Calnexin Impairs the Antitumor Immunity of CD4+ and CD8+ T Cells

Author Manuscript Published OnlineFirst on November 6, 2018; DOI: 10.1158/2326-6066.CIR-18-0124 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Calnexin impairs the antitumor immunity of CD4+ and CD8+ T cells

Running title：Calnexin impairs T cell antitumor immunity

Yichen Chen1*, Da Ma1*, Xi Wang1*, Juan Fang1, Xiangqi Liu1, Jingjing Song1, Xinye Li1,

Xianyue Ren1, Qiusheng Li1, Qunxing Li1, Shuqiong Wen1, Liqun Luo2, Juan Xia1, Jun

Cui4, Gucheng Zeng2, Lieping Chen3, Bin Cheng1#, Zhi Wang1,5#

1Guanghua School of Stomatology, Guangdong Provincial Key Laboratory of Stomatology,

Stomatological Hospital, Sun Yat-Sen University, Guangzhou, 510055, PRC.

2Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou 510080, PRC

3 Department of Immunobiology and Yale Comprehensive Cancer Center, Yale University,

New Haven, CT 06519, USA.

4 Key Laboratory of Gene Engineering of the Ministry of Education, State Key Laboratory of Biocontrol, School of Life Sciences, Sun Yat-Sen University, Guangzhou, 510275, PRC.

5 Lead contact

*These authors contributed equally.

The authors declare no potential conflicts of interest

#Corresponding authors: Zhi Wang, D.D.S, Ph.D Guangdong Provincial Key Laboratory of Stomatology, Guanghua School of Stomatology, Sun Yat-Sen University, No. 56, Lingyuanwest Road, Guangzhou 510055, Guangdong, China. Tel: +86-20-87330591. Fax: 86-20-83822807. E-mail: [email protected]

Bin Cheng, D.D.S, Ph.D Guangdong Provincial Key Laboratory of Stomatology, Guanghua School of Stomatology, Sun Yat-Sen University, No. 56, Lingyuanwest Road, Guangzhou

Downloaded from cancerimmunolres.aacrjournals.org on September 28, 2021. © 2018 American Association for Cancer Research. Author Manuscript Published OnlineFirst on November 6, 2018; DOI: 10.1158/2326-6066.CIR-18-0124 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

510055, Guangdong, China. Tel: +86-20-87330591. Fax: 86-20-83822807. E-mail: [email protected]

Abstract

Elucidation of the mechanisms of T cell–mediated antitumor responses will provide information for the rational design and development of cancer immunotherapies. Here, we found that calnexin, an endoplasmic reticulum (ER) chaperone protein, is significantly upregulated in oral squamous cell carcinoma (OSCC). Upregulation of its membranous expression on OSCC cells is associated with inhibited T-cell infiltration in tumor tissues and correlates with poor survival of OSCC patients. We found that calnexin inhibits the proliferation of CD4+ and CD8+ T cells isolated from the whole blood of healthy donors and

OSCC patients and inhibits the secretion of IFNγ, TNFα, and IL2 from these cells.

Furthermore, in a melanoma model, knockdown of calnexin enhanced the infiltration and effector functions of T cells in the tumor microenvironment and conferred better control of tumor growth, whereas treatment with a recombinant calnexin protein impaired the infiltration and effector functions of T cells and promoted tumor growth. We also found that calnexin enhanced the expression of PD-1 on CD4+ and CD8+ T cells by restraining the

DNA methylation status of a CpG island in the PD-1 promoter. Thus, this work uncovers a mechanism by which T-cell antitumor responses are regulated by calnexin in tumor cells and suggests that calnexin might serve as a potential target for the improvement of antitumor immunotherapy.

Introduction

Although T-cell immunity plays a critical role in mediating antitumor immunity, the molecular mechanisms underlying impaired antitumor T-cell immunity are not fully understood. Immune checkpoint blockade with monoclonal antibodies directed against the inhibitory immune receptors CTLA-4, PD-1, and PD-L1 has emerged as a successful treatment approach which has shown striking antitumor activity in a variety of cancer types(1-3). Currently there are over ten CTLA4, PD-1, and PD-L1 antibodies in different stages of clinical trial in tumors. Despite the durable response rates observed with cancer immunotherapies, the majority of patients do not benefit from the treatment. A ‘‘hot’’ tumor microenvironment, typified by an increased number of CD8+ cytotoxic T lymphocytes and PD-L1 positive cells, has been identified to be a reliable predictive biomarker of response to immune checkpoint blockade (4-6). Some new strategies have been developed to convert immunologically ‘‘cold’’ tumors into ‘‘hot’’ tumors. Examples of these strategies include metabolic reprogramming of T cells or modulation of the gut microbiome(7,8). Still another approach needs to be developed based on novel insights into T-cell responses and immune systems.

Endoplasmic reticulum (ER) chaperones, including BiP/GRP78, calreticulin, calnexin,

GRP94, and ERP57, are a large family of proteins that have been discovered to have many important roles in maintaining ER homeostasis and contributing to cancer cell survival and progression. The correlation between ER chaperone expression and tumorigenesis has been extensively studied in various cancers, and most reports have indicated that these proteins promote the proliferation, migration and attachment of cancer cells (9-13). The ER chaperone calnexin, which is an ER-specific type I transmembrane

protein, regulates the folding and quality control of newly synthesized glycoproteins(14).

Calnexin can escape from the ER and be transported to the plasma membrane or released into the extracellular space by interacting with glycoproteins (15-17) or via its phosphorylation at two serine residues (Ser554/564) by protein kinase CK2 (18). Some studies have found that extracellular calnexin could be involved in innate and adaptive immunity in non-mammals (19-21), but the impact of surface or secreted calnexin on the human immune system has not been reported. The results from a lung cancer patient cohort provided evidence that calnexin may be a sero-diagnostic marker for lung cancer

(15).

In this study, we found that calnexin inhibits the infiltration and effector functions of T cells and enhances the expression of PD-1 on T cells. Membrane expression of calnexin was positively correlated with poor prognosis of oral squamous cell carcinoma (OSCC) patients. Our work thus uncovers a mechanism by which antitumor responses are regulated by calnexin expressed in tumor cells and suggests that calnexin may serve as a target for antitumor immunotherapy. Elucidation of these mechanisms will reveal clues as to the next steps that need to be taken to potentially overcome resistance to immunotherapy.

Materials and Methods

Patients and tissue samples For western blot analyses, 8 pairs of primary OSCC samples and corresponding normal oral epithelial tissues were obtained during surgeries at the Hospital of Stomatology, Sun Yat-sen University. For real time PCR analyses, 33 pairs of primary OSCC samples and corresponding normal oral epithelial tissues were obtained during surgeries at the Hospital of Stomatology, Sun Yat-sen University. For immunohistochemistry and immunofluorescence analyses, the expression of calnexin was

investigated using a tissue microarray (TMA) containing samples from 357 patients with primary OSCC who were treated at the Hospital of Stomatology, Sun Yat-sen University, between January 2007 and January 2009. All specimens were confirmed histologically by

H&E staining, and tumor tissue was present in more than 80% of the specimens. The follow-up interval was calculated from the date of surgery to the date of death or last clinical evaluation. The detailed information of these patients is described in Supplemental

Table S2. This study protocol was approved by the Institutional Review Board of the

Hospital of Stomatology, Sun Yat-sen University and was conducted in agreement with the

Helsinki Declaration, and written informed consent was obtained from all study participants.

Cell lines and reagents The HSC-3 cell line was purchased from the cell bank of the

Japanese Collection of Research Bioresource (JCRB). SCC15, SCC25, CAL27, B16F10, and MB49 cells were purchased from the American Type Culture Collection (ATCC). The normal keratinocyte cell line (NOK-SI) was kindly provided by J. Silvio

Gutkind (UCSD). Cell lines used in these experiments were passaged a maximum of 4 times before the experiments. Cells were tested for Mycoplasma contamination and identified by STR.

Mice C57BL/6 mice were purchased from the experimental animal center of Sun Yat-sen

University. NOD-Prkdcem26Cd52Il2rgem26Cd22/Nju (NCG) mice were purchased from

Nanjing biomedical research institute of Nanjing University. All experiments were approved by the Institutional Animal Care and Use Committee of Sun Yat-sen University and performed following local rules.

Flow Cytometry Single-cell preparations were stained with antibodies purchased from eBioscience, BD bioscience, and Biolegend. Isotype matched control mAb were used.

Intracellular staining was done using a Foxp3/Transcription factor staining kit or

Intracellular fix & perm set according to the manufacturer’s instructions (BD bioscience).

Briefly, cells were stimulated with 50ng/ml PMA (Sigma-Aldrich) and 5μg/ml Ionomycin

(Sigma-Aldrich) in the presence of GolgiPlug (BD bioscience). After 4 hours, cells were stained for dead cells using a FVD dye (eBioscience) and surface markers then fixed prior to intracellular staining for cytokines. Data were analyzed using a FACSVerse flow cytometer (BD biosciences) and using FlowJo software (Tree Star). The following antibodies were used for flow cytometry: Anti-mouse CD4 (clone GK1.5); Anti-mouse

CD8a (clone 53-6.7); Anti-mouse CD3 (clone 17A2); Anti-mouse/rat Foxp3 (clone FJK-

16s); Anti-mouse CD45.2 (clone 104); Anti-mouse ki-67 (Clone 16A8); Anti-mouse TNFα

(CloneMP6-XT22); Anti-mouse IFNγ (Clone MOB-47).

Xenograft assays in immune-deficient mice CNX-knockdown (sh-CNX) cells or control cells (6×106) were injected subcutaneously into right flank of NCG mice. And 1x107 human peripheral blood mononuclear cells (PBMCs) were injected via the tail vein after tumor implantation. The animals were monitored for tumor formation every 2 days and euthanized

3 weeks later. Tumor length (L) and width (W) were measured at the end of the experiment, and tumor volume was calculated by the formula (L×W2)/2. Serum cytokines were analyzed at the indicated time points, and human CD3+ T cells were counted after tumor dissociation.

Tumor experiment B16F10 tumor cells were retrovirally transduced with sh-CNX or a control and selected with puromycin (3 µg/ml). For tumor vaccination, naïve C57BL/6 mice were immunized with 1,000,000 irradiated B16F10 (10,000 rad) cells that were inoculated subcutaneously into the left flank. On day 14, the vaccinated mice were challenged with live transduced tumor cells that were inoculated subcutaneously into the right flank. A

CNX-Ig fusion protein or Flag-Ig (200 µg) was injected intraperitoneally (i.p.) into each mouse once a week. Tumor growth was monitored every 2 days. The mice were euthanized when the tumor size reached 150 mm2.

Isolation of Tumor infiltrating leukocytes from tissues Tumor infiltrating leukocytes

(TILs) from the xenograft tumors were prepared according to the protocol described previously(22,23). Briefly, tumors were dissected and homogenized using a GentleMACS dissociator (Miltenyi Biotech), digested with 0.05% collagenase IV (Sigma-Aldrich),

0.002% DNase I (Roche) at 37°C for 1 hour prior to centrifugation on Percoll density gradient (40-80%), and the TILs were washed and resuspended in RPMI.

Retroviral Constructs and Transduction of OSCC cell lines HSC3 cells were transfected with CNX shRNA or empty vector (Genechem) using Polybrene. The cells were trypsinized and replated in 0.5 μg/ml puromycin 48 hours after transfection. Two months later, the puromycin-resistant stable line was established and maintained in medium with 1 μg/ml puromycin. The transfected cells were incubated for 24 hours and harvested for real time PCR and western blot analysis.

In vitro antigen-specific T-cell response assay OSCC tumor cells were isolated from fresh specimen; single cell suspensions were obtained as described above. Human

PBMCs from 6 healthy donors and 8 OSCC patients were density-enriched by Ficoll

(TBD). Tumor antigens were prepared as described previously (24). Briefly, 2x107 tumor cells were subjected to four freeze (liquid nitrogen) and thaw (37 ℃ water bath) cycles to obtain a crude lysate as tumor antigen. After removal of large particles by centrifugation and sterilization by filtering (0.22 μm). The protein concentration in the supernatant was measured (Coomassie blue protein assay kit, Thermo scientific) and aliquots stored at -

80°C until use. A total of 1x105 PBMCs were stimulated for 48 hours in the presence or

absence of tumor lysate from the same patient and 1 µg/ml PHA-M (Sigma Aldrich).

GolgiPlug was added for 5 hours to the cells in culture. After 5 hours, cells were stained for viability using a FVD dye (eBioscience), and surface markers were then fixed prior to intracellular staining for cytokines using transcription factor buffer set and fixation / permeabilization solution kit (BD bioscience) per the manufacturer’s instructions (25). The culture supernatants were collected for examination by a human Th1/Th2 cytometric bead assay (BD bioscience) to quantitatively measure IL2, IL4, IL5, IL10, TNFα, and IFNγ protein levels. Briefly, test samples (50 μl) and PE detection antibody were incubated with capture bead reagent for 3 h in the dark at room temperature. All unbound antibodies are washed (1.0 ml wash buffer), re-suspended in 300 μl before acquisition on FACSVerse flow cytometer (BD biosciences).

Immunohistochemistry and immunofluorescence Tissues were deparaffinized and rehydrated prior to Antigen retrieval in citrate buffer. Tissues were stained with anti- calnexin (C5C9, Cell signaling technology), anti-CD3 (17A2, ebioscience), anti-CD4

(OKT4, ebioscience), anti-CD8 (HIT8A, ebioscience). HRP staining was visualized with 3-

39 diaminobenzidine (Gene company), and fluorescence staining was visualized with

Alexa fluor conjugated secondary antibody (Thermo scientific). Slides were counterstained, cleared, and mounted.

Pathology assessment Each TMA staining result was confirmed by a tissue slide from the same patient. The slides were scanned using an Aperio Scan Scope AT Turbo for digital image analysis. The images were blindly reviewed and scored by two certified anatomic pathologists. Calnexin expression was defined as cytoplasmic or membranous based on its immunoreactivity. As previously described (26-28), cytoplasmic calnexin staining in tumor cells was evaluated using the staining-intensity-distribution (SID) score.

The staining intensity of positive tumor cells was categorized into three grades by comparing the intensity with that of internal controls: 0, negative staining; 1 (weak), lighter than skeletal muscle; 2 (moderate), equal to skeletal muscle; and 3 (strong), more intense than skeletal muscle. The distribution of positive tumor cells was graded as follows: 0, no stained cells; 1, < 25% stained cells; 2, 25–50% stained cells; and 3, > 50% stained cells.

After multiplying the distribution score by the intensity score in eight different high-powered image fields, the average of the eight fields was the SID score for the sample. Cytoplasmic calnexin expression was categorized into low and high expression groups using the median of SID scores of the total patients. Although upon analysis, calnexin membranous immunoreactivity correlated with overall survival, we defined extensive staining as positive and no staining or sporadic staining as negative.

In vitro plate-bound T-cell activation assay Human CD3+ T cells were isolated from

PBMC of healthy donor using pan T-cell isolation kits (Stem cell Inc.). Then, labeling was performed by incubating 106 cells/ml at 37°C for 15 minutes with 5µM CFSE in PBS. CFSE was quenched by adding twice volume of complete media, followed by 3 washes in complete media before stimulation. 96-well flat bottom plates were coated with 1 μg/ml anti-CD3 (clone OKT3) at 4°C overnight. The wells were washed three times with PBS to remove unboundantibody and coated with another 5 μg/ml (ratio 1:5) calnexin-Ig or control-Ig protein in PBS at 4°C overnight. Wells were washed three times with PBS before adding cells. Replicate cultures (1x105 cells per well) were maintained in complete RPMI

1640 medium supplemented with 10% FBS, 10 mM HEPES, 50 μM β-ME, and penicillin / streptomycin / L-glutamine. The cultures were analyzed for CFSE profiles according to a time course as indicated.

Real-time PCR Total RNA was derived from cultured cells with Rnaiso Reagent (Takara).

Quantitative real-time PCR was done employing SYBR Green I Dye (Roche) and according to the protocol of Lightcycle 480 kits (Roche). The primer sequences of CNX were 5’-CATGATGGACATGATGATGACAC-3’ (forward) and 5’-CTAGAGGCTTGGT

GTATAC-3’. Results were normalized to the expression of GAPDH (forward; 5’-

AACTTTGGCATTG TGGAAGG-3’ and reverse: 5’-ACACATTGGGGGTAGGAACA-3’).

Western blot analysis Cells and tissues were lysed with radioimmunoprecipitation assay

(RIPA) buffer containing proteases inhibitor cocktail (Sigma Aldrich) and ultrasonication.

Protein quantification was performed using BCA Protein Assay Reagent (Thermo Fisher

Scientific), and 45 mg protein per sample was loaded into SDS-PAGE and sequentially immunoblotted with calnexin mAb (C5C9, Cell signaling technology). The proteins were using GAPDH antibodies (D16H11, Cell signaling technology) as loading controls.

CTL killing assay Tumor antigen–specific CD8+ human T-cell clones were generated from PBMCs from a healthy donor by in vitro stimulation using dendritic cells loaded with corresponding peptide epitopes (irradiated HSC3 cells were used as tumor antigens).

CNX-overexpressing HSC3 cells or control cells were labeled with CFSE and cocultured with CTLs at an effector-to-target ratio (E/T) of 5:1 and 10:1 for 4 hours. Then, 0.1 μg of

DAPI was added to each sample, and the samples were immediately analyzed by flow cytometry. CTL killing (%) = CFSE+DAPI+ cells / total CFSE+ cells ×100%.

Statistical methods Baseline characteristics were described by mean and standard deviation for continuous variables or described by numbers and percentages for categorical variables. To compare the baseline characteristics between different groups,

Student t test was used for continuous variables, whereas Chi-square tests were used for categorical variables. Overall survival was calculated and described by Kaplan-Meier

method. The difference of survival curves was tested by log-rank test. Univariate and multivariate Cox proportional models were used to analyze the associations between baseline characteristics and overall survival, and the hazard ratios with 95% confidence interval were calculated. All statistical analyses were performed by GraphPad Prism 7.0 and Stata/MP 14.0. All tests were two-sided, and a P value of less than 0.05 was considered significant.

Results

Upregulation of membranous calnexin is correlated with reduced T-cell infiltration

iTRAQ-coupled 2D LC-MS/MS technique was used to study the protein expression patterns of OSCC tumor tissue and control normal tissue. In total, 6 pairs of tissue lysates were analyzed. When the protein patterns of the primary tumor and its corresponding normal tissue were compared, multiple proteins were found to be differentially expressed.

Supplementary Table S1 shows 43 proteins that are significantly upregulated (> 2-fold).

Calnexin exhibited a higher expression in cancer tissues (2.7-fold elevation) when compared with the corresponding normal tissues. We further confirmed its expression by qRT-PCR (Fig. 1A), western blotting (Fig. 1B) and immunohistochemistry staining (Fig.

1C) in OSCC cells; paired cancer and adjacent noncancerous tissues were derived from the same OSCC patients. We found that calnexin was significantly upregulated in OSCC tissues.

Additionally, immunofluorescence analysis suggested that although most of the calnexin protein expression was observed in the cytosol of OSCC cells, a considerable fraction of calnexin colocalized with WGA in the cell membrane of tumor cells. Membrane localization of calnexin has been found in several tumors, including OSCC and melanoma (Fig. 1D),

suggesting that calnexin may exert its biological or immunological regulation functions as either a secreted or membrane-bound form. Since T cells play a critical role in mediating antitumor immunity, and impaired T-cell infiltration is positively correlated with poorer prognosis of tumor patients (29), we first determined whether there was any correlation between membranous expression of calnexin and T-cell infiltration in tumor tissues. Cell surface calnexin expression was determined by flow cytometry. We found that higher calnexin membranous expression was negatively correlated with the numbers of infiltrated

CD4+ and CD8+ T cells in OSCC tumor tissues (Fig. 1E&F).

Upregulation of membranous calnexin correlated with poor clinical prognosis.

Given that calnexin membranous expression was upregulated in OSCC tissues, we next determined whether calnexin expression in the cytosol and cell membrane was correlated with tumor prognosis. To address this, IHC staining of calnexin was performed to assess the expression of calnexin in samples from 357 patients with primary OSCC.

Representative images of the intensity stages are shown in Fig. 2A. Overall, cytoplasmic calnexin expression was categorized into low (178 of the 357 tumor samples, 49.86%) and high (179 of the 357 tumor samples, 50.14%) expression groups using the cut-off point

5.04 based upon the median of SID scores of the total patients. In addition, 71 of the 357 tumor samples (19.89%) showed apparent calnexin expression at the plasma membrane, whereas 286 of the 357 tumor samples (80.11%) showed negative staining of calnexin at the plasma membrane (Supplementary Table S2). Representative images are shown in

Fig 2A. The expression of calnexin was assessed for association with a number of clinicopathological variables (Supplementary Table S2).

As shown in Supplementary Table S3, overall patient survival was not significantly different when compared between low and high cytoplasmic expression of calnexin (P =

0.405), whereas patients with positive calnexin membranous expression had a significantly reduced overall survival than patients with negative expression (3-year OS: 47.89%

(35.93%–58.88%) vs. 66.43% (60.64%–71.58%), P = 0.016) (Fig. 2B). In the univariate analysis, calnexin membranous expression (P = 0.018) along with nodal stage (P < 0.001), clinical TNM stage (P = 0.030), and radiotherapy (P = 0.042) were significantly associated with overall survival. Adjusted for nodal stage and radiotherapy, patients with positive membranous expression of calnexin was significantly associated with reduced overall survival, compared with patients with negative expression (HR, 1.59; 95% CI, 1.10-2.30; P

= 0.013) (Fig 2C). There was no significant association between cytoplasmic expression of calnexin and overall survival among OSCC patients (Supplementary Tables S3–4).

Calnexin inhibits T-cell proliferation and antitumor effector functions

Since upregulation of calnexin in OSCC tumor tissues was correlated with reduced infiltration of CD4+ and CD8+ T cells, we hypothesized that calnexin impairs the antitumor immunity of effector T cells. A calnexin-Ig fusion protein (CNX-Ig) was generated to examine the regulatory roles of calnexin in T-cell responses. Indeed, we found that when immobilized on a microplate, calnexin-Ig, but not control-Ig, suppressed the proliferation of bulk puriﬁed CD4+ and CD8+ T cells in response to anti-CD3 stimulation (Fig. 3A) and inhibited the production of effector molecules such as IFNγ, TNFα, and IL2 (Fig. 3B).

Furthermore, calnexin inhibited the antitumor cytolytic functions of CD8+ T cells against

HSC3 tumor cells (Fig. 3C). These data collectively suggested that calnexin inhibited the proliferation and antitumor effector functions of CD4+ and CD8+ T cells. Although the receptor for calnexin is unknown, we speculated that the engagement of calnexin-R on T cells suppresses T-cell receptor (TCR) signaling. To test this hypothesis, proximal TCR signaling events were examined using calnexin-Ig. LAT is a proximal signaling adaptor that

is phosphorylated upon TCR stimulation and forms a complex with multiple signaling molecules, including SH2 domain containing a leukocyte protein of 76 kDa (SLP76) and phospholipase C (PLC)-γ1 (30). Immobilized calnexin-Ig substantially reduced the amount of SLP76 recruited to the CD3 complex, as well as its phosphorylation. When total cell lysates were examined, the phosphorylation of several downstream signaling molecules, such as Akt and Erk1/2 was also impaired (Fig. 3D).

In addition to demonstrating the inhibitory effect of calnexin on peripheral blood T cells from healthy donors, we also evaluated its role in circulating blood T cells from OSCC patients. Tumor lysates from the same patients were used as tumor antigens. We found that PBMCs from OSCC patients cocultured with calnexin-Ig showed inhibitory effects on the proliferation of CD8+ T cells (Fig. 4A) and reduced the number of functional CD8+ T cells producing IFNγ by nearly half (Fig. 4B). These findings were confirmed by our cytometric bead assay (CBA) results, which showed decreased production of IFNγ and

TNFα but increased production of IL10 by T cells (Fig. 4C). These changes were more significant in the tumor antigen–experienced cells. Since an increase in IL10 production by

T cells was observed, the induction of Treg was examined. However, calnexin could not promote Treg production in an antigen-specific manner (Supplementary Fig. S1). These data collectively suggested that calnexin inhibited the proliferation and antitumor effector functions of CD8+ T cells in OSCC patients in an antigen-dependent manner.

Calnexin promotes OSCC tumor growth in a humanized mouse model

Since calnexin inhibits the proliferation and effector functions of CD4+ and CD8+ T cells, we next determined whether calnexin-mediated impairment of antitumor T-cell responses contributes to tumor growth. Since OSCC tumor cells do not grow well in wild-type mice, a humanized mouse model were used (31,32). HSC3 tumor cells expressing shRNA-CNX

(sh-CNX) or shRNA-control (sh-NEG) were inoculated into NCG mice, and the mice were engrafted with human PBMCs after tumor implantation. The mice were euthanized before experiencing weight loss, a symptom of graft-versus-host disease (GVHD) that occurs in this humanized mouse model (Fig. 5A). In this model, the tumor growth in the sh-CNX group was lower than that in the sh-NEG group (p = 0.047) (Fig. 5B). We also detected increased frequencies of multifunctional CD3+ T cells producing IFNγ in the sh-CNX group compared with the sh-NEG group upon PBMC engraftment (Fig. 5C-D). We also examined control mice without PBMC injection in HSC3 tumor model and found that in contrast to the results from humanized mice, calnexin silencing promoted tumor growth in the immune- deficient mice (Fig. 5E-F), indicating that calnexin might have another tumor-intrinsic role that is independent of its function on T cells. These data indicated that calnexin suppressed antitumor immunity and promoted OSCC tumor growth via inhibiting the proliferation and effector functions of CD4+ and CD8+ T cells.

Calnexin deficiency promotes antitumor immunity and controls tumor growth.

We next developed a mouse melanoma model to determine whether calnexin-mediated impairment of T cells contributes to tumor growth. We injected mice subcutaneously with

B16F10 cells expressing shRNA targeting calnexin (sh-CNX) or control shRNA (sh-NEG) and monitored tumor growth. To generate protective immunity, naïve mice were vaccinated with irradiated B16F10 tumor cells in advance (Fig. 6A). We found that knockdown of calnexin in melanoma tumor cells significantly inhibited melanoma growth in mice, whereas administration of calnexin-Ig enhanced melanoma growth (Fig. 6B). Furthermore, knockdown of calnexin in melanoma tumor cells increased the infiltration of CD3+, CD4+, and CD8+ T cells in melanoma tumors (Fig. 6C-D) and enhanced the expression of Ki67 in

CD4+ and CD8+ T cells (Fig. 6E). Additionally, treatment with calnexin-Ig inhibited this

infiltration in melanoma tumors (Fig. 6D-E) and the expression of Ki67 in these T cells (Fig.

6F). Moreover, knockdown of calnexin in melanoma tumor cells enhanced the expression of the antitumor effector molecules IFNγ and TNFα by CD4+ and CD8+ T cells in melanoma tumors, and this effect was significantly reversed by treatment with calnexin-Ig

(Fig. 6F). No differences in Tregs and MDSC frequencies among TILs were found

(Supplementary Fig. S2). There were no significant differences in the proliferation and effector functions of CD4+ and CD8+ T cells located in the spleen, lymph nodes and

PBMCs between the groups (Supplementary Fig. S3). To confirm that there is no intrinsic enhancement of tumor growth in the absence of T cell–mediated antitumor immunity, tumors were inoculated in T cell–deficient nude mice. As shown in Supplementary Fig. S4, administration of calnexin-Ig no longer enhanced melanoma growth upon T-cell deficiency.

Calnexin-silenced B16F10 tumors grew more rapidly than control tumors, which is consistent with our previous observation (Fig. 5E-F) that tumor intrinsic calnexin itself suppressed tumor growth. Together, these data indicated that calnexin deficiency promotes antitumor immunity and controls tumor growth in a T cell–dependent manner.

Calnexin enhances the expression of PD-1 by repressing PD-1 promoter methylation

Given that T-cell surface receptors such as TIGIT, CTLA-4, PD-1, and LAG-3 play critical roles in inhibiting T-cell responses, we next determined whether upregulation of calnexin might enhance the expression of these molecules and therefore induce impairment of the proliferation and effector functions of CD4+ and CD8+ T cells in tumors. To address this, we analyzed the expression of TIGIT, CTLA-4, PD-1H, PD-1, and LAG-3 on CD4+ and

CD8+ T cells derived from melanoma tumor samples. We found that knockdown of calnexin in melanoma tumor cells significantly decreased the expression of PD-1, but not

TIGIT, CTLA-4, PD-1H, or LAG-3, in CD4+ and CD8+ T cells derived from melanoma tumor

samples (Fig. 7A). In contrast, calnexin-Ig treatment partly reversed the decrease in PD-1 expression on CD4+ and CD8+ T cells conferred by knockdown of calnexin in melanoma tumors (Fig. 7A). Similar results were found in an MB49 tumor model with calnexin-Ig treatment (Fig. 7B). Additionally, calnexin-Ig enhanced the expression of PD-1 on CD8+ T cells in PBMCs derived from patients with progressive OSCC, and this enhancement was more significant in tumor antigen–experienced T cells, as shown in Fig. 7C. Thus, these data suggested that calnexin enhanced the expression of PD-1 on CD4+ and CD8+ T cells in OSCC in an antigen-dependent manner.

We then determined the mechanism by which calnexin enhanced the expression of PD-1 on T cells in tumors. Since PD-1 promoter CpG island methylation status plays a central role in mediating PD-1 expression (33,34), we analyzed the methylation of this region using bisulfite sequencing in T cells from OSCC patients’ PBMCs (Fig. 7D). In contrast to control-Ig, T cells treated with Calnexin-Ig significantly repressed the methylation of the

PD-1 promoter CpG island (Fig. 7E).

Discussion

In this study, we discovered that the ER chaperone protein calnexin was highly upregulated in OSCC tumor tissues and multiple tumors. Upregulation of membranous calnexin was positively correlated with poor prognosis of OSCC patients. We found that calnexin played a central role in inhibiting the infiltration and effector functions of T cells and promoting the expression of PD-1 on CD4+ and CD8+ T cells in tumors, which therefore enhanced tumor growth, demonstrating the potential of calnexin as a new antitumor immunotherapy target.

Calnexin has been reported to play a role in the folding and quality control of newly

synthesized glycoproteins (14,35). A wide variety of important cellular and viral glycoproteins are known substrates of calnexin, including HIV gp120 and gp160, class I major histocompatibility complex (MHC) heavy chain, and TCR subunits (36,37). Although several reports have shown that calnexin expression may be associated with the progression of breast cancer, lung cancer, and colorectal cancer, most previous studies of calnexin focused on the relationship between the expression of calnexin and clinical outcome (38-40). Whether calnexin regulates the T-cell response during tumor development is unknown. Here, we first identified that upregulation of calnexin in tumor cells could inhibit the infiltration of T cells in tumors and the proliferation and effector functions of CD4+ and CD8+ T cells. As increasing evidence has suggested that the infiltration and effector functions of T cells in tumors are critical for antitumor immunity, this finding therefore reveals a mechanism responsible for poor survival of tumor patients.

A finding of the current study is the establishment of an immunological link between calnexin and PD-1 on T cells. We found that knockdown of calnexin in melanoma tumor cells significantly decreased the expression of PD-1. In addition, calnexin-Ig treatment partly reversed the decrease of PD-1 expression on T cells. Calnexin-Ig also enhanced the expression of PD-1 on T cells in PBMCs derived from patients with progressive OSCC by inhibiting the PD-1 promoter CpG island methylation. PD-1 is upregulated on activated T cells. The binding of PD-1 and PD-L1 induces T-cell anergy and cell death (5,41). This study provides evidence suggesting that PD-1 expression on T cells can be influenced by the expression of calnexins. The detailed mechanism by which calnexin mediates PD-1 expression during tumor development should be investigated in future studies. There are substantial efforts underway to identify reliable predictive biomarkers of response and resistance to immune checkpoint blockade, including total tumor mutational load (42,43), as well as markers of an effective immune infiltrate within a tumor signifying a ‘‘hot’’ or

“cold” tumor microenvironment (44). This study provides a potential target for the improvement of responses to anti–PD-1 immunotherapy. Since the density or distribution of T cells and PD-1/PD-L1 axis activation could affect the differential responses to checkpoint blockade, the effect of calnexin on the enhancement of antitumor responses during PD-1 blockade should be determined in further studies.

Although we found that calnexin expressed in tumor cells limited the infiltration and effector functions of CD4+ and CD8+ T cells in tumors and therefore promoted tumor cell growth, the specific receptor expressed on CD4+ and CD8+ T cells that interacts with calnexin remains unknown. Additionally, the observations that only membranous calnexin expressed in tumor cells was associated with poorer survival of OSCC patients indicate that direct contact with PBMCs is required for calnexin to exert its regulatory function.

Identification of the receptor that interacts with calnexin expressed in tumor cells will allow us to better understand the mechanism by which calnexin impairs the infiltration and effector functions of CD4+ and CD8+ T cells in the tumor microenvironment. Although low concentrations of calnexin were isolated from lung cancer patients’ peripheral blood serum

(15), the interaction between calnexin and T cells may primarily occur in the tumor site.

Thus, the interaction between calnexin and T cells in the circulation and lymphoid tissue may be not sufficient for inhibition of the proliferation and effector functions of T cells.

Previous studies from other groups suggest that calnexin could be transported to the plasma membrane to interact with glycoproteins such as clonotype-independent CD3 complexes (45,46). Further studies are required to determine what protein interacts with calnexin.

Acknowledgements We thank Luisa A. DiPietro（College of Dentistry, UIC) for the suggestions on this manuscript. This project was supported by the National Natural

Science Foundations of China (No.81772896, 81472524, 81630025，81602383,

81602384).

Disclosure of Potential Conflicts of Interest

There is no conflict of interest

References

1. Okazaki T, Chikuma S, Iwai Y, Fagarasan S, Honjo T. A rheostat for immune responses: the unique properties of PD-1 and their advantages for clinical application. Nat Immunol 2013;14:1212-8 2. Zou W, Wolchok JD, Chen L. PD-L1 (B7-H1) and PD-1 pathway blockade for cancer therapy: Mechanisms, response biomarkers, and combinations. Sci Transl Med 2016;8:328rv4 3. Schadendorf D, Hodi FS, Robert C, Weber JS, Margolin K, Hamid O, et al. Pooled Analysis of Long-Term Survival Data From Phase II and Phase III Trials of Ipilimumab in Unresectable or Metastatic Melanoma. J Clin Oncol 2015;33:1889-94 4. Taube JM, Klein A, Brahmer JR, Xu H, Pan X, Kim JH, et al. Association of PD-1, PD-1 ligands, and other features of the tumor immune microenvironment with response to anti- PD-1 therapy. Clin Cancer Res 2014;20:5064-74 5. Tumeh PC, Harview CL, Yearley JH, Shintaku IP, Taylor EJ, Robert L, et al. PD-1 blockade induces responses by inhibiting adaptive immune resistance. Nature 2014;515:568- 71 6. Sharma P, Hu-Lieskovan S, Wargo JA, Ribas A. Primary, Adaptive, and Acquired Resistance to Cancer Immunotherapy. Cell 2017;168:707-23 7. Buck MD, O'Sullivan D, Klein Geltink RI, Curtis JD, Chang CH, Sanin DE, et al. Mitochondrial Dynamics Controls T Cell Fate through Metabolic Programming. Cell 2016;166:63-76 8. Sivan A, Corrales L, Hubert N, Williams JB, Aquino-Michaels K, Earley ZM, et al. Commensal Bifidobacterium promotes antitumor immunity and facilitates anti-PD-L1 efficacy. Science 2015;350:1084-9 9. Wiersma VR, Michalak M, Abdullah TM, Bremer E, Eggleton P. Mechanisms of Translocation of ER Chaperones to the Cell Surface and Immunomodulatory Roles in Cancer and Autoimmunity. Front Oncol 2015;5:7 10. Gutierrez T, Simmen T. Endoplasmic reticulum chaperones and oxidoreductases: critical regulators of tumor cell survival and immunorecognition. Front Oncol 2014;4:291 11. Graner MW, Lillehei KO, Katsanis E. Endoplasmic reticulum chaperones and their roles in the immunogenicity of cancer vaccines. Front Oncol 2014;4:379 12. Dejeans N, Glorieux C, Guenin S, Beck R, Sid B, Rousseau R, et al. Overexpression of GRP94 in breast cancer cells resistant to oxidative stress promotes high levels of cancer cell proliferation and migration: implications for tumor recurrence. Free Radic Biol Med 2012;52:993-1002 13. Zamanian M, Veerakumarasivam A, Abdullah S, Rosli R. Calreticulin and cancer. Pathol Oncol Res 2013;19:149-54

14. Schrag JD, Bergeron JJ, Li Y, Borisova S, Hahn M, Thomas DY, et al. The Structure of calnexin, an ER chaperone involved in quality control of protein folding. Mol Cell 2001;8:633-44 15. Kobayashi M, Nagashio R, Jiang SX, Saito K, Tsuchiya B, Ryuge S, et al. Calnexin is a novel sero-diagnostic marker for lung cancer. Lung Cancer 2015;90:342-5 16. Wiest DL, Burgess WH, McKean D, Kearse KP, Singer A. The molecular chaperone calnexin is expressed on the surface of immature thymocytes in association with clonotype- independent CD3 complexes. The EMBO Journal 1995;14:3425-33 17. Okazaki Y, Ohno H, Takase K, Ochiai T, Saito T. Cell surface expression of calnexin, a molecular chaperone in the endoplasmic reticulum. J Biol Chem 2000;275:35751-8 18. Myhill N, Lynes EM, Nanji JA, Blagoveshchenskaya AD, Fei H, Simmen KC, et al. The subcellular distribution of calnexin is mediated by PACS-2. Mol Biol Cell 2008;19:2777-88 19. Huang Y, Hui K, Jin M, Yin S, Wang W, Ren Q. Two endoplasmic reticulum proteins (calnexin and calreticulin) are involved in innate immunity in Chinese mitten crab (Eriocheir sinensis). Sci Rep 2016;6:27578 20. Wuthrich M, Brandhorst TT, Sullivan TD, Filutowicz H, Sterkel A, Stewart D, et al. Calnexin Induces Expansion of Antigen-Specific CD4(+) T Cells that Confer Immunity to Fungal Ascomycetes via Conserved Epitopes. Cell Host Microbe 2015;17:452-65 21. Zhang Q, Wang XQ, Jiang HS, Jia WM, Zhao XF, Wang JX. Calnexin functions in antibacterial immunity of Marsupenaeus japonicus. Dev Comp Immunol 2014;46:356-63 22. Lemos H, Mohamed E, Huang L, Ou R, Pacholczyk G, Arbab AS, et al. STING Promotes the Growth of Tumors Characterized by Low Antigenicity via IDO Activation. Cancer Res 2016;76:2076-81 23. Khan MW, Keshavarzian A, Gounaris E, Melson JE, Cheon EC, Blatner NR, et al. PI3K/AKT signaling is essential for communication between tissue-infiltrating mast cells, macrophages, and epithelial cells in colitis-induced cancer. Clin Cancer Res 2013;19:2342- 54 24. Bachleitner-Hofmann T, Strohschneider M, Krieger P, Sachet M, Dubsky P, Hayden H, et al. Heat shock treatment of tumor lysate-pulsed dendritic cells enhances their capacity to elicit antitumor T cell responses against medullary thyroid carcinoma. J Clin Endocrinol Metab 2006;91:4571-7 25. Singhal S, Bhojnagarwala PS, O'Brien S, Moon EK, Garfall AL, Rao AS, et al. Origin and Role of a Subset of Tumor-Associated Neutrophils with Antigen-Presenting Cell Features in Early-Stage Human Lung Cancer. Cancer Cell 2016;30:120-35 26. Harris MR, Yu YY, Kindle CS, Hansen TH, Solheim JC. Calreticulin and calnexin interact with different protein and glycan determinants during the assembly of MHC class I. J Immunol 1998;160:5404-9 27. Williams DB. Beyond lectins: the calnexin/calreticulin chaperone system of the endoplasmic reticulum. J Cell Sci 2006;119:615-23 28. Lewis MJ, Pelham HR. A human homologue of the yeast HDEL receptor. Nature 1990;348:162-3 29. Fridman WH, Galon J, Pages F, Tartour E, Sautes-Fridman C, Kroemer G. Prognostic and predictive impact of intra- and peritumoral immune infiltrates. Cancer Res 2011;71:5601-5 30. Zhang W, Sloan-Lancaster J, Kitchen J, Trible RP, Samelson LE. LAT: the ZAP-70 tyrosine kinase substrate that links T cell receptor to cellular activation. Cell 1998;92:83-92 31. Pearson T, Greiner DL, Shultz LD. Creation of "humanized" mice to study human immunity. Curr Protoc Immunol 2008;Chapter 15:Unit 15 21 32. Brehm MA, Cuthbert A, Yang C, Miller DM, DiIorio P, Laning J, et al. Parameters for establishing humanized mouse models to study human immunity: analysis of human

hematopoietic stem cell engraftment in three immunodeficient strains of mice bearing the IL2rgamma(null) mutation. Clin Immunol 2010;135:84-98 33. Youngblood B, Oestreich KJ, Ha SJ, Duraiswamy J, Akondy RS, West EE, et al. Chronic virus infection enforces demethylation of the locus that encodes PD-1 in antigen-specific CD8(+) T cells. Immunity 2011;35:400-12 34. Ahn E, Youngblood B, Lee J, Lee J, Sarkar S, Ahmed R. Demethylation of the PD-1 Promoter Is Imprinted during the Effector Phase of CD8 T Cell Exhaustion. J Virol 2016;90:8934-46 35. Leach MR, Cohen-Doyle MF, Thomas DY, Williams DB. Localization of the lectin, ERp57 binding, and polypeptide binding sites of calnexin and calreticulin. J Biol Chem 2002;277:29686-97 36. Jennelle L, Hunegnaw R, Dubrovsky L, Pushkarsky T, Fitzgerald ML, Sviridov D, et al. HIV-1 protein Nef inhibits activity of ATP-binding cassette transporter A1 by targeting endoplasmic reticulum chaperone calnexin. J Biol Chem 2014;289:28870-84 37. Thammavongsa V, Mancino L, Raghavan M. Polypeptide substrate recognition by calnexin requires specific conformations of the calnexin protein. J Biol Chem 2005;280:33497-505 38. Liu Y, Komohara Y, Domenick N, Ohno M, Ikeura M, Hamilton RL, et al. Expression of antigen processing and presenting molecules in brain metastasis of breast cancer. Cancer Immunol Immunother 2012;61:789-801 39. Okayama A, Miyagi Y, Oshita F, Nishi M, Nakamura Y, Nagashima Y, et al. Proteomic analysis of proteins related to prognosis of lung adenocarcinoma. J Proteome Res 2014;13:4686-94 40. Yeates LC, Powis G. The expression of the molecular chaperone calnexin is decreased in cancer cells grown as colonies compared to monolayer. Biochem Biophys Res Commun 1997;238:66-70 41. Chen DS, Mellman I. Oncology meets immunology: the cancer-immunity cycle. Immunity 2013;39:1-10 42. Roszik J, Haydu LE, Hess KR, Oba J, Joon AY, Siroy AE, et al. Novel algorithmic approach predicts tumor mutation load and correlates with immunotherapy clinical outcomes using a defined gene mutation set. BMC Med 2016;14:168 43. Chan TA, Wolchok JD, Snyder A. Genetic Basis for Clinical Response to CTLA-4 Blockade in Melanoma. N Engl J Med 2015;373:1984 44. van der Woude LL, Gorris MAJ, Halilovic A, Figdor CG, de Vries IJM. Migrating into the Tumor: a Roadmap for T Cells. Trends in cancer 2017;3:797-808 45. Wiest DL, Burgess WH, McKean D, Kearse KP, Singer A. The molecular chaperone calnexin is expressed on the surface of immature thymocytes in association with clonotype- independent CD3 complexes. EMBO J 1995;14:3425-33 46. van Leeuwen JE, Kearse KP. Calnexin associates exclusively with individual CD3 delta and T cell antigen receptor (TCR) alpha proteins containing incompletely trimmed glycans that are not assembled into multisubunit TCR complexes. J Biol Chem 1996;271:9660-5

Figure legends

Figure 1. Calnexin expression is upregulated in OSCC and its membranous expression is correlated with reduced infiltration of T cells in OSCC tissues. (A) Left

panel: qRT-PCR analyses of calnexin (CNX) expression in tumor and adjacent normal tissues derived from the same OSCC patient (n = 33); right panel: qRT-PCR analyses of

CNX expression in OSCC cell lines. NOK cells served as control cells. (B) Western blotting analysis of CNX expression in the cell lines (upper panel) and paired tissues (lower panel).

N: normal tissue; Ca: Cancer (n = 8). (C) Immunohistochemistry (IHC) analysis of CNX expression in tumor and adjacent normal tissues derived from a typical patient with progressive OSCC. (D) Representative immunofluorescence microscopic images of CNX in OSCC tissue and melanoma tissue. In addition to be primarily expressed in the cytosol of OSCC cells, a significant fraction of calnexin colocalized with Wheat germ agglutinin

(WGA) in the cell membrane of tumor cells (scale bar, 50 μm). (E) The gating strategy of

CNX positive epithelial cell and T cells in single cell suspension of fresh surgical specimen.

(F) The number of CNX+ epithelial cells among every gram of OSCC tissue, was correlated with CD4+ and CD8+ T cells in corresponding single cell suspensions, n = 20. Pearson’s correlation coefficient was used. Bar graph is shown as the mean ± SEM. *p < 0.05, ***p <

0.001, ****p < 0.0001. One representative experiment of three is depicted.

Figure 2. Upregulation of membranous calnexin is correlated with poorer overall survival rates of OSCC patients. (A) The calnexin (CNX) cytoplasmic expression was determined based on the staining intensity and proportion, and then divided into high and low expression groups using the cut-off point 5.04 based upon the median of SID scores of the total patients. The CNX plasma membrane expression was determined, and the samples were divided into positive and negative expression groups. Representative images showing strong-, moderate- and weak-intensity cytoplasmic staining and positive/negative membranous staining in tumor tissue samples derived from OSCC patients. (B) Analysis of the associations between the cytoplasmic and membranous expression of CNX and overall survival among 357 OSCC patients. Kaplan-Meier survival

curves showed that patients with positive membranous expression of CNX had a significantly reduced overall survival than patients with negative expression (p = 0.016).

CNX cytoplasmic expression was not significantly associated with overall survival (p =

0.405). The p value was determined by log-rank test. (C) Adjusted multivariable risk factor cohort of overall survival. CNX membranous expression was significantly associated with overall survival (p = 0.013).

Figure 3. Calnexin inhibited the proliferation of CD4+/CD8+ T cells and the cytotoxicity of CD8+ T cells. Fresh peripheral blood mononuclear cells (PBMCs) were isolated from 6 healthy donors. (A) CFSE-labeled, bulk-purified pan T cells were stimulated by plate-bound anti-CD3 together with co-absorbed calnexin-Ig (CNX-Ig) or control-Ig (Flag-Ig) protein. Upper panel: representative CFSE dilution profiles. Lower panel: the percentage of CFSE-low cells was quantified. (B) Culture supernatants in (A) were collected at the indicated times. The concentrations of IL2, IFNγ, and TNFα were analyzed by ELISA. (C) Tumor antigen–specific CD8+ human T-cell clones (CTL) were generated from PBMCs of a healthy donor by in vitro stimulation using dendritic cells loaded with irradiated HSC3 cells. CNX-overexpressing HSC3 cells (CNX) or control cells

(Vector) were labeled with CFSE and cocultured with CTLs at an effector-to-target ratio

(E/T) of 5:1 and 10:1 for 4 hours. (D) Engagement of CNX during TCR activation maximally suppresses proximal adaptor signaling. Naïve pan T cells purified from human

PBMCs were incubated on ice for 30 minutes with anti-CD3/CD28 and CNX-Ig or Flag-Ig.

Then, cell lysates were prepared, and the phosphorylation status of SLP76, PLC-γ1, AKT and Erk1/2 was examined by immunoblotting. Bar graph is shown as the mean ± SEM (n =

6), N.S., not significant. * p < 0.05, **P < 0.01, *** P < 0.001, **** P < 0.0001. One representative experiment of three is depicted.

Figure 4. Calnexin inhibited tumor antigen-specific Ki67 and IFNγ expression on

CD8+ T cells during progressive OSCC. Fresh PBMCs isolated from 8 patients with progressive OSCC were restimulated by tumor lysate in the presence of CNX-Ig or Flag-Ig for 48 hours. The PBMCs were then subjected to flow cytometric analyses of Ki67 and

IFNγ expression, and the culture supernatants were subjected to cytometric bead assay

(CBA) analysis of Th1/Th2 cytokine concentrations. (A) Representative flow cytometric data and bar graph show the percentages of Ki67+CD8+ T cells in the presence of OSCC tumor lysate with CNX-Ig or Flag-Ig. (B) Representative flow cytometric data and bar graph data show the percentages of IFNγ+CD8+ T cells in the presence of OSCC tumor lysate with CNX-Ig or Flag-Ig. (C) Concentrations of IFNγ, TNFα, and IL10 in the culture supernatants. Bar graph is shown as mean ± SEM (n = 8). N.S., not significant, * P < 0.05,

** P < 0.01, **** P < 0.0001. One representative experiment of two is depictedFigure 5.

Calnexin promotes OSCC tumor growth in humanized NCG mice. (A) Schematic diagram showed the experiment protocol used to determine the role of CNX in OSCC tumor growth in immune-integrity environment. On day 1, mouse was transplanted with

HSC3 cells transduced with sh-CNX or sh-NEG, 1x107 human PBMCs were injected i.p.

On day 7 and day 14, peripheral blood samples were taken. (B) Representative in situ images of OSCC tumors and tumor volume kinetics were measured and calculated using the following formula: V=L x W2 /2. (C-D) The bar graph shows the increased frequencies of CD3+ T cells and functional T cells producing IFNγ in the sh-CNX group compared with the sh-NEG group after PBMC engraftment. (E) Schematic diagram shows the experiment protocol used to determine the role of CNX in OSCC tumor growth in immune-deficient environment. HSC3 cells transduced with shRNA targeting CNX (sh-CNX) or control shRNA (sh-NEG) were injected s.c. at indicated time. (F) Representative in situ images of

OSCC tumors in NCG mice and tumor volume kinetics were measured and calculated

using the formula described in (B). Bar graph is shown as mean ± SEM (n = 5), * p < 0.05.

One representative experiment of two is depicted.

Figure 6. Calnexin expressed in tumor cells inhibits the anti-tumor protective immunity of CD4+ and CD8+ T cells in a mouse melanoma model. (A) Schematic diagram shows the protocol used to determine the effect of CNX on melanoma tumor growth in mice.. (B) Kinetics of tumor volumes in mice as indicated (n = 4-5). (C) Flow cytometry analysis of the number of CD4+ and CD8+ T cells infiltrated in tumors derived from mice with the indicated treatments. Note that knockdown of CNX significantly increased the number of infiltrated CD4+ or CD8+ T cells in tumors. However, treatment with CNX-Ig decreased the number of tumor-infiltrated CD4+ or CD8+ T cells (n = 4-5). (D)

IHC analysis of tumors derived from mice with indicated treatments suggested that significantly larger numbers of infiltrated CD3+ T cells in tumors were observed in the CNX- deficient group. (E) Flow cytometry analysis of the Ki67 expression on tumor infiltrated

CD4+ and CD8+ T cells. (G) Representative flow cytometric analysis of expression of IFNγ and TNFα in CD4+ or CD8+ T cells isolated from tumors derived from mice with the indicated treatments; note that knockdown of CNX in melanoma tumor cells enhanced expression of the antitumor effector molecules IFNγ and TNFα produced by CD4+ and

CD8+ T cells, and this enhancement of effector functions was significantly reversed by treatment with the CNX-Ig. Bar graph is shown as mean ± SEM(n=4-5), * P < 0.05, ** P <

0.01, *** P < 0.001, **** P < 0.0001, N.S., not significant. One representative experiment of two is depicted.

Figure 7. Calnexin promotes the expression of PD-1 on CD4+/CD8+ T cells in tumor by restraining the DNA methylation status of a CpG region in the PD-1 (PDCD1) promoter. (A) Representative flow cytometric analysis and dot plot data show the

expression of PD-1, TIGIT, CTLA-4, PD-1H, and LAG-3 on CD4+ or CD8+ T cells isolated from mice in Figure 6. The data showed that knockdown of CNX in B16F10 tumor cells significantly reduced the expression of PD-1, but not TIGIT, CTLA-4, PD-1H, or LAG-3, on

CD4+ or CD8+ T cells (n = 4-5). (B) Representative flow cytometric analysis and dot plot data from an MB49 tumor model showed that treatment with CNX-Ig, but not Flag-Ig protein, significantly enhanced the expression of PD-1 on CD4+ and CD8+ T cells(n = 4-5).

One representative experiment of two is depicted. (C) Representative flow cytometric data and bar graph data showed that CNX-Ig increased the expression of PD-1 among CD8+ T cells in the presence of OSCC tumor antigen(n=8). (D) Schematic of the CpG island and bisulfite pyrosequencing region in the PDCD1 promoter. TSS: transcription start site; Red letters: CG sites for bisulfite pyrosequencing. Bisulfite pyrosequencing was used to detect the methylation of PD-1 promoter CpG island. (E) The average methylation in the CNX-Ig and Flag-Ig group was calculated. Note that recombinant CNX-Ig significantly suppressed

PD-1 promoter CpG island methylation in T cells. The data are representative of three independent experiments. Bar graph is shown as mean ± SEM, * P < 0.05, ** P < 0.01, ***

P < 0.001, N.S., not significant.

Downloaded from cancerimmunolres.aacrjournals.org on September 28, 2021. © 2018 American Association for Cancer Research. Figure 1 Author Manuscript Published OnlineFirst on November 6, 2018; DOI: 10.1158/2326-6066.CIR-18-0124 A Author manuscripts have been peer reviewed and acceptedB for publication but have not yet been edited. p = 0.0121 * **** NOK Cal27HSC3 SCC15 SCC25 10 25 **** CNX 8 20 * 6 15 GAPDH 4 10 1 2 3 4 5 6 7 8

expression Ca Ca N Ca N Ca 2 5 N Ca N Ca N Ca N Ca N N Relative mRNA N/AD ratio CNX/GAPDH 0 0 CNX r 3 5 e al 2 nc rm OK L27 SC GAPDH N A H CC15CC Ca No C S S

C D

4X OSCC DAPI WGA CNX Merge

Malenoma DAPI WGA CNX Merge 40X 40X OSCC Normal tissue

E F

8.0M 8.0M

6.0M 6.0M

4.0M 4.0M

2.0M 2.0M /g) 5 /g) 7 r = -0.5197 7 3 r = -0.5080

0 0 p = 0.0189 SSC SSC 4 p = 0.0222 0 2.0M 4.0M 6.0M 8.0M 2 3 4 5 6 7 10 10 10 10 10 10 FSC PI 3 2 cells (x10 2 cells (x10 + + 1 4 1 CD CD8 7 7 10 10 0 0

6 0 2 4 6 0 2 4 6 10 6 10

5 10 + 7 + 7 5 10 CNX epithelial cells (x10 /g) CNX epithelial cells (x10 /g) 4 10 4 10 3 10 3 10 0

2 10 CNX CD4/8 2 3 4 5 6 7 2 3 4 5 6 7 10 10 10 10 10 10 10 10 10 10 10 10 EpCAM CD3

Downloaded from cancerimmunolres.aacrjournals.org on September 28, 2021. © 2018 American Association for Cancer Research. Figure 2 Author Manuscript Published OnlineFirst on November 6, 2018; DOI: 10.1158/2326-6066.CIR-18-0124 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

A CNX cytoplastic staining

CNX intensity (weak) CNX intensity (moderate) CNX intensity (strong)

CNX plasma membrane staining

Positive Negative

CNX cytoplasmic expression CNX membrance expression

) 100 100

High expression Negative 50 50 Low expression Positive Log-rank test: p=0.405 Log-rank test: p=0.016

Overall-survival (% 0 Overall-survival (%) 0 0 12 24 36 48 60 72 0 12 24 36 48 60 72 Months to last follow up Months to last follow up NO.at risk NO.at risk High expression 179 153 123 114 105 83 3 Negative 286 250 205 190 163 118 6 Low expression 178 154 122 110 92 60 3 Positive 71 57 40 34 34 25 0

Multivariable risk factor

HR (95% CI) p

CNX membranous expression 1.59 (1.1-2.3) 0.013 (Positive vs Negative) Nodal stage 1.88 (1.36-2.59) <0.001 (N1-N3 vs N0) Radiotherapy 0.56 (0.36-0.88) 0.012 (Yes vs No)

0 1 2 3

Downloaded from cancerimmunolres.aacrjournals.org on September 28, 2021. © 2018 American Association for Cancer Research. Author Manuscript Published OnlineFirst on November 6, 2018; DOI: 10.1158/2326-6066.CIR-18-0124 Figure 3 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. A B

CD4 CD8 * ** α-CD3 800 * 1500 *** ) l

α-CD3+CNX-Ig ) l 600 α-CD3+Flag-Ig 1000 pg /m

400 ( Control (pg /m 2

- 500 L

I 200 IFN-γ

0 0

CFSE 4 8 2 4 8 2 2 4 7 2 4 7

N.S. Time(h) Time(h) **** * 100 100 **** **** 500 N.S. * ** ** CNX-Ig ) **** l 80 ** 80 400 Flag-Ig

60 60 pg /m 300 ( FSE -l ow (%) FSE -l ow (%) 40 40 200 C C NF-α + +

20 20 T 100 CD 4 0 CD 8 0 0

4 8 2 α-CD3 + ++ - α-CD3 + ++ - 2 4 7 Flag-Ig- + - - Flag-Ig - + - - Time (h) CNX-Ig + --- CNX-Ig + ---

CNX-Ig Flag-Ig C D p-SLP76 CNX Vector

5 5 5 10 0 7.91 10 0 25.5 10 0 5.68 SLP76

4 4 4 10 10 10

3 3 3 10 10 10 p-PLCγ-1 2 2 2 10 10 10

1 1 1 10 10 10 0 92.1 0 74.5 0 94.3 0 0 0 PLCγ-1 10 10 10 DAPI 0 1 2 3 4 5 0 1 2 3 4 5 0 1 2 3 4 5 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 CFSE p-AKT Effector : Target = 5 : 1 Effector : Target = 0 : 1

AKT 50 5 5 *** *** CNX 10 0 14.3 10 0 38.8 40 4 4 Vector p-Erk1/2 10 10 (%)

3 3 10 10 30 illi n g 2 2 10 10 20 Erk1/2

1 1 10 10

0 85.7 0 61.2 CTL K 10 0 0

DAPI 10 10 0 1 2 3 4 5 0 1 2 3 4 5 β-actin 10 10 10 10 10 10 10 10 10 10 10 10 0 CFSE :1 :1 5 0 Effector : Target = 10 : 1 1

Downloaded from cancerimmunolres.aacrjournals.org on September 28, 2021. © 2018 American Association for Cancer Research. Author Manuscript Published OnlineFirst on November 6, 2018; DOI: 10.1158/2326-6066.CIR-18-0124 Figure 4 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. A

40 N.S. 5 5 5 5 * 10 10 10 10 17.7 13.4 37.2 21.9

4 4 4 4 30 10 10 10 10 CD 8 (%)

3 3 3 3 10 10 10 10 20

2 2 2 2 10 10 10 10 amon g 10

0 0 0 0 + Ki67 2 3 4 5 2 3 4 5 2 3 4 5 2 3 4 5 0 10 10 10 10 0 10 10 10 10 0 10 10 10 10 0 10 10 10 10

Ki67 0 CD8 Flag-Ig CNX-Ig Flag-Ig CNX-Ig Tumor Antigen + +-- Medium Tumor Antigen Flag-Ig + + -- CNX-Ig - - ++

40 N.S. B **** 30 CD 8 (%) 20

amon g 10 + γ

IFN-γ 0 IFN- CD8 Tumor Antigen + +-- Flag-Ig CNX-Ig Flag-Ig CNX-Ig Flag-Ig + + -- Medium Tumor Antigen CNX-Ig - - ++

C 150 500 ** * 200 N.S. *

N.S. *

) ) lm/gp( lm/gp( mg ) lm/gp 400 150 100 300

100

α γ -FNT 200

50 I-( mg ) LI1- (0 lm/gp FI -N( 100 50 0 0 0

Tumor Antigen + +-- Tumor Antigen + +-- Tumor Antigen + +-- Flag-Ig + + -- Flag-Ig + + -- Flag-Ig + + -- CNX-Ig - - ++ CNX-Ig - - ++ CNX-Ig - - ++

Downloaded from cancerimmunolres.aacrjournals.org on September 28, 2021. © 2018 American Association for Cancer Research. Figure 5 Author Manuscript Published OnlineFirst on November 6, 2018; DOI: 10.1158/2326-6066.CIR-18-0124 A Author manuscripts have been peerB reviewed and accepted for publication but have not yet been edited. Blood withdrawal 800 NCG mice ) sh-CNX ³ Day7 Day14 mm 600 sh-NEG

Day1 Day21 sh-NEG e ( 400 * 1×10⁷ human-PBMC i.v. tumor isolated 200 + sh-CNX 6×10⁶ sh-CNX or sh-NEG HSC3 s.c. Tumor volum 0 0 5 10 15 20 25 Days C D

600 * 50 N.S. * sh-CNX 40

T cell in 400 sh-NEG + 30 g of tumor 200 20 h m 10 eac human-CD3 0 human-IFN-γ (pg/ml) 0 X ay7 h-CN D ay14 s sh-NEG D

E F 800 ) sh-CNX

NCG mice ³ sh-NEG sh-NEG 600 Day1 Day22 ** 400 sh-CNX 6×10⁶ sh-CNX tumor isolated 200 or

sh-NEG HSC3 s.c. Tumor volume (mm 0 0 5 10 15 20 25 Days

Downloaded from cancerimmunolres.aacrjournals.org on September 28, 2021. © 2018 American Association for Cancer Research. Author Manuscript Published OnlineFirst on November 6, 2018; DOI: 10.1158/2326-6066.CIR-18-0124 Figure 6 A Author manuscripts have been peer reviewed and acceptedB for publication but have not yet been edited.

) 1500 sh-NEG+CNX-Ig 1X10⁶ irradiated B16 cells ³ tumor isolated vaccinated in left flank s.c. 1200 sh-NEG+Flag-Ig Day -14 Day 21 sh-CNX+CNX-Ig 900 sh-CNX+Flag-Ig Day 0 ** olu me (mm B6 mice 1X10⁵ transduced B16 cells 600 N.S. **** inoculated in right flank s.c. 300 200ug CNX-Ig or Flag-Ig i.p. * um or v

T 0 0 5 10 15 20 Days **** **** **** C **** D **** N.S. **** *** 25 40 HRP: CD3 + 20 30 20X 15 mon g TIL (%) mon g TIL (%) 20 10 ell a ell a c c 10 T 5 T + + 0 0 40X CD 4 Flag-Ig CNX-Ig Flag-Ig CNX-Ig CD 8 Flag-Ig CNX-Ig Flag-Ig CNX-Ig

sh-NEG sh-CNX sh-NEG sh-CNX Flag-Ig CNX-Ig N.S. N.S. E sh-NEG * N.S. 25 * N.S. 20 *** ** 20X 20 15 CD 4 (%) 15 CD 8 (%) 10 10 amon g amon g 5 + + 5 40X i 67 i 67 K K 0 0 Flag-Ig CNX-Ig Flag-Ig CNX-Ig Flag-Ig CNX-Ig Flag-Ig CNX-Ig Flag-Ig CNX-Ig sh-NEG sh-CNX sh-NEG sh-CNX sh-CNX

5 5 5 5 F 10 18.1 10 11.8 10 40.0 10 36.6

4 4 4 4 10 10 10 10 * ****

3 3 3 3 10 10 10 10 * ** 2 2 2 2

10 10 10 10 γ 1 1 1 1 -NFI N.S. N.S. ** 10 10 10 10 60 * 50

0 0 0 0 10 10 10 10 CD 4 (%) 0 1 2 3 4 5 0 1 2 3 4 5 0 1 2 3 4 5 0 1 2 3 4 5 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 40 CD4 CD4 CD 4 (%) 40 5 5 5 5 10 3.71 7.59 10 11.7 3.52 10 20.9 36.3 10 4.81 19.6 30 amon g 4 4 4 4 10 10 10 10 + 20 3 3 3 3

10 10 10 10 α

amon g 20

2 2 2 2

10 10 10 10 +

γ -NFI γ 10 1 1 1 1

10 10 10 10 TNF- 86.7 2.02 83.7 1.10 41.7 1.14 72.4 3.21

0 0 0 0 + 10 10 10 10 0 1 2 3 4 5 0 1 2 3 4 5 0 1 2 3 4 5 0 1 2 3 4 5 0 0

10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 IFN- γ TNF-α Flag-Ig CNX-Ig Flag-Ig CNX-Ig Flag-Ig CNX-Ig Flag-Ig CNX-Ig IFN-

5 5 5 5 10 33.7 10 19.0 10 46.1 10 43.1 sh-NEG sh-CNX sh-NEG sh-CNX

4 4 4 4 10 10 10 10

3 3 3 3 10 10 10 10 N.S. **

2 2 2 2 10 10 10 10

γ * *

-NFI 1 1 1 1 10 10 10 10

0 0 0 0 10 10 10 10 ** N.S. N.S. *** 0 1 2 3 4 5 0 1 2 3 4 5 0 1 2 3 4 5 0 1 2 3 4 5 60 15 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 CD8 CD 8 (%)

5 5 5 5 CD 8 (%) CD8 10 23.8 7.00 10 15.2 0.33 10 30.0 13.9 10 31.0 8.20 40 10 4 4 4 4 10 10 10 10 amon g

3 3 3 3 + 10 10 10 10 α 2 2 2 2

10 10 10 10 amon g 20 5 γ +

-NFI 1 1 1 1 10 10 10 10 γ

69.1 0.24 84.2 0.22 55.8 0.38 59.8 1.06 TNF- 0 0 0 0 10 10 10 10 0 1 2 3 4 5 0 1 2 3 4 5 0 1 2 3 4 5 0 1 2 3 4 5 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 0 + 0 γ TNF-α IFN- Flag-Ig CNX-Ig Flag-Ig CNX-Ig Flag-Ig CNX-Ig Flag-Ig CNX-Ig Flag-Ig CNX-Ig Flag-Ig CNX-Ig IFN- sh-NEG sh-CNX sh-NEG sh-CNX sh-NEG sh-CNX

Downloaded from cancerimmunolres.aacrjournals.org on September 28, 2021. © 2018 American Association for Cancer Research. A Author Manuscript Published OnlineFirst on November 6, 2018; DOI: 10.1158/2326-6066.CIR-18-0124 Figure 7 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

15 25 20 60

20 15 (%) 10 (%) 40 (%) (%) + 15 + + + 10 10 5 20 D- 1H TIGIT LAG-3

P 5

CTLA-4 5 0 0 0 0 CD4 CD8 CD4 CD8 CD4 CD8 CD4 CD8

*** **** sh-NEG+Flag-Ig *** **** 40 ** ** *** * sh-NEG+CNX-Ig sh-CNX+Flag-Ig 30 CD4

(%) sh-CNX+CNX-Ig

+ 20 D- 1

P 10

0 CD4 CD8 PD-1 CD8 Flag-Ig CNX-Ig Flag-Ig CNX-Ig B sh-NEG sh-CNX

*** 50 ** 40 CD8

(%) 30 CD4 + 20 CD4 D- 1 P 10 0 g B49 M CNX-I 9+ B4 B49+Flag-Ig CD8 M

M PD-1 MB49 MB49+CNX-Ig MB49+Flag-Ig

C 25 N.S. * 20

CD 8 (%) 15 10 amon g PD-1

+ 5

D- 1 0

CD8 P Flag-Ig CNX-Ig Flag-Ig CNX-Ig Tumor Antigen + +-- Medium Tumor Antigen Flag-Ig + + -- CNX-Ig - - ++

D Bisulfite pyrosequencing sequence -1104 ~ -1134bp: ACGAGAGCTTCCTCGCCGTGGCCGCGCCTCG Inupt sequence CpG island GC percentage 0 20 40 60 80 -1100 bp -900 bp -700 bp -500 bp -300 bp -100 bp CpG TSS

E D9 :C RAAACRCRACCACRACRAAAAAACTCTCRT 15% 11% 12% 12% 22% 7% 30 **

100 75 CNX-Ig 50 25 0 20 E S C G A A T C G A T C G A C A T C G A T C A G A A C T C T A C G A T G A T 5 10 15 20 25 30 35 Tumor

E9 :C RAAACRCRACCACRACRAAAAAACTCTCRT Antigen 28% 21% 27% 28% 33% 15% 10 125 100 75 Flag-Ig 50 25 0 E S C G A A T C G A T C G A C A T C G A T C A G A A C T C T A C G A T G A T 0 5 10 15 20 25 30 35 DC D-1 methylation rate (%)

P g NX-I lag-Ig C F Downloaded from cancerimmunolres.aacrjournals.org on September 28, 2021. © 2018 American Association for Cancer Research. Author Manuscript Published OnlineFirst on November 6, 2018; DOI: 10.1158/2326-6066.CIR-18-0124 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Calnexin impairs the antitumor immunity of CD4+ and CD8+ T cells

Yichen Chen, Da Ma, Xi Wang, et al.

Cancer Immunol Res Published OnlineFirst November 6, 2018.

Updated version Access the most recent version of this article at: doi:10.1158/2326-6066.CIR-18-0124

Supplementary Access the most recent supplemental material at: Material http://cancerimmunolres.aacrjournals.org/content/suppl/2018/11/06/2326-6066.CIR-18-0124.D C1

Author Author manuscripts have been peer reviewed and accepted for publication but have not yet Manuscript been edited.

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerimmunolres.aacrjournals.org/content/early/2018/11/06/2326-6066.CIR-18-0124. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.