Nuclear Lamina Genetic Variants, Including a Truncated LAP2, In

Page 1of84 between this versionandtheVersionofrecord. Pleasecitethis articleasdoi:10.1002/hep.29522. through thecopyediting, typesetting, paginationandproofreadingprocess, whichmayleadtodifferences This istheauthormanuscript acceptedforpublicationandhasundergone full peerreviewbuthasnotbeen polypeptide 2; 2; polypeptide magnetic resonance imaging; imaging; resonance magnetic green fluorescent protein; protein; greenfluorescent

NAFLD ofMichigan. institut and by (G.F.B.); Award Liver(ALF)Scholar ( DK094775 T32 grant training NIH (M.B.O.); DK47918 Financial Support: Financial interest: of conflict Potential thymopoietin. MI 48109-5622. Email: Email: MI48109-5622. Interna of Department of Gastroenterology, Division addressed be should correspondence whom #To Abbreviations: ALT Abbreviations: Keywords:

University of Michigan; Michigan; Universityof Nuclear lamina genetic variants, including a trunca a including variants, genetic Nuclearlamina 1 Graham F.Brady Graham Department of Molecular and Integrative Physiology IntegrativePhysiology and ofDepartment Molecular 2 Department of Computational Medicine and Bioinforma and Medicine ofDepartment Computational , nonalcoholic fatty liver disease; disease; liver fatty nonalcoholic , Venkatesha Basrur Venkatesha steatosis; lipodystrophy; laminopathy; nucleus; ge nucleus; laminopathy; lipodystrophy; steatosis;

AuthorMAF Manuscript

The work was supported by National Institutes of H Institutes National Theby work was supported 1,# , minor allele frequency; frequency; allele minor , , alanine aminotransferase; alanineaminotransferase; , , Raymond Kwan Raymond , [email protected] 4 This article isprotected by copyright. All rights reserved. Medicine, University of California, San Diego Diego San California, of University Medicine, NAFLD Research Center, Division of Gastroenterology Division NAFLDCenter, Research IF 2 , Alexey I. Nesvizhskii Alexey , , intermediate filament proteins; proteins; filament intermediate , MRI-PDFF None to report. report. Noneto nonalcoholic fatty liver disease disease liver fatty nonalcoholic 1 , Peter J. Ulintz J. Peter , , MRI-determined proton-density fat-fraction; fat-fraction; proton-density MRI-determined , PAGE, Hepatology

MRE

DAPI

polyacrylamide gel electrophoresis; electrophoresis; gel polyacrylamide : University of Michigan Medical School, School, Medical University of : Michigan 2,3 , magnetic resonance elastography; elastography; resonance magnetic , l Medicine, 1137 Catherine St., Ann Arbor, Ann St., Catherine 1137 Medicine, l ional grant P30 DK034933 to the University the to grant DK034933 ional P30 , Rohit Loomba Rohit , , 4',6-diamidino-2-phenylindole; 4',6-diamidino-2-phenylindole; , 2 ted LAP2, in twins and siblings with with siblings and twins LAP2,ted in and Department of Internal Medicine, of Department and G.F.B.); American Liver Foundation LiverFoundation American G.F.B.); , Phirum Nguyen , Phirum LAP2 tics, tics, netics netics 3 Department of Pathology, ofPathology, Department , lamina-associated lamina-associated , HEP-17-0541 (R2) (R2) HEP-17-0541 4 , M. Bishr Omary M. , ealth (NIH) grant R01 R01 grant (NIH) ealth 4 , Shirin Bassirian Shirin , , Department of Department , TMPO, MRI 1 GFP

, , 4 , , , ,

NAFLD. One novel variant, which results in a trunca in results which variant, Onenovel NAFLD. predispose to NAFLD and used a candidate gene-seque a used candidate and NAFLD to predispose becomin is disease(NAFLD) liver fatty Nonalcoholic variants in nuclear lamina-related genesident were lamina-related nuclear in variants in cell culture, represents the first association o association first the represents culture, cell in underscores the potential importance of the nuclear of the importance potential the underscores cytoplasmic association with the ubiquitin-binding ubiquitin-binding the with association cytoplasmic ac after oleic accumulation droplet lipid increased al LAP2mislocalization, caused binding, lamin-LAP2 inse a these, frameshift disease. One liver of with (LAP2) polypeptide-2 encodeslamina-associated the independent of the of the independent striking (>80% versus <25%; <25%; versus (>80% striking Abstract least one variant, compared to <40% of controls ( controls <40% of to compared one variant, least genes( varian sequence heterozygous NAFLD.Twelve without, twin a of 37 cohort genes in nuclearlamina-related that hypothesized NAFLD. We include syndromesthat proteins lamina nuclear genes in encoding mutations curre by fullyexplained not is which heritability, t but multifactorial is Its pathogenesis countries.

changes in conserved residues were considered, the the considered, were residues conserved changesin ZMPSTE24

Author Manuscript

/ PNPLA3 TMPO

This article isprotected by copyright. All rights reserved. / SREBF1 I148M polymorphism. Several variants were found in found were Several variants I148M polymorphism. P <0.0001). Presence of a lamina variant segregated w segregated variant of a lamina Presence <0.0001). / SREBF2 Hepatology Hepatology ). The majority of NAFLD patients (>90%) had at at (>90%) had patients NAFLD majorityof ).The f win and familial studies indicate significant significant indicate studies winandfamilial TMPO ntly-known genetic susceptibility loci. Notably, Notably, loci. geneticsusceptibility ntly-known rtion that generates truncated LAP2,abrogated generates that truncated rtion P id treatment in transfected cells, and led to to andled cells, transfected in treatment id ified in a cohort of twins and siblings with with andsiblings a of twins cohort in ified and sibling pairs: 21 individuals with, and 53 and53 with, individuals 21 pairs: andsibling <0.0001). When only insertions/deletions and only insertions/deletions When <0.0001). lamina in NAFLD. in lamina protein p62/SQSTM1. p62/SQSTM1. protein difference between the groups was similarly groupswas the between difference , including lamins, cause lipodystrophy lipodystrophy cause lamins, including , ted LAP2 protein and a dramatic phenotype dramatic phenotype anda LAP2 protein ted that has not previously been associated beenassociated previously hasnot that g the major chronic liver disease in many many disease in liver gchronic major the tered endogenous lamin distribution, distribution, lamin teredendogenous /LAP2 variants with NAFLD and NAFLD with variants /LAP2 ncing approach to test for variants in 10 10 for in variants test to approach ncing variants in lamina-associated proteins proteins lamina-associated in variants ts were identified in four lamina-related four lamina-related in identified were ts Conclusion:

TMPO ith NAFLD NAFLD ith Novel Novel , which which ,

Page 2of84 Page 3of84 Nonalcoholic fatty liver disease (NAFLD) is now the now is disease(NAFLD) liver fatty Nonalcoholic be the most common indication for liver transplant for transplant liver indication common most bethe pathogenesis. Twin and familial aggregation studies aggregation andfamilial Twin pathogenesis. LMNA Introduction therapies for NAFLD are limited (1,6), in part due due part (1,6), in limited are NAFLD therapiesfor Ite (1-4). is cirrhosis andultimately fibrosis to simple from a spectrum andincludes countries many

genes, B and IFA- the include IF, nuclear the cytoplasmic targeted effective no (IF), with proteins filament mut to linked have been diseases human 70 Morethan yet identified. been havenot geneticvariants are there discrepancythat is this identified loci susceptibility forthe by accounted structural integrity while providing a link between a providing link while integrity structural mem nuclear inner the with associated intimately is of gene expression impact disease phenotypes. A sub disease phenotypes. impact ofgene expression genet that suggesting (18,19), different phenotypes s andin oforgan systems, a number diseasesaffect th in causedmutations by are disorders 15 least At develop partial lipodystrophy syndromes characteri syndromes lipodystrophy partial develop LMNA

AuthorLMNB1 Manuscript / LMNB2 This article isprotected by copyright. All rights reserved. . Lamins form the major components of the nuclearl of the components major Lamins the form . Hepatology Hepatology stimated that NAFLD-related cirrhosis may soon soon may cirrhosis NAFLD-related that stimated that predispose to development of NAFLD but but of NAFLD development to predispose that to date (7-11). One possible explanation for explanation One possible date (7-11). to therapy (12-14). While there are >60 there are While therapy(12-14). the cytoskeleton and the genome (15). genome andthe cytoskeleton the e genes encoding lamins (15-17). These (15-17). These lamins egenes encoding to an incomplete understanding of its its of understanding an incomplete to ic modifiers and/or tissue-specific regulation regulation tissue-specific and/or modifiers ic ome cases the same mutation results in in results mutation cases ome same the listing in the United States (5). Effective (5). Effective States United the in listing brane and helps maintain the nuclear the maintain braneandhelps -type lamins which are encoded by three encodedthree are by which lamins -type suggest up to 50% heritability which is not not is which heritability 50% to up suggest set of patients with germline mutations in in mutations germline with of set patients most common form of liver disease in disease ofin form liver common most steatosis to steatohepatitis which can which lead steatohepatitis to steatosis ations in genes that encode intermediate genes intermediate in encode ations that zed by aberrant body fat distribution, distribution, bodyfat aberrant by zed amina, which which amina,

NAFLD. phenotype in cell culture and is the first associat first the andis culture cell in phenotype heterozygous mutations in in heterozygousmutations many including syndrome, metabolic with patients 87 ste resistance, andhepatic insulin hyperlipidemia, genes encoding lamins or lamina-related proteins th lamina-related proteins or lamins genesencoding wit NAFLD,with but patients some that hypothesized m with patients some in morphology nuclear abnormal patient disease in liver nearly the universal Given (22,23). morphology nuclear leukocyte and>10% maturation), lamin in orenzymes involved

heterozygous variants in lamina-related genes,incl lamina-related in heterozygousvariants which encodes lamina-associated polypeptide 2 (LAP2 2 polypeptide lamina-associated encodes which

Author Manuscriptwith pairs andsibling a of twin cohort examined We

This article isprotected by copyright. All rights reserved. LMNA or ZMPSTE24 Hepatology Hepatology ion of ion (of five tested genes that encode A-type lamins A-type lamins encode genesthat (of five tested s with lamin-related lipodystrophy and the andthe lipodystrophy lamin-related with s atosis (20,21). Notably, in a French cohort of a French cohort in (20,21). Notably, atosis uding a novel truncation variant in in variant udingtruncation a novel at predispose to their development of development their to at predispose with NAFLD, three patients harbored patients three NAFLD, with of the tested patients had abnormal hadabnormal patients tested ofthe hout lipodystrophy, might have variants in in have might variants lipodystrophy, hout TMPO etabolic syndrome and NAFLD (22), we (22),we NAFLD and syndrome etabolic ). This truncation manifests a dramatic manifests truncation ).This /LAP2 variants with NAFLD.with variants /LAP2 NAFLD and identified several several identified and NAFLD TMPO

, , Page 4of84 Page 5of84 performed with a custom-designed TruSeq amplicon pa amplicon TruSeq a custom-designed with performed Next-generation DNA sequencing for variant identifi variant for sequencing DNA Next-generation participants provided written informed consent, and consent, informed written provided participants ana heritability NAFLD the from excluded were pairs Study design and participants. and design Study previously reported (7,9,11) (see (7,9,11) reported previously (24,25) and data frequency Phase-3 population Genomes 1000 Re on based annotated were Variants Diego, San CA). Tiss and Blood DNeasy CA) City, Qiagen (Redwood the used for PCR amplification and sequencing ( andsequencing amplification for used PCR v flanking DNA of genomic regions base-pair 400-600 institutionalized persons. persons. institutionalized obtaine were samples No Board. Review Institutional Materials and Methods Methods Materialsand fibrosis was quantified by MR elastography-determin MR bywas quantified fibrosis med or steatogenic alcohol (e.g., hepaticsteatosis with ≥5% asMRI-PDFF defined NAFLD with (MRI-PDFF), imag resonance bymagnetic noninvasively quantified probability the study increase this to in included consisted of twin pairs, with the remainder consist remainder the with pairs, of twin consisted as pa Diego), San of California, (University Center

Authorsequencing DNA Sanger by confirmed were Variants Manuscript

This article isprotected by copyright. All rights reserved. Study participants were recruited through the NAFL the through recruited were Study participants Supplementary Methods Supplementary Hepatology Hepatology Table S1 Table of detecting rare variants. Hepatic steatosis was Hepaticsteatosis variants. rare detecting of ication use, other liver disease causes). Liver causes). disease liver other use, ication ing of sibling-sibling pairs; while non-twin non-twin while pairs; ingof sibling-sibling rt of a prospective study of twin pairs as pairs oftwin study of art prospective the research protocol was approved by the approvedthe by was research the protocol d from executed prisoners or other prisoners executed from d ed stiffness (MRE-stiffness) (7). All All (7). (MRE-stiffness) edstiffness lysis described previously (7), they were were (7), they previously described lysis ing-determined proton-density fat-fraction fat-fraction proton-density ing-determined ). fSeq v.69 gene models and matched with with and matched gene models v.69 fSeq cation. cation. ariants of interest. The same primers were were The same primers of interest. ariants dbNSFP v2.0 functional annotations annotations functional v2.0 dbNSFP nel using a MiSeq instrument (Illumina, instrument aMiSeq using nel ue Kit. Next-generation sequencing was was sequencing Next-generation ueKit. ). The majority (>80%) of the cohort cohort the (>80%) of ).The majority out apparent secondary cause of causesecondaryof apparent out

Genomic DNA was isolated using using DNA Genomic was isolated using primers designed to amplify to designed primers using D Research DResearch

primary antibodies ( antibodies primary PNPLA3 variant genotyping. genotyping. variant PNPLA3 by DNA staining using 4',6-diamidino-2-phenylindole using staining byDNA Immunofluorescence. Immunofluorescence. Plasmids and transfection. and Plasmids prepared in isopropanol (26). Huh7 cells were plate were cells Huh7 (26). isopropanol in prepared acetone and methanol mixture (-20 mixture andmethanol acetone the the

reading frame using primers engineered with flankin with engineered primers using readingframe (Waltham, MA) SNP Genotyping assay (catalog number (catalognumber Genotyping assay MA) SNP (Waltham, secondary antibody (Alexa Fluor® 488 or 594; Thermo or 594; Fluor®488 (Alexa antibody secondary LAP2 (1-99) was generated via PCR amplification of amplification PCR via generated was LAP2 (1-99) San Technologies, (Agilent kit directedmutagenesis Fatty acid treatment. acid Fatty objective. 40X Imager.M2microsc AXIO Zeiss a with werevisualized Culture Collection, Manassas, VA) (plated at ~60-70% at VA)Manassas, (plated Collection, Culture for was CA) used Carlsbad, (Life Technologies, 2000 simila tag GFP or myc/DDK with pCMV6 into subcloned myc/DDK tag (Origene) using (Origene) tag myc/DDK gr amino-terminal vectors with pCMV6 into subcloned (Rockvil Origene from purchased were readingframes immediately 3′ to the the to 3′ immediately PNPLA3

Author Manuscriptus genotyped were I148Mremainder (7). The variant

Table S2 Table Oleic acid (Sigma-Aldrich, St. Louis, MO) stock so Louis, MO) stock St. Oleic acid (Sigma-Aldrich, MluI Two days after transfection, cells were washed, the washed, were cells transfection, after days Two This article isprotected by copyright. All rights reserved. site. Mutants of LAP2α were generated using the Qu the generated LAP2αusing were of Mutants site. Plasmids containing human containing human Plasmids ) were added (overnight, 4 (overnight, )added were A subset of twin and sibling pairs were previously previously were pairs andsibling of twin Asubset SgfI ° and C, 10min). Following fixation, washing blockin then Following fixation, 10min). C, MluI Hepatology Hepatology restriction enzymes, with a stop codon engineered engineered codon a stop enzymes,with restriction d on lysine-coated glass chamber slides and chamber glass slides lysine-coated on d ta Clara, CA). The truncated variant of variant truncated The CA). Clara, ta g transfection of Huh7 cells (American Type (American cells of Huh7 transfection base-pairs 1-297 of the of the 1-297 base-pairs (DAPI) (Life Technologies). Stained cells cells Stained Technologies). (DAPI) (Life SgfI le, MD). The open reading frames were were frames MD).The reading open le, confluency 1d prior to transfection). transfection). to prior 1d confluency een fluorescent protein (GFP) or protein fluorescent een ope, and images were acquired with a with acquired were andimages ope, Fisher) was added (1h, 22 (1h, added was Fisher) ° TMPO C). After washing, fluorescently-tagged fluorescently-tagged washing, After C). 4351379). r to full-length LAP2α. Lipofectamine- LAP2α. full-length rto and (LAP2α) and and (LAP2α) MluI ing a Thermo Fisher Fisher aThermo ing

restriction sites, then then sites, restriction lution (50mM) was (50mM) lution n fixed with a 1:1 a 1:1 with fixed n LMNA TMPO ikChange II site- ikChange genotyped forgenotyped ° C), followed followed C), open open open open g, Page 6of84 Page 7of84 Semi-native and denaturing gels. denaturing and Semi-native Immunoprecipitation and immunoblotting. Immunoprecipitation paraformaldehyde, 15min, 22°C) and permeabilized (0 and permeabilized 22°C) 15min, paraformaldehyde, ImageJ version 1.4.3.67. 1.4.3.67. version ImageJ indicated, Where for immunoblotting. Hercules,CA) polyvinyli andtransferred to SDS-PAGE resolvedvia (In G protein andDynabeads antibody usinganti-GFP fatty acid-free BSA (Sigma-Aldrich) and oleic acid acid andoleic BSA (Sigma-Aldrich) acid-free fatty culture the 2d, After plating. after 1d transfected centrifugation (12,000x centrifugation co proteaseinhibitor NaCl, 150mM 8.0, pH Tris 50mM

was solubilized in SDS-containing sample buffer (95 SDS-containing buffer in sample wassolubilized (2% β-mercaptoethanol or without with CA) Carlsbad, gels)wit or (denaturing with buffer glycinesample The supe Fisher). Thermo assay, acid (bicinchoninic Zen 2.3 lite software package ( package Zensoftware lite 2.3 i andmeasuring counting by was staining quantified Triton lysis buffer (4 lysis buffer Triton afte LAP2α.days Two myc-tagged with cells cultured s Coomassie Fisher) byor (Thermo visualized silver wit (Invitrogen) gels native Tris-glycine 20% Novex (Thermo Fisher) was added at the primary antibodys primary the at added Fisher)was (Thermo perform were DAPImounting and antibodyincubation,

Author Manuscript ° C, 20min), and GFP or GFP-tagged lamin A was immuno lamin andGFP or GFP-tagged 20min), C, g , 10min, 4 10min, , This article isprotected by copyright. All rights reserved. Fig.S1 Cells were solubilized in lysis buffer (1% Triton Triton lysis in (1% buffer were solubilized Cells ° C), the supernatant protein concentration was deter concentration supernatant protein the C), ). ). Hepatology Hepatology GFP or GFP-tagged lamin A was co-expressed in in wasco-expressed A lamin GFP or GFP-tagged medium was changed to DMEM containing 1% containing 1% DMEM was changed to medium hout (semi-native gels) SDS (Invitrogen, SDS gels) (semi-native hout (500 µM) or vehicle. Cells were fixed (4% were fixed Cells or vehicle. µM) (500 ntracellular lipid droplets using the Zeiss using the droplets lipid ntracellular taining. taining. rnatant was then diluted in Novex 2X Tris- 2X Novex in diluted then was rnatant h running buffer containing 0.1% SDS, and containingSDS, 0.1% running h buffer ° tep and incubated overnight (4 overnight incubated and tep data were quantified by densitometry using using bydensitometry quantified data were dene fluoride membranes (Bio-Rad, (Bio-Rad, membranes fluoride dene C, 2min). Proteins were 4- resolvedusing Proteins 2min). C, vitrogen). Immunoprecipitates were Immunoprecipitateswere vitrogen). r transfection, cells were solubilized in in solubilized were cells rtransfection, ). In parallel, the Triton-insoluble pellet pellet Triton-insoluble In the ). parallel, .1% Triton X-100, 5min). Blocking, Blocking, 5min). X-100, Triton .1% cktail (Sigma-Aldrich)). After After (Sigma-Aldrich)). cktail ed, and 10µM BODIPY 493/503 493/503 BODIPY ed,and10µM precipitated precipitated X-100, ° C). Lipid C). mined mined

LAP2-binding protein identification by tandem mass bymass tandem identification protein LAP2-binding Statistical analysis. Statistical LC-MS/MS. by

test was used. was used. test F significance. statistical assess was to used test 22 g 50µL of 0.1M in incubatingimmunoprecipitates the °

Author Manuscript(pH Tris of 1M equalvolume of an addition then C),

For continuous data, the two-tailed Student’s Student’s two-tailed data, the For continuous

This article isprotected by copyright. All rights reserved. Hepatology Hepatology or categorical data, a two-tailed Fisher’s exact exact Fisher’s atwo-tailed data, categorical or lycine (pH2.5) with shaking (10min, (10min, shaking (pH2.5)with lycine spectrometry. spectrometry. 8) prior to trypsin digestion and analysis andanalysis digestion trypsin 8)to prior t -test or the Mann-Whitney U Mann-Whitney or the -test Proteinswere by eluted

Page 8of84 Page 9of84 Identification of variants in lamina-related genes. lamina-related in of variants Identification Study participants Study 1 enzymes( homeostasis lipid in involved factors transcription l lamins, genes encoding of ten directedsequencing with patients in proteins nuclearlamina-associated genes in befound might variants that hypothesized individ some in morphology nuclear abnormal andthe A1c, alanine aminotransferase (ALT) levels, and MRI and (ALT)levels, aminotransferase A1c,alanine andContro Cases pairs). or sibling twin discordant concorda 3 pairs, twin concordant NAFLD(19 without w group NAFLD This pairs. (2) sibling dizygotic)or memb and 9 pair, sibling concordant dizygotic),one conc of five consisted group NAFLD This steatosis). between differences significant no ethnicity showed Results Table S3 Table steatohepatitis among patients with lipodystrophy s lipodystrophy with among patients steatohepatitis evaluation, MRI, and lamina-related genesequencing andlamina-related MRI, evaluation, read coverage of 1100x across the 10 gene target wi genetarget 10 the across of 1100x readcoverage

), 21 met criteria for NAFLD (MRI-PDFF ≥5% without without ≥5% for(MRI-PDFF NAFLD criteria met ),21

). Sequencing was performed with an amplicon-based an amplicon-based with performed ).Sequencing was

AuthorLMNA Manuscript /

LMNB2 . . Thirty-seven (37) twin and sibling pairs underwent underwent pairs andsibling Thirty-seventwin (37)

This article isprotected by copyright. All rights reserved. / ZMPSTE24 / ICMT Hepatology Hepatology / FNTA that bind lamins), and lamin-processing andlamin-processing lamins), bind that NAFLD. To address this, we performed exon- we performed this, address NAFLD. To ls differed in body mass index, hemoglobin hemoglobin index, mass differed body ls in Given the frequency of hepatic steatosis and hepaticsteatosis of frequency the Given / yndromescaused by encoding lamins, lamin-related proteins, or proteins, lamin-related lamins, encoding amin-binding proteins (including two two (including proteins amin-binding the two groups. groups. two the FNTB th ~400 variants identified across all all across identified variants ~400 th ers of discordant twin (4 monozygotic, 3 3 (4 monozygotic, twin ersof discordant as compared with 53 subjects (Controls) (Controls) subjects 53 with ascompared ordant twin pairs (4 monozygotic, 1 1 monozygotic, (4 pairs twin ordant . Within this group of 74 subjects ( subjects 74 group of this Within . scores ( scores uals with metabolic syndrome (22), we (22),we syndrome metabolic with uals nt sibling-sibling pairs, and 9 members of members and9 pairs, sibling-sibling nt another apparent cause of hepatic cause of hepatic anotherapparent / TMPO Table 1 Table platform, achieving an average an achieving platform, / BANF1 ). Age, sex, race,and ).Age, sex, intake history, serologic history, serologic intake LMNA / SREBF1 mutations (20,21) mutations / SREBF2 Table Table , ,

participants with NAFLD. The majority of the ofpatien the The majority NAFLD. with participants protein; these were confirmed via Sanger sequencing via confirmed were these protein; predicted to result in an insertion/deletion or cha an insertion/deletion in result predictedto NAFLD, while the the while NAFLD, previously found to have a minor allele frequency ( frequency allele aminor have to found previously variant ( variant with for subjects 3.02±0.34% similar: findingswere ( onelamina-r least at in fora variant heterozygous change in a conserved amino acid were included ( acid were included amino conserved changea in correction, collectively the nuclear lamina genetic lamina nuclear the collectively correction, N with associated was significantly geneticvariant

twin pairs ( pairs twin 2.91±0.41% versus 6.74±0.90% in the latter group (m group latter the in 6.74±0.90% versus 2.91±0.41% samples. Of these, <10% were predicted to result in result wereto <10% predicted Of these, samples. individuals with NAFLD. The NAFLD. with individuals (81%) carried such a variant, compared to 11 of 53 53 of 11 compared to a variant, (81%)such carried (24). Among these, novel insertion variants in in variants insertion novel these, (24).Among the analyses; further from excluded wastherefore, related variant versus subjects with a ( variant with subjects versus relatedvariant c was byMRI-PDFF) (quantitated content hepaticfat Twelve unique variants in four genesvalidated were four in variants Twelveunique P <0.0001) ( <0.0001) P <0.0001) ( <0.0001) Fig.S3 Author Manuscript Fig.1A,

), monozygotic twin pairs ( pairs ),twin monozygotic

SREBF2 Fig.1B left panel left This article isprotected by copyright. All rights reserved. ). Comparable results were obtained when subgroup a when subgroup wereobtained results ).Comparable insertion was not present in the unaffected siblin unaffected the in present was not insertion ). When only variants predicted to result in insert in result predictedto only variants ).When TMPO insertion was also present in the monozygotic twin monozygotic the presentin also was insertion Hepatology Hepatology Fig.S4A Fig.1B TMPO nge in a conserved residue were included, the the were included, residue aconserved ngein elated gene, versus 19 of 53 (36%) controls (36%) controls of 53 19 gene, versus elated Fig.1A, variants were found preferentially in study in preferentially found were variants AFLD in this cohort after Bonferroni Bonferroni after cohort AFLDthis in remainder were novel or have MAF < 0.06 < 0.06 haveMAF or novel were remainder MAF) in the general population of 0.41 and, of 0.41 population general MAF) the in (21%) controls ( (21%)controls an amino acid change in the encoded the in acid change an amino out versus 7.93±1.12% for subjects with a with for subjects versus7.93±1.12% out ( ). The MRI-PDFF in the former group was group former the in ).The MRI-PDFF ( ts with NAFLD (19 of 21, NAFLDwith of (19 ts ompared in individuals without a lamina- without individuals omparedin and ), dizygotic twin pairs ( pairs ),dizygotic twin Table 2 Table ean±SEM; Fig.S2 SREBF2 SREBF2 right panel right ). ). ). Of these, ).Of these, P <0.0001); when only variants variants when only <0.0001); were identified in two two in identified were P ), 17 of 21 NAFLD patients patients NAFLD of21 ),17 <0.0001). Similarly, the the Similarly, <0.0001). SREBF2 g. While no single no g.While Fig.S4B

90%) were ion/deletion or ion/deletion nalysis of the of the nalysis G595A was G595A ),andnon- without without Page 10of84 Page 11of84 Effect of PNPLA3 I148M genotype. I148M Effectof PNPLA3 ( interaction between between interaction (2 NAFLD for allele susceptibility awell-described con domain phospholipase patatin-like encodes which conserved residue variant versus 14 of 62 controls controls of 62 14 versus residuevariant conserved the the more likely to carry lamina-related variants compar variants lamina-related carry likelymore to >3. (MRE-stiffness fibrosis advanced significantor MRE), underwent who NAFLDwith subjects (n=33total with combined were 13 these When underwent MRE. 13 above), (referenced pair ofpart a twin/sibling not Withi group. NAFLDthe in MRE-stiffness on variants high prevented number this gene, but lamina-related Ofthe MRE. underwent NAFLD with subjects 21 ofthe g the Within fibrosis. of hepatic extent the assess particip MRI, study some traditional to Inaddition

( controls of 62 24 versus avariant caseshad ana the in wereincluded pair, or sibling ofa twin recr were who controls) 9 cases, (15 NAFLD subjects separa was performed shown) (not pairs sibling twin Fig.S6 PNPLA3 ). ).

Authoran twin 37 the in was genotyped I148M polymorphism Manuscript

PNPLA3

This article isprotected by copyright. All rights reserved. genotype and the presence of lamina-related varian lamina-related of presence andthe genotype A single nucleotide polymorphism (C>G) in in (C>G) polymorphism nucleotide A single Hepatology Hepatology P =0.02); 20 of 36 cases had an insertion/deletion or insertion/deletion hadan cases of 36 20 =0.02); roup of 37 twin/sibling pairs (n=74 subjects), 20 20 (n=74 subjects), pairs twin/sibling of 37 roup lysis, the conclusions were unchanged: 23 of 36 of 36 23 unchanged: were conclusions the lysis, there were 15 subjects with NAFLD, of whom whom NAFLD,with of subjects 15 were there ants underwent MR elastography (MRE) to to (MRE) elastography underwent MR ants ( 66 kPa or >4.11 kPa, respectively (27)) being (27)) being respectively orkPa, >4.11 kPa 66 ed to controls ( controls edto P 8,29). To address whether there was any there whether address To 8,29). a meaningful assessment of the effect ofeffect of the assessment a meaningful tely. Similarly, when an additional 24 24 anadditional when Similarly, tely. =0.002)( uited as part of the same study, but not part not study, but same as ofpart the uited taining 3, resulting in an I148M change, is I148Mis change, an in resulting taining3, n the other group of 24 subjects who were were who subjects 24 groupother the n of se, 18 of 20 (90%) had a variant in a in hada variant (90%) of 20 se,18 there was a trend toward those having having towardthose a trend there was the 20 twins and siblings with NAFLDwith andsiblings twins 20 the Fig.S5 P =0.2 and 0.06, respectively) 0.06, =0.2and d sibling pairs. Notably, Notably, sibling d pairs. ). ). ts in our cohort, cohort, our in ts PNPLA3 , ,

base pair insertion (c.287_288insA) which was which ident (c.287_288insA) base insertion pair presence of one or two G alleles was not significan was not alleles G two of onepresence or Multiple variants TMPO in variants Multiple P

twins (one twin with NAFLD and one without) and is is and without) NAFLDwith andone (one twin twins the portion of the gene that is unique to the α-iso the to unique is gene of the that portion the its carboxy terminus (30). Notably, the majority of Notably,majority the (30). carboxy terminus its LAP2αprevi andwas as known is isoform Thelongest lamina variant was highest in subjects lacking subjects a in wasvariant highest lamina variants ( variants ver variant a lamina without subjects in 2.40±0.17% with a lamina variant was 17.0 (95% confidence inte (95% confidence 17.0 was variant a lamina with of lamina-associated polypeptide 2 (LAP2) that are are that (LAP2) 2 polypeptide oflamina-associated (odds ratio conferred by having at least one G alle oneG least at having by conferred ratio (odds

which remained significant after Bonferroni correct Bonferroni after remained which significant compa 21) NAFLDof (13 with subjects in represented variant versus 7.49±1.37% in those with variants ( variants with those in versus7.49±1.37% variant MRI-PD significant: also was lamina-relatedvariant carrying a carrying alamin ofeffect the subgroup this althoughwithin subjects lacking a lacking subjects threshold of threshold =0.09), similar to what was previously noted (7). I (7). noted was previously what to =0.09),similar P PNPLA3 <0.001) ( <0.001) P

Author genestested). ten were that given <0.005 Manuscript

PNPLA3 G allele ( G allele Fig.S7A

This article isprotected by copyright. All rights reserved. G allele when only the 31 twin pairs were examined were pairs twin 31 the whenG allele only . Several variants were identified in in identified were Several . variants ). Among those carrying at least one G allele (n=34 oneG allele least at carrying ).Among those P =0.06).

Hepatology Hepatology PNPLA3 form. The lone exception was a novel single wassingle a novel exception The lone form. le=2.48, 95% confidence interval 0.88-7.00, 0.88-7.00, interval confidence 95% le=2.48, P the variants we identified in in we variants the identified a variant was not as prominent among subjects as prominent not awas variant tly associated with NAFLD in our cohort cohort NAFLDour with in tlyassociated ion ( ion produced via alternative splicing ( splicing alternative via produced =0.02). Similar findings were observed in were in observed findings =0.02).Similar n contrast, the NAFLD odds ratio associated ratio odds NAFLD the contrast, n sus 5.57±0.87% in those with lamina lamina with those in 5.57±0.87% sus FF 4.08±1.25% in those subjects without a without subjects those in FF4.08±1.25% ified in one set of monozygotic 41 year-old of 41 monozygotic oneset in ified rval 3.6-81.0, rval3.6-81.0, located in the amino-terminal region region amino-terminal the locatedin red to controls (10 of 53), a difference a 53), difference of (10 controls redto ously found to interact with lamin A/C via via A/C lamin with interact to found ously TMPO P G allele (n=40): MRI-PDFF (n=40):G allele =0.0006 by Fisher’s exact test, with a with test, exact Fisher’s by =0.0006 encodes six isoforms (α,β,γ,δ,ε,ζ) (α,β,γ,δ,ε,ζ) isoforms six encodes TMPO P <0.001), and the effect of a effect andthe <0.001), ( Table 2 Table TMPO ( ), the effect ofeffect a ), the )over- andwere Fig.S7B Fig.S8 were in ), ). Page 12of84 Page 13of84 precipitated with lamin A similarly to wild-type LA wild-type to Asimilarly lamin with precipitated previous report showing reduced binding to the lami the to reduced binding report showing previous binding domain of LAP2α to residues 601-694 ( 601-694 residues to LAP2α of domain binding A (30-32). nucleoplasmic lamin and stabilizes binds independent experiments – data not shown), reductio shown), data not – experiments independent though signif a statistically modest, not exhibited residue and was previously reported to affect lamin affect to reported previously residueand was resu NAFLDwith (R690C) a patient wasin found that A, but not GFP alone, readily co-precipitated wild- co-precipitated GFP readily alone, not A, but usi co-immunoprecipitation and performed cells Huh7 wi with A lamin human GFP-tagged A,we co-expressed whetherth address To disease (33). liver to linked with a family in identified wasvariant previously while a second variant of LAP2α (Q599E) located out LAP2α(Q599E)located of a second variant while ( LAP2α lamin to binding abrogated completely acid 99 amino of LAP2 (LAP2 1-99) lacks the lamin-binding domain. lamin-binding the LAP21-99) lacks (LAP2 of found in the nucleoplasm (rather than directly asso directly (rather than nucleoplasm the in found Two variants of LAP2 impair interaction with lamin lamin with interaction impair of LAP2 variants Two

codon after Thr 99, resulting in truncation of all all of truncation in resulting Thr99, after codon predicted is insertion This isoforms. all to common

AuthorFig.2B Manuscript ). ).

This article isprotected by copyright. All rights reserved. Hepatology Hepatology Fig.S8 LAP2isoforms. icant (quantitation via densitometry of three of three densitometry via (quantitation icant hereditary cardiomyopathy but has not been been hasnot but cardiomyopathy hereditary ese variants of LAP2α affect binding to lamin lamin to binding LAP2αaffect of esevariants ciated with the inner nuclear membrane) and membrane) nuclear inner the ciatedwith type LAP2α( type to cause a frameshift and premature stop prematurestop and frameshift cause to a binding binding P2α. In contrast, truncation of LAP2 at of truncation Incontrast, P2α. Previous studies have narrowed the lamin- the narrowed have studies Previous n A tail A tail n n in co-precipitation with lamin A ( lamin with co-precipitation in n A, despite similar expression to wild-type to expression similar A,despite side the lamin-binding region co- region lamin-binding the side A. ng anti-GFP antibody. GFP-tagged lamin lamin antibody. GFP-tagged nganti-GFP lts in a charge change in a conserved a conserved in a change charge in lts ) (30). Hence, the novel truncated variant truncated variant )novel the (30). Hence, In addition, one other variant in in Inonevariant other addition, The α-isoform of LAP2 is largely LAP2is Theof α-isoform ld-type or mutant myc-tagged LAP2α in myc-tagged ld-typeor mutant in vitro vitro in in vitro vitro in

Fig.2A (33) (33), LAP2α R690C (33),LAP2α R690C ). In agreement with a with Inagreement ). . Interestingly, this Interestingly,this TMPO Fig.2A

Notably, the LAP2α R690C variant migrated as high-m migrated variant R690C LAP2α Notably, the bonds (36), we hypothesized that multimeric species multimeric that (36), we hypothesized bonds molecular-weight forms not seen with wild-type LAP2 wild-type seen with not forms molecular-weight formed β-me fraction, Triton-soluble the speciesin no LAP2 Indid which 1-99, variant. contrast, R690C va not did which Triton-soluble, were LAP2αspecies In (35). a report prior with consistent LAP2α, type Of note, although the high-molecular-weight smear f smear high-molecular-weight the although Of note, single species (~75 kDa) consistent with monomeric L monomeric with consistent kDa) (~75 singlespecies

length LAP2α, LAP2 1-99 formed no disulfide-linked disulfide-linked formed no LAP2LAP2α,1-99 length truncate as the species, high-molecular-weight form diff LAP2might 1-99 truncated that hypothesized We as disulf exist canof LAP2α proportion substantial weight species. weight solubl a truncated, forms LAP2α but not Full-length, semi-native SDS-PAGE (34,35). Given that lamin A fo lamin that Given (34,35). SDS-PAGE semi-native conditions ( conditions identical with shown), (not conditions semi-native as high-molec migrated LAP2α >50%of findings(35), den and denaturing/non-reducing, undersemi-native, H in LAP2α myc-tagged expressed we address To this, dimerize or trimerize or trimerize dimerize

Author ManuscriptFig.S9A Previous work demonstrated that the carboxy-termina the that work demonstrated Previous

). In contrast, under reducing conditions, >90% of conditions, reducing under Incontrast, ). in vitro in This article isprotected by copyright. All rights reserved. and that multimeric LAP2α migrates as a high molec as a high LAP2α migrates multimeric andthat Hepatology Hepatology addition, >50% of high-molecular-weight >50% of high-molecular-weight addition, results under denaturing non-reducing under denaturing results ide-linked multimeric complexes. complexes. multimeric ide-linked rcaptoethanol-resistant insoluble high- insoluble rcaptoethanol-resistant d protein lacks cysteines. Infull- to contrast cysteines. lacks protein d of LAP2α might also be disulfide-linked. bedisulfide-linked. also LAP2αmight of ormed by truncated LAP2 1-99 appears appears 1-99 LAP2 truncated by ormed aturing/reducing conditions. Similar to prior prior to Similar conditions. aturing/reducing t form detectable high-molecular-weight high-molecular-weight detectable form t ry between wild-type LAP2α and the andthe LAP2α wild-type ry between er from wild-type LAP2α in its ability its to in LAP2α wild-type erfrom AP2α ( AP2α high-molecular-weight species ( high-molecular-weight e, detergent-resistant, high molecular molecular high e,detergent-resistant, α or any point-variant tested ( tested any point-variant αor ular weight species (>250 kDa) under (>250 kDa) species ularweight uh7 cells, then performed SDS-PAGE SDS-PAGE performed then cells, uh7 rms intra- and intermolecular disulfide disulfide andintermolecular intra- rms olecular-weight species similar to wild- to similar species olecular-weight Fig.S9A l portion of LAP2αcan of portion l ). These data suggest that a that data suggest ).These LAP2α migrated asa migrated LAP2α ular species on on ularspecies Fig.S9B Fig.S9A ). ). Page 14of84 Page 15of84 found throughout the nucleus and cytoplasm under id under andcytoplasm nucleus the throughout found exc LAP2αlocalized full-length expected, As cells. full-length DDK-tagged examining by addressedthis LAP21 that we reasoned (37). Hence, residue 187 to region mature protein the that suggesting nucleus, LA study to (generated 1-187 acids amino containing LAP2α ( LAP2α g was significantly but groupsof cells), two these n showed (quantitation cells adjacentuntransfected trun with transfected cells in accumulation droplet After staining. lipid acid andoleic performed with cells Huh7 treated we hepatocytes, in accumulation NA to contribute might 1-99 LAP2 address To whether shown). (data not (BHK)cells adenocarcin lung human transfected in wereobtained

more prominent after β-mercaptoethanol treatment ( treatment β-mercaptoethanol after more prominent compared to full-length full-length LAP2α. to compared localizatio its nuclear disrupts of LAP2 Truncation treatment β-mercaptoethanol or without specieswith the in significant difference no showed experiments Fig.4

Author ). Manuscript

This article isprotected by copyright. All rights reserved. In prior studies of LAP2 in cultured cells, a tru cells, cultured LAP2 in of In studies prior Hepatology Hepatology reater than in cells transfected with full-length full-length with transfected cells in than reater cated LAP2 (1-99) was similar to that in in that to was LAP2similar (1-99) cated overnight incubation with oleic acid, lipid acid, lipid oleic with overnight incubation required for nuclear localization is C-terminal C-terminal is localization nuclear requiredfor o statistically significant difference between difference between significant statistically o lusively to the nucleus, while LAP2was while 1-99 nucleus, the to lusively relative amount of high-molecular-weight of high-molecular-weight amount relative expressing full-length LAP2α or LAP2 1-99 LAP2αor full-length expressing Fig.S9B n and increases lipid accumulation accumulation increases lipid and n . . -99 would also be mislocalized and bemislocalized also would -99 P2 domains) lost exclusive targeting to the the to targeting exclusive lost domains) P2 entical conditions ( conditions entical oma (A549) cells and baby hamster kidney kidney babyhamster and cells (A549) oma LAP2α or LAP2 1-99 localization in Huh7 Huh7 in localization LAP21-99 LAP2αor FLD development by facilitating lipid lipid byfacilitating FLDdevelopment ) , , quantitation of four independent of four independent quantitation Fig.3 ). Similar results results ).Similar ncated protein ncated protein

Expression of truncated LAP2 alters endogenous lami endogenous alters LAP2 of truncated Expression

Truncated LAP2 has multiple unique interaction part interaction unique has multiple LAP2 Truncated length protein were detected, many of which were cy were which many of detected, were length protein 99 exhibited unique biochemical properties compared properties biochemical unique exhibited 99 was mislocalized in cultured cells ( cells cultured in wasmislocalized full-length LAP2α in oleic acid-treated cells ( cells acid-treated LAP2αoleic in full-length accumulation in cells ( cells in accumulation ( immunoprecipi of the analysis spectrometry mass out 1-99 LAP2 or LAP2α GFP-tagged weimmunoprecipitated compare interactions protein-protein unique exhibit

tagged LAP2 followed by immunoblotting with anti-p6 with immunoblotting LAP2 byfollowed tagged LAP2 as 1-99 determi with interacted preferentially liver mouse in lipogenesis regulate to wasreported LAP2α, full-length to compared LAP2 1-99 truncated after proteins LAP2-associated amongidentified 235 p62/SQSTM protein ubiquitin-binding cytoplasmic the unique biochemical properties of truncated LAP2 ( LAP2 of truncated properties biochemical unique Huh7 cells and examined endogenous lamin A/C distri A/C lamin endogenous andexamined cells Huh7 express we address To this, organization. A/C lamin tha we hypothesized (31,32), organization A/C lamin not affect nuclear shape at the level of resolution level the at shape nuclear affect not Fig.5A

Author Manuscripttruncat for partners interacting unique ). Numerous Fig.4 This article isprotected by copyright. All rights reserved. ), and prior reports demonstrating a role for LAP2α for a role demonstrating ),reports and prior Fig.3 ) and led to increased lipid accumulation compared accumulation lipid increased to andled ) Hepatology Hepatology Fig.4 we tested, more abnormal punctate and globular and punctate abnormal morewe tested, (38). Notably, endogenous p62/SQSTM1 p62/SQSTM1 endogenous (38). Notably, ), we hypothesized that truncated LAP2 might truncated that ),we hypothesized Fig.2 d to the full-length protein. To address this, address To this, protein. full-length the to d ned by co-immunoprecipitation of GFP- ned byco-immunoprecipitation ed wild-type LAP2α and LAP2 LAP2αin 1-99 and edwild-type sorting by the ratio of spectra obtained with with spectraobtained of ratio the sorting by toplasmic proteins ( proteins toplasmic t LAP2 truncation might lead to altered lead to might LAP2 t truncation tates and associated endogenous proteins proteins endogenous andassociated tates to full-length LAP2α ( LAP2α full-length to then by percent coverage, and because it it and because coverage, bythen percent bution ( bution 1 for validation because it ranked first first ranked it because for 1 validation ners in Huh7 cells Huh7 in ners 2 antibody 2 ( n distribution in Huh7 cells in Huh7 distribution n , 3 , 5 from Huh7 cell lysates and carried andcarried lysates cell Huh7 from ed LAP2 1-99 as compared to full- compared to as LAP21-99 ed ; ; Fig.S9 Fig.6A Fig.5B,C ), its effect on lipid lipid on effect ),its ). Although LAP2 1-99 did LAP2did 1-99 ).Although Table S4 Table . Given that LAP21- . that Given Fig.2 ). ). in regulating in , , ). We selected ).We Fig.S9 . Given the the Given . ),and to to Page 16of84 Page 17of84

length LAP2α ( LAP2αlength tra of cells nuclei in was staining noted A/C lamin conditions ( conditions

Author ManuscriptFig.S10 Fig.6B

). A comparable effect was noted for B-type lamins B-typelamins for noted was effect Acomparable ). This article isprotected by copyright. All rights reserved. Hepatology Hepatology nsfected with LAP2 1-99 as compared to full- to as compared LAP21-99 nsfectedwith undersame the

ZMPSTE24 proteins in a cohort of twins and siblings with NAF with andsiblings a of twins cohort in proteins approaches. genesequencing bycandidate es that rare that variants and NAFLD,with patients effect of the lamina-related variants was most prom most was variants lamina-related ofeffect the variant this of frequency the to relation in cohort previousl as effect, noted NAFLD havea significant Among the variants we identified, one set of twins of twins oneset we identified, Amongvariants the population. a larger be assessed in to (CC genotype), but the interaction of lamina-relate interaction the genotype), but (CC other variants in genes encoding lamin-related and and lamin-related genesencoding in variants other expre A/C lack lamin that mice in as (20,21), noted (odds ratio 17.0, 17.0, ratio (odds conferred a significant variants these Collectively (each variants insertion are two while acidchange, of which several variants, aof set weHerereport

of patients with mutations in in mutations with of patients aggr familial byand twin suggested ofheritability thou (8,39), loci susceptibility several identified (GWAS) studies association genome-wide Large-scale Discussion

Authorlami in involved a protease encodes (L438F), which Manuscript

P <0.001). In our patient cohort, the the Incohort, our patient <0.001).

Hepatology Hepatology gh these loci cannot account for the high degree for high the degree account cannot loci these gh in the general population. Importantly, the Importantly,the population. general the in ly increased risk of NAFLD within this cohort cohort this within of NAFLD risk lyincreased are novel, in genes encoding lamina-related lamina-related genesencoding arein novel, egation studies (7,8,10,11). Given that a subset a subset that Given (7,8,10,11). studies egation of which was identified in one patient). one patient). in was of which identified d variants with with variants d with NAFLD carried a point mutation in in mutation point a NAFLDwith carried cape detection via GWAS might be identified beidentified might GWAS via capedetection lamina-associated proteins might be found in in befound might proteins lamina-associated ssion in hepatocytes (40), we reasoned that that we reasoned (40), hepatocytes in ssion LD. The majority result in a single amino a single in amino result LD. The majority inent among subjects with wild-type amongwith inent subjects y (7), likely due to the small size of the of the size small ythe dueto (7), likely PNPLA3 in individuals with NAFLDhave individuals in I148M polymorphism did not not did I148M polymorphism n A processing, that was that A n processing, PNPLA3 genotypes will need will genotypes PNPLA3 D

Page 18of84 Page 19of84 penetrance cause of NAFLD. However, the possibility the However, NAFLD. of cause penetrance phenotype conclusions because of the small numbers numbers small the of because conclusions phenotype previously identified in individuals with metabolic with individuals in previouslyidentified nuclei as determined by liver tissue staining but d staining but tissue liver by as determined nuclei

TMPO has previously been association disease.disease No n has (33) but onefamily in cardiomyopathy dilated Of (LAP2). protein encoded of α-isoform the the to studies showing that showing that studies in NAFLD and suggesting that this truncation may re may truncation this that andsuggesting NAFLDin underlining MRI-PDFF, normal with twin monozygotic enrollment in 2012 ( 2012 in enrollment twi involved as the information, clinical/lifestyle no is andit beneedinvestigated, to will variants the variants were in in were variants the truncated LAP2 on both A- and B-type lamins ( B-typelamins A-and LAP2 both on truncated remai spectrometry mass via identified interactions of importance functional the (38), liver but mouse whi p62/SQSTM1, endogenous robustlyco-precipitated pr in variant for this a role support accumulation, of endogenou alteration distribution, intracellular tran LAP2in 1-99 of truncated effects Thedramatic Author Manuscript pati NAFLD The Thr99. at truncation the including ,

TMPO Table S5 Table Lmnb1 This article isprotected by copyright. All rights reserved. , most of which were located in the portion of the of the portion the in located were of which most , and ). Lmnb2 depletion in hepatocytes did not lead to misshapen to lead not did hepatocytes in depletion Hepatology Hepatology Fig.6 t possible to make definitive genotype- makedefinitive to possible t ns were lost to follow-up after their initial initial their after follow-up to were ns lost edisposition to liver disease. Truncated LAP2 liver to disease. Truncated edisposition s lamin distribution, and increased lipid droplet droplet andincreased lipid distribution, lamin s id lead to nuclear blebbing of cultured cultured of blebbing nuclear lead to id syndrome (22,41). Notably, over one-third of one-third Notably,over (22,41). syndrome this and the other unique protein-protein protein-protein unique other andthe this n to be defined. In addition, the effects of effects the Inaddition, bedefined. to n described for any of the other variants in in variants other the anyof described for these, one was previously reported to cause cause to reported previously onewas these, sfected cells, including its altered its including cells, sfected ot previously been associated with metabolic metabolic with associated previously been ot , , present a predisposition rather than ahigh- rather than a predisposition present and the lack of longitudinal and of longitudinal lack andthe Fig.S10 of other NAFLD patients carrying patients NAFLD of other ch regulates lipogenic gene expression in in gene expression chregulates lipogenic the importance of environmental factors factors environmental of importance the ent with LAP2hasa 1-99 with ent ) are noteworthy given previous given previous noteworthy )are gene that is unique unique is genethat TMPO TMPO

progression but such a conclusion requires study in requires study conclusion a such but progression NAFLD and the need for further study. Another limit Another further study. for need andthe NAFLD ( subje those among MRE-stiffness towardtrend higher among study pa Still, disease severity. liver about of his (46),lack the well-established is steatosis Wh biopsy. liver than rather used disease was liver variants, even in our small cohort, underscores the underscores cohort, small our even variants, in variant anyindividual significancefor statistical relatively the include of findings our Limitations (44,45). injury associatedliver Mallory-D context the andB1/B2 in occur A/C lamins regulating the stability, localization, andfunctio localization, stability, regulatingthe have andmice illus systems culture cell in studies andlamin-bi of lamins andinteraction localization und Ourfindings NAFLD. and lamina-relateddisease, of implicatio havea number here Thedata presented with acquired partial lipodystrophy due to dueto lipodystrophy acquired partial with

hepatocyte-specific hepatocyte-specific fibrosis to susceptibility haveagingincreased or mice whether Itthese unknown is (42). hepatocytes Fig.S6

Authorvariant these that possibility the suggests ).This Manuscript

Lmna

LMNB2 Hepatology Hepatology tologic data precludes definitive conclusions conclusions definitive precludes tologicdata n of lamin A/C (31,32). Our findings are the first first are the findings Our (31,32). A/C of lamin n . Nevertheless, the fact that we identified several we identified that fact the Nevertheless, . upon high fat feeding as was noted in in noted aswas feeding high fat upon small number of participants which precludeswhich of participants number small rticipants who underwent MRE, there was a there was MRE, underwent who rticipants trated the role of LAP2α-lamin interaction in in interaction LAP2α-lamin of role tratedthe potential importance of the nuclear lamina in in lamina nuclear of the importance potential mutation (23,43). In addition, alterations of alterations In (23,43). addition, mutation nding proteins at the nuclear lamina. Prior Prior lamina. nuclear the at nding proteins ile the accuracy of MRI in assessing hepatic assessing in hepatic MRI accuracy the of ile larger cohorts. larger develop spontaneous hepatosteatosis upon upon hepatosteatosis spontaneous develop ns for the study of nuclear lamina function, function, lamina for study ns the of nuclear ation is that non-invasive assessment of non-invasive that assessment is ation cts carrying lamina-related variants variants carrying cts lamina-related erscore the importance of proper of proper importance erscorethe enk body formation and porphyria- formation enk body s might contribute to liver disease liver to contribute might s

orted in a patient a patient in orted

Page 20of84 Page 21of84 patients with nonfamilial NAFLD might have an unrec an have NAFLDmight nonfamilial with patients promote susceptibility to NAFLD via inappropriate i inappropriate NAFLDto via susceptibility promote the University of Michigan DNA Sequencing core for core DNA Sequencing Michigan University the of Acknowledgements: ( hepatocytes ( changes transcriptional downstream (49)and cause (w distribution altered lamin p62/SQSTM1, including

to suggest a potential link of link suggest a to potential might be relatively common among patients with fami with among patients common berelatively might ge ten the of(19 in 21) variants with cohort small Inext addition, organ(s). affected disease and the gene that likelihood andthe phenotypes laminopathy wit an individual in variant of this Identification (47),witho cardiomyopathy adilated family in with cardiomyop cause dilated to reported was previously several mechanisms by which lamina-related variants lamina-related which by severalmechanisms N with patients genes in lamina-related in variants beneeded clarify to will larger cohorts in patient develo are as drugs implications futuretherapeutic with lamin A. In this context, one of the InA. context, lamin this with

AuthorFig.6C Manuscript

). ). The authors would like to thank Dr. Robert Lyons a Lyons Dr. Robert thank to like would authors The This article isprotected by copyright. All rights reserved. TMPO variants with liver disease, possibly via impaired via disease, possibly liver with variants TMPO Hepatology Hepatology variants identified herein, the R690C variant, variant, R690C the herein, identified variants h NAFLD underscores the variability in variabilityin the NAFLDh underscores the frequency and relative contributions of contributions relative and frequency the rapolation of the number of patients in our in of patients number of the rapolation nes sequenced raises the possibility that they they that possibility the raises nessequenced AFLD. Taken together, our data suggest data suggest our together, AFLD.Taken ped to target laminopathies (48). Further study study (48). Further target laminopathies to ped ut the description of liver disease. of liver description the ut 50)), and promotion of lipid accumulation in in accumulation of lipid 50)),and promotion nteraction with cytoplasmic proteins proteins cytoplasmic with nteraction athy (33), or to serve as a genetic modifier a geneticmodifier as serve or athyto (33), tic modifiers influence both the severity of severity the both influence modifiers tic such as truncated LAP2 1-99 might might 1-99 LAP2 as such truncated hich could alter chromatin organization organization chromatin alter could hich lial NAFLD. We also posit that some some that posit also NAFLD. lial We their assistance with next-generation DNA next-generation with assistance their ognized laminopathy, which may have may which laminopathy, ognized nd Jeanne Geskes of Jeanne nd interaction interaction

manuscript. the for Omary oflaboratory the andmembers sequencing,

Author Manuscript

This article isprotected by copyright. All rights reserved. Hepatology Hepatology helpful discussions and critical review of review andcritical discussions helpful Page 22of84 Page 23of84 Nonalcoholic steatohepatitis is the second leading the is steatohepatitis Nonalcoholic Nonalcoholic Fatty Liver Disease. Gastroenterology Disease. Gastroenterology Liver Fatty Nonalcoholic

8. Anstee QM, Seth D, Day CP. Genetic Factors That That Genetic Factors CP. D,Day Seth AnsteeQM, 8. 2015;149:1784-1793. aProspecti Based on andSteatosis Fibrosis Hepatic Bhat R, Bettencourt CH, Chen N, Schork Loomba R, 7. 2010;362:1675-1685. fornonalcoholi or E, placebo vitamin Pioglitazone, A KV, McCullough Kowdley N, Chalasani SanyalAJ, 6. States United the in transplantation awaitingliver 5. Wong RJ, Aguilar M, Cheung R, Perumpail RB, Harr RB, Aguilar Perumpail Cheung M, R, RJ, Wong 5. Liver 2016; Dis Clin Adults. Liverin FattyDisease Progression BugianesiE. RI, MarengoA,Jouness 4. fat D. Non-alcoholic Preiss E, Forrest N, Sattar 3. 2013;10:656-665. Hepatol Gastroenterol NASH NAFLD, AM. Diehl MV, GA, Machado Michelotti 2. Hepatolog Association. AmericanGastroenterological LiverAmeric of Diseases, for Study the Association disease liver fatty of non-alcoholic andmanagement Br AM, Diehl LavineJE, Z, Younossi N, Chalasani 1. References

Author Manuscript

This article isprotected by copyright. All rights reserved. Hepatology Hepatology . Gastroenterology 2015;148:547-555. 2015;148:547-555. Gastroenterology . etiology of liver disease among adults adults among disease ofetiology liver c steatohepatitis. N Engl J Med Med J Engl N csteatohepatitis. 20:313-324. 20:313-324. ve Twin Study. Gastroenterology Gastroenterology Study. veTwin an College of Gastroenterology, and the andthe of Gastroenterology, anCollege American the by Guideline practice : 2016;150:1728-1744 e1727. e1727. 2016;150:1728-1744 y 2012;55:2005-2023. y2012;55:2005-2023. ty liver disease. BMJ 2014;349:g4596. 2014;349:g4596. BMJ disease. tyliver and Natural History of Nonalcoholic Nonalcoholic Historyof and Natural Affect Risk of Alcoholic and of Alcoholic AffectRisk unt EM, Cusi K, et al. The diagnosis Thediagnosis al. K, et Cusi EM, unt t A, Ang B, et al. Heritability of of Heritability al. et B,A,Ang t ison SA, Younossi ZM, Ahmed A. Ahmed ZM, Younossi SA, ison , Diehl AM, Bass NM, et al. al. et NM, Bass AM, Diehl , and liver cancer. Nat Rev cancer.Rev Nat andliver

prospective study. Gut 2016;65:1546-1554. 2016;65:1546-1554. Gut study. prospective

Trends Cell Biol 2014;24:247-256. 2014;24:247-256. Biol TrendsCell LammerdingBroken nuclei--lamin J. PM, Davidson 17. Invest 2 Clin therapy. J to biology cell from basic Laminop SG. A,Young Fong Muchir LG,HJ, Worman 16. 2013;14:13-24. flexib lamins: nuclear CL. The B, BurkeStewart 15. 2016;568:163-185. IntermediateFila Modulate that Drugs forScreening L,LiuL, H, Gui VE, Q, Groppi Chen Xie J, Sun 14. 2012;28:464-471. Genet disease.Trends R Goldman AE, Goldman SA, V,Adam Butin-Israeli 13. Invest Clin 2009;119:1756-1762. J of int a broadspectrum "IF-pathies": OmaryMB. 12. 2016;64:1547-1558. A p andfibrosis: hepaticsteatosis between effects R, LoBettencourt N, Schork CH, MT, Chen Cui J, 11. 2016;15:277-282. single nuc of multiple effect cumulative cirrhosis: Verma GP, Aithal J, Tibble M, GroveJI,Austin 10. explain discordance of non-alcoholic fatty liver di liver fatty discordance of non-alcoholic explain S, Subramaniam MR, Maurya S, A,Gupta Zarrinpar 9.

Author Manuscript

This article isprotected by copyright. All rights reserved. Hepatology Hepatology 009;119:1825-1836. 009;119:1825-1836. leotide polymorphisms? Hepatol Ann polymorphisms? leotide rospective twin study. Hepatology Hepatology study. rospectivetwin sease in monozygotic and dizygotic twins: a dizygotic twins: and seasemonozygotic in ment Proteins. Methods Enzymol Methods Proteins. ment ility in function. Nat Rev Mol Cell Biol Biol Cell Mol Rev Nat ilityfunction. in S. Monozygotic twins with NASH NASH with Monozygotic twins S. Omary MB. High-Throughput High-Throughput OmaryMB. ermediate filament-associated diseases. diseases. filament-associated ermediate Gonzalez MP, et al. Shared genetical. et MP, Gonzalez s, nuclear mechanics, and disease. and nuclear s, mechanics, Loomba R. Serum microRNAs LoombamicroRNAs Serum R. D. Nuclear lamin functions and functions lamin D. Nuclear athies and the long strange trip strange trip long andthe athies Page 24of84 Page 25of84 prevalence of laminopathies among patients with met with among patients of prevalence laminopathies pathophysiology. Am J Physiol Gastrointest LiverPh Physiol Gastrointest J Am pathophysiology. progeroid features. J Clin Endocrinol Metab 2006;91 Metab Endocrinol Clin J features. progeroid 23. Omary MB. Intermediate filament proteins of dig proteins filament Intermediate OmaryMB. 23. 2011;20:3779-3786. 22. 22. 2017;86:698-707. less lipodystrophy: partial with diseaseassociated Buras GF, AH, Brady Neidert Meral N, R, Ajluni 21. Dev Bi Cell Semin lipodystrophies. envelope-related Be P, G,Afonso Bidault N, Briand AC, Guenantin 20. hepatocyte lipoapoptosis. J Biol Chem 2006;281:1209 Chem Biol J hepatocytelipoapoptosis. Free Gores GJ. NW, H,Bronk Werneburg SF, Malhi 26. H andannotations. predictions functional andtheir a dat v2.0: dbNSFP E. X,Boerwinkle LiuX,Jian 25. 2015;526:68-74. for globalreference al.). et A JO, Korbel KangHM, A,Brook (Auton Consortium Project Genomes 1000 24.

lamin A/C gene associated with a novel syndrome of syndrome a novel with gene associated A/C lamin 19. 19. 2003;41:771-780. A/C lamin dueto cardiomyopathy historyof dilated Rob ML, G,Robinson Sinagra Fain PR, MR, Taylor 18. Dutour A, Roll P A,Roll Dutour

Author Manuscript AK Agarwal H, Esch Van

This article isprotected by copyright. All rights reserved. , Gaborit B, Courrier S, Alessi MC, Tregouet DA, et MC, Alessi B, CourrierS, Gaborit , , Debeer P, Fryns JP, Garg A. A homozygous mutation Garg A.A homozygous Fryns JP, P, Debeer , Hepatology Hepatology ons from a trial cohort. Clin Endocrinol (Oxf) (Oxf) Endocrinol Clin cohort. a from trial ons um Mutat 2013;34:E2393-2402. 2013;34:E2393-2402. Mutat um human genetic variation. Nature geneticvariation. human gene mutations. J Am Coll Cardiol Cardiol Coll Am J genemutations. ol 2014;29:148-157. 2014;29:148-157. ol :517-521. :517-521. ysiol 2017;312:G628-G634. ysiol2017;312:G628-G634. abolic syndrome. Hum Mol Genet Mol Hum syndrome. abolic arthropathy, tendinous calcinosis, and calcinosis, tendinous arthropathy, 3-12101. 3-12101. estive organs: physiology and physiology organs: estive abase of human non-synonymous SNVs SNVs non-synonymous of human abase E, McKenna B, et al. Spectrum of Spectrum al. et B,McKenna E, reziat V, Vatier C, et al. Nuclear al. et C, V,Vatier reziat ertson AD, Carniel E, et al. al. Natural et E, AD, Carniel ertson s LD, Durbin RM, Garrison EP, EP, Garrison LD,RM, s Durbin fatty acids induce JNK-dependent JNK-dependent induce acids fatty al. High al. in the the in

polypeptide 2alpha binds intranuclear A-type lamins intranuclear binds 2alpha polypeptide performance of magnetic resonance elastography in s in elastography resonance magnetic performanceof

2005;26:566-574. 2005;26:566-574. associated gene mutation 2) associated polypeptide L,Ku S, A,Vlcek D,Gajewski Slavov MR, Taylor 33. 2014;29:116-124. regulation cell stem adult in lamins nucleoplasmic Lamina-associated R. Foisner S, K,Vidak Gesson 32. 2008;10:1341-1348 Biol Cell Nat hyperproliferation. er causes A complexes LAP2alpha-lamin nucleoplasmic 30. Dechat T, Korbei B, Vaughan OA, Vlcek S, Hutchi S, OA,Vlcek B,Vaughan DechatKorbei T, 30. disease. Hepa metabolic not disease but fattyliver con specifically PNPLA3variants al. et Consortium, BF,Voight CD, Palmer ButlerEK, JL, Speliotes 29. 2008;40:1461-1465. nonal to susceptibility PNPLA3confers in variation 31. 31. 28. 28. e446. data. C participant of individual andmeta-analysis Motos Z,FH, WangMiller Venkatesh SK, S, Singh 27. Naetar N, Korbei B N,Korbei Naetar

Author ManuscriptJ Kozlitina RomeoS,

This article isprotected by copyright. All rights reserved. , Kozlov S, Kerenyi MA, Dorner D, Kral R, et al. Lo al. et R, D,Kral Kerenyi S, Dorner MA, Kozlov , , Xing C, Pertsemlidis A, Cox D, Pennacchio LA, et D,Pennacchio A,Cox XingPertsemlidis , C, Hepatology Hepatology tology 2010;52:904-912. 2010;52:904-912. tology lin Gastroenterol Hepatol 2015;13:440-451 2015;13:440-451 Gastroenterol Hepatol lin and disease. Semin Cell Dev Biol Cell anddisease. Semin with dilated cardiomyopathy. Hum Mutat Mutat Hum cardiomyopathy. dilated with coholic fatty liver disease. Nat Genet Genet Nat disease. liver fatty coholic . J Cell Sci 2000;113 Pt 19:3473-3484. Pt 19:3473-3484. 2000;113 Cell Sci J . fer increased risk for histologic nonalcoholic nonalcoholic for histologic risk ferincreased . . taging liver fibrosis: a systematic review a systematic review tagingfibrosis: liver ythroid and epidermal progenitor progenitor ythroidepidermal and GIANT Consortium, MIGen MIGen GIANTConsortium, polypeptide (LAP)2alpha and (LAP)2alpha polypeptide Fain PR, et al. Thymopoietin (lamina- Thymopoietin al. et FainPR, son CJ, Foisner R. Lamina-associated Foisner R. CJ, son ugi U, Low RN, et al. Diagnostic al. et Low ugiRN, U, ss of ss al. Genetic al. Page 26of84 Page 27of84 polypeptide 2-alpha forms homo-trimers via its C te C its via homo-trimers forms 2-alpha polypeptide

34. 34. Mol Gastroenterol Hepatol 2017 ( 2017 Gastroenterol Hepatol Mol lea A/C lamin of mouse deletion Hepatocyte-specific SV, Weerasinghe M, Brzozowski GF, Brady KwanR, 40. tra metabolic on effects distinct have diseasethat variant analysis identifies association Genome-wide 39. C Mol InsulinResistance. andSelective Lipogenesis p62/N Insulinand betweenTalk Cross Grb14-Mediated Bos M, L,Cauzac N, L,Carre Popineau Morzyglod 38. 1999;18:6370-6384. EMBOJ bycaused is association chromosome postmitotic in H,Dechat Functiona Foisner T, R. Just VlcekS, 37. 2011;10:106 Aging Cell generation. ROS responsesto la mammalian the in residues cysteine Conserved al. 36. 36. 2007;282:63 Chem Biol J mutation. adisease-causing B D,Korbei Skegro T, Dechat VlcekL,S, Snyers 35. 2007;15:643-653. LAP2alpha,c of a for dimerization basis Structural Bradley CM, Jones S CM, Jones Bradley Speliotes EK, Yerges-Armstrong LM, Wu J, Hernaez R, J, Wu LM, EK, Yerges-Armstrong Speliotes

Author ManuscriptI V,Gibbs-Seymour Pekovic

This article isprotected by copyright. All rights reserved. , Huang Y, Suzuki Y, Kvaratskhelia M, Hickman AB, e AB, Hickman M, Y,Kvaratskhelia HuangY,Suzuki , in press in , Markiewicz E, Alzoghaibi F, Benham AM, EdwardsR, AM, F,Benham Alzoghaibi E, Markiewicz , ). Hepatology Hepatology its. PLoS Genet 2011;7:e1001324. Genet PLoS 2011;7:e1001324. its. omponent of the nuclear lamina. Structure Structure lamina. nuclear of the omponent rminus, and oligomerization is unaffected is by andoligomerization rminus, s associated with nonalcoholic fatty liver liver fatty nonalcoholic associatedwith s min A tail are essential forcellular are A tail essential min an alpha-specific nuclear targeting domain. domain. targeting nuclear alpha-specific an ell Biol 2016;36:2168-2181. 2016;36:2168-2181. Biol ell ds to male-selective steatohepatitis. Cell Cell steatohepatitis. male-selective to ds 08-6315. 08-6315. 7-1079. 7-1079. l diversity of LAP2alpha and LAP2beta and LAP2alpha diversityof l rf2 Pathways Regulates Liver Regulates rf2Pathways , Gajewski A, et al. Lamina-associated al. A, et Gajewski , sard P, Prip-Buus C, et al. Novel al. Novel et C, Prip-Buus sardP, Martin H, Park M-J, et al. al. et M-J, H,Park Martin KimLJ , Palmer CD, et al. al. et CD, Palmer , t al. al. t et et

by a novel mutation with LMNB2 gene. J Pediatr Endo Pediatr LMNB2gene.J with mutation bya novel

43. Gao J, Li Y, Fu X, Luo X. A Chinese patient wit patient X.A Chinese LiLuo Y,Fu GaoX, J, 43. 2011;2:562-569. Nucleus cells? mammalian S LG, Fong Young C, Coffinier HJ, Jung YangSH, 42. 201 Cells Cardiomyopathy. andDilated Accumulation, Seve with Associated Mutation ZMPSTE24 Heterozygous I, Abdesselam C, B, Desgrouas D,Gaborit Galant 41. domain proteins. Curr Opin Cell Biol 2015;34:1-8. 2015;34:1-8. Biol Cell Opin Curr proteins. domain in Geyer Networking PK. AA, LJ, BartonSoshnev 49. 2016;568:557-580. Gene LaminM A/C by Caused of Cardiomyopathy Models Mitogen-Activate Targeting HJ. A,Worman Muchir 48. One 2016;11:e0155421. Death.PLoS Syndrome, Dil Sinus Sick with a Family in Modifiers andMu Mutation Splice-Site LMNA a Identifies Novel Mc K, F,Cung Oh E, L,FungJensen ZaragozaMV, 47. 2010;18:337-357. ImagingAm N Clin Reson f of liver CB. Quantification Sirlin ReederSB, 46. injur liver of porphyria-induced an early is sensor D Maitra NT, Snider R, Kwan NW, A,Griggs Singla 45. 1992;66:589-597. of livers B2 in B1 and of lamins Reduction lamina. H.Modula G,Hutter DenkH,Spurej ZatloukalK, 44.

Author Manuscript

This article isprotected by copyright. All rights reserved. Hepatology Hepatology y. J Cell Sci 2013;126:3105-3112. 2013;126:3105-3112. Sci Cell y.J griseofulvin-treated mice. Lab Invest LabInvest mice. griseofulvin-treated ated Cardiomyopathy, and Sudden Cardiac andSudden atedCardiomyopathy, at with magnetic resonance imaging. Magn Magn imaging. resonance magnetic with at 6;5. 6;5. crinol Metab 2012;25:375-377. 2012;25:375-377. Metab crinol ltigenic Heterozygosity of Potential ofPotential ltigenicHeterozygosity h acquired partial lipodystrophy caused caused lipodystrophy acquired h partial Bernard M, Levy N, et al. A al. et Levy N, Bernard M, tion of protein composition of nuclear of nuclear composition of protein tion re Metabolic Syndrome, Ectopic Fat Ectopic Syndrome, re Metabolic the nucleus: a spotlight on LEM- on a spotlight nucleus: the G. Are B-type lamins essential in all all in essential G.Are lamins B-type utations. Methods Enzymol Methods utations. d Protein Kinase Signaling in Mouse Mouse in Kinase Signaling Protein d Carthy LA, et al. Exome Sequencing Sequencing LA,Exome al. et Carthy , Ernst SA, et al. Lamin aggregation Lamin al. et SA, Ernst , Page 28of84 Page 29of84 proteins. Genes Dev 2015;29:2022-2036. 2015;29:2022-2036. Genes Dev proteins.

co-firstauthorship. designate bold in names Author lamina-associated polypeptide 2alpha (LAP2alpha) th (LAP2alpha) 2alpha polypeptide lamina-associated Prolife Foisner T, R. Dechat Kubben N, S, Vidak 50.

Author Manuscript

rough expression of extracellular matrix matrix of extracellular expression rough ration of progeria cells is enhanced by by enhanced is cells of progeria ration

M,bd asidx g,hmgoi. body BMI, index;mass Hgb, hemoglobin.

Table 1 Table . Characteristicsoftwin andsibling cohort (37 pa MRI Hgb A1c (S.D.) HgbA1c % Caucasian % Parameter % Hispanic % BMI (S.D.) BMI Age (S.D.)Age ALT (S.D.) ALT - % Male %

Author ManuscriptPDFF(S.D.)

(1 (0.7) (

7 7 ( 19 5.4 5.0

8 ) .6

21 ) )

)

Hepatology Hepatology )

irs, n=74 subjects).n=74 S.D., irs, standarddeviation; [withoutNAFLD] Controls (n = Controls(n 46.1 27.2 (5. 27.2 5.7 (0.4) 5.7 2. 2 1 6 6 1 51 3

(12 (20. (0.9) 5 2

) 4 6

)

< 0.0001 < P < 0.001 < 0.001 -value 0.0 0.27 0.3 0. 0. 07 26 1 0

Page 30of84 0 9 8 7 6 5 4 3 2 1 0 9 8 7 6 5 4 3 2 1 0 9 8 7 6 5 4 3 2 1 0 9 8 7 6 5 4 3 2 1 0 9 8 7 6 5 4 3 2 1 0 Page 31of84 ZMPSTE24 SREBF1 SREBF2 SREBF2 SREBF2 SREBF2 SREBF2 TMPO TMPO TMPO TMPO TMPO Gene

the Genomesfrom 1000 (referenceProject Ins,24). Table 2 Table Nucleotide Ins(24bp) change G > A > G A > G A > G C > G > C G C > G G > C C > T > C T > C T > C InsA . Confirmed coding variants. Minorallele frequency

> C >

Author Manuscript

S72Ins (in S72Ins

Conserved Conserved residue N/A N/A Yes Yes Yes Yes Yes Yes Yes No No No Hepatology Hepatology

insertion;fs, frameshift. Number of Number cases with variantwith (MAF) infar cited right iscolumn derived 1 16 1 1 1 0 0 1 2 1 6 0 1

Number of Number controls with variantwith 23 0 1 0 7 1 1 1 0 0 7 2

Not identified Not identified Not Minor alleleMinor frequency 0.001 0.001 0.007 0.011 0.030 0.002 0.001 0.06 0.41 0.06

NAFLD in a cohort of twin and sibling pairs. (A) (A) pairs. andsibling aof twin cohort NAFLD in immunoprecipitated, followed by visualization as in visualization by followed immunoprecipitated, LAP2αtruncat its or AandWT GFP-tagged lamin with myc to or the antibodies with afterimmunoblotting and p SDS-PAGE, resolvedon were Immunoprecipitates usi byimmunoprecipitation A,followed lamin tagged wild myc-tagged with co-transfected were cells Huh7 Figure 1. - HEP-17-0541.R2 FigureLegends Figure2 significance at a threshold of a at threshold significance Mann-Whitney mean. ofthe error standard represent insertion/deletion in resulting variants (includes andw without of individuals (assessedMRI-PDFF) by

variants with minor allele frequency < 0.06). frequency allele minor with variants a lamina- andwith without of individuals MRI-PDFF) coding variants with minor allele frequency < 0.06) frequency allele minor with codingvariants for shown bot are variants genetic and without with significance at a threshold of a at threshold significance ex Fisher’s andControls. cases for NAFLD are shown inser in a resulting variant andwithout with axis) . Variants of LAP2 found in NAFLD patients interfer NAFLDin found patients LAP2 Variantsof .

Author Manuscriptpredominantly genes were lamina-related Variantsin

This article isprotected by copyright. All rights reserved. P P <0.05. <0.05. <0.05. (B) <0.05. Left panel Left Hepatology Hepatology Right panel Right or change in a conserved residue). Error bars Error residue). aconserved change in or tion/deletion or change in a conserved residue residue aconserved or change in tion/deletion Left panel Left . . all (includes andControls cases NAFLDh GFP tag. (B) Huh7 cells were co-transfected co-transfected were cells Huh7 (B) GFPtag. panel A. Ig, immunoglobulin; M.W., M.W., Ig,A. immunoglobulin; panel : Scatter plot of liver fat content (assessed content by fat of liver Scatter plot : Right panel: Right U test was used to assess statistical statistical assess was to used Utest -type (WT) or variant LAP2αandGFP- or variant (WT) -type ng an antibody directed to the GFP tag. GFP tag. the to antibodyngdirected an related genetic variant (includes all coding coding all (includes geneticvariant related act test was used to assess statistical statistical assess was to used acttest ith a lamina-related genetic variant geneticvariant a lamina-related ith ed variant (LAP2 1-99). Lamin A was LaminA was 1-99). (LAP2 edvariant : Scatter plot of liver fat content content fat of liver Scatter plot : recipitated proteins were visualized were visualized recipitated proteins : Percentages of individuals ( individuals Percentages : of e with binding to lamin A. (A) A.(A) lamin to binding ewith found in individuals with with individuals in found Percentages of individuals ( individuals of Percentages y -axis) -axis) y - Page 32of84 Page 33of84 Figure3. recognized band anon-specific indicates Arrowhead IP, im kDa, kilodaltons; weight; apparentmolecular

and Methods for >10 high-power fields for each cond for each fields for >10 high-power andMethods (B)Lipid accumulation scale µm. bar, 20 condition; Repr andMethods. Materials as described in 493/593 Lipid antibody. using anti-FLAG immunofluorescence LAP2 transfected fixation, overnight. After medium acid o oleic µM 500 with treated then emptyvector, full-length DDK-tagged with transfected were cells Student’s Student’s Error ba experiments. three from independent fields LAP2). Data mislocalized with cells oftransfected or mislocaliz nucleus the to localized specifically sco were A panel as in transfected rows).Cells (B) (hig rows),µm fourth 20 and second, images: first, tag). DDK the recognizes (which antibody anti-FLAG LAP2and was visuali fixed, then were vector.Cells trunca LAP2α(F.L.) or full-length with transfected Figure4. The truncated variant of LAP2 is mislocalized in t in mislocalized LAP2is ofvariant truncated The Truncated LAP2 causes increased lipid accumulation causes lipid increased LAP2 Truncated

Author Manuscriptsignificanc statistical determine was to used test

This article isprotected by copyright. All rights reserved. Hepatology Hepatology ed throughout the cell (represented as percent as percent (represented cell the throughout ed red according to whether LAP2 was LAP2was whether to redaccording her magnification images: third and fifth andfifth third images: hermagnification ted LAP2 (1-99) with DDK tag, or empty DDKor empty tag, with LAP2(1-99) ted were derived from counting 9-12 high-power high-power 9-12 counting from derived were rs represent the standard error of the mean. the error of standard the rsrepresent munoprecipitation; IB, immunoblot. IB,immunoblot. munoprecipitation; r vehicle (isopropanol) in serum-free in rvehicle(isopropanol) was quantitated as described in Materials Materials in as described was quantitated (F.L.) LAP2α or truncated LAP2or (1-99) or truncated LAP2α (F.L.) zed by indirect immunofluorescence using using byimmunofluorescence zed indirect was visualized by indirect byindirect wasvisualized by the myc antibody. antibody. by myc the esentative images are shown for eachfor shown are images esentative ition, and the data shown are representative representative are data andshown the ition, Scale bar: 50 µm (lower magnification (lower magnification µm 50 Scale bar: droplets were stained with BODIPY with stained were droplets e at a threshold of a at threshold e ransfected cells. (A) Huh7 cells were were (A) cells Huh7 cells. ransfected in transfected cells. (A) Huh7 Huh7 (A) cells. transfected in P <0.05. <0.05.

p62/SQSTM1. (A) Huh7 cells were transfected with GF with transfected (A) were cells Huh7 p62/SQSTM1. of 3 independent experiments. Error bars represent represent Error bars experiments. independent of3

Figure6 antibodyhe indicate Arrowheads immunoprecipitates. molecu apparent B. M.W., panel in shown samples the were proteins andGFP-tagged GFP Immunoprecipitated was visual p62/SQSTM1 GFPantibody. Co-precipitated by followed LAP2(1-99), LAP2α,or truncated tagged Huh(B) bystaining. silver lysatesvisualized were The i as controls. included A were GFP-taggedlamin ananti- using immunoprecipitation by followed 99), was used to determine statistical significance at a at significance statistical determine wasto used fields/condition/experiment, >85 total nuclei/condi >85 total fields/condition/experiment, indepen three from fashion a were blinded in scored fu inwith transfected cells distribution A/C lamin Scal arrows. by highlighted are (punctate/globular) with cells of transfected nuclei areimagesshown; respective antibodies, A/C andanti-lamin anti-FLAG visu were A/C LAP2lamin andendogenous transfected LAP2 (F.L.) full-length DDK-tagged with transfected Figure5. . Truncated LAP2 causes altered lamin A/C distribut A/C lamin causes altered LAP2 Truncated .

Author Manuscriptcytoplasmic int unique multiple has LAP2 Truncated

This article isprotected by copyright. All rights reserved. Hepatology Hepatology threshold of threshold ll-length LAP2α or truncated LAP2 (1-99) truncated LAP2αor ll-length 7 cells were transfected with GFP GFP- alone, with transfected were cells 7 abnormal lamin A/C staining staining A/C lamin abnormal tion). Error bars represent standard error of standard error represent Error barstion). e bar, 20 µm. (B) Nuclear morphology and morphology (B) Nuclear e µm. bar, 20 standard error of the mean. Student’s Student’s mean. of the standard error dent experiments (3-6 experiments dent GFP antibody; empty vector (GFP only) and only) (GFP emptyvector GFP antibody; ly. Representative high-magnification high-magnification ly.Representative mmunoprecipitates and the input cell cell input the and mmunoprecipitates α or truncated LAP2 (1-99). After fixation, fixation, (1-99). After LAP2 αor truncated avy (~50 kDa) and light (~25 kDa) chains. chains. kDa) (~25 andlight avykDa) (~50 immunoprecipitation of LAP2using anti- of immunoprecipitation lar weight; kDa, kilodaltons; IP, kilodaltons; kDa, larweight; alized by immunofluorescence using using byimmunofluorescence alized P-tagged LAP2α or truncated LAP2(1- truncated or LAP2α P-tagged ized by immunoblotting. (C) byized immunoblotting. visualized by Coomassie staining for staining Coomassie by visualized ion. (A) were cells Huh7 ion. P eraction partners, including including partners, eraction <0.05. <0.05. t test test Page 34of84 Page 35of84 p62/SQSTM1), altered lamin A/C distribution, chroma distribution, A/C altered lamin p62/SQSTM1), i ectopic protein-protein via NAFLD to predisposing Student’s mean. the Schematic of alterations predicted to occur due to dueto occur predictedto of alterations Schematic accumulation in hepatocytes. ONM, outer nuclear mem nuclear outer ONM, hepatocytes. in accumulation

Author Manuscript

t test was used to determine statistical significanc statistical determine was to used test This article isprotected by copyright. All rights reserved. Hepatology Hepatology expression of LAP2thereby of 1-99, expression nteractions (e.g., LAP2 1-99 with with 1-99 LAP2 (e.g., nteractions tin reorganization, and increased lipid lipid increased and reorganization, tin brane; INM, inner nuclear membrane. nuclearmembrane. INM, brane;inner e; ***, ***, e; P <0.001. (C) <0.001.

Author Manuscript

Page 36of84 Page 37of84

Author Manuscript

Page 38of84 Page 39of84

Author Manuscript

Page 40of84 Page 41of84

Author Manuscript

60 59 58 57 56 55 54 53 52 51 50 49 48 47 46 45 44 43 42 41 40 39 38 37 36 35 34 33 32

Author Manuscript

This article isprotected by copyright. All rights reserved. Hepatology Hepatology Page 44of84 Page 45of84 threshold of NAFLD casesandControls.Fisher’sexacttestwas usedtoasses coding variantswithminor a twins (31pairs,n=62subjects)w without avariantresu Fig. S3. and withoutgeneticvariantsares predominantly foundintwinswithNAFLD.(A) variants resultingi (assessed byMRI-PDFF)oftwins variants withminor all standard errorofthemean; Mann- threshold of Among twinpairsonly(31pairs,n= P P <0.05. (B)

Author Manuscript<0.05.

n insertion/deletionorchangeinaconserv lting ininsertion/deletionorchange ele frequency<0.06). Left panel This article isprotected by copyright. All rights reserved. llele frequency<0.06). ithout andwithalamina-relat hown forNAFLDcasesandCont withoutandwithalamina-relat Whitney Utestwasusedtoass : Scatter plotofliverfatcon Hepatology Hepatology 62 subjects),variantsinla Right panel: Left panel Right panel Percentagesoftwins( : Percentages oftwins( a conservedresidueareshownfor ed residue).Error ed geneticvariant(includesall tent (assessedbyMRI-PDFF)of : Scatterplotofliverfatcontent s statisticalsignificance ata ess statistical significance at a ed geneticvariant(includes rols (includesallcoding mina-related genes were barsrepresent y -axis) withand y -axis) with

Author Manuscript

This article isprotected by copyright. All rights reserved. Hepatology Hepatology Page 46of84 Page 47of84 MRI-PDFF) ofmonozygotic twinsw significance atathresholdof bars representstandarderrorof variants withminor allelefre significance atathresholdof standard errorofthemean; Mann- variant (includesallcodingvari related geneticvariant(include of liverfatconten variant(s) areshownforbothNAF threshold of subjects). were predominantly foundintwi Controls (n=17)(includesallc test wasusedtoassessstatisti of twins( Fig. S4. Among bothmonozygotic (A)anddizygo y Left panel -axis) withandwithoutgeneticv P

Author Manuscript<0.05. (B)Dizygotictwinpairs

t (assessedbyMRI-PDFF) : Percentagesofmonozygotictwins(

This article isprotected by copyright. All rights reserved. P quency <0.06).Fisher’sexactte P cal significance at thresholda oding variantswit <0.05. <0.05. s allcodingvariantswithmino themean; Mann-WhitneyUtest ants withminor allelefrequen ns withNAFLD.(A)Monozygotict Whitney Utestwasusedtoass LD cases(n=12)andControls( ithout (n=16)andwith(n=24)a

Right panel: Hepatology Hepatology ariant(s) areshown forbothN oftwinswithout(n (11 pairs,n=22subjects). h minor allele Scatterplotofliverf tic twins(B),variantsin y -axis) withandwithoutgenetic of st wasusedtoassessstatistical cy <0.06).Errorbarsrepresent r allelefrequency<0.06).Error P frequency<0.06).Fisher’sexact <0.05. =14) andwith(n=8)alamina- was usedtoassessstatistical ess statistical significance at a n=28) (includesallcoding lamina-related genetic win pairs(20pairs,n=40 Right panel: at content(assessedby Left panel AFLD cases(n=5)and lamina-related genes : Percentages Scatterplot

60 59 58 57 56 Author Manuscript This article isprotected by copyright. All rights reserved. Hepatology Hepatology Page 48of84 Page 49of84 ( (includes allcodingvariantswit assess statisticalsigni residue areshownforNAFLDcas and withoutgeneticvariant(s)a predominantly foundinindividualsw subjects notpartofatwin/sibl Fig. S5. y -axis) with and withoutavarian

Author ManuscriptAmong allsubjects(n=98),incl ficance atathresholdof This article isprotected by copyright. All rights reserved. ing pair(n=24),variantsinla re shownforbothNAFLDcases( h minor allelefrequency<0.0 t resulting in insertion/deleti es (n=36)andcontrols(n=62).F ith NAFLD.(A)Percentages uding bothtwin/si Hepatology Hepatology P <0.05. bling pairs(n mina-related genes were on orchangeinaconserved 6). (B)Percentagesofindividuals n=36) andcontrols(n=62) isher’s exacttestwas usedto of individuals( =74) andadditional y -axis) with

60 59 Author Manuscript This article isprotected by copyright. All rights reserved. Hepatology Hepatology Page 50of84 Page 51of84 Significant fibrosis: Percentagesofindividuals( shown forbothCases(NAFLDw Fig. S6 < 3.66kPa;F2).(B)Advancedfib assess statisticalsigni controls (NAFLD withMRE<4.11kPa;F3). For eachgroup,Fi MRE data);n=33totalsubjects. subjects withNAFLDwhowerenotp siblings withNAFLD(n=20twins/siblingsandMREdat without geneticvariant(s)are

ith MRE>3.66kPa;F≥2)andCon ong studyparticipantswithNAFLDa rosis/cirrhosis: Percentage art ofatwin/siblingpair(n Hepatology Hepatology P <0.05. Notethatthisanalys y -axis) withandwithoutgen s ofindividuals( =13 subjectswithNAFLDand MRE>4.11kPa;F≥3)and sher’s exacttestwasusedto trols (NAFLDwithMRE a) aswelladditional nd hepaticfibrosis.(A) is includestwinsand etic variant(s)are y -axis) withand

Author Manuscript

This article isprotected by copyright. All rights reserved. Hepatology Hepatology Page 52of84 Page 53of84 Fig. S7. error ofthemean; Mann-Whitney U (A) Alltwinandsiblingpair of GG genotypewithoutandwithalam a lamina-related geneticvariant. with analyses duetothesmall number content (assessedbyMRI-PD Scatter plotofliverfatcont genetic variant.Errorbarsrep PDFF) ofthe34subjectswith subjects). to assessstatisticalsi P <0.05. Notethatsubjectswith PNPLA3 Presence or absence oflamina-related genetic variantsstratifi

Left panel

Author Manuscript CCgenotypewithoutandwithalam

: Scatterplotofliverfatcont gnificance atathresholdof This article isprotected by copyright. All rights reserved. ent (assessedbyMRI-PDFF)ofthe s (37pairs,n=74subjects). FF) ofthe40subjectswith resent standarderrorofthemea PNPLA3 Right panel ofGGhomozygotes PNPLA3 testwasusedtoassessstati ina-related geneticvariant. CGorGGgenotypewithouta Hepatology Hepatology CGandGGgenotypesweregroupedfor these : Scatterplotofliverf P ent (assessedbyMRI-PDFF)oft <0.05. (B)Twinpairsonly(31pairs,n=62 ina-related geneticvariant. (n=12)inth

Left panel PNPLA3 n; Mann-Whitney Utestwasused 31twinswith stical significance at thresholda Error barsrepresentstandard CC genotype withoutandwith CCgenotype : Scatterplotofliverfat at content(assessedbyMRI- e cohort. ed by nd withalamina-related PNPLA3 PNPLA3

Right panel he 31twins genotype. CGor :

60 59 58 57 56 55 54 53 52 51 50 49 48 47 46 45 44 43 42 41 40 39 38 37 36 35 34 33 32 31 30 29 28

Author Manuscript

highlights anon-specificbandr high molecular weight;M.W., apparentmolecular weight; kDa,ki denaturing SDS-PAGE (non-reducin Fig. S9. The Triton-insoluble(pellet)f Transfected LAP2 wasvisuali the indicatedvariant.Two daysa under non-reducingconditions. (A) Huh7 cells were transfected fraction wasresolvedondenaturi

Author Manuscript Full-length,butnottruncated,L

This article isprotected by copyright. All rights reserved. raction ofHuh7cells,transfect zed by immunoblotting with antibody ecognized bythemyc antibody. fter transfection,cellswere ng SDS-PAGEundernon-reducing g andreducing)analyzedby AP2α forms asolublehigh-mol Hepatology Hepatology ed asinpanelA,wasresolvedusing harvested andtheTriton-soluble with wild-type(WT) LAP2αor lodaltons. Arrowhead directedtothemyc tag.(B) or reducing conditions. immunoblotting. H.M.W., ecular weightspecies Page 56of84 60 59 58 Page 57of84

Author Manuscript

Error barsrepresentstandar mean. Student’s significance; **, arrows. Scalebar,20µm.Rightpa nuclei oftransfectedcellswit LAP2 andendogenouslamin B1were DDK-tagged full-length(F.L.)LA visualized by immunofluorescence visualized byimmunofluorescence Representative high-magnificati quantitation (>40nucleiscore lamin staining(punctate/globula Fig. S10. anti-lamin B1antibodies,respec DDK tagasinpanelA.Afterfix

Author ManuscriptTruncated LAP2 altersB-typelam

t P testwasusedtodetermine <0.01. (B)Cellswere transfecte

This article isprotected by copyright. All rights reserved. d errorofthemean. Student’s h abnormal laminstaining(punct d foreachcondition).Errorbars on images areshown;nucleioft tively. Representativehigh-mag r) areindicatedbyarrows.Sca ation, transfected LAP2 and end ation, transfectedLAP2and P2α ortruncatedLAP2(1-99).A nel showsquan using anti-FLAG andanti-lamin visualizedbyimmunofluoresce Hepatology Hepatology in distribution.(A)Huh7cells statistical significance;*, titation (>40n d withfull-lengthortruncated t testwasusedtodetermine statistical representstandarderrorofthe ate/globular) areindicatedby le bar,20µm.Rightpanelshows nification images are shown; uclei scored foreach condition). ransfected cellswithabnormal ogenous lamin B2 were ogenous lamin B2were fter fixation,transfected B2antibodies,respectively. nce usinganti-FLAG and P <0.05. weretransfected with LAP2αwith Page 58of84 60 59 58 57 Page 59of84 Table S1. ZMPSTE24‐L438F‐FWD ZMPSTE24‐L438F‐REV SREBF2‐R1080Q‐FWD SREBF1‐V610M‐FWD SREBF2‐R1080Q‐REV SREBF2‐G595A‐FWD SREBF2‐S72ins‐FWD SREBF2‐R371K‐FWD SREBF1‐V610M‐REV SREBF2‐R860S‐FWD SREBF2‐G595A‐REV SREBF2‐S72ins‐REV SREBF2‐R371K‐REV TMPO‐Q599E‐FWD SREBF2‐R860S‐REV TMPO‐R690C‐FWD TMPO‐R274K‐FWD BANF1‐G21E‐FWD TMPO‐Q599E‐REV TMPO‐R690C‐REV TMPO‐R274K‐REV TMPO‐T99fs‐FWD BANF1‐G21E‐REV TMPO‐T99fs‐REV rmrNm Vrat Sequence (5’ Variant Primer Name Author Primers used for PCR amplification of genomic DNA and Sanger s Manuscript

TMPO TMPO

ZMPSTE24 ZMPSTE24 SREBF2 SREBF2 SREBF1 SREBF1 R274K; R274K; SREBF2 SREBF2 SREBF2 SREBF2 SREBF2 SREBF2 SREBF2 SREBF2 TMPO TMPO TMPO TMPO BANF1 BANF1 TMPO TMPO This article is protected by copyright. All rights reserved. R00 CCACTCTCAGCGGGAAGAT R1080Q R00 CTTTTCCGTGGATTGGGTGG R1080Q Q9E AATCCTTCAGCCAGAGGTATCG Q599E Q9E TGGCATGCAAATATCCAGTTTC Q599E R9C ATTGTTTGTACCAGGCTTCCT R690C R9C CGCTTGGGATTCTGAGCAAA R690C V1M GAACTTGGGG V610M V1M GGGACAGATTCATGGTGTGCACAGG V610M G9A GGAAATACCTCAGAATGTCAGCAGGG G595A G9A GCTGGTCTTAGCTTCGTCTTCAAAGC G595A T9s AGTTACTTGCTTGGCTGTGC T99fs T9s GTCCTTGGAACCTAAACTGCT T99fs S2n GAAAGAGGTAAGGGTTTCCTGACCC S72ins S2n CTTGACTTGCAGAGTTGGAGCCTGTG S72ins R7K CCACCTCATTGTCCACCAGA R371K R7K TAACTTCTCCCGAGTGGCAC R371K R6S GGTCTTAGAGCTGGAGAGCTGAACAG R860S R6S GAACTGGAGCCACAGGTATGAACCTG R860S G1 GGGAAGAGTCTCCCTGGAAC G21E G1 TGCCATTCAGAGCACACAAG G21E TMPO TMPO L3F CATGCTGCCAGGACAGAAAT L438F L3F TTTCTGGCCTGTTTGCTTGG L438F T1S CCAGTGGGGGCATAGAGTTA T317S T1S TCTTGTTGCCACAAACTTGC T317S Hepatology Hepatology equencing. CTCTGGATTTCCTGG  3’) 60 59 58 57 Table S2. nioytre Mnfcue Ctlgcoenme Dilution Catalog/clone number Manufacturer Antibody target LG/DKtg Sigma‐Aldrich FLAG / DDK tag 6/QT1 ba a976 1:2000 (IB) ab96706 Abcam p62/SQSTM1 ai / Santa Cruz Biotechno Lamin A/C ai 1 ba a108 1:250 (IF) ab16048 12255 Cell Signaling Abcam Lamin B2 Lamin B1 y a Acm b16 1:1000 (IB) ab9106 Abcam Myc tag F Oiee TA150041 (clone 2H8) Origene GFP

Author Manuscript Antibodies used for immunofluorescence (IF), immunoprecipitati

10 coeM) 1:250 (IF) F1804 (clone M2) oy c261(‐1) 1:250 (IF) sc‐20681 (H‐110) logy This article is protected by copyright. All rights reserved. coeDPU 1:250 (IF) (clone D8P3U) Hepatology Hepatology on (IP), and immunoblotting (IB). 1:2000 (IB); 1.5 µg per 500 µL lysate (IP) Page 60of84 60 59 58 57 Page 61of84

Table S3 ZMPSTE24 SREBF2 SREBF1 LMNB2 BANF1 TMPO LMNA ee rti Associated disease(s) Protein Gene FNTA FNTB ICMT Author. Candidate ge Manuscript ai‐rcsigezm Mandibuloacral dysplasia, lipodystrophy Lamin‐processing enzyme ai‐rcsigezm None known Lamin‐processing enzyme ai‐rcsigezm None known Lamin‐processing enzyme ai‐rcsigezm None known Lamin‐processing enzyme nes sequenced. ai idn ate Atypical progeria (14) Lamin binding partner ai idn ate Dilated cardiomyopathy (13) Lamin binding partner

Transcription fa Transcription fa

A‐type lamin ‐yelmn Lipodystrophy (10) B‐type lamin

tr None known None known ctor ctor This article is protected by copyright. All rights reserved. Dilated cardiomyopathy, prog Marie‐Tooth disease, muscular dystrophy (1‐9) Hepatology Hepatology dermopathy (11, 12) eria, lipodystrophy, Charcot‐ , restrictive 60 59 58 57

Table S4.

Author Manuscript LAP2 interacting proteins as de

W1 4 N N N C 17 8. 2 Nn 2 9 8 . 79 1.8 8 92 26 None 33 100.6 28 1.74 83.9 1.73 CG CG No No No No Yes 41 No M TW02 41 M TW01 TWIN ID Table S5 HOMA‐IR, homeostatic model of in e Age Sex . Clinical and laboratory data for monozygotic twins TW01 and T

Author Manuscript(yrs)

ides. Height (m) Hepatology Hepatology W02 carrying insertion in Weight (kg) BMI (kg/ m 2 ) per week) than once Rare (less Alcohol use TMPO (IU/L) . U, units; IU, international units; ALT 6 0 4 . 172 3.1 14 90 26 (mg/dL) Glucose (µU/mL) Insulin HOMA‐ IR (mg/dL) TG 60 59 58 57 Unit includingdetailedmedical hi chronic liverdisease,fastinglab questionnaire andSkinnerLife including vitalsigns,height,wei visits andMRIproceduresforeac Study participantrecruitment andclinicaldata acquisition. Supplementary Methods underwent astandardizedclinical dividing bodyweightbythesquareo including completebloodcount,l glutamyltransferase, albumin, pr was quantified byMRelastography-determined stiffness(MRE-sti MR3T ResearchLaboratory. Liverf including serum ferritin),clini examinations wereperformed usi (total bilirubin,direct Author Manuscript

cal chemistry (creatinine,tota time Drinkinghistorywereadmini aspartate aminotransferase, oratory tests(seebelow),an othrombin time, andinternation ght, andanthropometric measu ng a3Tresearchscanner (GESig researchvisitattheUnivers iver diseasescreeningtests( h relatedpair were performed story, assessmentofalcohol at wasmeasured viaMRI-determ f theheight(kilogram/mete This article is protected by copyright. All rights reserved. alanineaminotransferase [ALT], alkalinephosphatase, l protein,bloodureanitrogen, uric d magnetic resonanceimaging (MR Allparticipants( Hepatology Hepatology ity ofCaliforniaSanDiego(UCSD hepatitis Bsurfaceantigen,Cantibody, andironpan consumption, physical examination, testingtoexcludeothercau rements wasperformed. Bodymass on thesame day.TheAlcoholUseD al normalized ratio),lipidprof rs stered torecordandquantifya 2 ffness) asdescribed (15).NAFLD na EXCITEHDxt;GEHealthcare, Waukesha, WI) atthe UCSD ). Fastinglaboratorystudieswer ined proton-densityfat-fractio recruited betweenJa acid),hemoglobin A1c,hep ile, andglucose/insulinlevels lcohol use.Aphysicalexaminati I) examination ofthe liver.Re ) NAFLDTranslationalResearch nuary 2012andJanuary2 index(BMI)wascalculatedby e obtainedforallparticipant n (MRI-PDFF),andliver fibrosis was defined asMRI-PDFF≥5% wasdefined isorders IdentificationTest  - atic panel el . MRI 015) search ses of s on

Page 64of84 60 59 58 57 Page 65of84 without apparentsecondarycause Next-generation DNAsequencing of liverdisease. were thentrimmedusingTrimmom amplification oftarget regions w data and dbNSFP v2.0 functiona data anddbNSFPv2.0 removed. Variantswere annotatedbasedonRefSeqv.69genemode Aligner ‘mem’ algorithmv0.7.8. Var with defaultparameters, -str reporting wereperformed usi Author Manuscript

and_emit_conf 10and-strand_call_ ng VarSeqv.1.1.0(GoldenHelix,Bo l annotations(16,17). ith acustom Illumina TruSeq a ofhepaticsteatosissuchass andvariantidentification: atic v0.32andalignedtohuman iants weredetectedusingth This article is protected by copyright. All rights reserved. Hepatology Hepatology Next-generationsequencedata ignificant alcoholuse,useofste mplicon paneland analysisviaIllumina MiSeqinstrument. Seque conf 30, DISCOVERY mode. Var e BroadInstituteGenome Anal zeman, MT).Variantswithfewer ls, andmatched with1000Genomes Phase3populationfrequency reference genome buildGrc37/ wasobtainedfrom DNAby genomic atogenic medication(s), orot ysis Toolkitv.3.3-0HaplotypeCal iant filtering, annotation and hg19 usingtheBurrows-Wheeler than5alternateobservationsw her cause nces ler ere

60 59 58 57 novel syndrome ofarthropathy,t . TaylorMR,FainPR,SinagraG,RobinsonML,Robertson AD, Ca 4. . Hatch E, HetzerM.Breachingthe 3. DavidsonPM,LammerdingJ.Bro 2. Clin Invest2009;119:1825-1836. 7. Bonne G, Di Barletta MR, Var Bonne G, Di 7. lipodystrophies. Semin CellDev Biol2014;29:148-157. GuenantinAC,BriandN, Bidau 6. the lamin A/Cgeneas causesof . Fatkin D,MacRae C, SasakiT 8. encoding lamin A/Ccauseautosomal dominant Emery-Dreifuss musc 5. cardiomyopathy duetolamin mutations. A/Cgene JAm Coll Cardi Worman HJ, FongLG,MuchirA,YoungSG.Laminopathies andth 1. Supplementary References

Author ManuscriptVan EschH,Agarwal AK dilatedcardiomyopathy andcond endinous calcinosis,andproger , DebeerP,FrynsJP,GargA.Ah , Wolff MR,Porcu M,FrenneauxM nous S,BecaneHM,Hammouda EH, lt G,AfonsoP,Bereziat V, Vat This article is protected by copyright. All rights reserved. nuclearenvelo ken nuclei--lamins, nuclearme pe indevelop Hepatology Hepatology oid features.JClinEndocri uction-system disease. NEnglJMed1999;341:1715-1724. ol 2003;41:771-780. omozygous mutation inthelami ular dystrophy.NatGenet 1999;21:285-288. ment anddisease.JCellBiol2014;205:133-141. ier C,Lascols O,etal.Nuclearenvelope-related chanics, anddisease.TrendsCellBiol2014;24:247-256. rniel E, DiLenardaA,etal , AthertonJ,etal.Missense e longstrangetripfrom basi Merlini L,MuntoniF,et al.Mutationsinthegene nol Metab2006;91:517-521. n A/Cgeneassociatedwitha . Naturalhistoryofdilated mutations in the rod domain of mutations intheroddomain c cellbiologytotherapy.J Page 66of84 60 59 58 57 Page 67of84 lipodystrophy: lessonsfrom a tr 0 HegeleRA,CaoH,LiuDM,Cos 10. LMNB2 generevealsnovelmutatio 1 AgarwalAK,FrynsJP,AuchusRJ,GargA.Zincmetalloprotei 11. AjluniN,MeralR,NeidertAH 9. 3 TaylorMR,SlavovD,GajewskiA,VlcekS,KuL,FainPR,Ca 13. Hum Mol Genet 2004;13:2493-2503. functional analysisidentifies 5 Loomba R,SchorkN,ChenCH,B 15. ZMPSTE24 (FACE-1)defectscause 4 PuenteXS, Quesada V,OsorioF 14. gene mutation associated withdi reference for human geneticvar 2 NavarroCL,DeSandre-Giova 12. Hum Mol Genet 2003;12:1995-2001. 6 1000Genomes ProjectConsortium (Auton A,BrooksLD,Durbin 16. Based onaProspectiveTwin S Author Manuscript

BANF1 mutation asthecauseofa

tudy. Gastroenterology2015;149:17 ial cohort.ClinEndocrinol (Ox iation. Nature 2015;526:68-74. lated cardiomyopathy. Hum Mutat ns inpatientswithacquiredpa nuclear disorganizationandide nnoli A, BernardR,BoccaccioI, , BradyGF,BurasE,McKennaB, This article is protected by copyright. All rights reserved. G, CabanillasR,Cadinanos J, tain GA,Charlton-MenysV,Rod ettencourt R,BhattA,Ang B, Hepatology Hepatology f) 2017;86:698-707. hereditaryprogeroidsyndrome. rtial lipodystrophy.Am J 2005;26:566-574. 84-1793. ntify restrictivedermopathy as FraileJM,OrdonezGR, et nase, ZMPSTE24,ismutatedi BoyerA,GenevieveD,Hadj-RabiaS,etal.Lamin Aand rniel E,etal.Thymopoietin (la NguyenP,etal.Herita DiPaolaF,etal.Spectrum ofd RM,Garrison EP, KangHM,K ger NW, DurringtonPN.Se HumGenet2006;79:383-389. bility ofHepaticFib Am J HumGenet2011;88:650-656. al. Exome sequencingand a lethalneonatallaminopathy. n mandibuloacral dysplasia. quencing ofthereannotated mina-associated polypeptide2) isease associated withpartial orbel JO,et al.). Aglobal rosis andSteatosi

s 60 59 58 57 7 LiuX,JianBoerwinkle 17. annotations. Hum Mutat 2013;34:E2393-2402.

Author Manuscript E. dbNSFPv2.0:adatabaseofhum This article is protected by copyright. All rights reserved. Hepatology Hepatology an non-synonymous SNVsandtheir functionalpredictionsand Page 68of84 Page 69of84 Q96CS3 P42704 197clei O=oospes 001 18 11 P10909-2 P08195-4 30.0 P40939 P17812 calmegin[OS=Homosapiens] Q8N163-1 O14967 P14866 P07237 P02675 Q9H936 Q14697-1 Q9Y4L1 O95864 Q9Y512 P41250 Q99848 O60762 Q9Y285 Q86TG7-1 P54136-1 O94973-2 Q13200 Q6P2E9-1 Q7Z6Z7 Q09666-1 Q9BQG0-2 P04114 Q92616 Q86VP6-1 Q92614-1 Q8NBJ5 P55157 P05023 O94832 P27708 Q9NVH1-1 O15027-5 P27824-2 P00367 Q13501-1 Accession Dolichol-phosphate mannosyltransferase subunit1[OS=Homosapiens] Phenylalanine--tRNA ligasealphasubunit[OS=Homo sapiens] Retrotransposon-derived proteinPEG10[OS=Homo sapiens] arginine--tRNA ligase,cytoplasmic[OS=Homosapiens] Isoform 2ofAP-2complexsubunitalpha-2[OS=Homo sapiens] 26S proteasomenon-ATPaseregulatorysubunit 2[OS=Homosapiens] FAS-associated factor2[OS=Homosapiens] Leucine-rich PPRmotif-containingprotein,mitochondrial [OS=Homosapiens] Enhancer ofmRNA-decappingprotein4[OS=Homo sapiens] E3 ubiquitin-proteinligaseHUWE1[OS=Homosapiens] Neuroblast differentiation-associatedproteinAHNAK[OS=Homosapiens] Isoform 2ofMyb-bindingprotein1A[OS=Homosapiens] apolipoprotein B-100[OS=Homosapiens] eIF-2-alpha kinaseactivatorGCN1[OS=Homosapiens] cullin-associated nedd8-dissociatedprotein1[OS=Homosapiens] Unconventional myosin-XVIIIa[OS=Homosapiens] Procollagen galactosyltransferase1[OS=Homosapiens] microsomal triglyceridetransferproteinlargesubunit[OS=Homosapiens] Sodium/potassium-transporting ATPasesubunitalpha-1[OS=Homosapiens] Unconventional myosin-Id[OS=Homosapiens] CAD protein[OS=Homosapiens] DnaJ homologsubfamilyCmember11[OS=Homosapiens] Isoform 5ofProteintransportproteinSec16A[OS=Homosapiens] Isoform 2ofCalnexin[OS=Homosapiens] Glutamate dehydrogenase1,mitochondrial[OS=Homosapiens] Isoform 2ofClusterin[OS=Homosapiens] Isoform 4of4F2cell-surfaceantigenheavychain[OS=Homosapiens] Trifunctional enzymesubunitalpha,mitochondrial[OS=Homosapiens] CTP synthase1[OS=Homosapiens] Cell cycleandapoptosisregulatorprotein2[OS=Homosapiens] Heterogeneous nuclearribonucleoproteinL[OS=Homosapiens] Protein disulfide-isomerase[OS=Homosapiens] Fibrinogen betachain[OS=Homosapiens] Mitochondrial glutamatecarrier1[OS=Homosapiens] Neutral alpha-glucosidaseAB[OS=Homosapiens] Hypoxia up-regulatedprotein1[OS=Homosapiens] sequestosome-1 [OS=Homosapiens] Description with LAP21-99. ratio ofpeptide-specificspectrawithtruncatedLAP2(1-99)tofull-length peptide-specific spectra,andproteinswithfewerthan15spectra(witheitherfull-lengthLAP2 toLC-MS/MSanalysisafterin-solutiontrypsindigestionasdescribedinMaterialandMethods.LAP2-associatedproteinsidentifiedbymassspectometrywerefilterednumberof Supplementary Table4

fatty aciddesaturase2[OS=Homo sapiens] sorting andassemblymachinery component50homolog[OS=Homosapiens] Glycine--tRNA ligase[OS=Homo sapiens] AuthorProbable rRNA-processing proteinEBP2[OS=Homosapiens] Manuscript

This article isprotected by copyright. All rights reserved. . LAP2-interactingproteins.GFP-taggedLAP2 % Coverage Hepatology Hepatology 481 23 34 23 34 31 12 30 12 26 18 11 15 61 24.8 82 25.0 14 39 27.4 14 28.4 12 9 34.3 25 37.6 34 38.3 13 39.3 39.4 46.3 63.9 00722 18 29 42 19 41 7 34 8 57 14 42 11 36 8 20.0 30 22.2 15 25.0 12 36.6 22 44 43.8 16 30 41.9 16 26 30.4 12 83 41.5 45 21.7 21 24.3 29 50 46.3 16 12 10 19 48 22 10.3 26 40 11.3 12 78 12.1 15 24 9 13.5 63 14.2 11 25 14.4 12 17 15.4 19 15 15.6 33 9 16.2 16.5 29 16.9 11 20.7 10 9 20.8 20.9 21.7 22.4 23.0 . 17 19 9 9 7.7 9.9 # Peptides # Peptidespectrummatches α (full-length), truncatedLAP2(1-99),orGFPalonewasimmunoprecipitatedfromHuh7cellsandsubmitted

Q9UBS4 P31689-1 Q05682-3 P46777 P50454 P07814 P41252 P49368-1 Q96PK6-1 P51812 Q15392 P28331-2 O95573 O60701 P35998 P47897 Q13813-2 O95433 P56192 Q02978 423Mti- O=oospes 851 55 P33992 Q9NYL9 O15143 Q9Y3I0 P59998-3 18 P55072 Q9Y608 P53621-1 O75874 28.5 P14868 O00159-1 Matrin-3[OS=Homosapiens] Q8WWM7-1 O75746 P43243 Q13148-1 P17987 Q9NVI7-2 O95782 P63010-2 Q16891-2 P32969 P16615 P06576 P78371-1 P78527 P16989-1 Q9UM54-6 Q06210-1 Q9UBX3-2 Isoform 3ofActin-related protein2/3complexsubunit4[OS=Homosapiens] Transitional endoplasmicreticulumATPase[OS=Homo sapiens] Leucine-rich repeatflightless-interactingprotein 2 [OS=Homosapiens] coatomer subunitalpha[OS=Homosapiens] Isocitrate dehydrogenase[NADP]cytoplasmic[OS=Homo sapiens] Aspartate--tRNA ligase,cytoplasmic[OS=Homo sapiens] Unconventional myosin-Ic[OS=Homosapiens] ataxin-2-like protein[OS=Homosapiens] Calcium-binding mitochondrialcarrierproteinAralar1 [OS=Homosapiens] TAR DNA-bindingprotein43[OS=Homosapiens] T-complex protein1subunitalpha[OS=Homosapiens] Isoform 2ofATPasefamilyAAAdomain-containingprotein3A[OS=Homosapiens] AP-2 complexsubunitalpha-1[OS=Homosapiens] Isoform 2ofAP-2complexsubunitbeta[OS=Homosapiens] Isoform 2ofMICOScomplexsubunitMIC60[OS=Homosapiens] 60S ribosomalproteinL9[OS=Homosapiens] Sarcoplasmic/endoplasmic reticulumcalciumATPase2[OS=Homosapiens] ATP synthasesubunitbeta,mitochondrial[OS=Homosapiens] T-complex protein1subunitbeta[OS=Homosapiens] DNA-dependent proteinkinasecatalyticsubunit[OS=Homosapiens] Y-box-binding protein3[OS=Homosapiens] Isoform 6ofUnconventionalmyosin-VI[OS=Homosapiens] glutamine--fructose-6-phosphate aminotransferase[isomerizing]1[OS=Homosapiens] DnaJ homologsubfamilyBmember11[OS=Homosapiens] DnaJ homologsubfamilyAmember1[OS=Homosapiens] Isoform 3ofCaldesmon[OS=Homosapiens] 60S ribosomalproteinL5[OS=Homosapiens] Serpin H1[OS=Homosapiens] Bifunctional glutamate/proline--tRNAligase[OS=Homosapiens] isoleucine--tRNA ligase,cytoplasmic[OS=Homosapiens] T-complex protein1subunitgamma[OS=Homosapiens] RNA-binding protein14[OS=Homosapiens] Ribosomal proteinS6kinasealpha-3[OS=Homosapiens] Delta(24)-sterol reductase[OS=Homosapiens] Isoform 2ofNADH-ubiquinoneoxidoreductase75kDasubunit,mitochondrial[OS=Homosapiens] long-chain-fatty-acid--CoA ligase3[OS=Homosapiens] UDP-glucose 6-dehydrogenase[OS=Homosapiens] 26S proteaseregulatorysubunit7[OS=Homosapiens] glutamine--tRNA ligase[OS=Homosapiens] Isoform 2ofSpectrinalphachain,non-erythrocytic1[OS=Homosapiens] activator of90kDaheatshockproteinATPasehomolog1[OS=Homosapiens] Methionine--tRNA ligase,cytoplasmic[OS=Homosapiens] Mitochondrial 2-oxoglutarate/malatecarrierprotein[OS=Homosapiens] Isoform 2ofMitochondrialdicarboxylatecarrier[OS=Homosapiens]

DNA replicationlicensing factormcm5[OS=Homosapiens] tropomodulin-3 [OS=Homo sapiens] Actin-related protein2/3 complexsubunit1B[OS=Homosapiens] AuthortRNA-splicing ligaseRtcB homolog[OS=Homosapiens] Manuscript

This article isprotected by copyright. All rights reserved. Hepatology Hepatology 481 27 42 43 39 136 80 11 63 12 38 8 21 15 21 44.8 44 21 27.6 30 45 35.0 18 47 48.6 13 22 39.5 10 68 28.4 10 96 43.3 12 24 26.9 20 38 19.3 20 16 21.3 10 26 26.0 24 37.5 39 51.6 11 31.6 17 7 43.9 20.3 11 45.9 30.3 24.2 53.7 661 52 152 42 46 46 139 19 61 23 93 9 29 17 66 8 36.6 57 79.0 34 60 34.7 14 29 42.8 33 54.5 22 10 57.8 21 104 29.1 19 67 32.5 22 63 30.7 11 82 47.1 70 8 23.8 48 25.5 25 48 19.2 18 56 21 53 35.5 26 61.0 50 22 351 8 32.3 97 25.8 19 60 38.7 18 26 39.2 15 61.5 113 6 24.3 49.1 34 39.8 25 36.0 10 19.9 36.6 48.6 35.5 Page 70of84 Page 71of84 Q12906-7 P05362 O75643-1 P25205-2 Q92598 P67809 Q15365 P62841 P07900-2 Q15366-3 O43795 Q04637-9 Q92499 P14649 Q00325-2 P49327 P53007 P48643 P50990 P62917 9951Eln2[SHm ain]4. 352 39 29 13 9 49.9 8 57.2 Erlin-2[OS=Homo sapiens] P62906 O94905-1 Cofilin-1[OS=Homosapiens] P15880 28.9 P61158 P23528 O43175 erlin-1[OS=Homosapiens] Q6P2Q9 O75477 Q9Y265 O15144 P61160-1 P18621-3 P26599-3 P39023 P52272 P18124 P00966 P62136-2 P83731 P62888 P04843 P06753-2 Q08211 P07226-1 Q9Y224 Q8NBQ5 Q07065 P50991 P11498 D-3-phosphoglycerate dehydrogenase[OS=Homo sapiens] Pre-mRNA-processing-splicing factor8[OS=Homo sapiens] RuvB-like 1[OS=Homosapiens] Actin-related protein2/3complexsubunit2[OS=Homo sapiens] Actin-related protein2[OS=Homosapiens] Isoform 3of60SribosomalproteinL17[OS=Homo sapiens] Isoform 3ofPolypyrimidinetract-bindingprotein 1[OS=Homosapiens] 60S ribosomalproteinL3[OS=Homosapiens] Heterogeneous nuclearribonucleoproteinM[OS=Homosapiens] 60S ribosomalproteinL7[OS=Homosapiens] Argininosuccinate synthase[OS=Homosapiens] Isoform 2ofSerine/threonine-proteinphosphatasePP1-alphacatalyticsubunit[OS=Homosapiens] 60S ribosomalproteinL24[OS=Homosapiens] 60S ribosomalproteinL30[OS=Homosapiens] Dolichyl-diphosphooligosaccharide--protein glycosyltransferasesubunit1[OS=Homosapiens] Isoform 2ofTropomyosinalpha-3chain[OS=Homosapiens] Atp-dependent rnahelicasea[OS=Homosapiens] Tropomyosin alpha-4chain[OS=Homosapiens] UPF0568 proteinC14orf166[OS=Homosapiens] Estradiol 17-beta-dehydrogenase11[OS=Homosapiens] Cytoskeleton-associated protein4[OS=Homosapiens] T-complex protein1subunitdelta[OS=Homosapiens] Isoform 7ofInterleukinenhancer-bindingfactor3[OS=Homosapiens] Intercellular adhesionmolecule1[OS=Homosapiens] U5 smallnuclearribonucleoprotein200kDahelicase[OS=Homosapiens] Isoform 2ofDNAreplicationlicensingfactorMCM3[OS=Homosapiens] Heat shockprotein105kDa[OS=Homosapiens] Nuclease-sensitive element-bindingprotein1[OS=Homosapiens] Poly(RC)-binding protein1[OS=Homosapiens] 40S ribosomalproteinS15[OS=Homosapiens] Isoform 2ofHeatshockproteinHSP90-alpha[OS=Homosapiens] Isoform 3ofPoly(rC)-bindingprotein2[OS=Homosapiens] Unconventional myosin-Ib[OS=Homosapiens] Isoform 9ofEukaryotictranslationinitiationfactor4gamma1[OS=Homosapiens] ATP-dependent RNAhelicaseDDX1[OS=Homosapiens] Myosin lightchain6B[OS=Homosapiens] Isoform BofPhosphatecarrierprotein,mitochondrial[OS=Homosapiens] Fatty acidsynthase[OS=Homosapiens] Tricarboxylate transportprotein,mitochondrial[OS=Homosapiens] T-complex protein1subunitepsilon[OS=Homosapiens] T-complex protein1subunittheta[OS=Homosapiens] 60S ribosomalproteinL8[OS=Homosapiens] pyruvate carboxylase,mitochondrial[OS=Homosapiens]

60S ribosomalproteinL10A [OS=Homosapiens] 40S ribosomalproteinS2 [OS=Homosapiens] Authoractin-related protein3[OS=Homo sapiens] Manuscript

This article isprotected by copyright. All rights reserved. Hepatology Hepatology 951 38 75 54 75 73 41 61 12 30 88 16 46 20 184 29.5 11 63 19.1 11 66 7 24.7 56 33.1 22 56 53.4 10 219 41.3 35 43 69.7 20 52 33.0 20 50 7 37.6 83 45.7 15 81 16.5 61 9 37.2 40.4 16 42.4 17 36.2 10 42.8 27 36.2 37.2 52.5 32.6 301 109 65 135 32 14 53 12 69 20 76 53.0 98 10 61 47.1 20 111 73.0 120 19 219 25.1 14 102 12.7 29 13 32 10 59.2 40 18 63.3 82 16 43.9 32 63 40.8 16 61 9 54.6 110 8 41.2 77 7 64.1 58 7 52.0 32 31.1 17 63 31.1 14 75 37.6 31 84 67.0 14 39.9 14 8 45.6 33.0 18 50.0 20 67.2 19 33.0 40.7 48.8 24.6

037Vli- O=oospes 163 241 83 32 21 51.6 48.3 Villin-1[OS=Homosapiens] P31943 Q00610-1 Vimentin[OS=Homosapiens] P09327 P61247 P08670 P33993-1 P09493-3 P07951-2 P52597 P51991-1 P09651-1 P35580-3 P27348 P35580-4 P62424 P62241 Q9P2E9-1 P62701 P08708 Q7Z406-6 Q9NZI8 P11940-1 P30050-1 P07910-2 Q02878 P62266 P38919 1421 Q9BUJ2-1 Q12905 Q9Y230 P36578 P62244 131 Q92841 P10412 P60842 60.9 P09493-5 P62258-1 Myosin-9[OS=Homosapiens] P27635 P35579-1 P60709 O00571 P17844 P10809 P11021 P62750 P17066 PRDX1_HUMAN Q9BQE3 Q00839 OMNCNAIAT 291 65 13 72.9 60S ribosomalproteinL6 [OS=Homosapiens] Heterogeneous nuclearribonucleoproteinU[OS=Homo sapiens] COMMON CONTAMINANT! 40S ribosomalproteinS23[OS=Homosapiens] Eukaryotic initiationfactor4A-III[OS=Homosapiens] Heterogeneous nuclearribonucleoproteinU-like protein1[OS=Homosapiens] Interleukin enhancer-bindingfactor2[OS=Homo sapiens] RuvB-like 2[OS=Homosapiens] 60S ribosomalproteinL4[OS=Homosapiens] 40S ribosomalproteinS15a[OS=Homosapiens] Probable ATP-dependentRNAhelicaseDDX17[OS=Homosapiens] Histone H1.4[OS=Homosapiens] Eukaryotic initiationfactor4A-I[OS=Homosapiens] Isoform 5ofTropomyosinalpha-1chain[OS=Homosapiens] 14-3-3 proteinepsilon[OS=Homosapiens] 60S ribosomalproteinL10[OS=Homosapiens] Actin, cytoplasmic1[OS=Homosapiens] ATP-dependent RNAhelicaseDDX3X[OS=Homosapiens] probable ATP-dependentRNAhelicaseDDX5[OS=Homosapiens] 60 kDaheatshockprotein,mitochondrial[OS=Homosapiens] 78 kDaglucose-regulatedprotein[OS=Homosapiens] 60S ribosomalproteinL23a[OS=Homosapiens] Heat shock70kDaprotein6[OS=Homosapiens] Heterogeneous nuclearribonucleoproteinH[OS=Homosapiens] Clathrin heavychain1[OS=Homosapiens] 40S ribosomalproteinS3a[OS=Homosapiens] DNA replicationlicensingfactorMCM7[OS=Homosapiens] Isoform 3ofTropomyosinalpha-1chain[OS=Homosapiens] Isoform 2ofTropomyosinbetachain[OS=Homosapiens] Heterogeneous nuclearribonucleoproteinF[OS=Homosapiens] Heterogeneous nuclearribonucleoproteinA3[OS=Homosapiens] Heterogeneous nuclearribonucleoproteinA1[OS=Homosapiens] Isoform 3ofMyosin-10[OS=Homosapiens] 14-3-3 proteintheta[OS=Homosapiens] Isoform 4ofMyosin-10[OS=Homosapiens] 60S ribosomalproteinL7a[OS=Homosapiens] 40S ribosomalproteinS8[OS=Homosapiens] Ribosome-binding protein1[OS=Homosapiens] 40S ribosomalproteinS4,Xisoform[OS=Homosapiens] 40S ribosomalproteinS17[OS=Homosapiens] Isoform 6ofMyosin-14[OS=Homosapiens] Tubulin alpha-1Cchain[OS=Homosapiens]

Insulin-like growthfactor 2mRNA-bindingprotein1[OS=Homosapiens] Polyadenylate-binding protein 1[OS=Homosapiens] 60S ribosomalproteinL12 [OS=Homosapiens] AuthorIsoform C1ofHeterogeneous nuclearribonucleoproteinsC1/C2[OS=Homo sapiens] Manuscript

This article isprotected by copyright. All rights reserved. Hepatology Hepatology 556 383 88 77 70 69 72 31 42 13 40 55.5 22 15 711 44 50.0 15 7 714 130 9 38.7 84 9 49.3 355 53.5 106 108 25.1 45 11 28.0 107 361 28.8 19 212 54.5 11 45.3 73 54.7 15 7 54.1 51.9 78 68.3 23 51.3 57.0 46.6 78.8 872 167 160 90 88 125 105 25 43 24 6 49 14 51 48.7 15 73 47.3 17 81 54.5 145 7 41.6 56 49.7 12 112 28.5 12 59 13 117 49.0 42 16 34.5 42 18 6 22.0 49 51.3 23 42.5 12 542 42.4 23 124 7 51.5 128 9 35.9 195 9 37.4 269 67.2 50 25.7 20 124 40.8 25 82 43.0 25 29 74.9 34 8 48.6 51.0 14 67.7 13 60.1 34.6 20.2 44.1 Page 72of84 Page 73of84 Q13247 Q07955-1 P01857 Q9P2K8-1 O43396 P42167 O43143 Q13310-3 P13010 Q15029 P62805 P07355-2 P26373-1 P62280 P09874 P61353 P19338 P60228 P61978-2 P62269 P46781 Q14240-2 P05387 Q7L014 P53999 Q9UHX1-2 P23284 Q93009 Q8IYB3 Q9Y262 O75533-1 P42166 O43809 P62316 Q96HS1-1 Q9UQ35 Q15393-1 O00303 P02545 P06899 Q5QNW6-2 P55884-2 Q16629 Q08170 P01861 Q00839-2 Activated RNApolymerase IItranscriptionalcoactivatorp15[OS=Homo sapiens] Isoform 2ofPoly(U)-binding-splicingfactorPUF60 [OS=Homosapiens] peptidyl-prolyl cis-transisomeraseB[OS=Homo sapiens] Ubiquitin carboxyl-terminalhydrolase7[OS=Homo sapiens] Serine/arginine repetitivematrixprotein1[OS=Homo sapiens] eukaryotic translationinitiationfactor3subunitL [OS=Homosapiens] splicing factor3Bsubunit1[OS=Homosapiens] Lamina-associated polypeptide2,isoformalpha [OS=Homosapiens] Cleavage andpolyadenylationspecificityfactor subunit 5[OS=Homosapiens] Small nuclearribonucleoproteinSmD2[OS=Homo sapiens] Serine/threonine-protein phosphatasePgam5,mitochondrial[OS=Homosapiens] serine/arginine repetitivematrixprotein2[OS=Homosapiens] Serine/arginine-rich splicingfactor6[OS=Homosapiens] Splicing factor3Bsubunit3[OS=Homosapiens] Eukaryotic translationinitiationfactor3subunitF[OS=Homosapiens] Prelamin-A/C [OS=Homosapiens] Histone H2Btype1-J[OS=Homosapiens] Isoform 2ofHistoneH2Btype2-F[OS=Homosapiens] Isoform 2ofEukaryotictranslationinitiationfactor3subunitB[OS=Homosapiens] serine/arginine-rich splicingfactor7[OS=Homosapiens] Serine/arginine-rich splicingfactor4[OS=Homosapiens] Serine/arginine-rich splicingfactor1[OS=Homosapiens] Ig gamma-1chainCregion[OS=Homosapiens] Ig gamma-4chainCregion[OS=Homosapiens] eIF-2-alpha kinaseGCN2[OS=Homosapiens] Thioredoxin-like protein1[OS=Homosapiens] Lamina-associated polypeptide2,isoformsbeta/gamma[OS=Homosapiens] Pre-mRNA-splicing factorATP-dependentRNAhelicaseDHX15[OS=Homosapiens] Isoform 3ofPolyadenylate-bindingprotein4[OS=Homosapiens] X-ray repaircross-complementingprotein5[OS=Homosapiens] 116 kDaU5smallnuclearribonucleoproteincomponent[OS=Homosapiens] histone H4[OS=Homosapiens] Isoform 2ofAnnexinA2[OS=Homosapiens] 60S ribosomalproteinL13[OS=Homosapiens] 40S ribosomalproteinS11[OS=Homosapiens] Poly [ADP-ribose]polymerase1[OS=Homosapiens] 60S ribosomalproteinL27[OS=Homosapiens] Nucleolin [OS=Homosapiens] Eukaryotic translationinitiationfactor3subunitE[OS=Homosapiens] Isoform 2ofHeterogeneousnuclearribonucleoproteinK[OS=Homosapiens] 40S ribosomalproteinS18[OS=Homosapiens] 40S ribosomalproteinS9[OS=Homosapiens] Isoform 2ofEukaryoticinitiationfactor4A-II[OS=Homosapiens] 60S acidicribosomalproteinP2[OS=Homosapiens] Isoform ShortofHeterogeneousnuclearribonucleoproteinU[OS=Homosapiens]

Authorprobable ATP-dependent RNAhelicaseDDX46[OS=Homosapiens] Manuscript

This article isprotected by copyright. All rights reserved. Hepatology Hepatology 931 127 417 79 108 90 46 76 19 18 92 20 57 63 22 89.3 20 114 38.5 60 14 7 29.9 129 37.1 17 67 41.3 11 150 8 19.4 79 52.4 59 29 5 55.2 49 39.3 24 144 46.8 13 106 36.0 20 41.9 11 9 32.7 34.8 10 9 53.7 52.6 17 40.2 32.8 78.3 28.0 431 23 33 23 29 141 41 13 38 9 54 10 706 8 32 14.3 39 38 8 46.5 48 29.3 10 238 42.1 20 87 45.9 46 7 14.3 67 6 20.0 687 24.0 10 107 79.3 65 117 46.7 13 44 55.9 40 47.4 54 11 33.2 49 94 7 33.7 7 45.1 12 97 7 69.6 7 47.6 44.8 14 20.5 28.6 14.6 33 48.4 24.0 . 31 9 39 39 9.6 1 1 7.6 7.6 ratio ofpeptide-specificspectrawithtruncatedLAP2(1-99)tofull-length peptide-specific spectra,andproteinswithfewerthan15spectra(witheitherfull-lengthLAP2 toLC-MS/MSanalysisafterin-solutiontrypsindigestionasdescribedinMaterialandMethods.LAP2-associatedproteinsidentifiedbymassspectometrywerefilterednumberof 60 59 58 57 56 55 54 53 52 51 50 49 48 47 46 45 44 43 42 41 40 39 38 37 36 35 34 33 32 31 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 (full-length), truncatedLAP2(1-99),orGFPalonewasimmunoprecipitatedfromHuh7cellsandsubmitted # UniquePeptides 2788. 38 PEG10 10969 34.8 2193 57.5 306 23089 80.1 5917 75.3 508 708 5708 100.1 660 23197 52.6 11 908 445 15 10075 481.6 12 79026 628.7 22 10514 149.3 4374 5890 16 10985 292.6 1332 12 55832 136.3 2671 4547 1230 99.3 28 12 476 112.8 10 894 4642 116.1 790 242.8 1023 26 1006 12 821 235.6 2225 71.5 2746 61.4 2201 11 627 71.1 12 558 3030 82.9 15 33 661 1047 57805 70 102.8 763 29 3191 64.1 11 923 5034 57.1 10 610 589 12 508 23193 12 106.8 10525 111.3 15 944 11 999 14 14 25 34 2415. 2244 55.9 491 8878 47.7 440 12 13 4798. 2617 83.1 739 14 338 515.3 4563 399687 233 2054 48 24 1516. 1503 66.6 591 11 5 3255735 63.2 559 9 2 4479751 34.4 323 9 4 229415 52.2 25813 51.9 444 469 8813 29.6 260 161 104 7 8 940 10128 157.8 8 23644 151.6 1394 1401 8 9 79709 71.6 9 622 9 0 781191 57.8 501 9 α

Author Manuscript orLAP21-99)wereremoved.Theremainingproteinsareshownhere,arrangedby(1)

# AAs α , (2)percentcoverage,and(3)totalnumberofpeptide-specificspectra This article isprotected by copyright. All rights reserved. MW [kDa] Entrez GeneID Hepatology Hepatology ENSG00000168003 ENSG00000084754 ENSG00000171793 ENSG00000158941 ENSG00000153132 ENSG00000104824 ENSG00000185624 ENSG00000171564 ENSG00000177542 ENSG00000089597 ENSG00000149428; ENSG00000280682 ENSG00000161011 Ensembl GeneID ENSG00000134824 ENSG00000100347 ENSG00000106105 ENSG00000117395 ENSG00000000419 ENSG00000179115 ENSG00000113643 ENSG00000183020 ENSG00000175166 ENSG00000113194 ENSG00000138095 ENSG00000038358 ENSG00000086758 ENSG00000124942 ENSG00000132382 ENSG00000084674 ENSG00000089154 ENSG00000111530 ENSG00000196535 ENSG00000130309 ENSG00000138823 ENSG00000163399 ENSG00000176658 ENSG00000084774 ENSG00000007923 ENSG00000127022 ENSG00000148672 ENSG00000120885 HADHA CTPS1 CCAR2; KIAA1967 CLGN HNRNPL P4HB FGB SLC25A22 GANAB HYOU1 SQSTM1 Gene ID FADS2 SAMM50 GARS EBNA1BP2 DPM1 FARSA RARS AP2A2 PSMD2 FAF2 LRPPRC EDC4 HUWE1 AHNAK MYBBP1A APOB GCN1L1; GCN1 CAND1 MYO18A COLGALT1; GLT25D1 MTTP ATP1A1 MYO1D CAD DNAJC11 CANX GLUD1 CLU # Peptides(GFP) 2 Page 74of84 Page 75of84 1 184885591 468.8 4128 113 9748. 4174 82.2 29766 39.6 734 51493 55.2 352 7415 89.3 505 9209 82.1 806 1314 3417 138.3 46.6 19 721 1615 57.1 23 1224 414 4641 121.6 17 501 9782 1063 94.6 34 14 6950 60.3 33 847 10 160 21 107.5 556 163 19 105.6 10989 82.6 977 951 18 747 488 506 114.7 56.5 10576 57.5 25 1042 529 13 535 26 2673 148.6 78.8 22 51726 40.5 3301 1285 44.8 19 699 800 64.2 18 358 15 397 871 46.4 558 2058 170.5 33 418 3376 7203 144.4 60.5 25 10432 1512 69.4 10 6197 1262 83.7 11 545 1718 60.1 12 669 4719 80.9 740 2181 80.4 7358 55 15 516 43 741 5701 48.6 30 720 5859 87.7 18 494 13 433 6709 10598 284.9 38.3 10 775 10 2477 12 338 18 16 10 23 39 11 7901114141 101.1 1468 32.1 900 296 17 11 217 1. 11273 113.3 1075 22 7 018531 40.1 372 2 8 1610093 21.6 187 8604 74.7 8 23435 44.7 678 55210 66.2 414 586 6133 21.9 4 192 8 6 8 1 48402 34 314 7

7 0910095 40.9 372 8 Author Manuscript 6125 34.3 297 8

This article isprotected by copyright. All rights reserved. Hepatology Hepatology ENSG00000086061 ENSG00000122786 ENSG00000122406 ENSG00000149257 ENSG00000136628 ENSG00000196305 ENSG00000163468 ENSG00000239306 ENSG00000177189 ENSG00000116133 ENSG00000023228 ENSG00000123983 ENSG00000109814 ENSG00000161057 ENSG00000172053 ENSG00000197694 ENSG00000100591 ENSG00000166986 ENSG00000108528 ENSG00000183048 ENSG00000100297 ENSG00000138594 ENSG00000130429 ENSG00000100220 ENSG00000241553 ENSG00000165280 ENSG00000093167 ENSG00000122218 ENSG00000138413 ENSG00000115866 ENSG00000197879 ENSG00000168488 ENSG00000115840 ENSG00000015479; ENSG00000280987 ENSG00000120948 ENSG00000120438 ENSG00000197785 ENSG00000196961 ENSG00000006125 ENSG00000132305 ENSG00000163682 ENSG00000174437 ENSG00000110955 ENSG00000166226 ENSG00000253729 ENSG00000060138 ENSG00000198380 ENSG00000090520 DNAJA1 CALD1 RPL5 SERPINH1 3 EPRS IARS CCT3 RBM14 RPS6KA3 DHCR24 NDUFS1 ACSL3 UGDH PSMC2 QARS SPTAN1 AHSA1 MARS SLC25A11 SLC25A10 MCM5 2 TMOD3 ARPC1B C22orf28; RTCB ARPC4 VCP 1 LRRFIP2 COPA IDH1 DARS MYO1C ATXN2L SLC25A12 MATR3 2 TARDBP TCP1 ATAD3A AP2A1 AP2B1 IMMT RPL9 ATP2A2 1 ATP5B CCT2 PRKDC CSDA; YBX3 GFPT1 DNAJB11 1

4272. 4736 24.8 11160 37.8 6187 31.3 217 10096 47.3 339 293 26227 56.6 418 533 8607 50.2 14 10109 34.3 11 12 456 26.4 20 300 5725 59.6 6122 46.1 10 228 4670 77.5 557 6129 29.2 403 19 730 14 248 10 6184 68.5 7170 29 18 16 32 607 1660 140.9 16 248 1270 10970 66 10575 57.9 3609 95.7 17 602 10 539 31 898 23020 4172 244.4 95.8 10808 96.8 2136 853 18 858 19 3320 98.1 19 30 854 16 1653 176.1 82.4 19 5250 1606 39.9 740 2194 273.3 11 361 22948 59.6 10694 2511 59.6 6132 28 20 541 20 548 257 15 61 15 17 10 023 7. 10594 273.4 2335 20 4242. 51637 28.1 244 3383 57.8 532 14 12 4430 131.9 1136 43 5091 129.6 1178 27 3344. 10097 44.7 394 13 2 594904 35.9 5093 37.5 324 356 5094 38.2 362 140465 22.8 7 7 6576 34 208 6 311 5 9 4 89163ERLIN1 1072 18.5 166 10613 38.9 346 9 6 445 46.5 5499 38.6 6152 17.8 412 6156 12.8 341 157 115 7171 28.5 9 51170 32.9 248 2 7 300 7 8 8

Author Manuscript 6209 17 145 7

This article isprotected by copyright. All rights reserved. 100526842 Hepatology Hepatology ENSG00000090339 ENSG00000144028 ENSG00000112118 ENSG00000120694 ENSG00000065978 ENSG00000169564 ENSG00000115268 ENSG00000080824 ENSG00000197111 ENSG00000128641 ENSG00000114867 ENSG00000079785 ENSG00000196465 ENSG00000075415 ENSG00000169710 ENSG00000100075 ENSG00000150753 ENSG00000156261 ENSG00000161016 ENSG00000173599 ENSG00000198755 ENSG00000147475 ENSG00000140988 ENSG00000115091 ENSG00000172757 ENSG00000092621 ENSG00000174231; ENSG00000274442 ENSG00000175792 ENSG00000163466 ENSG00000138071 ENSG00000215472 ENSG00000011304 ENSG00000100316 ENSG00000099783 ENSG00000147604 ENSG00000130707 ENSG00000172531 ENSG00000114391 ENSG00000156482 ENSG00000163902 ENSG00000143549 ENSG00000135829 ENSG00000167460 ENSG00000087302 ENSG00000198189 ENSG00000136026 ENSG00000115484 ENSG00000129351 CM 1 ICAM1 SNRNP200 1 MCM3 HSPH1 YBX1 1 PCBP1 RPS15 HSP90AA1 PCBP2 1 MYO1B 2 DDX1 MYL6B SLC25A3 FASN SLC25A1 CCT5 CCT8 RPL8 PC P1A1 RPL10A ERLIN2 RPS2 ACTR3 CFL1 PHGDH PRPF8 RUVBL1 ARPC2 ACTR2 RPL17-C18ORF32 5 PTBP1 RPL3 HNRNPM 1 RPL7 1 ASS1 1 PPP1CA RPL24 RPL30 RPN1 TPM3 DHX9 TPM4 1 C14orf166 HSD17B11 CKAP4 CCT4 ILF3 3 Page 76of84 Page 77of84 1 902644627 226.4 1960 112 2576. 10642 63.4 26986 70.6 577 3183 32.3 636 6128 32.7 293 5052 22.1 288 22 199 11100 95.7 3608 43 17 10856 51.1 14 856 6124 47.7 15 390 463 12 427 1973 46.1 12 13 406 16 18 60 41.7 1654 73.2 1655 69.1 3329 61 375 14 662 3309 72.3 614 573 654 11 1213 7429 191.5 92.6 24 6189 29.9 18 7431 1675 53.6 29 827 4176 81.3 32 264 466 719 69 32 13 20 6130 30 22 6202 24.2 266 6238 152.4 208 1410 79784 228.5 2003 19 11 73 68 5232. 6191 29.6 263 84790 49.9 449 15 10 0414. 9775 46.8 411 10 6798. 02 D1 1 DDX17 10521 80.2 729 16 4 923187 49.2 449 7168 32.9 7169 33 3185 45.6 284 7 220988 39.6 284 3178 38.7 415 378 4628 10971 231.2 27.7 372 4628 232.4 1997 245 7 7 2007 5 9 6218 15.5 8 1 135 6 2 7 6 786136 17.8 165 3192 90.5 6228 15.8 825 143 6 1 3008 21.9 7 7168 28.4 219 7531 29.2 6134 24.6 245 255 214 3 2 6147 17.7 6 9 156 8 3 486210 14.8 130 6

Author 3310 71 Manuscript 643 1

This article isprotected by copyright. All rights reserved. Hepatology Hepatology ENSG00000141367 ENSG00000127831 ENSG00000145425 ENSG00000026025 ENSG00000166508 ENSG00000140416 ENSG00000198467 ENSG00000169813 ENSG00000170144 ENSG00000135486 ENSG00000133026 ENSG00000134308 ENSG00000133026 ENSG00000148303; ENSG00000280858 ENSG00000142937 ENSG00000125844 ENSG00000198034 ENSG00000182774; ENSG00000278229 ENSG00000105357 ENSG00000167553 ENSG00000159217 ENSG00000070756 ENSG00000197958 ENSG00000092199 ENSG00000089009 ENSG00000153187 ENSG00000117450 ENSG00000186468 ENSG00000141543 ENSG00000105323 ENSG00000143621 ENSG00000183207 ENSG00000174444 ENSG00000134419 ENSG00000168298 ENSG00000161960 ENSG00000140416 ENSG00000108953; ENSG00000274474 ENSG00000147403 ENSG00000100345 ENSG00000075624 ENSG00000215301 ENSG00000108654 ENSG00000144381 ENSG00000044574 ENSG00000198242 ENSG00000173110 ENSG00000169045 I11 1 CLTC 1 VIL1 RPS3A VIM MCM7 TPM1 TPM2 3 HNRNPF HNRNPA3 1 3 HNRNPA1 1 MYH10 2 YWHAQ MYH10 1 RPL7A RPS8 1 RRBP1 RPS4X 10 RPS17; RPS17L MYH14 TUBA1C G2P 1 5 2 IGF2BP1 1 2 PABPC1 RPL12 1 4 HNRNPC RPL6 HNRNPU PRDX1 RPS23 EIF4A3 1 HNRNPUL1 ILF2 1 RUVBL2 RPL4 4 RPS15A HIST1H1E 1 EIF4A1 26 TPM1 11 YWHAE RPL10 1 MYH9 8 ACTB 7 DDX3X DDX5 6 HSPD1 HSPA5 RPL23A HSPA6 HNRNPH1 1 2

313 1. 9879 117.3 22827 58.1 1031 542 7874 128.2 51386 66.7 1102 23451 7112 145.7 75.4 13 564 1304 192111 32 10 694 38 23524 299.4 289 10 8665 2752 37.5 20 31 357 99 10 65 873 6426 27.7 11 248 440275 9352 186.8 32.2 12 1665 1649 90.9 289 8761 72.3 7520 82.7 14 795 660 732 302 40.4 33 6137 24.2 19 357 142 113 20 211 15 4691 76.6 20 3646 1014 52.2 3190 51 710 6222 17.7 17 445 11 464 152 29 24 13 20 11 3921949343 109.4 972 13 7647. 4000 74.1 664 47 3 48440689 14.8 134 2 5 067112 50.6 454 11.4 103 6205 18.4 3 6155 15.8 158 136 7 6203 22.6 1974 46.5 8 6181 11.7 194 408 5 115 9 1 9 2 4410923 14.4 5479 23.7 127 10250 102.3 216 904 11051 26.2 9 6633 13.5 227 8 118 6431 39.6 8 23450 135.5 344 1217 7 6 6432 27.4 6429 56.6 8 238 9 3500 36.1 494 3503 35.9 330 327 6 2 1 1 0 893192 88.9 806 1

Author 8970 13.9 126 2 Manuscript

This article isprotected by copyright. All rights reserved. 8359; 8361;8360;8363;8370;554313;8365;8364;121504;8367;8294;8366;8362;8368 Hepatology Hepatology ENSG00000091164 ENSG00000120802 ENSG00000109606 ENSG00000090621 ENSG00000079246 ENSG00000108883 ENSG00000158406; ENSG00000270882;ENSG00000197837;ENSG00000270276;ENSG00000197061;ENSG00000197238;ENSG00000278705;ENSG00000274618;ENSG00000278637; ENSG00000273542;ENSG00000276966;ENSG00000277157;ENSG00000275126;ENSG00000276180 ENSG00000182718 ENSG00000167526 ENSG00000142534 ENSG00000143799 ENSG00000131469 ENSG00000115053 ENSG00000104408 ENSG00000165119 ENSG00000223367; ENSG00000226225;ENSG00000231500;ENSG00000235650;ENSG00000096150 ENSG00000170889; ENSG00000278270;ENSG00000274005;ENSG00000277359;ENSG00000274646;ENSG00000274626;ENSG00000275323;ENSG00000277079;ENSG00000274950; ENSG00000278081 ENSG00000156976 ENSG00000177600 ENSG00000153187 ENSG00000145833 ENSG00000113387 ENSG00000179950; ENSG00000274081 ENSG00000166794 ENSG00000187555 ENSG00000133226 ENSG00000100129 ENSG00000115524 ENSG00000120802 ENSG00000167005 ENSG00000125743 ENSG00000247077 ENSG00000167978 ENSG00000124193 ENSG00000189091 ENSG00000175390; ENSG00000280606 ENSG00000160789 ENSG00000124635 ENSG00000203814 ENSG00000115875 ENSG00000116350 ENSG00000136450 ENSG00000211896; ENSG00000277633 ENSG00000211892; ENSG00000277016 ENSG00000128829 TXNL1 3 TMPO DHX15 PABPC4 1 XRCC5 2 EFTUD2 3 HIST1H4A; HIST1H4F;HIST1H4D;HIST1H4J;HIST2H4A;HIST2H4B;HIST1H4H;HIST1H4C;HIST4H4;HIST1H4E;HIST1H4I;HIST1H4B;HIST1H4K;HIST1H4L 1 ANXA2 1 RPL13 RPS11 PARP1 RPL27 3 4 NCL 1 EIF3E 2 HNRNPK 3 RPS18 RPS9 1 EIF4A2 RPLP2 HNRNPU U11 DDX46 SUB1 PUF60 PPIB USP7 SRRM1 EIF3L SF3B1 TMPO NUDT21 SNRPD2 PGAM5 SRRM2 SRSF6 SF3B3 EIF3F LMNA HIST1H2BJ HIST2H2BF 1 SRSF7 1 SRSF4 SRSF1 IGHG1 IGHG4 EIF2AK4 2 3 3 Page 78of84 toLC-MS/MSanalysisafterin-solutiontrypsindigestionasdescribedinMaterialandMethods.LAP2-associatedproteinsidentifiedbymassspectometrywerefilterednumberof (full-length), truncatedLAP2(1-99),orGFPalonewasimmunoprecipitatedfromHuh7cellsandsubmitted orLAP21-99)wereremoved.Theremainingproteinsareshownhere,arrangedby(1) , (2)percentcoverage,and(3)totalnumberofpeptide-specificspectra 60 59 58 57 56 55 54 53 52 51 50 49 48 47 46 45 44 43 42 41 40 39 38 37 36 35 34 33 32 31 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 Page 79of84 # Peptidespectrummatches(GFP)

Author Manuscript4 # Peptides(LAP2alphaFL) 16 16 24 16 7 16 8 33 13 25 9 42 8 17 15 26 12 27 2 21 2 8 3 16 2 12 2 4 3 1 5 2 2 2 3 1 3 2 2 3 3 2 2 2 This article isprotected by copyright. All rights reserved. # Peptidespectrummatches(LAP2alphaFL) Hepatology Hepatology # Peptides(LAP21-99) 118 18 29 25 11 11 59 14 82 12 34 25 34 13 944 22 83 29 45 12 20 34 48 26 19 12 19 22 25 48 11 11 52 15 25 30 17 29 23 11 20 10 23 27 12 10 11 13 18 9 17 17 9 15 9 9 16 9 15 9 15 8 # Peptidespectrummatches(LAP21-99)

42 381 33 38 16 20 11 23 37 10 17 14 4 Author 215 5 9 3 109 2 2 5 2 44 17 3 9 29 Manuscript1 3 2 4 01 061 20 55 29 18 15 10 11 727 17 17 17 21 8 29 11 8 19 14 23 8 23 10 5 28 5 13 16 6 13 53 8 14 4 25 7 25 5 3 24 46 17 3 6 12 4 31 6 16 36 5 22 24 7 7 4 18 20 3 13 18 47 14 4 47 6 4 21 6 6 21 11 27 16 4 4 25 16 3 7 10 9 32 8 10 5 9 82 5 7 56 4 28 4 15 7 9 3 43 18 9 5 30 18 4 16 6 18 4 4 36 3 10 36 3 10 2 19 6 12 5 45 15 20 6 41 10 16 3 21 5 10 2 29 23 15 2 3 26 2 23 3 11 3 3 16 9 6 7 8 6 11 3 3 7 2 6 3 3 3 4 4 2 5 3 3 4 4 2 2 1 3 This article isprotected by copyright. All rights reserved. Hepatology Hepatology Page 80of84 Page 81of84 22 34 6 15 8 12 2 7 2 2 41 29 12 14 97 8 16 31 32 37 7 1 7 17 43 7 14 16 24 21 4 5 5 48 24 10 11 1 20 10 1 1 8 18 9 5 10 6 1 5 1

Author 35 23 18 11 14 9 Manuscript 8 4 1 1 23 6106 56 53 24 37 16 22 11 63 980 39 30 16 01 136 21 30 17 15 12 10 10 42 948 19 38 23 16 14 17 10 44 25 17 12 21 25 22 9 36 13 11 10 7 8 7 11 4 5 5 6 01 27 22 15 13 10 8 6 5 11 26 34 22 20 11 13 9 8 11 14 9 8 5 6 5 5 31 27 25 19 17 13 11 30 15 8 8 35 35 17 8 42 20 13 16 12 12 45 13 9 8 8 43 16 14 16 14 7 6 16 8 16 9 16 8 19 5 9 5 9 20 4 9 19 9 7 8 7 5 9 26 9 39 4 26 4 21 14 19 9 5 10 15 10 8 7 8 4 2 11 28 14 11 7 This article isprotected by copyright. All rights reserved. Hepatology Hepatology

9113716501 170 126 19 307 104 101 17 39 28 32 92 82 115 55 28 34 14 49 68 32 20 26 10 13 11 13 95 23 46 17 24 62 445 24 35 95 12 24 27 41 31 13 21 20 17 16 274 54 13 276 44 9 29 96 22 9 2 97 40 19 11 25 137 8 15 146 3 13 9 62 146 1 23 15 1 1 20 62 5 67 62 11 6 5 1 10 5 1 32 2 1 1

13 049 53 24 23 20 41 22 6 33 11 24 14 13 12 37 40 32 18 20 17 30 37 17 15 24 6 17 47 21 16 19 20 8 6 8 23 13 7 21 2 11 9 11 13 5 Author 24 3 11 2 30 1 4 10 10 5 15 6 2 15 5 2 2 1 6 1 Manuscript 42 145 21 142 27 59 14 81 126 48 57 65 38 53 855 18 36 15 71 30 28 11 28 15 15 15 14 13 6 7 7 17 15 15 16 8 8 9 8 6 7 8 5 4 4 8 3 2717 20 19 19 7 11 11 9 16 12 14 16 13 13 6 8 6 8 7 6 10 10 4 5 0817 8 10 5 This article isprotected by copyright. All rights reserved. Hepatology Hepatology Page 82of84 Page 83of84 923 2 29 9 1 8518 19 5 5 28 29 6 6 3 3

Author 12 12 1 1 32 17 17 16 33 15 16 20 6 30 18 15 8 8 Manuscript 29 1 16 5 1 53 24 19 15 18 29 39 20 13 10 4 17 9 33 4 15 9 25 15 9 6 13 15 42 7 4 19 7 15 16 14 5 3 30 1 25 4 4 16 8 1 9 1 7 8 4 12 5 1 3 6 1 322 13 95 018 8 10 207 5 11 15 73 23 57 6 14 38 22 10 19 471 6 13 29 21 135 40 13 44 23 35 10 65 13 11 20 34 229 45 12 52 205 25 24 17 30 13 17 14 40 15 10 52 59 202 23 39 13 22 27 15 29 20 16 12 14 12 17 10 32 18 16 10 512 5 7 1 6 3 5 7 4 8 15 5 24 5 9 21 15 6 9 15 8 16 8 8 15 7 6 9 7812 12 15 8 6 6 17 17 21 9 7 7 This article isprotected by copyright. All rights reserved. Hepatology Hepatology # Peptidespectrummatches(LAP21-99) 60 59 58 57 56 55 54 53 52 51 50 49 48 47 46 45 44 43 42 41 40 39 38 37 36 35 34 33 32 31 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1

Author Manuscript