DOCSLIB.ORG

The Genomic Sequence of Ectromelia Virus, the Causative Agent of Mousepox

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Genomic Sequence of Ectromelia Virus, the Causative Agent of Mousepox View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Available online at www.sciencedirect.com R Virology 317 (2003) 165–186 www.elsevier.com/locate/yviro The genomic sequence of ectromelia virus, the causative agent of mousepox Nanhai Chen,a,1 Maria I. Danila,b,1 Zehua Feng,a R. Mark L. Buller,a,* Chunlin Wang,c Xiaosi Han,c Elliot J. Lefkowitz,c and Chris Uptonb a Department of Molecular Microbiology and Immunology, Saint Louis University Health Sciences Center, 1402 South Grand Boulevard, St. Louis, MO 63104, USA b Department of Biochemistry and Microbiology, University of Victoria, Victoria, British Columbia V8W 2Y2, Canada c Department of Microbiology, University of Alabama at Birmingham, Birmingham, AL 35294, USA Received 31 March 2003; returned to author for revision 5 May 2003; accepted 26 June 2003 Abstract Ectromelia virus is the causative agent of mousepox, an acute exanthematous disease of mouse colonies in Europe, Japan, China, and the U.S. The Moscow, Hampstead, and NIH79 strains are the most thoroughly studied with the Moscow strain being the most infectious and virulent for the mouse. In the late 1940s mousepox was proposed as a model for the study of the pathogenesis of smallpox and generalized vaccinia in humans. Studies in the last five decades from a succession of investigators have resulted in a detailed description of the virologic and pathologic disease course in genetically susceptible and resistant inbred and out-bred mice. We report the DNA sequence of the left-hand end, the predicted right-hand terminal repeat, and central regions of the genome of the Moscow strain of ectromelia virus (approximately 177,500 bp), which together with the previously sequenced right-hand end, yields a genome of 209,771 bp. We identified 175 potential genes specifying proteins of between 53 and 1924 amino acids, and 29 regions containing sequences related to genes predicted in other poxviruses, but unlikely to encode for functional proteins in ectromelia virus. The translated protein sequences were compared with the protein database for structure/function relationships, and these analyses were used to investigate poxvirus evolution and to attempt to explain at the cellular and molecular level the well-characterized features of the ectromelia virus natural life cycle. © 2003 Elsevier Inc. All rights reserved. Keywords: Poxvirus; Ectromelia virus; Virulence; Mousepox; Genomic sequence Introduction tion of infectivity in tissue culture, and genomic DNA sequence information. The poxvirus family is divided into two subfamilies: Genomic sequences have been determined for represen- Entomopoxvirinae (poxviruses of insects) and Chordopox- tative species from seven of the eight vertebrate poxvirus virinae (poxviruses of the vertebrates). Poxviruses replicate genera: avipoxvirus (fowlpox virus) (Afonso et al., 2000); in the cytoplasm of cells and assemble large virions that are capripoxvirus (lumpy skin disease virus, sheeppox virus, visible in the light microscope. The structurally complex and goatpox virus) (Tulman et al., 2001, 2002); leporipox- virions contain a double-stranded DNA genome of between virus [shope fibroma virus (Willer et al., 1999) and myxoma ϳ 140 and 280 kb, and an early gene transcription system virus (Cameron et al., 1999)]; molluscipoxvirus (molluscum (Moss, 2001). Poxviruses are classified into genera by com- contagiosum virus) (Senkevich et al., 1997); orthopoxvirus paring cross-protection in animal studies, cross-neutraliza- [monkeypox virus (Shchelkunov et al., 2002), camelpox virus (Afonso et al., 2001; Gubser and Smith, 2002), vac- cinia virus (Goebel et al., 1990), and variola virus (Massung * Corresponding author. Fax: ϩ1-314-773-3403. E-mail address: [email protected] (R.M.L. Buller). et al., 1994; Shchelkunov et al., 1995, 2000)]; suipoxvirus 1 These authors contributed equally to this work. (swinepox virus) (Afonso et al., 2002); and yatapoxvirus 0042-6822/$ – see front matter © 2003 Elsevier Inc. All rights reserved. doi:10.1016/S0042-6822(03)00520-8 166 N. Chen et al. / Virology 317 (2003) 165–186 (Yaba-like disease virus) (Lee et al., 2001). The availability quencing reactions based on 16 overlapping PCR fragments of these genomic sequences has permitted the comparison generated from genomic DNA of ECTV strain Moscow of distantly related orthologs to determine conserved amino (ECTV-MOS), and the predicted 1503-bp right-hand termi- acids (aa), which in turn can facilitate bioinformatics pre- nal repeat. Each position was sequenced on both strands at dictions as to ORF function. least once with an average coverage of 3.7-fold. This se- Ectromelia virus (ECTV) is the causative agent of quence, in addition to 32,318 bases sequenced previously, mousepox, an acute exanthematous disease of mouse colo- constitutes a genome of 209,771 bp (Chen et al., 2000). The nies in Europe, Japan, China, and the U.S. (Buller and presented sequence does not contain the hairpin termini of Palumbo, 1991; Fenner, 1982). The disease is on the decline the ECTV-MOS genome, but based on DNA homology in vivariums due to improvements in animal husbandry and with closely related orthopoxvirus vaccinia [VACV, strain health surveillance. The natural reservoir for ECTV is un- Copenhagen (COP)], the ECTV-MOS sequence presented known but one report provides evidence that wild mice may here starts ϳ136 bases from the terminus. This value is be involved. Laboratory studies have shown ECTV to have consistent with the estimated position of the 5Ј primer a very narrow host range, infecting only certain mouse sequence containing a part of the concatamer resolution species (Buller et al., 1986; Fenner, 1982). A number of dif- motif, ATTTAGTGTCTAGAAAAAAA, which was used ferent strains of ECTV have been isolated which have been to amplify the left terminal fragment, and restriction endo- shown to differ in their virulence for the mouse. The Moscow, nuclease analysis of the terminal region of the genome Hampstead, and NIH79 strains are the most thoroughly studied (Baroudy et al., 1982; Esposito and Knight, 1985; Goebel et with the Moscow strain being the most infectious and virulent al., 1990; Merchlinsky, 1990; Stuart et al., 1991). As is for the mouse. In the late 1940s mousepox was proposed as a typical of the orthopoxviruses, the genome of ECTV-MOS model for the study of the pathogenesis of smallpox and is AϩT-rich (67%), although there is considerable variation generalized vaccinia in humans (Fenner, 1948). Studies in the between individual ORFs. Previous DNA restriction en- last five decades from a succession of investigators have re- zyme mapping analyses have shown genomes of orthopox- sulted in a detailed description of the virologic and pathologic viruses to have a central, highly conserved region. The disease course in genetically susceptible (A, BALB/c, DBA/2, region between ORF 029 (VACV-COP F6L) and ORF 127 and C3H/He) and resistant (C57BL/6 and AKR) inbred and (VACV-COP A24R), which covers 99,798 nucleotides, outbred mice; identification and characterization of the impor- shows strong conservation of gene order, and approximately tant cell-mediated and innate responses for recovery from 97, 96, and 97% aa identity when compared to a similar infection; and the discovery of rmp-1, rmp-2, rmp-3, and region of VACV-COP, variola virus strain Bangladesh rmp-4 loci, which govern resistance to severe mousepox (VARV-BSH), and cowpox virus strain Brighton Red (Brownstein and Gras, 1995; Brownstein, 1998; Delano and (CPXV-BR) counterparts. Brownstein, 1995). Since varying mouse genotype, virus The inverted terminal repeat (ITR) reported here con- strain, and dose of virus can manipulate disease patterns for a tains 9413 bp. The right ITR junction falls within ORF 169 given route of infection, ECTV infections of mice are one of and thus a C-terminal fragment of this ORF, designated as the best models for studying viral pathogenesis, and testing the noncoding Region D, is present in the left ITR (Fig. 1). efficacy of orthopoxvirus antivirals and vaccines. There are several specific structures contained in the or- In this study we report the DNA sequence of the left- thopoxvirus ITR: terminal hairpin, the concatamer resolu- hand end, the predicted right-hand terminal repeat, and tion motif, two conserved nonrepeating sequences, NR I and central regions of the genome of the Moscow strain of NR II, and direct repeats on each side of the NR II region. ECTV (approximately 177.5 kb), which together with the An alignment of the ITRs from VACV-COP, VARV-BSH, previously sequenced right-hand end provide the entire pro- cowpox virus strain Grishak (CPXV-GRI), and ECTV- tein coding region of the genome (Chen et al., 2000). The MOS shows that NR I and NR II regions are highly con- translated protein sequences were compared with the pro- served within these genomes (data not shown). The DR I of tein database for structure/function relationships, and these ECTV-MOS, named for convention, is not in fact repeated analyses have been used to investigate poxvirus evolution but contains one copy of a 68-bp element, which is similar and to explain at the cellular and molecular level the well- to the 70-bp element from the ITR of VACV-COP, and one characterized features of the ECTV natural life cycle. copy of a 25-bp element which is a portion of the 54-bp element in VACV-COP. The second set of direct repeats is represented by an 85-bp monomer, which is repeated 10.4 Results and discussion times. The 85-bp element can be aligned with the 54-bp element from VACV-COP, by introducing a 31 nucleotide Overview of the structure of the genome of ectromelia insertion between positions 27 and 28 of the VACV-COP virus strain Moscow element (data not shown). This 85-bp monomer is polymor- phic at position 30 of the unit, where either an A oraGcan We report 175,950 base pairs (bp) of contiguous se- be present.
Load more

Recommended publications
  • Ectromelia Virus (Mousepox)
    technical sheet Ectromelia Virus (Mousepox) Classification the virus its name, ectromelia, or partial amputation of DNA virus, enveloped the limbs and tail. Family Diagnosis Poxviridae Mousepox should be suspected if animals with the above clinical signs are seen in the animal facility, or Affected species there is unexplained widespread mortality in susceptible strains. Serologic diagnosis through MFIA™/ELISA Laboratory mice, wild mice, and other wild rodents or IFA is possible; if animals recover, they produce protective antibodies. Lesions strongly suggestive of Frequency mousepox are noted on necropsy, including splenic Rare in laboratory mice, uncommon in wild mice. fibrosis in recovered animals, and liver, spleen, and skin lesions in ill animals. Histologically, intracytoplasmic Transmission inclusion bodies are seen in skin lesions. PCR of skin Ectromelia virus, which causes the disease mousepox, lesions can be used for confirmation. Vaccination with is transmitted by direct contact or by fomites. Although vaccinia virus as part of an experimental protocol may many routes of infection are possible experimentally, give false positive serology results. exposure to the virus via cutaneous trauma is the natural route of infection. Lesions appear 7-11 days Interference with Research after infection in susceptible strains, and virus is shed Overwhelming mortality (near 100%) in susceptible for 3 weeks. However, virus has been found in scabs strains may have a negative effect on research and feces for as long as 16 weeks post-infection. programs and animal facilities. Ectromelia virus infection Cage-to-cage transmission in mousepox infections is may modify the phagocytic response in resistant primarily through handling of infected mice.
    [Show full text]
  • Investigation of Poxvirus Host-Range and Gene Expression in Mammalian Cells
    ABSTRACT Title: INVESTIGATION OF POXVIRUS HOST-RANGE AND GENE EXPRESSION IN MAMMALIAN CELLS. Jorge David Méndez Ríos, Doctor of Philosophy, 2014. Directed By: Dr. Bernard Moss, Chief, Laboratory of Viral Diseases, NIAID, NIH; Adjunct Professor Department of Cell Biology and Molecular Genetics, University of Maryland; Members of the Poxviridae family have been known as human pathogens for centuries. Their impact in society included several epidemics that decimated the population. In the last few centuries, Smallpox was of great concern that led to the development of our modern vaccines. The systematic study of Poxvirus host-range and immunogenicity provided the knowledge to translate those observations into practice. After the global vaccination campaign by the World Health Organization, Smallpox was the first infectious disease to be eradicated. Nevertheless, diseases such as Monkeypox, Molluscum contagiosum, new bioterrorist threads, and the use of poxviruses as vaccines or vectors provided the necessity to further understand the host-range from a molecular level. Here, we take advantage of the newly developed technologies such as 454 pyrosequencing and RNA-Seq to address previously unresolved questions for the field. First, we were able to identify the Erytrhomelagia-related poxvirus (ERPV) 25 years after its isolation in Hubei, China. Whole-genome sequencing and bioinformatics identified ERPV as an Ectromelia strain closely related to the Ectromelia Naval strain. Second, by using RNA-Seq, the first MOCV in vivo and in vitro transcriptome was generated. New tools have been developed to support future research and for this human pathogen. Finally, deep-sequencing and comparative genomes of several recombinant MVAs (rMVAs) in conjunction with classical virology allowed us to confirm several genes (O1, F5, C17, F11) association to plaque formation in mammalian cell lines.
    [Show full text]
  • Control of Lymphocytic Choriomeningitis Virus Infection in Granzyme B Deficient Mice
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Virology 305, 1–9 (2003) doi:10.1006/viro.2002.1754 Control of Lymphocytic Choriomeningitis Virus Infection in Granzyme B Deficient Mice Allan J. Zajac,*,† John M. Dye,* and Daniel G. Quinn*,1 *Department of Microbiology and Immunology, Loyola University Chicago, Maywood, Illinois 60153; and †Department of Microbiology, University of Alabama at Birmingham, Birmingham, Alabama 35294 Received July 11, 2001; returned to author for revision October 5, 2001; accepted August 30, 2002 We have investigated whether granzyme B (GzmB)is required for effective cytotoxic T lymphocyte (CTL)mediated control of lymphocytic choriomeningitis virus (LCMV)infection. Clearance of LCMV from tissues of GzmB-deficient (GzmB Ϫ)mice following intraperitoneal infection with LCMV was impaired compared with control mice; however, the virus was ultimately eliminated. The impaired clearance of LCMV in GzmBϪ mice was not due to a deficiency in the generation of LCMV-specific T cells. In addition, CTL from LCMV-infected GzmBϪ mice efficiently lysed virus-infected cells in vitro, but were deficient in their ability to induce rapid DNA fragmentation in target cells. We examined whether the development of protective immunity against intracranial (i.c.)rechallenge with LCMV was compromised in GzmB Ϫ mice. We found that clearance of LCMV from the brain following secondary i.c. infection also was slower in the absence of GzmB; however, the virus was ultimately eliminated and the mice survived. Our data indicate that clearance of LCMV is delayed in the absence of GzmB expression, but that other CTL effector molecules can compensate for the absence of this granule constituent in vivo.
    [Show full text]
  • A System Based-Approach to Examine Cytokine Response in Poxvirus-Infected Macrophages
    viruses Article A System Based-Approach to Examine Cytokine Response in Poxvirus-Infected Macrophages Pui-San Wong 1,†, Richard Sutejo 2,†,‡, Hui Chen 2,§ , Sock-Hoon Ng 1, Richard J. Sugrue 2 and Boon-Huan Tan 1,3,* 1 Defence Medical and Environmental Research Institute, DSO National Labs, Singapore 117510, Singapore; [email protected] (P.-S.W.); [email protected] (S.-H.N.) 2 School of Biological Sciences, Nanyang Technological University, Singapore 637551, Singapore; [email protected] (R.S.); [email protected] (H.C.); [email protected] (R.J.S.) 3 Infection and Immunity, LKC School of Medicine, Nanyang Technological University, Singapore 308232, Singapore * Correspondence: [email protected]; Tel: +65-64857238 † These authors contributed equally to this work. ‡ Current address: International Institute for life Sciences, Jakarta Timur 13210, Indonesia. Received: 9 October 2018; Accepted: 30 November 2018; Published: 5 December 2018 Abstract: The poxviruses are large, linear, double-stranded DNA viruses about 130 to 230 kbp, that have an animal origin and evolved to infect a wide host range. Variola virus (VARV), the causative agent of smallpox, is a poxvirus that infects only humans, but other poxviruses such as monkey poxvirus and cowpox virus (CPXV) have crossed over from animals to infect humans. Therefore understanding the biology of poxviruses can devise antiviral strategies to prevent these human infections. In this study we used a system-based approach to examine the host responses to three orthopoxviruses, CPXV, vaccinia virus (VACV), and ectromelia virus (ECTV) in the murine macrophage RAW 264.7 cell line.
    [Show full text]
  • Enhanced Resistance in STAT6-Deficient Mice to Infection with Ectromelia Virus
    Enhanced resistance in STAT6-deficient mice to infection with ectromelia virus Surendran Mahalingam*†, Gunasegaran Karupiah‡, Kiyoshi Takeda§, Shizuo Akira¶, Klaus I. Matthaei*, and Paul S. Foster* *Division of Biochemistry and Molecular Biology, The John Curtin School of Medical Research, Australian National University, Canberra ACT 2601, Australia; ‡Department of Pathology, Division of Faculty of Medicine, Blackburn Building, D06, University of Sydney, Sydney NSW 2006, Australia; §Department of Host Defense, Research Institute for Microbial Disease, Osaka University, Suita-shi, Osaka 565-0871, Japan; and ¶Department of Biochemistry, Hyogo College of Medicine, 1-1 Mukogawa-cho, Nishinomiya, Hyogo 663-8501, Japan Communicated by Frank J. Fenner, Australian National University, Canberra, Australia, March 27, 2001 (received for review January 25, 2001) -We inoculated BALB͞c mice deficient in STAT6 (STAT6؊/؊) and their characterized in Leishmania major infection. Studies have indi wild-type (wt) littermates (STAT6؉/؉) with the natural mouse cated that control of lesion growth induced by L. major in pathogen, ectromelia virus (EV). STAT6؊/؊ mice exhibited in- genetically resistant mice (C57BL͞6) is associated with the creased resistance to generalized infection with EV when com- expansion of CD4ϩ T helper 1 (Th1) cells and the production of ؉ ؉ pared with STAT6 / mice. In the spleens and lymph nodes of cytokines such as IL-12, IFN-␥, and IL-2 (13, 14). By contrast, ؊ ؊ STAT6 / mice, T helper 1 (Th1) cytokines were induced at earlier nonhealing responses in susceptible mice (BALB͞c) have been time points and at higher levels postinfection when compared with related to the expansion of CD4ϩ Th2 cells and the production ؉ ؉ those in STAT6 / mice.
    [Show full text]
  • Ectromelia Virus Disease Characterization in the BALB/C Mouse: a Surrogate Model for Assessment of Smallpox Medical Countermeasures
    viruses Article Ectromelia Virus Disease Characterization in the BALB/c Mouse: A Surrogate Model for Assessment of Smallpox Medical Countermeasures Jennifer Garver 1,*, Lauren Weber 1, Eric M. Vela 2, Mike Anderson 1, Richard Warren 3, Michael Merchlinsky 3, Christopher Houchens 3 and James V. Rogers 1 1 Battelle Biomedical Research Center, West Jefferson, OH 43162, USA; [email protected] (L.W.); [email protected] (M.A.); [email protected] (J.V.R.) 2 Vaccine and Gene Therapy Institute, Oregon Health and Science University, Portland, OR 97239, USA; [email protected] 3 Biomedical Advanced Research and Development Authority, US Department of Health and Human Services, Washington, DC 20201, USA; [email protected] (R.W.); [email protected] (M.M.); [email protected] (C.H.) * Correspondence: [email protected]; Tel.: +1-614-424-3984; Fax: +1-614-458-3984 Academic Editor: Curt Hagedorn Received: 22 June 2016; Accepted: 19 July 2016; Published: 22 July 2016 Abstract: In 2007, the United States’ Food and Drug Administration (FDA) issued guidance concerning animal models for testing the efficacy of medical countermeasures against variola virus (VARV), the etiologic agent for smallpox. Ectromelia virus (ECTV) is naturally-occurring and responsible for severe mortality and morbidity as a result of mousepox disease in the murine model, displaying similarities to variola infection in humans. Due to the increased need of acceptable surrogate animal models for poxvirus disease, we have characterized ECTV infection in the BALB/c mouse. Mice were inoculated intranasally with a high lethal dose (125 PFU) of ECTV, resulting in complete mortality 10 days after infection.
    [Show full text]
  • Here, There, and Everywhere: the Wide Host Range and Geographic Distribution of Zoonotic Orthopoxviruses
    viruses Review Here, There, and Everywhere: The Wide Host Range and Geographic Distribution of Zoonotic Orthopoxviruses Natalia Ingrid Oliveira Silva, Jaqueline Silva de Oliveira, Erna Geessien Kroon , Giliane de Souza Trindade and Betânia Paiva Drumond * Laboratório de Vírus, Departamento de Microbiologia, Instituto de Ciências Biológicas, Universidade Federal de Minas Gerais: Belo Horizonte, Minas Gerais 31270-901, Brazil; [email protected] (N.I.O.S.); [email protected] (J.S.d.O.); [email protected] (E.G.K.); [email protected] (G.d.S.T.) * Correspondence: [email protected] Abstract: The global emergence of zoonotic viruses, including poxviruses, poses one of the greatest threats to human and animal health. Forty years after the eradication of smallpox, emerging zoonotic orthopoxviruses, such as monkeypox, cowpox, and vaccinia viruses continue to infect humans as well as wild and domestic animals. Currently, the geographical distribution of poxviruses in a broad range of hosts worldwide raises concerns regarding the possibility of outbreaks or viral dissemination to new geographical regions. Here, we review the global host ranges and current epidemiological understanding of zoonotic orthopoxviruses while focusing on orthopoxviruses with epidemic potential, including monkeypox, cowpox, and vaccinia viruses. Keywords: Orthopoxvirus; Poxviridae; zoonosis; Monkeypox virus; Cowpox virus; Vaccinia virus; host range; wild and domestic animals; emergent viruses; outbreak Citation: Silva, N.I.O.; de Oliveira, J.S.; Kroon, E.G.; Trindade, G.d.S.; Drumond, B.P. Here, There, and Everywhere: The Wide Host Range 1. Poxvirus and Emerging Diseases and Geographic Distribution of Zoonotic diseases, defined as diseases or infections that are naturally transmissible Zoonotic Orthopoxviruses. Viruses from vertebrate animals to humans, represent a significant threat to global health [1].
    [Show full text]
  • Sequential Activation of Two Pathogen-Sensing Pathways Required for Type I Interferon Expression and Resistance to an Acute DNA Virus Infection
    Article Sequential Activation of Two Pathogen-Sensing Pathways Required for Type I Interferon Expression and Resistance to an Acute DNA Virus Infection Highlights Authors d TLR9, MyD88, STING, and IRF7 are required for IFN-I Ren-Huan Xu, Eric B. Wong, Daniel expression in the dLN Rubio, ..., Shinu John, Mark Shlomchik, Luis J. Sigal d Inflammatory monocytes are the major producers of IFN-I in the dLN Correspondence + [email protected] d TLR9, MyD88, and IRF7 are required in CD11c cells for iMo recruitment to dLNs In Brief d STING-IRF7 are required in iMos for IFN-a and STING-NF-kB How different pathogen-sensing for IFN-b expression in iMos mechanisms contribute to the expression of IFN-I in vivo is unclear. Sigal and colleagues report that in lymph nodes of ectromelia-virus-infected mice, CD11c+ cells use TLR9-MyD88-IRF7 to recruit inflammatory monocytes (iMos). In turn, infected iMos express IFN-a and IFN-b through STING-IRF7 and STING-NF-kB, respectively. Xu et al., 2015, Immunity 43, 1148–1159 December 15, 2015 ª2015 Elsevier Inc. http://dx.doi.org/10.1016/j.immuni.2015.11.015 Immunity Article Sequential Activation of Two Pathogen-Sensing Pathways Required for Type I Interferon Expression and Resistance to an Acute DNA Virus Infection Ren-Huan Xu,1,5 Eric B. Wong,1,6 Daniel Rubio,1,7 Felicia Roscoe,1 Xueying Ma,1 Savita Nair,1 Sanda Remakus,1 Reto Schwendener,2 Shinu John,3 Mark Shlomchik,4 and Luis J. Sigal1,6,* 1Immune Cell Development and Host Defense Program, The Research Institute at Fox Chase Cancer Center, 333 Cottman Avenue,
    [Show full text]
  • New Insights Into the Evolutionary and Genomic Landscape of Molluscum Contagiosum Virus (MCV) Based on Nine MCV1 and Six MCV2 Complete Genome Sequences
    viruses Article New Insights into the Evolutionary and Genomic Landscape of Molluscum Contagiosum Virus (MCV) based on Nine MCV1 and Six MCV2 Complete Genome Sequences Tomaž M. Zorec 1 , Denis Kutnjak 2 , Lea Hošnjak 1 , Blanka Kušar 1, Katarina Trˇcko 3, Boštjan J. Kocjan 1 , Yu Li 4, Miljenko Križmari´c 5, Jovan Miljkovi´c 5, Maja Ravnikar 2 and Mario Poljak 1,* 1 Institute of Microbiology and Immunology, Faculty of Medicine, University of Ljubljana, Zaloška 4, SI-1000 Ljubljana, Slovenia; [email protected] (T.M.Z.); [email protected] (L.H.); [email protected] (B.K.); [email protected] (B.J.K.) 2 Department of Biotechnology and Systems Biology, National Institute of Biology, Veˇcna pot 111, SI-1000 Ljubljana, Slovenia; [email protected] (D.K.); [email protected] (M.R.) 3 Department of Dermatovenereology, University Medical Centre Maribor, Ljubljanska ulica 5, SI-2000 Maribor, Slovenia; [email protected] 4 Poxvirus and Rabies Branch, Division of High-Consequence Pathogens and Pathology, National Center for Emerging and Zoonotic Infectious Diseases, Centers for Disease Control and Prevention, 1600 Clifton Road NE, Atlanta, GA 30333, USA; [email protected] 5 Faculty of Medicine, University of Maribor, Taborska Ulica 6b, SI-2000 Maribor, Slovenia; [email protected] (M.K.); [email protected] (J.M.) * Correspondence: [email protected]; Tel.: +386-1-543-7415 Received: 9 October 2018; Accepted: 25 October 2018; Published: 26 October 2018 Abstract: Molluscum contagiosum virus (MCV) is the sole member of the Molluscipoxvirus genus and the causative agent of molluscum contagiosum (MC), a common skin disease.
    [Show full text]
  • Evaluation of Taterapox Virus in Small Animals
    viruses Article Evaluation of Taterapox Virus in Small Animals Scott Parker * ID , Ryan Crump, Hollyce Hartzler and R. Mark Buller † Department of Molecular Microbiology and Immunology, Saint Louis University School of Medicine, 1100 South Grand Boulevard, St. Louis, MO 63104, USA; [email protected] (R.C.); [email protected] (H.H.); [email protected] (R.M.B.) * Correspondence: [email protected]; Tel.: +1-314-783-6107 † Deceased. Academic Editors: Hermann Meyer, Jônatas Abrahão and Erna Geessien Kroon Received: 8 July 2017; Accepted: 24 July 2017; Published: 1 August 2017 Abstract: Taterapox virus (TATV), which was isolated from an African gerbil (Tatera kempi) in 1975, is the most closely related virus to variola; however, only the original report has examined its virology. We have evaluated the tropism of TATV in vivo in small animals. We found that TATV does not infect Graphiurus kelleni, a species of African dormouse, but does induce seroconversion in the Mongolian gerbil (Meriones unguiculatus) and in mice; however, in wild-type mice and gerbils, the virus produces an unapparent infection. Following intranasal and footpad inoculations with 1 × 106 plaque forming units (PFU) of TATV, immunocompromised stat1−/− mice showed signs of disease but did not die; however, SCID mice were susceptible to intranasal and footpad infections with 100% mortality observed by Day 35 and Day 54, respectively. We show that death is unlikely to be a result of the virus mutating to have increased virulence and that SCID mice are capable of transmitting TATV to C57BL/6 and C57BL/6 stat1−/− animals; however, transmission did not occur from TATV inoculated wild-type or stat1−/− mice.
    [Show full text]
  • Mousepox Resulting from Use of Ectromelia Virus-Contaminated, Imported Mouse Serum
    Comparative Medicine Vol 50, No 4 Copyright 2000 August 2000 by the American Association for Laboratory Animal Science Mousepox Resulting from Use of Ectromelia Virus-Contaminated, Imported Mouse Serum Neil S. Lipman,1* Scott Perkins,1 Hai Nguyen,1 Martin Pfeffer,2 and Hermann Meyer3 Abstract Mousepox was identified in a single mouse-holding room in early 1999 after a group of 20 CAF1/Hsd mice were inoculated SC with a killed murine spindle cell tumor line, S1509A. The cell line had been used without complications multiple times and was determined to be free of viral contamination on the basis of results of mouse antibody production testing. Of the 20 mice inoculated, 12 mice died by postinoculation day 8. Severe lymphoid and hepatic necrosis was observed in select mice subjected to histologic examination. Ballooning degeneration of epi- thelial cells with intracytoplasmic eosinophilic inclusion bodies was observed in the skin overlying the inoculation site of the single mouse from which this tissue site was evaluated. Presence of ectromelia virus was confirmed by use of immunohistochemical and polymerase chain reaction analyses, and the virus was isolated after serum, pooled from 5 of the index cases, was inoculated into an immune-naive mouse. Investigation into the source of virus con- tamination included inoculating mice with aliquots of various S1509A freeze dates; chemically defined media and supplements, including fetal bovine serum; and two lots of pooled commercial mouse sera, after heat inactivation at 56ЊC for 30 minutes used as a medium supplement. One lot of pooled commercial mouse serum was identified as the source of ectromelia virus.
    [Show full text]
  • Granzyme a Is Critical for Recovery of Mice from Infection With
    Proc. Natl. Acad. Sci. USA Vol. 93, pp. 5783-5787, June 1996 Immunology Granzyme A is critical for recovery of mice from infection with the natural cytopathic viral pathogen, ectromelia (poxvirus/cytolytic leukocytes/proteases) ARNO MULLBACHER*, KLAUS EBNETtS, ROBERT V. BLANDEN*, RON THA HLA*, THOMAS STEHLEt, CRISAN MUSETEANUt, AND MARKUS M. SIMONt§ *Division of Immunology and Cell Biology, John Curtin School of Medical Research, The Australian National University, Canberra City, Australian Capital Territory 2601, Australia; and tMax-Planck-Institut for Immunbiology, Stiibeweg 51, D-79108 Freiburg, Germany Communicated by Frank Fenner, The John Curtin School of Medical Research, The Australian National University, Canberra, Australia, February 7, 1996 (received for review December 6, 1995) ABSTRACT Cytolytic lymphocytes are of cardinal impor- normal littermates between 6 and 12 weeks of age were used tance in the recovery from primary viral infections. Both throughout the experiments. natural killer cells and cytolytic T cells mediate at least part Viruses. The virulent Moscow strain ectromelia virus was of their effector function by target cell lysis and DNA frag- grown in mouse spleen, the intracellular naked ectromelia mentation. Two proteins, perforin and granzyme B, contained virus (INV), and the extracellular enveloped ectromelia virus within the cytoplasmic granules ofthese cytolytic effector cells (EEV) in tissue culture, as has been described previously (12, have been shown to be directly involved in these processes. A 13). Viruses were purified and titrated on BS-C-1 monkey cell third protein contained within these granules, granzyme A, monolayers as has been described (14). The predominance of has so far not been attributed with any biological relevance.
    [Show full text]