=2 - [CPSF6_HUMAN] Multidrug resistance-associated protein 4 OS=Homo sapiens GN=ABCC4 PE=1 O15439 1.81% 1 2 1.702 SV=3 - [MRP4_HUMAN] Methylosome subunit pICln OS=Homo sapiens GN=CLNS1A PE=1 SV=1 - P54105 16.03% 3 3 1.682 [ICLN_HUMAN] P06280 Alpha-galactosidase A OS=Homo sapiens GN=GLA PE=1 SV=1 - [AGAL_HUMAN] 5.59% 2 2 1.638 Structural maintenance of chromosomes protein 3 OS=Homo sapiens GN=SMC3 Q9UQE7 0.90% 1 1 1.597 PE=1 SV=2 - [SMC3_HUMAN] Cold shock domain-containing protein E1 OS=Homo sapiens GN=CSDE1 PE=1 O75534 1.63% 1 1 1.589 SV=2 - [CSDE1_HUMAN] 60S ribosomal protein L3 OS=Homo sapiens GN=RPL3 PE=1 SV=2 - P39023 1.74% 1 1 1.585 [RL3_HUMAN] P07737 Profilin-1 OS=Homo sapiens GN=PFN1 PE=1 SV=2 - [PROF1_HUMAN] 22.86% 2 2 1.526 181

Chapter 8

Leucine-rich repeat flightless-interacting protein 1 OS=Homo sapiens GN=LRRFIP1 Q32MZ4 2.10% 1 1 1.506 PE=1 SV=2 - [LRRF1_HUMAN] DNA replication complex GINS protein PSF3 OS=Homo sapiens GN=GINS3 PE=1 Q9BRX5 3.70% 1 1 1.456 SV=1 - [PSF3_HUMAN] Guanine nucleotide-binding protein subunit beta-2-like 1 OS=Homo sapiens P63244 2.84% 1 1 1.443 GN=GNB2L1 PE=1 SV=3 - [GBLP_HUMAN] SWI/SNF complex subunit SMARCC1 OS=Homo sapiens GN=SMARCC1 PE=1 Q92922 0.72% 1 1 1.406 SV=3 - [SMRC1_HUMAN] Small nuclear ribonucleoprotein Sm D3 OS=Homo sapiens GN=SNRPD3 PE=1 P62318 10.32% 2 2 1.306 SV=1 - [SMD3_HUMAN] Proteasome subunit alpha type-5 OS=Homo sapiens GN=PSMA5 PE=1 SV=3 - P28066 7.88% 1 1 1.282 [PSA5_HUMAN] 60S ribosomal protein L10 OS=Homo sapiens GN=RPL10 PE=1 SV=4 - P27635 2.80% 1 1 1.267 [RL10_HUMAN] Serine/arginine-rich splicing factor 6 OS=Homo sapiens GN=SRSF6 PE=1 SV=2 - Q13247 9.01% 3 3 1.262 [SRSF6_HUMAN] E3 UFM1-protein ligase 1 OS=Homo sapiens GN=UFL1 PE=1 SV=2 - O94874 2.90% 2 2 1.259 [UFL1_HUMAN] O00541 Pescadillo homolog OS=Homo sapiens GN=PES1 PE=1 SV=1 - [PESC_HUMAN] 1.70% 1 1 1.238 Q9ULV4 Coronin-1C OS=Homo sapiens GN=CORO1C PE=1 SV=1 - [COR1C_HUMAN] 4.64% 1 2 1.218 O60749 Sorting nexin-2 OS=Homo sapiens GN=SNX2 PE=1 SV=2 - [SNX2_HUMAN] 2.70% 1 1 1.209 Actin-related protein 2 OS=Homo sapiens GN=ACTR2 PE=1 SV=1 - P61160 2.54% 1 1 1.205 [ARP2_HUMAN] 39S ribosomal protein L22, mitochondrial OS=Homo sapiens GN=MRPL22 PE=1 Q9NWU5 3.40% 1 1 1.192 SV=1 - [RM22_HUMAN] Splicing factor 3A subunit 1 OS=Homo sapiens GN=SF3A1 PE=1 SV=1 - Q15459 13.11% 8 9 1.184 [SF3A1_HUMAN] Cytochrome c oxidase subunit 5A, mitochondrial OS=Homo sapiens GN=COX5A P20674 20.67% 2 3 1.182 PE=1 SV=2 - [COX5A_HUMAN] Q15717 ELAV-like protein 1 OS=Homo sapiens GN=ELAVL1 PE=1 SV=2 - [ELAV1_HUMAN] 22.39% 4 4 1.169 Proliferating cell nuclear antigen OS=Homo sapiens GN=PCNA PE=1 SV=1 - P12004 12.64% 2 3 1.163 [PCNA_HUMAN] P20700 Lamin-B1 OS=Homo sapiens GN=LMNB1 PE=1 SV=2 - [LMNB1_HUMAN] 21.67% 9 13 1.145

182

Chapter 8

DnaJ homolog subfamily C member 7 OS=Homo sapiens GN=DNAJC7 PE=1 SV=2 Q99615 2.63% 1 1 1.141 - [DNJC7_HUMAN] Uncharacterized protein C7orf50 OS=Homo sapiens GN=C7orf50 PE=1 SV=1 - Q9BRJ6 4.64% 1 1 1.137 [CG050_HUMAN] Heterogeneous nuclear ribonucleoprotein A3 OS=Homo sapiens GN=HNRNPA3 P51991 14.02% 2 6 1.117 PE=1 SV=2 - [ROA3_HUMAN] Coatomer subunit alpha OS=Homo sapiens GN=COPA PE=1 SV=2 - P53621 4.33% 5 5 1.116 [COPA_HUMAN] 26S proteasome non-ATPase regulatory subunit 2 OS=Homo sapiens GN=PSMD2 Q13200 1.65% 1 1 1.113 PE=1 SV=3 - [PSMD2_HUMAN] Methionine adenosyltransferase 2 subunit beta OS=Homo sapiens GN=MAT2B Q9NZL9 3.59% 1 1 1.111 PE=1 SV=1 - [MAT2B_HUMAN] T-complex protein 1 subunit zeta OS=Homo sapiens GN=CCT6A PE=1 SV=3 - P40227 7.34% 3 3 1.105 [TCPZ_HUMAN] Leukotriene A-4 hydrolase OS=Homo sapiens GN=LTA4H PE=1 SV=2 - P09960 2.95% 1 1 1.096 [LKHA4_HUMAN] Cullin-associated NEDD8-dissociated protein 1 OS=Homo sapiens GN=CAND1 Q86VP6 1.06% 1 1 1.091 PE=1 SV=2 - [CAND1_HUMAN] Heterogeneous nuclear ribonucleoprotein H3 OS=Homo sapiens GN=HNRNPH3 P31942 1.73% 1 1 1.089 PE=1 SV=2 - [HNRH3_HUMAN] Heat shock protein 105 kDa OS=Homo sapiens GN=HSPH1 PE=1 SV=1 - Q92598 9.67% 6 7 1.089 [HS105_HUMAN] Histone H2B type 1-O OS=Homo sapiens GN=HIST1H2BO PE=1 SV=3 - P23527 42.86% 7 7 1.087 [H2B1O_HUMAN] Q07812 Apoptosis regulator BAX OS=Homo sapiens GN=BAX PE=1 SV=1 - [BAX_HUMAN] 6.77% 1 1 1.085 Thioredoxin domain-containing protein 5 OS=Homo sapiens GN=TXNDC5 PE=1 Q8NBS9 15.05% 4 4 1.058 SV=2 - [TXND5_HUMAN] Heterogeneous nuclear ribonucleoprotein K OS=Homo sapiens GN=HNRNPK PE=1 P61978 20.73% 9 10 1.057 SV=1 - [HNRPK_HUMAN] P35612 Beta-adducin OS=Homo sapiens GN=ADD2 PE=1 SV=3 - [ADDB_HUMAN] 3.17% 1 2 1.056 AH receptor-interacting protein OS=Homo sapiens GN=AIP PE=1 SV=2 - O00170 7.88% 2 2 1.052 [AIP_HUMAN] 60S ribosomal protein L19 OS=Homo sapiens GN=RPL19 PE=1 SV=1 - P84098 3.57% 1 1 1.052 [RL19_HUMAN]

183

Chapter 8

F-actin-capping protein subunit alpha-2 OS=Homo sapiens GN=CAPZA2 PE=1 P47755 5.59% 2 2 1.05 SV=3 - [CAZA2_HUMAN] P27708 CAD protein OS=Homo sapiens GN=CAD PE=1 SV=3 - [PYR1_HUMAN] 2.38% 4 4 1.047 40S ribosomal protein S3a OS=Homo sapiens GN=RPS3A PE=1 SV=2 - P61247 37.12% 12 12 1.044 [RS3A_HUMAN] RNA-binding protein EWS OS=Homo sapiens GN=EWSR1 PE=1 SV=1 - Q01844 2.59% 2 2 1.043 [EWS_HUMAN] Q9Y265 RuvB-like 1 OS=Homo sapiens GN=RUVBL1 PE=1 SV=1 - [RUVB1_HUMAN] 6.80% 2 2 1.042 Paraspeckle component 1 OS=Homo sapiens GN=PSPC1 PE=1 SV=1 - Q8WXF1 3.06% 1 2 1.041 [PSPC1_HUMAN] Aconitate hydratase, mitochondrial OS=Homo sapiens GN=ACO2 PE=1 SV=2 - Q99798 6.03% 4 5 1.04 [ACON_HUMAN] Heterogeneous nuclear ribonucleoprotein F OS=Homo sapiens GN=HNRNPF PE=1 P52597 13.98% 2 5 1.038 SV=3 - [HNRPF_HUMAN] ATP-dependent RNA helicase A OS=Homo sapiens GN=DHX9 PE=1 SV=4 - Q08211 6.61% 12 12 1.034 [DHX9_HUMAN] Protein SDA1 homolog OS=Homo sapiens GN=SDAD1 PE=1 SV=3 - Q9NVU7 1.60% 1 1 1.029 [SDA1_HUMAN] Heterogeneous nuclear ribonucleoprotein A/B OS=Homo sapiens GN=HNRNPAB Q99729 21.08% 8 9 1.025 PE=1 SV=2 - [ROAA_HUMAN] L-lactate dehydrogenase B chain OS=Homo sapiens GN=LDHB PE=1 SV=2 - P07195 21.26% 9 10 1.02 [LDHB_HUMAN] Regulator of chromosome condensation OS=Homo sapiens GN=RCC1 PE=1 SV=1 P18754 8.79% 2 2 1.019 - [RCC1_HUMAN] Plasminogen activator inhibitor 1 RNA-binding protein OS=Homo sapiens Q8NC51 4.90% 3 3 1.014 GN=SERBP1 PE=1 SV=2 - [PAIRB_HUMAN] DNA replication licensing factor MCM2 OS=Homo sapiens GN=MCM2 PE=1 SV=4 - P49736 1.11% 1 1 1.014 [MCM2_HUMAN] Heat shock 70 kDa protein 4L OS=Homo sapiens GN=HSPA4L PE=1 SV=3 - O95757 2.38% 2 2 1.014 [HS74L_HUMAN] Elongation factor 1-gamma OS=Homo sapiens GN=EEF1G PE=1 SV=3 - P26641 7.09% 4 4 1.011 [EF1G_HUMAN] Rab GDP dissociation inhibitor beta OS=Homo sapiens GN=GDI2 PE=1 SV=2 - P50395 6.74% 2 3 1.006 [GDIB_HUMAN]

184

Chapter 8

Pre-mRNA-processing factor 19 OS=Homo sapiens GN=PRPF19 PE=1 SV=1 - Q9UMS4 7.34% 3 3 1.004 [PRP19_HUMAN] Proteasome subunit alpha type-6 OS=Homo sapiens GN=PSMA6 PE=1 SV=1 - P60900 7.32% 1 1 1 [PSA6_HUMAN] Structural maintenance of chromosomes protein 1A OS=Homo sapiens GN=SMC1A Q14683 7.30% 7 7 0.997 PE=1 SV=2 - [SMC1A_HUMAN] U5 small nuclear ribonucleoprotein 200 kDa helicase OS=Homo sapiens O75643 2.43% 3 3 0.991 GN=SNRNP200 PE=1 SV=2 - [U520_HUMAN] P18206 Vinculin OS=Homo sapiens GN=VCL PE=1 SV=4 - [VINC_HUMAN] 1.41% 1 1 0.989 Methionine--tRNA ligase, cytoplasmic OS=Homo sapiens GN=MARS PE=1 SV=2 - P56192 4.44% 3 3 0.988 [SYMC_HUMAN] Eukaryotic translation initiation factor 3 subunit C OS=Homo sapiens GN=EIF3C Q99613 4.60% 3 5 0.984 PE=1 SV=1 - [EIF3C_HUMAN] Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - P60174 41.96% 7 7 0.984 [TPIS_HUMAN] Bcl-2-associated transcription factor 1 OS=Homo sapiens GN=BCLAF1 PE=1 SV=2 Q9NYF8 3.26% 2 2 0.984 - [BCLF1_HUMAN] DnaJ homolog subfamily C member 8 OS=Homo sapiens GN=DNAJC8 PE=1 SV=2 O75937 7.51% 1 1 0.983 - [DNJC8_HUMAN] Heterogeneous nuclear ribonucleoprotein H OS=Homo sapiens GN=HNRNPH1 P31943 21.60% 4 7 0.982 PE=1 SV=4 - [HNRH1_HUMAN] Ran GTPase-activating protein 1 OS=Homo sapiens GN=RANGAP1 PE=1 SV=1 - P46060 8.18% 3 3 0.977 [RAGP1_HUMAN] Probable ATP-dependent RNA helicase DDX5 OS=Homo sapiens GN=DDX5 PE=1 P17844 3.75% 4 4 0.972 SV=1 - [DDX5_HUMAN] Probable tRNA pseudouridine synthase 1 OS=Homo sapiens GN=TRUB1 PE=1 Q8WWH5 3.15% 1 1 0.968 SV=1 - [TRUB1_HUMAN] 60S ribosomal protein L9 OS=Homo sapiens GN=RPL9 PE=1 SV=1 - P32969 21.88% 3 3 0.967 [RL9_HUMAN] 60S ribosomal protein L13 OS=Homo sapiens GN=RPL13 PE=1 SV=4 - P26373 28.44% 5 6 0.961 [RL13_HUMAN] GTP-binding nuclear protein Ran OS=Homo sapiens GN=RAN PE=1 SV=3 - P62826 22.69% 6 6 0.96 [RAN_HUMAN] P12270 Nucleoprotein TPR OS=Homo sapiens GN=TPR PE=1 SV=3 - [TPR_HUMAN] 6.81% 9 11 0.958

185

Chapter 8

T-complex protein 1 subunit beta OS=Homo sapiens GN=CCT2 PE=1 SV=4 - P78371 20.75% 7 8 0.957 [TCPB_HUMAN] Malate dehydrogenase, cytoplasmic OS=Homo sapiens GN=MDH1 PE=1 SV=4 - P40925 3.59% 1 1 0.955 [MDHC_HUMAN] 40S ribosomal protein S6 OS=Homo sapiens GN=RPS6 PE=1 SV=1 - P62753 20.48% 5 6 0.955 [RS6_HUMAN] Interleukin enhancer-binding factor 3 OS=Homo sapiens GN=ILF3 PE=1 SV=3 - Q12906 5.82% 5 5 0.953 [ILF3_HUMAN] Eukaryotic initiation factor 4A-II OS=Homo sapiens GN=EIF4A2 PE=1 SV=2 - Q14240 15.97% 1 4 0.949 [IF4A2_HUMAN] DNA replication licensing factor MCM3 OS=Homo sapiens GN=MCM3 PE=1 SV=3 - P25205 13.49% 8 8 0.948 [MCM3_HUMAN] D-3-phosphoglycerate dehydrogenase OS=Homo sapiens GN=PHGDH PE=1 SV=4 O43175 11.63% 5 6 0.948 - [SERA_HUMAN] C-terminal-binding protein 1 OS=Homo sapiens GN=CTBP1 PE=1 SV=2 - Q13363 7.50% 2 2 0.947 [CTBP1_HUMAN] Eukaryotic initiation factor 4A-III OS=Homo sapiens GN=EIF4A3 PE=1 SV=4 - P38919 15.82% 4 5 0.942 [IF4A3_HUMAN] Acidic leucine-rich nuclear phosphoprotein 32 family member E OS=Homo sapiens Q9BTT0 2.61% 2 2 0.94 GN=ANP32E PE=1 SV=1 - [AN32E_HUMAN] Serine/arginine-rich splicing factor 3 OS=Homo sapiens GN=SRSF3 PE=1 SV=1 - P84103 35.37% 4 4 0.937 [SRSF3_HUMAN] Transcription intermediary factor 1-beta OS=Homo sapiens GN=TRIM28 PE=1 SV=5 Q13263 22.04% 18 19 0.932 - [TIF1B_HUMAN] Serine/arginine repetitive matrix protein 2 OS=Homo sapiens GN=SRRM2 PE=1 Q9UQ35 3.02% 3 4 0.93 SV=2 - [SRRM2_HUMAN] Adenylosuccinate synthetase isozyme 2 OS=Homo sapiens GN=ADSS PE=1 SV=3 P30520 11.40% 3 3 0.929 - [PURA2_HUMAN] Protein deglycase DJ-1 OS=Homo sapiens GN=PARK7 PE=1 SV=2 - Q99497 3.70% 1 1 0.927 [PARK7_HUMAN] DNA replication licensing factor MCM4 OS=Homo sapiens GN=MCM4 PE=1 SV=5 - P33991 5.56% 3 3 0.924 [MCM4_HUMAN] Eukaryotic initiation factor 4A-I OS=Homo sapiens GN=EIF4A1 PE=1 SV=1 - P60842 16.01% 1 4 0.922 [IF4A1_HUMAN] P49327 Fatty acid synthase OS=Homo sapiens GN=FASN PE=1 SV=3 - [FAS_HUMAN] 12.19% 19 21 0.919 186

Chapter 8

Eukaryotic translation initiation factor 2 subunit 1 OS=Homo sapiens GN=EIF2S1 P05198 3.81% 1 1 0.916 PE=1 SV=3 - [IF2A_HUMAN] ATP-dependent RNA helicase DDX42 OS=Homo sapiens GN=DDX42 PE=1 SV=1 - Q86XP3 1.39% 1 1 0.915 [DDX42_HUMAN] 60S ribosomal protein L12 OS=Homo sapiens GN=RPL12 PE=1 SV=1 - P30050 16.36% 3 3 0.913 [RL12_HUMAN] Q9NSI2 Protein FAM207A OS=Homo sapiens GN=FAM207A PE=1 SV=2 - [F207A_HUMAN] 5.65% 1 1 0.913 Serine/threonine-protein phosphatase 2A catalytic subunit beta isoform OS=Homo P62714 12.94% 2 2 0.911 sapiens GN=PPP2CB PE=1 SV=1 - [PP2AB_HUMAN] Delta-1-pyrroline-5-carboxylate synthase OS=Homo sapiens GN=ALDH18A1 PE=1 P54886 13.08% 12 12 0.91 SV=2 - [P5CS_HUMAN] Thioredoxin-dependent peroxide reductase, mitochondrial OS=Homo sapiens P30048 19.92% 4 4 0.91 GN=PRDX3 PE=1 SV=3 - [PRDX3_HUMAN] 14-3-3 protein epsilon OS=Homo sapiens GN=YWHAE PE=1 SV=1 - P62258 14.51% 2 2 0.908 [1433E_HUMAN] Bifunctional methylenetetrahydrofolate dehydrogenase/cyclohydrolase, mitochondrial P13995 8.29% 3 3 0.904 OS=Homo sapiens GN=MTHFD2 PE=1 SV=2 - [MTDC_HUMAN] T-complex protein 1 subunit alpha OS=Homo sapiens GN=TCP1 PE=1 SV=1 - P17987 5.58% 2 2 0.9 [TCPA_HUMAN] Glucose-6-phosphate isomerase OS=Homo sapiens GN=GPI PE=1 SV=4 - P06744 12.19% 4 4 0.898 [G6PI_HUMAN] Proliferation-associated protein 2G4 OS=Homo sapiens GN=PA2G4 PE=1 SV=3 - Q9UQ80 9.14% 4 4 0.898 [PA2G4_HUMAN] Q9UHV9 Prefoldin subunit 2 OS=Homo sapiens GN=PFDN2 PE=1 SV=1 - [PFD2_HUMAN] 14.29% 1 1 0.897 Phosphoglycerate kinase 1 OS=Homo sapiens GN=PGK1 PE=1 SV=3 - P00558 30.46% 11 11 0.896 [PGK1_HUMAN] Nuclear pore complex protein Nup205 OS=Homo sapiens GN=NUP205 PE=1 SV=3 Q92621 1.04% 1 2 0.894 - [NU205_HUMAN] Superkiller viralicidic activity 2-like 2 OS=Homo sapiens GN=SKIV2L2 PE=1 SV=3 - P42285 4.32% 3 3 0.892 [SK2L2_HUMAN] Splicing factor, proline- and glutamine-rich OS=Homo sapiens GN=SFPQ PE=1 P23246 26.17% 18 19 0.89 SV=2 - [SFPQ_HUMAN] Heat shock 70 kDa protein 4 OS=Homo sapiens GN=HSPA4 PE=1 SV=4 - P34932 9.05% 5 7 0.89 [HSP74_HUMAN]

187

Chapter 8

Rho GDP-dissociation inhibitor 1 OS=Homo sapiens GN=ARHGDIA PE=1 SV=3 - P52565 8.33% 1 1 0.889 [GDIR1_HUMAN] C-1-tetrahydrofolate synthase, cytoplasmic OS=Homo sapiens GN=MTHFD1 PE=1 P11586 19.89% 11 13 0.889 SV=3 - [C1TC_HUMAN] L-lactate dehydrogenase A chain OS=Homo sapiens GN=LDHA PE=1 SV=2 - P00338 14.16% 6 7 0.888 [LDHA_HUMAN] O43707 Alpha-actinin-4 OS=Homo sapiens GN=ACTN4 PE=1 SV=2 - [ACTN4_HUMAN] 7.35% 5 5 0.888 ATP synthase subunit e, mitochondrial OS=Homo sapiens GN=ATP5I PE=1 SV=2 - P56385 18.84% 2 2 0.888 [ATP5I_HUMAN] Elongation factor 1-delta OS=Homo sapiens GN=EEF1D PE=1 SV=5 - P29692 31.32% 6 8 0.882 [EF1D_HUMAN] 60S ribosomal protein L7 OS=Homo sapiens GN=RPL7 PE=1 SV=1 - P18124 15.73% 3 3 0.881 [RL7_HUMAN] 60S ribosomal protein L4 OS=Homo sapiens GN=RPL4 PE=1 SV=5 - P36578 3.98% 2 2 0.879 [RL4_HUMAN] DNA-dependent protein kinase catalytic subunit OS=Homo sapiens GN=PRKDC P78527 2.23% 6 8 0.877 PE=1 SV=3 - [PRKDC_HUMAN] Q9Y230 RuvB-like 2 OS=Homo sapiens GN=RUVBL2 PE=1 SV=3 - [RUVB2_HUMAN] 13.61% 3 3 0.877 60S ribosomal protein L5 OS=Homo sapiens GN=RPL5 PE=1 SV=3 - P46777 8.75% 1 1 0.877 [RL5_HUMAN] Sodium/potassium-transporting ATPase subunit alpha-3 OS=Homo sapiens P13637 7.40% 1 8 0.875 GN=ATP1A3 PE=1 SV=3 - [AT1A3_HUMAN] Small ubiquitin-related modifier 1 OS=Homo sapiens GN=SUMO1 PE=1 SV=1 - P63165 6.93% 1 1 0.875 [SUMO1_HUMAN] Nucleolar RNA helicase 2 OS=Homo sapiens GN=DDX21 PE=1 SV=5 - Q9NR30 6.64% 5 5 0.874 [DDX21_HUMAN] Heterogeneous nuclear ribonucleoproteins A2/B1 OS=Homo sapiens P22626 58.64% 22 23 0.874 GN=HNRNPA2B1 PE=1 SV=2 - [ROA2_HUMAN] P02545 Prelamin-A/C OS=Homo sapiens GN=LMNA PE=1 SV=1 - [LMNA_HUMAN] 13.25% 7 7 0.872 Heterogeneous nuclear ribonucleoprotein R OS=Homo sapiens GN=HNRNPR PE=1 O43390 11.37% 8 8 0.872 SV=1 - [HNRPR_HUMAN] P08670 Vimentin OS=Homo sapiens GN=VIM PE=1 SV=4 - [VIME_HUMAN] 57.30% 21 22 0.871 Serrate RNA effector molecule homolog OS=Homo sapiens GN=SRRT PE=1 SV=1 - Q9BXP5 4.34% 3 3 0.87 [SRRT_HUMAN] 188

Chapter 8

Trifunctional purine biosynthetic protein adenosine-3 OS=Homo sapiens GN=GART P22102 9.41% 6 6 0.87 PE=1 SV=1 - [PUR2_HUMAN] Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 P04406 32.54% 12 13 0.869 SV=3 - [G3P_HUMAN] Chromatin target of PRMT1 protein OS=Homo sapiens GN=CHTOP PE=1 SV=2 - Q9Y3Y2 9.27% 2 2 0.867 [CHTOP_HUMAN] Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-2 OS=Homo sapiens P62879 8.82% 2 2 0.867 GN=GNB2 PE=1 SV=3 - [GBB2_HUMAN] Q9UMX0 Ubiquilin-1 OS=Homo sapiens GN=UBQLN1 PE=1 SV=2 - [UBQL1_HUMAN] 2.89% 1 1 0.866 Fragile X mental retardation syndrome-related protein 1 OS=Homo sapiens P51114 1.29% 1 1 0.865 GN=FXR1 PE=1 SV=3 - [FXR1_HUMAN] Asparagine--tRNA ligase, cytoplasmic OS=Homo sapiens GN=NARS PE=1 SV=1 - O43776 2.37% 1 1 0.865 [SYNC_HUMAN] Mitochondrial Rho GTPase 2 OS=Homo sapiens GN=RHOT2 PE=1 SV=2 - Q8IXI1 1.78% 1 1 0.864 [MIRO2_HUMAN] P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 52.80% 23 25 0.863 Serine/arginine-rich splicing factor 2 OS=Homo sapiens GN=SRSF2 PE=1 SV=4 - Q01130 3.62% 1 1 0.863 [SRSF2_HUMAN] Q9Y490 Talin-1 OS=Homo sapiens GN=TLN1 PE=1 SV=3 - [TLN1_HUMAN] 1.73% 3 3 0.861 Nuclear autoantigenic sperm protein OS=Homo sapiens GN=NASP PE=1 SV=2 - P49321 5.20% 3 4 0.859 [NASP_HUMAN] Heat shock protein HSP 90-alpha OS=Homo sapiens GN=HSP90AA1 PE=1 SV=5 - P07900 32.38% 16 28 0.857 [HS90A_HUMAN] Inositol 1,4,5-trisphosphate receptor type 3 OS=Homo sapiens GN=ITPR3 PE=1 Q14573 0.45% 1 1 0.857 SV=2 - [ITPR3_HUMAN] P19338 Nucleolin OS=Homo sapiens GN=NCL PE=1 SV=3 - [NUCL_HUMAN] 39.15% 32 33 0.856 RNA-binding protein 4 OS=Homo sapiens GN=RBM4 PE=1 SV=1 - Q9BWF3 14.84% 3 3 0.856 [RBM4_HUMAN] Heterogeneous nuclear ribonucleoproteins C1/C2 OS=Homo sapiens GN=HNRNPC P07910 22.22% 7 7 0.854 PE=1 SV=4 - [HNRPC_HUMAN] E3 ubiquitin-protein ligase CHIP OS=Homo sapiens GN=STUB1 PE=1 SV=2 - Q9UNE7 11.88% 3 3 0.854 [CHIP_HUMAN] T-complex protein 1 subunit eta OS=Homo sapiens GN=CCT7 PE=1 SV=2 - Q99832 11.05% 5 5 0.852 [TCPH_HUMAN] 189

Chapter 8

28S ribosomal protein S2, mitochondrial OS=Homo sapiens GN=MRPS2 PE=1 Q9Y399 2.70% 1 1 0.852 SV=1 - [RT02_HUMAN] Spectrin beta chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTBN1 PE=1 SV=2 Q01082 8.63% 11 12 0.847 - [SPTB2_HUMAN] 6-phosphogluconate dehydrogenase, decarboxylating OS=Homo sapiens GN=PGD P52209 5.38% 3 3 0.847 PE=1 SV=3 - [6PGD_HUMAN] Deoxyuridine 5'-triphosphate nucleotidohydrolase, mitochondrial OS=Homo sapiens P33316 5.56% 1 1 0.847 GN=DUT PE=1 SV=4 - [DUT_HUMAN] Eukaryotic translation initiation factor 5B OS=Homo sapiens GN=EIF5B PE=1 SV=4 O60841 1.72% 1 1 0.846 - [IF2P_HUMAN] P53396 ATP-citrate synthase OS=Homo sapiens GN=ACLY PE=1 SV=3 - [ACLY_HUMAN] 6.63% 5 5 0.846 P35579 Myosin-9 OS=Homo sapiens GN=MYH9 PE=1 SV=4 - [MYH9_HUMAN] 4.54% 5 5 0.845 Spliceosome RNA helicase DDX39B OS=Homo sapiens GN=DDX39B PE=1 SV=1 - Q13838 18.46% 10 11 0.845 [DX39B_HUMAN] AT-rich interactive domain-containing protein 1A OS=Homo sapiens GN=ARID1A O14497 0.92% 1 1 0.844 PE=1 SV=3 - [ARI1A_HUMAN] Probable ATP-dependent RNA helicase DDX17 OS=Homo sapiens GN=DDX17 Q92841 14.95% 8 8 0.843 PE=1 SV=2 - [DDX17_HUMAN] Q00610 Clathrin heavy chain 1 OS=Homo sapiens GN=CLTC PE=1 SV=5 - [CLH1_HUMAN] 10.57% 13 14 0.842 Transitional endoplasmic reticulum ATPase OS=Homo sapiens GN=VCP PE=1 P55072 14.39% 10 10 0.842 SV=4 - [TERA_HUMAN] Far upstream element-binding protein 2 OS=Homo sapiens GN=KHSRP PE=1 SV=4 Q92945 28.69% 13 18 0.842 - [FUBP2_HUMAN] P13639 Elongation factor 2 OS=Homo sapiens GN=EEF2 PE=1 SV=4 - [EF2_HUMAN] 16.90% 13 15 0.842 Zinc finger CCCH domain-containing protein 11A OS=Homo sapiens GN=ZC3H11A O75152 1.85% 1 2 0.841 PE=1 SV=3 - [ZC11A_HUMAN] Far upstream element-binding protein 1 OS=Homo sapiens GN=FUBP1 PE=1 SV=3 Q96AE4 14.29% 4 10 0.84 - [FUBP1_HUMAN] SAP domain-containing ribonucleoprotein OS=Homo sapiens GN=SARNP PE=1 P82979 29.05% 6 6 0.84 SV=3 - [SARNP_HUMAN] Eukaryotic translation initiation factor 3 subunit A OS=Homo sapiens GN=EIF3A Q14152 3.62% 4 5 0.836 PE=1 SV=1 - [EIF3A_HUMAN] Tubulin beta-2B chain OS=Homo sapiens GN=TUBB2B PE=1 SV=1 - Q9BVA1 21.12% 1 7 0.835 [TBB2B_HUMAN] 190

Chapter 8

RNA-binding protein 14 OS=Homo sapiens GN=RBM14 PE=1 SV=2 - Q96PK6 3.14% 2 2 0.835 [RBM14_HUMAN] Tropomyosin alpha-4 chain OS=Homo sapiens GN=TPM4 PE=1 SV=3 - P67936 28.63% 5 5 0.834 [TPM4_HUMAN] Splicing factor 3B subunit 3 OS=Homo sapiens GN=SF3B3 PE=1 SV=4 - Q15393 3.45% 5 5 0.834 [SF3B3_HUMAN] Mitochondrial import receptor subunit TOM70 OS=Homo sapiens GN=TOMM70A O94826 3.13% 2 2 0.833 PE=1 SV=1 - [TOM70_HUMAN] Polyadenylate-binding protein 1 OS=Homo sapiens GN=PABPC1 PE=1 SV=2 - P11940 7.08% 2 4 0.831 [PABP1_HUMAN] Splicing factor 3B subunit 1 OS=Homo sapiens GN=SF3B1 PE=1 SV=3 - O75533 1.61% 1 1 0.831 [SF3B1_HUMAN] P32119 Peroxiredoxin-2 OS=Homo sapiens GN=PRDX2 PE=1 SV=5 - [PRDX2_HUMAN] 14.65% 2 3 0.83 Poly [ADP-ribose] polymerase 1 OS=Homo sapiens GN=PARP1 PE=1 SV=4 - P09874 10.16% 12 12 0.83 [PARP1_HUMAN] Proteasome subunit alpha type-1 OS=Homo sapiens GN=PSMA1 PE=1 SV=1 - P25786 13.31% 2 3 0.829 [PSA1_HUMAN] 40S ribosomal protein SA OS=Homo sapiens GN=RPSA PE=1 SV=4 - P08865 14.58% 4 4 0.829 [RSSA_HUMAN] Fructose-bisphosphate aldolase A OS=Homo sapiens GN=ALDOA PE=1 SV=2 - P04075 52.20% 18 19 0.827 [ALDOA_HUMAN] Eukaryotic translation initiation factor 3 subunit I OS=Homo sapiens GN=EIF3I PE=1 Q13347 10.46% 3 3 0.827 SV=1 - [EIF3I_HUMAN] HLA class I histocompatibility antigen, A-3 alpha chain OS=Homo sapiens GN=HLA- P04439 22.74% 3 6 0.825 A PE=1 SV=2 - [1A03_HUMAN] P07437 Tubulin beta chain OS=Homo sapiens GN=TUBB PE=1 SV=2 - [TBB5_HUMAN] 33.33% 4 12 0.824 5'-3' exoribonuclease 2 OS=Homo sapiens GN=XRN2 PE=1 SV=1 - Q9H0D6 5.16% 4 4 0.824 [XRN2_HUMAN] Oxysterol-binding protein-related protein 8 OS=Homo sapiens GN=OSBPL8 PE=1 Q9BZF1 2.47% 1 1 0.824 SV=3 - [OSBL8_HUMAN] Serine/threonine-protein phosphatase PP1-gamma catalytic subunit OS=Homo P36873 8.98% 3 3 0.822 sapiens GN=PPP1CC PE=1 SV=1 - [PP1G_HUMAN] Peptidyl-prolyl cis-trans isomerase FKBP4 OS=Homo sapiens GN=FKBP4 PE=1 Q02790 18.52% 4 5 0.82 SV=3 - [FKBP4_HUMAN]

191

Chapter 8

Mitochondrial inner membrane protein OXA1L OS=Homo sapiens GN=OXA1L PE=1 Q15070 1.84% 1 1 0.82 SV=3 - [OXA1L_HUMAN] Nuclear inhibitor of protein phosphatase 1 OS=Homo sapiens GN=PPP1R8 PE=1 Q12972 11.40% 2 2 0.82 SV=2 - [PP1R8_HUMAN] Q969Z0 Protein TBRG4 OS=Homo sapiens GN=TBRG4 PE=1 SV=1 - [TBRG4_HUMAN] 1.43% 1 1 0.819 60S acidic ribosomal protein P1 OS=Homo sapiens GN=RPLP1 PE=1 SV=1 - P05386 14.04% 1 1 0.819 [RLA1_HUMAN] Elongation factor 1-alpha 1 OS=Homo sapiens GN=EEF1A1 PE=1 SV=1 - P68104 37.01% 16 17 0.818 [EF1A1_HUMAN] Polyadenylate-binding protein 4 OS=Homo sapiens GN=PABPC4 PE=1 SV=1 - Q13310 8.07% 3 5 0.818 [PABP4_HUMAN] Endoplasmic reticulum resident protein 29 OS=Homo sapiens GN=ERP29 PE=1 P30040 4.21% 2 2 0.817 SV=4 - [ERP29_HUMAN] Serine/arginine-rich splicing factor 7 OS=Homo sapiens GN=SRSF7 PE=1 SV=1 - Q16629 10.92% 2 2 0.815 [SRSF7_HUMAN] BH3-interacting domain death agonist OS=Homo sapiens GN=BID PE=1 SV=1 - P55957 10.26% 1 1 0.813 [BID_HUMAN] Spectrin alpha chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTAN1 PE=1 Q13813 5.70% 11 11 0.812 SV=3 - [SPTN1_HUMAN] 60S ribosomal protein L6 OS=Homo sapiens GN=RPL6 PE=1 SV=3 - Q02878 13.54% 3 3 0.812 [RL6_HUMAN] Ras-related protein Rab-7a OS=Homo sapiens GN=RAB7A PE=1 SV=1 - P51149 12.08% 2 2 0.812 [RAB7A_HUMAN] Q06830 Peroxiredoxin-1 OS=Homo sapiens GN=PRDX1 PE=1 SV=1 - [PRDX1_HUMAN] 33.17% 4 7 0.811 BAG family molecular chaperone regulator 2 OS=Homo sapiens GN=BAG2 PE=1 O95816 5.21% 1 1 0.811 SV=1 - [BAG2_HUMAN] Thiosulfate sulfurtransferase OS=Homo sapiens GN=TST PE=1 SV=4 - Q16762 13.13% 2 3 0.811 [THTR_HUMAN] Eukaryotic translation initiation factor 6 OS=Homo sapiens GN=EIF6 PE=1 SV=1 - P56537 4.08% 1 1 0.81 [IF6_HUMAN] 40S ribosomal protein S3 OS=Homo sapiens GN=RPS3 PE=1 SV=2 - P23396 17.70% 3 3 0.808 [RS3_HUMAN] Proteasomal ubiquitin receptor ADRM1 OS=Homo sapiens GN=ADRM1 PE=1 SV=2 Q16186 3.93% 1 1 0.808 - [ADRM1_HUMAN]

192

Chapter 8

rRNA 2'-O-methyltransferase fibrillarin OS=Homo sapiens GN=FBL PE=1 SV=2 - P22087 8.10% 3 3 0.807 [FBRL_HUMAN] Far upstream element-binding protein 3 OS=Homo sapiens GN=FUBP3 PE=1 SV=2 Q96I24 12.76% 4 8 0.804 - [FUBP3_HUMAN] P37837 Transaldolase OS=Homo sapiens GN=TALDO1 PE=1 SV=2 - [TALDO_HUMAN] 14.24% 6 6 0.803 Vesicle-trafficking protein SEC22b OS=Homo sapiens GN=SEC22B PE=1 SV=4 - O75396 10.23% 2 2 0.803 [SC22B_HUMAN] Ubiquitin-like modifier-activating enzyme 1 OS=Homo sapiens GN=UBA1 PE=1 P22314 21.83% 16 16 0.802 SV=3 - [UBA1_HUMAN] Adenosylhomocysteinase OS=Homo sapiens GN=AHCY PE=1 SV=4 - P23526 3.47% 1 1 0.802 [SAHH_HUMAN] Non-POU domain-containing octamer-binding protein OS=Homo sapiens Q15233 18.68% 9 10 0.801 GN=NONO PE=1 SV=4 - [NONO_HUMAN] T-complex protein 1 subunit delta OS=Homo sapiens GN=CCT4 PE=1 SV=4 - P50991 8.72% 3 4 0.8 [TCPD_HUMAN] 60S ribosomal protein L27a OS=Homo sapiens GN=RPL27A PE=1 SV=2 - P46776 8.78% 2 2 0.799 [RL27A_HUMAN] ER membrane protein complex subunit 10 OS=Homo sapiens GN=EMC10 PE=1 Q5UCC4 6.49% 1 1 0.799 SV=1 - [EMC10_HUMAN] tRNA pseudouridine synthase A, mitochondrial OS=Homo sapiens GN=PUS1 PE=1 Q9Y606 2.81% 1 1 0.798 SV=3 - [TRUA_HUMAN] Bifunctional glutamate/proline--tRNA ligase OS=Homo sapiens GN=EPRS PE=1 P07814 5.95% 9 11 0.796 SV=5 - [SYEP_HUMAN] P39748 Flap endonuclease 1 OS=Homo sapiens GN=FEN1 PE=1 SV=1 - [FEN1_HUMAN] 4.74% 2 2 0.795 THO complex subunit 4 OS=Homo sapiens GN=ALYREF PE=1 SV=3 - Q86V81 28.02% 7 7 0.794 [THOC4_HUMAN] DNA replication licensing factor MCM7 OS=Homo sapiens GN=MCM7 PE=1 SV=4 - P33993 15.16% 8 8 0.794 [MCM7_HUMAN] Heat shock protein HSP 90-beta OS=Homo sapiens GN=HSP90AB1 PE=1 SV=4 - P08238 39.23% 18 34 0.792 [HS90B_HUMAN] Heat shock 70 kDa protein 1A OS=Homo sapiens GN=HSPA1A PE=1 SV=1 - P0DMV8 47.11% 21 30 0.789 [HS71A_HUMAN] T-complex protein 1 subunit gamma OS=Homo sapiens GN=CCT3 PE=1 SV=4 - P49368 10.64% 4 5 0.787 [TCPG_HUMAN]

193

Chapter 8

40S ribosomal protein S8 OS=Homo sapiens GN=RPS8 PE=1 SV=2 - P62241 27.40% 4 4 0.787 [RS8_HUMAN] Chromodomain-helicase-DNA-binding protein 4 OS=Homo sapiens GN=CHD4 PE=1 Q14839 1.57% 2 2 0.787 SV=2 - [CHD4_HUMAN] P16402 Histone H1.3 OS=Homo sapiens GN=HIST1H1D PE=1 SV=2 - [H13_HUMAN] 26.70% 4 5 0.784 Alcohol dehydrogenase class-3 OS=Homo sapiens GN=ADH5 PE=1 SV=4 - P11766 3.48% 1 1 0.784 [ADHX_HUMAN] Cleavage and polyadenylation specificity factor subunit 5 OS=Homo sapiens O43809 21.15% 2 2 0.783 GN=NUDT21 PE=1 SV=1 - [CPSF5_HUMAN] P35221 Catenin alpha-1 OS=Homo sapiens GN=CTNNA1 PE=1 SV=1 - [CTNA1_HUMAN] 3.20% 2 2 0.782 P06733 Alpha-enolase OS=Homo sapiens GN=ENO1 PE=1 SV=2 - [ENOA_HUMAN] 60.37% 32 33 0.781 4-trimethylaminobutyraldehyde dehydrogenase OS=Homo sapiens GN=ALDH9A1 P49189 4.66% 2 2 0.78 PE=1 SV=3 - [AL9A1_HUMAN] Transcription elongation regulator 1 OS=Homo sapiens GN=TCERG1 PE=1 SV=2 - O14776 2.00% 2 3 0.778 [TCRG1_HUMAN] O00410 Importin-5 OS=Homo sapiens GN=IPO5 PE=1 SV=4 - [IPO5_HUMAN] 1.19% 1 1 0.778 Heterogeneous nuclear ribonucleoprotein A0 OS=Homo sapiens GN=HNRNPA0 Q13151 10.82% 3 3 0.776 PE=1 SV=1 - [ROA0_HUMAN] Succinyl-CoA ligase [ADP-forming] subunit beta, mitochondrial OS=Homo sapiens Q9P2R7 7.13% 3 3 0.775 GN=SUCLA2 PE=1 SV=3 - [SUCB1_HUMAN] Phosphoglycerate mutase 1 OS=Homo sapiens GN=PGAM1 PE=1 SV=2 - P18669 11.42% 3 3 0.768 [PGAM1_HUMAN] Threonine--tRNA ligase, cytoplasmic OS=Homo sapiens GN=TARS PE=1 SV=3 - P26639 8.58% 4 5 0.768 [SYTC_HUMAN] P35613 Basigin OS=Homo sapiens GN=BSG PE=1 SV=2 - [BASI_HUMAN] 2.34% 1 1 0.767 X-ray repair cross-complementing protein 6 OS=Homo sapiens GN=XRCC6 PE=1 P12956 10.34% 5 6 0.767 SV=2 - [XRCC6_HUMAN] Cell division cycle 5-like protein OS=Homo sapiens GN=CDC5L PE=1 SV=2 - Q99459 8.48% 3 3 0.766 [CDC5L_HUMAN] 60S ribosomal protein L8 OS=Homo sapiens GN=RPL8 PE=1 SV=2 - P62917 25.29% 9 9 0.765 [RL8_HUMAN] Cytochrome b-c1 complex subunit 2, mitochondrial OS=Homo sapiens P22695 21.19% 8 8 0.765 GN=UQCRC2 PE=1 SV=3 - [QCR2_HUMAN]

194

Chapter 8

Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 - P68363 29.49% 11 11 0.764 [TBA1B_HUMAN] Ras-related protein Rab-11A OS=Homo sapiens GN=RAB11A PE=1 SV=3 - P62491 12.50% 2 2 0.763 [RB11A_HUMAN] Sorting and assembly machinery component 50 homolog OS=Homo sapiens Q9Y512 1.49% 1 1 0.763 GN=SAMM50 PE=1 SV=3 - [SAM50_HUMAN] Q15637 Splicing factor 1 OS=Homo sapiens GN=SF1 PE=1 SV=4 - [SF01_HUMAN] 1.72% 1 1 0.762 Phosphoribosylformylglycinamidine synthase OS=Homo sapiens GN=PFAS PE=1 O15067 5.38% 5 5 0.761 SV=4 - [PUR4_HUMAN] Heat shock cognate 71 kDa protein OS=Homo sapiens GN=HSPA8 PE=1 SV=1 - P11142 37.00% 18 23 0.759 [HSP7C_HUMAN] Ubiquitin thioesterase OTUB1 OS=Homo sapiens GN=OTUB1 PE=1 SV=2 - Q96FW1 7.01% 1 1 0.759 [OTUB1_HUMAN] Eukaryotic translation initiation factor 4B OS=Homo sapiens GN=EIF4B PE=1 SV=2 P23588 1.31% 1 1 0.759 - [IF4B_HUMAN] P08758 Annexin A5 OS=Homo sapiens GN=ANXA5 PE=1 SV=2 - [ANXA5_HUMAN] 17.81% 4 4 0.758 60S ribosomal protein L28 OS=Homo sapiens GN=RPL28 PE=1 SV=3 - P46779 8.76% 1 1 0.758 [RL28_HUMAN] PDZ and LIM domain protein 1 OS=Homo sapiens GN=PDLIM1 PE=1 SV=4 - O00151 22.49% 4 4 0.754 [PDLI1_HUMAN] ATPase family AAA domain-containing protein 3B OS=Homo sapiens GN=ATAD3B Q5T9A4 18.06% 1 11 0.753 PE=1 SV=1 - [ATD3B_HUMAN] P12277 Creatine kinase B-type OS=Homo sapiens GN=CKB PE=1 SV=1 - [KCRB_HUMAN] 36.75% 14 15 0.753 60S ribosomal protein L11 OS=Homo sapiens GN=RPL11 PE=1 SV=2 - P62913 9.55% 2 2 0.753 [RL11_HUMAN] O75955 Flotillin-1 OS=Homo sapiens GN=FLOT1 PE=1 SV=3 - [FLOT1_HUMAN] 12.41% 3 5 0.751 Keratin, type II cytoskeletal 8 OS=Homo sapiens GN=KRT8 PE=1 SV=7 - P05787 33.95% 11 13 0.75 [K2C8_HUMAN] Small nuclear ribonucleoprotein Sm D1 OS=Homo sapiens GN=SNRPD1 PE=1 P62314 31.93% 3 3 0.75 SV=1 - [SMD1_HUMAN] 40S ribosomal protein S7 OS=Homo sapiens GN=RPS7 PE=1 SV=1 - P62081 28.35% 3 3 0.747 [RS7_HUMAN] Staphylococcal nuclease domain-containing protein 1 OS=Homo sapiens GN=SND1 Q7KZF4 18.90% 14 14 0.747 PE=1 SV=1 - [SND1_HUMAN] 195

Chapter 8

Nuclear migration protein nudC OS=Homo sapiens GN=NUDC PE=1 SV=1 - Q9Y266 12.99% 4 4 0.747 [NUDC_HUMAN] Golgin subfamily A member 2 OS=Homo sapiens GN=GOLGA2 PE=1 SV=3 - Q08379 1.00% 1 1 0.747 [GOGA2_HUMAN] Nucleosome assembly protein 1-like 1 OS=Homo sapiens GN=NAP1L1 PE=1 SV=1 P55209 5.63% 2 2 0.746 - [NP1L1_HUMAN] Serine hydroxymethyltransferase, mitochondrial OS=Homo sapiens GN=SHMT2 P34897 25.40% 12 14 0.744 PE=1 SV=3 - [GLYM_HUMAN] 4F2 cell-surface antigen heavy chain OS=Homo sapiens GN=SLC3A2 PE=1 SV=3 - P08195 9.21% 6 6 0.742 [4F2_HUMAN] Heterogeneous nuclear ribonucleoprotein A1 OS=Homo sapiens GN=HNRNPA1 P09651 40.32% 16 19 0.742 PE=1 SV=5 - [ROA1_HUMAN] Enoyl-CoA delta isomerase 1, mitochondrial OS=Homo sapiens GN=ECI1 PE=1 P42126 12.58% 2 3 0.741 SV=1 - [ECI1_HUMAN] P23528 Cofilin-1 OS=Homo sapiens GN=CFL1 PE=1 SV=3 - [COF1_HUMAN] 25.30% 1 2 0.741 P15311 Ezrin OS=Homo sapiens GN=EZR PE=1 SV=4 - [EZRI_HUMAN] 7.85% 5 6 0.74 P35637 RNA-binding protein FUS OS=Homo sapiens GN=FUS PE=1 SV=1 - [FUS_HUMAN] 4.37% 1 1 0.74 P43243 Matrin-3 OS=Homo sapiens GN=MATR3 PE=1 SV=2 - [MATR3_HUMAN] 13.22% 11 11 0.74 Paired amphipathic helix protein Sin3a OS=Homo sapiens GN=SIN3A PE=1 SV=2 - Q96ST3 0.86% 1 1 0.74 [SIN3A_HUMAN] Cob(I)yrinic acid a,c-diamide adenosyltransferase, mitochondrial OS=Homo sapiens Q96EY8 4.00% 1 1 0.74 GN=MMAB PE=1 SV=1 - [MMAB_HUMAN] Elongation factor 1-beta OS=Homo sapiens GN=EEF1B2 PE=1 SV=3 - P24534 14.22% 2 4 0.738 [EF1B_HUMAN] Q03252 Lamin-B2 OS=Homo sapiens GN=LMNB2 PE=1 SV=3 - [LMNB2_HUMAN] 15.50% 6 9 0.737 Acyl-coenzyme A thioesterase 9, mitochondrial OS=Homo sapiens GN=ACOT9 Q9Y305 2.28% 1 1 0.737 PE=1 SV=2 - [ACOT9_HUMAN] Q8NFH5 Nucleoporin NUP53 OS=Homo sapiens GN=NUP35 PE=1 SV=1 - [NUP53_HUMAN] 32.52% 7 7 0.736 Q86Y82 Syntaxin-12 OS=Homo sapiens GN=STX12 PE=1 SV=1 - [STX12_HUMAN] 3.99% 1 1 0.735 Multifunctional protein ADE2 OS=Homo sapiens GN=PAICS PE=1 SV=3 - P22234 9.88% 3 3 0.734 [PUR6_HUMAN] 40S ribosomal protein S11 OS=Homo sapiens GN=RPS11 PE=1 SV=3 - P62280 8.23% 1 1 0.733 [RS11_HUMAN] 196

Chapter 8

Early endosome antigen 1 OS=Homo sapiens GN=EEA1 PE=1 SV=2 - Q15075 1.98% 1 3 0.731 [EEA1_HUMAN] RNA-binding protein 39 OS=Homo sapiens GN=RBM39 PE=1 SV=2 - Q14498 3.21% 1 1 0.731 [RBM39_HUMAN] O60637 Tetraspanin-3 OS=Homo sapiens GN=TSPAN3 PE=2 SV=1 - [TSN3_HUMAN] 2.77% 1 1 0.731 Creatine kinase U-type, mitochondrial OS=Homo sapiens GN=CKMT1A PE=1 SV=1 P12532 8.39% 3 5 0.729 - [KCRU_HUMAN] V-type proton ATPase catalytic subunit A OS=Homo sapiens GN=ATP6V1A PE=1 P38606 4.86% 2 2 0.729 SV=2 - [VATA_HUMAN] RNA-binding motif protein, X chromosome OS=Homo sapiens GN=RBMX PE=1 P38159 35.04% 11 12 0.729 SV=3 - [RBMX_HUMAN] P26640 Valine--tRNA ligase OS=Homo sapiens GN=VARS PE=1 SV=4 - [SYVC_HUMAN] 1.98% 2 2 0.729 Aminoacyl tRNA synthase complex-interacting multifunctional protein 1 OS=Homo Q12904 6.73% 1 1 0.729 sapiens GN=AIMP1 PE=1 SV=2 - [AIMP1_HUMAN] Hydroxysteroid dehydrogenase-like protein 2 OS=Homo sapiens GN=HSDL2 PE=1 Q6YN16 14.11% 4 4 0.728 SV=1 - [HSDL2_HUMAN] Nuclear pore complex protein Nup93 OS=Homo sapiens GN=NUP93 PE=1 SV=2 - Q8N1F7 3.79% 3 3 0.725 [NUP93_HUMAN] Acidic leucine-rich nuclear phosphoprotein 32 family member A OS=Homo sapiens P39687 8.84% 3 3 0.725 GN=ANP32A PE=1 SV=1 - [AN32A_HUMAN] ADP/ATP translocase 2 OS=Homo sapiens GN=SLC25A5 PE=1 SV=7 - P05141 16.78% 3 8 0.725 [ADT2_HUMAN] WD repeat-containing protein 18 OS=Homo sapiens GN=WDR18 PE=1 SV=2 - Q9BV38 9.49% 4 5 0.725 [WDR18_HUMAN] Elongation factor Ts, mitochondrial OS=Homo sapiens GN=TSFM PE=1 SV=2 - P43897 8.31% 1 1 0.725 [EFTS_HUMAN] Heterogeneous nuclear ribonucleoprotein U OS=Homo sapiens GN=HNRNPU PE=1 Q00839 26.06% 19 19 0.724 SV=6 - [HNRPU_HUMAN] Importin subunit beta-1 OS=Homo sapiens GN=KPNB1 PE=1 SV=2 - Q14974 11.76% 7 8 0.723 [IMB1_HUMAN] 39S ribosomal protein L40, mitochondrial OS=Homo sapiens GN=MRPL40 PE=1 Q9NQ50 10.19% 1 2 0.722 SV=1 - [RM40_HUMAN] Protein-L-isoaspartate(D-aspartate) O-methyltransferase OS=Homo sapiens P22061 15.42% 2 2 0.722 GN=PCMT1 PE=1 SV=4 - [PIMT_HUMAN]

197

Chapter 8

Q969V3 Nicalin OS=Homo sapiens GN=NCLN PE=1 SV=2 - [NCLN_HUMAN] 1.42% 1 1 0.721 Histone-binding protein RBBP4 OS=Homo sapiens GN=RBBP4 PE=1 SV=3 - Q09028 2.12% 2 2 0.721 [RBBP4_HUMAN] Single-stranded DNA-binding protein, mitochondrial OS=Homo sapiens GN=SSBP1 Q04837 51.35% 8 8 0.721 PE=1 SV=1 - [SSBP_HUMAN] Presequence protease, mitochondrial OS=Homo sapiens GN=PITRM1 PE=1 SV=3 - Q5JRX3 7.23% 6 6 0.721 [PREP_HUMAN] P14618 Pyruvate kinase PKM OS=Homo sapiens GN=PKM PE=1 SV=4 - [KPYM_HUMAN] 40.87% 18 18 0.72 Lysocardiolipin acyltransferase 1 OS=Homo sapiens GN=LCLAT1 PE=1 SV=1 - Q6UWP7 2.90% 1 1 0.719 [LCLT1_HUMAN] P16949 Stathmin OS=Homo sapiens GN=STMN1 PE=1 SV=3 - [STMN1_HUMAN] 8.72% 1 1 0.719 Transmembrane emp24 domain-containing protein 9 OS=Homo sapiens Q9BVK6 8.09% 2 2 0.719 GN=TMED9 PE=1 SV=2 - [TMED9_HUMAN] Exocyst complex component 3-like protein 4 OS=Homo sapiens GN=EXOC3L4 Q17RC7 2.08% 1 2 0.718 PE=1 SV=2 - [EX3L4_HUMAN] TAR DNA-binding protein 43 OS=Homo sapiens GN=TARDBP PE=1 SV=1 - Q13148 11.11% 5 6 0.718 [TADBP_HUMAN] Sodium/potassium-transporting ATPase subunit alpha-2 OS=Homo sapiens P50993 7.25% 1 6 0.717 GN=ATP1A2 PE=1 SV=1 - [AT1A2_HUMAN] Tyrosine--tRNA ligase, mitochondrial OS=Homo sapiens GN=YARS2 PE=1 SV=2 - Q9Y2Z4 5.24% 3 3 0.717 [SYYM_HUMAN] P06748 Nucleophosmin OS=Homo sapiens GN=NPM1 PE=1 SV=2 - [NPM_HUMAN] 33.33% 7 8 0.715 Cysteine desulfurase, mitochondrial OS=Homo sapiens GN=NFS1 PE=1 SV=3 - Q9Y697 6.13% 2 2 0.715 [NFS1_HUMAN] Isocitrate dehydrogenase [NAD] subunit beta, mitochondrial OS=Homo sapiens O43837 3.12% 1 1 0.715 GN=IDH3B PE=1 SV=2 - [IDH3B_HUMAN] 40S ribosomal protein S4, X isoform OS=Homo sapiens GN=RPS4X PE=1 SV=2 - P62701 17.49% 7 7 0.714 [RS4X_HUMAN] Pre-mRNA-processing factor 6 OS=Homo sapiens GN=PRPF6 PE=1 SV=1 - O94906 9.78% 8 8 0.713 [PRP6_HUMAN] NSFL1 cofactor p47 OS=Homo sapiens GN=NSFL1C PE=1 SV=2 - Q9UNZ2 2.70% 1 1 0.712 [NSF1C_HUMAN] SUMO-activating enzyme subunit 1 OS=Homo sapiens GN=SAE1 PE=1 SV=1 - Q9UBE0 12.14% 3 3 0.711 [SAE1_HUMAN] 198

Chapter 8

Nuclear pore complex protein Nup107 OS=Homo sapiens GN=NUP107 PE=1 SV=1 P57740 4.00% 3 3 0.71 - [NU107_HUMAN] Myb-binding protein 1A OS=Homo sapiens GN=MYBBP1A PE=1 SV=2 - Q9BQG0 6.48% 6 7 0.709 [MBB1A_HUMAN] Q13162 Peroxiredoxin-4 OS=Homo sapiens GN=PRDX4 PE=1 SV=1 - [PRDX4_HUMAN] 19.19% 4 6 0.708 60S ribosomal protein L15 OS=Homo sapiens GN=RPL15 PE=1 SV=2 - P61313 4.41% 1 1 0.708 [RL15_HUMAN] Serine/arginine-rich splicing factor 10 OS=Homo sapiens GN=SRSF10 PE=1 SV=1 - O75494 4.58% 1 1 0.708 [SRS10_HUMAN] Mitotic spindle assembly checkpoint protein MAD1 OS=Homo sapiens GN=MAD1L1 Q9Y6D9 4.74% 2 2 0.708 PE=1 SV=2 - [MD1L1_HUMAN] O75369 Filamin-B OS=Homo sapiens GN=FLNB PE=1 SV=2 - [FLNB_HUMAN] 3.38% 5 6 0.706 Actin-related protein 3 OS=Homo sapiens GN=ACTR3 PE=1 SV=3 - P61158 2.63% 1 1 0.706 [ARP3_HUMAN] P0C0S5 Histone H2A.Z OS=Homo sapiens GN=H2AFZ PE=1 SV=2 - [H2AZ_HUMAN] 7.03% 1 1 0.705 O95197 Reticulon-3 OS=Homo sapiens GN=RTN3 PE=1 SV=2 - [RTN3_HUMAN] 1.45% 1 1 0.705 Aldehyde dehydrogenase X, mitochondrial OS=Homo sapiens GN=ALDH1B1 PE=1 P30837 17.02% 5 6 0.703 SV=3 - [AL1B1_HUMAN] P55196 Afadin OS=Homo sapiens GN=MLLT4 PE=1 SV=3 - [AFAD_HUMAN] 0.71% 1 1 0.702 NADPH:adrenodoxin oxidoreductase, mitochondrial OS=Homo sapiens GN=FDXR P22570 14.26% 5 5 0.702 PE=1 SV=3 - [ADRO_HUMAN] Dolichyl-diphosphooligosaccharide--protein glycosyltransferase 48 kDa subunit P39656 8.99% 4 4 0.7 OS=Homo sapiens GN=DDOST PE=1 SV=4 - [OST48_HUMAN] Keratin, type I cytoskeletal 18 OS=Homo sapiens GN=KRT18 PE=1 SV=2 - P05783 32.09% 12 14 0.699 [K1C18_HUMAN] 39S ribosomal protein L11, mitochondrial OS=Homo sapiens GN=MRPL11 PE=1 Q9Y3B7 39.06% 3 4 0.699 SV=1 - [RM11_HUMAN] Ribosomal RNA processing protein 1 homolog A OS=Homo sapiens GN=RRP1 P56182 4.56% 2 2 0.698 PE=1 SV=1 - [RRP1_HUMAN] Mitochondrial import inner membrane translocase subunit TIM44 OS=Homo sapiens O43615 14.16% 5 5 0.697 GN=TIMM44 PE=1 SV=2 - [TIM44_HUMAN] Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial P31040 14.91% 7 8 0.695 OS=Homo sapiens GN=SDHA PE=1 SV=2 - [SDHA_HUMAN]

199

Chapter 8

P55060 Exportin-2 OS=Homo sapiens GN=CSE1L PE=1 SV=3 - [XPO2_HUMAN] 2.57% 1 2 0.694 60S ribosomal protein L7a OS=Homo sapiens GN=RPL7A PE=1 SV=2 - P62424 25.94% 9 9 0.693 [RL7A_HUMAN] 39S ribosomal protein L38, mitochondrial OS=Homo sapiens GN=MRPL38 PE=1 Q96DV4 2.63% 1 1 0.692 SV=2 - [RM38_HUMAN] DNA replication licensing factor MCM6 OS=Homo sapiens GN=MCM6 PE=1 SV=1 - Q14566 10.84% 6 7 0.691 [MCM6_HUMAN] NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 10 OS=Homo O96000 9.30% 1 1 0.689 sapiens GN=NDUFB10 PE=1 SV=3 - [NDUBA_HUMAN] Inorganic pyrophosphatase OS=Homo sapiens GN=PPA1 PE=1 SV=2 - Q15181 8.30% 2 2 0.688 [IPYR_HUMAN] 2',3'-cyclic-nucleotide 3'-phosphodiesterase OS=Homo sapiens GN=CNP PE=1 P09543 3.09% 1 1 0.687 SV=2 - [CN37_HUMAN] S-formylglutathione hydrolase OS=Homo sapiens GN=ESD PE=1 SV=2 - P10768 7.80% 1 1 0.687 [ESTD_HUMAN] O15400 Syntaxin-7 OS=Homo sapiens GN=STX7 PE=1 SV=4 - [STX7_HUMAN] 42.53% 7 7 0.686 Trifunctional enzyme subunit alpha, mitochondrial OS=Homo sapiens GN=HADHA P40939 9.04% 5 6 0.684 PE=1 SV=2 - [ECHA_HUMAN] Q86UP2 Kinectin OS=Homo sapiens GN=KTN1 PE=1 SV=1 - [KTN1_HUMAN] 4.50% 5 5 0.684 Secretory carrier-associated membrane protein 2 OS=Homo sapiens GN=SCAMP2 O15127 10.64% 4 4 0.683 PE=1 SV=2 - [SCAM2_HUMAN] Peroxisomal multifunctional enzyme type 2 OS=Homo sapiens GN=HSD17B4 PE=1 P51659 25.41% 15 15 0.682 SV=3 - [DHB4_HUMAN] T-complex protein 1 subunit theta OS=Homo sapiens GN=CCT8 PE=1 SV=4 - P50990 17.15% 7 7 0.682 [TCPQ_HUMAN] Golgin subfamily B member 1 OS=Homo sapiens GN=GOLGB1 PE=1 SV=2 - Q14789 2.92% 5 6 0.681 [GOGB1_HUMAN] Tubulin beta-4B chain OS=Homo sapiens GN=TUBB4B PE=1 SV=1 - P68371 31.91% 3 10 0.681 [TBB4B_HUMAN] Pre-mRNA-processing-splicing factor 8 OS=Homo sapiens GN=PRPF8 PE=1 SV=2 Q6P2Q9 4.24% 7 8 0.681 - [PRP8_HUMAN] Pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial P08559 5.38% 2 2 0.679 OS=Homo sapiens GN=PDHA1 PE=1 SV=3 - [ODPA_HUMAN]

200

Chapter 8

Voltage-dependent anion-selective channel protein 1 OS=Homo sapiens P21796 48.41% 12 12 0.677 GN=VDAC1 PE=1 SV=2 - [VDAC1_HUMAN] Mimitin, mitochondrial OS=Homo sapiens GN=NDUFAF2 PE=1 SV=1 - Q8N183 27.22% 2 2 0.677 [MIMIT_HUMAN] Fumarate hydratase, mitochondrial OS=Homo sapiens GN=FH PE=1 SV=3 - P07954 14.71% 4 6 0.676 [FUMH_HUMAN] Diablo homolog, mitochondrial OS=Homo sapiens GN=DIABLO PE=1 SV=1 - Q9NR28 20.92% 4 4 0.671 [DBLOH_HUMAN] 60 kDa heat shock protein, mitochondrial OS=Homo sapiens GN=HSPD1 PE=1 P10809 67.71% 51 52 0.67 SV=2 - [CH60_HUMAN] CAAX prenyl protease 1 homolog OS=Homo sapiens GN=ZMPSTE24 PE=1 SV=2 - O75844 6.32% 2 3 0.67 [FACE1_HUMAN] Isovaleryl-CoA dehydrogenase, mitochondrial OS=Homo sapiens GN=IVD PE=1 P26440 3.78% 2 2 0.669 SV=1 - [IVD_HUMAN] Aldehyde dehydrogenase, mitochondrial OS=Homo sapiens GN=ALDH2 PE=1 P05091 11.22% 3 4 0.669 SV=2 - [ALDH2_HUMAN] Heterogeneous nuclear ribonucleoprotein L OS=Homo sapiens GN=HNRNPL PE=1 P14866 12.05% 6 7 0.668 SV=2 - [HNRPL_HUMAN] P21333 Filamin-A OS=Homo sapiens GN=FLNA PE=1 SV=4 - [FLNA_HUMAN] 10.24% 17 19 0.667 Heat shock protein 75 kDa, mitochondrial OS=Homo sapiens GN=TRAP1 PE=1 Q12931 24.01% 19 20 0.667 SV=3 - [TRAP1_HUMAN] Guanine nucleotide-binding protein G(i) subunit alpha-2 OS=Homo sapiens P04899 8.73% 1 3 0.666 GN=GNAI2 PE=1 SV=3 - [GNAI2_HUMAN] Elongation factor Tu, mitochondrial OS=Homo sapiens GN=TUFM PE=1 SV=2 - P49411 47.12% 27 30 0.666 [EFTU_HUMAN] P0CG48 Polyubiquitin-C OS=Homo sapiens GN=UBC PE=1 SV=3 - [UBC_HUMAN] 47.30% 4 4 0.665 Mitochondrial import inner membrane translocase subunit TIM50 OS=Homo sapiens Q3ZCQ8 22.38% 10 10 0.665 GN=TIMM50 PE=1 SV=2 - [TIM50_HUMAN] Q01105 Protein SET OS=Homo sapiens GN=SET PE=1 SV=3 - [SET_HUMAN] 3.10% 1 1 0.665 Tubulin gamma-1 chain OS=Homo sapiens GN=TUBG1 PE=1 SV=2 - P23258 2.00% 1 1 0.664 [TBG1_HUMAN] Q99623 Prohibitin-2 OS=Homo sapiens GN=PHB2 PE=1 SV=2 - [PHB2_HUMAN] 68.23% 23 24 0.663 Eukaryotic translation initiation factor 4 gamma 1 OS=Homo sapiens GN=EIF4G1 Q04637 2.25% 2 2 0.663 PE=1 SV=4 - [IF4G1_HUMAN] 201

Chapter 8

P35232 Prohibitin OS=Homo sapiens GN=PHB PE=1 SV=1 - [PHB_HUMAN] 72.79% 22 22 0.662 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 OS=Homo sapiens P16615 12.09% 8 8 0.661 GN=ATP2A2 PE=1 SV=1 - [AT2A2_HUMAN] ER membrane protein complex subunit 4 OS=Homo sapiens GN=EMC4 PE=1 SV=2 Q5J8M3 8.20% 1 1 0.66 - [EMC4_HUMAN] Cytoskeleton-associated protein 4 OS=Homo sapiens GN=CKAP4 PE=1 SV=2 - Q07065 33.55% 15 15 0.659 [CKAP4_HUMAN] 28S ribosomal protein S18a, mitochondrial OS=Homo sapiens GN=MRPS18A PE=1 Q9NVS2 9.69% 1 1 0.659 SV=1 - [RT18A_HUMAN] Transducin beta-like protein 2 OS=Homo sapiens GN=TBL2 PE=1 SV=1 - Q9Y4P3 4.92% 3 3 0.658 [TBL2_HUMAN] Hydroxyacyl-coenzyme A dehydrogenase, mitochondrial OS=Homo sapiens Q16836 12.74% 6 6 0.657 GN=HADH PE=1 SV=3 - [HCDH_HUMAN] Ras-related protein Rap-1b-like protein OS=Homo sapiens PE=2 SV=1 - A6NIZ1 7.61% 1 1 0.657 [RP1BL_HUMAN] 39S ribosomal protein L15, mitochondrial OS=Homo sapiens GN=MRPL15 PE=1 Q9P015 7.77% 2 3 0.655 SV=1 - [RM15_HUMAN] Translocon-associated protein subunit delta OS=Homo sapiens GN=SSR4 PE=1 P51571 6.36% 1 1 0.655 SV=1 - [SSRD_HUMAN] O75695 Protein XRP2 OS=Homo sapiens GN=RP2 PE=1 SV=4 - [XRP2_HUMAN] 2.00% 1 1 0.655 Importin subunit alpha-1 OS=Homo sapiens GN=KPNA2 PE=1 SV=1 - P52292 9.83% 5 5 0.654 [IMA1_HUMAN] Malate dehydrogenase, mitochondrial OS=Homo sapiens GN=MDH2 PE=1 SV=3 - P40926 53.85% 28 28 0.652 [MDHM_HUMAN] Lamina-associated polypeptide 2, isoforms beta/gamma OS=Homo sapiens P42167 36.12% 13 14 0.652 GN=TMPO PE=1 SV=2 - [LAP2B_HUMAN] Arginase-2, mitochondrial OS=Homo sapiens GN=ARG2 PE=1 SV=1 - P78540 11.02% 2 2 0.652 [ARGI2_HUMAN] Aspartate aminotransferase, mitochondrial OS=Homo sapiens GN=GOT2 PE=1 P00505 33.49% 13 13 0.65 SV=3 - [AATM_HUMAN] Peptidyl-prolyl cis-trans isomerase F, mitochondrial OS=Homo sapiens GN=PPIF P30405 29.95% 5 6 0.65 PE=1 SV=1 - [PPIF_HUMAN] Keratin, type I cytoskeletal 19 OS=Homo sapiens GN=KRT19 PE=1 SV=4 - P08727 18.25% 2 8 0.649 [K1C19_HUMAN]

202

Chapter 8

BTB/POZ domain-containing protein KCTD14 OS=Homo sapiens GN=KCTD14 Q9BQ13 3.92% 1 1 0.648 PE=1 SV=2 - [KCD14_HUMAN] Alanine--tRNA ligase, mitochondrial OS=Homo sapiens GN=AARS2 PE=1 SV=1 - Q5JTZ9 11.37% 7 7 0.647 [SYAM_HUMAN] Q9P258 Protein RCC2 OS=Homo sapiens GN=RCC2 PE=1 SV=2 - [RCC2_HUMAN] 4.79% 2 2 0.647 Delta(3,5)-Delta(2,4)-dienoyl-CoA isomerase, mitochondrial OS=Homo sapiens Q13011 20.73% 7 7 0.646 GN=ECH1 PE=1 SV=2 - [ECH1_HUMAN] SUN domain-containing protein 2 OS=Homo sapiens GN=SUN2 PE=1 SV=3 - Q9UH99 4.74% 2 2 0.646 [SUN2_HUMAN] Protein SCO1 homolog, mitochondrial OS=Homo sapiens GN=SCO1 PE=1 SV=1 - O75880 5.32% 1 1 0.643 [SCO1_HUMAN] Alanine--tRNA ligase, cytoplasmic OS=Homo sapiens GN=AARS PE=1 SV=2 - P49588 4.03% 2 3 0.643 [SYAC_HUMAN] X-ray repair cross-complementing protein 5 OS=Homo sapiens GN=XRCC5 PE=1 P13010 11.61% 5 6 0.642 SV=3 - [XRCC5_HUMAN] KH domain-containing, RNA-binding, signal transduction-associated protein 1 Q07666 13.77% 5 5 0.642 OS=Homo sapiens GN=KHDRBS1 PE=1 SV=1 - [KHDR1_HUMAN] Pyruvate dehydrogenase E1 component subunit beta, mitochondrial OS=Homo P11177 17.27% 4 5 0.641 sapiens GN=PDHB PE=1 SV=3 - [ODPB_HUMAN] Voltage-dependent anion-selective channel protein 2 OS=Homo sapiens P45880 31.63% 7 7 0.641 GN=VDAC2 PE=1 SV=2 - [VDAC2_HUMAN] Succinyl-CoA ligase [ADP/GDP-forming] subunit alpha, mitochondrial OS=Homo P53597 4.34% 1 1 0.64 sapiens GN=SUCLG1 PE=1 SV=4 - [SUCA_HUMAN] Protein disulfide-isomerase A6 OS=Homo sapiens GN=PDIA6 PE=1 SV=1 - Q15084 39.32% 14 15 0.639 [PDIA6_HUMAN] Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit 1 OS=Homo P04843 26.36% 12 14 0.639 sapiens GN=RPN1 PE=1 SV=1 - [RPN1_HUMAN] Q9NYL9 Tropomodulin-3 OS=Homo sapiens GN=TMOD3 PE=1 SV=1 - [TMOD3_HUMAN] 8.81% 2 2 0.639 Signal peptidase complex subunit 2 OS=Homo sapiens GN=SPCS2 PE=1 SV=3 - Q15005 4.42% 2 2 0.639 [SPCS2_HUMAN] ATP synthase subunit alpha, mitochondrial OS=Homo sapiens GN=ATP5A1 PE=1 P25705 44.30% 33 35 0.638 SV=1 - [ATPA_HUMAN] Q9H9B4 Sideroflexin-1 OS=Homo sapiens GN=SFXN1 PE=1 SV=4 - [SFXN1_HUMAN] 31.99% 10 12 0.638

203

Chapter 8

Heterogeneous nuclear ribonucleoprotein M OS=Homo sapiens GN=HNRNPM P52272 38.49% 25 26 0.636 PE=1 SV=3 - [HNRPM_HUMAN] Q96PU8 Protein quaking OS=Homo sapiens GN=QKI PE=1 SV=1 - [QKI_HUMAN] 9.68% 2 2 0.636 Stress-70 protein, mitochondrial OS=Homo sapiens GN=HSPA9 PE=1 SV=2 - P38646 49.48% 36 38 0.635 [GRP75_HUMAN] P50454 Serpin H1 OS=Homo sapiens GN=SERPINH1 PE=1 SV=2 - [SERPH_HUMAN] 17.94% 5 5 0.635 Eukaryotic translation initiation factor 3 subunit B OS=Homo sapiens GN=EIF3B P55884 4.67% 3 3 0.634 PE=1 SV=3 - [EIF3B_HUMAN] Protein disulfide-isomerase OS=Homo sapiens GN=P4HB PE=1 SV=3 - P07237 23.62% 13 13 0.633 [PDIA1_HUMAN] Microtubule-associated protein 4 OS=Homo sapiens GN=MAP4 PE=1 SV=3 - P27816 5.64% 4 4 0.633 [MAP4_HUMAN] Calcium signal-modulating cyclophilin ligand OS=Homo sapiens GN=CAMLG PE=1 P49069 4.05% 1 1 0.633 SV=1 - [CAMLG_HUMAN] Ornithine aminotransferase, mitochondrial OS=Homo sapiens GN=OAT PE=1 SV=1 P04181 41.00% 17 17 0.633 - [OAT_HUMAN] MICOS complex subunit MIC60 OS=Homo sapiens GN=IMMT PE=1 SV=1 - Q16891 24.67% 15 16 0.632 [MIC60_HUMAN] Glycine dehydrogenase (decarboxylating), mitochondrial OS=Homo sapiens P23378 5.10% 4 4 0.632 GN=GLDC PE=1 SV=2 - [GCSP_HUMAN] P33176 Kinesin-1 heavy chain OS=Homo sapiens GN=KIF5B PE=1 SV=1 - [KINH_HUMAN] 4.05% 3 3 0.63 MICOS complex subunit MIC19 OS=Homo sapiens GN=CHCHD3 PE=1 SV=1 - Q9NX63 35.68% 8 9 0.63 [MIC19_HUMAN] Cytochrome b-c1 complex subunit 1, mitochondrial OS=Homo sapiens P31930 18.75% 8 9 0.63 GN=UQCRC1 PE=1 SV=3 - [QCR1_HUMAN] Q13505 Metaxin-1 OS=Homo sapiens GN=MTX1 PE=1 SV=2 - [MTX1_HUMAN] 5.58% 2 2 0.63 Cytochrome b-c1 complex subunit Rieske, mitochondrial OS=Homo sapiens P47985 15.69% 5 6 0.629 GN=UQCRFS1 PE=1 SV=2 - [UCRI_HUMAN] Peptidyl-prolyl cis-trans isomerase A OS=Homo sapiens GN=PPIA PE=1 SV=2 - P62937 21.82% 2 2 0.628 [PPIA_HUMAN] 39S ribosomal protein L46, mitochondrial OS=Homo sapiens GN=MRPL46 PE=1 Q9H2W6 9.32% 2 2 0.627 SV=1 - [RM46_HUMAN] Protein SCO2 homolog, mitochondrial OS=Homo sapiens GN=SCO2 PE=1 SV=3 - O43819 4.14% 1 1 0.627 [SCO2_HUMAN] 204

Chapter 8

S-adenosylmethionine synthase isoform type-2 OS=Homo sapiens GN=MAT2A P31153 6.58% 2 2 0.627 PE=1 SV=1 - [METK2_HUMAN] Interleukin enhancer-binding factor 2 OS=Homo sapiens GN=ILF2 PE=1 SV=2 - Q12905 12.05% 2 3 0.625 [ILF2_HUMAN] P19367 Hexokinase-1 OS=Homo sapiens GN=HK1 PE=1 SV=3 - [HXK1_HUMAN] 8.72% 5 6 0.625 Elongation factor G, mitochondrial OS=Homo sapiens GN=GFM1 PE=1 SV=2 - Q96RP9 4.53% 3 3 0.623 [EFGM_HUMAN] P37802 Transgelin-2 OS=Homo sapiens GN=TAGLN2 PE=1 SV=3 - [TAGL2_HUMAN] 11.06% 1 1 0.622 Citrate synthase, mitochondrial OS=Homo sapiens GN=CS PE=1 SV=2 - O75390 14.59% 9 9 0.622 [CISY_HUMAN] Serine/threonine-protein phosphatase PGAM5, mitochondrial OS=Homo sapiens Q96HS1 13.15% 4 4 0.62 GN=PGAM5 PE=1 SV=2 - [PGAM5_HUMAN] Procollagen galactosyltransferase 1 OS=Homo sapiens GN=COLGALT1 PE=1 Q8NBJ5 4.50% 2 2 0.619 SV=1 - [GT251_HUMAN] Ran-specific GTPase-activating protein OS=Homo sapiens GN=RANBP1 PE=1 P43487 6.47% 1 1 0.618 SV=1 - [RANG_HUMAN] Trifunctional enzyme subunit beta, mitochondrial OS=Homo sapiens GN=HADHB P55084 14.14% 6 6 0.617 PE=1 SV=3 - [ECHB_HUMAN] Dihydrolipoyl dehydrogenase, mitochondrial OS=Homo sapiens GN=DLD PE=1 P09622 14.93% 8 8 0.617 SV=2 - [DLDH_HUMAN] P51610 Host cell factor 1 OS=Homo sapiens GN=HCFC1 PE=1 SV=2 - [HCFC1_HUMAN] 2.11% 2 2 0.617 14-3-3 protein beta/alpha OS=Homo sapiens GN=YWHAB PE=1 SV=3 - P31946 11.79% 3 3 0.616 [1433B_HUMAN] ATP synthase subunit beta, mitochondrial OS=Homo sapiens GN=ATP5B PE=1 P06576 63.89% 27 28 0.616 SV=3 - [ATPB_HUMAN] 10 kDa heat shock protein, mitochondrial OS=Homo sapiens GN=HSPE1 PE=1 P61604 25.49% 2 2 0.616 SV=2 - [CH10_HUMAN] Calcium-binding mitochondrial carrier protein Aralar2 OS=Homo sapiens Q9UJS0 5.48% 2 2 0.616 GN=SLC25A13 PE=1 SV=2 - [CMC2_HUMAN] Sodium/potassium-transporting ATPase subunit alpha-1 OS=Homo sapiens P05023 15.84% 10 18 0.615 GN=ATP1A1 PE=1 SV=1 - [AT1A1_HUMAN] Very-long-chain (3R)-3-hydroxyacyl-CoA dehydratase 3 OS=Homo sapiens Q9P035 9.12% 3 3 0.613 GN=HACD3 PE=1 SV=2 - [HACD3_HUMAN]

205

Chapter 8

Thioredoxin-related transmembrane protein 1 OS=Homo sapiens GN=TMX1 PE=1 Q9H3N1 12.14% 2 3 0.613 SV=1 - [TMX1_HUMAN] Signal recognition particle receptor subunit beta OS=Homo sapiens GN=SRPRB Q9Y5M8 21.03% 5 5 0.612 PE=1 SV=3 - [SRPRB_HUMAN] GrpE protein homolog 1, mitochondrial OS=Homo sapiens GN=GRPEL1 PE=1 Q9HAV7 11.06% 2 2 0.612 SV=2 - [GRPE1_HUMAN] Acyl-coenzyme A thioesterase 1 OS=Homo sapiens GN=ACOT1 PE=1 SV=1 - Q86TX2 13.30% 4 4 0.612 [ACOT1_HUMAN] Extended synaptotagmin-1 OS=Homo sapiens GN=ESYT1 PE=1 SV=1 - Q9BSJ8 9.69% 9 9 0.612 [ESYT1_HUMAN] 40S ribosomal protein S17 OS=Homo sapiens GN=RPS17 PE=1 SV=2 - P08708 18.52% 1 1 0.612 [RS17_HUMAN] Isocitrate dehydrogenase [NAD] subunit alpha, mitochondrial OS=Homo sapiens P50213 5.74% 2 2 0.611 GN=IDH3A PE=1 SV=1 - [IDH3A_HUMAN] Glycerol-3-phosphate dehydrogenase, mitochondrial OS=Homo sapiens GN=GPD2 P43304 2.06% 1 1 0.611 PE=1 SV=3 - [GPDM_HUMAN] Cytochrome c1, heme protein, mitochondrial OS=Homo sapiens GN=CYC1 PE=1 P08574 14.46% 4 4 0.611 SV=3 - [CY1_HUMAN] Isoleucine--tRNA ligase, mitochondrial OS=Homo sapiens GN=IARS2 PE=1 SV=2 - Q9NSE4 6.62% 5 5 0.609 [SYIM_HUMAN] Nucleoside diphosphate kinase A OS=Homo sapiens GN=NME1 PE=1 SV=1 - P15531 7.89% 1 1 0.609 [NDKA_HUMAN] Inhibitor of nuclear factor kappa-B kinase-interacting protein OS=Homo sapiens Q70UQ0 6.86% 2 2 0.608 GN=IKBIP PE=1 SV=1 - [IKIP_HUMAN] Polypyrimidine tract-binding protein 1 OS=Homo sapiens GN=PTBP1 PE=1 SV=1 - P26599 22.22% 8 8 0.607 [PTBP1_HUMAN] Voltage-dependent anion-selective channel protein 3 OS=Homo sapiens Q9Y277 4.59% 2 2 0.607 GN=VDAC3 PE=1 SV=1 - [VDAC3_HUMAN] Ceroid-lipofuscinosis neuronal protein 6 OS=Homo sapiens GN=CLN6 PE=1 SV=1 - Q9NWW5 7.40% 2 2 0.606 [CLN6_HUMAN] Endoplasmic reticulum resident protein 44 OS=Homo sapiens GN=ERP44 PE=1 Q9BS26 8.13% 3 3 0.604 SV=1 - [ERP44_HUMAN] Acetyl-CoA acetyltransferase, mitochondrial OS=Homo sapiens GN=ACAT1 PE=1 P24752 32.79% 11 12 0.604 SV=1 - [THIL_HUMAN]

206

Chapter 8

ADP/ATP translocase 3 OS=Homo sapiens GN=SLC25A6 PE=1 SV=4 - P12236 12.42% 1 7 0.603 [ADT3_HUMAN] Pyridoxine-5'-phosphate oxidase OS=Homo sapiens GN=PNPO PE=1 SV=1 - Q9NVS9 8.43% 1 1 0.602 [PNPO_HUMAN] LETM1 and EF-hand domain-containing protein 1, mitochondrial OS=Homo sapiens O95202 6.77% 3 3 0.6 GN=LETM1 PE=1 SV=1 - [LETM1_HUMAN] Tubulin-folding cofactor B OS=Homo sapiens GN=TBCB PE=1 SV=2 - Q99426 13.11% 2 2 0.599 [TBCB_HUMAN] Short/branched chain specific acyl-CoA dehydrogenase, mitochondrial OS=Homo P45954 5.56% 2 2 0.599 sapiens GN=ACADSB PE=1 SV=1 - [ACDSB_HUMAN] 39S ribosomal protein L39, mitochondrial OS=Homo sapiens GN=MRPL39 PE=1 Q9NYK5 12.13% 4 4 0.597 SV=3 - [RM39_HUMAN] Transferrin receptor protein 1 OS=Homo sapiens GN=TFRC PE=1 SV=2 - P02786 5.26% 3 3 0.596 [TFR1_HUMAN] 26S proteasome non-ATPase regulatory subunit 6 OS=Homo sapiens GN=PSMD6 Q15008 4.37% 1 1 0.596 PE=1 SV=1 - [PSMD6_HUMAN] Q14739 Lamin-B receptor OS=Homo sapiens GN=LBR PE=1 SV=2 - [LBR_HUMAN] 11.06% 4 5 0.595 DNA-(apurinic or apyrimidinic site) lyase OS=Homo sapiens GN=APEX1 PE=1 SV=2 P27695 8.49% 2 2 0.594 - [APEX1_HUMAN] U2 small nuclear ribonucleoprotein A' OS=Homo sapiens GN=SNRPA1 PE=1 SV=2 P09661 11.76% 2 2 0.591 - [RU2A_HUMAN] Structural maintenance of chromosomes protein 4 OS=Homo sapiens GN=SMC4 Q9NTJ3 1.16% 1 1 0.591 PE=1 SV=2 - [SMC4_HUMAN] Secretory carrier-associated membrane protein 3 OS=Homo sapiens GN=SCAMP3 O14828 22.19% 5 5 0.59 PE=1 SV=3 - [SCAM3_HUMAN] Ceramide synthase 2 OS=Homo sapiens GN=CERS2 PE=1 SV=1 - Q96G23 7.89% 2 2 0.59 [CERS2_HUMAN] P27797 Calreticulin OS=Homo sapiens GN=CALR PE=1 SV=1 - [CALR_HUMAN] 26.62% 7 7 0.587 Nuclear pore membrane glycoprotein 210 OS=Homo sapiens GN=NUP210 PE=1 Q8TEM1 0.90% 1 2 0.586 SV=3 - [PO210_HUMAN] Polymerase delta-interacting protein 3 OS=Homo sapiens GN=POLDIP3 PE=1 Q9BY77 27.32% 6 7 0.586 SV=2 - [PDIP3_HUMAN] Stomatin-like protein 2, mitochondrial OS=Homo sapiens GN=STOML2 PE=1 SV=1 Q9UJZ1 35.39% 11 11 0.586 - [STML2_HUMAN]

207

Chapter 8

Calcium-binding mitochondrial carrier protein SCaMC-1 OS=Homo sapiens Q6NUK1 4.19% 1 2 0.586 GN=SLC25A24 PE=1 SV=2 - [SCMC1_HUMAN] Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, mitochondrial OS=Homo P21912 12.14% 4 4 0.584 sapiens GN=SDHB PE=1 SV=3 - [SDHB_HUMAN] Palmitoyl-protein thioesterase 1 OS=Homo sapiens GN=PPT1 PE=1 SV=1 - P50897 6.54% 1 1 0.583 [PPT1_HUMAN] 60S ribosomal protein L24 OS=Homo sapiens GN=RPL24 PE=1 SV=1 - P83731 8.28% 2 2 0.583 [RL24_HUMAN] Lon protease homolog, mitochondrial OS=Homo sapiens GN=LONP1 PE=1 SV=2 - P36776 17.94% 15 15 0.582 [LONM_HUMAN] Retinol dehydrogenase 14 OS=Homo sapiens GN=RDH14 PE=1 SV=1 - Q9HBH5 5.36% 1 1 0.582 [RDH14_HUMAN] Leucine-rich PPR motif-containing protein, mitochondrial OS=Homo sapiens P42704 13.49% 16 17 0.581 GN=LRPPRC PE=1 SV=3 - [LPPRC_HUMAN] Cell cycle and apoptosis regulator protein 2 OS=Homo sapiens GN=CCAR2 PE=1 Q8N163 17.44% 11 11 0.581 SV=2 - [CCAR2_HUMAN] P14625 Endoplasmin OS=Homo sapiens GN=HSP90B1 PE=1 SV=1 - [ENPL_HUMAN] 43.46% 36 41 0.579 3-hydroxyisobutyryl-CoA hydrolase, mitochondrial OS=Homo sapiens GN=HIBCH Q6NVY1 10.10% 2 3 0.579 PE=1 SV=2 - [HIBCH_HUMAN] Neutral amino acid transporter B(0) OS=Homo sapiens GN=SLC1A5 PE=1 SV=2 - Q15758 11.46% 5 5 0.575 [AAAT_HUMAN] P52789 Hexokinase-2 OS=Homo sapiens GN=HK2 PE=1 SV=2 - [HXK2_HUMAN] 1.31% 1 1 0.575 HLA class I histocompatibility antigen, Cw-17 alpha chain OS=Homo sapiens Q95604 13.44% 1 3 0.574 GN=HLA-C PE=1 SV=1 - [1C17_HUMAN] Serine/threonine-protein phosphatase PP1-alpha catalytic subunit OS=Homo P62136 11.82% 2 2 0.574 sapiens GN=PPP1CA PE=1 SV=1 - [PP1A_HUMAN] Translocon-associated protein subunit gamma OS=Homo sapiens GN=SSR3 PE=1 Q9UNL2 9.73% 2 2 0.574 SV=1 - [SSRG_HUMAN] U4/U6 small nuclear ribonucleoprotein Prp3 OS=Homo sapiens GN=PRPF3 PE=1 O43395 3.66% 1 2 0.57 SV=2 - [PRPF3_HUMAN] Dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase P10515 complex, mitochondrial OS=Homo sapiens GN=DLAT PE=1 SV=3 - 5.56% 5 5 0.569 [ODP2_HUMAN]

208

Chapter 8

78 kDa glucose-regulated protein OS=Homo sapiens GN=HSPA5 PE=1 SV=2 - P11021 51.83% 30 33 0.568 [GRP78_HUMAN] 3-ketoacyl-CoA thiolase, mitochondrial OS=Homo sapiens GN=ACAA2 PE=1 SV=2 - P42765 43.83% 12 12 0.568 [THIM_HUMAN] Electron transfer flavoprotein subunit beta OS=Homo sapiens GN=ETFB PE=1 P38117 45.10% 10 10 0.566 SV=3 - [ETFB_HUMAN] 3-hydroxyacyl-CoA dehydrogenase type-2 OS=Homo sapiens GN=HSD17B10 PE=1 Q99714 25.67% 5 6 0.566 SV=3 - [HCD2_HUMAN] General transcription factor II-I OS=Homo sapiens GN=GTF2I PE=1 SV=2 - P78347 7.01% 4 5 0.566 [GTF2I_HUMAN] Ribosome-binding protein 1 OS=Homo sapiens GN=RRBP1 PE=1 SV=4 - Q9P2E9 4.33% 4 5 0.565 [RRBP1_HUMAN] Serine--tRNA ligase, mitochondrial OS=Homo sapiens GN=SARS2 PE=1 SV=1 - Q9NP81 13.90% 4 5 0.564 [SYSM_HUMAN] Q92797 Symplekin OS=Homo sapiens GN=SYMPK PE=1 SV=2 - [SYMPK_HUMAN] 1.33% 1 1 0.563 Cleft lip and palate transmembrane protein 1 OS=Homo sapiens GN=CLPTM1 PE=1 O96005 1.05% 1 1 0.562 SV=1 - [CLPT1_HUMAN] Polyribonucleotide nucleotidyltransferase 1, mitochondrial OS=Homo sapiens Q8TCS8 7.54% 7 7 0.562 GN=PNPT1 PE=1 SV=2 - [PNPT1_HUMAN] 39S ribosomal protein L18, mitochondrial OS=Homo sapiens GN=MRPL18 PE=1 Q9H0U6 16.67% 3 3 0.56 SV=1 - [RM18_HUMAN] Glutamate dehydrogenase 1, mitochondrial OS=Homo sapiens GN=GLUD1 PE=1 P00367 13.26% 7 7 0.559 SV=2 - [DHE3_HUMAN] Mitochondrial ribonuclease P protein 1 OS=Homo sapiens GN=TRMT10C PE=1 Q7L0Y3 8.44% 2 2 0.559 SV=2 - [MRRP1_HUMAN] 40S ribosomal protein S10 OS=Homo sapiens GN=RPS10 PE=1 SV=1 - P46783 20.00% 1 2 0.557 [RS10_HUMAN] SRA stem-loop-interacting RNA-binding protein, mitochondrial OS=Homo sapiens Q9GZT3 9.17% 1 1 0.557 GN=SLIRP PE=1 SV=1 - [SLIRP_HUMAN] Protein disulfide-isomerase A3 OS=Homo sapiens GN=PDIA3 PE=1 SV=4 - P30101 42.18% 20 21 0.555 [PDIA3_HUMAN] 60S acidic ribosomal protein P0 OS=Homo sapiens GN=RPLP0 PE=1 SV=1 - P05388 5.36% 1 1 0.555 [RLA0_HUMAN] P49257 Protein ERGIC-53 OS=Homo sapiens GN=LMAN1 PE=1 SV=2 - [LMAN1_HUMAN] 4.12% 2 2 0.553

209

Chapter 8

DAZ-associated protein 1 OS=Homo sapiens GN=DAZAP1 PE=1 SV=1 - Q96EP5 4.42% 2 2 0.55 [DAZP1_HUMAN] Heme oxygenase 2 OS=Homo sapiens GN=HMOX2 PE=1 SV=2 - P30519 15.51% 3 3 0.55 [HMOX2_HUMAN] Nucleoside diphosphate-linked moiety X motif 19, mitochondrial OS=Homo sapiens A8MXV4 22.13% 6 6 0.55 GN=NUDT19 PE=1 SV=1 - [NUD19_HUMAN] Carbonyl reductase [NADPH] 1 OS=Homo sapiens GN=CBR1 PE=1 SV=3 - P16152 10.11% 3 3 0.549 [CBR1_HUMAN] 3-mercaptopyruvate sulfurtransferase OS=Homo sapiens GN=MPST PE=1 SV=3 - P25325 9.43% 3 3 0.547 [THTM_HUMAN] ES1 protein homolog, mitochondrial OS=Homo sapiens GN=C21orf33 PE=1 SV=3 - P30042 20.52% 7 7 0.546 [ES1_HUMAN] Manganese-transporting ATPase 13A1 OS=Homo sapiens GN=ATP13A1 PE=1 Q9HD20 2.91% 2 2 0.546 SV=2 - [AT131_HUMAN] Heterogeneous nuclear ribonucleoprotein D0 OS=Homo sapiens GN=HNRNPD Q14103 6.76% 2 3 0.54 PE=1 SV=1 - [HNRPD_HUMAN] P29401 Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 - [TKT_HUMAN] 14.13% 6 6 0.538 Mitochondrial-processing peptidase subunit alpha OS=Homo sapiens GN=PMPCA Q10713 10.67% 3 3 0.538 PE=1 SV=2 - [MPPA_HUMAN] Retinol dehydrogenase 13 OS=Homo sapiens GN=RDH13 PE=1 SV=2 - Q8NBN7 10.88% 3 3 0.536 [RDH13_HUMAN] Vesicle-associated membrane protein-associated protein B/C OS=Homo sapiens O95292 6.58% 1 1 0.536 GN=VAPB PE=1 SV=3 - [VAPB_HUMAN] Transcription activator BRG1 OS=Homo sapiens GN=SMARCA4 PE=1 SV=2 - P51532 2.67% 2 3 0.535 [SMCA4_HUMAN] Mitochondrial-processing peptidase subunit beta OS=Homo sapiens GN=PMPCB O75439 14.72% 4 5 0.533 PE=1 SV=2 - [MPPB_HUMAN] Serine/threonine-protein phosphatase 1 regulatory subunit 10 OS=Homo sapiens Q96QC0 2.13% 1 1 0.532 GN=PPP1R10 PE=1 SV=1 - [PP1RA_HUMAN] Glucosidase 2 subunit beta OS=Homo sapiens GN=PRKCSH PE=1 SV=2 - P14314 10.80% 7 9 0.53 [GLU2B_HUMAN] Transmembrane emp24 domain-containing protein 10 OS=Homo sapiens P49755 8.68% 2 2 0.53 GN=TMED10 PE=1 SV=2 - [TMEDA_HUMAN] NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 9, mitochondrial Q16795 7.69% 2 2 0.53 OS=Homo sapiens GN=NDUFA9 PE=1 SV=2 - [NDUA9_HUMAN] 210

Chapter 8

Neutral alpha-glucosidase AB OS=Homo sapiens GN=GANAB PE=1 SV=3 - Q14697 21.82% 17 18 0.529 [GANAB_HUMAN] Adipocyte plasma membrane-associated protein OS=Homo sapiens GN=APMAP Q9HDC9 17.79% 4 4 0.529 PE=1 SV=2 - [APMAP_HUMAN] Q9UBR2 Cathepsin Z OS=Homo sapiens GN=CTSZ PE=1 SV=1 - [CATZ_HUMAN] 3.96% 1 1 0.528 Monofunctional C1-tetrahydrofolate synthase, mitochondrial OS=Homo sapiens Q6UB35 12.17% 7 8 0.527 GN=MTHFD1L PE=1 SV=1 - [C1TM_HUMAN] Minor histocompatibility antigen H13 OS=Homo sapiens GN=HM13 PE=1 SV=1 - Q8TCT9 8.22% 2 2 0.527 [HM13_HUMAN] P01116 GTPase KRas OS=Homo sapiens GN=KRAS PE=1 SV=1 - [RASK_HUMAN] 13.76% 3 3 0.526 Q92692 Nectin-2 OS=Homo sapiens GN=PVRL2 PE=1 SV=1 - [PVRL2_HUMAN] 1.49% 1 1 0.525 Medium-chain specific acyl-CoA dehydrogenase, mitochondrial OS=Homo sapiens P11310 25.42% 7 7 0.524 GN=ACADM PE=1 SV=1 - [ACADM_HUMAN] Polymerase delta-interacting protein 2 OS=Homo sapiens GN=POLDIP2 PE=1 Q9Y2S7 14.67% 3 3 0.523 SV=1 - [PDIP2_HUMAN] Mannosyl-oligosaccharide glucosidase OS=Homo sapiens GN=MOGS PE=1 SV=5 - Q13724 3.94% 3 3 0.523 [MOGS_HUMAN] NAD(P) transhydrogenase, mitochondrial OS=Homo sapiens GN=NNT PE=1 SV=3 - Q13423 11.05% 8 9 0.522 [NNTM_HUMAN] Plasma membrane calcium-transporting ATPase 1 OS=Homo sapiens GN=ATP2B1 P20020 8.98% 8 8 0.521 PE=1 SV=3 - [AT2B1_HUMAN] Phosphate carrier protein, mitochondrial OS=Homo sapiens GN=SLC25A3 PE=1 Q00325 9.67% 5 5 0.518 SV=2 - [MPCP_HUMAN] Band 4.1-like protein 2 OS=Homo sapiens GN=EPB41L2 PE=1 SV=1 - O43491 10.35% 5 8 0.517 [E41L2_HUMAN] Protein disulfide-isomerase A4 OS=Homo sapiens GN=PDIA4 PE=1 SV=2 - P13667 21.09% 17 17 0.515 [PDIA4_HUMAN] Hypoxia up-regulated protein 1 OS=Homo sapiens GN=HYOU1 PE=1 SV=1 - Q9Y4L1 13.11% 10 10 0.515 [HYOU1_HUMAN] ATP synthase subunit gamma, mitochondrial OS=Homo sapiens GN=ATP5C1 PE=1 P36542 19.80% 4 5 0.514 SV=1 - [ATPG_HUMAN] ATP synthase subunit d, mitochondrial OS=Homo sapiens GN=ATP5H PE=1 SV=3 - O75947 23.60% 3 3 0.513 [ATP5H_HUMAN]

211

Chapter 8

Double-stranded RNA-specific adenosine deaminase OS=Homo sapiens GN=ADAR P55265 5.71% 5 5 0.51 PE=1 SV=4 - [DSRAD_HUMAN] Zinc phosphodiesterase ELAC protein 2 OS=Homo sapiens GN=ELAC2 PE=1 SV=2 Q9BQ52 1.82% 1 1 0.508 - [RNZ2_HUMAN] Q14165 Malectin OS=Homo sapiens GN=MLEC PE=1 SV=1 - [MLEC_HUMAN] 10.96% 3 3 0.506 Large neutral amino acids transporter small subunit 1 OS=Homo sapiens Q01650 6.71% 3 3 0.506 GN=SLC7A5 PE=1 SV=2 - [LAT1_HUMAN] B-cell receptor-associated protein 31 OS=Homo sapiens GN=BCAP31 PE=1 SV=3 - P51572 9.35% 2 2 0.504 [BAP31_HUMAN] P07099 Epoxide hydrolase 1 OS=Homo sapiens GN=EPHX1 PE=1 SV=1 - [HYEP_HUMAN] 7.69% 2 2 0.503 Q9NQC3 Reticulon-4 OS=Homo sapiens GN=RTN4 PE=1 SV=2 - [RTN4_HUMAN] 1.93% 2 2 0.5 HLA class I histocompatibility antigen, B-54 alpha chain OS=Homo sapiens P30492 9.94% 1 3 0.498 GN=HLA-B PE=1 SV=1 - [1B54_HUMAN] Electron transfer flavoprotein subunit alpha, mitochondrial OS=Homo sapiens P13804 33.93% 8 8 0.497 GN=ETFA PE=1 SV=1 - [ETFA_HUMAN] Aspartate--tRNA ligase, mitochondrial OS=Homo sapiens GN=DARS2 PE=1 SV=1 - Q6PI48 1.71% 1 1 0.495 [SYDM_HUMAN] Sodium/potassium-transporting ATPase subunit beta-3 OS=Homo sapiens P54709 9.32% 2 2 0.491 GN=ATP1B3 PE=1 SV=1 - [AT1B3_HUMAN] Uncharacterized protein C19orf52 OS=Homo sapiens GN=C19orf52 PE=1 SV=2 - Q9BSF4 6.15% 1 1 0.491 [CS052_HUMAN] Cytochrome c oxidase subunit 2 OS=Homo sapiens GN=MT-CO2 PE=1 SV=1 - P00403 7.49% 1 1 0.49 [COX2_HUMAN] Probable ATP-dependent RNA helicase DDX23 OS=Homo sapiens GN=DDX23 Q9BUQ8 5.49% 3 4 0.488 PE=1 SV=3 - [DDX23_HUMAN] U4/U6.U5 tri-snRNP-associated protein 1 OS=Homo sapiens GN=SART1 PE=1 O43290 4.50% 2 3 0.487 SV=1 - [SNUT1_HUMAN] NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial OS=Homo sapiens P49821 1.94% 1 1 0.487 GN=NDUFV1 PE=1 SV=4 - [NDUV1_HUMAN] 39S ribosomal protein L13, mitochondrial OS=Homo sapiens GN=MRPL13 PE=1 Q9BYD1 14.04% 2 2 0.484 SV=1 - [RM13_HUMAN] Monocarboxylate transporter 1 OS=Homo sapiens GN=SLC16A1 PE=1 SV=3 - P53985 8.20% 2 2 0.484 [MOT1_HUMAN]

212

Chapter 8

Complement component 1 Q subcomponent-binding protein, mitochondrial Q07021 22.70% 6 7 0.482 OS=Homo sapiens GN=C1QBP PE=1 SV=1 - [C1QBP_HUMAN] Scaffold attachment factor B1 OS=Homo sapiens GN=SAFB PE=1 SV=4 - Q15424 2.30% 1 1 0.482 [SAFB1_HUMAN] Delta-1-pyrroline-5-carboxylate dehydrogenase, mitochondrial OS=Homo sapiens P30038 7.46% 2 2 0.482 GN=ALDH4A1 PE=1 SV=3 - [AL4A1_HUMAN] ATP synthase subunit O, mitochondrial OS=Homo sapiens GN=ATP5O PE=1 SV=1 P48047 16.43% 5 5 0.48 - [ATPO_HUMAN] 28S ribosomal protein S27, mitochondrial OS=Homo sapiens GN=MRPS27 PE=1 Q92552 5.31% 2 2 0.48 SV=3 - [RT27_HUMAN] Ubiquitin carboxyl-terminal hydrolase 5 OS=Homo sapiens GN=USP5 PE=1 SV=2 - P45974 8.04% 3 3 0.479 [UBP5_HUMAN] P35580 Myosin-10 OS=Homo sapiens GN=MYH10 PE=1 SV=3 - [MYH10_HUMAN] 4.00% 6 6 0.476 Cleavage and polyadenylation specificity factor subunit 1 OS=Homo sapiens Q10570 2.01% 2 2 0.476 GN=CPSF1 PE=1 SV=2 - [CPSF1_HUMAN] Pyrroline-5-carboxylate reductase 1, mitochondrial OS=Homo sapiens GN=PYCR1 P32322 7.21% 1 1 0.473 PE=1 SV=2 - [P5CR1_HUMAN] Enoyl-CoA hydratase, mitochondrial OS=Homo sapiens GN=ECHS1 PE=1 SV=4 - P30084 13.45% 4 4 0.472 [ECHM_HUMAN] Serine/threonine-protein phosphatase PP1-beta catalytic subunit OS=Homo sapiens P62140 4.89% 1 1 0.471 GN=PPP1CB PE=1 SV=3 - [PP1B_HUMAN] Synaptic vesicle membrane protein VAT-1 homolog OS=Homo sapiens GN=VAT1 Q99536 7.63% 2 2 0.471 PE=1 SV=2 - [VAT1_HUMAN] NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 10, mitochondrial O95299 4.79% 1 1 0.462 OS=Homo sapiens GN=NDUFA10 PE=1 SV=1 - [NDUAA_HUMAN] Ribosome biogenesis protein BRX1 homolog OS=Homo sapiens GN=BRIX1 PE=1 Q8TDN6 12.18% 2 2 0.462 SV=2 - [BRX1_HUMAN] Ras-related protein Rab-5C OS=Homo sapiens GN=RAB5C PE=1 SV=2 - P51148 22.69% 4 4 0.461 [RAB5C_HUMAN] Sterol-4-alpha-carboxylate 3-dehydrogenase, decarboxylating OS=Homo sapiens Q15738 6.17% 2 2 0.461 GN=NSDHL PE=1 SV=2 - [NSDHL_HUMAN] Inner nuclear membrane protein Man1 OS=Homo sapiens GN=LEMD3 PE=1 SV=2 - Q9Y2U8 4.83% 3 3 0.46 [MAN1_HUMAN] 2-oxoglutarate dehydrogenase, mitochondrial OS=Homo sapiens GN=OGDH PE=1 Q02218 2.54% 2 3 0.459 SV=3 - [ODO1_HUMAN] 213

Chapter 8

ER membrane protein complex subunit 2 OS=Homo sapiens GN=EMC2 PE=1 SV=1 Q15006 4.04% 1 1 0.459 - [EMC2_HUMAN] Apoptosis-inducing factor 1, mitochondrial OS=Homo sapiens GN=AIFM1 PE=1 O95831 17.13% 7 7 0.457 SV=1 - [AIFM1_HUMAN] Pyrroline-5-carboxylate reductase 2 OS=Homo sapiens GN=PYCR2 PE=1 SV=1 - Q96C36 13.75% 6 6 0.457 [P5CR2_HUMAN] P50402 Emerin OS=Homo sapiens GN=EMD PE=1 SV=1 - [EMD_HUMAN] 23.23% 6 6 0.456 P05455 Lupus La protein OS=Homo sapiens GN=SSB PE=1 SV=2 - [LA_HUMAN] 8.58% 3 3 0.456 P04040 Catalase OS=Homo sapiens GN=CAT PE=1 SV=3 - [CATA_HUMAN] 5.31% 1 1 0.455 U5 small nuclear ribonucleoprotein 40 kDa protein OS=Homo sapiens Q96DI7 21.29% 3 3 0.455 GN=SNRNP40 PE=1 SV=1 - [SNR40_HUMAN] Pituitary tumor-transforming gene 1 protein-interacting protein OS=Homo sapiens P53801 6.67% 1 1 0.455 GN=PTTG1IP PE=1 SV=1 - [PTTG_HUMAN] Band 4.1-like protein 3 OS=Homo sapiens GN=EPB41L3 PE=1 SV=2 - Q9Y2J2 4.14% 3 5 0.452 [E41L3_HUMAN] 60S ribosomal protein L18 OS=Homo sapiens GN=RPL18 PE=1 SV=2 - Q07020 5.32% 1 1 0.449 [RL18_HUMAN] Mitochondrial import receptor subunit TOM22 homolog OS=Homo sapiens Q9NS69 17.61% 1 1 0.448 GN=TOMM22 PE=1 SV=3 - [TOM22_HUMAN] Coiled-coil domain-containing protein 124 OS=Homo sapiens GN=CCDC124 PE=1 Q96CT7 3.59% 1 1 0.448 SV=1 - [CC124_HUMAN] Leucine-rich repeat-containing protein 59 OS=Homo sapiens GN=LRRC59 PE=1 Q96AG4 30.29% 9 9 0.445 SV=1 - [LRC59_HUMAN] NAD kinase 2, mitochondrial OS=Homo sapiens GN=NADK2 PE=1 SV=2 - Q4G0N4 3.39% 1 1 0.439 [NAKD2_HUMAN] P27824 Calnexin OS=Homo sapiens GN=CANX PE=1 SV=2 - [CALX_HUMAN] 18.75% 8 10 0.437 Cell division cycle and apoptosis regulator protein 1 OS=Homo sapiens GN=CCAR1 Q8IX12 3.57% 3 3 0.435 PE=1 SV=2 - [CCAR1_HUMAN] Dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate P36957 dehydrogenase complex, mitochondrial OS=Homo sapiens GN=DLST PE=1 SV=4 - 12.14% 4 4 0.434 [ODO2_HUMAN] ER membrane protein complex subunit 7 OS=Homo sapiens GN=EMC7 PE=1 SV=1 Q9NPA0 6.61% 1 1 0.433 - [EMC7_HUMAN]

214

Chapter 8

NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial OS=Homo sapiens P28331 5.50% 5 5 0.433 GN=NDUFS1 PE=1 SV=3 - [NDUS1_HUMAN] 116 kDa U5 small nuclear ribonucleoprotein component OS=Homo sapiens Q15029 10.91% 7 9 0.432 GN=EFTUD2 PE=1 SV=1 - [U5S1_HUMAN] Membrane-associated progesterone receptor component 1 OS=Homo sapiens O00264 32.31% 9 9 0.429 GN=PGRMC1 PE=1 SV=3 - [PGRC1_HUMAN] Cell division control protein 42 homolog OS=Homo sapiens GN=CDC42 PE=1 SV=2 P60953 20.94% 3 3 0.426 - [CDC42_HUMAN] ATP-dependent Clp protease proteolytic subunit, mitochondrial OS=Homo sapiens Q16740 14.80% 2 2 0.425 GN=CLPP PE=1 SV=1 - [CLPP_HUMAN] Q12846 Syntaxin-4 OS=Homo sapiens GN=STX4 PE=1 SV=2 - [STX4_HUMAN] 6.40% 1 1 0.423 Replication factor C subunit 4 OS=Homo sapiens GN=RFC4 PE=1 SV=2 - P35249 3.31% 1 1 0.422 [RFC4_HUMAN] Nodal modulator 1 OS=Homo sapiens GN=NOMO1 PE=1 SV=5 - Q15155 4.17% 3 3 0.421 [NOMO1_HUMAN] P05556 Integrin beta-1 OS=Homo sapiens GN=ITGB1 PE=1 SV=2 - [ITB1_HUMAN] 8.77% 7 7 0.419 Q5JTH9 RRP12-like protein OS=Homo sapiens GN=RRP12 PE=1 SV=2 - [RRP12_HUMAN] 4.09% 2 4 0.419 Insulin receptor substrate 4 OS=Homo sapiens GN=IRS4 PE=1 SV=1 - O14654 9.71% 9 9 0.418 [IRS4_HUMAN] Very-long-chain 3-oxoacyl-CoA reductase OS=Homo sapiens GN=HSD17B12 PE=1 Q53GQ0 5.13% 1 1 0.417 SV=2 - [DHB12_HUMAN] Cytosol aminopeptidase OS=Homo sapiens GN=LAP3 PE=1 SV=3 - P28838 4.62% 2 2 0.416 [AMPL_HUMAN] NADH dehydrogenase [ubiquinone] iron-sulfur protein 3, mitochondrial OS=Homo O75489 4.92% 1 1 0.415 sapiens GN=NDUFS3 PE=1 SV=1 - [NDUS3_HUMAN] P78406 mRNA export factor OS=Homo sapiens GN=RAE1 PE=1 SV=1 - [RAE1L_HUMAN] 2.45% 1 1 0.415 G-rich sequence factor 1 OS=Homo sapiens GN=GRSF1 PE=1 SV=3 - Q12849 2.29% 1 1 0.414 [GRSF1_HUMAN] Microtubule-associated protein RP/EB family member 1 OS=Homo sapiens Q15691 20.52% 4 4 0.411 GN=MAPRE1 PE=1 SV=3 - [MARE1_HUMAN] AFG3-like protein 2 OS=Homo sapiens GN=AFG3L2 PE=1 SV=2 - Q9Y4W6 8.16% 4 4 0.408 [AFG32_HUMAN] O94905 Erlin-2 OS=Homo sapiens GN=ERLIN2 PE=1 SV=1 - [ERLN2_HUMAN] 25.66% 3 6 0.408

215

Chapter 8

Protein NipSnap homolog 2 OS=Homo sapiens GN=GBAS PE=1 SV=1 - O75323 6.99% 2 2 0.407 [NIPS2_HUMAN] ATPase family AAA domain-containing protein 3A OS=Homo sapiens GN=ATAD3A Q9NVI7 22.24% 3 13 0.399 PE=1 SV=2 - [ATD3A_HUMAN] Uncharacterized protein KIAA2013 OS=Homo sapiens GN=KIAA2013 PE=2 SV=1 - Q8IYS2 1.42% 1 1 0.397 [K2013_HUMAN] 39S ribosomal protein L12, mitochondrial OS=Homo sapiens GN=MRPL12 PE=1 P52815 32.83% 2 4 0.396 SV=2 - [RM12_HUMAN] Eukaryotic translation initiation factor 4H OS=Homo sapiens GN=EIF4H PE=1 SV=5 Q15056 15.32% 3 3 0.386 - [IF4H_HUMAN] Transmembrane protein 109 OS=Homo sapiens GN=TMEM109 PE=1 SV=1 - Q9BVC6 9.47% 3 3 0.385 [TM109_HUMAN] Adenylate kinase 2, mitochondrial OS=Homo sapiens GN=AK2 PE=1 SV=2 - P54819 43.10% 9 9 0.381 [KAD2_HUMAN] Oxygen-dependent coproporphyrinogen-III oxidase, mitochondrial OS=Homo P36551 6.39% 2 2 0.38 sapiens GN=CPOX PE=1 SV=3 - [HEM6_HUMAN] Histidine triad nucleotide-binding protein 2, mitochondrial OS=Homo sapiens Q9BX68 17.79% 1 1 0.377 GN=HINT2 PE=1 SV=1 - [HINT2_HUMAN] Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial OS=Homo sapiens Q9HCC0 1.60% 1 1 0.376 GN=MCCC2 PE=1 SV=1 - [MCCB_HUMAN] Nuclear pore complex protein Nup88 OS=Homo sapiens GN=NUP88 PE=1 SV=2 - Q99567 2.43% 1 1 0.371 [NUP88_HUMAN] Histone deacetylase complex subunit SAP130 OS=Homo sapiens GN=SAP130 Q9H0E3 1.15% 1 1 0.369 PE=1 SV=1 - [SP130_HUMAN] Macrophage migration inhibitory factor OS=Homo sapiens GN=MIF PE=1 SV=4 - P14174 32.17% 1 2 0.363 [MIF_HUMAN] Tryptophan--tRNA ligase, mitochondrial OS=Homo sapiens GN=WARS2 PE=1 Q9UGM6 2.78% 1 1 0.36 SV=1 - [SYWM_HUMAN] Chitobiosyldiphosphodolichol beta-mannosyltransferase OS=Homo sapiens Q9BT22 5.82% 3 3 0.354 GN=ALG1 PE=1 SV=2 - [ALG1_HUMAN] A-kinase anchor protein 1, mitochondrial OS=Homo sapiens GN=AKAP1 PE=1 Q92667 4.21% 2 2 0.353 SV=1 - [AKAP1_HUMAN] Procollagen-lysine,2-oxoglutarate 5-dioxygenase 1 OS=Homo sapiens GN=PLOD1 Q02809 0.96% 1 1 0.352 PE=1 SV=2 - [PLOD1_HUMAN]

216

Chapter 8

Growth arrest and DNA damage-inducible proteins-interacting protein 1 OS=Homo Q8TAE8 17.12% 3 3 0.35 sapiens GN=GADD45GIP1 PE=1 SV=1 - [G45IP_HUMAN] 40S ribosomal protein S16 OS=Homo sapiens GN=RPS16 PE=1 SV=2 - P62249 9.59% 1 1 0.348 [RS16_HUMAN] P30041 Peroxiredoxin-6 OS=Homo sapiens GN=PRDX6 PE=1 SV=3 - [PRDX6_HUMAN] 13.84% 2 2 0.347 Ubiquitin-associated protein 2-like OS=Homo sapiens GN=UBAP2L PE=1 SV=2 - Q14157 3.04% 2 2 0.332 [UBP2L_HUMAN] Melanoma inhibitory activity protein 3 OS=Homo sapiens GN=MIA3 PE=1 SV=1 - Q5JRA6 2.73% 3 3 0.33 [MIA3_HUMAN] OCIA domain-containing protein 1 OS=Homo sapiens GN=OCIAD1 PE=1 SV=1 - Q9NX40 25.31% 5 5 0.329 [OCAD1_HUMAN] Succinyl-CoA:3-ketoacid coenzyme A transferase 1, mitochondrial OS=Homo P55809 11.35% 3 3 0.3 sapiens GN=OXCT1 PE=1 SV=1 - [SCOT1_HUMAN] Cat eye syndrome critical region protein 5 OS=Homo sapiens GN=CECR5 PE=1 Q9BXW7 5.67% 2 2 0.284 SV=1 - [CECR5_HUMAN] Ancient ubiquitous protein 1 OS=Homo sapiens GN=AUP1 PE=1 SV=1 - Q9Y679 3.15% 1 1 0.273 [AUP1_HUMAN] ATPase family AAA domain-containing protein 1 OS=Homo sapiens GN=ATAD1 Q8NBU5 7.20% 1 1 0.27 PE=1 SV=1 - [ATAD1_HUMAN] Alpha-aminoadipic semialdehyde synthase, mitochondrial OS=Homo sapiens Q9UDR5 1.84% 1 1 0.268 GN=AASS PE=1 SV=1 - [AASS_HUMAN] Guanine nucleotide-binding protein G(s) subunit alpha isoforms short OS=Homo P63092 11.93% 2 5 0.266 sapiens GN=GNAS PE=1 SV=1 - [GNAS2_HUMAN] Threonine--tRNA ligase, mitochondrial OS=Homo sapiens GN=TARS2 PE=1 SV=1 - Q9BW92 5.71% 3 3 0.265 [SYTM_HUMAN] Fumarylacetoacetate hydrolase domain-containing protein 2A OS=Homo sapiens Q96GK7 3.82% 2 2 0.265 GN=FAHD2A PE=1 SV=1 - [FAH2A_HUMAN] 39S ribosomal protein L45, mitochondrial OS=Homo sapiens GN=MRPL45 PE=1 Q9BRJ2 14.05% 2 2 0.258 SV=2 - [RM45_HUMAN] Ribonucleoprotein PTB-binding 1 OS=Homo sapiens GN=RAVER1 PE=1 SV=1 - Q8IY67 2.15% 2 2 0.255 [RAVR1_HUMAN] ER membrane protein complex subunit 1 OS=Homo sapiens GN=EMC1 PE=1 SV=1 Q8N766 9.37% 5 5 0.254 - [EMC1_HUMAN] Q9UNK0 Syntaxin-8 OS=Homo sapiens GN=STX8 PE=1 SV=2 - [STX8_HUMAN] 7.63% 1 1 0.243

217

Chapter 8

Kunitz-type protease inhibitor 2 OS=Homo sapiens GN=SPINT2 PE=1 SV=2 - O43291 4.76% 1 1 0.241 [SPIT2_HUMAN] Thioredoxin-related transmembrane protein 2 OS=Homo sapiens GN=TMX2 PE=1 Q9Y320 9.12% 1 1 0.239 SV=1 - [TMX2_HUMAN] Protein transport protein Sec61 subunit beta OS=Homo sapiens GN=SEC61B PE=1 P60468 25.00% 1 1 0.239 SV=2 - [SC61B_HUMAN] Heme oxygenase 1 OS=Homo sapiens GN=HMOX1 PE=1 SV=1 - P09601 5.21% 1 1 0.239 [HMOX1_HUMAN] 39S ribosomal protein L19, mitochondrial OS=Homo sapiens GN=MRPL19 PE=1 P49406 3.08% 1 1 0.234 SV=2 - [RM19_HUMAN] Transmembrane and coiled-coil domain-containing protein 1 OS=Homo sapiens Q9UM00 10.64% 2 2 0.205 GN=TMCO1 PE=1 SV=1 - [TMCO1_HUMAN] P14209 CD99 antigen OS=Homo sapiens GN=CD99 PE=1 SV=1 - [CD99_HUMAN] 5.41% 1 1 0.196 P35611 Alpha-adducin OS=Homo sapiens GN=ADD1 PE=1 SV=2 - [ADDA_HUMAN] 6.11% 3 3 0.177 28S ribosomal protein S29, mitochondrial OS=Homo sapiens GN=DAP3 PE=1 SV=1 P51398 4.77% 1 1 0.149 - [RT29_HUMAN] Phosphatidylserine synthase 2 OS=Homo sapiens GN=PTDSS2 PE=1 SV=1 - Q9BVG9 7.80% 2 2 0.121 [PTSS2_HUMAN] Protein scribble homolog OS=Homo sapiens GN=SCRIB PE=1 SV=4 - Q14160 3.56% 3 3 0.068 [SCRIB_HUMAN] 1-acyl-sn-glycerol-3-phosphate acyltransferase alpha OS=Homo sapiens Q99943 8.13% 1 1 0.06 GN=AGPAT1 PE=1 SV=2 - [PLCA_HUMAN] *Light = control siRNA transfected HEK-293 cells; Heavy = MARCHF6 siRNA transfected HEK-293 cells

218

Chapter 8

Table 8.2 Mass spectrometry data from in-house MARCHF6 overexpression using SILAC Number Unique Medium/Heavy Accession Description Coverage of Peptides Ratio* Peptides Cleavage and polyadenylation specificity factor subunit 7 OS=Homo sapiens Q8N684 2.76% 1 1 0.166 GN=CPSF7 PE=1 SV=1 - [CPSF7_HUMAN] Insulin receptor substrate 4 OS=Homo sapiens GN=IRS4 PE=1 SV=1 - O14654 0.72% 1 1 0.28 [IRS4_HUMAN] SWI/SNF-related matrix-associated actin-dependent regulator of chromatin Q969G3 subfamily E member 1 OS=Homo sapiens GN=SMARCE1 PE=1 SV=2 - 7.06% 2 2 0.376 [SMCE1_HUMAN] O94905 Erlin-2 OS=Homo sapiens GN=ERLIN2 PE=1 SV=1 - [ERLN2_HUMAN] 5.60% 1 1 0.391 Nuclear mitotic apparatus protein 1 OS=Homo sapiens GN=NUMA1 PE=1 SV=2 - Q14980 1.32% 1 2 0.398 [NUMA1_HUMAN] ATP synthase subunit d, mitochondrial OS=Homo sapiens GN=ATP5H PE=1 SV=3 - O75947 23.60% 3 3 0.406 [ATP5H_HUMAN] Thyroid hormone receptor-associated protein 3 OS=Homo sapiens GN=THRAP3 Q9Y2W1 1.05% 1 1 0.411 PE=1 SV=2 - [TR150_HUMAN] Palmitoyl-protein thioesterase 1 OS=Homo sapiens GN=PPT1 PE=1 SV=1 - P50897 6.54% 1 1 0.437 [PPT1_HUMAN] Q14254 Flotillin-2 OS=Homo sapiens GN=FLOT2 PE=1 SV=2 - [FLOT2_HUMAN] 3.04% 1 1 0.439 General transcription factor II-I OS=Homo sapiens GN=GTF2I PE=1 SV=2 - P78347 3.91% 3 3 0.443 [GTF2I_HUMAN] Putative transferase CAF17, mitochondrial OS=Homo sapiens GN=IBA57 PE=1 Q5T440 4.21% 1 1 0.453 SV=1 - [CAF17_HUMAN] Transducin beta-like protein 2 OS=Homo sapiens GN=TBL2 PE=1 SV=1 - Q9Y4P3 4.47% 1 1 0.453 [TBL2_HUMAN] OCIA domain-containing protein 1 OS=Homo sapiens GN=OCIAD1 PE=1 SV=1 - Q9NX40 3.27% 1 1 0.456 [OCAD1_HUMAN] DnaJ homolog subfamily C member 7 OS=Homo sapiens GN=DNAJC7 PE=1 SV=2 Q99615 2.63% 1 1 0.456 - [DNJC7_HUMAN] Creatine kinase U-type, mitochondrial OS=Homo sapiens GN=CKMT1A PE=1 SV=1 P12532 10.55% 2 4 0.461 - [KCRU_HUMAN]

219

Chapter 8

Nodal modulator 3 OS=Homo sapiens GN=NOMO3 PE=3 SV=2 - P69849 2.29% 2 2 0.462 [NOMO3_HUMAN] Myb-binding protein 1A OS=Homo sapiens GN=MYBBP1A PE=1 SV=2 - Q9BQG0 1.96% 2 2 0.475 [MBB1A_HUMAN] Protein scribble homolog OS=Homo sapiens GN=SCRIB PE=1 SV=4 - Q14160 0.86% 1 1 0.489 [SCRIB_HUMAN] Guanine nucleotide-binding protein G(s) subunit alpha isoforms short OS=Homo P63092 8.88% 3 3 0.49 sapiens GN=GNAS PE=1 SV=1 - [GNAS2_HUMAN] Sister chromatid cohesion protein PDS5 homolog B OS=Homo sapiens GN=PDS5B Q9NTI5 2.35% 2 2 0.499 PE=1 SV=1 - [PDS5B_HUMAN] Q92797 Symplekin OS=Homo sapiens GN=SYMPK PE=1 SV=2 - [SYMPK_HUMAN] 1.02% 1 1 0.5 P50402 Emerin OS=Homo sapiens GN=EMD PE=1 SV=1 - [EMD_HUMAN] 22.44% 4 4 0.506 Q13162 Peroxiredoxin-4 OS=Homo sapiens GN=PRDX4 PE=1 SV=1 - [PRDX4_HUMAN] 11.07% 1 3 0.509 Cytosol aminopeptidase OS=Homo sapiens GN=LAP3 PE=1 SV=3 - P28838 4.62% 1 1 0.509 [AMPL_HUMAN] Ceroid-lipofuscinosis neuronal protein 6 OS=Homo sapiens GN=CLN6 PE=1 SV=1 - Q9NWW5 6.75% 1 1 0.511 [CLN6_HUMAN] GRIP and coiled-coil domain-containing protein 2 OS=Homo sapiens GN=GCC2 Q8IWJ2 0.65% 1 1 0.515 PE=1 SV=4 - [GCC2_HUMAN] Ras-related protein Rap-1b-like protein OS=Homo sapiens PE=2 SV=1 - A6NIZ1 7.61% 1 1 0.515 [RP1BL_HUMAN] Zinc phosphodiesterase ELAC protein 2 OS=Homo sapiens GN=ELAC2 PE=1 SV=2 Q9BQ52 2.66% 1 2 0.515 - [RNZ2_HUMAN] Extended synaptotagmin-1 OS=Homo sapiens GN=ESYT1 PE=1 SV=1 - Q9BSJ8 10.87% 10 10 0.517 [ESYT1_HUMAN] Keratin, type I cytoskeletal 19 OS=Homo sapiens GN=KRT19 PE=1 SV=4 - P08727 11.25% 1 4 0.528 [K1C19_HUMAN] ER membrane protein complex subunit 10 OS=Homo sapiens GN=EMC10 PE=1 Q5UCC4 6.49% 1 1 0.528 SV=1 - [EMC10_HUMAN] Growth arrest and DNA damage-inducible proteins-interacting protein 1 OS=Homo Q8TAE8 16.22% 2 2 0.532 sapiens GN=GADD45GIP1 PE=1 SV=1 - [G45IP_HUMAN] 3-hydroxyacyl-CoA dehydrogenase type-2 OS=Homo sapiens GN=HSD17B10 PE=1 Q99714 7.66% 1 1 0.537 SV=3 - [HCD2_HUMAN]

220

Chapter 8

28S ribosomal protein S27, mitochondrial OS=Homo sapiens GN=MRPS27 PE=1 Q92552 2.66% 1 1 0.544 SV=3 - [RT27_HUMAN] P27824 Calnexin OS=Homo sapiens GN=CANX PE=1 SV=2 - [CALX_HUMAN] 4.90% 2 2 0.556 Band 4.1-like protein 3 OS=Homo sapiens GN=EPB41L3 PE=1 SV=2 - Q9Y2J2 2.76% 2 2 0.565 [E41L3_HUMAN] Electron transfer flavoprotein subunit beta OS=Homo sapiens GN=ETFB PE=1 P38117 35.29% 5 5 0.565 SV=3 - [ETFB_HUMAN] HLA class I histocompatibility antigen, Cw-7 alpha chain OS=Homo sapiens P10321 5.74% 1 2 0.566 GN=HLA-C PE=1 SV=3 - [1C07_HUMAN] Q14739 Lamin-B receptor OS=Homo sapiens GN=LBR PE=1 SV=2 - [LBR_HUMAN] 11.22% 5 5 0.572 P04040 Catalase OS=Homo sapiens GN=CAT PE=1 SV=3 - [CATA_HUMAN] 7.78% 2 2 0.573 Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit 2 OS=Homo P04844 7.77% 2 2 0.575 sapiens GN=RPN2 PE=1 SV=3 - [RPN2_HUMAN] Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 OS=Homo sapiens P16615 6.91% 4 4 0.58 GN=ATP2A2 PE=1 SV=1 - [AT2A2_HUMAN] Paired amphipathic helix protein Sin3a OS=Homo sapiens GN=SIN3A PE=1 SV=2 - Q96ST3 2.59% 2 2 0.581 [SIN3A_HUMAN] Heterogeneous nuclear ribonucleoproteins C1/C2 OS=Homo sapiens GN=HNRNPC P07910 14.71% 3 3 0.584 PE=1 SV=4 - [HNRPC_HUMAN] O75976 Carboxypeptidase D OS=Homo sapiens GN=CPD PE=1 SV=2 - [CBPD_HUMAN] 2.90% 4 5 0.586 Procollagen galactosyltransferase 1 OS=Homo sapiens GN=COLGALT1 PE=1 Q8NBJ5 4.50% 2 2 0.587 SV=1 - [GT251_HUMAN] Golgin subfamily B member 1 OS=Homo sapiens GN=GOLGB1 PE=1 SV=2 - Q14789 1.20% 2 2 0.59 [GOGB1_HUMAN] P19367 Hexokinase-1 OS=Homo sapiens GN=HK1 PE=1 SV=3 - [HXK1_HUMAN] 5.23% 3 4 0.596 Sodium/potassium-transporting ATPase subunit alpha-1 OS=Homo sapiens P05023 11.53% 9 10 0.596 GN=ATP1A1 PE=1 SV=1 - [AT1A1_HUMAN] P16949 Stathmin OS=Homo sapiens GN=STMN1 PE=1 SV=3 - [STMN1_HUMAN] 12.75% 1 2 0.596 Medium-chain specific acyl-CoA dehydrogenase, mitochondrial OS=Homo sapiens P11310 7.36% 3 3 0.599 GN=ACADM PE=1 SV=1 - [ACADM_HUMAN] Q9NRG9 Aladin OS=Homo sapiens GN=AAAS PE=1 SV=1 - [AAAS_HUMAN] 3.48% 2 2 0.599 Serine--tRNA ligase, mitochondrial OS=Homo sapiens GN=SARS2 PE=1 SV=1 - Q9NP81 9.27% 3 3 0.601 [SYSM_HUMAN] 221

Chapter 8

Enoyl-CoA hydratase, mitochondrial OS=Homo sapiens GN=ECHS1 PE=1 SV=4 - P30084 12.41% 3 3 0.605 [ECHM_HUMAN] Histidine triad nucleotide-binding protein 2, mitochondrial OS=Homo sapiens Q9BX68 17.79% 1 1 0.607 GN=HINT2 PE=1 SV=1 - [HINT2_HUMAN] Nuclear pore membrane glycoprotein 210 OS=Homo sapiens GN=NUP210 PE=1 Q8TEM1 0.53% 1 1 0.608 SV=3 - [PO210_HUMAN] Neutral amino acid transporter B(0) OS=Homo sapiens GN=SLC1A5 PE=1 SV=2 - Q15758 5.91% 2 2 0.609 [AAAT_HUMAN] Transmembrane protein 109 OS=Homo sapiens GN=TMEM109 PE=1 SV=1 - Q9BVC6 4.94% 1 1 0.614 [TM109_HUMAN] Heterogeneous nuclear ribonucleoprotein A1 OS=Homo sapiens GN=HNRNPA1 P09651 26.08% 7 7 0.617 PE=1 SV=5 - [ROA1_HUMAN] Heterogeneous nuclear ribonucleoproteins A2/B1 OS=Homo sapiens P22626 33.99% 10 12 0.617 GN=HNRNPA2B1 PE=1 SV=2 - [ROA2_HUMAN] P11171 Protein 4.1 OS=Homo sapiens GN=EPB41 PE=1 SV=4 - [41_HUMAN] 7.29% 2 3 0.618 Melanoma inhibitory activity protein 3 OS=Homo sapiens GN=MIA3 PE=1 SV=1 - Q5JRA6 1.84% 2 2 0.619 [MIA3_HUMAN] P35221 Catenin alpha-1 OS=Homo sapiens GN=CTNNA1 PE=1 SV=1 - [CTNA1_HUMAN] 2.76% 2 2 0.622 Solute carrier family 12 member 2 OS=Homo sapiens GN=SLC12A2 PE=1 SV=1 - P55011 2.72% 1 2 0.622 [S12A2_HUMAN] Receptor-type tyrosine-protein phosphatase F OS=Homo sapiens GN=PTPRF PE=1 P10586 1.05% 1 1 0.623 SV=2 - [PTPRF_HUMAN] AT-rich interactive domain-containing protein 1A OS=Homo sapiens GN=ARID1A O14497 1.44% 2 2 0.624 PE=1 SV=3 - [ARI1A_HUMAN] P35659 Protein DEK OS=Homo sapiens GN=DEK PE=1 SV=1 - [DEK_HUMAN] 3.20% 1 1 0.624 Q16643 Drebrin OS=Homo sapiens GN=DBN1 PE=1 SV=4 - [DREB_HUMAN] 2.47% 1 1 0.627 Ras-related protein Rab-5A OS=Homo sapiens GN=RAB5A PE=1 SV=2 - P20339 9.77% 1 1 0.629 [RAB5A_HUMAN] 5'-3' exoribonuclease 2 OS=Homo sapiens GN=XRN2 PE=1 SV=1 - Q9H0D6 2.63% 1 2 0.629 [XRN2_HUMAN] Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, mitochondrial OS=Homo P21912 7.14% 2 2 0.63 sapiens GN=SDHB PE=1 SV=3 - [SDHB_HUMAN] Ras-related protein Rab-5C OS=Homo sapiens GN=RAB5C PE=1 SV=2 - P51148 6.48% 2 2 0.63 [RAB5C_HUMAN] 222

Chapter 8

NAD kinase 2, mitochondrial OS=Homo sapiens GN=NADK2 PE=1 SV=2 - Q4G0N4 3.39% 1 1 0.631 [NAKD2_HUMAN] Polyribonucleotide nucleotidyltransferase 1, mitochondrial OS=Homo sapiens Q8TCS8 1.53% 1 2 0.634 GN=PNPT1 PE=1 SV=2 - [PNPT1_HUMAN] Q86UP2 Kinectin OS=Homo sapiens GN=KTN1 PE=1 SV=1 - [KTN1_HUMAN] 4.64% 5 5 0.634 ATP synthase subunit O, mitochondrial OS=Homo sapiens GN=ATP5O PE=1 SV=1 P48047 15.96% 3 3 0.634 - [ATPO_HUMAN] Probable global transcription activator SNF2L2 OS=Homo sapiens GN=SMARCA2 P51531 1.01% 1 1 0.635 PE=1 SV=2 - [SMCA2_HUMAN] Mitochondrial import inner membrane translocase subunit TIM50 OS=Homo sapiens Q3ZCQ8 10.76% 4 4 0.639 GN=TIMM50 PE=1 SV=2 - [TIM50_HUMAN] 39S ribosomal protein L15, mitochondrial OS=Homo sapiens GN=MRPL15 PE=1 Q9P015 3.38% 1 1 0.64 SV=1 - [RM15_HUMAN] Membrane-associated progesterone receptor component 1 OS=Homo sapiens O00264 16.41% 1 3 0.641 GN=PGRMC1 PE=1 SV=3 - [PGRC1_HUMAN] Ceramide synthase 2 OS=Homo sapiens GN=CERS2 PE=1 SV=1 - Q96G23 2.37% 1 1 0.641 [CERS2_HUMAN] G2/mitotic-specific cyclin-B1 OS=Homo sapiens GN=CCNB1 PE=1 SV=1 - P14635 3.93% 1 1 0.642 [CCNB1_HUMAN] Polyadenylate-binding protein 2 OS=Homo sapiens GN=PABPN1 PE=1 SV=3 - Q86U42 3.59% 1 1 0.645 [PABP2_HUMAN] Dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate P36957 dehydrogenase complex, mitochondrial OS=Homo sapiens GN=DLST PE=1 SV=4 - 2.21% 1 1 0.646 [ODO2_HUMAN] Serine/arginine-rich splicing factor 3 OS=Homo sapiens GN=SRSF3 PE=1 SV=1 - P84103 22.56% 3 3 0.647 [SRSF3_HUMAN] P05556 Integrin beta-1 OS=Homo sapiens GN=ITGB1 PE=1 SV=2 - [ITB1_HUMAN] 2.13% 1 1 0.651 Aconitate hydratase, mitochondrial OS=Homo sapiens GN=ACO2 PE=1 SV=2 - Q99798 3.59% 2 2 0.652 [ACON_HUMAN] Apoptosis-inducing factor 1, mitochondrial OS=Homo sapiens GN=AIFM1 PE=1 O95831 17.78% 4 7 0.653 SV=1 - [AIFM1_HUMAN] Serine/threonine-protein kinase MAK OS=Homo sapiens GN=MAK PE=1 SV=2 - P20794 2.57% 1 2 0.654 [MAK_HUMAN]

223

Chapter 8

26S proteasome non-ATPase regulatory subunit 6 OS=Homo sapiens GN=PSMD6 Q15008 7.71% 2 2 0.654 PE=1 SV=1 - [PSMD6_HUMAN] Q9H9B4 Sideroflexin-1 OS=Homo sapiens GN=SFXN1 PE=1 SV=4 - [SFXN1_HUMAN] 12.73% 5 5 0.655 Q27J81 Inverted formin-2 OS=Homo sapiens GN=INF2 PE=1 SV=2 - [INF2_HUMAN] 2.48% 2 2 0.657 Dolichyl-diphosphooligosaccharide--protein glycosyltransferase 48 kDa subunit P39656 7.68% 3 3 0.658 OS=Homo sapiens GN=DDOST PE=1 SV=4 - [OST48_HUMAN] HLA class I histocompatibility antigen, A-68 alpha chain OS=Homo sapiens P01891 6.85% 1 2 0.659 GN=HLA-A PE=1 SV=4 - [1A68_HUMAN] Electron transfer flavoprotein subunit alpha, mitochondrial OS=Homo sapiens P13804 12.31% 2 2 0.661 GN=ETFA PE=1 SV=1 - [ETFA_HUMAN] Chitobiosyldiphosphodolichol beta-mannosyltransferase OS=Homo sapiens Q9BT22 3.23% 1 1 0.661 GN=ALG1 PE=1 SV=2 - [ALG1_HUMAN] Leucine-rich PPR motif-containing protein, mitochondrial OS=Homo sapiens P42704 9.68% 10 12 0.662 GN=LRPPRC PE=1 SV=3 - [LPPRC_HUMAN] Heterogeneous nuclear ribonucleoprotein A/B OS=Homo sapiens GN=HNRNPAB Q99729 13.55% 3 4 0.662 PE=1 SV=2 - [ROAA_HUMAN] Acetyl-CoA acetyltransferase, mitochondrial OS=Homo sapiens GN=ACAT1 PE=1 P24752 19.44% 8 10 0.664 SV=1 - [THIL_HUMAN] Superkiller viralicidic activity 2-like 2 OS=Homo sapiens GN=SKIV2L2 PE=1 SV=3 - P42285 1.63% 1 1 0.668 [SK2L2_HUMAN] Leucine-rich repeat-containing protein 59 OS=Homo sapiens GN=LRRC59 PE=1 Q96AG4 19.54% 5 5 0.67 SV=1 - [LRC59_HUMAN] Heterogeneous nuclear ribonucleoprotein A3 OS=Homo sapiens GN=HNRNPA3 P51991 6.35% 2 2 0.67 PE=1 SV=2 - [ROA3_HUMAN] Peptidyl-prolyl cis-trans isomerase F, mitochondrial OS=Homo sapiens GN=PPIF P30405 15.94% 3 3 0.67 PE=1 SV=1 - [PPIF_HUMAN] Double-stranded RNA-specific adenosine deaminase OS=Homo sapiens GN=ADAR P55265 4.32% 4 4 0.672 PE=1 SV=4 - [DSRAD_HUMAN] Pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial P08559 5.38% 2 2 0.674 OS=Homo sapiens GN=PDHA1 PE=1 SV=3 - [ODPA_HUMAN] Nucleoside diphosphate kinase A OS=Homo sapiens GN=NME1 PE=1 SV=1 - P15531 7.89% 1 1 0.676 [NDKA_HUMAN] Q969V3 Nicalin OS=Homo sapiens GN=NCLN PE=1 SV=2 - [NCLN_HUMAN] 1.42% 1 1 0.676

224

Chapter 8

ATPase family AAA domain-containing protein 3A OS=Homo sapiens GN=ATAD3A Q9NVI7 19.56% 2 12 0.678 PE=1 SV=2 - [ATD3A_HUMAN] ADP/ATP translocase 3 OS=Homo sapiens GN=SLC25A6 PE=1 SV=4 - P12236 9.06% 1 5 0.678 [ADT3_HUMAN] Ras-related protein Rab-11A OS=Homo sapiens GN=RAB11A PE=1 SV=3 - P62491 12.50% 2 2 0.681 [RB11A_HUMAN] Glutamate dehydrogenase 1, mitochondrial OS=Homo sapiens GN=GLUD1 PE=1 P00367 11.83% 5 5 0.681 SV=2 - [DHE3_HUMAN] Stomatin-like protein 2, mitochondrial OS=Homo sapiens GN=STOML2 PE=1 SV=1 Q9UJZ1 16.01% 4 4 0.683 - [STML2_HUMAN] Spectrin alpha chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTAN1 PE=1 Q13813 6.47% 11 11 0.684 SV=3 - [SPTN1_HUMAN] Tyrosine--tRNA ligase, mitochondrial OS=Homo sapiens GN=YARS2 PE=1 SV=2 - Q9Y2Z4 5.66% 2 2 0.684 [SYYM_HUMAN] Aspartate aminotransferase, mitochondrial OS=Homo sapiens GN=GOT2 PE=1 P00505 12.79% 4 4 0.687 SV=3 - [AATM_HUMAN] Spectrin beta chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTBN1 PE=1 SV=2 Q01082 8.12% 13 14 0.689 - [SPTB2_HUMAN] ADP/ATP translocase 2 OS=Homo sapiens GN=SLC25A5 PE=1 SV=7 - P05141 13.42% 2 5 0.69 [ADT2_HUMAN] Serine/threonine-protein phosphatase PGAM5, mitochondrial OS=Homo sapiens Q96HS1 3.46% 1 1 0.691 GN=PGAM5 PE=1 SV=2 - [PGAM5_HUMAN] U4/U6.U5 tri-snRNP-associated protein 1 OS=Homo sapiens GN=SART1 PE=1 O43290 4.50% 2 3 0.692 SV=1 - [SNUT1_HUMAN] Phosphate carrier protein, mitochondrial OS=Homo sapiens GN=SLC25A3 PE=1 Q00325 3.87% 2 2 0.692 SV=2 - [MPCP_HUMAN] Q15717 ELAV-like protein 1 OS=Homo sapiens GN=ELAVL1 PE=1 SV=2 - [ELAV1_HUMAN] 3.37% 1 1 0.692 Trifunctional enzyme subunit beta, mitochondrial OS=Homo sapiens GN=HADHB P55084 5.70% 2 2 0.695 PE=1 SV=3 - [ECHB_HUMAN] ATP synthase subunit beta, mitochondrial OS=Homo sapiens GN=ATP5B PE=1 P06576 47.64% 22 22 0.695 SV=3 - [ATPB_HUMAN] Endoplasmic reticulum resident protein 29 OS=Homo sapiens GN=ERP29 PE=1 P30040 4.21% 2 2 0.695 SV=4 - [ERP29_HUMAN] Elongation factor Tu, mitochondrial OS=Homo sapiens GN=TUFM PE=1 SV=2 - P49411 31.86% 14 14 0.695 [EFTU_HUMAN] 225

Chapter 8

MICOS complex subunit MIC60 OS=Homo sapiens GN=IMMT PE=1 SV=1 - Q16891 7.39% 3 3 0.696 [MIC60_HUMAN] ATP synthase subunit e, mitochondrial OS=Homo sapiens GN=ATP5I PE=1 SV=2 - P56385 18.84% 2 2 0.696 [ATP5I_HUMAN] Thioredoxin-related transmembrane protein 1 OS=Homo sapiens GN=TMX1 PE=1 Q9H3N1 3.93% 1 1 0.696 SV=1 - [TMX1_HUMAN] Band 4.1-like protein 2 OS=Homo sapiens GN=EPB41L2 PE=1 SV=1 - O43491 1.69% 1 1 0.697 [E41L2_HUMAN] Thioredoxin-dependent peroxide reductase, mitochondrial OS=Homo sapiens P30048 3.91% 1 2 0.699 GN=PRDX3 PE=1 SV=3 - [PRDX3_HUMAN] Q13948 Protein CASP OS=Homo sapiens GN=CUX1 PE=1 SV=2 - [CASP_HUMAN] 2.65% 1 2 0.702 Interleukin enhancer-binding factor 2 OS=Homo sapiens GN=ILF2 PE=1 SV=2 - Q12905 4.36% 1 1 0.705 [ILF2_HUMAN] Citrate synthase, mitochondrial OS=Homo sapiens GN=CS PE=1 SV=2 - O75390 10.52% 6 6 0.706 [CISY_HUMAN] Ornithine aminotransferase, mitochondrial OS=Homo sapiens GN=OAT PE=1 SV=1 P04181 21.18% 8 8 0.706 - [OAT_HUMAN] NAD-dependent malic enzyme, mitochondrial OS=Homo sapiens GN=ME2 PE=1 P23368 5.99% 3 4 0.709 SV=1 - [MAOM_HUMAN] P49257 Protein ERGIC-53 OS=Homo sapiens GN=LMAN1 PE=1 SV=2 - [LMAN1_HUMAN] 4.12% 3 3 0.71 Succinyl-CoA ligase [ADP-forming] subunit beta, mitochondrial OS=Homo sapiens Q9P2R7 2.16% 1 1 0.711 GN=SUCLA2 PE=1 SV=3 - [SUCB1_HUMAN] Protein SCO1 homolog, mitochondrial OS=Homo sapiens GN=SCO1 PE=1 SV=1 - O75880 5.32% 1 1 0.714 [SCO1_HUMAN] ATP-dependent Clp protease ATP-binding subunit clpX-like, mitochondrial O76031 6.00% 3 3 0.714 OS=Homo sapiens GN=CLPX PE=1 SV=2 - [CLPX_HUMAN] P14625 Endoplasmin OS=Homo sapiens GN=HSP90B1 PE=1 SV=1 - [ENPL_HUMAN] 37.73% 29 31 0.719 THO complex subunit 4 OS=Homo sapiens GN=ALYREF PE=1 SV=3 - Q86V81 17.90% 5 6 0.72 [THOC4_HUMAN] Transcription elongation factor SPT6 OS=Homo sapiens GN=SUPT6H PE=1 SV=2 - Q7KZ85 1.22% 1 1 0.721 [SPT6H_HUMAN] Protein disulfide-isomerase A4 OS=Homo sapiens GN=PDIA4 PE=1 SV=2 - P13667 17.98% 11 12 0.721 [PDIA4_HUMAN] Q01085 Nucleolysin TIAR OS=Homo sapiens GN=TIAL1 PE=1 SV=1 - [TIAR_HUMAN] 6.13% 2 2 0.724 226

Chapter 8

Zinc finger RNA-binding protein OS=Homo sapiens GN=ZFR PE=1 SV=2 - Q96KR1 1.58% 1 1 0.725 [ZFR_HUMAN] P43243 Matrin-3 OS=Homo sapiens GN=MATR3 PE=1 SV=2 - [MATR3_HUMAN] 7.79% 5 5 0.725 Early endosome antigen 1 OS=Homo sapiens GN=EEA1 PE=1 SV=2 - Q15075 2.98% 2 4 0.731 [EEA1_HUMAN] Hydroxysteroid dehydrogenase-like protein 2 OS=Homo sapiens GN=HSDL2 PE=1 Q6YN16 4.31% 1 1 0.731 SV=1 - [HSDL2_HUMAN] NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 7 OS=Homo sapiens P17568 9.49% 1 1 0.731 GN=NDUFB7 PE=1 SV=4 - [NDUB7_HUMAN] Polypyrimidine tract-binding protein 1 OS=Homo sapiens GN=PTBP1 PE=1 SV=1 - P26599 16.95% 10 10 0.734 [PTBP1_HUMAN] Signal recognition particle receptor subunit beta OS=Homo sapiens GN=SRPRB Q9Y5M8 13.65% 4 4 0.734 PE=1 SV=3 - [SRPRB_HUMAN] DNA-directed RNA polymerase II subunit RPB2 OS=Homo sapiens GN=POLR2B P30876 3.41% 2 3 0.735 PE=1 SV=1 - [RPB2_HUMAN] Protein disulfide-isomerase OS=Homo sapiens GN=P4HB PE=1 SV=3 - P07237 32.87% 16 16 0.738 [PDIA1_HUMAN] Protein disulfide-isomerase A3 OS=Homo sapiens GN=PDIA3 PE=1 SV=4 - P30101 35.84% 17 19 0.74 [PDIA3_HUMAN] Beta-1,4-glucuronyltransferase 1 OS=Homo sapiens GN=B4GAT1 PE=1 SV=1 - O43505 6.99% 2 2 0.74 [B4GA1_HUMAN] P50454 Serpin H1 OS=Homo sapiens GN=SERPINH1 PE=1 SV=2 - [SERPH_HUMAN] 10.05% 2 2 0.74 Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit 1 OS=Homo P04843 17.30% 8 9 0.74 sapiens GN=RPN1 PE=1 SV=1 - [RPN1_HUMAN] Vesicle-trafficking protein SEC22b OS=Homo sapiens GN=SEC22B PE=1 SV=4 - O75396 23.72% 2 3 0.74 [SC22B_HUMAN] TAR DNA-binding protein 43 OS=Homo sapiens GN=TARDBP PE=1 SV=1 - Q13148 8.70% 2 4 0.742 [TADBP_HUMAN] Serine/arginine repetitive matrix protein 2 OS=Homo sapiens GN=SRRM2 PE=1 Q9UQ35 4.80% 9 9 0.743 SV=2 - [SRRM2_HUMAN] Myelin expression factor 2 OS=Homo sapiens GN=MYEF2 PE=1 SV=3 - Q9P2K5 3.33% 1 2 0.743 [MYEF2_HUMAN] Exosome component 10 OS=Homo sapiens GN=EXOSC10 PE=1 SV=2 - Q01780 1.13% 1 1 0.745 [EXOSX_HUMAN]

227

Chapter 8

Heterogeneous nuclear ribonucleoprotein M OS=Homo sapiens GN=HNRNPM P52272 21.78% 14 16 0.748 PE=1 SV=3 - [HNRPM_HUMAN] Heat shock protein 75 kDa, mitochondrial OS=Homo sapiens GN=TRAP1 PE=1 Q12931 25.28% 17 18 0.748 SV=3 - [TRAP1_HUMAN] Uncharacterized protein C7orf50 OS=Homo sapiens GN=C7orf50 PE=1 SV=1 - Q9BRJ6 4.64% 1 1 0.748 [CG050_HUMAN] Chromodomain-helicase-DNA-binding protein 4 OS=Homo sapiens GN=CHD4 PE=1 Q14839 1.57% 2 2 0.751 SV=2 - [CHD4_HUMAN] RNA-binding protein 4 OS=Homo sapiens GN=RBM4 PE=1 SV=1 - Q9BWF3 13.46% 3 3 0.751 [RBM4_HUMAN] Alanine--tRNA ligase, mitochondrial OS=Homo sapiens GN=AARS2 PE=1 SV=1 - Q5JTZ9 1.32% 1 1 0.752 [SYAM_HUMAN] MICOS complex subunit MIC19 OS=Homo sapiens GN=CHCHD3 PE=1 SV=1 - Q9NX63 22.03% 4 4 0.754 [MIC19_HUMAN] Stress-70 protein, mitochondrial OS=Homo sapiens GN=HSPA9 PE=1 SV=2 - P38646 29.60% 23 23 0.756 [GRP75_HUMAN] RNA-binding protein 27 OS=Homo sapiens GN=RBM27 PE=1 SV=2 - Q9P2N5 3.68% 2 3 0.756 [RBM27_HUMAN] 78 kDa glucose-regulated protein OS=Homo sapiens GN=HSPA5 PE=1 SV=2 - P11021 48.17% 26 27 0.757 [GRP78_HUMAN] ATP synthase subunit alpha, mitochondrial OS=Homo sapiens GN=ATP5A1 PE=1 P25705 38.88% 30 32 0.758 SV=1 - [ATPA_HUMAN] Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial P31040 5.87% 4 4 0.759 OS=Homo sapiens GN=SDHA PE=1 SV=2 - [SDHA_HUMAN] Single-stranded DNA-binding protein, mitochondrial OS=Homo sapiens GN=SSBP1 Q04837 20.95% 2 2 0.759 PE=1 SV=1 - [SSBP_HUMAN] Neutral alpha-glucosidase AB OS=Homo sapiens GN=GANAB PE=1 SV=3 - Q14697 9.22% 7 8 0.761 [GANAB_HUMAN] Serine/arginine-rich splicing factor 7 OS=Homo sapiens GN=SRSF7 PE=1 SV=1 - Q16629 13.45% 3 3 0.761 [SRSF7_HUMAN] ATP-dependent RNA helicase A OS=Homo sapiens GN=DHX9 PE=1 SV=4 - Q08211 7.48% 10 10 0.763 [DHX9_HUMAN] P35232 Prohibitin OS=Homo sapiens GN=PHB PE=1 SV=1 - [PHB_HUMAN] 55.88% 13 13 0.763 Q5JTH9 RRP12-like protein OS=Homo sapiens GN=RRP12 PE=1 SV=2 - [RRP12_HUMAN] 1.54% 1 1 0.764

228

Chapter 8

Dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase P10515 complex, mitochondrial OS=Homo sapiens GN=DLAT PE=1 SV=3 - 4.33% 2 2 0.764 [ODP2_HUMAN] Voltage-dependent anion-selective channel protein 2 OS=Homo sapiens P45880 10.20% 3 3 0.764 GN=VDAC2 PE=1 SV=2 - [VDAC2_HUMAN] UBX domain-containing protein 4 OS=Homo sapiens GN=UBXN4 PE=1 SV=2 - Q92575 2.36% 1 1 0.764 [UBXN4_HUMAN] ATPase family AAA domain-containing protein 3B OS=Homo sapiens GN=ATAD3B Q5T9A4 14.97% 1 11 0.765 PE=1 SV=1 - [ATD3B_HUMAN] 3-ketoacyl-CoA thiolase, mitochondrial OS=Homo sapiens GN=ACAA2 PE=1 SV=2 - P42765 18.14% 3 3 0.765 [THIM_HUMAN] Cytoskeleton-associated protein 4 OS=Homo sapiens GN=CKAP4 PE=1 SV=2 - Q07065 26.74% 11 12 0.766 [CKAP4_HUMAN] Bifunctional methylenetetrahydrofolate dehydrogenase/cyclohydrolase, mitochondrial P13995 8.00% 2 2 0.766 OS=Homo sapiens GN=MTHFD2 PE=1 SV=2 - [MTDC_HUMAN] Lamina-associated polypeptide 2, isoforms beta/gamma OS=Homo sapiens P42167 22.47% 9 9 0.767 GN=TMPO PE=1 SV=2 - [LAP2B_HUMAN] Elongation factor Ts, mitochondrial OS=Homo sapiens GN=TSFM PE=1 SV=2 - P43897 8.31% 1 1 0.767 [EFTS_HUMAN] GrpE protein homolog 1, mitochondrial OS=Homo sapiens GN=GRPEL1 PE=1 Q9HAV7 11.06% 2 2 0.768 SV=2 - [GRPE1_HUMAN] RNA binding protein fox-1 homolog 2 OS=Homo sapiens GN=RBFOX2 PE=1 SV=3 - O43251 7.95% 3 3 0.768 [RFOX2_HUMAN] NADPH:adrenodoxin oxidoreductase, mitochondrial OS=Homo sapiens GN=FDXR P22570 4.28% 2 3 0.768 PE=1 SV=3 - [ADRO_HUMAN] Lon protease homolog, mitochondrial OS=Homo sapiens GN=LONP1 PE=1 SV=2 - P36776 1.04% 1 1 0.769 [LONM_HUMAN] Voltage-dependent anion-selective channel protein 3 OS=Homo sapiens Q9Y277 3.89% 1 1 0.77 GN=VDAC3 PE=1 SV=1 - [VDAC3_HUMAN] Pyruvate dehydrogenase E1 component subunit beta, mitochondrial OS=Homo P11177 9.75% 2 2 0.77 sapiens GN=PDHB PE=1 SV=3 - [ODPB_HUMAN] Glucosidase 2 subunit beta OS=Homo sapiens GN=PRKCSH PE=1 SV=2 - P14314 3.79% 3 3 0.773 [GLU2B_HUMAN] Keratin, type I cytoskeletal 18 OS=Homo sapiens GN=KRT18 PE=1 SV=2 - P05783 19.07% 4 6 0.775 [K1C18_HUMAN] 229

Chapter 8

Lethal(2) giant larvae protein homolog 1 OS=Homo sapiens GN=LLGL1 PE=1 SV=3 Q15334 1.13% 1 1 0.775 - [L2GL1_HUMAN] Voltage-dependent anion-selective channel protein 1 OS=Homo sapiens P21796 26.50% 4 4 0.776 GN=VDAC1 PE=1 SV=2 - [VDAC1_HUMAN] Heterogeneous nuclear ribonucleoprotein A0 OS=Homo sapiens GN=HNRNPA0 Q13151 5.90% 2 2 0.778 PE=1 SV=1 - [ROA0_HUMAN] HLA class I histocompatibility antigen, Cw-17 alpha chain OS=Homo sapiens Q95604 3.23% 1 1 0.779 GN=HLA-C PE=1 SV=1 - [1C17_HUMAN] RNA-binding motif protein, X chromosome OS=Homo sapiens GN=RBMX PE=1 P38159 4.09% 1 1 0.779 SV=3 - [RBMX_HUMAN] Q99623 Prohibitin-2 OS=Homo sapiens GN=PHB2 PE=1 SV=2 - [PHB2_HUMAN] 33.78% 11 11 0.779 Small nuclear ribonucleoprotein Sm D1 OS=Homo sapiens GN=SNRPD1 PE=1 P62314 15.13% 2 2 0.779 SV=1 - [SMD1_HUMAN] NAD(P) transhydrogenase, mitochondrial OS=Homo sapiens GN=NNT PE=1 SV=3 - Q13423 5.43% 3 3 0.781 [NNTM_HUMAN] Serine/threonine-protein phosphatase 2A 65 kDa regulatory subunit A alpha isoform P30153 3.40% 2 2 0.781 OS=Homo sapiens GN=PPP2R1A PE=1 SV=4 - [2AAA_HUMAN] Dihydrolipoyl dehydrogenase, mitochondrial OS=Homo sapiens GN=DLD PE=1 P09622 12.77% 6 6 0.783 SV=2 - [DLDH_HUMAN] 60S ribosomal protein L7 OS=Homo sapiens GN=RPL7 PE=1 SV=1 - P18124 12.10% 2 2 0.783 [RL7_HUMAN] Heterogeneous nuclear ribonucleoprotein L OS=Homo sapiens GN=HNRNPL PE=1 P14866 6.79% 6 6 0.783 SV=2 - [HNRPL_HUMAN] Protein disulfide-isomerase A6 OS=Homo sapiens GN=PDIA6 PE=1 SV=1 - Q15084 20.00% 6 8 0.786 [PDIA6_HUMAN] ES1 protein homolog, mitochondrial OS=Homo sapiens GN=C21orf33 PE=1 SV=3 - P30042 26.87% 4 4 0.792 [ES1_HUMAN] 39S ribosomal protein L18, mitochondrial OS=Homo sapiens GN=MRPL18 PE=1 Q9H0U6 16.67% 2 2 0.793 SV=1 - [RM18_HUMAN] 60 kDa heat shock protein, mitochondrial OS=Homo sapiens GN=HSPD1 PE=1 P10809 53.93% 44 44 0.795 SV=2 - [CH60_HUMAN] Ribosome-binding protein 1 OS=Homo sapiens GN=RRBP1 PE=1 SV=4 - Q9P2E9 1.13% 1 1 0.795 [RRBP1_HUMAN] Malate dehydrogenase, mitochondrial OS=Homo sapiens GN=MDH2 PE=1 SV=3 - P40926 40.24% 11 12 0.797 [MDHM_HUMAN] 230

Chapter 8

Sister chromatid cohesion protein PDS5 homolog A OS=Homo sapiens GN=PDS5A Q29RF7 2.39% 1 2 0.8 PE=1 SV=1 - [PDS5A_HUMAN] Keratin, type II cytoskeletal 8 OS=Homo sapiens GN=KRT8 PE=1 SV=7 - P05787 14.91% 4 7 0.806 [K2C8_HUMAN] Calcium-binding mitochondrial carrier protein Aralar2 OS=Homo sapiens Q9UJS0 2.67% 1 1 0.806 GN=SLC25A13 PE=1 SV=2 - [CMC2_HUMAN] P27797 Calreticulin OS=Homo sapiens GN=CALR PE=1 SV=1 - [CALR_HUMAN] 15.35% 6 6 0.807 P20700 Lamin-B1 OS=Homo sapiens GN=LMNB1 PE=1 SV=2 - [LMNB1_HUMAN] 28.50% 14 18 0.807 P02545 Prelamin-A/C OS=Homo sapiens GN=LMNA PE=1 SV=1 - [LMNA_HUMAN] 20.63% 12 14 0.809 Endoplasmic reticulum resident protein 44 OS=Homo sapiens GN=ERP44 PE=1 Q9BS26 6.90% 2 2 0.81 SV=1 - [ERP44_HUMAN] Hypoxia up-regulated protein 1 OS=Homo sapiens GN=HYOU1 PE=1 SV=1 - Q9Y4L1 2.30% 2 2 0.813 [HYOU1_HUMAN] Torsin-1A-interacting protein 1 OS=Homo sapiens GN=TOR1AIP1 PE=1 SV=2 - Q5JTV8 4.80% 2 2 0.814 [TOIP1_HUMAN] 4F2 cell-surface antigen heavy chain OS=Homo sapiens GN=SLC3A2 PE=1 SV=3 - P08195 8.25% 4 4 0.817 [4F2_HUMAN] Serine hydroxymethyltransferase, mitochondrial OS=Homo sapiens GN=SHMT2 P34897 31.15% 14 15 0.819 PE=1 SV=3 - [GLYM_HUMAN] Short/branched chain specific acyl-CoA dehydrogenase, mitochondrial OS=Homo P45954 4.17% 1 1 0.826 sapiens GN=ACADSB PE=1 SV=1 - [ACDSB_HUMAN] P06280 Alpha-galactosidase A OS=Homo sapiens GN=GLA PE=1 SV=1 - [AGAL_HUMAN] 5.59% 2 2 0.83 Cytochrome b-c1 complex subunit 1, mitochondrial OS=Homo sapiens P31930 7.92% 3 4 0.83 GN=UQCRC1 PE=1 SV=3 - [QCR1_HUMAN] ATP-binding cassette sub-family B member 10, mitochondrial OS=Homo sapiens Q9NRK6 1.63% 1 1 0.831 GN=ABCB10 PE=1 SV=2 - [ABCBA_HUMAN] Complement component 1 Q subcomponent-binding protein, mitochondrial Q07021 6.74% 2 2 0.832 OS=Homo sapiens GN=C1QBP PE=1 SV=1 - [C1QBP_HUMAN] P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 46.40% 23 26 0.832 Bromodomain-containing protein 4 OS=Homo sapiens GN=BRD4 PE=1 SV=2 - O60885 3.01% 3 3 0.834 [BRD4_HUMAN] Peroxisomal multifunctional enzyme type 2 OS=Homo sapiens GN=HSD17B4 PE=1 P51659 7.47% 5 5 0.836 SV=3 - [DHB4_HUMAN]

231

Chapter 8

Monofunctional C1-tetrahydrofolate synthase, mitochondrial OS=Homo sapiens Q6UB35 2.04% 1 2 0.837 GN=MTHFD1L PE=1 SV=1 - [C1TM_HUMAN] 39S ribosomal protein L46, mitochondrial OS=Homo sapiens GN=MRPL46 PE=1 Q9H2W6 3.94% 1 1 0.837 SV=1 - [RM46_HUMAN] DNA-dependent protein kinase catalytic subunit OS=Homo sapiens GN=PRKDC P78527 3.68% 11 13 0.84 PE=1 SV=3 - [PRKDC_HUMAN] DNA repair protein RAD50 OS=Homo sapiens GN=RAD50 PE=1 SV=1 - Q92878 5.41% 5 5 0.842 [RAD50_HUMAN] U5 small nuclear ribonucleoprotein 40 kDa protein OS=Homo sapiens Q96DI7 3.36% 1 1 0.843 GN=SNRNP40 PE=1 SV=1 - [SNR40_HUMAN] DAZ-associated protein 1 OS=Homo sapiens GN=DAZAP1 PE=1 SV=1 - Q96EP5 4.42% 2 2 0.846 [DAZP1_HUMAN] Delta(3,5)-Delta(2,4)-dienoyl-CoA isomerase, mitochondrial OS=Homo sapiens Q13011 8.84% 3 3 0.849 GN=ECH1 PE=1 SV=2 - [ECH1_HUMAN] Ras-related protein Rab-7a OS=Homo sapiens GN=RAB7A PE=1 SV=1 - P51149 6.76% 1 1 0.85 [RAB7A_HUMAN] Secretory carrier-associated membrane protein 3 OS=Homo sapiens GN=SCAMP3 O14828 5.19% 1 1 0.852 PE=1 SV=3 - [SCAM3_HUMAN] SAP domain-containing ribonucleoprotein OS=Homo sapiens GN=SARNP PE=1 P82979 16.19% 2 2 0.852 SV=3 - [SARNP_HUMAN] Adenylate kinase 2, mitochondrial OS=Homo sapiens GN=AK2 PE=1 SV=2 - P54819 17.99% 3 3 0.853 [KAD2_HUMAN] Q9BZZ5 Apoptosis inhibitor 5 OS=Homo sapiens GN=API5 PE=1 SV=3 - [API5_HUMAN] 4.77% 2 2 0.856 Heterogeneous nuclear ribonucleoprotein D0 OS=Homo sapiens GN=HNRNPD Q14103 3.94% 1 1 0.858 PE=1 SV=1 - [HNRPD_HUMAN] Succinyl-CoA:3-ketoacid coenzyme A transferase 1, mitochondrial OS=Homo P55809 12.31% 4 5 0.861 sapiens GN=OXCT1 PE=1 SV=1 - [SCOT1_HUMAN] Plasminogen activator inhibitor 1 RNA-binding protein OS=Homo sapiens Q8NC51 8.33% 3 3 0.861 GN=SERBP1 PE=1 SV=2 - [PAIRB_HUMAN] P37802 Transgelin-2 OS=Homo sapiens GN=TAGLN2 PE=1 SV=3 - [TAGL2_HUMAN] 11.06% 1 1 0.866 Aspartate--tRNA ligase, mitochondrial OS=Homo sapiens GN=DARS2 PE=1 SV=1 - Q6PI48 2.95% 1 1 0.87 [SYDM_HUMAN] Q6P1J9 Parafibromin OS=Homo sapiens GN=CDC73 PE=1 SV=1 - [CDC73_HUMAN] 10.36% 4 4 0.876

232

Chapter 8

Cep170-like protein OS=Homo sapiens GN=CEP170P1 PE=5 SV=2 - Q96L14 3.41% 1 1 0.878 [C170L_HUMAN] Q14126 Desmoglein-2 OS=Homo sapiens GN=DSG2 PE=1 SV=2 - [DSG2_HUMAN] 1.61% 1 1 0.88 Phosphoenolpyruvate carboxykinase [GTP], mitochondrial OS=Homo sapiens Q16822 2.50% 1 1 0.88 GN=PCK2 PE=1 SV=3 - [PCKGM_HUMAN] Cytochrome b-c1 complex subunit 2, mitochondrial OS=Homo sapiens P22695 13.69% 5 5 0.882 GN=UQCRC2 PE=1 SV=3 - [QCR2_HUMAN] Q03252 Lamin-B2 OS=Homo sapiens GN=LMNB2 PE=1 SV=3 - [LMNB2_HUMAN] 9.67% 5 9 0.885 Q9NSI2 Protein FAM207A OS=Homo sapiens GN=FAM207A PE=1 SV=2 - [F207A_HUMAN] 5.65% 1 1 0.885 Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial OS=Homo sapiens Q9HCC0 7.46% 2 3 0.886 GN=MCCC2 PE=1 SV=1 - [MCCB_HUMAN] NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 10 OS=Homo O96000 9.30% 1 1 0.891 sapiens GN=NDUFB10 PE=1 SV=3 - [NDUBA_HUMAN] Putative ATP-dependent RNA helicase DHX30 OS=Homo sapiens GN=DHX30 Q7L2E3 0.75% 1 1 0.892 PE=1 SV=1 - [DHX30_HUMAN] Pre-mRNA-processing-splicing factor 8 OS=Homo sapiens GN=PRPF8 PE=1 SV=2 Q6P2Q9 1.07% 2 2 0.893 - [PRP8_HUMAN] Sorting and assembly machinery component 50 homolog OS=Homo sapiens Q9Y512 1.49% 1 1 0.893 GN=SAMM50 PE=1 SV=3 - [SAM50_HUMAN] Mitochondrial-processing peptidase subunit alpha OS=Homo sapiens GN=PMPCA Q10713 2.67% 1 1 0.894 PE=1 SV=2 - [MPPA_HUMAN] P06748 Nucleophosmin OS=Homo sapiens GN=NPM1 PE=1 SV=2 - [NPM_HUMAN] 26.53% 7 7 0.896 U5 small nuclear ribonucleoprotein 200 kDa helicase OS=Homo sapiens O75643 4.68% 6 6 0.897 GN=SNRNP200 PE=1 SV=2 - [U520_HUMAN] Collagen alpha-1(VI) chain OS=Homo sapiens GN=COL6A1 PE=1 SV=3 - P12109 1.56% 1 1 0.899 [CO6A1_HUMAN] Succinate-semialdehyde dehydrogenase, mitochondrial OS=Homo sapiens P51649 1.87% 1 1 0.899 GN=ALDH5A1 PE=1 SV=2 - [SSDH_HUMAN] Caseinolytic peptidase B protein homolog OS=Homo sapiens GN=CLPB PE=1 SV=1 Q9H078 2.83% 1 1 0.902 - [CLPB_HUMAN] Poly [ADP-ribose] polymerase 1 OS=Homo sapiens GN=PARP1 PE=1 SV=4 - P09874 15.78% 15 16 0.904 [PARP1_HUMAN] 60S ribosomal protein L18 OS=Homo sapiens GN=RPL18 PE=1 SV=2 - Q07020 16.49% 2 2 0.904 [RL18_HUMAN] 233

Chapter 8

Prolyl 4-hydroxylase subunit alpha-1 OS=Homo sapiens GN=P4HA1 PE=1 SV=2 - P13674 10.30% 4 4 0.907 [P4HA1_HUMAN] Polymerase delta-interacting protein 3 OS=Homo sapiens GN=POLDIP3 PE=1 Q9BY77 3.56% 2 2 0.908 SV=2 - [PDIP3_HUMAN] Cell cycle and apoptosis regulator protein 2 OS=Homo sapiens GN=CCAR2 PE=1 Q8N163 12.68% 11 11 0.909 SV=2 - [CCAR2_HUMAN] Probable ATP-dependent RNA helicase DDX5 OS=Homo sapiens GN=DDX5 PE=1 P17844 7.33% 5 6 0.91 SV=1 - [DDX5_HUMAN] RNA-binding protein 10 OS=Homo sapiens GN=RBM10 PE=1 SV=3 - P98175 4.09% 2 2 0.917 [RBM10_HUMAN] P51610 Host cell factor 1 OS=Homo sapiens GN=HCFC1 PE=1 SV=2 - [HCFC1_HUMAN] 3.78% 4 4 0.918 Heterogeneous nuclear ribonucleoprotein Q OS=Homo sapiens GN=SYNCRIP O60506 3.37% 3 3 0.919 PE=1 SV=2 - [HNRPQ_HUMAN] SWI/SNF complex subunit SMARCC2 OS=Homo sapiens GN=SMARCC2 PE=1 Q8TAQ2 1.73% 1 1 0.919 SV=1 - [SMRC2_HUMAN] P35637 RNA-binding protein FUS OS=Homo sapiens GN=FUS PE=1 SV=1 - [FUS_HUMAN] 4.37% 2 2 0.92 RNA-binding protein 26 OS=Homo sapiens GN=RBM26 PE=1 SV=3 - Q5T8P6 2.58% 1 2 0.925 [RBM26_HUMAN] Importin subunit alpha-1 OS=Homo sapiens GN=KPNA2 PE=1 SV=1 - P52292 9.83% 5 5 0.926 [IMA1_HUMAN] P35611 Alpha-adducin OS=Homo sapiens GN=ADD1 PE=1 SV=2 - [ADDA_HUMAN] 1.63% 1 1 0.926 Protein NipSnap homolog 2 OS=Homo sapiens GN=GBAS PE=1 SV=1 - O75323 3.85% 1 1 0.931 [NIPS2_HUMAN] Q16352 Alpha-internexin OS=Homo sapiens GN=INA PE=1 SV=2 - [AINX_HUMAN] 4.41% 1 2 0.932 Heterogeneous nuclear ribonucleoprotein U OS=Homo sapiens GN=HNRNPU PE=1 Q00839 12.61% 8 8 0.935 SV=6 - [HNRPU_HUMAN] Laminin subunit beta-1 OS=Homo sapiens GN=LAMB1 PE=1 SV=2 - P07942 1.57% 2 2 0.94 [LAMB1_HUMAN] Nuclear pore complex protein Nup155 OS=Homo sapiens GN=NUP155 PE=1 SV=1 O75694 3.24% 3 3 0.94 - [NU155_HUMAN] Aldehyde dehydrogenase, mitochondrial OS=Homo sapiens GN=ALDH2 PE=1 P05091 6.38% 3 3 0.941 SV=2 - [ALDH2_HUMAN] Heterogeneous nuclear ribonucleoprotein K OS=Homo sapiens GN=HNRNPK PE=1 P61978 29.59% 13 15 0.942 SV=1 - [HNRPK_HUMAN] 234

Chapter 8

P19338 Nucleolin OS=Homo sapiens GN=NCL PE=1 SV=3 - [NUCL_HUMAN] 25.07% 20 21 0.943 Ribosomal RNA processing protein 1 homolog A OS=Homo sapiens GN=RRP1 P56182 1.95% 1 1 0.96 PE=1 SV=1 - [RRP1_HUMAN] Q969Z0 Protein TBRG4 OS=Homo sapiens GN=TBRG4 PE=1 SV=1 - [TBRG4_HUMAN] 1.43% 1 1 0.964 Delta-1-pyrroline-5-carboxylate synthase OS=Homo sapiens GN=ALDH18A1 PE=1 P54886 13.08% 8 8 0.965 SV=2 - [P5CS_HUMAN] 60S ribosomal protein L8 OS=Homo sapiens GN=RPL8 PE=1 SV=2 - P62917 8.17% 3 3 0.971 [RL8_HUMAN] 60S acidic ribosomal protein P1 OS=Homo sapiens GN=RPLP1 PE=1 SV=1 - P05386 14.04% 1 1 0.973 [RLA1_HUMAN] P12270 Nucleoprotein TPR OS=Homo sapiens GN=TPR PE=1 SV=3 - [TPR_HUMAN] 3.22% 6 6 0.986 ATP-dependent RNA helicase DDX39A OS=Homo sapiens GN=DDX39A PE=1 O00148 9.84% 6 7 0.986 SV=2 - [DX39A_HUMAN] Structural maintenance of chromosomes flexible hinge domain-containing protein 1 A6NHR9 2.39% 5 5 0.989 OS=Homo sapiens GN=SMCHD1 PE=1 SV=2 - [SMHD1_HUMAN] DNA (cytosine-5)-methyltransferase 1 OS=Homo sapiens GN=DNMT1 PE=1 SV=2 - P26358 2.17% 3 4 0.989 [DNMT1_HUMAN] Mitochondrial import inner membrane translocase subunit TIM44 OS=Homo sapiens O43615 5.09% 2 2 0.993 GN=TIMM44 PE=1 SV=2 - [TIM44_HUMAN] Heterogeneous nuclear ribonucleoprotein F OS=Homo sapiens GN=HNRNPF PE=1 P52597 6.27% 3 5 0.995 SV=3 - [HNRPF_HUMAN] Serine/arginine-rich splicing factor 6 OS=Homo sapiens GN=SRSF6 PE=1 SV=2 - Q13247 6.40% 2 2 0.996 [SRSF6_HUMAN] Heat shock 70 kDa protein 4L OS=Homo sapiens GN=HSPA4L PE=1 SV=3 - O95757 2.38% 2 2 0.996 [HS74L_HUMAN] Cytoplasmic dynein 1 intermediate chain 2 OS=Homo sapiens GN=DYNC1I2 PE=1 Q13409 3.45% 1 1 1.007 SV=3 - [DC1I2_HUMAN] KH domain-containing, RNA-binding, signal transduction-associated protein 1 Q07666 15.12% 7 8 1.014 OS=Homo sapiens GN=KHDRBS1 PE=1 SV=1 - [KHDR1_HUMAN] 26S proteasome non-ATPase regulatory subunit 11 OS=Homo sapiens O00231 4.74% 1 2 1.018 GN=PSMD11 PE=1 SV=3 - [PSD11_HUMAN] Probable ATP-dependent RNA helicase DDX17 OS=Homo sapiens GN=DDX17 Q92841 13.44% 9 10 1.023 PE=1 SV=2 - [DDX17_HUMAN]

235

Chapter 8

Dihydropyrimidinase-related protein 2 OS=Homo sapiens GN=DPYSL2 PE=1 SV=1 Q16555 6.12% 2 2 1.024 - [DPYL2_HUMAN] Threonine--tRNA ligase, cytoplasmic OS=Homo sapiens GN=TARS PE=1 SV=3 - P26639 4.29% 2 2 1.026 [SYTC_HUMAN] Nuclear pore complex protein Nup153 OS=Homo sapiens GN=NUP153 PE=1 SV=2 P49790 1.69% 2 2 1.027 - [NU153_HUMAN] Q9Y467 Sal-like protein 2 OS=Homo sapiens GN=SALL2 PE=1 SV=4 - [SALL2_HUMAN] 1.29% 1 1 1.03 Transitional endoplasmic reticulum ATPase OS=Homo sapiens GN=VCP PE=1 P55072 12.66% 8 8 1.031 SV=4 - [TERA_HUMAN] Double-strand break repair protein MRE11A OS=Homo sapiens GN=MRE11A PE=1 P49959 2.12% 1 1 1.031 SV=3 - [MRE11_HUMAN] Far upstream element-binding protein 3 OS=Homo sapiens GN=FUBP3 PE=1 SV=2 Q96I24 10.49% 3 5 1.033 - [FUBP3_HUMAN] Interferon regulatory factor 2-binding protein 1 OS=Homo sapiens GN=IRF2BP1 Q8IU81 3.60% 1 1 1.033 PE=1 SV=1 - [I2BP1_HUMAN] Far upstream element-binding protein 2 OS=Homo sapiens GN=KHSRP PE=1 SV=4 Q92945 25.18% 13 15 1.037 - [FUBP2_HUMAN] Importin subunit beta-1 OS=Homo sapiens GN=KPNB1 PE=1 SV=2 - Q14974 6.05% 3 4 1.039 [IMB1_HUMAN] Large neutral amino acids transporter small subunit 1 OS=Homo sapiens Q01650 6.71% 2 2 1.04 GN=SLC7A5 PE=1 SV=2 - [LAT1_HUMAN] WW domain-binding protein 11 OS=Homo sapiens GN=WBP11 PE=1 SV=1 - Q9Y2W2 3.12% 1 1 1.042 [WBP11_HUMAN] Q9UMX0 Ubiquilin-1 OS=Homo sapiens GN=UBQLN1 PE=1 SV=2 - [UBQL1_HUMAN] 2.89% 1 1 1.043 P35613 Basigin OS=Homo sapiens GN=BSG PE=1 SV=2 - [BASI_HUMAN] 2.34% 1 1 1.046 Delta-1-pyrroline-5-carboxylate dehydrogenase, mitochondrial OS=Homo sapiens P30038 4.97% 2 2 1.055 GN=ALDH4A1 PE=1 SV=3 - [AL4A1_HUMAN] Heterogeneous nuclear ribonucleoprotein H OS=Homo sapiens GN=HNRNPH1 P31943 18.04% 6 8 1.057 PE=1 SV=4 - [HNRH1_HUMAN] Splicing factor 3B subunit 2 OS=Homo sapiens GN=SF3B2 PE=1 SV=2 - Q13435 3.69% 2 2 1.074 [SF3B2_HUMAN] Synaptic vesicle membrane protein VAT-1 homolog OS=Homo sapiens GN=VAT1 Q99536 7.63% 2 2 1.075 PE=1 SV=2 - [VAT1_HUMAN]

236

Chapter 8

Eukaryotic translation initiation factor 4H OS=Homo sapiens GN=EIF4H PE=1 SV=5 Q15056 11.69% 2 2 1.076 - [IF4H_HUMAN] Regulation of nuclear pre-mRNA domain-containing protein 1A OS=Homo sapiens Q96P16 5.77% 1 1 1.078 GN=RPRD1A PE=1 SV=1 - [RPR1A_HUMAN] Diablo homolog, mitochondrial OS=Homo sapiens GN=DIABLO PE=1 SV=1 - Q9NR28 7.53% 1 1 1.079 [DBLOH_HUMAN] WD40 repeat-containing protein SMU1 OS=Homo sapiens GN=SMU1 PE=1 SV=2 - Q2TAY7 5.26% 2 2 1.082 [SMU1_HUMAN] Pre-mRNA-processing factor 19 OS=Homo sapiens GN=PRPF19 PE=1 SV=1 - Q9UMS4 5.56% 3 3 1.086 [PRP19_HUMAN] MAP7 domain-containing protein 3 OS=Homo sapiens GN=MAP7D3 PE=1 SV=2 - Q8IWC1 1.83% 1 1 1.086 [MA7D3_HUMAN] BUB3-interacting and GLEBS motif-containing protein ZNF207 OS=Homo sapiens O43670 2.93% 2 2 1.091 GN=ZNF207 PE=1 SV=1 - [ZN207_HUMAN] 116 kDa U5 small nuclear ribonucleoprotein component OS=Homo sapiens Q15029 5.56% 4 6 1.095 GN=EFTUD2 PE=1 SV=1 - [U5S1_HUMAN] HIV Tat-specific factor 1 OS=Homo sapiens GN=HTATSF1 PE=1 SV=1 - O43719 5.03% 2 3 1.098 [HTSF1_HUMAN] 26S protease regulatory subunit 6A OS=Homo sapiens GN=PSMC3 PE=1 SV=3 - P17980 3.87% 1 1 1.106 [PRS6A_HUMAN] Histone H2B type 1-K OS=Homo sapiens GN=HIST1H2BK PE=1 SV=3 - O60814 29.37% 4 4 1.108 [H2B1K_HUMAN] Q00341 Vigilin OS=Homo sapiens GN=HDLBP PE=1 SV=2 - [VIGLN_HUMAN] 4.50% 3 5 1.11 Nucleosome assembly protein 1-like 1 OS=Homo sapiens GN=NAP1L1 PE=1 SV=1 P55209 8.70% 4 5 1.11 - [NP1L1_HUMAN] Pre-mRNA-processing factor 6 OS=Homo sapiens GN=PRPF6 PE=1 SV=1 - O94906 3.72% 3 3 1.111 [PRP6_HUMAN] P08670 Vimentin OS=Homo sapiens GN=VIM PE=1 SV=4 - [VIME_HUMAN] 53.00% 23 27 1.114 Polyadenylate-binding protein 4 OS=Homo sapiens GN=PABPC4 PE=1 SV=1 - Q13310 6.68% 1 4 1.119 [PABP4_HUMAN] C-terminal-binding protein 1 OS=Homo sapiens GN=CTBP1 PE=1 SV=2 - Q13363 7.50% 2 2 1.119 [CTBP1_HUMAN] Eukaryotic initiation factor 4A-III OS=Homo sapiens GN=EIF4A3 PE=1 SV=4 - P38919 5.11% 1 2 1.122 [IF4A3_HUMAN]

237

Chapter 8

P0C0S5 Histone H2A.Z OS=Homo sapiens GN=H2AFZ PE=1 SV=2 - [H2AZ_HUMAN] 7.03% 1 1 1.125 Splicing factor 3B subunit 1 OS=Homo sapiens GN=SF3B1 PE=1 SV=3 - O75533 2.45% 2 2 1.127 [SF3B1_HUMAN] Actin-like protein 6A OS=Homo sapiens GN=ACTL6A PE=1 SV=1 - O96019 3.26% 1 1 1.131 [ACL6A_HUMAN] WD repeat-containing protein 18 OS=Homo sapiens GN=WDR18 PE=1 SV=2 - Q9BV38 5.09% 2 2 1.136 [WDR18_HUMAN] Structural maintenance of chromosomes protein 3 OS=Homo sapiens GN=SMC3 Q9UQE7 5.67% 6 6 1.142 PE=1 SV=2 - [SMC3_HUMAN] Methionine--tRNA ligase, cytoplasmic OS=Homo sapiens GN=MARS PE=1 SV=2 - P56192 3.44% 2 3 1.143 [SYMC_HUMAN] 60S ribosomal protein L3 OS=Homo sapiens GN=RPL3 PE=1 SV=2 - P39023 3.97% 2 2 1.151 [RL3_HUMAN] Peptidyl-prolyl cis-trans isomerase FKBP4 OS=Homo sapiens GN=FKBP4 PE=1 Q02790 6.54% 3 3 1.16 SV=3 - [FKBP4_HUMAN] Synapse-associated protein 1 OS=Homo sapiens GN=SYAP1 PE=1 SV=1 - Q96A49 4.26% 1 1 1.162 [SYAP1_HUMAN] Transcription intermediary factor 1-beta OS=Homo sapiens GN=TRIM28 PE=1 SV=5 Q13263 20.72% 17 18 1.163 - [TIF1B_HUMAN] Stress-induced-phosphoprotein 1 OS=Homo sapiens GN=STIP1 PE=1 SV=1 - P31948 3.68% 1 2 1.163 [STIP1_HUMAN] P0CG48 Polyubiquitin-C OS=Homo sapiens GN=UBC PE=1 SV=3 - [UBC_HUMAN] 30.22% 4 4 1.17 Multifunctional protein ADE2 OS=Homo sapiens GN=PAICS PE=1 SV=3 - P22234 6.82% 2 2 1.172 [PUR6_HUMAN] Cell division control protein 42 homolog OS=Homo sapiens GN=CDC42 PE=1 SV=2 P60953 7.33% 1 1 1.178 - [CDC42_HUMAN] Transcription elongation factor SPT5 OS=Homo sapiens GN=SUPT5H PE=1 SV=1 - O00267 8.83% 5 5 1.182 [SPT5H_HUMAN] 3-mercaptopyruvate sulfurtransferase OS=Homo sapiens GN=MPST PE=1 SV=3 - P25325 8.08% 1 2 1.187 [THTM_HUMAN] Nuclear pore complex protein Nup50 OS=Homo sapiens GN=NUP50 PE=1 SV=2 - Q9UKX7 4.91% 1 1 1.189 [NUP50_HUMAN] O75369 Filamin-B OS=Homo sapiens GN=FLNB PE=1 SV=2 - [FLNB_HUMAN] 5.73% 9 9 1.189

238

Chapter 8

Rab GDP dissociation inhibitor beta OS=Homo sapiens GN=GDI2 PE=1 SV=2 - P50395 2.70% 1 1 1.192 [GDIB_HUMAN] Serrate RNA effector molecule homolog OS=Homo sapiens GN=SRRT PE=1 SV=1 - Q9BXP5 7.65% 5 5 1.194 [SRRT_HUMAN] Nuclear migration protein nudC OS=Homo sapiens GN=NUDC PE=1 SV=1 - Q9Y266 8.46% 2 3 1.197 [NUDC_HUMAN] Nucleolar RNA helicase 2 OS=Homo sapiens GN=DDX21 PE=1 SV=5 - Q9NR30 6.26% 3 4 1.203 [DDX21_HUMAN] DNA replication licensing factor MCM5 OS=Homo sapiens GN=MCM5 PE=1 SV=5 - P33992 4.22% 2 2 1.211 [MCM5_HUMAN] Non-POU domain-containing octamer-binding protein OS=Homo sapiens Q15233 24.63% 8 12 1.216 GN=NONO PE=1 SV=4 - [NONO_HUMAN] Pyrroline-5-carboxylate reductase 2 OS=Homo sapiens GN=PYCR2 PE=1 SV=1 - Q96C36 11.25% 3 3 1.221 [P5CR2_HUMAN] O43707 Alpha-actinin-4 OS=Homo sapiens GN=ACTN4 PE=1 SV=2 - [ACTN4_HUMAN] 9.88% 7 7 1.224 Aspartate--tRNA ligase, cytoplasmic OS=Homo sapiens GN=DARS PE=1 SV=2 - P14868 2.00% 1 1 1.227 [SYDC_HUMAN] X-ray repair cross-complementing protein 5 OS=Homo sapiens GN=XRCC5 PE=1 P13010 1.50% 2 2 1.236 SV=3 - [XRCC5_HUMAN] Small nuclear ribonucleoprotein Sm D3 OS=Homo sapiens GN=SNRPD3 PE=1 P62318 7.94% 1 1 1.238 SV=1 - [SMD3_HUMAN] 60S ribosomal protein L9 OS=Homo sapiens GN=RPL9 PE=1 SV=1 - P32969 9.90% 2 2 1.24 [RL9_HUMAN] Alanine aminotransferase 2 OS=Homo sapiens GN=GPT2 PE=1 SV=1 - Q8TD30 2.10% 1 1 1.243 [ALAT2_HUMAN] Q9UHD9 Ubiquilin-2 OS=Homo sapiens GN=UBQLN2 PE=1 SV=2 - [UBQL2_HUMAN] 3.37% 1 1 1.244 U2 snRNP-associated SURP motif-containing protein OS=Homo sapiens O15042 1.36% 1 1 1.245 GN=U2SURP PE=1 SV=2 - [SR140_HUMAN] Far upstream element-binding protein 1 OS=Homo sapiens GN=FUBP1 PE=1 SV=3 Q96AE4 22.67% 7 11 1.254 - [FUBP1_HUMAN] Q9Y230 RuvB-like 2 OS=Homo sapiens GN=RUVBL2 PE=1 SV=3 - [RUVB2_HUMAN] 4.54% 2 2 1.259 Tropomyosin alpha-4 chain OS=Homo sapiens GN=TPM4 PE=1 SV=3 - P67936 20.56% 5 5 1.263 [TPM4_HUMAN]

239

Chapter 8

Tubulin beta-4B chain OS=Homo sapiens GN=TUBB4B PE=1 SV=1 - P68371 44.27% 4 16 1.266 [TBB4B_HUMAN] P55060 Exportin-2 OS=Homo sapiens GN=CSE1L PE=1 SV=3 - [XPO2_HUMAN] 2.57% 1 2 1.267 Splicing factor, proline- and glutamine-rich OS=Homo sapiens GN=SFPQ PE=1 P23246 19.24% 11 13 1.268 SV=2 - [SFPQ_HUMAN] Splicing factor 3A subunit 3 OS=Homo sapiens GN=SF3A3 PE=1 SV=1 - Q12874 4.19% 2 2 1.27 [SF3A3_HUMAN] 60S ribosomal protein L13 OS=Homo sapiens GN=RPL13 PE=1 SV=4 - P26373 14.22% 3 3 1.277 [RL13_HUMAN] Eukaryotic translation initiation factor 5B OS=Homo sapiens GN=EIF5B PE=1 SV=4 O60841 1.72% 1 1 1.279 - [IF2P_HUMAN] Poly(U)-binding-splicing factor PUF60 OS=Homo sapiens GN=PUF60 PE=1 SV=1 - Q9UHX1 11.09% 3 3 1.304 [PUF60_HUMAN] Putative RNA-binding protein Luc7-like 2 OS=Homo sapiens GN=LUC7L2 PE=1 Q9Y383 4.59% 1 1 1.305 SV=2 - [LC7L2_HUMAN] Transcription elongation regulator 1 OS=Homo sapiens GN=TCERG1 PE=1 SV=2 - O14776 3.01% 3 5 1.305 [TCRG1_HUMAN] Insulin-like growth factor 2 mRNA-binding protein 1 OS=Homo sapiens Q9NZI8 2.43% 1 1 1.315 GN=IGF2BP1 PE=1 SV=2 - [IF2B1_HUMAN] P21333 Filamin-A OS=Homo sapiens GN=FLNA PE=1 SV=4 - [FLNA_HUMAN] 14.36% 28 30 1.325 Q16181 Septin-7 OS=Homo sapiens GN=SEPT7 PE=1 SV=2 - [SEPT7_HUMAN] 2.06% 1 1 1.326 Cytochrome b-c1 complex subunit Rieske, mitochondrial OS=Homo sapiens P47985 3.28% 2 2 1.336 GN=UQCRFS1 PE=1 SV=2 - [UCRI_HUMAN] Splicing factor 3B subunit 3 OS=Homo sapiens GN=SF3B3 PE=1 SV=4 - Q15393 4.60% 6 6 1.338 [SF3B3_HUMAN] UDP-glucose:glycoprotein glucosyltransferase 1 OS=Homo sapiens GN=UGGT1 Q9NYU2 1.16% 1 1 1.342 PE=1 SV=3 - [UGGG1_HUMAN] Q00610 Clathrin heavy chain 1 OS=Homo sapiens GN=CLTC PE=1 SV=5 - [CLH1_HUMAN] 13.55% 17 17 1.349 Staphylococcal nuclease domain-containing protein 1 OS=Homo sapiens GN=SND1 Q7KZF4 6.81% 6 6 1.354 PE=1 SV=1 - [SND1_HUMAN] Histone-binding protein RBBP4 OS=Homo sapiens GN=RBBP4 PE=1 SV=3 - Q09028 2.12% 2 2 1.354 [RBBP4_HUMAN] 60S ribosomal protein L12 OS=Homo sapiens GN=RPL12 PE=1 SV=1 - P30050 10.91% 1 1 1.357 [RL12_HUMAN] 240

Chapter 8

Tubulin alpha-1C chain OS=Homo sapiens GN=TUBA1C PE=1 SV=1 - Q9BQE3 33.18% 12 12 1.369 [TBA1C_HUMAN] P18206 Vinculin OS=Homo sapiens GN=VCL PE=1 SV=4 - [VINC_HUMAN] 5.56% 4 4 1.37 60S ribosomal protein L4 OS=Homo sapiens GN=RPL4 PE=1 SV=5 - P36578 4.68% 2 2 1.37 [RL4_HUMAN] Q9Y265 RuvB-like 1 OS=Homo sapiens GN=RUVBL1 PE=1 SV=1 - [RUVB1_HUMAN] 15.35% 4 5 1.371 Probable ATP-dependent RNA helicase DDX46 OS=Homo sapiens GN=DDX46 Q7L014 3.88% 3 3 1.38 PE=1 SV=2 - [DDX46_HUMAN] Heat shock cognate 71 kDa protein OS=Homo sapiens GN=HSPA8 PE=1 SV=1 - P11142 43.34% 21 28 1.385 [HSP7C_HUMAN] Splicing factor 3A subunit 1 OS=Homo sapiens GN=SF3A1 PE=1 SV=1 - Q15459 11.73% 9 9 1.388 [SF3A1_HUMAN] Structural maintenance of chromosomes protein 1A OS=Homo sapiens GN=SMC1A Q14683 8.76% 8 10 1.397 PE=1 SV=2 - [SMC1A_HUMAN] Elongation factor 1-beta OS=Homo sapiens GN=EEF1B2 PE=1 SV=3 - P24534 5.78% 1 1 1.406 [EF1B_HUMAN] Serine/threonine-protein phosphatase 1 regulatory subunit 10 OS=Homo sapiens Q96QC0 2.13% 1 1 1.409 GN=PPP1R10 PE=1 SV=1 - [PP1RA_HUMAN] DNA damage-binding protein 1 OS=Homo sapiens GN=DDB1 PE=1 SV=1 - Q16531 3.60% 2 2 1.416 [DDB1_HUMAN] 60S ribosomal protein L15 OS=Homo sapiens GN=RPL15 PE=1 SV=2 - P61313 4.41% 1 1 1.418 [RL15_HUMAN] Eukaryotic translation initiation factor 4 gamma 1 OS=Homo sapiens GN=EIF4G1 Q04637 2.63% 2 3 1.418 PE=1 SV=4 - [IF4G1_HUMAN] Proteasomal ubiquitin receptor ADRM1 OS=Homo sapiens GN=ADRM1 PE=1 SV=2 Q16186 6.63% 2 2 1.424 - [ADRM1_HUMAN] Q14247 Src substrate cortactin OS=Homo sapiens GN=CTTN PE=1 SV=2 - [SRC8_HUMAN] 2.36% 1 1 1.438 26S protease regulatory subunit 4 OS=Homo sapiens GN=PSMC1 PE=1 SV=1 - P62191 7.73% 2 2 1.44 [PRS4_HUMAN] PERQ amino acid-rich with GYF domain-containing protein 2 OS=Homo sapiens Q6Y7W6 1.39% 1 2 1.443 GN=GIGYF2 PE=1 SV=1 - [PERQ2_HUMAN] GTP-binding nuclear protein Ran OS=Homo sapiens GN=RAN PE=1 SV=3 - P62826 22.69% 6 6 1.445 [RAN_HUMAN]

241

Chapter 8

X-ray repair cross-complementing protein 6 OS=Homo sapiens GN=XRCC6 PE=1 P12956 14.45% 8 8 1.445 SV=2 - [XRCC6_HUMAN] P35580 Myosin-10 OS=Homo sapiens GN=MYH10 PE=1 SV=3 - [MYH10_HUMAN] 6.53% 8 8 1.456 Eukaryotic translation initiation factor 3 subunit A OS=Homo sapiens GN=EIF3A Q14152 4.34% 5 7 1.467 PE=1 SV=1 - [EIF3A_HUMAN] RNA-binding protein 39 OS=Homo sapiens GN=RBM39 PE=1 SV=2 - Q14498 3.21% 2 2 1.472 [RBM39_HUMAN] Isoleucine--tRNA ligase, cytoplasmic OS=Homo sapiens GN=IARS PE=1 SV=2 - P41252 1.11% 1 1 1.476 [SYIC_HUMAN] Bifunctional glutamate/proline--tRNA ligase OS=Homo sapiens GN=EPRS PE=1 P07814 6.55% 8 10 1.481 SV=5 - [SYEP_HUMAN] Coatomer subunit alpha OS=Homo sapiens GN=COPA PE=1 SV=2 - P53621 2.61% 3 3 1.481 [COPA_HUMAN] Condensin complex subunit 1 OS=Homo sapiens GN=NCAPD2 PE=1 SV=3 - Q15021 1.50% 1 2 1.501 [CND1_HUMAN] RNA-binding protein 14 OS=Homo sapiens GN=RBM14 PE=1 SV=2 - Q96PK6 1.79% 1 1 1.513 [RBM14_HUMAN] Proteasome subunit alpha type-5 OS=Homo sapiens GN=PSMA5 PE=1 SV=3 - P28066 14.11% 2 2 1.516 [PSA5_HUMAN] ATP-dependent RNA helicase DDX42 OS=Homo sapiens GN=DDX42 PE=1 SV=1 - Q86XP3 5.33% 4 4 1.525 [DDX42_HUMAN] T-complex protein 1 subunit theta OS=Homo sapiens GN=CCT8 PE=1 SV=4 - P50990 17.88% 9 9 1.528 [TCPQ_HUMAN] P49327 Fatty acid synthase OS=Homo sapiens GN=FASN PE=1 SV=3 - [FAS_HUMAN] 13.18% 22 22 1.529 Proteasome subunit alpha type-1 OS=Homo sapiens GN=PSMA1 PE=1 SV=1 - P25786 5.70% 1 1 1.53 [PSA1_HUMAN] Heat shock 70 kDa protein 1A OS=Homo sapiens GN=HSPA1A PE=1 SV=1 - P0DMV8 27.93% 17 24 1.532 [HS71A_HUMAN] Probable 28S rRNA (cytosine(4447)-C(5))-methyltransferase OS=Homo sapiens P46087 2.96% 2 2 1.543 GN=NOP2 PE=1 SV=2 - [NOP2_HUMAN] E3 ubiquitin-protein ligase CHIP OS=Homo sapiens GN=STUB1 PE=1 SV=2 - Q9UNE7 3.96% 1 1 1.544 [CHIP_HUMAN] GTPase-activating protein and VPS9 domain-containing protein 1 OS=Homo Q14C86 1.76% 2 2 1.549 sapiens GN=GAPVD1 PE=1 SV=2 - [GAPD1_HUMAN]

242

Chapter 8

40S ribosomal protein SA OS=Homo sapiens GN=RPSA PE=1 SV=4 - P08865 20.34% 5 5 1.551 [RSSA_HUMAN] Cleavage and polyadenylation specificity factor subunit 5 OS=Homo sapiens O43809 21.15% 2 2 1.57 GN=NUDT21 PE=1 SV=1 - [CPSF5_HUMAN] Ubiquitin-associated protein 2-like OS=Homo sapiens GN=UBAP2L PE=1 SV=2 - Q14157 1.38% 1 1 1.595 [UBP2L_HUMAN] Eukaryotic translation initiation factor 3 subunit B OS=Homo sapiens GN=EIF3B P55884 2.58% 1 1 1.598 PE=1 SV=3 - [EIF3B_HUMAN] Proliferation-associated protein 2G4 OS=Homo sapiens GN=PA2G4 PE=1 SV=3 - Q9UQ80 6.60% 2 2 1.6 [PA2G4_HUMAN] Heat shock protein HSP 90-beta OS=Homo sapiens GN=HSP90AB1 PE=1 SV=4 - P08238 23.76% 7 16 1.603 [HS90B_HUMAN] Eukaryotic translation initiation factor 3 subunit C OS=Homo sapiens GN=EIF3C Q99613 3.07% 1 3 1.603 PE=1 SV=1 - [EIF3C_HUMAN] Eukaryotic translation initiation factor 2 subunit 1 OS=Homo sapiens GN=EIF2S1 P05198 3.81% 1 1 1.603 PE=1 SV=3 - [IF2A_HUMAN] Q9Y490 Talin-1 OS=Homo sapiens GN=TLN1 PE=1 SV=3 - [TLN1_HUMAN] 1.73% 3 3 1.604 T-complex protein 1 subunit epsilon OS=Homo sapiens GN=CCT5 PE=1 SV=1 - P48643 4.07% 2 2 1.612 [TCPE_HUMAN] Coiled-coil and C2 domain-containing protein 1A OS=Homo sapiens GN=CC2D1A Q6P1N0 2.10% 2 2 1.618 PE=1 SV=1 - [C2D1A_HUMAN] P07437 Tubulin beta chain OS=Homo sapiens GN=TUBB PE=1 SV=2 - [TBB5_HUMAN] 37.61% 3 15 1.621 Paraspeckle component 1 OS=Homo sapiens GN=PSPC1 PE=1 SV=1 - Q8WXF1 6.69% 2 4 1.624 [PSPC1_HUMAN] Polyadenylate-binding protein 1 OS=Homo sapiens GN=PABPC1 PE=1 SV=2 - P11940 5.82% 1 3 1.634 [PABP1_HUMAN] 40S ribosomal protein S6 OS=Homo sapiens GN=RPS6 PE=1 SV=1 - P62753 4.42% 1 1 1.639 [RS6_HUMAN] PDZ and LIM domain protein 1 OS=Homo sapiens GN=PDLIM1 PE=1 SV=4 - O00151 4.56% 1 1 1.64 [PDLI1_HUMAN] DNA replication licensing factor MCM7 OS=Homo sapiens GN=MCM7 PE=1 SV=4 - P33993 14.88% 7 8 1.651 [MCM7_HUMAN] T-complex protein 1 subunit gamma OS=Homo sapiens GN=CCT3 PE=1 SV=4 - P49368 16.33% 8 9 1.659 [TCPG_HUMAN]

243

Chapter 8

Ras GTPase-activating-like protein IQGAP1 OS=Homo sapiens GN=IQGAP1 PE=1 P46940 3.86% 4 5 1.684 SV=1 - [IQGA1_HUMAN] Proteasome subunit alpha type-6 OS=Homo sapiens GN=PSMA6 PE=1 SV=1 - P60900 16.26% 3 3 1.688 [PSA6_HUMAN] Microtubule-associated protein 4 OS=Homo sapiens GN=MAP4 PE=1 SV=3 - P27816 2.86% 3 3 1.69 [MAP4_HUMAN] 40S ribosomal protein S11 OS=Homo sapiens GN=RPS11 PE=1 SV=3 - P62280 8.23% 1 1 1.702 [RS11_HUMAN] O60749 Sorting nexin-2 OS=Homo sapiens GN=SNX2 PE=1 SV=2 - [SNX2_HUMAN] 2.70% 1 1 1.708 60S ribosomal protein L6 OS=Homo sapiens GN=RPL6 PE=1 SV=3 - Q02878 6.60% 2 2 1.71 [RL6_HUMAN] Glutaminase kidney isoform, mitochondrial OS=Homo sapiens GN=GLS PE=1 SV=1 O94925 1.49% 1 1 1.721 - [GLSK_HUMAN] Replication protein A 70 kDa DNA-binding subunit OS=Homo sapiens GN=RPA1 P27694 11.53% 4 4 1.724 PE=1 SV=2 - [RFA1_HUMAN] T-complex protein 1 subunit delta OS=Homo sapiens GN=CCT4 PE=1 SV=4 - P50991 14.66% 6 6 1.732 [TCPD_HUMAN] Leukotriene A-4 hydrolase OS=Homo sapiens GN=LTA4H PE=1 SV=2 - P09960 2.95% 1 1 1.739 [LKHA4_HUMAN] P13639 Elongation factor 2 OS=Homo sapiens GN=EEF2 PE=1 SV=4 - [EF2_HUMAN] 10.61% 6 8 1.741 E3 ubiquitin-protein ligase BRE1B OS=Homo sapiens GN=RNF40 PE=1 SV=4 - O75150 6.49% 4 4 1.742 [BRE1B_HUMAN] Serine/arginine-rich splicing factor 8 OS=Homo sapiens GN=SRSF8 PE=1 SV=1 - Q9BRL6 15.96% 3 4 1.757 [SRSF8_HUMAN] T-complex protein 1 subunit beta OS=Homo sapiens GN=CCT2 PE=1 SV=4 - P78371 14.77% 7 7 1.759 [TCPB_HUMAN] T-complex protein 1 subunit zeta OS=Homo sapiens GN=CCT6A PE=1 SV=3 - P40227 13.94% 7 7 1.765 [TCPZ_HUMAN] Heat shock protein HSP 90-alpha OS=Homo sapiens GN=HSP90AA1 PE=1 SV=5 - P07900 25.14% 11 20 1.77 [HS90A_HUMAN] Carbonyl reductase [NADPH] 1 OS=Homo sapiens GN=CBR1 PE=1 SV=3 - P16152 11.19% 3 3 1.772 [CBR1_HUMAN] Cleavage and polyadenylation specificity factor subunit 6 OS=Homo sapiens Q16630 1.63% 1 1 1.779 GN=CPSF6 PE=1 SV=2 - [CPSF6_HUMAN]

244

Chapter 8

P27708 CAD protein OS=Homo sapiens GN=CAD PE=1 SV=3 - [PYR1_HUMAN] 2.43% 4 4 1.785 P50995 Annexin A11 OS=Homo sapiens GN=ANXA11 PE=1 SV=1 - [ANX11_HUMAN] 2.38% 1 1 1.792 P14618 Pyruvate kinase PKM OS=Homo sapiens GN=PKM PE=1 SV=4 - [KPYM_HUMAN] 44.44% 23 23 1.793 DNA replication licensing factor MCM2 OS=Homo sapiens GN=MCM2 PE=1 SV=4 - P49736 15.15% 9 10 1.794 [MCM2_HUMAN] DNA replication licensing factor MCM4 OS=Homo sapiens GN=MCM4 PE=1 SV=5 - P33991 11.01% 6 8 1.801 [MCM4_HUMAN] 14-3-3 protein zeta/delta OS=Homo sapiens GN=YWHAZ PE=1 SV=1 - P63104 6.12% 2 2 1.802 [1433Z_HUMAN] T-complex protein 1 subunit alpha OS=Homo sapiens GN=TCP1 PE=1 SV=1 - P17987 15.11% 6 7 1.811 [TCPA_HUMAN] Cytoplasmic dynein 1 heavy chain 1 OS=Homo sapiens GN=DYNC1H1 PE=1 SV=5 Q14204 2.04% 6 6 1.828 - [DYHC1_HUMAN] DNA replication licensing factor MCM3 OS=Homo sapiens GN=MCM3 PE=1 SV=3 - P25205 17.20% 12 14 1.84 [MCM3_HUMAN] P07355 Annexin A2 OS=Homo sapiens GN=ANXA2 PE=1 SV=2 - [ANXA2_HUMAN] 4.13% 1 1 1.842 26S proteasome non-ATPase regulatory subunit 2 OS=Homo sapiens GN=PSMD2 Q13200 1.65% 1 1 1.845 PE=1 SV=3 - [PSMD2_HUMAN] C-1-tetrahydrofolate synthase, cytoplasmic OS=Homo sapiens GN=MTHFD1 PE=1 P11586 9.41% 5 7 1.85 SV=3 - [C1TC_HUMAN] Elongation factor 1-alpha 1 OS=Homo sapiens GN=EEF1A1 PE=1 SV=1 - P68104 18.18% 9 9 1.858 [EF1A1_HUMAN] Elongation factor 1-delta OS=Homo sapiens GN=EEF1D PE=1 SV=5 - P29692 11.74% 2 2 1.87 [EF1D_HUMAN] tRNA-splicing ligase RtcB homolog OS=Homo sapiens GN=RTCB PE=1 SV=1 - Q9Y3I0 5.54% 3 3 1.872 [RTCB_HUMAN] Q15019 Septin-2 OS=Homo sapiens GN=SEPT2 PE=1 SV=1 - [SEPT2_HUMAN] 8.59% 2 2 1.893 P53396 ATP-citrate synthase OS=Homo sapiens GN=ACLY PE=1 SV=3 - [ACLY_HUMAN] 9.08% 7 7 1.918 40S ribosomal protein S2 OS=Homo sapiens GN=RPS2 PE=1 SV=2 - P15880 7.17% 1 2 1.925 [RS2_HUMAN] P12277 Creatine kinase B-type OS=Homo sapiens GN=CKB PE=1 SV=1 - [KCRB_HUMAN] 27.30% 10 11 1.926 D-3-phosphoglycerate dehydrogenase OS=Homo sapiens GN=PHGDH PE=1 SV=4 O43175 15.76% 7 7 1.928 - [SERA_HUMAN] 245

Chapter 8

14-3-3 protein epsilon OS=Homo sapiens GN=YWHAE PE=1 SV=1 - P62258 14.90% 3 3 1.932 [1433E_HUMAN] Structural maintenance of chromosomes protein 2 OS=Homo sapiens GN=SMC2 O95347 2.92% 2 2 1.949 PE=1 SV=2 - [SMC2_HUMAN] Q06830 Peroxiredoxin-1 OS=Homo sapiens GN=PRDX1 PE=1 SV=1 - [PRDX1_HUMAN] 28.64% 3 6 1.954 Adenosylhomocysteinase OS=Homo sapiens GN=AHCY PE=1 SV=4 - P23526 3.47% 1 1 1.963 [SAHH_HUMAN] Transmembrane emp24 domain-containing protein 10 OS=Homo sapiens P49755 4.11% 1 1 1.965 GN=TMED10 PE=1 SV=2 - [TMEDA_HUMAN] Phosphoribosylformylglycinamidine synthase OS=Homo sapiens GN=PFAS PE=1 O15067 2.24% 2 2 1.971 SV=4 - [PUR4_HUMAN] DNA replication licensing factor MCM6 OS=Homo sapiens GN=MCM6 PE=1 SV=1 - Q14566 11.81% 8 10 1.973 [MCM6_HUMAN] Phosphoglycerate kinase 1 OS=Homo sapiens GN=PGK1 PE=1 SV=3 - P00558 13.19% 5 5 1.981 [PGK1_HUMAN] Cullin-associated NEDD8-dissociated protein 1 OS=Homo sapiens GN=CAND1 Q86VP6 1.79% 2 2 1.991 PE=1 SV=2 - [CAND1_HUMAN] Fructose-bisphosphate aldolase A OS=Homo sapiens GN=ALDOA PE=1 SV=2 - P04075 32.69% 11 11 1.991 [ALDOA_HUMAN] Tubulin beta-2B chain OS=Homo sapiens GN=TUBB2B PE=1 SV=1 - Q9BVA1 32.81% 1 11 2.001 [TBB2B_HUMAN] P05455 Lupus La protein OS=Homo sapiens GN=SSB PE=1 SV=2 - [LA_HUMAN] 4.90% 1 1 2.005 P35579 Myosin-9 OS=Homo sapiens GN=MYH9 PE=1 SV=4 - [MYH9_HUMAN] 5.46% 8 9 2.022 L-lactate dehydrogenase B chain OS=Homo sapiens GN=LDHB PE=1 SV=2 - P07195 18.56% 4 5 2.052 [LDHB_HUMAN] Transformation/transcription domain-associated protein OS=Homo sapiens Q9Y4A5 0.47% 1 1 2.054 GN=TRRAP PE=1 SV=3 - [TRRAP_HUMAN] Eukaryotic translation initiation factor 3 subunit D OS=Homo sapiens GN=EIF3D O15371 2.55% 1 1 2.056 PE=1 SV=1 - [EIF3D_HUMAN] T-complex protein 1 subunit eta OS=Homo sapiens GN=CCT7 PE=1 SV=2 - Q99832 8.84% 3 4 2.107 [TCPH_HUMAN] P58107 Epiplakin OS=Homo sapiens GN=EPPK1 PE=1 SV=2 - [EPIPL_HUMAN] 2.57% 2 3 2.146 Elongation factor 1-gamma OS=Homo sapiens GN=EEF1G PE=1 SV=3 - P26641 11.67% 6 6 2.158 [EF1G_HUMAN] 246

Chapter 8

Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 P04406 28.96% 10 11 2.21 SV=3 - [G3P_HUMAN] Glucose-6-phosphate isomerase OS=Homo sapiens GN=GPI PE=1 SV=4 - P06744 9.32% 4 4 2.247 [G6PI_HUMAN] P06733 Alpha-enolase OS=Homo sapiens GN=ENO1 PE=1 SV=2 - [ENOA_HUMAN] 56.68% 30 32 2.262 Adenylosuccinate synthetase isozyme 2 OS=Homo sapiens GN=ADSS PE=1 SV=3 P30520 5.92% 2 2 2.268 - [PURA2_HUMAN] Nuclear autoantigenic sperm protein OS=Homo sapiens GN=NASP PE=1 SV=2 - P49321 17.64% 9 11 2.324 [NASP_HUMAN] 26S protease regulatory subunit 7 OS=Homo sapiens GN=PSMC2 PE=1 SV=3 - P35998 4.62% 1 1 2.356 [PRS7_HUMAN] Ubiquitin-like modifier-activating enzyme 1 OS=Homo sapiens GN=UBA1 PE=1 P22314 16.26% 14 14 2.376 SV=3 - [UBA1_HUMAN] Asparagine--tRNA ligase, cytoplasmic OS=Homo sapiens GN=NARS PE=1 SV=1 - O43776 2.37% 1 1 2.466 [SYNC_HUMAN] P30041 Peroxiredoxin-6 OS=Homo sapiens GN=PRDX6 PE=1 SV=3 - [PRDX6_HUMAN] 4.46% 1 1 2.477 E3 ubiquitin-protein ligase BRE1A OS=Homo sapiens GN=RNF20 PE=1 SV=2 - Q5VTR2 2.36% 2 2 2.485 [BRE1A_HUMAN] P18858 DNA ligase 1 OS=Homo sapiens GN=LIG1 PE=1 SV=1 - [DNLI1_HUMAN] 4.13% 2 2 2.535 Transmembrane emp24 domain-containing protein 9 OS=Homo sapiens Q9BVK6 8.09% 1 1 2.536 GN=TMED9 PE=1 SV=2 - [TMED9_HUMAN] 40S ribosomal protein S3a OS=Homo sapiens GN=RPS3A PE=1 SV=2 - P61247 12.12% 3 3 2.557 [RS3A_HUMAN] Q01105 Protein SET OS=Homo sapiens GN=SET PE=1 SV=3 - [SET_HUMAN] 10.00% 3 3 2.576 P29401 Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 - [TKT_HUMAN] 31.62% 16 16 2.623 tRNA (cytosine(34)-C(5))-methyltransferase OS=Homo sapiens GN=NSUN2 PE=1 Q08J23 1.96% 1 1 2.625 SV=2 - [NSUN2_HUMAN] Q9UHV9 Prefoldin subunit 2 OS=Homo sapiens GN=PFDN2 PE=1 SV=1 - [PFD2_HUMAN] 14.29% 1 1 2.64 L-lactate dehydrogenase A chain OS=Homo sapiens GN=LDHA PE=1 SV=2 - P00338 12.05% 4 5 2.651 [LDHA_HUMAN] Acidic leucine-rich nuclear phosphoprotein 32 family member A OS=Homo sapiens P39687 16.47% 3 4 2.758 GN=ANP32A PE=1 SV=1 - [AN32A_HUMAN]

247

Chapter 8

Putative protein FAM10A4 OS=Homo sapiens GN=ST13P4 PE=5 SV=1 - Q8IZP2 5.83% 1 1 2.797 [ST134_HUMAN] Q9P258 Protein RCC2 OS=Homo sapiens GN=RCC2 PE=1 SV=2 - [RCC2_HUMAN] 15.71% 6 6 2.804 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - P60174 21.33% 5 6 2.815 [TPIS_HUMAN] SUMO-activating enzyme subunit 2 OS=Homo sapiens GN=UBA2 PE=1 SV=2 - Q9UBT2 5.00% 2 3 2.847 [SAE2_HUMAN] DNA mismatch repair protein Msh6 OS=Homo sapiens GN=MSH6 PE=1 SV=2 - P52701 2.65% 4 4 2.924 [MSH6_HUMAN] DnaJ homolog subfamily C member 8 OS=Homo sapiens GN=DNAJC8 PE=1 SV=2 O75937 4.74% 1 1 2.945 - [DNJC8_HUMAN] Methionine adenosyltransferase 2 subunit beta OS=Homo sapiens GN=MAT2B Q9NZL9 5.39% 1 2 2.962 PE=1 SV=1 - [MAT2B_HUMAN] Tryptophan--tRNA ligase, cytoplasmic OS=Homo sapiens GN=WARS PE=1 SV=2 - P23381 5.52% 2 2 2.965 [SYWC_HUMAN] Alcohol dehydrogenase class-3 OS=Homo sapiens GN=ADH5 PE=1 SV=4 - P11766 3.48% 1 1 2.979 [ADHX_HUMAN] Heat shock 70 kDa protein 4 OS=Homo sapiens GN=HSPA4 PE=1 SV=4 - P34932 7.14% 4 4 2.987 [HSP74_HUMAN] Structural maintenance of chromosomes protein 4 OS=Homo sapiens GN=SMC4 Q9NTJ3 4.43% 4 4 3.026 PE=1 SV=2 - [SMC4_HUMAN] DNA mismatch repair protein Msh2 OS=Homo sapiens GN=MSH2 PE=1 SV=1 - P43246 1.28% 1 1 3.028 [MSH2_HUMAN] Very long-chain specific acyl-CoA dehydrogenase, mitochondrial OS=Homo sapiens P49748 2.90% 1 1 3.17 GN=ACADVL PE=1 SV=1 - [ACADV_HUMAN] Eukaryotic initiation factor 4A-I OS=Homo sapiens GN=EIF4A1 PE=1 SV=1 - P60842 5.91% 1 2 3.182 [IF4A1_HUMAN] P32119 Peroxiredoxin-2 OS=Homo sapiens GN=PRDX2 PE=1 SV=5 - [PRDX2_HUMAN] 14.14% 1 2 3.286 BAG family molecular chaperone regulator 2 OS=Homo sapiens GN=BAG2 PE=1 O95816 5.21% 1 1 3.309 SV=1 - [BAG2_HUMAN] Bifunctional purine biosynthesis protein PURH OS=Homo sapiens GN=ATIC PE=1 P31939 11.66% 4 4 3.374 SV=3 - [PUR9_HUMAN] Phosphoglycerate mutase 1 OS=Homo sapiens GN=PGAM1 PE=1 SV=2 - P18669 15.75% 2 2 3.477 [PGAM1_HUMAN]

248

Chapter 8

Proliferating cell nuclear antigen OS=Homo sapiens GN=PCNA PE=1 SV=1 - P12004 7.66% 2 2 3.561 [PCNA_HUMAN] P37837 Transaldolase OS=Homo sapiens GN=TALDO1 PE=1 SV=2 - [TALDO_HUMAN] 14.24% 6 6 3.613 Acidic leucine-rich nuclear phosphoprotein 32 family member E OS=Homo sapiens Q9BTT0 5.22% 1 2 4.362 GN=ANP32E PE=1 SV=1 - [AN32E_HUMAN] Nuclear pore complex protein Nup205 OS=Homo sapiens GN=NUP205 PE=1 SV=3 Q92621 0.75% 1 1 4.404 - [NU205_HUMAN] Pyridoxine-5'-phosphate oxidase OS=Homo sapiens GN=PNPO PE=1 SV=1 - Q9NVS9 8.43% 1 1 4.481 [PNPO_HUMAN] Inosine-5'-monophosphate dehydrogenase 2 OS=Homo sapiens GN=IMPDH2 PE=1 P12268 7.20% 3 3 4.945 SV=2 - [IMDH2_HUMAN] Microtubule-associated protein 1B OS=Homo sapiens GN=MAP1B PE=1 SV=2 - P46821 0.57% 1 1 6.01 [MAP1B_HUMAN] SUMO-activating enzyme subunit 1 OS=Homo sapiens GN=SAE1 PE=1 SV=1 - Q9UBE0 8.38% 2 2 6.883 [SAE1_HUMAN] Laminin subunit gamma-1 OS=Homo sapiens GN=LAMC1 PE=1 SV=3 - P11047 0.87% 1 1 9.498 [LAMC1_HUMAN] DNA-(apurinic or apyrimidinic site) lyase OS=Homo sapiens GN=APEX1 PE=1 SV=2 P27695 2.83% 1 1 11.289 - [APEX1_HUMAN] *Medium = vehicle treated HEK-MARCHF6-myc cells; Heavy = cholesterol treated HEK-MARCHF6-myc cells

249