Compression of Next-Generation Sequencing Reads Aided by Highly

Total Page:16

File Type:pdf, Size:1020Kb

Compression of Next-Generation Sequencing Reads Aided by Highly Compression of next-generation sequencing reads aided by highly efficient de novo assembly Daniel C. Jones∗1, Walter L. Ruzzo†1,2,3, Xinxia Peng‡4, and Michael G. Katze§4 1Department of Computer Science and Engineering, University of Washington 2Department of Genome Sciences, University of Washington 3Fred Hutchinson Cancer Research Center 4Department of Microbiology, University of Washington November 1, 2018 Abstract to cope with the vast increase in raw data. Experi- ments that would previously have been conducted with microarrays and resulted in several megabytes of data, We present Quip, a lossless compression algorithm for are now performed by sequencing, producing many giga- next-generation sequencing data in the FASTQ and SAM/BAM formats. In addition to implementing bytes, and demanding a significant investment in com- reference-based compression, we have developed, to our putational infrastructure. While the cost of disk storage has also steadily decreased over time, it has not matched knowledge, the first assembly-based compressor, using a the dramatic change in the cost and volume of sequenc- novel de novo assembly algorithm. A probabilistic data ing. A transformative breakthrough in storage technol- structure is used to dramatically reduce the memory re- quired by traditional de Bruijn graph assemblers, allowing ogy may occur in the coming years, but the era of the millions of reads to be assembled very efficiently. Read se- $1000 genome is certain to arrive before that of the $100 petabyte hard disk. quences are then stored as positions within the assembled contigs. This is combined with statistical compression As cloud computing and software as a service become in- of read identifiers, quality scores, alignment information, creasingly relevant to molecular biology research, hours and sequences, effectively collapsing very large datasets spent transferring NGS datasets to and from off-site to less than 15% of their original size with no loss of in- servers for analysis will delay meaningful results. More formation. often researchers will be forced to maximize bandwidth Availability: Quip is freely avail- by physically transporting storage media (via the “sneak- able under the BSD license from ernet”), an expensive and logistically complicated option. http://cs.washington.edu/homes/dcjones/quip. These difficulties will only be amplified as exponentially more sequencing data is generated, implying that even moderate gains in domain-specific compression methods arXiv:1207.2424v1 [q-bio.QM] 10 Jul 2012 1 Introduction will translate into a significant reduction in the cost of managing these massive datasets over time. With the development of next-generation sequencing Storage and analysis of NGS data centers primarily (NGS) technology researchers have had to adapt quickly ∗[email protected][email protected][email protected] §[email protected] 1 around two formats that have arisen recently as de facto regardless of the length of the read. standards: FASTQ and SAM. FASTQ stores, in addition to nucleotide sequences, a unique identifier for each read This idea is explored also in the Goby format and quality scores, which encode estimates of the proba- (http://campagnelab.org/software/goby/), which bility that each base is correctly called. For its simplicity, has been proposed an alternative to SAM/BAM, the FASTQ is a surprisingly ill-defined format. The closest primary functional difference being that sequences of thing to an accepted specification is the description by aligned reads are not stored but looked up in a reference Cock et al. (2010), but the format arose ad hoc from mul- genome when needed (frequently they are not). For some tiple sources (primarily Sanger and Solexa/Illumina), so applications, reference-based compression can be taken a number of variations exist, particularly in how quality much further by storing only SNP information, sum- scores are encoded. The SAM format is far more complex marizing a sequencing experiment in several megabytes but also more tightly defined, and comes with a reference (Christley et al., 2009). However, even when SNP calls implementation in the form of SAMtools (Li et al., 2009). are all that is needed, discarding the raw reads would It is able to store alignment information in addition to prevent any reanalysis of the data. read identifiers, sequences, and quality scores. SAM files, While a reference-based approach typically results in which are stored in plain text, can also be converted to superior compression it has a number of disadvan- the BAM format, a compressed binary version of SAM, tages. Most evidently, an appropriate reference sequence which is far more compact and allows for relatively effi- database is not always available, particularly in the case cient random access. of metagenomic sequencing. One could be contrived by compiling a set of genomes from species expected to be Compression of nucleotide sequences has been the tar- represented in the sample. However, a high degree of ex- get of some interest, but compressing NGS data, made pertise is required to curate and manage such a project- up of millions of short fragments of a greater whole, dependent database. Secondly, there is the practical combined with metadata in the form of read identifiers concern that files compressed with a reference-based ap- and quality scores, presents a very different problem and proach are not self-contained. Decompression requires demands new techniques. Splitting the data into sepa- precisely the same reference database used for compres- rate contexts for read identifiers, sequences, and quality sion, and if it is lost or forgotten the compressed data scores and compressing them with the Lempel-Zip algo- becomes inaccessible. rithm and Huffman coding has been explored explored by Tembe et al. (2010) and Deorowicz and Grabowski Another recurring theme in the the growing literature (2011), who demonstrate the promise of domain-specific on short read compression is lossy encoding of sequence compression with significant gains over general-purpose quality scores. This follows naturally from the realiza- programs like gzip and bzip2. tion that quality scores are particularly difficult to com- press. Unlike read identifiers, which are highly redundant, Kozanitis et al. (2011) and Hsi-Yang Fritz et al. (2011) or nucleotide sequences, which contain some structure, proposed reference-based compression methods, exploit- quality scores are inconsistently encoded between proto- ing the redundant nature of the data by aligning reads to cols and computational pipelines and are often simply a known reference genome sequence and storing genomic high-entropy. It is dissatisfying that metadata (quality positions in place of nucleotide sequences. Decompression scores) should consume more space than primary data is then performed by copying the read sequences from the (nucleotide sequences). Yet, also dissatisfying to many genome. Though any differences from the reference se- researchers is the thought of discarding information with- quence must also be stored, referenced-based approaches out a very good understanding of its effect on downstream can achieve much higher compression and they grow in- analysis. creasing efficient with longer read lengths, since storing a genomic position requires the same amount of space, A number of lossy compression algorithms for 2 quality scores have been proposed, includ- 2 Materials & Methods ing various binning schemes implemented in QScores-Archiver (Wan et al., 2011) and SCALCE 2.1 Statistical Compression (http://scalce.sourceforge.net), scaling to a re- duced alphabet with randomized rounding in SlimGene (Kozanitis et al., 2011), and discarding quality scores for The basis of our approach is founded on statistical com- bases which match a reference sequence in Cramtools pression using arithmetic coding, a form of entropy cod- (Hsi-Yang Fritz et al., 2011). In SCALCE, SlimGene, ing which approaches optimality, but requires some care and Cramtools, quality scores may also be losslessly to implement efficiently (see Said (2004) for an excellent compressed. Kozanitis et al. (2011) analyzed of the review). Arithmetic coding can be thought of as a refine- effects of their algorithm on downstream analysis. Their ment of Huffman coding, the major advantage being that results suggest that while some SNP calls are affected, it is able to assign codes of a non-integral number of bits. they are primarily marginal, low-confidence calls between If a symbol appears with probability 0.1, it can be en- . hetero- and homozygosity. coded near to its optimal code length of − log2(0 1) ≈ 3 3 bits. Despite its power, it has historically seen much less use than Huffman coding, due in large part to fear of infringing on a number of patents that have now expired. Arithmetic coding is a particularly elegant means of com- Decreasing the entropy of quality scores while retaining pression in that it allows a complete separation between accuracy is an important goal, but successful lossy com- statistical modeling and encoding. In Quip, the same pression demands an understanding of what is lost. For arithmetic coder is used to encode quality scores, read example, lossy audio compression (e.g. MP3) is grounded identifiers, nucleotide sequences, and alignment informa- in psychoacoustic principles, preferentially discarding the tion, but with very different statistical models for each, least perceptible sound. Conjuring a similarly principled which gives it a tremendous advantage over general-
Recommended publications
  • Bioinformatics Study of Lectins: New Classification and Prediction In
    Bioinformatics study of lectins : new classification and prediction in genomes François Bonnardel To cite this version: François Bonnardel. Bioinformatics study of lectins : new classification and prediction in genomes. Structural Biology [q-bio.BM]. Université Grenoble Alpes [2020-..]; Université de Genève, 2021. En- glish. NNT : 2021GRALV010. tel-03331649 HAL Id: tel-03331649 https://tel.archives-ouvertes.fr/tel-03331649 Submitted on 2 Sep 2021 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. THÈSE Pour obtenir le grade de DOCTEUR DE L’UNIVERSITE GRENOBLE ALPES préparée dans le cadre d’une cotutelle entre la Communauté Université Grenoble Alpes et l’Université de Genève Spécialités: Chimie Biologie Arrêté ministériel : le 6 janvier 2005 – 25 mai 2016 Présentée par François Bonnardel Thèse dirigée par la Dr. Anne Imberty codirigée par la Dr/Prof. Frédérique Lisacek préparée au sein du laboratoire CERMAV, CNRS et du Computer Science Department, UNIGE et de l’équipe PIG, SIB Dans les Écoles Doctorales EDCSV et UNIGE Etude bioinformatique des lectines: nouvelle classification et prédiction dans les génomes Thèse soutenue publiquement le 8 Février 2021, devant le jury composé de : Dr. Alexandre de Brevern UMR S1134, Inserm, Université Paris Diderot, Paris, France, Rapporteur Dr.
    [Show full text]
  • A SARS-Cov-2 Sequence Submission Tool for the European Nucleotide
    Databases and ontologies Downloaded from https://academic.oup.com/bioinformatics/advance-article/doi/10.1093/bioinformatics/btab421/6294398 by guest on 25 June 2021 A SARS-CoV-2 sequence submission tool for the European Nucleotide Archive Miguel Roncoroni 1,2,∗, Bert Droesbeke 1,2, Ignacio Eguinoa 1,2, Kim De Ruyck 1,2, Flora D’Anna 1,2, Dilmurat Yusuf 3, Björn Grüning 3, Rolf Backofen 3 and Frederik Coppens 1,2 1Department of Plant Biotechnology and Bioinformatics, Ghent University, 9052 Ghent, Belgium, 1VIB Center for Plant Systems Biology, 9052 Ghent, Belgium and 2University of Freiburg, Department of Computer Science, Freiburg im Breisgau, Baden-Württemberg, Germany ∗To whom correspondence should be addressed. Associate Editor: XXXXXXX Received on XXXXX; revised on XXXXX; accepted on XXXXX Abstract Summary: Many aspects of the global response to the COVID-19 pandemic are enabled by the fast and open publication of SARS-CoV-2 genetic sequence data. The European Nucleotide Archive (ENA) is the European recommended open repository for genetic sequences. In this work, we present a tool for submitting raw sequencing reads of SARS-CoV-2 to ENA. The tool features a single-step submission process, a graphical user interface, tabular-formatted metadata and the possibility to remove human reads prior to submission. A Galaxy wrap of the tool allows users with little or no bioinformatic knowledge to do bulk sequencing read submissions. The tool is also packed in a Docker container to ease deployment. Availability: CLI ENA upload tool is available at github.com/usegalaxy- eu/ena-upload-cli (DOI 10.5281/zenodo.4537621); Galaxy ENA upload tool at toolshed.g2.bx.psu.edu/view/iuc/ena_upload/382518f24d6d and https://github.com/galaxyproject/tools- iuc/tree/master/tools/ena_upload (development) and; ENA upload Galaxy container at github.com/ELIXIR- Belgium/ena-upload-container (DOI 10.5281/zenodo.4730785) Contact: [email protected] 1 Introduction Nucleotide Archive (ENA).
    [Show full text]
  • Six-Fold Speed-Up of Smith-Waterman Sequence Database Searches Using Parallel Processing on Common Microprocessors
    Six-fold speed-up of Smith-Waterman sequence database searches using parallel processing on common microprocessors Running head: Six-fold speed-up of Smith-Waterman searches Torbjørn Rognes* and Erling Seeberg Institute of Medical Microbiology, University of Oslo, The National Hospital, NO-0027 Oslo, Norway Abstract Motivation: Sequence database searching is among the most important and challenging tasks in bioinformatics. The ultimate choice of sequence search algorithm is that of Smith- Waterman. However, because of the computationally demanding nature of this method, heuristic programs or special-purpose hardware alternatives have been developed. Increased speed has been obtained at the cost of reduced sensitivity or very expensive hardware. Results: A fast implementation of the Smith-Waterman sequence alignment algorithm using SIMD (Single-Instruction, Multiple-Data) technology is presented. This implementation is based on the MMX (MultiMedia eXtensions) and SSE (Streaming SIMD Extensions) technology that is embedded in Intel’s latest microprocessors. Similar technology exists also in other modern microprocessors. Six-fold speed-up relative to the fastest previously known Smith-Waterman implementation on the same hardware was achieved by an optimised 8-way parallel processing approach. A speed of more than 150 million cell updates per second was obtained on a single Intel Pentium III 500MHz microprocessor. This is probably the fastest implementation of this algorithm on a single general-purpose microprocessor described to date. Availability: Online searches with the software are available at http://dna.uio.no/search/ Contact: [email protected] Published in Bioinformatics (2000) 16 (8), 699-706. Copyright © (2000) Oxford University Press. *) To whom correspondence should be addressed.
    [Show full text]
  • Bioinformatics Courses Lecture 3: (Local) Alignment and Homology
    C E N Bioinformatics courses T R E Principles of Bioinformatics (BSc) & F B O I Fundamentals of Bioinformatics R O I I N N (MSc) T F E O G R R M A A T T I I Lecture 3: (local) alignment and V C E S homology searching V U Centre for Integrative Bioinformatics VU (IBIVU) Faculty of Exact Sciences / Faculty of Earth and Life Sciences 1 http://ibi.vu.nl, [email protected], 87649 (Heringa), Room P1.28 Divergent evolution sequence -> structure -> function • Common ancestor (CA) CA • Sequences change over time • Protein structures typically remain the same (robust against Sequence 1 ≠ Sequence 2 multiple mutations) • Therefore, function normally is Structure 1 = Structure 2 preserved within orthologous families Function 1 = Function 2 “Structure more conserved than sequence” 2 Reconstructing divergent evolution Ancestral sequence: ABCD ACCD (B C) ABD (C ø) mutation deletion ACCD or ACCD Pairwise Alignment AB─D A─BD 3 Reconstructing divergent evolution Ancestral sequence: ABCD ACCD (B C) ABD (C ø) mutation deletion ACCD or ACCD Pairwise Alignment AB─D A─BD true alignment 4 Pairwise alignment examples A protein sequence alignment MSTGAVLIY--TSILIKECHAMPAGNE----- ---GGILLFHRTHELIKESHAMANDEGGSNNS * * * **** *** A DNA sequence alignment attcgttggcaaatcgcccctatccggccttaa att---tggcggatcg-cctctacgggcc---- *** **** **** ** ****** 5 Evolution and three-dimensional protein structure information Multiple alignment Protein structure What do we see if we colour code the space-filling (CPK) protein model? • E.g., red for conserved alignment positions to blue for variable (unconserved) positions. 6 Evolution and three-dimensional protein structure information Isocitrate dehydrogenase: The distance from the active site (in yellow) determines the rate of evolution (red = fast evolution, blue = slow evolution) Dean, A.
    [Show full text]
  • A Survey on Data Compression Methods for Biological Sequences
    Article A Survey on Data Compression Methods for Biological Sequences Morteza Hosseini *, Diogo Pratas and Armando J. Pinho Institute of Electronics and Informatics Engineering of Aveiro/Department of Electronics, Telecommunications and Informatics (IEETA/DETI), University of Aveiro, 3810-193 Aveiro, Portugal; [email protected] (D.P.); [email protected] (A.J.P.) * Correspondence: [email protected]; Tel.: +351-234-370520; Fax: +351-234-370545 Academic Editor: Khalid Sayood Received: 27 June 2016; Accepted: 29 September 2016; Published: 14 October 2016 Abstract: The ever increasing growth of the production of high-throughput sequencing data poses a serious challenge to the storage, processing and transmission of these data. As frequently stated, it is a data deluge. Compression is essential to address this challenge—it reduces storage space and processing costs, along with speeding up data transmission. In this paper, we provide a comprehensive survey of existing compression approaches, that are specialized for biological data, including protein and DNA sequences. Also, we devote an important part of the paper to the approaches proposed for the compression of different file formats, such as FASTA, as well as FASTQ and SAM/BAM, which contain quality scores and metadata, in addition to the biological sequences. Then, we present a comparison of the performance of several methods, in terms of compression ratio, memory usage and compression/decompression time. Finally, we present some suggestions for future research on biological data compression. Keywords: protein sequence; DNA sequence; reference-free compression; reference-based compression; FASTA; Multi-FASTA; FASTQ; SAM; BAM 1. Introduction With the development of high-throughput sequencing (HTS) technologies, huge volumes of sequencing data are produced everyday, fast and cheaply, that can lead to upgrading the scientific knowledge of genome sequence information as well as facilitating the diagnosis and therapy.
    [Show full text]
  • Biohackathon Series in 2013 and 2014
    F1000Research 2019, 8:1677 Last updated: 02 AUG 2021 OPINION ARTICLE BioHackathon series in 2013 and 2014: improvements of semantic interoperability in life science data and services [version 1; peer review: 2 approved with reservations] Toshiaki Katayama 1, Shuichi Kawashima1, Gos Micklem 2, Shin Kawano 1, Jin-Dong Kim1, Simon Kocbek1, Shinobu Okamoto1, Yue Wang1, Hongyan Wu3, Atsuko Yamaguchi 1, Yasunori Yamamoto1, Erick Antezana 4, Kiyoko F. Aoki-Kinoshita5, Kazuharu Arakawa6, Masaki Banno7, Joachim Baran8, Jerven T. Bolleman 9, Raoul J. P. Bonnal10, Hidemasa Bono 1, Jesualdo T. Fernández-Breis11, Robert Buels12, Matthew P. Campbell13, Hirokazu Chiba14, Peter J. A. Cock15, Kevin B. Cohen16, Michel Dumontier17, Takatomo Fujisawa18, Toyofumi Fujiwara1, Leyla Garcia 19, Pascale Gaudet9, Emi Hattori20, Robert Hoehndorf21, Kotone Itaya6, Maori Ito22, Daniel Jamieson23, Simon Jupp19, Nick Juty19, Alex Kalderimis2, Fumihiro Kato 24, Hideya Kawaji25, Takeshi Kawashima18, Akira R. Kinjo26, Yusuke Komiyama27, Masaaki Kotera28, Tatsuya Kushida 29, James Malone30, Masaaki Matsubara 31, Satoshi Mizuno32, Sayaka Mizutani 28, Hiroshi Mori33, Yuki Moriya1, Katsuhiko Murakami34, Takeru Nakazato1, Hiroyo Nishide14, Yosuke Nishimura 28, Soichi Ogishima32, Tazro Ohta1, Shujiro Okuda35, Hiromasa Ono1, Yasset Perez-Riverol 19, Daisuke Shinmachi5, Andrea Splendiani36, Francesco Strozzi37, Shinya Suzuki 28, Junichi Takehara28, Mark Thompson38, Toshiaki Tokimatsu39, Ikuo Uchiyama 14, Karin Verspoor 40, Mark D. Wilkinson 41, Sarala Wimalaratne19, Issaku Yamada
    [Show full text]
  • Database and Bioinformatic Analysis of BCL-2 Family Proteins and BH3-Only Proteins Abdel Aouacheria, Vincent Navratil, Christophe Combet
    Database and Bioinformatic Analysis of BCL-2 Family Proteins and BH3-Only Proteins Abdel Aouacheria, Vincent Navratil, Christophe Combet To cite this version: Abdel Aouacheria, Vincent Navratil, Christophe Combet. Database and Bioinformatic Analysis of BCL-2 Family Proteins and BH3-Only Proteins. Gavathiotis E. BCL-2 Family Proteins. Methods in Molecular Biology, 1877, Springer Nature, pp.23-43, 2019, Methods in Molecular Biology, 978-1-4939- 8860-0. 10.1007/978-1-4939-8861-7_2. hal-02347884 HAL Id: hal-02347884 https://hal.archives-ouvertes.fr/hal-02347884 Submitted on 5 Nov 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Copyright Database and bioinformatic analysis of BCL-2 family proteins and BH3-only proteins Abdel Aouacheria 1,*, Vincent Navratil 2 and Christophe Combet 3 1 ISEM, Institut des Sciences de l’Evolution de Montpellier, Université de Montpellier, UMR 5554, CNRS, IRD, EPHE, Place Eugène Bataillon, 34095 Montpellier, France 2 PRABI, Rhône Alpes Bioinformatics Center, UCBL, Lyon1, Université de Lyon, Lyon, France. 3 Centre de Recherche en Cancérologie de Lyon, UMR Inserm U1052, CNRS 5286, Université Claude Bernard Lyon 1, Centre Léon Bérard, Lyon, France.
    [Show full text]
  • Protein Database
    UniProt Unit-2 Paper- Bioinformatics (DSE-1) B.Sc. (H) Microbiology V Sem UniProt It provide the scientific community with a comprehensive, high-quality and freely accessible resource of protein sequence and functional information UniProt - Universal protein resource Swiss-Prot & TrEMBL PIR-PSD •Merger of these three databases, since 2002 •Funded mainly by NIH (US) to be the highest quality, most thoroughly annotated protein sequence database •UniProt is a collaboration between the European Bioinformatics Institute (EMBL- EBI), the Swiss Institute of Bioinformatics (SIB) and the Protein Information Resource (PIR). •Collaboration through different tasks such as database curation, software development and support. Source of protein sequence data • Protein sequencing is rare • Most protein sequence Large-scale sequencing Individual Patent derived from nucleotide data projects scientists Offices Nucleotide sequencing Submit Protein sequencing Submit Nucleotide Derive Protein sequence protein sequence sequence database database More than 95 % of the protein sequences provided by UniProtKB are derived from the translation of the coding sequences (CDS) Protein sequence is mainly derived data submit DNA sequence ACGCTCGTACGCATCGTCACTACTAGCTACGACGACGACACGCTACTACTCGACGATTCT may not have direct Predicted Predicted transcribe Predicted evidence start splice sites stop Derived mRNA sequence AUGCGUAGUGAUGAAUGCUGCUGUGCGAUGAGCUGC translate Derived protein sequence MRSNECCCAMSC UniProt • The Universal Protein Resource (UniProt) is a comprehensive resource for protein sequence and annotation data. • The UniProt databases are: 1. UniProt Knowledgebase (UniProtKB), 2. UniProt Reference Clusters (UniRef), 3. UniProt Archive (UniParc). UniProtKB UniProtKB • Reviewed (Swiss-Prot) - Manually annotated Records with information extracted from literature and curator-evaluated computational analysis and and scientific conclusions. • Is a high quality non-redundant protein sequence database • Unreviewed (TrEMBL) - Computationally analyzed Records that await full manual annotation.
    [Show full text]
  • Sequence Database Searching
    Sequence Database Searching 2007-01-14 Gao, Ge Center for Bioinformatics, Peking University Sequence Alignment: A Quick Review Object: see how close two sequences are Usages: To infer functions. To determine the common area of some sequences To infer protein structure, if the structure of one of the sequences is known. To “guess” whether they are descended from a common ancestor (and construct evolutionary trees). © Copyright 2006 Center for Bioinformatics, Peking University Sequence Alignment: in Biology The purpose of a sequence alignment is to line up all residues in the sequence that were derived from the same residue position in the ancestral gene or protein in any number of sequences A B A B © Copyright 2006g aCpe n=te irn fsoer rBtiooinf oorrm dateicles,t iPoenking University Sequence Alignment: Scoring GAATC GAAT-C -GAAT-C CATAC C-ATAC C-A-TAC GAATC- GAAT-C GA-ATC CA-TAC CA-TAC CATA-C Scoring function: measure the quality of a candidate alignment. scoring matrix, gap penalty © Copyright 2006 Center for Bioinformatics, Peking University Sequence Alignment : Global vs. Local Global alignments: align residues in whole sequence, are most useful when the sequences are similar and of roughly equal size. Algorithm: Needleman-Wunsch Local alignments: align residues in regions are more useful for diverged sequences Algorithm: Smith-Waterman With sufficiently similar sequences, there is no difference between local and global alignments. © Copyright 2006 Center for Bioinformatics, Peking University Sequence Database Searching Rather than do the alignment pair-wise, it’s necessary to run database searching in a high-throughput style. Identify similarities between novel query sequences whose structures and functions are unknown and uncharacterized sequences in (public) databases whose structures and functions have been elucidated.
    [Show full text]
  • Accessing Molecular Biology Information * Genome Browsers
    Accessing molecular biology information * Genome browsers - UCSC * NCBI * Galaxy Flow of genetic information and databases Exon 1 Exon 2 Exon 3 Exon 4 intron intron intron DNA transcription 5' 3' RNA Genbank/ EMBL splicing 5' UTR 3' UTR polyA mature coding sequence mRNA translation protein GenPept / SwissProt folding / UniProt Protein Data Bank (PDB) Databases, cont. Redundancy at GenBank => RefSeq Many sequences are represented more than once in GenBank 2003 RefSeq collection : curated secondary database non-redundant selected organisms •Genome DNA (assemblies) •Transcripts (RNA) •Protein http://www.ncbi.nlm.nih.gov/books/bv.fcg i?rid=handbook RefSeq vs GenBank GenBank RefSeq Not curated Curated Author submits NCBI creates from existing data Only author can revise NCBI reivses as new data emerge Multiple records from same loci Single records for each molecule common of major organisms Records can contradict each other No limit to species included Limited to model organisms Akin to primary literature Akin to review articles Archives with nucleotide sequences • Genbank/EMBL • Sequence read archive (NCBI) • GEO (Gene expression omnibus, NCBI) • 1000 Genomes Project • The Cancer Genome Atlas • The Cancer Genome Project • Species-specific databases like –FlyBase – WormBase – Saccharomyces Genome Database Genome sequencing using a shotgun approach Sequenced eukaryotic genomes Sequencing going wild ... BGI : "capacity to sequence the equivalent of 1,600 complete human genomes each day" "BGI and BGI Americas aim to build a library of digital
    [Show full text]
  • Introduction to Bioinformatics
    INTRODUCTION TO BIOINFORMATICS > Please take the initial BIOINF525 questionnaire: < http://tinyurl.com/bioinf525-questions Barry Grant University of Michigan www.thegrantlab.org BIOINF 525 http://bioboot.github.io/bioinf525_w16/ 12-Jan-2016 Barry Grant, Ph.D. [email protected] Ryan Mills, Ph.D. [email protected] Hongyang Li (GSI) [email protected] COURSE LOGISTICS Lectures: Tuesdays 2:30-4:00 PM Rm. 2062 Palmer Commons Labs: Session I: Thursdays 2:30 - 4:00 PM Session II: Fridays 10:30 - 12:00 PM Rm. 2036 Palmer Commons Website: http://tinyurl.com/bioinf525-w16 Lecture, lab and background reading material plus homework and course announcements MODULE OVERVIEW Objective: Provide an introduction to the practice of bioinformatics as well as a practical guide to using common bioinformatics databases and algorithms 1.1. ‣ Introduction to Bioinformatics 1.2. ‣ Sequence Alignment and Database Searching 1.3 ‣ Structural Bioinformatics 1.4 ‣ Genome Informatics: High Throughput Sequencing Applications and Analytical Methods TODAYS MENU Overview of bioinformatics • The what, why and how of bioinformatics? • Major bioinformatics research areas. • Skepticism and common problems with bioinformatics. Bioinformatics databases and associated tools • Primary, secondary and composite databases. • Nucleotide sequence databases (GenBank & RefSeq). • Protein sequence database (UniProt). • Composite databases (PFAM & OMIM). Database usage vignette • Searching with ENTREZ and BLAST. • Reference slides and handout on major databases. HOMEWORK Complete the initial
    [Show full text]
  • An Open-Access Platform for Glycoinformatics
    Glycobiology vol. 21 no. 4 pp. 493–502, 2011 doi:10.1093/glycob/cwq188 Advance Access publication on November 23, 2010 EUROCarbDB: An open-access platform for glycoinformatics Claus-Wilhelm von der Lieth 2,†, Ana Ardá Freire 3, relational database containing glycan structures, their Dennis Blank 4, Matthew P Campbell 5,6,11, Alessio Ceroni 7, biological context and, when available, primary and David R Damerell 7, Anne Dell 7,RaymondADwek6, interpreted analytical data from high-performance liquid Beat Ernst 8, Rasmus Fogh 9,12, Martin Frank 2, chromatography, mass spectrometry and nuclear magnetic Hildegard Geyer 4, Rudolf Geyer 4, Mathew J Harrison 9,13, resonance experiments. Database content can be accessed Kim Henrick 9,14, Stefan Herget 2, William E Hull 2, via a web-based user interface. The database is complemen- John Ionides 9,14, Hiren J Joshi 2,9, Johannis P Kamerling 3, ted by a suite of glycoinformatics tools, specifically designed 3 3,12 Bas R Leeflang , Thomas Lütteke , to assist the elucidation and submission of glycan structure Downloaded from Magnus Lundborg 10, Kai Maass 4,15, Anthony Merry 9, and experimental data when used in conjunction with con- René Ranzinger 2,16, Jimmy Rosen 3, Louise Royle 5,6, temporary carbohydrate research workflows. All software Pauline M Rudd 5,6, Siegfried Schloissnig 2, tools and source code are licensed under the terms of the Roland Stenutz 10, Wim F Vranken 9,14, Göran Widmalm 10, Lesser General Public License, and publicly contributed glycob.oxfordjournals.org and Stuart M Haslam 1,7 structures and data are freely accessible.
    [Show full text]