Behavioural Genetics of the Leaf-Cutting Ant Acromyrmex Echinatior

faculty of science university of copenhagen

Behavioural Genetics of the Leaf-Cutting Ant Acromyrmex echinatior

Jack Howe MSc Thesis: 60 ETCS Academic Supervisors: Jacobus J Boomsma and Morten Schiøtt Centre of Social Evolution, University of Copenhagen September 2015

Danish National Research Foundation Centre for Social Evolution

Preface

This work is submitted to fulﬁl the requirements for a 60 ECTS thesis for the completion of the MSc in Biology at the University of Copenhagen. It marks the completion of 12 months of work under the supervision of Associate Professor Morten Schiøtt and Professor Jacobus J. Boomsma at the Centre for Social Evolution (CSE). A total of 1 month was spent at the Smithsonian Tropical Research Institute, in Gamboa, Panama.

This work consists of three chapters, covering a range of topics within social evolution: genomic imprinting, the division of labour and symbiont transmission. Each chapter represents an independent line of research, and each is presented in turn, following an introduction that provides a brief background and justiﬁcation of each. The ﬁrst chapter presents work conducted in collaboration with Qiye Li and Zongji Wang of the Beijing Genomics Institute (BGI), who kindly granted me access to the remarkable data set that was used as the foundation of this chapter. Some of the data that are presented in chapter 2 have previously submitted for the completion of a 7.5ECTS speciale-projekt in 2014. Sucient new data have been added, in the form of two further experiments, that it is submitted again here as part of a larger thesis. These data were also presented as a poster at the 2015 ESEB conference held in Lausanne in August 2015, this poster is included at the end of the thesis. The third chapter is based on work conducted during a two week period in Gamboa, Panama during May of 2015. Finally, I discuss the questions arising from this work, and potential avenues of future study.

The work of each chapter is ongoing, and each will contribute to either manuscripts to be submitted for review in the near future, or will form the basis of work to be completed over the course of a PhD commencing Fall 2015.

The cover photo was taken by David Nash.

Contents

General Abstract i

List of Figures ii

List of Tables iv

Introduction 1

0.1 BehaviouralGeneticsintheSocialInsects ...... 1

0.2 TheAttineAntsasaModelSystem...... 4

0.3 Conﬂict and Imprinting in Insect Societies ...... 6

0.4 The Self-Organisation of Insect Colonies ...... 9

0.5 Ant-FungusSymbiosis ...... 11

1 The Use of Transcriptomic Data to Identify Imprinted Genes in Social Insects 27

1.1 Whole-GenomeSearchesUsingTranscriptomics ...... 32

1.2 Application to Acromyrmex echinatior ...... 38

1.2.1 Methods ...... 39

1.2.2 Results ...... 45

1.2.3 Discussion ...... 49

Figures...... 54

Appendices 61 2 A Potential Role for the Neuropeptide Tachykinin in Acromyrmex echinatior Division of Labour 77

2.1 Methods ...... 84

2.2 Results ...... 90

2.3 Discussion ...... 94

Figures...... 100

3 Horizontal Transfer of a Leaf-Cutting Ant’s Fungal Symbiont In Situ 119

3.1 Methods ...... 123

3.2 Results ...... 124

3.3 Discussion ...... 126

Figures...... 129

Conclusions and Future Directions 134

ESEB Poster 2015 140

Acknowledgements 141 General Abstract

The fungus-growing ant Acromyrmex echinatior is increasingly being used as a model species for the study of social evolution owing to its obligate association with a symbiotic fungus and a range of bacteria, its complicated colony kin-structure and caste system, and the increasing availability of genetic data. I utilised this data to explore three evolutionary questions. First, I conducted the ﬁrst genome-wide survey for genomic imprinting in an ant, and developed novel techniques to search for imprinting in previously intractable species. Although this search has been unsuccessful so far, a number of candidate genes have been identiﬁed that warrant further study, and the techniques developed may aid in the search for imprinted genes in the social insects. Second, I tested for the role of tachykinin, a neuropeptide-encoding gene, in the aggressive division of labour within a colony. I compared behaviour and gene expression among the various worker castes and in various stages of the reproductive females. I also manipulated the aggression of virgin queens and tested for changes in gene expression. Expression patterns suggest that tachykinin may play a role in the division of labour, at least in the worker castes, but there are inconsistencies in the reproductive caste. Finally, the fortunate discovery of clusters of very young A. echinatior colonies, in a stage where the queen is still foraging, enabled a test for horizontal transmission of the fungal symbiont in a natural setting. This work demonstrated that young A. echinatior queens will search for and adopt novel symbiont fungal symbionts after the loss of their own.

i List of Figures

1.1 PredictionsofASEUnderGenomicImprinting...... 54

1.2 PredictionsofASEwithVaryingQueenGenotypes ...... 55

1.3 Allele Speciﬁc Expression of Vitellogenin 1 : GenomeWideData ...... 56

1.4 Allele Speciﬁc Expression of Major Royal Jelly Protein III : Genome Wide Data...... 57

1.5 Allele Speciﬁc Expression of Major Royal Jelly Protein III: ddPCR Data . . 58

1.6 Allele Ratios for Major Royal Jelly Protein III: Pooled Male DNA ...... 59

1.7 Allele Ratios for Major Royal Jelly Protein III: Individual Male DNA . . . . 60

2.1 Aggression of A. echinatior Castes ...... 100

2.2 Expression levels of Tachykinin and Tachykinin-Receptor 99D ...... 101

2.3 Relationship Between Tachykinin and Tachykinin-Receptor 99D Expression . 102

2.4 Brain Allometry of A. echinatior Castes ...... 103

2.5 Brain-Size Corrected Expression Levels ...... 104

2.6 Worker-likeBehaviourofWinglessVirginQueens ...... 105

2.7 Expression of Tac and TacR99D After Wing-Clipping ...... 106

3.1 An Acromyrmex echinatior queen with her nascent fungus garden ...... 119

3.2 FungusStealing:SiteA ...... 129

ii 3.3 Fungus Stealing: Site B ...... 130

3.4 TheE↵ect of Distance on Stealing Fungus Vs. Relocating ...... 131

iii List of Tables

1 GeneswithSigniﬁcantASE ...... 61

2LociConsistentwithImprinting...... 63

iv Introduction

Ants are so much like human beings as to be an embarrassment. They

farm fungi, raise aphids as livestock, launch armies into war, use

chemical sprays to alarm and confuse enemies, capture slaves, engage

in child labour, exchange information ceaselessly. They do everything

but watch television.

The Lives of a Cell, Lewis Thomas, 1974

0.1 Behavioural Genetics in the Social In- sects

In the past decade or so, several ﬁelds of social biology have begun to converge upon genetics (Johnson and Linksvayer, 2010; Robinson et al., 2005). As the fundamental unit of evolution (Dawkins, 1976), it is perhaps not surprising that the gene is receiving so much attention, but up until very recently, the genetic underpinnings of traits were only really the purview of those of those working with the few model organisms for which there was sucient genomic data: Drosophila, Mus,orCaenorhabditis. With the precipitous decline in the cost of DNA-sequencing (Sboner et al., 2011), attention is now being turned to the complex societies of the social insects, attempting to decipher the molecular basis of their social organisation, and to determine the e↵ects of colony life on the genome (Robinson et al., 2005).

There are two broad methods applied in the search of genetic e↵ects on behaviour, which of the two is applied depends on the availability of genomic data for the organism

1 under study, and its experimental tractability (Oldroyd and Thompson, 2006). The reverse- genetics approach tests the role of few candidate genes with known functions from model organisms in novel systems (Fitzpatrick et al., 2005). In contrast, a forward-genetics approach requires no such prior knowledge. Forward-genetic approaches test as many genes as possible throughout the genome to identify candidate genes. This has been, until recently, limited to species that can be bred in the lab, or can be subject to mutagenesis screens (Ol- droyd and Thompson, 2006). Now however, high-throughput sequencing is making many more organisms accessible to forward-genetic approaches, radically changing the ﬁeld of behavioural genetics (Gadau et al., 2012; Libbrecht et al., 2013; Schneeberger and Weigel, 2011)

Of the two techniques, the candidate gene approach has been the most successful in the social insects, and a number of genes have been identified with roles in caste determination, and the division of labour in particular. The candidate gene approach is dependent on the conservation of genes across taxa; that social behaviours are encoded by genes that control similar phenotypes in other, better-studied organisms (Fitzpatrick et al., 2005). The identification of the protein-kinase encoded by the forager gene in the foraging behaviour of Drosophila and the honeybee have become a paradigmatic example of the application of reverse-genetics in the social insects. Two distinct foraging phenotypes were identified in Drosophila larvae: those that moved relatively little, and those that left long foraging trails. Careful breeding first narrowed the gene responsible for this down to chromosome 2 (Sokolowski, 1980), and subsequent mutagenesis screens identified the responsible gene as a cGMP-dependent Protein Kinase (Osborne et al., 1997). Targeted measurements of honeybee forager (AmFor) mRNA levels in di↵erent behavioural tasks (Ben-Shahar et al., 2003), and direct measurements of protein-kinase activity (Ben-Shahar, 2005) demonstrated dif- ferences among foraging and nursing bees; while pharmacological manipulation of protein- kinase activity caused an early switch to foraging (Ben-Shahar, 2005). This has since been repeated in ants, and it appears that protein kinase activity has separately evolved a role

2 in foraging in the ants– although kinase activity appears inversely correlated with foraging activity (Lucas and Sokolowski, 2009; Lucas et al., 2010; Manfredini et al., 2014).

The relative dearth of successful forward-genetic approaches in the social insects, by comparison, is predominantly a result of their much more complex life-history compared to non-social insects such as Drosophila.Socialinsectsarenotwell-suitedforthelabora- tory: they are much more expensive to rear, more dicult to breed, have longer generation times, are vulnerable to inbreeding depression and only small population sizes can be maintained (Page et al., 2002). Gregor Mendel apparently had intentions of conducting his inheritance experiments using in the honeybee, but was unable to control their breeding suciently(Orel, 1996; Page et al., 2002): artiﬁcial insemination was not perfected till over acenturylater(Laidlaw,1987).

With the publication of the first linkage map, alongside the development of quantitative trait-loci (QTL) analyses, in the honeybees in the final few years of the 20th century (Hunt and Page, 1995), forward-genetics in the social insects could begin in earnest, and have been used to identify loci associated with foraging (Page et al., 1998; Rueppell et al., 2004), among other traits (Oldroyd and Thompson, 2006). The field was greatly enhanced the publication of the honeybee genome (The Honeybee Genome Sequencing Consortium, 2006), and particularly following the introduction of ‘next-generation’ sequencing technol- ogy (Sboner et al., 2011), the number of forward genetics studies in the social insects has greatly increased, particularly exploring di↵erences in gene expression among di↵erent castes, both queen versus worker, and among behaviourally distinct worker castes themselves (eg. Chandrasekaran et al. (2011); Chen et al. (2012); Greenberg et al. (2012); Kocher et al. (2015); Wang et al. (2012)).

Moreover, these technological breakthroughs have opened other social insect species to both reverse genetic studies, utilising the abundance of genomes, and increasingly cheap transcriptomics (eg.Bonasio et al. (2010); Manfredini et al. (2014); Simola et al. (2013);

3 Smith et al. (2012)). In particular, there has been a rapid increase in the number of ant genomes published in recent years (Gadau et al., 2012; Libbrecht et al., 2013): 8 ant genomes are now freely available online (Munoz-Torres et al., 2011). As a consequence, the ants o↵er an opportunity to independently test ideas generated within the bees, and they are rapidly approaching the bees as the model system of choice in the study of social insects: they exhibit a wider-range of colony kin structures, some possess a wide range of morphologically distinct worker castes, and are now one of the most well-represented groups in genomic databases (Libbrecht et al., 2013).

0.2 The Attine Ants as a Model System

The attine ants, in particular, have received much attention. There are published genomes for 2 species Atta cephalotes (Suen et al., 2011) and Acromyrmex echinatior (Nygaard et al., 2011), another 4 are currently in progress, and many more have been proposed as targets (http://ldl.genomics.org.cn/page/showinsects.jsp).

The attines have received this attention, in part, because of their unique life-history; all attines are obligately associated with a symbiotic fungus on which they are nutritionally dependent (Weber, 1972). The fungus-ant association originated around 50 MYA in the neotropics, and the fungus-growing ants are now a diverse group represented by over 230 species (Mueller et al., 2001; Schultz and Brady, 2008). They can be classiﬁed into three broad groups: the lower attines, the higher attines, and the leaf-cutting ants.

The basal lower attines have relatively small, simple colonies consisting of only a few hun- dred individuals they have a queen that mates only once and a monomorphic worker caste. They feed their fungus on a range of dead plant matter, nectar and insect frass(De Fine Licht and Boomsma, 2010). The fungus that they raise is relatively unspecialised, with close rela-

4 tives found unassociated with ants (Vo et al., 2009). One lower-attine genus (Cyphomyrmex) raises its fungus as a yeast rather than mycelium as in the other species (Mueller et al., 1998). A second, Apterostigma,hasreplacedthetypicalLeucocoprinus species with an unrelated coral fungus (family Pterula) (Mueller et al., 1998). One unusual species, My- cocepurus smithii appears to be reproduce asexually, at least in some populations (Himler et al., 2009; Rabeling et al., 2009).

The higher-attines, Trachymyrmex and Sericomyrmex,havecolonieswithaworkforce that may approach a thousand or so. The workers are still monomorphic, and the queen is still only singly mated (Dijkstra and Boomsma, 2008). However, they feed their fungus amorederiveddietthatincludesfreshvegetation,petalsandfruit.Themutualismalso shows a greater degree of specialisation between the partners: no free-living relatives of the fungus crop are known (Mikheyev et al., 2006), and the fungus has an altered enzyme proﬁle and grows specialised nutritional swellings (gongylidia) upon which the ants predominantly feed (De Fine Licht et al., 2010).

With the transition to the leaf-cutting ants, which consists of the two genera Atta and Acromyrmex, the queen becomes multiply mated (Villesen et al., 2002) and the colonies are much larger and more complex. An Atta colony can contain millions of individuals, from 7 morphologically distinct worker castes of enormous diversity (H¨olldobler and Wilson, 1990). As their name suggests leaf-cutting ants predominantly feed their fungus on fresh foliage, and the two symbiotic partners show an even greater degree of specialisation to one another – the leaf-cutting ant fungus shows a more derived genome, and specialises in the degradation of live plant matter (Schiøtt et al., 2008).

In the subsequent chapters of this thesis I utilise the increasing availability of molecular data in the fungus-growing ants to explore three of the highly derived characteristics of the leaf-cutting ant Acromyrmex echinatior.FortheﬁrstchapterIusedaforward-genetics approach to conducted what was, at the time of inception, the ﬁrst genome-wide study

5 for genomic imprinting in any social insect, in order to determine if genomic-imprinting could mediate conflicts that result from a multiply-mated queen. In the second chapter, areverse-geneticsapproachisused:recentfindingsinDrosophila (Asahina et al., 2014) suggested a potential role for a conserved neuropeptide (tachykinin) in the behavioural di↵erentiation of the various castes, this possibility is explored. The final chapter does not take a behavioural genetics approach, but instead explores the transmission dynamics of the fungal symbiont.

The aims of this thesis are therefore broad, but all attempt to improve our understanding of this fascinating species, and to add to its claims as an important model organism for the study of social evolution.

0.3 Conﬂict and Imprinting in Insect Soci- eties

Hamiltonian inclusive fitness theory states that the unmated workers give up their own reproductive potential because of the high-relatedness within a colony (Hamilton, 1964a,b, 1972). Under single mating a female worker (all workers in the social hymenoptera are female) is equally related to her siblings as she is to her own o↵spring, she is therefore indi↵erent between raising an o↵spring or a sibling, and any incremental benefit in raising siblings will be selected for (Boomsma, 2009). However, individuals within a colony are not clonally related. Consequently, there is great potential for conflict over worker production of male eggs, policing of worker egg-laying, sex ratio, nepotism and caste fate (Ratnieks et al., 2006). These conflicts have provided strong support for inclusive fitness theory.

In the more derived social insects, such as the leaf-cutting Acromyrmex, the queens

6 mate multiply and relatedness within a colony consequently is much lower, increasing the possibility for conﬂict. Ac. echinatior queens mate with 5 or so males before colony foundation (Hughes et al., 2003). We see for example, consistent with the drop in relatedness, that the genes of these males appear to vie to preferentially end up in a larvae destined to be queens, rather than workers (Hughes and Boomsma, 2008), in an attempt to parasitise the altruism of worker half-sisters for their own reproduction.

One class of conflicts that has been the subject of much discussion, but has yet to be conclusively demonstrated, is the intra-genomic conflict between the the maternally-derived and the paternally derived halves of an individual’s genome (Queller and Strassmann, 2002). It is hypothesised that conflict should arise as individuals within a colony are not equally related through the matriline (through the queen) and the patrilines (through the males). In a species with multiple mating, individuals in a colony are much more closely related through the queen than they are through their fathers. The paternally-derived genome is expected, therefore, to be much more selfish than that inherited from the queen. This disparity is hypothesised to influence many of the well-studied conflicts in social insects, and in some cases is entirely responsible for the observed conflict; the predictions are reviewed in Queller (2003).

The intra-genomic conflict is expected to manifest as parent-specific gene expression (Haig and Graham, 1991; Haig and Westoby, 1989), where a gene is expressed or silenced depending on its parent of origin, an e↵ect known as genomic-imprinting. In the social insects, genomic imprinting theory was derived from theory of analogous conflicts in mammals.

The logic in mammals is much the same (Haig and Graham, 1991; Haig and Westoby, 1989), and was developed to explain the unusual patterns of expression that were observed in some genes (Barlow et al., 1991; Dechiara et al., 1991; Johnson, 1974). In mammals, where a female mates with more than one male, conﬂicts arise between the maternally-

7 inherited (matrigenic (Queller, 2003)) and paternally-inherited (patrigenic (Queller, 2003)) alleles, much as above. Again, a patrigene cares less for the mother’s future fitness, and is expected to be more selfish than a matrigene. We observe this expression pattern in the insulin-like growth factor II (Igf2 ), a gene that increases resource acquisition from the mother and is expressed only from the patrigene, and the expression of the Igf2-receptor, that counteracts these e↵ects and is only expressed from the matrigene (Haig and Graham, 1991). Many other such genes are found, many also influencing resource allocation during development: Ins1, Ins2, Peg3, and Rasgrf1 increase growth and are expressed only from the patrigene, while Meg3, Gnas, H19, and Mash2 are expressed only from the matrigene and have the opposite e↵ects.

One criticism levelled at the kinship theory is that it was only proposed after the unusual expression patterns in mammals had been described, and it has therefore not been subject to a truly independent test (Spencer and Clark, 2014). There are many other theories of genomic imprinting, that are not all necessarily mutually exclusive. Some argue that imprinting would allow for greater coordination with the mother during development in mammals if only the maternal allele was expressed in the o↵spring (Wolf, 2013). Similarly, it may be better to express those genes that are inherited from the mother along with the mitochondria (Wolf, 2009). Spencer and Clark (2006) argues that sex-speciﬁc selection or migration patterns could promote imprinting, if it is favourably to more closely resemble one of your parents. Finally, it has been proposed that imprinting may have evolved to prevent the occurrence of spontaneous development of unfertilised eggs in the ovaries (Weisstein et al., 2002), or to suppress transposable elements (McDonald et al., 2005). The alternative theories are discussed in depth in a recent imprinting edition of heredity (Haig, 2014; Patten et al., 2014; Spencer and Clark, 2014).

Although I would consider the many imprinted genes found since the kinship theory was proposed as strong support, the testing of the a priori predictions of the kinship theory in the social insects would provide a rigorous test for the kinship theory, as well as the

8 inclusive ﬁtness theory that underlies it (Queller, 2003). Here we aim to test the kinship theory by searching for genomic imprinting in a multiply-mated social insect.

0.4 The Self-Organisation of Insect Colonies

Acromyrmex echinatior also has morphologically distinct worker castes that contribute to a complex division of labour. This division of labour is distinct from the reproductive division outlined above, instead this describes how di↵erent individuals within the sterile workforce will tend to perform di↵erent tasks. The division of labour is hypothesised to increase the eciency and productivity of a colony by facilitating task specialisation and reducing the time spent switching between tasks, and is regarded as one of the traits that has facilitated the great ecological success of the social insects (Wilson et al., 1971).

What is perhaps most remarkable about the division of labour in a social in the social insects, is the lack of any central control mechanism; the division of labour is decentralised, it is an emergent property of the actions of individual workers (Boomsma and Franks, 2006). How the workers organise themselves is of great interest if we are to understand what makes these insects so successful, and an understanding of these mechanisms can inform ﬁelds as far removed as the design of autonomous cooperative robots (Krieger et al., 2000; Labella et al., 2006). There are many models that attempt to capture the decision-making progress of an individual, and they can be divided into three broad groups (Duarte et al., 2011): foraging-for-work, social information and threshold-based models.

The main strength of the foraging-for-work hypotheses are their simplicity. In these models, all individuals are behaviourally identical, and an individual will search for a task, complete that task and then search for another (Franks and Tofts, 1994). If these tasks are spatially distributed, a division of labour will occur. These very simple models do capture

9 some of the patterns observed in colonies, older individuals will tend to perform tasks further away from the nests, while younger individuals will be concentrated in and around the nest – a pattern that is observed in both bees (Johnson, 2010) and ants (Camargo et al., 2007). These models, however, do not tend to capture the ability of a colony to respond rapidly to environmental changes.

In contrast, the ‘social-information’ models are quite complex. These suppose that the workers are constantly exchanging information that is used to inform decisions (Duarte et al., 2011). This information may allow individuals to assess the current distribution of workers across tasks and adjust if this is not optimal (Gordon et al., 1992), or may be an assessment of task proﬁtability, with workers switching to tasks that are advertised as more proﬁtable (Pacala et al., 1996).

The threshold models assume that individuals have di↵erent propensities to perform a task depending on an internal threshold– if the stimulus is above the response threshold, the worker will perform the task (Robinson et al., 2011). A population of individuals with varying thresholds will exhibit a division of labour, that is ﬂexible to the colony’s needs (Myerscough and Oldroyd, 2004). There are an increasing number of threshold- based models, which vary in whether the thresholds are ﬁxed (Bonabeau et al., 1998) or are allowed to move in response to the performance of a task (Bonabeau and Theraulaz, 1999), creating even greater specialisation. The threshold models have the most empirical support, we know that individuals di↵er in their sensitivity to stimuli from both behavioural (Jones et al., 2004) and molecular data (Ben-Shahar, 2005; Oldroyd and Thompson, 2006). Furthermore, variable thresholds do not require the evolution of novel mechanisms, but can utilise standing variation in behaviour: when solitary bee species are forced to form pairs, one will specialise in digging while the other guards the nest entrance, a division consistent with their tendency to forage and guard when they are alone (Jeanson et al., 2005, 2008).

Such thresholds are thought to occur in the behavioural di↵erentiation of A. echinatior

10 worker castes (Larsen et al., 2014), in the second chapter I tested whether the expression of a candidate gene is consistent with their hypothesised motivational states.

0.5 Ant-Fungus Symbiosis

The ﬁnal chapter cannot be said to fall within ‘behavioural ecology’. It explores another highly derived aspect of the leaf-cutter ants: their obligate association with a fungal symbiont, and the dynamics of how the symbiont is transmitted.

The ant-fungus mutualism, described brieﬂy above, is a remarkable partnership. A. echinatior and its fungal crop show intricate adaptations to their symbiotic lifestyle indica- tive of their long-history of coevolution together: the fungus is highly specialised to break down fresh leaves, and the ants have evolved their characteristic leaf-cutting behaviour (We- ber, 1972). The fungus also produces costly gongylidia: nutritionally rich hyphal swellings that develop only to serve as the ants’ main source of food. These gongylidia are packed with fungal enzymes that pass through the gut of the ant, and are transferred to the leaves in fecal drops that the ants deposit on freshly cut leaves (Schiøtt et al., 2010), initiating their digestion.

Consistent with this tight coevolution, and as is observed in many ancient mutualisms, the ants’ fungus is vertically inherited. A gyne carries a small pellet of fungal hyphae from her natal garden, and uses this to establish her colony (Fern´andez-Mar´ınet al., 2004). Fur- ther, both the ant and the fungus act to maintain strict monoculture within a colony (Ivens et al., 2009; Poulsen and Boomsma, 2005), further stabilising the mutualism. However, (Bot et al., 2001; Mikheyev et al., 2007) phylogenies and analyses of population structure suggests the symbiont is transmitted horizontally regularly. It is hypothesised that this occurs during the early stages of colony development, before the emergence of the worker

11 caste, as can be prompted in the lab (Poulsen et al., 2009).

The ﬁnal chapter explores whether this mode of transmission can occur outside of a laboratory setting.

12 Bibliography

K. Asahina, K. Watanabe, B. J. Duistermars, E. Hoopfer, C. R. González, E. A. Eyjólfsdóttir, P. Perona, and D. J. Anderson. Tachykinin-Expressing Neurons Con- trol Male-Specific Aggressive Arousal in Drosophila. Cell, 156(1-2):221–235, Jan. 2014. doi: 10.1016/j.cell.2013.11.045. URL http://linkinghub.elsevier.com/retrieve/ pii/S0092867413015365.

D. P. Barlow, R. Stoger, B. G. Herrmann, K. Saito, and N. Schweifer. The mouse insulin-like growth factor type-2 receptor is imprinted and closely linked to the tme locus. Nature, 349(6304):84–87, 01 1991. URL http://dx.doi.org/10.1038/349084a0.

Y. Ben-Shahar. The foraging gene, behavioral plasticity, and honeybee division of labor. Journal of Comparative Physiology A,191(11):987–994,2005.

Y. Ben-Shahar, H.-T. Leung, W. Pak, M. Sokolowski, and G. Robinson. cgmp-dependent changes in phototaxis: a possible role for the foraging gene in honey bee division of labor. Journal of Experimental Biology,206(14):2507–2515,2003.

E. Bonabeau and G. Theraulaz. Role and variability of response thresholds in the regulation of division of labor in insect societies. In Information processing in social insects,pages 141–163. Springer, 1999.

E. Bonabeau, G. Theraulaz, and J.-L. Deneubourg. Fixed response thresholds and the regulation of division of labor in insect societies. Bulletin of Mathematical Biology,60 (4):753–807, 1998.

R. Bonasio, G. Zhang, C. Ye, N. S. Mutti, X. Fang, N. Qin, G. Donahue, P. Yang, Q. Li, C. Li, et al. Genomic comparison of the ants camponotus ﬂoridanus and harpegnathos saltator. science,329(5995):1068–1071,2010.

13 J. J. Boomsma. Lifetime monogamy and the evolution of eusociality. Philosophical transactions of the Royal Society of London. Series B, Biological sciences,364(1533):3191–3207, 2009. doi: 10.1098/rstb.2009.0101. URL http://rstb.royalsocietypublishing.org/ cgi/doi/10.1098/rstb.2009.0101.

J. J. Boomsma and N. R. Franks. Social insects: from selﬁsh genes to self organisation and beyond. Trends in Ecology & Evolution,21(6):303–308,62006.doi:http://dx.doi.org/ 10.1016/j.tree.2006.04.001. URL http://www.sciencedirect.com/science/article/ pii/S016953470600125X.

A. Bot, S. Rehner, and J. J. Boomsma. Partial incompatibility between ants and symbiotic fungi in two sympatric species of acromyrmex leaf-cutting ants. Evolution,55(10):1980– 1991, 2001.

R. S. Camargo, L. C. Forti, J. F. S. Lopes, A. P. P. Andrade, and A. L. T. Ottati. Age polyethism in the leaf-cutting ant Acromyrmex subterraneus brunneus Forel, 1911 (Hym., Formicidae). Journal of Applied Entomology,131(2):139–145,Mar.2007.doi: 10.1111/j.1439-0418.2006.01129.x. URL http://onlinelibrary.wiley.com/doi/10. 1111/j.1439-0418.2006.01129.x/full.

S. Chandrasekaran, S. A. Ament, J. A. Eddy, S. L. Rodriguez-Zas, B. R. Schatz, N. D. Price, and G. E. Robinson. Behavior-speciﬁc changes in transcriptional modules lead to distinct and predictable neurogenomic states. Proceedings of the National Academy of Sciences,108(44):18020–18025,2011.

X. Chen, Y. Hu, H. Zheng, L. Cao, D. Niu, D. Yu, Y. Sun, S. Hu, and F. Hu. Transcriptome comparison between honey bee queen- and worker-destined larvae. Insect Biochemistry and Molecular Biology, 42(9):665 – 673, 2012. ISSN 0965-1748. doi: http://dx.doi.org/ 10.1016/j.ibmb.2012.05.004. URL http://www.sciencedirect.com/science/article/ pii/S0965174812000756.

T. H. G. S. Consortium. Insights into social insects from the genome of the honeybee apis

14 mellifera. Nature, 443(7114):931–949, 10 2006. URL http://dx.doi.org/10.1038/ nature05260.

R. Dawkins. The Selﬁsh Gene. Oxford University Press, 1976.

H. H. De Fine Licht and J. J. Boomsma. Forage collection, substrate preparation, and diet composition in fungus-growing ants. Ecological Entomology,35(3):259–269,2010.

H. H. De Fine Licht, M. Schiøtt, U. G. Mueller, and J. J. Boomsma. Evolutionary transitions in enzyme activity of ant fungus gardens. Evolution,64(7):2055–2069,2010.

T. M. Dechiara, E. J. Robertson, and A. Efstratiadis. Parental Imprinting of the Mouse Insulin-Like Growth Factor-Ii Gene. Cell, 64(4):849–859, 1991. doi: 10. 1016/0092-8674(91)90513-X. URL http://linkinghub.elsevier.com/retrieve/pii/ 009286749190513X.

M. B. Dijkstra and J. J. Boomsma. Sex Allocation in Fungus-Growing Ants: Worker or Queen Control without Symbiont-Induced Female Bias. Oikos,117(12):1892–1906,Dec. 2008. doi: 10.2307/40235597?ref=search-gateway:700b677c5175c8cda1f5456d↵e14fb0.

A. Duarte, F. J. Weissing, I. Pen, and L. Keller. An evolutionary perspective on self- organized division of labor in social insects. Annual Review of Ecology, Evolution, and Systematics,42:91–110,2011.

H. Fern´andez-Mar´ın, J. Zimmerman, and W. Wcislo. Ecological traits and evolutionary sequence of nest establishment in fungus-growing ants (hymenoptera, formicidae, attini). Biological Journal of the Linnean Society,81(1):39–48,2004.

M. J. Fitzpatrick, Y. Ben-Shahar, H. M. Smid, L. E. Vet, G. E. Robinson, and M. B. Sokolowski. Candidate genes for behavioural ecology. Trends in Ecology amp; Evolution, 20(2):96 – 104, 2005. ISSN 0169-5347. doi: http://dx.doi.org/10.1016/j.tree.2004.11.017. URL http://www.sciencedirect.com/science/article/pii/S0169534704003477.

15 N. R. Franks and C. Tofts. Foraging for work: how tasks allocate workers. Animal Be- haviour,48(2):470–472,1994.

J. Gadau, M. Helmkampf, S. Nygaard, J. Roux, D. F. Simola, C. R. Smith, G. Suen, Y. Wurm, and C. D. Smith. The genomic impact of 100 million years of social evolution in seven ant species. Trends Genet, 28(1):14–21, Jan 2012. doi: 10.1016/j.tig.2011.08.005.

D. M. Gordon, B. C. Goodwin, and L. E. Trainor. A parallel distributed model of the behaviour of ant colonies. Journal of theoretical Biology,156(3):293–307,1992.

J. Greenberg, J. Xia, X. Zhou, S. Thatcher, X. Gu, S. Ament, T. Newman, P. Green, W. Zhang, G. Robinson, et al. Behavioral plasticity in honey bees is associated with di↵erences in brain microrna transcriptome. Genes, Brain and Behavior,11(6):660–670, 2012.

D. Haig. Coadaptation and conﬂict, misconception and muddle, in the evolution of genomic imprinting. Heredity, 113(2):96–103, Aug. 2014. doi: 10.1038/hdy.2013.97. URL http: //www.nature.com/doifinder/10.1038/hdy.2013.97.

D. Haig and C. Graham. Genomic imprinting and the strange case of the insulin-like growth factor II receptor. Cell,64(6):1045–1046,1991.ISSN0092-8674.doi:http: { } //dx.doi.org/10.1016/0092-8674(91)90256-X. URL http://www.sciencedirect.com/ science/article/pii/009286749190256X.

D. Haig and M. Westoby. Parent-speciﬁc gene expression and the triploid endosperm. American Naturalist,pages147–155,1989.

W. D. Hamilton. The genetical evolution of social behaviour. II. Journal of Theoreti- cal Biology, 7(1):17–52, July 1964a. URL http://eutils.ncbi.nlm.nih.gov/entrez/ eutils/elink.fcgi?dbfrom=pubmed&id=5875340&retmode=ref&cmd=prlinks.

W. D. Hamilton. The genetical evolution of social behaviour. I. Journal of Theoretical Biol-

16 ogy, 7(1):1–16, July 1964b. URL http://eutils.ncbi.nlm.nih.gov/entrez/eutils/ elink.fcgi?dbfrom=pubmed&id=5875341&retmode=ref&cmd=prlinks.

W. D. Hamilton. Altruism and related phenomena, mainly in social insects. Annual Review of Ecology and systematics,pages193–232,1972.

A. G. Himler, E. J. Caldera, B. C. Baer, H. Fern´andez-Mar´ın, and U. G. Mueller. No Sex in Fungus-Farming Ants or Their Crops. Proceedings: Biological Sci- ences, 276(1667):2611–2616, July 2009. doi: 10.2307/30245047?ref=search-gateway: ed5107c040031b5b0b6ed5daaa326031.

B. H¨olldobler and E. O. Wilson. The Ants. Harvard University Press, 1990.

W. Hughes, S. Sumner, S. Van Borm, and J. J. Boomsma. Worker caste polymorphism has a genetic basis in Acromyrmex leaf-cutting ants. 100(16):9394–9397, 2003. doi: 10.1073/ pnas.1633701100. URL http://www.pnas.org/cgi/doi/10.1073/pnas.1633701100.

W. O. H. Hughes and J. J. Boomsma. Genetic royal cheats in leaf-cutting ant societies. 105(13):5150–5153, 2008. doi: 10.1073/pnas.0710262105. URL http://www.pnas.org/ cgi/doi/10.1073/pnas.0710262105.

G. J. Hunt and R. Page. Linkage map of the honey bee, apis mellifera, based on rapd markers. Genetics,139(3):1371–1382,1995.

A. B. F. Ivens, D. R. Nash, M. Poulsen, and J. J. Boomsma. Caste-speciﬁc symbiont policing by workers of Acromyrmex fungus-growing ants. Behavioral Ecology,20(2):378– 384, 2009. doi: 10.1093/beheco/arn150. URL http://www.beheco.oxfordjournals. org/cgi/doi/10.1093/beheco/arn150.

R. Jeanson, P. F. Kukuk, and J. H. Fewell. Emergence of division of labour in halictine bees: contributions of social interactions and behavioural variance. Animal Be- haviour,70(5):1183–1193,2005.ISSN0003-3472.doi:http://dx.doi.org/10.1016/

17 j.anbehav.2005.03.004. URL http://www.sciencedirect.com/science/article/pii/ S0003347205002423.

R. Jeanson, R. M. Clark, C. T. Holbrook, S. M. Bertram, J. H. Fewell, and P. F. Kukuk. Division of labour and socially induced changes in response thresholds in associations of solitary halictine bees. Animal Behaviour,76(3):593–602,2008.

B. R. Johnson. Division of labor in honeybees: form, function, and proximate mechanisms. Behavioral Ecology and Sociobiology,64(3):305–316,012010. doi: 10.1007/s00265-009-0874-7. URL http://www.ncbi.nlm.nih.gov/pmc/articles/ PMC2810364/.

B. R. Johnson and T. A. Linksvayer. Deconstructing the superorganism: social physiology, groundplans, and sociogenomics. The Quarterly Review of Biology,85(1):57–79,2010.

D. R. Johnson. Hairpin-tail: A case of post-reductional gene action in the mouse egg? Ge- netics, 76(4):795–805, 04 1974. URL http://www.ncbi.nlm.nih.gov/pmc/articles/ PMC1213105/.

J. C. Jones, M. R. Myerscough, S. Graham, and B. P. Oldroyd. Honey bee nest thermoregulation: Diversity promotes stability. Science (New York, N.Y.),305(5682):402–404,2004. doi: 10.1126/science.1096340. URL http://www.sciencemag.org/content/305/5682/ 402.full.

S. D. Kocher, J. M. Tsuruda, J. D. Gibson, C. M. Emore, M. E. Arechavaleta-Velasco, D. C. Queller, J. E. Strassmann, C. M. Grozinger, M. R. Gribskov, P. San Miguel, R. Westerman, and G. J. Hunt. A search for parent-of-origin e↵ects on honey bee gene expression. G3 (Bethesda), Jun 2015. doi: 10.1534/g3.115.017814.

M. J. Krieger, J.-B. Billeter, and L. Keller. Ant-like task allocation and recruitment in cooperative robots. Nature,406(6799):992–995,2000.

18 T. H. Labella, M. Dorigo, and J.-L. Deneubourg. Division of labor in a group of robots inspired by ants’ foraging behavior. ACM Transactions on Autonomous and Adaptive Systems (TAAS),1(1):4–25,2006.

H. H. Laidlaw. Instrumental insemination of honeybee queens: its origin and development. Bee World,68(1):17–36,1987.

J. Larsen, B. Fouks, N. Bos, P. d’Ettorre, and V. Nehring. Variation in nestmate recognition ability among polymorphic leaf-cutting ant workers. Journal of insect physiology, 70C:59–66, Sept. 2014. doi: 10.1016/j.jinsphys.2014.09.002. URL http://linkinghub. elsevier.com/retrieve/pii/S0022191014001668.

R. Libbrecht, P. R. Oxley, D. Kronauer, and L. Keller. Ant genomics sheds light on the molecular regulation of social organization. Genome Biol,14:212,2013.

C. Lucas and M. B. Sokolowski. Molecular basis for changes in behavioral state in ant social behaviors. Proceedings of the National Academy of Sciences,106(15):6351–6356,2009.

C. Lucas, B. N. Hughson, and M. B. Sokolowski. Job switching in ants: role of a kinase. Communicative & integrative biology,3(1):6–8,2010.

F. Manfredini, C. Lucas, M. Nicolas, L. Keller, D. Shoemaker, and C. M. Grozinger. Molec- ular and social regulation of worker division of labour in ﬁre ants. Molecular ecology,23 (3):660–672, 2014.

J. McDonald, M. Matzke, and A. Matzke. Host defenses to transposable elements and the evolution of genomic imprinting. Cytogenetic and genome research,110(1-4):242–249, 2005.

A. Mikheyev, U. Mueller, and J. Boomsma. Population genetic signatures of di↵use coevolution between leaf-cutting ants and their cultivar fungi. Molecular Ecology,16(1): 209–216, 2007.

19 A. S. Mikheyev, U. G. Mueller, and P. Abbot. Cryptic sex and many-to-one coevolution in the fungus-growing ant symbiosis. Proceedings of the National Academy of Sciences,103 (28):10702–10706, 2006.

U. G. Mueller, S. A. Rehner, and T. R. Schultz. The evolution of agriculture in ants. Science,281(5385):2034–2038,1998.

U. G. Mueller, T. R. Schultz, C. R. Currie, R. Adams, and D. Malloch. The origin of the attine ant-fungus mutualism. Quarterly Review of Biology, 76(2):169–197, June 2001. URL http://eutils.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi?dbfrom= pubmed&id=11409051&retmode=ref&cmd=prlinks.

M. C. Munoz-Torres, J. T. Reese, C. P. Childers, A. K. Bennett, J. P. Sundaram, K. L. Childs, J. M. Anzola, N. Milshina, and C. G. Elsik. Hymenoptera genome database: integrated community resources for insect species of the order hymenoptera. Nucleic Acids Research, 39(Database issue):D658–D662, 01 2011. doi: 10.1093/nar/gkq1145. URL http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3013718/.

M. Myerscough and B. Oldroyd. Simulation models of the role of genetic variability in social insect task allocation. Insectes Sociaux,51(2):146–152,2004.

S. Nygaard, G. Zhang, M. Schiøtt, C. Li, Y. Wurm, H. Hu, J. Zhou, L. Ji, F. Qiu, M. Ras- mussen, H. Pan, F. Hauser, A. Krogh, C. J. P. Grimmelikhuijzen, J. Wang, and J. J. Boomsma. The genome of the leaf-cutting ant Acromyrmex echinatior suggests key adaptations to advanced social life and fungus farming. Genome Research,21(8):1339–1348, Aug. 2011. doi: 10.1101/gr.121392.111. URL http://genome.cshlp.org/content/21/ 8/1339.full.

B. P. Oldroyd and G. J. Thompson. Behavioural genetics of the honey bee apis mellifera. Advances in insect physiology,33:1–49,2006.

V. Orel. Mendel the ﬁrst Geneticist. Oxford: Oxford University Press, 1996.

20 K. Osborne, A. Robichon, E. Burgess, S. Butland, R. Shaw, A. Coulthard, H. Pereira, R. Greenspan, and M. Sokolowski. Natural behavior polymorphism due to a cgmp- dependent protein kinase of drosophila. Science,277(5327):834–836,1997.

S. W. Pacala, D. M. Gordon, and H. Godfray. E↵ects of social group size on information transfer and task allocation. Evolutionary Ecology,10(2):127–165,1996.

R. E. Page, J. Erber, and M. Fondrk. The e↵ect of genotype on response thresholds to sucrose and foraging behavior of honey bees (apis mellifera l.). Journal of Comparative Physiology A,182(4):489–500,1998.

R. E. Page, J. Gadau, and M. Beye. The emergence of hymenopteran genetics. Genetics, 160(2):375–379, 2002.

M. M. Patten, L. Ross, J. P. Curley, and D. C. Queller. The evolution of genomic imprinting: theories, predictions and empirical tests. Heredity, 2014. URL http://www.nature.com/ hdy/journal/vaop/ncurrent/full/hdy201429a.html.

M. Poulsen and J. J. Boomsma. Mutualistic fungi control crop diversity in fungus-growing ants. Science,307(5710):741–744,2005.

M. Poulsen, H. Fern´andez-Mar´ın, C. R. Currie, and J. J. Boomsma. Ephemeral windows of opportunity for horizontal transmission of fungal symbionts in leaf-cutting ants. Evo- lution,63(9):2235–47,Sep2009.doi:10.1111/j.1558-5646.2009.00704.x.

D. C. Queller. Theory of genomic imprinting conﬂict in social insects. Bmc Evolu- tionary Biology, 3(1):15, July 2003. doi: 10.1186/1471-2148-3-15. URL http://www. biomedcentral.com/1471-2148/3/15.

D. C. Queller and J. E. Strassmann. The many selves of social insects. Science (New York, N.Y.), 296(5566):311–313, Apr. 2002. doi: 10.1126/science.1070671. URL http: //www.sciencemag.org/content/296/5566/311.full.

21 C. Rabeling, J. Lino-Neto, S. C. Cappellari, I. A. Dos-Santos, U. G. Mueller, and M. Bacci. Thelytokous parthenogenesis in the fungus-gardening ant Mycocepurus smithii (Hy- menoptera: Formicidae). PloS one,4(8):e6781,2009.doi:10.1371/journal.pone.0006781. URL http://dx.plos.org/10.1371/journal.pone.0006781.

F. L. Ratnieks, K. R. Foster, and T. Wenseleers. Conﬂict resolution in insect societies. An- nual Review of Entomology,51(1):581–608,2006.doi:10.1146/annurev.ento.51.110104. 151003. URL http://dx.doi.org/10.1146/annurev.ento.51.110104.151003.PMID: 16332224.

E. J. H. Robinson, N. R. Franks, S. Ellis, S. Okuda, and J. A. R. Marshall. A simple threshold rule is sucient to explain sophisticated collective decision-making. PLoS ONE, 6(5):e19981, 05 2011. doi: 10.1371/journal.pone.0019981. URL http://dx.doi. org/10.1371%2Fjournal.pone.0019981.

G. E. Robinson, C. M. Grozinger, and C. W. Whitﬁeld. Sociogenomics: social life in molecular terms. Nat Rev Genet, 6(4):257–270, 04 2005. URL http://dx.doi.org/10. 1038/nrg1575.

O. Rueppell, T. Pankiw, D. I. Nielsen, M. K. Fondrk, M. Beye, and R. E. Page. The genetic architecture of the behavioral ontogeny of foraging in honeybee workers. Genetics,167 (4):1767–1779, 2004.

A. Sboner, X. J. Mu, D. Greenbaum, R. K. Auerbach, M. B. Gerstein, et al. The real cost of sequencing: higher than you think! Genome biology,12(8):125,2011.

M. Schiøtt, H. H. D. F. Licht, L. Lange, and J. J. Boomsma. Towards a molecular understanding of symbiont function: identiﬁcation of a fungal gene for the degradation of xylan in the fungus gardens of leaf-cutting ants. BMC microbiology,8(1):40,2008.

M. Schiøtt, A. Rogowska-Wrzesinska, P. Roepstor↵, and J. J. Boomsma. Leaf-cutting ant fungi produce cell wall degrading pectinase complexes reminiscent of phytopathogenic fungi. BMC biology,8(1):156,2010.

22 K. Schneeberger and D. Weigel. Fast-forward genetics enabled by new sequencing tech- nologies. Trends in Plant Science,16(5):282–288,52011.doi:http://dx.doi.org/10. 1016/j.tplants.2011.02.006. URL http://www.sciencedirect.com/science/article/ pii/S136013851100029X.

T. R. Schultz and S. G. Brady. Major evolutionary transitions in ant agriculture. Proceedings of the National Academy of Sciences of the United States of America,105(14):5435–5440, 04 2008. doi: 10.1073/pnas.0711024105. URL http://www.ncbi.nlm.nih.gov/pmc/ articles/PMC2291119/.

D. F. Simola, L. Wissler, G. Donahue, R. M. Waterhouse, M. Helmkampf, J. Roux, S. Nygaard, K. M. Glastad, D. E. Hagen, L. Viljakainen, J. T. Reese, B. G. Hunt, D. Graur, E. Elhaik, E. V. Kriventseva, J. Wen, B. J. Parker, E. Cash, E. Priv- man, C. P. Childers, M. C. Mu˜noz-Torres, J. J. Boomsma, E. Bornberg-Bauer, C. R. Currie, C. G. Elsik, G. Suen, M. A. D. Goodisman, L. Keller, J. Liebig, A. Rawls, D. Reinberg, C. D. Smith, C. R. Smith, N. Tsutsui, Y. Wurm, E. M. Zdobnov, S. L. Berger, and J. Gadau. Social insect genomes exhibit dramatic evolution in gene composition and regulation while preserving regulatory features linked to sociality. Genome Research, 23(8):1235–1247, Aug. 2013. doi: 10.1101/gr.155408.113. URL http://genome.cshlp.org/content/23/8/1235.full.

C. R. Smith, N. S. Mutti, W. C. Jasper, A. Naidu, C. D. Smith, and J. Gadau. Patterns of dna methylation in development, division of labor and hybridization in an ant with genetic caste determination. PLoS One,7(8):e42433–e42433,2012.

M. B. Sokolowski. Foraging strategies ofdrosophila melanogaster: A chromosomal analysis. Behavior genetics,10(3):291–302,1980.

H. G. Spencer and A. G. Clark. A chip o↵the old block: a model for the evolution of genomic imprinting via selection for parental similarity. Genetics,174(2):931–5,Oct 2006. doi: 10.1534/genetics.106.060475.

23 H. G. Spencer and A. G. Clark. Non-conﬂict theories for the evolution of genomic imprinting. Heredity, 113(2):112–118, Aug. 2014. doi: 10.1038/hdy.2013.129. URL http://www.nature.com/hdy/journal/vaop/ncurrent/full/hdy2013129a.html.

G. Suen, C. Teiling, L. Li, C. Holt, E. Abouheif, E. Bornberg-Bauer, P. Bou↵ard, E. J. Caldera, E. Cash, A. Cavanaugh, et al. The genome sequence of the leaf-cutter ant atta cephalotes reveals insights into its obligate symbiotic lifestyle. PLoS Genet,7(2): e1002007, 2011.

P. Villesen, T. Murakami, T. R. Schultz, et al. Identifying the transition between single and multiple mating of queens in fungus-growing ants. Proceedings of the Royal Society of London B: Biological Sciences,269(1500):1541–1548,2002.

T. L. Vo, U. G. Mueller, and A. S. Mikheyev. Free-living fungal symbionts (lepiotaceae) of fungus-growing ants (attini: Formicidae). Mycologia,101(2):206–210,2009.

Y. Wang, S. D. Kocher, T. A. Linksvayer, C. M. Grozinger, R. E. Page, and G. V. Amdam. Regulation of behaviorally associated gene networks in worker honey bee ovaries. The Journal of experimental biology,215(1):124–134,2012.

N. A. Weber. The fungus-culturing behavior of ants. American Zoologist,12(3):577–587, 1972.

A. E. Weisstein, M. W. Feldman, and H. G. Spencer. Evolutionary genetic models of the ovarian time bomb hypothesis for the evolution of genomic imprinting. Genetics,162(1): 425–439, 09 2002. URL http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1462244/.

E. O. Wilson et al. The insect societies. The insect societies.,1971.

J. B. Wolf. Cytonuclear interactions can favor the evolution of genomic imprinting. Evolu- tion,63(5):1364–1371,2009.

J. B. Wolf. Evolution of genomic imprinting as a coordinator of coadapted gene expression.

24 Proceedings of the National Academy of Sciences,110(13):5085–5090,Mar.2013.doi: 10.1073/pnas.1205686110. URL http://www.pnas.org/content/110/13/5085.full.

Chapter 1

The Use of Transcriptomic Data to Iden- tify Imprinted Genes in Social Insects

27 Abstract

The kinship theory of genomic imprinting states that imprinting is a consequence of an intra-genomic conflict between maternally and paternally inherited genes, a result of their di↵erential relatedness to social partners. It predicts that imprinting may evolve wherever there are relatedness asymmetries and close interactions among kin. The social hymenoptera therefore appear perfect candidates for genomic imprinting; however, no imprinted genes have been confirmed in any social insect. Here we develop a method for searching for imprinted genes in social insect species that cannot be bred under laboratory conditions. We test this model in the leaf-cutting ant Acromyrmex echinatior–providingthefirst genome-wide search for imprinting in any ant species. We identify a number of genes as potentially imprinted, and confirm the imprinting status of a major royal jelly protein homologue, Major Royal Jelly Protein III,asunimprinted.

28 Genomic imprinting describes an unusual pattern of expression, where the expression of an allele depends on whether it was maternally or paternally inherited (Reik and Walter, 2001a). Often, one allele is completely silenced, and expression comes exclusively from its counterpart – although more subtle patterns are often observed (Khatib, 2007). This strange pattern of expression relies on ‘imprints’, epigenetic marks, that are applied at loci during oogenesis and spermatogenesis, typically in the form of methylation (Reik and Walter, 2001b). Imprinting is well documented in mammals (Haig, 2004) and ﬂowering plants (Pires and Grossniklaus, 2014) and has been predicted to occur in the social insects (Queller, 2003), but has yet to be demonstrated.

The kinship theory of genomic imprinting suggests that imprinting is the result of con- ﬂict between the maternally and paternally derived halves of the genome (Haig, 1997, 2000; Haig and Graham, 1991). Kin-selection, on which the kinship theory is based, describes how an individual will weigh an action’s ﬁtness e↵ects on itself against the e↵ects on relatives, according to how closely related these individuals are (Hamilton, 1964a,b). The kinship theory of genomic imprinting highlights that, within an individual, maternally and paternally derived genes may not be equally likely to be found in other individuals and will therefore value interactions di↵erently, and disagree about the optimal phenotype (Haig, 2000; Haig and Graham, 1991).

The theory was originally developed to describe cross-placental conflict over resource- provisioning in mammals (Haig, 2000). In a developing embryo, a gene faces a ‘decision’ of how much energy to extract from the mother. Where a species is multiply mated, a paternally-derived gene (a patrigene (Queller, 2003)) will be unrelated to the mother and her future o↵spring. Selection will therefore favour a selfish patrigene that maximises the o↵spring’s fitness without regard to the e↵ect on the mother. A gene inherited from the mother (a matrigene (Queller, 2003)), on the other hand, is present in the mother by defi- nition and will be present in half of her o↵spring. The matrigene, therefore, will take into account the fitness e↵ects on the mother, and be selected to show more restraint. Consistent

29 with this, many imprinted genes have been found to have roles in placental development– Insulin-like Growth Factor-2 (Igf2 )increasesthesizeofthefoetusandisexpressedex- clusively from the patrigene in an attempt to gain more resources (Dechiara et al., 1991). The Igf2-receptor counteracts these e↵ects by sequestering Igf2,andisexpressedexclusively from the matrigene (Haig, 2004). Similarly, many diseases associated with imprinting appear to have e↵ects consistent with the conﬂict theory (Haig, 2004), although we should be wary of reading too much into phenotypes associated with disease (Hurst and McVean, 1997). Many imprinted genes have also been identiﬁed in the mammalian brain (Gregg et al., 2010c; Wang et al., 2008), and have been suggested as a potential cause of social disorders such as autism (Crespi and Badcock, 2008).

The kinship theory therefore predicts that imprinting may evolve wherever we have close interactions among kin, who are asymmetrically related through the matriline and patriline. The social Hymenoptera,thebees,waspsandants,thereforeappearperfectcandidatesfor genomic imprinting, and o↵er an independent test of the predictions of the kinship theory (Queller and Strassmann, 2002). Within a colony, the majority of the individuals gain ﬁtness through interactions with relatives, and their haplodiploid sex-determination creates extreme relatedness asymmetries between matri- and patrigenes (Queller, 2003).

Imprinting could influence many of the kin conflicts in social insect colonies that have already been the subject of much study; it applies to conflict over sex-ratio, worker egg- laying, policing, nepotism, and caste-determination (Queller, 2003). A full discussion of these predictions can be found in Queller (2003), but in brief, we expect the patrigene to be more ‘selfish’ than the matrigene where the queen mates with multiple males, as relatedness through the patriline decreases with increasing mate number. This is reversed under single-mating, where a colony is clonal through the patriline.

Thus there appears to be an abundance of suitable kin conﬂict in social insect societies to favour the use of genomic imprinting (Queller, 2003), and the social insects appear

30 to have the suitable imprinting machinery (Wang et al., 2006). Despite this, genomic imprinting has yet to be conclusively demonstrated in any social insect. Imprinting has been demonstrated in the sex-determination of Nasonia vitripennis (Verhulst et al., 2010) and a number of studies have shown behavioural e↵ects suggestive of genomic-imprinting in both social and solitary Hymenoptera: hybrid males of the parasitoid wasps Nasonia have courtship displays that are biased towards their grandfather (Beukeboom and van den Assem, 2001, 2002), bumblebees treated with compounds that disrupt methylation develop larger ovaries are more aggressive and are more likely to lay eggs (Amarasinghe et al., 2014), and hybrids between Africanised and European honeybees with an Africanized father and a European mother are more aggressive than the reciprocal cross (Guzman-Novoa et al., 2005).

The next step, therefore, is to identify genes that are involved in genomic imprinting in the social insects and to evaluate whether they play a role in kin conﬂict, and to test whether this is consistent with the kinship theory. In mammals, arguably the most progress has been made through chance discoveries – the Igf2 /Igf2R system was found when a mutation did not follow mendelian inheritance, but where the presentation of the mutant phenotype depended on the parent-of-origin (Barlow et al., 1991; Dechiara et al., 1991; Johnson, 1974). Other imprinted genes have been found by virtue of occurring next to identiﬁed imprinted genes, as imprinted genes tend to occur in clusters (Reik and Maher, 1997). It is clear, however, that we cannot rely on serendipity alone to test imprinting predictions in the social insects. Recently, more systematic screens have been developed to identify further imprinted genes in mammals, and these methods are now being applied to other groups.

31 1.1 Whole-Genome Searches Using Transcrip- tomics

Genome-wide scans for imprinting take two general forms: using RNA-sequencing to estimate expression levels of the two alleles, or alternatively, using methylation-dependent techniques to find di↵erentially-methylated genes (Reik and Walter, 2001b). Owing to the decreasing cost of transcriptomics, RNA-based methods are increasingly being used to study expression of alleles, and have been applied to mice (Babak et al., 2015; Gregg et al., 2010b,c; Wang et al., 2008), chickens (Frésardet al., 2014; Wang et al., 2015), fruit flies (Coolon et al., 2012; Fontanillas et al., 2010) and most recently honeybees (Kocher et al., 2015).

The RNA-based techniques consist of two steps (Wang and Clark, 2014): first the genome sequence is used to identify single-nucleotide polymorphisms (SNPs) within coding sequences, then the same sites are identified in the transcriptome and the relative relative proportions of the two alleles are counted. At unimprinted heterozygous loci, the alleles should be represented equally in the RNA reads. Where the alleles are found to di↵er significantly from parity in RNA, using a Fisher’s exact test or a 2 test (Wang et al., 2008), the locus is said to show allele-specific expression (ASE). ASE could be manifest as the complete absence of one genotype, or much more subtle e↵ects (Fontanillas et al., 2010; Khatib, 2007). An epigenetic parent-of-origin e↵ect represents one possible cause of ASE, and consequently sequencing is conducted on reciprocal crosses to ensure that the expression is a parental e↵ect (as in Kocher et al. (2015)), or many samples are considered, since imprinting-based e↵ects will be inconsistent with respect to sequence over multiple samples (Babak et al., 2015).

Although these approaches have a number of advantages, they are not without technical

32 diculties, the high rate of false-positives being the most notable (Wang and Clark, 2014). Gregg et al. (2010b,c), for example, identified over 1300 genes with parent-of-origin e↵ects in the mouse brain. This number that is likely a gross overestimate; DeVeale et al. (2012) could only replicate around 13% of these genes. Although frequent false-positives can be a hindrance, they are not intolerable if the candidate genes are verified by independent means before they are labelled as imprinted, and ultimately this approach has been a success, identifying a number of imprinted genes in mammals (Babak et al., 2015; DeVeale et al., 2012) that continue to uphold the predictions of the kinship theory– as is also seen in the lack of confirmation of any imprinted genes in the chicken thus far (Frésard et al., 2014; Renfree et al., 2013; Wang et al., 2015).

Many of the organisms where RNA-sequencing has been applied are typically large enough that both the genome and the transcriptome can be isolated from the same individual with relative ease. Insects, on the other hand, must be pooled in order to produce data of sucient quality. In model systems, such as Drosophila,theavailabilityofgenetically identical strains means that, in practice, no novel diculties are introduced. Similarly, the recent imprinting screen in the honeybee created many genetically similar individuals by artiﬁcially inseminating a queen with only a single male (Kocher et al., 2015). Even in these simple colonies, three genomes are present in a sample of workers: the two that are inherited from the queen, along with that of the father. Kocher et al. (2015) alleviated this by considering only loci where the queen was homozygous, and the male possessed an alternative allele. In this sense, their data was identical to that produced from a diploid system, and the methods did not need to be adjusted.

For other systems, things are not so straightforward. There are many social insects that experience such kin conﬂicts, but are not amenable to breeding in a laboratory setting, and consequently remain beyond the reach of such screens. In this study, we developed an extension to the methodology applied in previous studies, facilitating the identiﬁcation of putatively imprinted genes in species that cannot be mated, and for which we may lack

33 data regarding paternal genotypes.

Identifying Imprinted Loci in Intractable Species

As in the cases above, the ﬁrst step in identifying an imprinted gene is determining whether the RNA ratios di↵er signiﬁcantly from that found in the DNA. In diploids, the ratio of two alleles at a heterozygous locus in the DNA will always be 1:1. Implicit in this is the null hypothesis that the allelic proportion found in the RNA is the same as that found in the DNA: pRNA = pDNA (1.1)

For the social insects, we must consider the colony-level e↵ects of imprinting, rather than the e↵ects on an individual, as such the proportions can take any value between 0 and 1, wherever a queen has mated with more than one male. This unimprinted expectation is shown in ﬁgure 1.1a. The proportion at which an allele is found in the colony DNA is the average of its frequency in the queen and her mates:

q + m pDNA = (1.2) 2 where q is the allelic proportion in the queen, and m is the proportion in the males she mates with. q is therefore restricted to 1, 0, or 1/2, while m can take any value between 0 and 1. The method employed to identify genes showing ASE in such a colony does not di↵er from that used in other studies cited above. In this case, however, statistical power is reduced compared to previous studies as the DNA proportion we use as a null hypothesis is also an estimate with an associated degree of error.

ASE will cause deviations from DNA-RNA parity within the colony, ie. the line described by equation 1.1, and will do so predictably under imprinting, dependent on the

34 parental genotypes and the direction of imprinting. Here, we develop these predictions. We consider only the simplest case of imprinting where one allele is completely silenced in each individual. This expectation is derived from the ‘loudest-voice-prevails’ principle (Haig, 1996), which predicts that as one allele is selected to increase its expression, the other is selected to counteract this with reduced expression, thus selecting for increased expression in the former – a cycle that will continue until the latter can reduce expression no further. Less extreme imprinting is known to occur in many species (Khatib, 2007), and does appear to also occur in the honey bee (Kocher et al., 2015), but were this to be included, the predictions would become too di↵use to refute. There are consequently two imprinting scenarios that we develop in turn: exclusive expression from the matrigene, and exclusive expression from the patrigene.

Matrigenic Expression

Where only the matrigene is expressed, the proportion in the colony RNA is the same as the proportion of the allele in the queen’s genome:

pRNA = q (1.3)

As q is restricted to reﬂect the queen’s genome– 0 or 1 where the queen is homozygous, or 1/2wheresheisheterozygous–threepredictionscanbegeneratedfromequations1.1and 1.2:

DNA m RNA where q =0: p = 2 ,andp =0. 1 DNA 1 m RNA 1 where q = 2 : p = 4 + 2 ,andp = 2 . DNA 1 m RNA where q =1: p = 2 + 2 ,andp =1.

Each of these is a horizontal line 0.5 units wide, as shown in ﬁgure 1.1b, as the fathers contribute to 1/2 of the colony DNA but have no e↵ect on the colony RNA. The queen’s

35 genotype sets upper and lower bounds for the allele frequency in the colony DNA and deﬁnes its frequency in the colony RNA. The queen therefore determines which line the colony should fall on, while the frequency of the allele in the males determines the position along each line.

Patrigenic Expression

Conversely, under patrigenic expression, the proportion in the RNA reﬂects the proportion of the allele in the fathers: pRNA = m (1.4)

Any restrictions here depend on the mating frequency of the species considered; however wherever mating frequency is greater than 1, the allele frequency can take any value. By substituting equation 1.4 into equation 1.2, we see that:

pRNA =(2 pDNA) q (1.5) ·

Again, since q can take three possible values, three lines are produced (shown in figure 1.1c). The gradient of 2 reflects that the fathers contribute half of the colony DNA colony but, under patrigenic expression, are the sole contributors to the colony RNA under patrigenic expression. As above, the queen’s genotype sets the same limits for the colony DNA, while again the position along each line reflects the fathers’ genotypes.

Implementation

There are therefore three possibilities for a locus within a single colony, as is summarised in ﬁgure 1.2: given a queen’s genotype, each colony may fall on the dashed line that represents parity between the RNA and the DNA (unimprinted expression), or it may fall on either a horizontal line (matrigenic expression) or one of the steeper lines (patrigenic expression). Inspection of these lines highlights the major diculties associated with this

36 method: namely, that the predictions are not always mutually exclusive, and that the expectations are highly dependent on the genotype of the colony – more so than when these methods have been applied to diploids or to singly-mated social insects. In each of ﬁgures 1.2a, 1.2b and 1.2c, there is a point where all three predictions overlap, and so are indistinguishable. At this point in ﬁgures 1.2a and 1.2c, this is simply because the locus lacks any diversity, and therefore contain no information. It is the scenario in 1.2b that is unique to this method: where a locus contains sucient information, but imprinted and an unimprinted expectations are identical.

Similarly, as we approach each point of convergence in ﬁgure 1.2, the di↵erence between the imprinted and unimprinted expectations approaches 0, meaning that we do not necessarily expect ASE even under complete silencing of one allele. For the majority of polymorphic loci, where we could expect to see a combination of parental genotypes, much higher sequencing depth is needed to identify ASE than would be needed for a sample derived under a singly-mated queen (Fontanillas et al., 2010). Under single mating, expectations are restricted to the extreme limits of each line, and would therefore show a greater degree of ASE since m can only take a value of 0 or 1. Furthermore, we cannot always distinguish between matrigenic and patrigenic expression. With the colony structures most favourable for identifying ASE, exclusive matrigenic and patrigenic expression will appear identical. However, as we cannot create favourable colony structures through breeding, these problems are unavoidable, and we must persevere in the hope that at least some loci are suitable in one of the sampled colonies.

Once loci showing ASE have been identiﬁed, they must be tested for consistency with the imprinting scenarios outlined above. Under the assumption of a binomial sampling distribution of reads, Agresti-Coull conﬁdence intervals can be constructed for allelic proportions in both the DNA and the RNA– although the read distribution typically shows more variance than the binomial distribution (Wang and Clark, 2014), it is not thought that this invalidates the comparisons made here: it simply creates a more conservative test.

37 The observed conﬁdence intervals for the DNA are then used to predict intervals in RNA proportions that are expected under matrigenic and patrigenic expression, for each of the possible queen genotypes. If the conﬁdence interval for the observed RNA proportion does not overlap with the RNA proportion predicted from the DNA, we consider the locus to be inconsistent with this imprinting scenario. Each locus is also tested for consistency across all samples: if this locus falls within an imprinted gene, it should be imprinted in the same direction in all samples. Across all colonies, the locus should fall only on either matrigenic or patrigenic lines, and samples within the same colony will fall on the same line as the queen will have the same genotype. Some variation along the line may occur because of sampling e↵ects during material collection or di↵erential representation of fathers in di↵erent castes.

1.2 Application to Acromyrmex echinatior

The above reasoning was developed for application in the leaf-cutting ant Acromyrmex echinatior,aspeciesthatlivesinlargecoloniesheadedbyasingle,multiply-matedqueen. Acromyrmex is a member of the Attini tribe, a highly speciose group in which all members rear a fungal crop on which they are nutritionally dependent (Schultz and Brady, 2008). Acromyrmex,alongsideAtta,isoneofthemosthighlyderivedofthefungus-growingants, maintaining their fungus garden predominantly on freshly cut leaf-material (Schultz and Brady, 2008).

The attines represent a particularly suitable group for study of kin conﬂict. The leaf- cutting ants have queens that mate multiply, while the other attine queens are singly-mated (Villesen et al., 2002), while there are also a number of inquiline parasites (Rabeling et al.; Schultz et al., 1998), and the asexual Mycoceparus smithii (Himler et al., 2009; Rabeling et al., 2009). Furthermore, there has been a recent proliferation of genomic and transcriptomic data within the attine ants. This recently culminated in the demonstration of the

38 extensive use of RNA-editing in Acromyrmex echinatior (Li et al., 2014). For this, Li et al. produced both the genome and transcriptome for three castes across three colonies. Their sampling method makes this dataset perfect for testing for unusual expression patterns: each sample consists of a large number of individuals (50 for larger workers and reproductive females, and 200 for small workers), but more importantly, the DNA and RNA were also extracted from the same individuals: the DNA from the ants’ bodies, and the RNA from the heads.

We used this dataset to test the methodology outlined above and to identify potentially imprinted genes within a social insect. We created similar samples to those of Li et al. in order to independently test identiﬁed loci using independent PCR-based techniques targeted at individual loci.

1.2.1 Methods

The Dataset

The data used here were kindly supplied for use in this study by Li et al. (2014), full methods for library construction, sequencing, and alignment are described therein. In brief, the RNA and DNA were sequenced using the Illumina HiSeq system, and the reads of each were aligned to the A. echinatior genome (Nygaard et al., 2011): (‘Aech 2.0 sca↵olds.fa.gz’ from http://hymenopteragenome.org/acromyrmex/), using the Burrows-Wheeler Aligner (Li and Durbin, 2009). Each end of the uniquely mapping reads was trimmed by 6bp, and then realigned to the genome using BLAT– only those reads supported by both BWA and BLAT were kept.

Li et al. (2014) also developed a second pipeline for the identiﬁcation of sites showing ASE. Firstly, any low quality reads (quality score <20) were discarded, as were loci with a

39 DNA sequencing depth of <10X. The probability of each possible genotype was calculated for each position in the reference genome, and a statistical framework based on Bayesian theory and the Illumina quality scoring system was used to call SNPs. Only those sites with a posterior probability of heterozygosity >0.95 were identified as SNPs. At each SNP, a Fisher’s exact test was used to test for a di↵erence between the SNP frequencies in the DNA and RNA reads. The p-value generated was corrected for the false-discovery rate, and those loci that had an adjusted p-value of <0.01 were identified as showing ASE. Later, the p-value threshold was relaxed to <0.05. For each SNP that was identified as showing ASE, the data was downloaded for all 9 samples since, as described above, we may not expect ASE under complete imprinting.

Each locus from each sample was then tested for consistency with the various imprinting scenarios, as is outlined above. Aggresti-Coul 95% confidence limits were calculated for the DNA and RNA reads. The DNA confidence interval was then used to predict RNA proportions, and we tested for overlap between the predicted RNA range and the 95% confidence intervals. We specified that all samples for each locus within a colony must be consistent with the same line, and that all three colonies must fit the same class of line. That is, the predicted direction of imprinting (maternal vs. paternal) must be consistent across all samples, and within a colony we should observe similar allelic-bias owing to the shared parental genotypes. We therefore created a subset of all loci where at least one sample showed significant allele-specificity, and so is inconsistent with an unimprinted locus, and where all samples for this locus are consistent with the same direction of imprinting.

Estimation of Queen Genotype Using Sanger Sequencing

Material Collection and DNA Extraction

As the model outlined above makes clear predictions regarding the genotype of the queen, based on the line with which the data are most consistent, we ﬁrst tested for consistency

40 between the queen’s genotypes and her predicted genotype. We collected 10 males from the three colonies used in Li et al (2014): Ae356, Ae322 and Ae363. Unfortunately, the queen of colony Ae363 had recently died, as such only a small number of males remained in the colony, and the colony was not used beyond this stage. DNA was extracted from two legs from each male using Chelex.

Primers were designed for two genes, Vitellogenin-1 and Major Royal Jelly Protein 3 (MRJP3) using the A. echinatior genome, to span a region of around 800bp. The primer sequences were as follows:

• Vitellogenin-F1: TTCACAGTCCTCCCGATAAG • Vitellogenin-R1:CGTTCTCGACAAAACCCAAG • MRJP-F1: TGTGCGGCGAATAGCATCT • MRJP-R1:CATCCACGTGCACTGGATTG

PCR was conducted for both primer pairs, in 20µl reactions, containing 10µl RedTaq DNA polymerase, 1µl DNA template, 1µl of each primer, and 7µl water. In each case, a touchdown thermal protocol was used to ensure speciﬁc reactions (Korbie and Mattick, 2008).

For vitellogenin this consisted of: 94°Cfor5m,10cyclesof94°Cfor10s,61.8°Cfor20s (decreasing by 1°Cpercycle)and72°Cfor1m,followedby25cycleswithanannealing temperature of 51.8°C. The protocol used for MRJP3 was much the same, however, 15 cycles were used in the touchdown section and only 20 cycles in the second cycling stage.

Consequently, the MRJP3 annealing temperature used ranged from 63.8°Cto48.8°C.

Validation of Expression Ratios

Material Collection

The six A. echinatior colonies (Ae356, Ae322, Ae160B, Ae263, Ae226 and Ae168) used in this study were collected from Gamboa, Panama over the period of 2001-2008, and have

41 since been maintained in Copenhagen at 25 °Candca.70%relativehumidity,onadietof bramble leaves, apple and rice. From each colony, four samples were collected: 50 gynes, 50 large workers, 100 small workers and 50 males. Samples were ﬂash frozen using liquid nitrogen during collection, after which the head and body of each ant was separated using forceps. Heads and bodies were pooled separately, and ground to a ﬁne powder in liquid nitrogen using a pestle and mortar. A sample of this powder was then used for nucleic acid extraction: the heads used for RNA, and the bodies for DNA. This is in contrast to the methods applied by Li et al. (2014), who conducted larger extractions on the entire samples. The smaller scale method employed here is more than sucient for the current application, and facilitates the inclusion of more colonies.

DNA and RNA Extraction

An approximately equal amount of starting material from each sample was used for extraction– approximately 10mm3 for the RNA, and around twice this amount for DNA. For the small workers, this was the entirety of each sample; for the larger castes, this was only a subset of the total. RNA was extracted using the Qiagen RNeasy Universal Mini kit, as per the manufacturer’s instructions. We included a DNase I digestion step, to ensure that no genomic DNA was carried over to later stages. DNA was extracted using the Qiagen DNeasy kit. DNA was also extracted from 8 individual males’ abdomens from three of the colonies (Ae322, Ae356, and Ae226). Again, the DNeasy kit (Qiagen) was used; an overnight Pro- teinase K digestion was used for these samples. The success of DNA and RNA extractions were measured using the NanoDrop spectrophotometer. RNA was also run through a 2% agarose gel to ensure its integrity.

8.5 µl of the DNA extractions were digested using 0.5µl of the restriction endonuclease

HindIII,and1µl digestion bu↵er. Digestion consisted of 20 minutes at 37°C, followed by a 10 minute denaturation step at 80 °C. Products were then diluted in 190µl water.

42 Reverse transcription of the RNA to cDNA was conducted in 10µl reactions containing 5.25µl RNA sample, 0.5µl SuperScript III (Invitrogen), 2µl 5X ﬁrst strand bu↵er, 1µl

DNTP, 1µl DTT, 0.125µl RNASin, and 0.125µl Primer Qt. The RNA was heated to 65°C for 3 mins before the reagents were mixed, and a thermal protocol of 42°Cfor60mins, 50°Cfor10mins,and70°C for 15 mins was used.

Typically, it is recommended to standardise the quantities of RNA used in a reverse transcription experiment, particularly for quantitative-PCR applications. Here, however, we are using digital-droplet PCR to relative quantities for SNPs at a single locus, and it was therefore deemed more appropriate to attempt to maximise the amount of RNA that contributed to each sample, as di↵erences among the reactions would not adversely inﬂuence the results.

Following reverse transcription, RNA was digested using RNase H (20 minutes at

37°C). cDNA products were diluted in 40µl bu↵er AE (if the initial RNA concentration 300ng/µl), or 20µl bu↵er AE (if the initial RNA concentration <300ng/µl). These were then diluted by a factor of 9.

Competitive Allele-Speciﬁc Digital Droplet PCR

Digital Droplet PCR (ddPCR) is a relatively new quantitative-PCR method that relies on microfluidics to more accurately estimate quantities within a sample. Before the reaction is started, it is partitioned into an emulsion of approximately 20,000 droplets. Fluorescently labelled TaqMan probes, which release their fluorescence upon successful amplification, are used to target a specific sequence between the primers and, after the reaction has been completed, the fluorescence of each droplet is measured individually, to determine whether the droplet contained the original target sequence. Each droplet is given a binary score for the presence of the template and the number of positive droplets is then used to measure quantity. Here, we use a ‘competitive allele-specific taqman’ assay (CAST), a

43 form of mutation detection assay that uses two di↵erentially marked probes that target the same stretch of DNA and compete for binding. The probes di↵er at one base, and each therefore preferentially binds to one allele to the exclusion of the other probe. Each droplet is measured for the two wavelengths corresponding to the two dyes, and the number that ﬂuoresce for each wavelength provides a reliable measure for the number of copies of each allele present in the sample.

Primers and probes were designed according to the guidelines of the BioRad applications guide, and the web-based software Primer3Plus (Untergasser et al., 2007). Thus far, we have only applied this technique to a single gene: MRJP3,whichisdiscussedfurtherbelow The primer and probe sequences used were:

• MRJP-Primer F: GCGTCTTGTCATTCTTGA • MRJP-Primer R: CTTTGCTACCATGAATCC • MRJP-Probe C: FAM-CCTGGCAT[C]ATTGTGTACTC-BHQ1 • MRJP-Probe T: HEX-CCTGGCAT[T]ATTGTGTACTCTT-BHQ1

Diagnostic PCRs were to check the ecacy of the primers, and the quality of the DNA and cDNA samples. Both reactions conducted as above (20µl reactions, containing 10µl RedTaq DNA polymerase, 1µl DNA template, 1µl of each primer, and 7µl water). However for the cDNA 2µl of template was used, replacing 1µl water. Both reactions were subject to the same thermal protocol: 94°Cfor5m,and35cyclesof94°Cfor10s,56°C for 20s and 72°Cfor60s,andaﬁnalelongationat72°Cfor10m.

The ddPCR reactions were 21µl, and consisted of 10µlSuperMix,1µlofeachofthetwo primer-probe mixes, and 1µltemplate,withwatercomprisingtheremainder.Theprimer- probe mix contained primers at 9µM of each primer, and one of the probes at 5µM.20.5µl of the reaction mix were added to the droplet generator, as this is the maximum volume we could reliably pipette from each reaction mix. This is greater than the volume suggested by the BioRad documentation, as it was found to increase the number of droplets and the

44 greater the number of droplets generated, the more reliable are our quantity estimates. A thermal protocol with a two-step cycling-stage was used: an initial denaturation of 95°C for 10m, 40 cycles of 94°Cfor30sand56°Cfor90s,andﬁnally98°Cfor10m.Theplate was then immediately transferred to the BioRad droplet reader for analysis.

1.2.2 Results

Identiﬁcation of Candidate Genes

The original dataset from sent from the Beijing Genomics Institute (BGI), using the more conservative p-value cut-o↵of 0.01, contained 1124 entries, consisting of 336 distinct loci from 37 genes. Many loci mapped to unannotated regions of the genome, and therefore cannot be assigned functions: 579 entries, for 166 loci, were unlabelled, others were annotated as ‘Putative uncharacterised protein’. These were excluded from the dataset, leaving 358 entries representing 115 loci. Of those that remained, by far the most represented gene was ‘Copia Protein’ (40 distinct loci, found to have signiﬁcant ASE in 167 of the 360 possible samples).

Other genes of note relate to epigenetic control of gene expression, such as the histone modification enzymes: Histone acetyltransferase KAT2A, Histone deacetylase 6,and Histone-lysine N-methyltransferase SETMAR,andaputativedimethyladenosinetrans- ferase. With a less strict adjusted p-value of 0.05, 1478 entries showed significant ASE. These were spread across 516 loci from 71 genes, many of the additional loci were found within unlabelled or uncharacterised genes. See Appendix A for a complete list of genes that show significant ASE.

The data for each identiﬁed locus were downloaded for all 9 samples, and tested for consistency with the imprinting expectations across all samples: 38 loci were found to be

45 consistent with exclusive matrigenic expression, and 50 loci with patrigenic expression, from 17 and 35 genes respectively– consistent loci are listed in table 2, Appendix B. In total, 72 loci for 41 genes are listed; some loci were found to be consistent with both maternal and paternal imprinting, (eg. ‘Histone-lysine N-methyltransferase SETMAR’, in which 6 loci were found to be consistent with both matrigenic and patrigenic expression).

In all datasets and tests, the gene Major Royal Jelly Protein III (MRJP3) stands out as having ASE that fits well with predictions of exclusive patrigenic expression, as is shown in figure 1.4. Furthermore, it was the only gene for which all three samples from a single colony were found to have significant ASE at p<0.01, but where this was not found in other colonies– suggesting a clear and consistent di↵erence between the genome and the transcriptome within a colony, but di↵erences between colonies. MRJP3 was therefore selected as the priority for further study.

Vitellogenin-1 was also selected, it was also identiﬁed as having signiﬁcant ASE, and two loci were consistent with matrigenic expression (see Appendix B).

Validation of Candidate Gene Expression

Vitellogenin-1 (fragment)

Two loci were found to be consistent with matrigenic expression within Vitellogenin-1,see table 2. Additional SNPs were sought within this gene, we identified a further 3 SNPs that had not been called as showing significant ASE. As is shown in figure 1.3, ASE was not consistent across all 5 SNPs, the SNP at position 1644225 di↵ers greatly from all others, while the other loci appears more consistent with a sequence specific e↵ect, indicating that vitellogenin is likely not imprinted. Furthermore, sequences from males of colony Ae363 indicated that the queen was heterozygous at locus 1628016, where we would predict homozygosity under both imprinting scenarios. Manual inspection of a subset of reads

46 indicated that the loci that show expression of only one allele may be a result of a bias of the error calling algorithm, and the corrected ASE did not conform to imprinting predictions.

As there is little support for the imprinted expression of Vitellogenin-1,e↵ortswere focussed on MRJP3.

Major Royal Jelly Protein III

As shown in ﬁgure 1.4, if MRJP3 is indeed imprinted, we expect that the queen is homozygous for our focal allele– in this case a C, rather than the alternative T– Sanger sequencing of DNA extracted from 10 individual males from each of the three colonies suggested this was the case (data not shown). Inspection of the chromatographs showed that an unusually high number of samples were found to have contain both alleles (20 of 30): in colony Ae363, every sample had two peaks at the polymorphic locus. This was deemed to have been most likely a result of contamination of the males by their nestmates– only a small amount of tissue was used for these extractions, and the males were in close contact with their sisters in the colony, many of whom carry the alternative allele. As no individual was found to carry only the T allele, we did not consider this result to be inconsistent with a homozygous (C/C) queen.

The DNA and RNA reads for the locus in question were inspected manually, in order to identify additional SNPs that could be used to validate the allele-speciﬁcity observed. No additional SNPs were found within the surrounding 1000bp, nor were any identiﬁed from the Sanger sequencing.

The allelic proportions in the DNA and the RNA were estimated for six colonies, using a mutation detection ddPCR assay. These six colonies contained two of those from the original dataset (Ae322 and Ae356), to test the reliability of the original estimates, Ae363 had collapsed before the inception of this experiment so could not be included. We also included 4 additional colonies. The proportions are shown in ﬁgure 1.5, all points are

47 found to be consistent with one of the imprinting predictions–the exlusively patrigenic expression of MRJP3 under a homozygous queen. This predicts that all 6 queens tested are homozygous for the same allele; although this is not impossible, it does seem unlikely given that the alternative allele is apparently not uncommon in the fathers that contributed to the colonies.

Furthermore, the frequency at which this allele is found within males taken from the colony did not agree with the predicted queen genotypes: only one colony, Ae263, agreed with the predictions (see ﬁgure 1.6). The other 4 colonies tested suggested that the focal allele is present in the queens at a frequency of approximately 75%– a number that seems highly reproducible across colonies. This is unexpected, as haplodiploidy means that a suciently large sample of a queen’s sons will approximate her genotype. We should therefore see proportions of 0, 0.5, or 1, with any intermediate values introduced by a sampling e↵ect, something that would not produce the consistent values observed here. We can be reasonably conﬁdent, therefore, that this result is not an artefact of the dynamics of the reaction, nor of sampling and pooling of males, leaving only the possibility that there are multiple copies of the gene present.

The ratio of the two alleles within individual males confirmed this (see figure 1.7). Heterozygous males should not be observed under haplodiploid sex determination, yet here 7 of 21 males tested were ‘heterozygous’. Although diploid males do sometimes occur in A. echinatior, it is certainly not at the frequency required to produce this ratio, and we must therefore conclude that there are two genes that are indistinguishable in this region, and that we have inadvertently been targeting both: were only one of the two genes expressed in the tissue sampled, we would see the pattern observed above– a result that is superficially very similar to imprinting. This result also reconciles the unusually high levels of ‘contamination’ observed in the Sanger sequencing

48 1.2.3 Discussion

Unfortunately, the work thus far has failed to unequivocally identify a single imprinted gene in Acromyrmex echinatior– we can only say that Major Royal Jelly Protein 3 is unlikely to be imprinted, and that it has undergone a recent duplication event, without any di↵erentiation between the two copies. We have, however, developed a method for identifying and verifying imprinted genes that can aid in the search for imprinted genes in social insect species that were previously considered intractable for such studies – a method that is robust to those cases that only resemble imprinting, as with MRJP3. Furthermore, we also have generated a relatively short list of candidate genes that require veriﬁcation in future.

Superﬁcially, MRJP3 appeared promising. MRJPs are, as their name suggests, found at high levels in honeybee royal jelly, and are involved in inducing queen, rather than worker, developmental pathways in larvae (Huang et al., 2012; Kamakura, 2011). Such a gene would be an ideal candidate for imprinting. Under the kinship theory, we would expect this gene to be patrigenically expressed in multiply mated species, as the patrigenes attempt to increase their share of colony reproduction (Dobata and Tsuji, 2012). However, the honeybee royal jelly proteins are thought to have been recently coopted into caste determination from their ancestral state as digestive enzymes; as is still the case in the bumblebee (Kupke et al., 2012). It is unlikely then that they determine caste-fate in Acromyrmex.Theroyal jelly proteins still have a number of functions in honeybees besides their role in caste-fate; they are expressed in many tissues other than nurse bee hypopharyngeal glands (Buttstedt et al., 2013), including the brain in both honeybees (Kucharski et al., 1998) and bumblebees (Albert et al., 2014)– suggesting a role in other aspects of physiology.

A. echinatior is thought to have as many as 6 MRJP genes (Buttstedt et al., 2014), while the closely related Atta cephalotes contains 8. In Atta,ﬁveofthesegenesappearto

49 be undergoing pseudogenisation (Buttstedt et al., 2014; Suen et al., 2011). Based on the Sanger sequencing results here, it does not appear that either of the genes we ampliﬁed were di↵erentiated from one another, indicating highly stabilising selection and suggesting both copies are functional. We cannot currently speculate regarding what these functions may be.

It is possible that the model used in the present study may be inappropriate, as it is based entirely on the assumption that imprinting will be manifest as complete silencing of one allele. This is an assumption based on the ‘loudest-voice-prevails’ principle, which states that one allele is selected to increase its expression, the other will be selected decrease its own expression until it is no longer expressed. This is well supported in many cases of genomic-imprinting in mammals, but does not apply to all imprinted genes– many genes are now being found with less extreme patterns of expression (Khatib, 2007).

Whether the ‘loudest-voice-prevails’ principle can be applied to the Hymenoptera is not clear. Under haplodiploidy, males possess only one copy of each gene, and were maternally derived alleles to be silenced, they may not be able to develop. The inheritance of the haplodiploid genome is analogous to that of the X-chromosome in mammals; models describing the evolution of imprinting on the X-chromosome suggest that the ‘haploidy’ of males at these loci can constrain the silencing of maternal alleles (Iwasa and Pomiankowski, 2001), and that X-chromosome imprinting may be a↵ected more by selection for sex-specific expression, rather than kinship conflict (Iwasa and Pomiankowski, 1999). It is likely, however, that the selection regimes will di↵er greatly between the X-chromosome and a haplodiploid genome, perhaps facilitating greater divergence in expression levels between allele copies. The restrictions on silencing will not apply for the silencing of paternal alleles; they are not found in males anyway, so presumably could be silenced in females with little adverse e↵ect. Similarly, there is no reason to expect that the cellular machinery that reads imprinting marks could not be expressed in a sex-specific manner. Sex-specific parental e↵ects have already been observed in mice (Gregg et al., 2010a; Hager et al., 2008) and chickens (Wang

50 et al., 2015), so cannot be excluded in social insects.

Perhaps somewhat ominously, a genome-wide search for imprinted genes in the honeybee did not identify any genes that showed complete silencing of one allele in either direction (Kocher et al., 2015). Although this is surprising, it should be pointed out that Kocher et al (2015) created hybrids between the african and the european honeybee. Imprinting has been suggested as a possible mechanism for hybrid incompatibilities (Wolf et al., 2014), and it is possible that the imprinting patterns that were observed in these honeybee crosses do not reﬂect the normal patterns of imprinted expression.

One could also argue that imprinted genes will be dicult to identify in the adult brain, the tissue used for RNA expression levels in this study. The choice of adult brains was imposed by the data available (Li et al., 2014). Complex patterns of expression are observed in the brains of mammals,(Gregg et al., 2010b,c; Wang et al., 2008) and may also be the case in insects. If, for example, kin recognition genes relating to nepotism within acolonyareimprinted(Queller,2003),thegenesa↵ectedmayonlybeexpressedatlow levels in few cells; these genes would not be well-represented within the transcriptome data, and we would not be able to identify them. The methods presented here are most likely to identify highly-expressed genes, and are perhaps better suited to searching for imprinting in genes involved in growth or caste-determination that are expressed in earlier life-stages (larvae), where caste-determination conﬂict is still ongoing. Under imprinting, we may expect larvae to have high levels of growth factors much more favourable to such searches (Haig, 1996).

Despite the limitations of the methodology outlined above, there is reason for optimism. Firstly, there are 39 genes remaining that warrant veriﬁcation, many of which appear to be good candidates for imprinting e↵ects.

‘Cytochrome P450 9e2 ’, for example, was found to show parent of origin speciﬁc e↵ects

51 in the honeybee. Here, three loci were found to be consistent with imprinting at this gene (entries 3, 71, and 72 in table 2). Kocher et al. (2015) found a matrigenic bias for these genes, whereas we find two loci consistent with matrigenic expression, and one consistent with patrigenic. This inconsistency could be considered damning, but these loci are suciently distant that these entries may not belong to the same gene. If this gene is indeed imprinted in both the honeybee and A. echinatior, it may represent an ancestral imprint. Under this scenario the kinship theory may not be the most appropriate explanation, as the imprint would pre-date sociality and therefore many of the conflicts that apply to the social insects. This also lends support to the idea that cytonuclear interactions could be an important selective pressure for the evolution of imprinting. Mitochondria are inherited solely from the mother, so it may be beneficial to express the genomic allele that was also inherited from her (Wolf, 2009). We also found a second cytochrome gene (P450 4V3) and a gene that contributes to the ‘Mitochondrial tri-functional enzyme’, an enzyme that is oxidises fatty-acids, an important pathway for energy production. These genes must be explored further.

That Copia is also so highly represented in ASE dataset is also interesting. Copia is an ancient transposable element (Wicker and Keller, 2007), that has been shown to regulate gene expression in Drosophila (Bryant et al., 1991). This e↵ect is consistent with a potential role in imprinting, and may also imply that imprinting in insects could originally have been associated with the suppression of selﬁsh genetic elements, as has been suggested previously (McDonald et al., 2005).

More pertinent to the kinship theory, Kocher et al. (2015) also found a maternal bias for a histone-methyltransferase. We identified 3 histone-modification enzymes here, each showing expression patterns consistent with matrigenic expression. Histone-modification is involved in the transcriptional regulation of many genes, and interacts in complex ways with DNA methylation in insects(Hunt et al., 2013). It therefore holds great potential for silencing or activating alleles depending on epigenetic marks. In mammals, histones

52 are thought to also regulate imprinted expression, perhaps independently from methylation (Hunt et al., 2013; Lewis et al., 2004). We cannot exclude that imprinting in insects is mech- anistically di↵erent from that observed so far in mammals; whether imprinted expression of sets of genes could be induced by imprinting histone-modifying enzymes has not been fully explored. Similarly, we also found that two genes associated with splicing also show expression consistent with genomic imprinting (CWC15, also known as c12.1 in Drosophila (Herold et al., 2009) and a ‘putative-splicing-factor’).

There remains much to be done, and we hope that this work allows the search for imprinted gene expression to be expanded across a wide range of social insects, a thorough, genome-wide search across multiple taxa may be more likely to eventually unearth an imprinted gene, opening an entirely new system to the study of genomic imprinting and kin conﬂicts.

Acknowledgments

We would like to thank the Beijing Genomics Institute, particularly Qiye Li and Zongji Wang, for supplying the data used in this study. Thanks must also go to the Smithsonian Tropical Research Institute, Panama, for kind use of their facilities.

53 Figure 1.1: Predictions of ASE Under Genomic Imprinting

1.00 1.00 1.00

0.75 0.75 0.75

0.50 0.50 0.50 54 Allele Frequency in Colony RNA in Colony Allele Frequency Allele Frequency in Colony RNA in Colony Allele Frequency Allele Frequency in Colony RNA in Colony Allele Frequency 0.25 0.25 0.25

0.00 0.00 0.00

0.00 0.25 0.50 0.75 1.00 0.00 0.25 0.50 0.75 1.00 0.00 0.25 0.50 0.75 1.00 Allele Frequency in Colony DNA Allele Frequency in Colony DNA Allele Frequency in Colony DNA (b) Expression exclusively from the matri- (c) Expression exclusively from the patri- (a) Expectation without imprinting gene gene Figure 1.2: Predictions of ASE with Varying Queen Genotypes

1.00 1.00 1.00

0.75 0.75 0.75

0.50 0.50 0.50 55 Allele Frequency in Colony RNA in Colony Allele Frequency RNA in Colony Allele Frequency RNA in Colony Allele Frequency

0.25 0.25 0.25

0.00 0.00 0.00

0.00 0.25 0.50 0.75 1.00 0.00 0.25 0.50 0.75 1.00 0.00 0.25 0.50 0.75 1.00 Allele Frequency in Colony DNA Allele Frequency in Colony DNA Allele Frequency in Colony DNA (a) Queen is homozygous: 2/2 (b) Queen is heterozygous: 2/1 (c) Queen is homozygous: 1/1 The e↵ect of queen genotype on the predicted proportions of an allele in colony DNA and RNA. Horizontal lines are predicted under matrigenic expression, diagonal lines are predicted under patrigenic expression. Figure 1.3: Allele Speciﬁc Expression of Vitellogenin 1 : Genome Wide Data

1627958 1627977 1628016

1.0

0.5

Caste G L 0.0 S 1634597 1644225 Colony 1.0 322 356 363 Proportion of SNP 1 in RNA

0.5

0.0

0.0 0.5 0.0 0.5 Proportion of SNP 1 in DNA The ASE patterns of Vitellogenin-1 found in the DNA and RNA illumina-sequencing data are consistent with imprinting at some loci (eg. 1627977), but inconsistent in others. Locus 1644225 also di↵ers from other loci within this gene. Error bars indicate the 95% Aggresti- Coul conﬁdence limits.

56 Figure 1.4: Allele Speciﬁc Expression of Major Royal Jelly Protein III : Genome Wide Data

0.8

Caste G L S

Colony 322 0.4 356 363 Proportion of SNP 1 in RNA

0.0

0.0 0.4 0.8 Proportion of SNP 1 in DNA The proportions of the SNP found within MRJP3 for the DNA and RNA illumina- sequencing data are consistent with the predictions of patrigenic expression, predicting a queen homozygous for SNP1 in all three colonies. Error bars indicate the 95% Aggresti- Coul conﬁdence limits.

57 Figure 1.5: Allele Speciﬁc Expression of Major Royal Jelly Protein III: ddPCR Data

100

● 75 ● Caste ● Gy LW SW

Colony 50 ● 160b ● 168 ● 226b ● 263 ● 322 Proportion of SNP 1 in cDNA ● 356 25

0 25 50 75 100 Proportion of SNP 1 in DNA Proportions of the SNP1 as estimated using ddPCR for 6 colonies, all are consistent with imprinting, but suggest that each queen is homozygous for SNP1. Error bars represent the 95% conﬁdence intervals for allelic proportions for each reaction, based on subsampling error among droplets.

58 Figure 1.6: Allele Ratios for Major Royal Jelly Protein III: Pooled Male DNA

100

50 Proportion of SNP 1 in Male DNA 25

160b 168 263 322 356 Colony The proportion of SNP1 in the DNA of pooled males, used as an estimate of queen genotype. Error bars represent 95% conﬁdence intervals based on subsampling error in the ddPCR.

59 Figure 1.7: Allele Ratios for Major Royal Jelly Protein III: Individual Male DNA

100

Colony 226 50 322 356 Proportion of SNP 1 in Male DNA

Individual The proportion of SNP1 found in individual males from 3 colonies, 13 males were found to be ‘heterozygous’ for the two SNPs at this locus. Error bars indicate 95% conﬁdence intervals based on subsampling among droplets in the ddPCR.

60 Appendix A: List of Genes showing ASE (p<0.05)

Table 1: All genes identified as showing significant ASE (p<0.05), those genes found with the more strict p-value cut-o↵(p<0.01) are shown first, followed by the additional genes found under less stringent conditions.

Gene P

1 Adenylate cyclase type 8 (Fragment) p<0.01 2 Alpha-N-acetylgalactosaminidase p<0.01 3Brixdomain-containing protein 1p<0.01 4C3and PZP-like alpha-2-macroglobulin domain-containing protein 8p<0.01 5Copiaprotein p<0.01 6CytochromeP450 9e2 p<0.01 7CytochromeP450 9e2 (Fragment) p<0.01 8Endocuticlestructural glycoprotein SgAbd-1 (Fragment) p<0.01 9Eukaryotictranslation initiation factor 4 gamma 2p<0.01 10 Flotillin-2 p<0.01 11 G-protein coupled receptor Mth2 p<0.01 12 Guanylate cyclase (EC 4.6.1.2) p<0.01 13 Histone acetyltransferase KAT2A p<0.01 14 Histone acetyltransferase KAT2A (Fragment) p<0.01 15 Histone deacetylase 6p<0.01 16 Histone-lysine N-methyltransferase SETMAR p<0.01 17 Hormone-sensitive lipase p<0.01 18 Major royal jelly protein 3p<0.01 19 Neurotrimin (Fragment) p<0.01 20 Protein alan shepard (Fragment) p<0.01 21 Protein CWC15-like protein A (Fragment) p<0.01 22 Protein distal antenna p<0.01 23 Putative dimethyladenosine transferase p<0.01

61 24 Putative glutaminyl-tRNA synthetase p<0.01 25 Putative splicing factor, arginine/serine-rich 7p<0.01 26 RNA-binding protein 40 (Fragment) p<0.01 27 Selenium-binding protein 1-A (Fragment) p<0.01 28 Stress-activated protein kinase JNK p<0.01 29 Thrombospondin-4 p<0.01 30 Titin p<0.01 31 TM2 domain-containing protein p<0.01 32 Trifunctional enzyme subunit alpha, mitochondrial p<0.01 33 Uncharacterized protein p<0.01 34 Vitellogenin-1 (Fragment) p<0.01 35 26S proteasome non-ATPase regulatory subunit 4p<0.05 36 3-ketoacyl-CoA thiolase, mitochondrial p<0.05 37 Aats-gln p<0.05 38 Adenylate cyclase type 3p<0.05 39 Alpha-aminoadipic semialdehyde synthase, mitochondrial (Fragment) p<0.05 40 Carboxypeptidase Mp<0.05 41 CG6091 p<0.05 42 CG6867 p<0.05 43 Coiled-coil domain-containing protein 6p<0.05 44 Cytochrome P450 4V3 (Fragment) p<0.05 45 Estradiol 17-beta-dehydrogenase 8 (Fragment) p<0.05 46 HDAC6 p<0.05 47 Kazrin p<0.05 48 Large proline-rich protein BAT3 p<0.05 49 Lipoamide acyltransferase component...mitochondrial p<0.05 50 Muscle-speciﬁc protein 20 (Fragment) p<0.05 51 Mushroom body large-type Kenyon cell-speciﬁc protein 1 (Fragment) p<0.05

62 52 Pcaf p<0.05 53 Phosphatidylethanolamine-binding protein 1p<0.05 54 Protein lethal(2)essential for life p<0.05 55 Pyrazinamidase/nicotinamidase p<0.05 56 Ras-related protein Rab-26 p<0.05 57 Ras-related protein Rab-7a p<0.05 58 S1 RNA-binding domain-containing protein 1p<0.05 59 Sentrin-speciﬁc protease 7p<0.05 60 sls p<0.05 61 Spectrin alpha chain p<0.05 62 Spermatogenesis-associated protein 17 p<0.05 63 Splicing factor 3B subunit 3p<0.05 64 TBPH p<0.05 65 Transmembrane protein 47 p<0.05 66 Tuftelin-interacting protein 11 p<0.05 67 Voltage-dependent calcium channel subunit alpha-2/delta-3 p<0.05 68 WW domain-containing oxidoreductase p<0.05

Appendix B: Loci Consistent with Genomic Imprinting

Table 2: All loci that were found to have signiﬁcant ASE (p<0.05) consistent with complete silencing of one parental allele. ‘Patrigenic’ and ‘matrigenic’ refer to the expressed allele.

Gene Locus Patrigenic Matrigenic

1Proteinalan shepard (Fragment) 1029394 TRUE FALSE 2Proteinalan shepard (Fragment) 1029395 TRUE FALSE 3CytochromeP450 9e2 109865 TRUE FALSE 4 Histone acetyltransferase KAT2A 1466338 FALSE TRUE 5 Histone acetyltransferase KAT2A 1466345 TRUE TRUE

63 6 Histone acetyltransferase KAT2A 1466378 FALSE TRUE 7 Histone acetyltransferase KAT2A 1466439 FALSE TRUE 8 Heme oxygenase 2 1466496 TRUE FALSE 9 Histone acetyltransferase KAT2A 1466496 FALSE TRUE 10 Heme oxygenase 2 1466511 TRUE FALSE 11 Protein distal antenna 147 FALSE TRUE 12 Vitellogenin-1 (Fragment) 1627958 FALSE TRUE 13 Vitellogenin-1 (Fragment) 1627977 TRUE TRUE 14 Spermatogenesis-associated protein 17 1651368 TRUE FALSE 15 Alpha-aminoadipic semialdehyde synthase, mitoch... 168519 TRUE FALSE 16 Histone deacetylase 6 169700 FALSE TRUE 17 Olfactomedin-like protein 2A 182153 TRUE FALSE 18 Titin 184543 TRUE FALSE 19 Titin 184545 TRUE TRUE 20 Titin 184546 TRUE TRUE 21 Transmembrane protein 47 199149 TRUE TRUE 22 Histone-lysine N-methyltransferase SETMAR 212379 TRUE TRUE 23 Histone-lysine N-methyltransferase SETMAR 212807 TRUE TRUE 24 Histone-lysine N-methyltransferase SETMAR 212902 TRUE TRUE 25 Histone-lysine N-methyltransferase SETMAR 213035 TRUE TRUE 26 Histone-lysine N-methyltransferase SETMAR 213072 TRUE TRUE 27 Histone-lysine N-methyltransferase SETMAR 213231 TRUE TRUE 28 OTU domain-containing protein 5-B 241961 TRUE FALSE 29 Putative splicing factor, arginine/serine-rich 7 266876 TRUE TRUE 30 Histone-lysine N-methyltransferase SETMAR 29276 FALSE TRUE 31 Guanylate cyclase (EC 4.6.1.2) 297469 TRUE FALSE 32 Cytochrome P450 4V3 (Fragment) 299540 TRUE FALSE 33 Hormone-sensitive lipase 3124259 TRUE FALSE

64 34 T-complex protein 1 subunit theta 329 TRUE FALSE 35 Putative glutaminyl-tRNA synthetase 329904 TRUE FALSE 36 Major royal jelly protein 3 3456 TRUE FALSE 37 S1 RNA-binding domain-containing protein 1 364062 TRUE FALSE 38 Nose resistant to fluoxetine protein 6 (Fragment) 3879 TRUE TRUE 39 Trifunctional enzyme subunit alpha, mitochondrial 398957 TRUE FALSE 40 Trifunctional enzyme subunit alpha, mitochondrial 399098 TRUE FALSE 41 Trifunctional enzyme subunit alpha, mitochondrial 399419 TRUE FALSE 42 Trifunctional enzyme subunit alpha, mitochondrial 399446 TRUE FALSE 43 Muscle-specific protein 20 (Fragment) 400705 TRUE FALSE 44 Sodium channel protein para 400705 TRUE FALSE 45 Muscle-specific protein 20 (Fragment) 400729 TRUE FALSE 46 Ras-related protein Rab-7a 447709 FALSE TRUE 47 Adenylate cyclase type 8 (Fragment) 466952 TRUE FALSE 48 Copia protein 578555 TRUE FALSE 49 Copia protein 578653 FALSE TRUE 50 Copia protein 578795 TRUE FALSE 51 Copia protein 578913 FALSE TRUE 52 Copia protein 578924 FALSE TRUE 53 Copia protein 579373 FALSE TRUE 54 Copia protein 579386 FALSE TRUE 55 Copia protein 579496 TRUE TRUE 56 Copia protein 580030 FALSE TRUE 57 Spectrin alpha chain 589357 FALSE TRUE 58 Uncharacterized protein 61444 FALSE TRUE 59 Uncharacterized protein 61489 FALSE TRUE 60 G-protein coupled receptor Mth2 61498 FALSE TRUE 61 G-protein coupled receptor Mth2 61501 FALSE TRUE

65 62 Phosphatidylethanolamine-binding protein 1 653004 TRUE FALSE 63 Protein CWC15-like protein A (Fragment) 6797 TRUE FALSE 64 3-ketoacyl-CoA thiolase, mitochondrial 699207 TRUE FALSE 65 Alpha-N-acetylgalactosaminidase 773202 TRUE FALSE 66 Neurotrimin (Fragment) 80663 TRUE FALSE 67 Homeobox protein DTH-2 852382 TRUE TRUE 68 TM2 domain-containing protein 864543 TRUE FALSE 69 Selenium-binding protein 1-A (Fragment) 86630 TRUE FALSE 70 Putative dimethyladenosine transferase 89908 TRUE FALSE 71 Cytochrome P450 9e2 (Fragment) 951187 FALSE TRUE 72 Cytochrome P450 9e2 (Fragment) 951217 FALSE TRUE

66 Bibliography

S. Albert, J. Spaethe, K. Gruebel, and W. Roessler. Royal jelly-like protein localization reveals di↵erences in hypopharyngeal glands buildup and conserved expression pattern in brains of bumblebees and honeybees. Biology Open, 3(4):281–288, 2014. doi: 10.1242/ bio.20147211. URL http://bio.biologists.org/content/3/4/281.full.

H. E. Amarasinghe, C. I. Clayton, and E. B. Mallon. Methylation and worker reproduction in the bumble-bee (Bombus terrestris). Proceedings of the Royal Society B: Biological Sciences, 281(1780):20132502–20132502, Apr. 2014. doi: 10.1098/rspb. 2013.2502. URL http://classic.rspb.royalsocietypublishing.org/content/281/ 1780/20132502.full.

T. Babak, B. DeVeale, E. K. Tsang, Y. Zhou, X. Li, K. S. Smith, K. R. Kukurba, R. Zhang, J. B. Li, D. van der Kooy, S. B. Montgomery, and H. B. Fraser. Genetic conflict reflected in tissue-specific maps of genomic imprinting in human and mouse. Nature Genetics,47(5):544–549,May2015.doi:10.1038/ng. 3274. URL http://eutils.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi?dbfrom= pubmed&id=25848752&retmode=ref&cmd=prlinks.

L. W. Beukeboom and J. van den Assem. Courtship and mating behaviour of inter- speciﬁc Nasonia hybrids (Hymenoptera, Pteromalidae): A grandfather e↵ect. Be- havior Genetics, 31(2):167–177, Mar. 2001. doi: 10.1007/978-3-319-05467-4. URL http://link.springer.com/article/10.1023/A:1010201427204.

L. W. Beukeboom and J. van den Assem. Courtship displays of introgressed, interspeciﬁc

67 hybrid nasonia males: Further investigations into the ’grandfather e↵ect’. Behaviour, 139:1029–1042, Aug. 2002. URL http://gateway.webofknowledge.com/gateway/ Gateway.cgi?GWVersion=2&SrcAuth=mekentosj&SrcApp=Papers&DestLinkType=

FullRecord&DestApp=WOS&KeyUT=000179463200002.

L. A. Bryant, C. Brierley, A. J. Flavell, and J. H. Sinclair. The retrotransposon copia regulates drosophila gene expression both positively and negatively. Nucleic Acids Research, 19(20):5533–5536, 10 1991. URL http://www.ncbi.nlm.nih.gov/pmc/ articles/PMC328953/.

A. Buttstedt, R. F. A. Moritz, and S. Erler. More than royal food - Major royal jelly protein genes in sexuals and workers of the honeybee Apis mellifera. Frontiers in Zoology,10 (1), 2013. doi: 10.1186/1742-9994-10-72. URL http://www.frontiersinzoology.com/ content/10/1/72.

A. Buttstedt, R. F. A. Moritz, and S. Erler. Origin and function of the major royal jelly proteins of the honeybee (Apis mellifera) as members of the yellow gene family. Biological Reviews, 89(2):255–269, May 2014. doi: 10.1111/brv.12052. URL http:// onlinelibrary.wiley.com/doi/10.1111/brv.12052/full.

J. D. Coolon, K. R. Stevenson, C. J. McManus, B. R. Graveley, and P. J. Wittkopp. Genomic Imprinting Absent in Drosophila melanogaster Adult Fe- males. Cell Reports, 2(1):69–75, July 2012. doi: 10.1016/j.celrep.2012.06. 013. URL http://eutils.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi?dbfrom= pubmed&id=22840398&retmode=ref&cmd=prlinks.

B. Crespi and C. Badcock. Psychosis and autism as diametrical disorders of the social brain. Behav Brain Sci, 31(3):241–61; discussion 261–320, Jun 2008. doi: 10.1017/ S0140525X08004214.

T. M. Dechiara, E. J. Robertson, and A. Efstratiadis. Parental Imprinting of the Mouse Insulin-Like Growth Factor-Ii Gene. Cell,64(4):849–859,1991.doi:10.

68 1016/0092-8674(91)90513-X. URL http://linkinghub.elsevier.com/retrieve/pii/ 009286749190513X.

B. DeVeale, D. van der Kooy, and T. Babak. Critical Evaluation of Imprinted Gene Ex- pression by RNA-Seq: A New Perspective. Plos Genetics,8(3),Mar.2012.doi:10.1371/ journal.pgen.1002600. URL http://dx.plos.org/10.1371/journal.pgen.1002600.

S. Dobata and K. Tsuji. Intragenomic conﬂict over queen determination favours genomic imprinting in eusocial Hymenoptera. Proceedings of the Royal Society B: Bio- logical Sciences, 279(1738):2553–2560, 2012. doi: 10.1098/rspb.2011.2673. URL http: //rspb.royalsocietypublishing.org/content/279/1738/2553.full.

P. Fontanillas, C. R. Landry, P. J. Wittkopp, C. Russ, J. D. Gruber, C. Nusbaum, and D. L. Hartl. Key considerations for measuring allelic expression on a genomic scale using high-throughput sequencing. Molecular ecology,19(s1):212–227,Mar.2010.doi: 10.1111/j.1365-294X.2010.04472.x. URL http://onlinelibrary.wiley.com/doi/10. 1111/j.1365-294X.2010.04472.x/full.

L. Fr´esard, S. Leroux, B. Servin, D. Gourichon, P. Dehais, M. S. Cristobal, N. Marsaud, F. Vignoles, B. Bed’hom, J.-L. Coville, F. Hormozdiari, C. Beaumont, T. Zerjal, A. Vi- gnal, M. Morisson, S. Lagarrigue, and F. Pitel. Transcriptome-wide investigation of genomic imprinting in chicken. Nucleic Acids Res, 42(6):3768–82, Apr 2014. doi: 10.1093/nar/gkt1390.

C. Gregg, J. Zhang, J. E. Butler, D. Haig, and C. Dulac. Sex-speciﬁc parent-of-origin allelic expression in the mouse brain. Science, 329(5992):682–5, Aug 2010a. doi: 10. 1126/science.1190831.

C. Gregg, J. Zhang, J. E. Butler, D. Haig, and C. Dulac. Sex-Speciﬁc Parent-of-Origin Al- lelic Expression in the Mouse Brain. Science (New York, N.Y.),329(5992):682–685, 2010b. doi: 10.1126/science.1190831. URL http://www.sciencemag.org/content/ 329/5992/682.full.

69 C. Gregg, J. Zhang, B. Weissbourd, S. Luo, G. P. Schroth, D. Haig, and C. Dulac. High- Resolution Analysis of Parent-of-Origin Allelic Expression in the Mouse Brain. Science (New York, N.Y.), 329(5992):643–648, 2010c. doi: 10.1126/science.1190830. URL http: //www.sciencemag.org/content/329/5992/643.full.

E. Guzman-Novoa, G. Hunt, R. Page, J. Uribe-Rubio, D. Prieto-Merlos, and F. Becerra- Guzman. Paternal e↵ects on the defensive behavior of honeybees. Journal of Heredity, 96(4):376–380, 2005.

R. Hager, J. M. Cheverud, L. J. Leamy, and J. B. Wolf. Sex dependent imprinting e↵ects on complex traits in mice. Bmc Evolutionary Biology,8(1):303,2008.doi:10.1186/ 1471-2148-8-303. URL http://www.biomedcentral.com/1471-2148/8/303.

D. Haig. Placental hormones, genomic imprinting, and maternal-fetal communication. Jour- nal of Evolutionary Biology,9(3):357–380,1996.

D. Haig. Parental antagonism, relatedness asymmetries, and genomic imprinting. Pro- ceedings of the Royal Society B: Biological Sciences,264(1388):1657–1662,1997.doi: 10.1098/rspb.1997.0230. URL http://rspb.royalsocietypublishing.org/cgi/doi/ 10.1098/rspb.1997.0230.

D. Haig. The kinship theory of genomic imprinting. Annual review of ecology and systematics,pages9–32,2000.

D. Haig. GENOMIC IMPRINTING AND KINSHIP: How Good is the Evidence? Annual Review of Genetics,38(1):553–585,Dec.2004.doi:10.1146/annurev.genet.37.110801. 142741. URL http://www.annualreviews.org/doi/abs/10.1146/annurev.genet.37. 110801.142741.

70 W. D. Hamilton. The genetical evolution of social behaviour. II. Journal of Theoreti- cal Biology, 7(1):17–52, July 1964a. URL http://eutils.ncbi.nlm.nih.gov/entrez/ eutils/elink.fcgi?dbfrom=pubmed&id=5875340&retmode=ref&cmd=prlinks.

W. D. Hamilton. The genetical evolution of social behaviour. I. Journal of Theoretical Biol- ogy, 7(1):1–16, July 1964b. URL http://eutils.ncbi.nlm.nih.gov/entrez/eutils/ elink.fcgi?dbfrom=pubmed&id=5875341&retmode=ref&cmd=prlinks.

N. Herold, C. L. Will, E. Wolf, B. Kastner, H. Urlaub, and R. L¨uhrmann. Conservation of the protein composition and electron microscopy structure of drosophila melanogaster and human spliceosomal complexes. Molecular and cellular biology,29(1):281–301,2009.

C.-Y. Huang, L.-L. Chi, W.-J. Huang, Y.-W. Chen, W.-J. Chen, Y.-C. Kuo, C. M. Yuan, and C.-N. Chen. Growth stimulating e↵ect on queen bee larvae of histone deacetylase inhibitors. Journal of agricultural and food chemistry, 60(24):6139–6149, June 2012. doi: 10.1021/jf300815b. URL http://eutils.ncbi.nlm.nih.gov/entrez/eutils/elink. fcgi?dbfrom=pubmed&id=22642680&retmode=ref&cmd=prlinks.

B. G. Hunt, K. M. Glastad, V. Y. Soojin, and M. A. Goodisman. Patterning and regulatory associations of dna methylation are mirrored by histone modiﬁcations in insects. Genome biology and evolution,5(3):591–598,2013.

L. D. Hurst and G. T. McVean. Growth e↵ects of uniparental disomies and the conﬂict theory of genomic imprinting. Trends in Genetics,13(11):436–443,1997.

Y. Iwasa and A. Pomiankowski. Sex speciﬁc x chromosome expression caused by genomic imprinting. Journal of theoretical biology,197(4):487–495,1999.

71 Y. Iwasa and A. Pomiankowski. The evolution of x-linked genomic imprinting. Genetics, 158(4):1801–1809, 2001.

D. R. Johnson. Hairpin-tail: A case of post-reductional gene action in the mouse egg? Ge- netics, 76(4):795–805, 04 1974. URL http://www.ncbi.nlm.nih.gov/pmc/articles/ PMC1213105/.

M. Kamakura. Royalactin induces queen di↵erentiation in honeybees. Nature,473 (7348):478–483, 2011. doi: 10.1038/nature10093. URL http://eutils.ncbi.nlm.nih. gov/entrez/eutils/elink.fcgi?dbfrom=pubmed&id=21516106&retmode=ref&cmd=

prlinks.

H. Khatib. Is it genomic imprinting or preferential expression? BioEssays : news and reviews in molecular, cellular and developmental biology,29(10):1022–1028,Oct.2007. doi: 10.1002/bies.20637. URL http://onlinelibrary.wiley.com/doi/10.1002/bies. 20637/abstract.

D. J. Korbie and J. S. Mattick. Touchdown PCR for increased speciﬁcity and sensitivity in PCR ampliﬁcation. Nature protocols,3(9):1452–1456,2008.doi:10.1038/nprot.2008. 133. URL http://eutils.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi?dbfrom= pubmed&id=18772872&retmode=ref&cmd=prlinks.

R. Kucharski, R. Maleszka, D. C. Hayward, and E. E. Ball. A royal jelly protein is expressed in a subset of Kenyon cells in the mushroom bodies of the honey bee brain. Naturwissenschaften, 85(7):343–346, July 1998. URL http://eutils.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi?dbfrom= pubmed&id=9722965&retmode=ref&cmd=prlinks.

72 J. Kupke, J. Spaethe, M. J. Mueller, W. R¨ossler, and S. Albert. Molecular and biochemical characterization of the major royal jelly protein in bumblebees suggest a non-nutritive function. Insect Biochemistry and Molecular Biology, 42(9):647–654, Sept. 2012. doi: 10.1016/j.ibmb.2012.05.003. URL http://linkinghub.elsevier.com/retrieve/pii/ S0965174812000732.

A. Lewis, K. Mitsuya, D. Umlauf, P. Smith, W. Dean, J. Walter, M. Higgins, R. Feil, and W. Reik. Imprinting on distal chromosome 7 in the placenta involves repressive histone methylation independent of dna methylation. Nat Genet,36(12):1291–1295,122004. URL http://dx.doi.org/10.1038/ng1468.

H. Li and R. Durbin. Fast and accurate short read alignment with burrows-wheeler trans- form. Bioinformatics, 25(14):1754–60, Jul 2009. doi: 10.1093/bioinformatics/btp324.

Q. Li, Z. Wang, J. Lian, M. Schiøtt, L. Jin, P. Zhang, Y. Zhang, S. Nygaard, Z. Peng, Y. Zhou, Y. Deng, W. Zhang, J. J. Boomsma, and G. Zhang. Caste-speciﬁc RNA editomes in the leaf-cutting ant Acromyrmex echinatior. Nature communications,5:4943, 2014. doi: 10.1038/ncomms5943. URL http://eutils.ncbi.nlm.nih.gov/entrez/ eutils/elink.fcgi?dbfrom=pubmed&id=25266559&retmode=ref&cmd=prlinks.

J. McDonald, M. Matzke, and A. Matzke. Host defenses to transposable elements and the evolution of genomic imprinting. Cytogenetic and genome research,110(1-4):242–249, 2005.

73 N. D. Pires and U. Grossniklaus. Di↵erent yet similar: evolution of imprinting in ﬂowering plants and mammals. F1000Prime Rep,6:63,2014.doi:10.12703/P6-63.

D. C. Queller. Theory of genomic imprinting conﬂict in social insects. Bmc Evolu- tionary Biology, 3(1):15, July 2003. doi: 10.1186/1471-2148-3-15. URL http://www. biomedcentral.com/1471-2148/3/15.

C. Rabeling, T. Schultz, M. Bacci Jr, and M. Bollazzi. Acromyrmex charruanus: a new inquiline social parasite species of leaf-cutting ants. Insectes Sociaux,pages1–15.

C. Rabeling, J. Lino-Neto, S. C. Cappellari, I. A. Dos-Santos, U. G. Mueller, and M. Bacci. Thelytokous parthenogenesis in the fungus-gardening ant Mycocepurus smithii (Hy- menoptera: Formicidae). PloS one,4(8):e6781,2009.doi:10.1371/journal.pone.0006781. URL http://dx.plos.org/10.1371/journal.pone.0006781.

W. Reik and E. R. Maher. Imprinting in clusters: Lessons from Beckwith-Wiedemann syndrome. Trends in genetics : TIG, 13(8):330–334, Aug. 1997. doi: 10. 1016/S0168-9525(97)01200-6. URL http://linkinghub.elsevier.com/retrieve/ pii/S0168952597012006.

W. Reik and J. o. r. Walter. Evolution of imprinting mechanisms: the battle of the sexes begins in the zygote. Nature Genetics,27(3):255–256,Mar.2001a.doi:10.1038/85804. URL http://www.nature.com/ng/journal/v27/n3/full/ng0301_255.html.

W. Reik and J. o. r. Walter. Genomic imprinting: parental inﬂuence on the genome. Nature Reviews Genetics, 2(1):21–32, Jan. 2001b. doi: 10.1038/35047554. URL http: //www.nature.com/nrg/journal/v2/n1/abs/nrg0101_021a.html.

74 M. B. Renfree, S. Suzuki, and T. Kaneko-Ishino. The origin and evolution of genomic imprinting and viviparity in mammals. Philos Trans R Soc Lond B Biol Sci,368(1609): 20120151, Jan 2013. doi: 10.1098/rstb.2012.0151.

T. Schultz, D. Bekkevold, and J. J. Boomsma. Acromyrmex insinuator new species: an incipient social parasite of fungus-growing ants. Insectes Sociaux,45(4):457–471,1998.

A. Untergasser, H. Nijveen, X. Rao, T. Bisseling, R. Geurts, and J. A. Leunissen. Primer3plus, an enhanced web interface to primer3. Nucleic acids research,35(suppl 2):W71–W74, 2007.

E. C. Verhulst, L. W. Beukeboom, and L. van de Zande. Maternal control of haplodiploid sex determination in the wasp Nasonia. Science (New York, N.Y.),328(5978):620–623, Apr. 2010. doi: 10.1126/science.1185805. URL http://www.sciencemag.org/content/ 328/5978/620.full.

Q. Wang, K. Li, D. Zhang, J. Li, G. Xu, J. Zheng, N. Yang, and L. Qu. Next-generation sequencing techniques reveal that genomic imprinting is absent in day-old gallus gallus domesticus brains. PLoS One,10(7):e0132345,2015.doi:10.1371/journal.pone.0132345.

75 X. Wang and A. G. Clark. Using next-generation RNA sequencing to identify imprinted genes. Heredity, 113(2):156–166, Aug. 2014. doi: 10.1038/hdy.2014.18. URL http: //www.nature.com/doifinder/10.1038/hdy.2014.18.

X. Wang, Q. Sun, S. D. McGrath, E. R. Mardis, P. D. Soloway, and A. G. Clark. Transcriptome-wide identiﬁcation of novel imprinted genes in neonatal mouse brain. PLoS One, 3(12):e3839, 2008. doi: 10.1371/journal.pone.0003839.

Y. Wang, M. Jorda, P. L. Jones, R. Maleszka, X. Ling, H. M. Robertson, C. A. Mizzen, M. A. Peinado, and G. E. Robinson. Functional cpg methylation system in a social insect. Science,314(5799):645–647,2006.

T. Wicker and B. Keller. Genome-wide comparative analysis of copia retrotransposons in triticeae, rice, and arabidopsis reveals conserved ancient evolutionary lineages and distinct dynamics of individual copia families. Genome Research,17(7):1072–1081,07 2007. doi: 10.1101/gr.6214107. URL http://www.ncbi.nlm.nih.gov/pmc/articles/ PMC1899118/.

J. Wolf, R. Oakey, and R. Feil. Imprinted gene expression in hybrids: perturbed mechanisms and evolutionary implications. Heredity,113(2):167–175,2014.

J. B. Wolf. Cytonuclear interactions can favor the evolution of genomic imprinting. Evolu- tion,63(5):1364–1371,2009.

76 Chapter 2

A Potential Role for the Neuropeptide Tachykinin in Acromyrmex echinatior Division of Labour

Jack Howe, Morten Schiøtt and Jacobus, J. Boomsma. The Centre for Social Evolution, University of Copenhagen. Corresponding author: [email protected]

77 Abstract

The tachykinins are a widely conserved family of neuropeptides that inﬂuence a wide range of behavioural phenotypes in both vertebrates and invertebrates; they appear to have a conserved role in the processing of stimuli, and in the control of aggression in a wide range of animals. Expression of tachykinin in a cluster of neurons was recently shown to determine the position of a ‘stimulus response threshold for aggressive behaviour in Drosophila (Asahina et al., 2014), suggesting a potential role in the organisation of colony defence. Varying response thresholds are implicated in the division of labour within social insect colonies, and here we test for a potential role of tachykinin in the aggressive division of labour among the castes of the leaf-cutting ant Acromyrmex echinatior,aspecieswith several morphologically and behaviourally distinct castes. We also manipulate the position of the aggression-threshold in virgin-queens. After correction for allometry, expression levels indicate that tachykinin could play an important role in the behavioural di↵erentiation of A. echinatior worker castes, with the largest, most aggressive worker caste showing the highest expression levels. The expression levels in the reproductive caste, both in mated queens and in the manipulations of virgin queens disagree with the observed aggression, and suggest that behavioural changes in the reproductive castes are controlled by an alternative pathway, or that the tachykinins could inﬂuence alternative behaviours.

78 The insect societies exhibit a conspicuous division of labour that is often cited as one of the main drivers of their great ecological success (Wilson et al., 1971). Within a social insect colony, the behaviour of potentially millions of individuals is coordinated to produce acomplexcohesivecolony;eachindividualinthecolonyinterpretingenvironmentalstimuli and making local decisions, which sum to create a division of labour at the colony level that is ﬂexible to prevailing conditions and the needs of the colony (Beshers and Fewell, 2001). There are two distinct divisions of labour within a colony: the reproductive division of labour between the egg-laying queens and the unmated workers, and a division of labour among these unmated helpers as they assume di↵erent caste phenotypes; the former analogous to the soma-germline division in multicellular organisms, and the latter more akin to the di↵erent cell-types (Boomsma, 2009).

Models of self-organisation concentrate on the proximate mechanisms behind the decision making process of the sterile workers, trying to decode the simple rules that they must follow. The majority of these models are based on di↵ering thresholds among individuals (Beshers and Fewell, 2001; Duarte et al., 2011). These threshold models propose that acolonyworkforceconsistsof,atleastinitially,behaviourallytotipotentindividualswho vary in their stimulus-response threshold: an individual will perform a given task when a stimulus exceeds this internal threshold (Beshers et al., 1999). Variation among individuals in the position of this threshold creates an ecient and ﬂexible division of labour whereby those individuals with lower threshold will be more likely to perform a task than those with higher threshold (Myerscough and Oldroyd, 2004).

The threshold models are well-supported by behavioural studies: honeybee foragers tend to specialise as either water-foragers or as nectar-foragers, consistent with their sensitivity to sucrose-concentrations (Page et al., 1998; Pankiw and Page, 2000), individuals di↵er in their temperature thresholds in honeybees (Jones et al., 2004) and bumblebees (Duong and Dornhaus, 2012; Jandt and Dornhaus, 2014; O’Donnell and Foster, 2001), and in their tendency to forage and defend the nest in ants (Detrain and Pasteels, 1991, 1992). A

79 corollary of the threshold model is that a colony with a greater variety of thresholds will show a more ecient division of labour, and therefore higher productivity (Myerscough and Oldroyd, 2004)– a prediction upheld in honeybee thermal homeostasis (Jones et al., 2007; Oldroyd and Fewell, 2007) and in aggression of the monomorphic ant Temnothorax (Modlmeier and Foitzik, 2011).

Despite the strong behavioural support, relatively little is known about the molecular mechanisms that determine an individual’s threshold (Libbrecht et al., 2013). By far the most progress has been made in the honey bee, the most pronounced model social insect (Oldroyd and Thompson, 2006). Here, the manganese transporter malvolio appears to control sucrose sensitivity and therefore foraging behaviour (Ben-Shahar et al., 2004), and the forager gene (Ben-Shahar, 2005; Ben-Shahar et al., 2003) and octopamine appear to control the tendency to forage rather than perform nursing tasks (Schulz et al., 2002).

Outside of the honeybees, however, very little work has been conducted on the molecular controls of stimulus thresholds and, where it has, it is often an extension of the work conducted in honeybees. As in the honeybees, forager has also been implicated in the control of the division of labour the ant Pheidole pallidula (Lucas and Sokolowski, 2009b; Lucas et al., 2010b)– where for-mediated changes in cGMP-dependent kinase activity were negatively associated with foraging and positively associated with nest defence. With the increasing availability of genomic data for ants in particular, we now have the opportunity to test the molecular basis of response-thresholds in a much wider array of insects, with much more diverse social structures (Libbrecht et al., 2013). Here, we utilised the published Acromyrmex echinatior genome (Nygaard et al., 2011), to test for a role of the neuropeptide Tachykinin in the control of the defensive division of labour in this leaf-cutting ant.

A. echinatior belongs to the leaf-cutting crown-group of the attine fungus-growing ants (Schultz and Brady, 2008). It lives in an obligate nutritional symbiosis with a fungus, that it maintains within the nest, fertilising it using freshly cut foliage (Schultz and Brady, 2008;

80 Weber, 1972). Acromyrmex exhibits a complex division of labour, with morphologically distinct worker castes (Camargo et al., 2007). How many morphologically distinct worker castes A. echinatior has is still debated, some authors argue there are only two (major and minor) that are morphologically variable (Hughes et al., 2003), others state there are as many as four (Camargo et al., 2007). In this study, we followed Larsen et al. (2014) and distinguished between three morphological castes according to size. The smaller minor workers, mainly complete tasks within the nest: caring for brood and tending the fungus; while the larger media and major workers forage for substrate outside of the colony (Camargo et al., 2007; Hart et al., 2002). The castes therefore o↵er easily recognisable individuals that di↵er in their apparent response-thresholds. This is observed in aggression: the major workers defend the colony, and stand guard at the nest entrance; they have also been found to respond more aggressively to a foreign conspeciﬁc than the mediae, who are in turn more aggressive than the minor workers (Larsen et al., 2014). Larsen et al. attributed these aggressive di↵erences to a higher motivation to attack in the major workers, and a lower sensitivity to the chemical stimuli in the minor workers.

Acromyrmex also provides us with the opportunity to manipulate the threshold for aggression directly; reproductive females that have not yet left the nest to mate (gynes) are occasionally found within a colony having lost their wings. These wingless subsequently adopt a worker/soldier-like phenotype (Nehring et al., 2012). These gynes exhibit higher levels of aggression when they start to conduct worker/soldier tasks, and can be prompted to do so by experimental wing-removal (Nehring et al., 2012).

Tachykinin

ArecentscreenofvariousneuropeptidesinDrosophila implicated tachykinin as a controller of the response-stimulus threshold for sex-speciﬁc aggression (Asahina et al., 2014; Pavlou et al., 2014). Asahina et al. (2014) screened Drosophila lines for heightened aggression using atemperature-sensitiveionchannel,allowingselectiveactivationoftheneuronsinwhich

81 this peptide is expressed. Two lines that exhibited heightened aggression corresponded to a subset of tachykinin expressing neurons found only in males: increasing expression of tachykinin in these males increased aggression, while reducing tachykinin expression at these neurons, or the disrupting the expression of its receptor, greatly reduced aggression (Asahina et al., 2014) – the mutant ﬂies with elevated tachykinin expression showed aggression in scenarios where it is not normally observed, and could be prompted to attack moving magnets.

The tachykinins are an ancient family of neuropeptides widespread across the animal kingdom (Severini et al., 2002). They act to modulate neurotransmission, and have a wide range of functions in the central and peripheral nervous system, as well as the gastrointestinal tract (Maggi, 2000; N¨assel, 1999; Severini et al., 2002). Several tachykinin proteins are typically found in each organism, all formed from cleavage and modiﬁcation of fewer larger pro-tachykinins. Drosophila,forexample,has6tachykinin-peptidestranscribedfrom asinglegene(Poelsetal.,2009),whilehumanshaveatleast10encodedby3genes(Pen- nefather et al., 2004). In vertebrates, these proteins have been implicated in aggression, pain, fear, learning and memory, but are also important in gastrointestinal motility, blood pressure, the stimulation of secretions and the storage of fats (Severini et al., 2002; Trivedi et al., 2015).

Less is known about tachykinin in the invertebrates, although it appears to have equally wide-ranging e↵ects (Nässel, 1999; Van Loy et al., 2010). In the American cockroach, 15 tachykinin-related proteins (TRPs) have been identified (Neupert et al., 2012), a number of which can stimulate contractions of the midgut and influence the heart-rate (Nässel, 1999). In locusts and Drosophila, some TRPs have been found to be involved in lipid metabolism (Nässel, 1999; Song et al., 2014); while in the crustacea, they can trigger the rhythmic firing of the stomatogastric ganglion– a group of neurons associated with the decapod gut (Nässel, 1999). TRPs have also been found in the salivary glands of a mosquito (Champagne and Ribeiro, 1994) and the common octopus (Kanda et al., 2003); where they are thought to

82 a↵ect their prey by acting as vasodilators and venoms, respectively.

The TRPs do, however, appear to have consistent roles in the processing and relay of information – processes more germane to colony organisation. Tachykinin expression is regularly observed in the olfactory processing centres of the brain (Fusca et al., 2015; N¨assel and Homberg, 2006) and knock-down of expression through RNAi in Drosophila impairs olfactory sensitivity and increases locomotory activity (Winther et al., 2006). Con- sistent with this putative role in the processing of information, tachykinin was found to be expressed in the kenyon-cells of the honeybee mushroom bodies (Takeuchi et al., 2004), agroupofneuronsinvolvedinhigher-levelprocessingofinformationandassociatedwith locomotion, learning and memory (Heisenberg, 1998; Mobbs, 1982). Tachykinin expression in the mushroom bodies has not yet been observed outside of the Hymenoptera however (Heuer et al., 2012). Pertinently, in the honeybee brain, tachykinin is expressed at higher levels in the queens and foragers than in the nurses, suggesting a possible role in the division of labour (Takeuchi et al., 2003), although no quantitative estimates have been provided. The TRPs therefore have the potential to act as important regulators of social phenotypes by a↵ecting how individuals perceive, process and respond to sensory stimuli.

Here, we used quantitative-PCR to measure the levels of tachykinin and it’s receptor Tachykinin-99D in the brains of morphologically distinct Acromyrmex echinatior castes to evaluate the potential role of tachykinin in a behavioural division of labour. To determine if, following Asahina et al. (2014), tachykinin could play a role in division of labour with respect to colony-defence, we conducted a series of behavioural trials. The ‘tachykinin receptor-86C ’wasnotincludedinthisstudy,asitwasrecentlydemonstratedtobea natalisin receptor rather than a true tachykinin receptor (Jiang et al., 2013).

Measuring the expression of brain related genes in morphologically distinct individuals is challenging. The castes of A. echinatior di↵er greatly in size, and have di↵erent brain sizes as a result – in fact, a wide-ranging study of 40 myrmicine ant species found A. echinatior

83 to have both the largest and the smallest brains among this sample (Seid et al., 2011). As no reliable neuron-specific housekeeping genes are available for A. echinatior,expressionof genes in the brain will predominantly reflect allometric scaling among the castes, and these e↵ects must be removed to study biologically meaningful di↵erences. Consequently, in order to investigate tachykinin expression, we explored the relationship between the expression of tachykinin and its receptor. We also directly measured brain size in each caste to determine the e↵ect of caste-specific brain sizes.

Finally, we manipulated the aggression threshold of virgin queens by removing their wings, and tested whether tachykinin could control the heightened aggression that has previously been observed (Nehring et al., 2012).

2.1 Methods

Sample collection and Behavioural Trials

Founding Queens

12 founding-queens were collected in May of 2014 and 2015, in Gamboa, Panama along with their nascent fungus garden; these were housed in a 5cm petri dish with a small amount of damp cotton wool to maintain humidity. In three cases, the queen was collected without her fungus-garden and was o↵ered fungus from a mature colony that had been collected concurrently – the queens quickly adopted the new fungus. After acclimatising to the petri- dish for at least 24 hours, behavioural trials were conducted by introducing an allospeciﬁc Acromyrmex octospinosus major worker from a sympatric colony to the petri dish, and recording the host’s behaviour over the next three minutes. After conclusion of the trials, the intruder was removed, and the host was left for a further 12 hours in an attempt to

84 ensure the trials did not inﬂuence gene expression. The hosts were frozen at -80°Cfor5 minutes, decapitated and the heads were stored in RNAlater.Duringonetrial,itbecame apparent that the queen was not in good health; the trial was aborted, and the she was removed from the study.

Lab Colonies

Behavioural trials were conducted, as above, on 20 ants for four castes (Gynes, Major, Me- dia and Minor) across two colonies (Ae226 and 263) that have been kept under controlled conditions in Copenhagen for a number of years (25°C, 75% relative humidity, and a diet of bramble leaves, apple and rice). Worker castes were di↵erentiated according to head width (majors >2.0mm, 2.0mm1.6mm, minor <1.2mm (Larsen et al., 2014)). Half of the hosts were subject to intrusion by a nestmate control, and half by an allospeciﬁc A. octospinosus major worker, each A. echinatior colony was paired with an A. octospinosus colony (Ao604 and Ao273, respectively). 5 additional individuals of each caste were collected from the two A. echinatior colonies, as well as ants from a further 4 (Ae160, Ae322, Ae331 and Ae372): ants were ﬂash frozen in liquid nitrogen, the heads were removed from the body and stored at -80°C.

Aggression Indices

The videos were randomised, and later scored using JWatcher (Blumstein and Daniel, 2007) without knowledge of the intruder’s identity. As in Larsen et al. (2014) and Nehring et al. (2012) behaviours were scored as 0 for antennation, 1 for the mandibles being opened, and 2forbiting.TheaggressionindiceswerethencalculatedasinGuerrierietal.(2009):we multiplied the score of each behaviours by the proportion of the trial time that the host spent in each behaviour, the total was used as the aggression index. The index therefore ranges from 0 (completely peaceful interactions) to 2 (continuous biting).

85 Brain Dissections

Individuals were selected at random from two colonies (Ae226 and Ae263) and chilled at

5°Cfor15minutes.Theheadwasthenremovedandweighed.Beforedissection,thehead was brieﬂy submerged in 96% ethanol ( 1-2 sec), dried on lens paper and dissected under ⇠ PBS bu↵er. The brain was transferred to a microbalance in a pipette, and placed on a small piece of paraﬁlm; the PBS bu↵er was then removed using a twist of lens paper and the weight recorded.

Wing-Clipping

Gyne manipulation

We selected a further three colonies (Ae150, Ae356, and Ae394), that have also been housed in laboratory conditions for a number of years. All reproductive individuals were removed from each colony, the males were discarded and the females were chilled at 5°Cfor15 minutes. For each colony, we removed the wings from one third of the gynes collected, a middle leg from a second, and the remainder were left unharmed. The thorax of each gyne was marked with a spot of paint, a di↵erent colour for each treatment. They were left to recover for 30 minutes before being returned to the colony.

Behavioural Trials: Aggression

Behavioural trials were conducted as in Nehring et al. (2012). That is, a gyne was placed in a circular arena (5cm diameter) with fluon-coated walls and the floor lined with filter paper that had spent at least 24 hours in the gyne’s colony. She was then left for 5 minutes to acclimatise, before a large worker from either the natal nest or from an A. octospinosus colony was introduced, and the gyne’s behaviour was recorded for the next three minutes. Again each A. echinatior colony was paired with an A. octospinosus colony (Ae150-Ao512, Ae394-Ao615, and Ae356-Ao615). The aggression index was calculated as above, again

86 without knowledge of the intruder’s identity.

Behavioural Trials: Brood Retrieval

Another subset of the treated gynes were tested for their tendency to retrieve brood, as an indicator of a shift to a ‘worker-like phenotype’. A gyne was placed in an 8.5cm diameter petri dish along with a small amount of fungus from the gyne’s nest and 5-8 minor workers. Each gyne was left for 30 minutes to acclimatise, before a larva was placed in the dish some distance away from the fungus garden; only larvae with a length greater than 4 mm were used, so the minor workers would be unable to move the larvae. The position of the larvae was recorded two hours later, and the trial was considered successful if the larvae had been placed in the fungus garden. This was repeated for all three colonies, and an additional 20 trials were conducted without a gyne present, to ensure that it was indeed the gynes and not the workers that retrieved the larva; in none of the worker-only trials was a larva moved. After the behavioural trial, the gynes were ﬂash frozen in liquid nitrogen, and again the heads were stored at -80°C.

RNA Extraction and Gene Expression Quantiﬁcation

As the founding-queen heads that were stored on RNAlater each represented a di↵erent colony, RNA was extracted from individual heads; for all other samples RNA was extracted from pools of individuals according to caste and colony. For the larger castes (gynes, major and media workers) the heads of ﬁve individuals were pooled, whereas for the minor workers, 10 heads were pooled for extraction. Likewise, 5 gyne heads from the brood-retrieval trials were pooled according to treatment and colony. To ensure that the gene expression changes reﬂected the behavioural shift, treatment gynes were not selected randomly: for the wing-mutilated treatment, only individuals who successfully retrieved the larvae were used, whereas for the unmanipulated, and leg-mutilated treatments, only gynes that did not retrieve larvae were used.

87 All RNA was extracted using the RNEasy kit (QIAGEN), according to the manufacturer’s protocol. Extraction success was evaluated using the Nanodrop spectrophotometer, and integrity was checked using a 2% agarose gel. To obtain cDNA used in the qPCR, 500ng of RNA was reverse transcribed in a 10µl reaction containing 5.25µl RNA sample, 0.5µl SuperScript III (Invitrogen), 2µl 5X ﬁrst strand bu↵er, 1µl DNTP, 1µl DTT, 0.125µl

RNASin, and 0.125µl Primer Qt. RNa was heated to 65°Cfor3minutes,beforethereagents mixed. The thermal protocol consisted of: 42°Cfor60mins,50°Cfor10mins,and70°C for 15 mins. Following reverse transcription, the cDNA was treated with RNase H at 37°C for 20 minutes, to remove any residual RNA, before a ten-fold dilution in TE bu↵er.

Four primer pairs were designed using the A. echinatior genome (Nygaard et al., 2011), the two genes of interest Tachykinin and Tachykinin-receptor 99D (TacR99D), and two housekeeping genes Elongation factor 1- (EF1)andRibosomal Protein L18 (RPL18):

• Tachykinin F-CAA TGA GTT TTC AAG GGA TG • Tachykinin R-TCT ATT GCT CCT TCC TTG AT • TacR99D F-GTT GCA TGA ATA CTA GAT TCC • TacR99D R-TAC CAT TCC GCG ATA TTC TG • EF1 F-CCC ACA GTT ATT GCC AAA TCG • EF1 R-CCA CTG GGA CAA GTT TTG ATG • RPL18 F-TCC CCA AGT TGA CGG TAT G • RPL18 R-CCC TGC ATT AAG ACT GTA CG

The primers were designed to span an intron, as these are spliced from the mRNA after transcription– thereby preventing erroneous ampliﬁcation of genomic-DNA and ensuring more accurate quantiﬁcation of the mRNA.

The ecacy of the designed primers, and the success of the reverse-transcription, was determined using PCR: the 20µl reactions consisted of 10µl RedTaq polymerase, 1µl of each of the two primers (10µM), 7µl H2O, and 1µl of the cDNA template. The thermocycler protocol was: 94°C for 5 minutes, with 30 cycles of 94°Cfor20seconds,55°Cfor30seconds,

88 and 72°Cfor1minute,followedbyaﬁnalelongationof72°Cfor10minutes.PCRproducts were veriﬁed using 2% agarose gel.

Quantitative-PCR reactions were conducted on the Strategene Mx3005P system using SYBR-Green dye. Each reaction totalled 20µl:10µl System Ex Taq, 0.4µl of both the forward and reverse primers, 0.4µl ROX reference dye, and 2µl cDNA template; the remaining 6.8µl was made up with water. Five ﬁve-fold dilutions were used to construct a standard curve, in order to estimate the eciency of ampliﬁcation for each reaction: a new standard curve was constructed for each plate used. To prevent extrapolation from the standard curve, the reactions used to produce the curve had 5µl cDNA template and only

3.8µl.Thesamereactioncyclewasusedinallcases:95°Cfor2minutes,followedby40 cycles of 95°Cfor30seconds,55°Cfor30secondsand72°Cfor30seconds.Thereactions were followed by a dissociation curve, and any reactions with spurious peaks were removed from analysis; this only applied to the most dilute standard curve reactions, and therefore does not inﬂuence results. All reactions were conducted in triplicate.

Acommonfluorescencethresholdof0.0128dRNwasusedacrossallreactionstostan- dardise the Ct values; this was the highest fluorescence value returned by the MxPro software for any successful reaction. The ReadQPCR and NormQPCR packages were used to combine technical replicates and to calculate Ct values relative to the geometric mean of the two housekeeping genes (Perkins et al., 2012). The validity of EF1 and RPL18 as housekeeping genes was verified using the geNorm algorithm (Vandesompele et al., 2002). Although they were the only two candidate house-keeping genes that were tested, they are thought to be appropriate as they were more stable with respect to one another than the recommended stability cut-o↵(Vandesompele et al., 2002), (maximum M= 0.099, recommended-threshold= 0.15). Eciencies, from the standard curves, di↵ered between primer pairs and reactions, and were used to correct estimated template quantities by us-

Ct Ct ing [2.eciency] rather than simply 2 when calculating relative quantities – an eciency of 1 would represent a perfect reaction with a doubling of DNA each cycle. This

89 method assumes that the reference genes were ampliﬁed with equal eciency although this was not quite the case (EF1 = 100.8%, RPL18 = 95.5%), it is not thought to substantially alter results, given that the di↵erence is only slight, and transformation of these genes would e↵ect all genes and castes equally.

2.2 Results

Di↵erences Among Castes

Aggression Trials

The results of the behavioural trials are shown in figure 2.1. Using a general linear mixed model; with the caste of the host, and the identity of the opponent (nestmate or non- nestmate) as fixed explanatory variables, and host-colony as a random factor; all castes were found to be more aggressive towards non-nestmates than nestmates (least squared means, max p-value was for gynes, p= 0.015). The host caste significantly a↵ects aggression, when compared to a similar model without the host caste as a variable (parametric bootstrap test, 500 simulations, p=0.002): the major and media workers were found to be the most aggressive towards non-nestmates, while the gynes, minor workers and founding queens did not significantly di↵er in their response.

Caste Speciﬁc Expression Levels

The expression of tachykinin and TacR99D relative to the two housekeeping genes, across the four castes is shown in figure 2.2. Although we show the relative quantities in figure 2.2, as these are easier to interpret visually, these were not normally distributed and statistical tests were therefore conducted after log2 transformation. The expression levels of both Tachykinin and TacR99D relative to the housekeeping genes di↵ered significantly among

90 castes (ANOVA, Tac: [F(4,23) =42.71, p<0.0001], TacR99D: [F(4,25) =10.97, p<0.0001]). ATukey-Kramerpairwisecomparisonindicatedthat,forTachykinin,thefounding-queens’ expression is signiﬁcantly lower than all other castes, while the gynes also di↵er from the media and minor workers (p<0.05). For TacR99D,theminorworkershadhigherexpression than the gynes, major workers and founding-queens; the founding-queens also di↵ered from the major workers.

The relative expression levels of Tachykinin and TacR99D follow a similar pattern across the 5 castes, with the small workers having the highest expression, the founding queens the lowest, and the other castes being intermediate to this. This pattern is consistent with allometric expectations: a step-wise increase in expression in progressively smaller castes.

In order to explore whether the di↵erent castes exhibit di↵erences in expression of tachykinin and TacR99D independent of allometry, we explored the relationship between the expression levels of the two. These is shown in figure 2.3; lines were fitted using a standardised major axis (SMA) model II regression (Taskinen and Warton, 2011; Warton et al., 2006, 2012), and were found to have the same slope of 0.652 (2(4)=1.527, p=0.82), but to have di↵erent intercepts (W (4)=39.47, p<0.0001). The major workers were found to have the greatest intercept ( 0.103 0.596), and the founding-queens the lowest ( 0.727 ± ± 0.596). Again, statistics were carried out on log-transformed values. When the data are separated according to caste, the correlation between tachykinin and TacR99D became non-significant within each caste, the minimum p-value (p=0.06) was found for the minor workers. However, across all castes tachykinin increases proportionally with increasing TacR99D levels (p<0.0001, R2=0.71), interpreted here as a result of variation in the brain size of castes. That the major workers have the highest intercept suggests they have higher levels of tachykinin relative to TacR99D than we might expect based on the relationship observed in other castes.

91 Brain Allometry

Morphological correction also supports the conclusion that the major workers have higher tachykinin expression levels than the other castes. The observed patterns of allometry mirror those of the raw gene expression, as shown in figure 2.4b: the minor workers have the largest relative brain, and the gynes the smallest, despite the absolute brain size being much larger in the gyne (see figure 2.4a). Again the line is fitted using a SMA regression (Taskinen and Warton, 2011; Warton et al., 2012) (p<0.0001, R2=0.93). This suggests that the pattern of gene expression found is, at least in part, a result of allometric di↵erences among the castes tested and that we are justified in evaluating the relationship between the genes, rather then the expression levels of each gene individually.

As shown in figure 2.5, when estimates of relative brain-size are used to correct for the expression, all castes show a consistent pattern at the exclusion of tachykinin in the major workers – we find no significant correlation between the brain size and relative tachykinin expression (p=0.07, R2=0.79) when all four castes were used to calculate the regression line. However, this becomes significant if the major workers are considered separately (figure 2.5a, p=0.03, R2=0.998). The same is not true for TacR99D:thecorrelationbetween gene expression and relative brain size is significant when all four castes are considered together (figure 2.5b,p=0.006, R2=0.98), but is diminished when we consider the major workers separately (p=0.09, R2=0.97). The founding-queens were not included as, based on figures 2.2 and 2.3, they clearly di↵er from allometric expectations.

Gyne Manipulations

Aggression

Again, a general linear mixed model was used to explain di↵erences in the aggression of the di↵erent gyne treatments: treatment and opponent (nestmate vs non-nestmate) were

92 used as fixed variables, and host-colony as a random variable. Aggression indices for each treatment are shown in figure 2.6a. The treatment was found to a↵ect aggression, compared to a null model without the treatment variable (parametric bootstrap test, 500 simulations, p=0.006). No treatments were found to di↵er when challenged with a nestmate (p>0.05). Only the wingless gynes responded di↵erently to the identity of the intruder (least squared means, p=0.0001)– no other treatment showed a di↵erence in aggression between nestmate and non-nestmate. The wingless gynes were found to be significantly more aggressive to non-nestmates than both the leg-mutilated (least squared means, p=0.049) and the unmutilated gynes (p=0.0007).

Brood Retrieval

A final linear mixed model was constructed for the brood retrieval, with treatment as a fixed variable and the gyne’s colony as a random variable, using a binomial error distribution. The treatment was also found to a↵ect whether the gyne retrieved the larvae to the fungus garden, shown in figure 2.6b (parametric bootstrap test, 500 simulations, p=0.002), consistent with results found previously (Nehring et al., 2012). The wingless gynes were significantly more likely to move the larva than the leg-mutilated gynes (least squared means, p=0.0004) and the unmutilated gynes (p=0.0007); no di↵erence was found between the leg-mutilated and unmutilated gynes (p=0.85).

Gene Expression Following Manipulations

Wing-removal did not have a significant e↵ect on the expression of Tachykinin (paired t- tests, p>0.05). The di↵erence between Tachykinin expression in the wingless and unmutilated gynes appears consistent in all samples, and did tend to significance (p=0.077).TacR99 expression was found to decrease significantly between the unmutilated and wing-mutilated treatments (p=0.007); again it appears that the tachykinin receptor decreases by an approximately equal amount in all treatments. However, in all three treatments, the maximum expression found was lower than the minimum observed in the untreated gynes from the

93 previous section; the di↵erences observed among the di↵erent gyne-treatments consequently seem likely to result from biological or experimental variation, rather than from the treatment.

2.3 Discussion

The aggression results (ﬁgure 2.1) agree, for the most part, with results that have been found previously (Larsen et al., 2014): the major workers were found to be more aggressive than the minor workers. Unlike Larsen et al., however, we found no di↵erence in aggression between the major and media workers. This may be a result of the di↵erence in the experimental arenas used; some fungus was present in the arena used here, so the petri dishes were perhaps more convincing as ‘nests’, although this could also reﬂect the much smaller sample sizes used in the behavioural trials in our present study. As found previously, the gynes are generally passive towards non-nestmates, with very few individuals showing any aggression.

Why we found the minor workers to be significantly less aggressive than the major and media workers is unclear, as they have previously been shown to be equally aggressive as the media workers towards allospecific intruders (Larsen et al., 2014; Norman et al., 2014). Again, this is likely a result of di↵erences in experimental procedure. The smaller workers would often enter the interstices of the fungus, perhaps reflecting their role in nursing of brood and maintenance of the fungus garden rather than in colony defence (Hart et al., 2002) – stimuli that were not present in the previous trials (Larsen et al., 2014; Norman et al., 2014).

There does appear to be an increase in aggression from the gynes to the founding- queens, although this was not found to be signiﬁcant here. This is perhaps not surprising–

94 the queens stand to lose much more than any of the other castes if they are injured in aconﬂict,soshouldbemorewaryofinjury.Thefounding-queensdidshowqualitatively di↵erent behaviours to the gynes however; they would often pursue and lunge at intruders, while the gynes only showed aggression after being attacked by the intruder. It seems likely that the insigniﬁcance is simply a result of the three outlying gynes.

The relationship between the aggression di↵erences among castes and the expression patterns observed (figure 2.2) are dicult to reconcile, but are in line with the expectations from allometric scaling (figure 2.4). We find, as many have previously, that the smaller ants have the largest relative brain size (Rensch, 1948; Seid et al., 2011; Wilson, 1953). The two methods for correction used here, a statistical and a morphological approach, both agree that the major workers have the highest expression of tachykinin –moresothananyofthe other castes.

It has previously been proposed that the major workers are more motivated to attack, and that the motivation does not di↵er between the mediae and minors (Larsen et al., 2014). The regression-based correction agrees with this: the major workers have the highest relative levels of tachykinin,whilethemediaandminorworkersareindistinguishable, but perhaps higher than the gynes (ﬁgure 2.3).The morphological correction however (ﬁg- ure 2.5a) suggests that only the major workers di↵er from the allometric expectations – diverging from the linear relationship between brain size and gene expression that appears to apply to the other castes.

The founding-queens appear to disagree with the potential role of tachykinin in aggressive motivation. Their tachykinin levels are lower than all other castes, and TacR99D levels also appear to be reduced, in contrast to their heightened aggression. The aggression that accompanies the founding of a colony is only a transient phase and the queen will soon switch to a much more passive state, so it is possible that the queen’s brain reﬂects her life-time ahead as an egg-laying queen. That tachykinin is higher in the gynes than the

95 queens could suggest a bet-hedging strategy: while a virgin gyne remains in the colony, there remains the possibility that she may adopt a worker-like role (Nehring et al., 2012), so it appears she is only committing developmentally to a queen-like brain after mating and nest-founding.

Similarly, the tachykinin levels across the gyne manipulations do not appear to be consistent with predictions. Following wing-removal, the gynes did switch to a more aggressive worker-like phenotype (ﬁgure 2.6), in agreement with previous studies (Nehring et al., 2012), but they do not show a concomitant increase in tachykinin levels, and TacR99D expression decreases, contrary to expectations (ﬁgure 2.7b). It is possible that the small sample size here means that there are consistent di↵erences of small e↵ect that we have missed.

Thus it appears that, at least in the reproductive caste, there is an uncoupling of aggression and tachykinin:therecanbeanincreaseinaggressionwithoutaconcomitantincrease in tachykinin (the wingless gynes), and high levels of tachykinin are not necessary for aggression (the founding-queens). It is possible, therefore, that the aggressive phenotypes of workers are controlled by tachykinin,butthatotherregulatorysystemscontrolaggression in the reproductive caste. Morphologically distinct worker castes evolved much later than nest-founding and defence, so it is possible that the aggression of the reproductive caste are controlled by a distinct pathway from that in the workers, and that tachykinin was later coopted for behavioural caste di↵erentiation. To this end, it would be interesting to evaluate the spatial distribution of tachykinin-expressing neurons among the di↵erent castes, to determine if, as in Asahina et al. (2014), tachykinin has qualitatively di↵erent e↵ects in the brains of di↵erent castes. No di↵erences have been observed in spatial expression patterns in the honeybee (Takeuchi et al., 2004),

We currently do not know how many tachykinin-related proteins are produced from the Acromyrmex-tachykinin gene, but there may be many: 15 have been identiﬁed in the brain of Periplaneta americana (the American Cockroach) (Neupert et al., 2012). Tachykinin

96 likely inﬂuences many physiological and behavioural traits, as it appears to do in other species (N¨assel, 1999). Tachykinin may be responsible di↵erences in aggressive motivation, as we hypothesised here, but any di↵erences responsible for changes in aggression are masked by changes a↵ecting other behaviours.

Tachykinin is often also implicated in olfactory processing, both in the pattern of expression (Fusca et al., 2015) and from manipulative studies (Ignell et al., 2009; Winther et al., 2006), so could inﬂuence many traits besides nest defence. The attine ants have a huge array of olfactory glomeruli; although data are not available for A. echinatior,seven of its congenerics have 369-477 glomeruli, compared to 43 in Drosophila and 164 in Apis mellifera (Kelber et al., 2009). There is huge potential for tachykinin-mediated olfactory processing to a↵ect many behaviours, and there are a number of di↵erences in caste behaviour that could be implicated. For example, the major workers are better able to recognise non-nestmates with more similar chemical proﬁles (Larsen et al., 2014), and are more likely to reject a foreign strain of the symbiotic fungus (Ivens et al., 2009), whereas the smaller workers are more likely to show aggression towards nestmates contaminated with waste (Waddington and Hughes, 2010). Similarly, di↵erent castes of the closely related genus Atta di↵er in their sensitivity to components of trail pheromones (Kleineidam et al., 2007)– it is possible that a similar di↵erence could be present in Acromyrmex,asonlythe major workers forage (Kooij et al., 2014).

Further, tachykinin appears to be involved in locomotion (Winther et al., 2006) and spatial orientation (Kahsai et al., 2010) in Drosophila,andisthoughttobedi↵erentially expressed between forager and nurse bees (Takeuchi et al., 2004); all of which suggest apotentiallyimportantroleinforagingbehaviours.Thehigherlevelsoftachykinin we ﬁnd here could be seen as consistent with a foraging phenotype. It is therefore worth exploring expression changes in tachykinin with respect to the age-dependent polyethism in Acromyrmex.Muchlikehoneybeeworkers,Acromyrmex subterraneus brunneus major workers tend to stay in the nest while young, before switching to foraging when older

97 (Camargo et al., 2007). The workers selected in our present study were chosen exclusively from outside the nest, perhaps a di↵erent pattern would be observed with younger workers.

Along these lines, it is possible that foraging and aggression are neurologically linked, potentially interacting with tachykinin.Theforager gene, mentioned in the introduction, encodes a cGMP-dependent protein kinase (PKG). PKG-activity is known to correlate with aggression in the workers of Pheidole pallidula (Lucas and Sokolowski, 2009a; Lucas et al., 2010a); higher PKG activity is observed in the brains of in the aggressive major workers, than in those of foraging minor workers (Lucas et al., 2010a). Tachykinin acts through G- protein coupled receptors, and could therefore inﬂuence cGMP levels in the cytosol of the neurons that express the receptor (Guard and Watson, 1991), with tachykinin potentially acting upstream of forager. However, the founding-queens provide a diculty for this interpretation, as they also forage during colony foundation (Fern´andez-Mar´ın et al., 2004).

In sum, tachykinin and its receptor could have a significant role in the behavioural di↵erentiation of the worker castes of A. echinatior and other social insects. It is possible that tachykinin is responsible for the heightened aggression of the major workers, but this does not appear to be the case in the reproductive castes, neither in the founding-queens nor the wingless gynes – suggesting either that they use a di↵erent pathway, or that tachykinin influences other behavioural phenotypes, of which aggression may be only one of many. To refine our understanding of the role that tachykinin may have in the division of labour, an estimate of the number of tachykinin related peptides present in the Acromyrmex brain are needed. It would be useful to explore the spatial distribution of expression across, and within, castes– particularly among unmated, mated and mature queens, and between winged and wingless gynes. Expression should also be explored with respect to the age- dependent polyethism of the major workers (Camargo et al., 2007), as has often been conducted in honeybees (Oldroyd and Thompson, 2006), but so far appears to have been neglected in ants with morphological castes. Finally, it would be interesting to see if the gynes of Atta have heightened expression of these genes relative to the mated queens, as

98 worker-like gynes are not known in this genus (Nehring et al., 2012).

Acknowledgments

The authors would like to acknowledge the Smithsonian Tropical Research Institute for the use of their facilities and the collection of samples.

99 Figure 2.1: Aggression of A. echinatior Castes

A Nestmate B Non−Nestmate 2.0 [b] [b]

[a] 1.5 [a] x e

1.0 Aggression Ind

0.5

[a] NA 0.0 21 21 20 18 19 20 19 19 11

Gyne Major Media Minor Gyne Major Media Minor

ounding−Queen ounding−Queen F Caste F

Aggression indices for 3 worker castes (major, media and minor), and 2 life-stages of the reproductive caste (gynes and founding-queens) of A. echinatior. All castes attacked non- nestmates (right) more than nestmates (left), with the major and media workers the most aggressive. Letters indicate signiﬁcantly di↵erent pairs (Tukey-Kramer, p<0.05), numbers underneath each box indicate sample size. There are no data for founding-queens challenged with nestmates (NA), as they do not yet have nestmates.

100 Figure 2.2: Expression levels of Tachykinin and Tachykinin-Receptor 99D

Tachykinin TacR99D

0.100 [a,b] [b] [b] 0.100

] [c] ] (−dCt) [a,c] (−dCt)

0.050 101 0.050 [a]

e Quantity [2.Efficiency [a,b] v e Quantity [2.Efficiency [c] v [a,b] [b] Relati Relati

0.000 0.000 n=3 n=5 n=6 n=6 n=7 n=3 n=5 n=6 n=6 n=7 Gyne Major Media Minor Founding Queen Gyne Major Media Minor Founding Queen Caste Caste

(a) Quantity of Tachykinin expression relative to EF1 and (b) Quantity of Tachykinin-Receptor 99D expression relative RPL18. Letters indicate signiﬁcantly di↵erent pairs (Tukey- to EF1 and RPL18. Letters indicate signiﬁcantly di↵erent Kramer, p<0.05), sample sizes are indicated underneath each pairs (Tukey-Kramer, p<0.05), sample sizes are indicated un- box. derneath each box. Figure 2.3: Relationship Between Tachykinin and Tachykinin-Receptor 99D Expression

0.10

[b,c]

[a,b,c] [c] ykinin Quantity h [b] ac T e v Relati

0.01 [a]

Caste Gyne Major Media Minor Founding Queen

0.01 Relative TacR99D Quantity 0.10

The relationship between tachykinin and TacR99D expression. Lines were ﬁtted using standardised major axis, and were found to have the same slope (p=0.8), but di↵ering intercepts: letters indicate those intercepts that di↵ered signiﬁcantly (p<0.05). Note that the axes are logarithmic.

102 Figure 2.4: Brain Allometry of A. echinatior Castes

1.0

[b] 0.20 eight)

W [c] eight (mg) eight/ Head W 0.15 W ain r 103 B ain r [a] e (B z ain Si r 0.10 [a] e B

0.1 Caste v Gyne Major

p<0.0001 Media Relati R-squared = 0.93 Minor

1 Head Weight (mg) 10 0.05 n=9 12 11 5 Gyne Major Media Minor (a) Brain weight and head weight of A. echinatior individu- Caste als. Note that the axes are logarithmic, line ﬁtted using stan- 2 dardised major axis [p<0.0001, R =0.93, log10(Brain)=0.59 (b) The relative brain sizes of each worker caste, letters indicate log (Head) 0.84]. · signiﬁcantly di↵erent pairs (Tukey-Kramer, p<0.005). 10 Figure 2.5: Brain-Size Corrected Expression Levels

0.06

0.08

ykinin Quantity 0.06 0.04 h ac T acR99D Quantity e T v e v 104 Relati Relati 0.04

Caste 0.02 Caste Gyne Gyne Major Major Media Media Minor 0.02 Minor

0.10 0.15 0.20 0.10 0.15 0.20 Relative Brain Size Relative Brain Size (a) Relative quantity of Tachykinin in each caste with respect to brain size: a linear relationship between brain size and (b) Relative quantity of Tachykinin-Receptor 99D in each caste tachykinin is found only when the major workers, who have with respect to brain size: a linear relationship between brain higher than expected expression levels, are excluded (p=0.028, size and TacR99D is found (p=0.006, R2 =0.98). Error bars R2 =0.998). Error bars show means SE. show means SE. ± ± Figure 2.6: Worker-like Behaviour of Wingless Virgin Queens

A Nestmate B Non−nestmate 28 17 26 21 26 36 0.6 *** 2.0 *** *** *

1.5 ving Brood x 0.4 e e i r

1.0 105 Aggression Ind tion of Gynes Ret ns r 0.2

0.5 Propo

n=29 n=31 n=62

0.0 0.0

Unmutilated Leg−mutilated Wingless Unmutilated Leg−mutilated Wingless Unmutilated Leg−mutilated Wingless Treatment Treatment (a) Wingless gynes increase aggression relative to gynes with (b) Wingless gynes are more likely to retrieve larvae than un- a leg removed, or unmanipulated gynes. Numbers above each treated gynes, or gynes with a leg removed. The numbers column refer to the sample size, (*p<0.05, ***p<0.0001) within each bar represent the sample size, (***p<0.0001). Figure 2.7: Expression of Tac and TacR99D After Wing-Clipping

B: TacR99D A: Tachykinin

0.010 0.016 *

0.014

0.008

0.012 106 Relative Tac Quantity Relative TacR99D Quantity Colony 0.006 150 0.010 356 394

Leg-mutilated Unmutiliated Wingless Leg-mutilated Unmutilated Wingless Treatment Treatment (b) Expression of TacR99D following Wing or Leg removal (a) Expression of Tachykinin following Wing or Leg removal in in gynes, the wingless gynes and the unmutilated gynes were gynes, no treatments were found to be signiﬁcant. found to di↵er signiﬁcantly (paired t-test, p=0.008) Bibliography

Y. Ben-Shahar. The foraging gene, behavioral plasticity, and honeybee division of labor. Journal of Comparative Physiology A,191(11):987–994,2005.

Y. Ben-Shahar, N. L. Dudek, and G. E. Robinson. Phenotypic deconstruction reveals involvement of manganese transporter malvolio in honey bee division of labor. Journal of experimental biology,207(19):3281–3288,2004.

S. N. Beshers and J. H. Fewell. Models of division of labor in social insects. Annual review of entomology, 46(1):413–440, 2001. doi: 10.1146/annurev.ento.46.1.413. URL http://www.annualreviews.org/doi/abs/10.1146/annurev.ento.46.1.413.

S. N. Beshers, G. E. Robinson, and J. E. Mittenthal. Response thresholds and division of labor in insect colonies. In Information processing in social insects,pages115–139. Springer, 1999.

D. T. Blumstein and J. C. Daniel. Quantifying behavior the JWatcher way, 2007. URL http://scholar.google.com/scholar?q=related:D4S_YOC7u28J: scholar.google.com/&hl=en&oe=ASCII&as_sdt=0,5.

107 J. J. Boomsma. Lifetime monogamy and the evolution of eusociality. Philosophical transactions of the Royal Society of London. Series B, Biological sciences,364(1533):3191–3207, 2009. doi: 10.1098/rstb.2009.0101. URL http://rstb.royalsocietypublishing.org/ cgi/doi/10.1098/rstb.2009.0101.

D. E. Champagne and J. Ribeiro. Sialokinin i and ii: vasodilatory tachykinins from the yellow fever mosquito aedes aegypti. Proceedings of the National Academy of Sciences, 91(1):138–142, 1994.

C. Detrain and J. M. Pasteels. Caste Di↵erences in Behavioral Thresholds as a Basis for Polyethism During Food Recruitment in the Ant, Pheidole-Pallidula (Nyl) (Hy- menoptera, Myrmicinae). Journal of Insect Behavior,4(2):157–176,Mar.1991.doi: 10.1007/BF01054609. URL http://link.springer.com/10.1007/BF01054609.

C. Detrain and J. M. Pasteels. Caste Polyethism and Collective Defense in the Ant, Pheidole-Pallidula - the Outcome of Quantitative Di↵erences in Recruitment. Behav- ioral Ecology and Sociobiology, 29(6):405–412, Feb. 1992. doi: 10.1007/BF00170170. URL http://link.springer.com/10.1007/BF00170170.

N. Duong and A. Dornhaus. Ventilation response thresholds do not change with age or self- reinforcement in workers of the bumble bee bombus impatiens. 59(1):25–32, 2012. doi: 10.1007/s00040-011-0183-9. URL http://dx.doi.org/10.1007/s00040-011-0183-9.

108 H. Fern´andez-Mar´ın, J. Zimmerman, and W. Wcislo. Ecological traits and evolutionary sequence of nest establishment in fungus-growing ants (hymenoptera, formicidae, attini). Biological Journal of the Linnean Society,81(1):39–48,2004.

D. Fusca, J. Schachtner, and P. Kloppenburg. Colocalization of allatotropin and tachykinin- related peptides with classical transmitters in physiologically distinct subtypes of olfactory local interneurons in the cockroach (periplaneta americana). Journal of Compara- tive Neurology, 523(10):1569–1586, 2015. ISSN 1096-9861. doi: 10.1002/cne.23757. URL http://dx.doi.org/10.1002/cne.23757.

S. Guard and S. P. Watson. Tachykinin receptor types: Classiﬁcation and membrane signalling mechanisms. Neurochemistry International,18(2):149–165,1991.doi:http: //dx.doi.org/10.1016/0197-0186(91)90180-L. URL http://www.sciencedirect.com/ science/article/pii/019701869190180L.

F. J. Guerrieri, V. Nehring, C. G. Jørgensen, J. Nielsen, C. G. Galizia, and P. d’Ettorre. Ants recognize foes and not friends. Proceedings of the Royal Society of London B: Biological Sciences,pagesrspb–2008,2009.

A. G. Hart, C. Anderson, and F. L. Ratnieks. Task partitioning in leafcutting ants. acta ethologica, 5(1):1–11, Sept. 2002. doi: 10.1007/s10211-002-0062-5. URL http://link. springer.com/article/10.1007/s10211-002-0062-5.

M. Heisenberg. What do the mushroom bodies do for the insect brain? an introduction. Learning & Memory,5(1):1–10,1998.

C. M. Heuer, M. Kollmann, M. Binzer, and J. Schachtner. Neuropeptides in insect mushroom bodies. Arthropod Struct Dev,41(3):199–226,May2012.doi:10.1016/j.asd.2012. 02.005.

109 R. Ignell, C. M. Root, R. T. Birse, J. W. Wang, D. R. N¨assel, and A.˚ M. Winther. Presy- naptic peptidergic modulation of olfactory receptor neurons in drosophila. Proceedings of the National Academy of Sciences,106(31):13070–13075,2009.

J. M. Jandt and A. Dornhaus. Bumblebee response thresholds and body size: does worker diversity increase colony performance? Animal Behaviour,87:97–106,2014.ISSN 0003-3472. doi: http://dx.doi.org/10.1016/j.anbehav.2013.10.017. URL http://www. sciencedirect.com/science/article/pii/S0003347213004740.

H. Jiang, A. Lkhagva, I. Daubnerova, H.-S. Chae, L. Simo, S.-H. Jung, Y.-K. Yoon, N.-R. Lee, J. Y. Seong, D. Zitnan, Y. Park, and Y.-J. Kim. Natalisin, a tachykinin-like signaling system, regulates sexual activity and fecundity in insects. Proceedings of the National Academy of Sciences, 110(37):E3526–E3534, 2013. doi: 10.1073/pnas.1310676110. URL http://www.pnas.org/content/110/37/E3526.full.

J. C. Jones, P. Nanork, and B. P. Oldroyd. The role of genetic diversity in nest cooling in a wild honey bee, apis ﬂorea. Journal of Comparative Physiology A,193(2):159–165,2007.

L. Kahsai, J.-R. Martin, and A.˚ M. Winther. Neuropeptides in the drosophila central complex in modulation of locomotor behavior. The Journal of experimental biology,213 (13):2256–2265, 2010.

110 A. Kanda, E. Iwakoshi-Ukena, K. Takuwa-Kuroda, and H. Minakata. Isolation and characterization of novel tachykinins from the posterior salivary gland of the common octopus octopus vulgaris. Peptides, 24(1):35–43, 1 2003. doi: http://dx.doi. org/10.1016/S0196-9781(02)00274-7. URL http://www.sciencedirect.com/science/ article/pii/S0196978102002747.

C. Kelber, W. R¨ossler, F. Roces, and C. J. Kleineidam. The antennal lobes of fungus- growing ants (attini): neuroanatomical traits and evolutionary trends. Brain Behav Evol, 73(4):273–84, 2009. doi: 10.1159/000230672.

C. J. Kleineidam, W. R¨ossler, B. H¨olldobler, and F. Roces. Perceptual di↵erences in trail- following leaf-cutting ants relate to body size. J Insect Physiol,53(12):1233–41,Dec 2007. doi: 10.1016/j.jinsphys.2007.06.015.

P. W. Kooij, J. Liberti, K. Giampoudakis, M. Schiøtt, and J. J. Boomsma. Di↵erences in forage-acquisition and fungal enzyme activity contribute to niche segregation in pana- manian leaf-cutting ants. PLoS ONE,9(4):e94284,042014.doi:10.1371/journal.pone. 0094284. URL http://dx.doi.org/10.1371%2Fjournal.pone.0094284.

R. Libbrecht, P. R. Oxley, D. Kronauer, and L. Keller. Ant genomics sheds light on the molecular regulation of social organization. Genome Biol,14:212,2013.

C. Lucas and M. B. Sokolowski. Molecular basis for changes in behavioral state in ant social behaviors. Proceedings of the National Academy of Sciences,106(15):6351–6356, Apr. 2009a. doi: 10.1073/pnas.0809463106. URL http://www.pnas.org/content/106/ 15/6351.full.

111 C. Lucas and M. B. Sokolowski. Molecular basis for changes in behavioral state in ant social behaviors. Proceedings of the National Academy of Sciences,106(15):6351–6356,2009b.

C. Lucas, B. N. Hughson, and M. B. Sokolowski. Job switching in ants: Role of a kinase. Communicative & integrative biology, 3(1):6–8, Jan. 2010a. URL http://eutils.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi?dbfrom=pubmed&id=

20539773&retmode=ref&cmd=prlinks.

C. Lucas, B. N. Hughson, and M. B. Sokolowski. Job switching in ants: role of a kinase. Communicative & integrative biology,3(1):6–8,2010b.

C. A. Maggi. Principles of tachykininergic co-transmission in the peripheral and enteric nervous system. Regulatory Peptides,93(1-3):53–64,2000.doi:10. 1016/S0167-0115(00)00177-4. URL http://linkinghub.elsevier.com/retrieve/ pii/S0167011500001774.

P. Mobbs. The brain of the honeybee apis mellifera. i. the connections and spatial organization of the mushroom bodies. Philosophical Transactions of the Royal Society of London B: Biological Sciences,298(1091):309–354,1982.

A. P. Modlmeier and S. Foitzik. Productivity increases with variation in aggression among group members in Temnothorax ants. Behavioral Ecology,22(5):1026–1032,2011.doi:10. 1093/beheco/arr086. URL http://beheco.oxfordjournals.org/content/22/5/1026. full.

M. Myerscough and B. Oldroyd. Simulation models of the role of genetic variability in social insect task allocation. Insectes Sociaux,51(2):146–152,2004.

D. N¨assel and U. Homberg. Neuropeptides in interneurons of the insect brain. 326 (1):1–24, 2006. doi: 10.1007/s00441-006-0210-8. URL http://dx.doi.org/10.1007/ s00441-006-0210-8.

112 D. R. N¨assel. Tachykinin-related peptides in invertebrates: a review. Peptides,20(1): 141–158, 1999.

V. Nehring, J. J. Boomsma, and P. d’Ettorre. Wingless virgin queens assume helper roles in Acromyrmex leaf-cutting ants. Current Biology,22(17):R671–R673,Sept.2012. doi: 10.1016/j.cub.2012.06.038. URL http://linkinghub.elsevier.com/retrieve/ pii/S0960982212007142.

S. Neupert, D. Fusca, J. Schachtner, P. Kloppenburg, and R. Predel. Toward a single- cell-based analysis of neuropeptide expression in periplaneta americana antennal lobe neurons. Journal of comparative neurology,520(4):694–716,2012.

V. C. Norman, M. Hopp´e, and W. O. H. Hughes. Old and wise but not size: factors a↵ecting threat response behaviour and nestmate recognition in Acromyrmex echinatior leaf-cutting ants. Insectes Sociaux, 61(3):289–296, Aug. 2014. doi: 10.1007/s00040-014-0355-5. URL http://link.springer.com/article/10.1007/ s00040-014-0355-5/fulltext.html.

S. O’Donnell and R. L. Foster. Thresholds of response in nest thermoregulation by worker bumble bees, bombus bifarius nearcticus (hymenoptera: Apidae). Ethology,107(5):387– 399, 2001.

B. P. Oldroyd and J. H. Fewell. Genetic diversity promotes homeostasis in insect colonies. Trends Ecol Evol, 22(8):408–13, Aug 2007. doi: 10.1016/j.tree.2007.06.001.

113 B. P. Oldroyd and G. J. Thompson. Behavioural genetics of the honey bee apis mellifera. Advances in insect physiology,33:1–49,2006.

T. Pankiw and R. E. Page. Response thresholds to sucrose predict foraging division of labor in honeybees. 47(4):265–267, 2000. doi: 10.1007/s002650050664. URL http: //dx.doi.org/10.1007/s002650050664.

H. J. Pavlou, M. C. Neville, and S. F. Goodwin. Aggression: Tachykinin Is All the Rage. Current Biology, 24(6):R243–R244, Mar. 2014. doi: 10.1016/j.cub.2014.02.017. URL http://linkinghub.elsevier.com/retrieve/pii/S0960982214001559.

J. N. Pennefather, A. Lecci, M. L. Candenas, E. Patak, F. M. Pinto, and C. A. Maggi. Tachykinins and tachykinin receptors: a growing family. Life sciences,74(12):1445–1463, 2004.

J. R. Perkins, J. M. Dawes, S. B. McMahon, D. L. Bennett, C. Orengo, and M. Kohl. Read- qPCR and NormqPCR: R packages for the reading, quality checking and normalisation of RT-qPCR quantiﬁcation cycle (Cq) data. BMC Genomics, 13(1):296, July 2012. doi: 10.1186/1471-2164-13-296. URL http://www.biomedcentral.com/1471-2164/13/296.

J. Poels, R. T. Birse, R. J. Nachman, J. Fichna, A. Janecka, J. V. Broeck, and D. R. Nassel. Characterization and distribution of NKD, a receptor for Drosophila tachykinin-related peptide 6. Peptides,30(3):545–556,Mar.2009.doi:10.1016/j.peptides.2008.10.012. URL http://gateway.webofknowledge.com/gateway/Gateway.cgi?GWVersion= 2&SrcAuth=mekentosj&SrcApp=Papers&DestLinkType=FullRecord&DestApp=WOS&

KeyUT=000264791300014.

B. Rensch. Histological changes correlated with evolutionary changes of body size. Evolu- tion,pages218–230,1948.

114 T. R. Schultz and S. G. Brady. Major evolutionary transitions in ant agriculture. Proceedings of the National Academy of Sciences of the United States of America,105(14):5435–5440, 04 2008. doi: 10.1073/pnas.0711024105. URL http://www.ncbi.nlm.nih.gov/pmc/ articles/PMC2291119/.

D. J. Schulz, A. B. Barron, and G. E. Robinson. A role for octopamine in honey bee division of labor. Brain, behavior and evolution,60(6):350–359,2002.

M. A. Seid, A. Castillo, and W. T. Wcislo. The Allometry of Brain Miniaturization in Ants. Brain Behavior and Evolution, 77(1):5–13, 2011. doi: 10.1159/000322530. URL http://www.karger.com/Article/FullText/322530.

C. Severini, G. Improta, G. Falconieri-Erspamer, S. Salvadori, and V. Erspamer. The tachykinin peptide family. Pharmacological reviews,54(2):285–322,2002.

W. Song, J. A. Veenstra, and N. Perrimon. Control of lipid metabolism by tachykinin in drosophila. Cell Rep,9(1):40–7,Oct2014.doi:10.1016/j.celrep.2014.08.060.

H. Takeuchi, A. Yasuda, Y. Yasuda-Kamatani, T. Kubo, and T. Nakajima. Identiﬁcation of a tachykinin-related neuropeptide from the honeybee brain using direct maldi-tof ms and its gene expression in worker, queen and drone heads. Insect Molecular Biology, 12(3):291–298, 2003. ISSN 1365-2583. doi: 10.1046/j.1365-2583.2003.00414.x. URL http://dx.doi.org/10.1046/j.1365-2583.2003.00414.x.

H. Takeuchi, A. Yasuda, Y. Yasuda-Kamatani, M. Sawata, Y. Matsuo, A. Kato, A. Tsuji- moto, T. Nakajima, and T. Kubo. Prepro-tachykinin gene expression in the brain of the honeybee apis mellifera. 316(2):281–293, 2004. doi: 10.1007/s00441-004-0865-y. URL http://dx.doi.org/10.1007/s00441-004-0865-y.

S. Taskinen and D. I. Warton. Robust estimation and inference for bivariate line-ﬁtting in allometry. Biom J, 53(4):652–72, Jul 2011. doi: 10.1002/bimj.201000018.

115 C. Trivedi, X. Shan, Y.-C. L. Tung, D. Kabra, J. Holland, S. Amburgy, K. Heppner, H. Kirchner, G. S. Yeo, and D. Perez-Tilve. Tachykinin-1 in the central nervous system regulates adiposity in rodents. Endocrinology,156(5):1714–1723,2015.

T. Van Loy, H. P. Vandersmissen, J. Poels, M. B. Van Hiel, H. Verlinden, and J. Van- den Broeck. Tachykinin-related peptides and their receptors in invertebrates: a current view. Peptides,31(3):520–4,Mar2010.doi:10.1016/j.peptides.2009.09.023.

J. Vandesompele, K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De Paepe, and F. Speleman. Accurate normalization of real-time quantitative rt-pcr data by geometric averaging of multiple internal control genes. Genome biology,3(7):research0034,2002.

S. J. Waddington and W. O. H. Hughes. Waste management in the leaf-cutting ant Acromyrmex echinatior: the role of worker size, age and plasticity. Behavioral Ecology and Sociobiology, 64(8):1219–1228, Aug. 2010. doi: 10.2307/40792928?ref=no-x-route: 1a6061f2db64984ab594c9c7c76504f2.

D. I. Warton, I. J. Wright, D. S. Falster, and M. Westoby. Bivariate line-ﬁtting methods for allometry. Biol Rev Camb Philos Soc,81(2):259–91,May2006.doi: 10.1017/S1464793106007007.

D. I. Warton, R. A. Duursma, D. S. Falster, and S. Taskinen. smatr 3–an r package for estimation and inference about allometric lines. Methods in Ecology and Evolution,3(2): 257–259, 2012.

N. A. Weber. The fungus-culturing behavior of ants. American Zoologist,12(3):577–587, 1972.

E. O. Wilson. The origin and evolution of polymorphism in ants. Quarterly Review of Biology,pages136–156,1953.

E. O. Wilson et al. The insect societies. The insect societies.,1971.

116 A.˜ M. E. Winther, A. Acebes, and A. FerrAs.˜ Tachykinin-related peptides modulate odor perception and locomotor activity in drosophila. Molecular and Cellular Neuroscience, 31(3):399–406, 3 2006. doi: http://dx.doi.org/10.1016/j.mcn.2005.10.010. URL http: //www.sciencedirect.com/science/article/pii/S1044743105002538.

117

Chapter 3

Horizontal Transfer of a Leaf-Cutting Ant’s Fungal Symbiont In Situ

Figure 3.1: An Acromyrmex echinatior queen with her nascent fungus garden

119 Abstract

The leaf-cutting ant Acromymex echinatior lives in an obligate symbiosis with a fungus on which it is nutritionally dependent. The fungal symbiont is vertically transmitted through virgin queens as they leave their natal nest to mate and initiate their own colony. The fungus and ants also take measures to ensure that their fungal crop is not contaminated by foreign strains. Despite this, phylogenetic analyses indicate that there is some degree of horizontal symbiont transmission among ant lineages. It has been demonstrated that aqueencanacceptnovelfungalstrainsunderlaboratoryconditionsintheearlystagesof colony founding. We tested if this could occur outside of the laboratory. We removed the fungus gardens of a number of founding-queens, as well as removing queens from other nests,and tracked the movement of the ant and the fungi. Results indicate that horizontal transmission does occur, at least through queens switching nests, and that fungus-stealing may also occur and be relatively common. We await microsatellite data to conﬁrm this.

120 The fungus-growing attine ants are one of the few taxa, outside of humans, that cultivate acropforsustenance:theyliveinaremarkablenutritionalsymbiosiswithafungus,that they maintain with material they forage, and on which they are completely dependent. Fungus-growing evolved roughly 50 million years ago in the neotropics, and the attines have since diversified into over 230 species (Schultz and Brady, 2008). The lower attines cultivate fungal strains that are closely related to those found free-living, while the fungus gardens of the more highly derive leaf-cutting genera (Atta and Acromyrmex)areonly found in association with ants. The leaf-cutting ants and their fungal symbionts have a long history of coevolution, each showing adaptations to its symbiotic life-history. The fungus has evolved specialised enzyme expression profiles in order to break down the fresh leaf-matter the ants provide it with (De Fine Licht and Boomsma, 2010; Schiøtt et al., 2010), as well as nutritionally-rich hyphal structures (gongylidia) upon which the ants predominantly feed (Quinlan and Cherrett, 1979). The fungus is vertically transmitted; as avirginAcromyrmex echinatior leaves her natal nest to mate, she carries a small pellet of fungal mycelia in her infrabuccal pocket. Upon mating and shedding her wings, the queen digs a small chamber and hangs her small fungal pellet on a thin root (Fernández-Mar´ın et al., 2004).

Vertical transmission acts to stabilise mutualistic interactions such as this by ensuring high partner-fidelity feedback (Foster and Wenseleers, 2006); this occurs in two ways. First, strict vertical transmission aligns the reproductive interests of the host and symbiont – with complete vertical transmission, the only means a symbiont has of increasing its own fitness is to increase the fitness of the host (Foster and Wenseleers, 2006). Where there is a possibility of horizontal transmission, a symbiont may be selected to show a degree of virulence if it facilitates its increase in a population of hosts (Frank, 1996a; Herre et al., 1999).

Second, the symbiotic community is initiated from a small propagule, ensuring that relatedness within this community is very high. As a consequence, the beneﬁts of cooperat- ing (or the cost of cheating) will fall predominantly on relatives, removing any incentive to

121 cheat (Foster and Wenseleers, 2006). Were relatedness to drop within the pool of symbionts, the scale of competition would shift from among host-mutualist-partnerships to within the pool of symbionts itself (Frank, 1996a,b). This shift can create competitive interactions between symbionts that are deleterious for the host, and would select for mechanisms in the host to suppress this (Frank, 1996a). In the attine system; the fungus garden appears to be clonal in mature colonies. A number of mechanisms appear to be responsible for this. Unrelated fungal strains often show incompatibility reactions towards one another, decreasing colony productivity; as such, the ants will recognise and remove foreign fungal strains (Ivens et al., 2009; Viana et al., 2001). The fungal symbiont also ensures it maintains a monopoly within the colony by priming the ants’ fecal droplets to reject alien fungi; the fecal droplets harm unrelated strains in proportion with the genetic distance between the two fungi, an e↵ect that is lost after the host ants are forced to feed upon the new strain (Poulsen and Boomsma, 2005).

Despite the vertical mode of transmission and the mechanisms to ensure a mature colony is unlikely to adopt a new fungal strain, there are several indications that that the strict vertical transmission is violated with relative regularity (Bot et al., 2001; Mikheyev et al., 2007): there is no discernible population structure within the fungus at higher levels (Mikheyev et al., 2007); the fungi of Acromyrmex echinatior and its congeneric Acromyrmex octospinosus are not mutually monophyletic, suggesting some host switching occurs regularly over evolutionary time-scales (Bot et al., 2001).

Since horizontal transfer is unlikely between mature colonies, given the mechanisms in both the fungi and the ants to prevent it, the early stages of colony foundation provide the best candidate stage for transmission. Indeed, in the lab, Acromyrmex queens will readily accept a novel fungus strain when hers has been removed by an experimenter, and appears do so without su↵ering any loss in ﬁtness besides a slight delay in colony development, even across species’ boundaries (Poulsen et al., 2009).

122 There appears to be high potential for horizontal fungal transmission in the early stages of a colony’s lifecycle; the route this takes, however, is not yet known. Young A. echinatior nests often occur in clusters (Fernández-Mar´ınet al., 2004), with each likely containing a di↵erent fungal strain. It is possible therefore, should a queen lose her fungus, she could adopt the fungus of a neighbour, as she is capable of doing in controlled conditions (Poulsen et al., 2009). She could achieve this by stealing the symbiont, usurping the host, or finding an orphaned fungus. Acromyrmex queens show semi-claustral founding, ie. she feeds her young fungus using leaf matter that she forages, so must leave the relative safety of her nest (Fernández-Mar´ınet al., 2004). It seems likely therefore that there will be a high mortality in queens at this stage, and a number of unattended fungi that could be adopted. This behavioural suite could also be quite easily adopted to foraging for a new symbiont, should aqueen’soriginalsymbiontbelostforanyreason.Ayoung(likely 1-2 weeks post-mating) ⇠ A. echinatior queen is shown in figure 3.1 on page 119.

We tested the possibility of the horizontal transmission of the A. echinatior fungal symbiont during the hypothesised ‘window’ for symbiont transmission (Poulsen et al., 2009) that occurs during the early stages of colony foundation. We motivated queens to move by removing their symbiotic fungus, as well as creating orphaned fungi nearby. We tracked their respective movements in order to determine if horizontal transmission is possible and the route it most likely takes.

3.1 Methods

All trials were conducted at two sites in Gamboa, Panama, during May 2015. An A. echinatior queens initiate their nests by digging into the face of relatively steep slopes; anumberofsuitableslopesthroughoutGamboawereassessed,andtheﬁnalsiteswere selected based on a quick density estimate. If 3queenscouldbefound,eitherwithina 123 nest or outside foraging, in under 10 minutes of searching, it was thought that a sucient number would be present to test. Two sites were selected for treatment.

Each nest was marked, and the entrance widened using a teaspoon, before being assigned to one of three possible treatments: queen,fungus,orcontrol.Forthequeen treatment, the queen was removed and a small sample of the fungus was taken using forceps. For the fungus treatment, the fungus garden was removed by cutting the root on which the garden was hung above and below the fungus garden, and the queen was marked using coloured paint. For the control treatment, a small sample of the fungus garden was removed and the queen marked, but the majority of the garden and the queen were left in situ.If,in either the fungus or the control treatment the queen would ﬂee after marking, I waited for her to return to the nest, which she invariably did. After treatment, the nest entrance was rebuilt in an attempt to reduce the risk of fungus-garden desiccation and queen loss.

Atotalof32nestswereidentifiedandusedinthisstudy,fromtwosites:9fromSiteA (figure 3.2) and 23 from Site B (figure 3.3). At Site A, 3 nests were used in each treatment; at Site B there were 9 fungus,8queen,and6controls.Thenestswereleftovernight, and each nest was checked again the following morning. The ant present in each nest was recorded and collected, and the remainder of the fungus garden taken.

All fungus was stored in absolute ethanol, and the queens were housed individually in apetridishwithfungusfromamaturecolonythatwascollectedaroundthesametime.

3.2 Results

Figure 3.2 summarises the results from site A. Here, 7/9 nests showed a change in either the ant or the fungus present. The 2 nests that remained unchanged were controls, in the

124 third control both the ant and the fungus were no longer present. It is possible that the treatment was too large a disturbance and the queen abandoned this nest. 2 of the queen nests lost the fungus overnight (A1 and A6), while the third was occupied by a new queen (A5). This queen was not marked, and must have come from a nest that was missed during the initial survey, or was present in the inaccessible area above the test site. 2 of the 3 fungus nests regained a small fungus garden (A3 and A7), the queen present in the third (A4) could not be accounted for. Both of the nests that regained a garden were in close proximity to a nest that had lost fungus.

At site B (ﬁgure 3.3), 16/23 nests showed some change following treatment. Only one of the 6 control nests showed any change: nest B14 had gained a second queen that had not been marked. The queens showed aggressive towards one another and were housed separately in the lab. Of the 9 queen nests, 5 had no fungus the following day, 2 showed no change, and 2 were occupied by a marked queen from a neighbouring nest (B5 to B4, and B12 to B11). Finally, of the 8 fungus nests, 1 queen could not be accounted for, 4 regained a small fungus garden and 2 were found in neighbouring queen nests. A single queen showed no change, and was found again in her nest still without a fungus. This queen was the most isolated of those tested; her closest neighbour was 80cm away. Again, all queens that regained a fungus were in close proximity to other nests; 3 of the 4 that regained fungus had a orphaned fungus nearby, while 1 (B13) had 2 nests with fungus nearby (B11 and B14), although these were both occupied by other queens at the end of the study.

The hypothesised fungus movements (mean=0.34m) tended to be longer than the queens’ movements (mean=0.12m, ANOVA, p=0.049), shown in ﬁgure 3.4. Although these data may be somewhat biased as those ants that may have travelled farthest to occupy the vacant nests (A5 and B14) cannot be included; they were not found and marked during the experimental set-up. We must also stress that these are only hypothesised movements, liable to change when microsatellite data are obtained.

125 3.3 Discussion

Here, we have demonstrated the first unequivocal horizontal transfer of the fungal symbiont of Acromyrmex among di↵erent lineages of the ant in a natural setting. The fungus in nest A5 (figure 3.2) was adopted by a new queen, and the fungi in nests B4 and B11 were adopted by the queens from nests B5 and B12, respectively, as the queens relocated to these vacant nests (figure 3.3). We also observed many of the orphaned fungi apparently being removed, while nearby queens apparently reacquired a fungal symbiont. It is tempting to suggest that these queens obtained their new symbionts from these nests but, as of yet, we cannot assign identities to the fungus, and so cannot confirm that horizontal transfer has occurred in these cases. The alternative, that a small amount of fungus was missed during the initial collection, cannot be excluded. Microsatellite markers are available for fungal strains, and these data will shortly be available.

If it is found that the queens did not steal the fungi, something else must be found to explain their disappearance. In two of the queen nests, A1 and B9, the fungus had been removed and the empty hole was occupied by a millipede ( 7-10cm, species unknown). ⇠ Although speculative, it is possible that the fungi were lost due to predation by this millipede while it was undefended. Millipedes generally feed upon leaf-litter, but some are known to associate with ants (Kronauer and Pierce, 2011), and have been recorded feeding on the fungus associated with the waste dumps of Atta sexdens and Acromyrmex landolti fracticornis(Fowler, 1981); they have also been shown to follow the trail pheromone of Atta sexdens (Fowler, 1981). The queens’ fungi could o↵er a decent meal to the millipede fortunate enough to ﬁnd the unguarded nests created in this experiment.

Alternatively, if we assume that the hypothesised fungus transfers in ﬁgures 3.2 and 3.3 are correct, we must then explain why these ants would steal the fungus, rather than take over the nest (as in A5, B4 and B11). An Acromyrmex queen has been observed

126 carrying fungus over some distance (pers. obs., a video is available upon request), indicating that movement of the fungus is a possibility. There may be an e↵ect of distance, as the hypothesised fungal movements were longer than the known queen movements. There are potentially two reasons why longer distances could favour stealing a fungus over relocating nest. Firstly, a long distance migration could increase the chance that she loses her nest. If the queen navigates using a pheromone trail during her foraging trips, or a form of cognitive map, she may not be able to locate her new nest again. If she were to use pheromones, her pheromones would be concentrated around her previous nest, whereas if the queen were to use a cognitive map, she may not have the neurological flexibility to remember the location of the new nest. These problems are alleviated with nearby nests, which would be easy to find relative to an old nest. Secondly, fungus-stealing rather than usurping could reduce the risk of an aggressive encounter. The queens in this experiment likely did not know that the fungus gardens were orphaned; the resident may simply have been foraging. By stealing the fungus before the original owner returned, a symbiont could be regained while running less of a risk of a costly fight. When the fungus is stolen from a close neighbour, it is likely that the now symbiont-less queen would find the nest and an aggressive encounter would ensue.

The choice to steal or to usurp could depend on factors that were not measured in this study, such as the stage of development of the donor garden, or something as simple as the presence of a second suitable root in the queen’s original nest.

The apparent regularity with which a fungus may be adopted by a new queen raises the possibility that the fungus itself would benefit from being found and stolen, or taken over by a new queen (Frank, 1996b). The fungus is unable to survive without a host, so would benefit greatly if it were to advertise its availability to nearby queens. Likewise, a fungus that is still tended by a healthy queen could also benefit from horizontal transfer: under fungus stealing, the fungus could be split between two nests which, depending on the cost of stealing on the survivorship of the original host and the new queen, could increase the

127 probability that the fungus will eventually contribute to a mature colony.

Much of the biology of the very early stages of colony foundation are unknown, and observational studies are needed to untangle the dynamics of horizontal symbiont transmission and partner choice in Acromyrmex,fromboththeperspectiveofthequeenandthe fungus; particularly in the potential role that the fungus plays in soliciting the attention of Acromyrmex queens. The data here suggest that both nest usurpation and fungus-stealing are common in queens that have lost their symbiotic fungus. We await the data to conﬁrm the validity of the hypothesised instances of fungus stealing.

Acknowledgments

We would like to thank the Smithsonian Tropical Research Institute, Panama, for housing us, and granting access to the laboratory facilities, and to the ants that make such fascinating subjects. Special thanks are reserved for Aaron O’Dea, whose garden (Site B) is now littered with divots following this study.

128 Figure 3.2: Fungus Stealing: Site A

Site A 6

1 9 2 3 4

5 129 8

7 1 2 3 4 5 6 7

Queen +, fungus - Movement of queen 1m Fungus +, queen - Movement of fungus Control Hypothesised movement of fungus

The set-up and results of the second experimental site. The solid arrows indicate known movement of either ants (blue) or fungus (red), the dashed arrows indicate hypothesised movement based on these known movements. Figure 3.3: Fungus Stealing: Site B

Site B

1 2 3 4 5 6 Queen +, fungus - 19 6 10 Fungus +, queen - 4 5 9 Control

Movement of queen 3 2 Movement of fungus

Hypothesised movement of fungus 8 18 7 15 17 130

16 11 12 13 14 ~3m 21 1 20 23 22

steal Outcome

relocate

0.1 0.2 0.3 0.4 Distance (cm) The known movements of queens (relocate) were found to be signiﬁcantly shorter than the hypothesised movements of the fungal symbiont (steal) (ANOVA, p=0.049).

131 Bibliography

A. Bot, S. Rehner, and J. J. Boomsma. Partial incompatibility between ants and symbiotic fungi in two sympatric species of acromyrmex leaf-cutting ants. Evolution,55(10):1980– 1991, 2001.

H. H. De Fine Licht and J. J. Boomsma. Forage collection, substrate preparation, and diet composition in fungus-growing ants. Ecological Entomology,35(3):259–269,2010.

K. R. Foster and T. Wenseleers. A general model for the evolution of mutualisms. Journal of evolutionary biology, 19(4):1283–1293, July 2006. doi: 10.1111/j.1420-9101.2005.01073. x. URL http://onlinelibrary.wiley.com/doi/10.1111/j.1420-9101.2005.01073. x/full.

H. G. Fowler. Behavior of two myrmecophilesof paraguayan leaf-cutting ants. 1981.

S. A. Frank. Host-symbiont conﬂict over the mixing of symbiotic lineages. Proceedings of the Royal Society of London B: Biological Sciences,263(1368):339–344,1996a.

S. A. Frank. Host control of symbiont transmission: the separation of symbionts into germ and soma. American Naturalist,pages1113–1124,1996b.

E. A. Herre, N. Knowlton, U. G. Mueller, and S. A. Rehner. The evolution of mutualisms: exploring the paths between conﬂict and cooperation. Trends in Ecology & Evolution,14 (2):49–53, 2 1999. doi: http://dx.doi.org/10.1016/S0169-5347(98)01529-8. URL http: //www.sciencedirect.com/science/article/pii/S0169534798015298.

132 A. B. F. Ivens, D. R. Nash, M. Poulsen, and J. J. Boomsma. Caste-speciﬁc symbiont policing by workers of Acromyrmex fungus-growing ants. Behavioral Ecology,20(2):378– 384, 2009. doi: 10.1093/beheco/arn150. URL http://www.beheco.oxfordjournals. org/cgi/doi/10.1093/beheco/arn150.

D. J. Kronauer and N. E. Pierce. Myrmecophiles. Current Biology,21(6):R208–R209,2011.

A. Mikheyev, U. Mueller, and J. Boomsma. Population genetic signatures of di↵use coevolution between leaf-cutting ants and their cultivar fungi. Molecular Ecology,16(1): 209–216, 2007.

M. Poulsen and J. J. Boomsma. Mutualistic fungi control crop diversity in fungus-growing ants. Science,307(5710):741–744,2005.

R. Quinlan and J. Cherrett. The role of fungus in the diet of the leaf-cutting ant atta cephalotes (l.). Ecological Entomology,4(2):151–160,1979.

A. M. Viana, A. Fr´ezard, C. Malosse, T. M. Della Lucia, C. Errard, and A. Lenoir. Colonial recognition of fungus in the fungus-growing ant acromyrmex subterraneus subterraneus (hymenoptera: Formicidae). Chemoecology,11(1):29–36,2001.

133 Conclusions and Future Directions

Each of the three chapters above raises many questions that provide potential avenues for future research, here I brieﬂy describe a few of these. i: The Use of Transcriptomic Data to Identify Imprinted Genes

We still cannot confirm of refute the presence of genomic imprinting in the social insects. However, progress is being made. The present study enables genome-wide searches in a much wider range of insects, increasing the chance that, if imprinting is present, it will be identified. The first step in this regard is to test the imprinting statuses of those genes identified in appendix 2 – particularly those genes that were identified as imprinting candidates in the honeybee (cytochrome P450 9e2 and the histone-methyltransferase) (Kocher et al., 2015). It would be informative to test the model presented here against the dataset of Kocher et al., to see whether this method can identify loci that were excluded by their strict conditions (homozygosity in the queen).

If we are to apply these techniques to larvae, where we may be more likely to detect imprinting, we must be able to reliably di↵erentiate larval stages and castes using non-lethal and quick techniques. This cannot yet be done in Acromyrmex echinatior and requires careful observation and rearing work. This is already underway, but much work is required before a simple key can be developed.

Although the method described in chapter 1 can be applied without breeding the organism under study, it is not as powerful for detecting imprinting as similar studies where the species can be bred in the laboratory. We cannot currently breed Acromyrmex,although much e↵ort has been spent attempting to artiﬁcially inseminate them. Artiﬁcial insemination is possible in the related genus Atta (den Boer et al., 2010). Atta queens are also

134 multiply-mated (Villesen et al., 2002), so would also be expected to have similar imprinting kin conﬂicts. The genome is available for Atta cephalotes (Suen et al., 2011), and provides an alternative fungus-growing ant in which to test imprinting theory.

Finally, it may be possible to use the genomes available within the attine ants to further narrow down the list of imprinted genes provided here, or to at least prioritise some over others. One prediction of the kinship theory is that an arms race may develop between the imprinted genes that act within the o↵spring, and the trans-acting genes that act during the application of the imprints in the parents (Wilkins and Haig, 2003). This is because the imprinting genes act in accordance with the maternal or paternal interests, while the imprinted genes act in the matrigenic or patrigenic interests – a matrigene is sure it is in the o↵spring, a maternal gene is not. If such an arms race does occur, we may expect imprinted and imprinting genes to evolve faster than unimprinted loci, all else being equal. Searching for changes in rate of evolution in genes after the transition to multiple mating in the higher attines (Villesen et al., 2002) could highlight genes a↵ected by the sudden shift in kin-conﬂicts. This, however, is conﬂated by a number of other changes in foraging and caste structure (Schultz and Brady, 2008), so is likely to be challenging. ii: A Potential Role for the Neuropeptide Tachykinin

In chapter 2, we showed that tachykinin expression in the major workers is higher than the other castes. Tachykinin may therefore play a role in the control of the division of labour in A. echinatior.Toexplorethisrolefurther,assuggestedinthechapter,expressionlevels should also be evaluated in behaviourally distinct subsets of each worker caste; di↵erences between the young callow major workers within the nest, and between the older workers that leave the nest to forage would perhaps be the most informative.

If we are to conﬁrm a role for tachykinin in controlling the behaviour of the workers, we must move beyond correlative studies and manipulate the levels of tachykinin or the

135 receptor. Techniques to manipulate gene expression (RNAi or CRISPR) cannot currently be applied to A. echinatior. Although this may be developed in the future, an alternative could be o↵ered by the apparently high functional conservation across the tachykinins; invertebrate tachykinin-proteins can a↵ect vertebrate tissues (Kanda et al., 2003), and vice versa (Severini et al., 2002). It may be possible, therefore, to use drugs such as NK1 receptor agonist, or therapeutic drugs currently developed for use in humans (Ebner et al., 2009; Patacchini and Maggi, 2001) to disrupt tachykinin signalling in the ants and observe any behavioural changes. iii: Horizontal Transfer of the Fungal Symbiont of a Fungus-Growing Ant

In the ﬁnal chapter, we demonstrated that the fungal symbiont of A. echinatior can be horizontally transferred in a natural setting. We are, however, still ignorant of many of the dynamics of horizontal symbiont transfer. The microsatellite data, currently in preparation, will solve this to some extent, by conﬁrming whether our hypothesised cases of fungus- stealing are true.

Even with this data, it would be valuable to observe the process of fungus transfer more closely. This would allow us to explore any potential mechanisms of symbiont choice in the queen – does she always take the closest fungus? Is the hypothesised e↵ect of distance true? Establishing common foraging areas for 4 or 5 young queens in the lab would relatively straightforward, and repeating the experiment above with continuous observation after fungus-stealing would answer many such questions.

Finally, the possibility of horizontal transfer opens up the possibility of traits in the fungus that may not be in the best interests of the host queen. A fungus that could inﬂuence its host queen, or the queens of nearby nests, in order to make horizontal transfer more likely would be at a selective advantage. Consistent with this, it appears that the fungus may use volatile substances to attract a queen – a piece of fungus can be placed at

136 some distance from a queen, and she seems to rapidly become aware of its presence and will head straight to it (pers. observation). This means that there could be some degree of symbiont choice on the part of the fungus, if it is able to change the expression of these volatiles depending on the queen. Attempts should be made to determine the identity of these volatile compounds, and to test for di↵erences in the composition of these volatiles between fungi that are tended by ﬁt or unﬁt queens.

137 Bibliography

S. P. den Boer, B. Baer, and J. J. Boomsma. Seminal ﬂuid mediates ejaculate competition in social insects. Science,327(5972):1506–1509,2010.

K. Ebner, S. B. Sartori, and N. Singewald. Tachykinin receptors as therapeutic targets in stress-related disorders. Current pharmaceutical design,15(14):1647–1674,2009.

A. Kanda, E. Iwakoshi-Ukena, K. Takuwa-Kuroda, and H. Minakata. Isolation and characterization of novel tachykinins from the posterior salivary gland of the common octopus octopus vulgaris. Peptides,24(1):35–43,12003.doi:http://dx.doi. org/10.1016/S0196-9781(02)00274-7. URL http://www.sciencedirect.com/science/ article/pii/S0196978102002747.

R. Patacchini and C. A. Maggi. Peripheral tachykinin receptors as targets for new drugs. European Journal of Pharmacology,429(1ˆa“3):13–21,2001.ISSN0014-2999.doi: http://dx.doi.org/10.1016/S0014-2999(01)01301-2. URL http://www.sciencedirect. com/science/article/pii/S0014299901013012. SPRING 2001. { }

T. R. Schultz and S. G. Brady. Major evolutionary transitions in ant agriculture. 105(14): 5435–5440, 2008. doi: 10.1073/pnas.0711024105. URL http://www.pnas.org/cgi/doi/ 10.1073/pnas.0711024105.

C. Severini, G. Improta, G. Falconieri-Erspamer, S. Salvadori, and V. Erspamer. The tachykinin peptide family. Pharmacological reviews,54(2):285–322,2002.

138 G. Suen, C. Teiling, L. Li, C. Holt, E. Abouheif, E. Bornberg-Bauer, P. Bou↵ard, E. J. Caldera, E. Cash, A. Cavanaugh, et al. The genome sequence of the leaf-cutter ant atta cephalotes reveals insights into its obligate symbiotic lifestyle. PLoS Genet,7(2): e1002007, 2011.

P. Villesen, T. Murakami, T. R. Schultz, and J. J. Boomsma. Identifying the transition between single and multiple mating of queens in fungus-growing ants. Pro- ceedings of the Royal Society B: Biological Sciences,269(1500):1541–1548,2002.doi: 10.1098/rspb.2002.2044. URL http://rspb.royalsocietypublishing.org/cgi/doi/ 10.1098/rspb.2002.2044.

J. F. Wilkins and D. Haig. What good is genomic imprinting: The function of parent- speciﬁc gene expression. Nature Reviews Genetics,4(5):359–368,May2003.doi:10.1038/ nrg1062. URL http://www.nature.com/nrg/journal/v4/n5/abs/nrg1062.html.

139 Tachykinin expression is consistent with aggressive motivation in worker castes of the leaf-cutting ant Acromyrmex echinatior

Jack Howe, Morten Schiøtt & Jacobus J. Boomsma Centre for Social Evolution, University of Copenhagen. [email protected]

Background Brain allometry: A null model for gene expression.

• The leaf-cutting ant Acromyrmex echinatior shows a sophisticated Method: We weighed the heads of individuals, before the brain was removed and division of labour among its castes. weighed.

• This division of labour is observed in colony defence— major work- Figure 2

ers are more aggressive than media and minor workers, which are more 1.0 A: Brain and Head Weight B: Relative brain size [c] of A. echinatior individuals 0.20 of A. echinatior castes aggressive than gynes (virgin-queens before dispersal) [1]. [d] • Aggression changes throughout the lifetime of a reproductive female:

unmated, she is very passive, but shows an aggressive worker pheno- 0.15 eight (mg)) type if her wings are lost [2], and is transiently aggressive as a new- W ain

r [b] ly-mated queen before the emergence of her frst workers.

Log10(B 0.10 Brain weight / Head Weight [a] • The tachykinin signalling system controls the threshold for aggres- Gyne Major sive behaviour in Drosophila melanogaster [3], and is explored for a role 0.1 Media in the control of aggression in A. echinatior. Minor 0.05

1 10 Gyne Major Media Minor Log10(Head Weight (mg)) Caste

The larger relative brain-size of smaller workers suggests that a large portion of the Does tachykinin control aggressive division of labour? diferences observed in the expression levels (lower left) are a result of allometry.

A. echinatior castes difer in aggression. We tested whether this is refected in diferences in tachykinin signalling. Does tachykinin signalling control a fexible threshold? Method: qPCR of tachykinin and tachykinin-receptor 99D conducted on heads of three worker castes, virgin queens (non-aggressive) and queens of recently- Gynes of A. echinatior express worker phenotypes when any future chance of founded colonies (aggressive). Expression was normalised against Ribosomal reproduction is lost along with their wings [2]. We tested whether their increased Protein 1 and Elongation-Factor 1β. aggression could be a result of changes in the tachykinin signalling.

Method: We removed all gynes from three colonies, and removed either a leg or Figure 1 their wings, or left them untreated, before returning them. 10 days later, qPCR was

A: Expression levels of tachykinin C: Relationship between expression of tachykinin conducted on fve pooled heads from each treatment group, for each colony. and tachykinin receptor 99D.

0.1 [b] [a,b] [a,b] 0.10 Figure 3

[b,c] A: Expression levels of tachykinin with ‘wing-clipping’ B: Expression levels of Quantity tachykinin receptor 99D with 0.05 ‘wing-clipping’ 0.016 0.010 [a]

[a,b,c] [c] [c] 0.014

0 0.008

Log10(Tac-Quantity) [b] Quantity Gyne Major Media Minor Founding Quantity 0.012 Caste Queens

B: Expression levels of tachykinin receptor 99D Colony Colony 0.010 150 0.006 150 356 356 0.1 [c] 394 394 0.01 [a,c] Leg Control Wing Leg Control Wing [a] Treatment Treatment

Quantity Caste

0.05 Gyne [a,b] Major For tachykinin (3A), no change was found to be signifcant. For the receptor (3B), [a,b] Media [b] Minor only the ‘control’ and ‘wing’ treatments difered (3B) (p=0.008). Founding Queen

0 Tachykinin signalling does not appear to control the increased aggression of Gyne Major Media Minor Founding 0.01 0.10 Log10(TacR99-Quantity) worker-like gynes following wing-removal. Caste Queens

Higher expression levels are observed in the smaller castes for both genes (1A and 1B): a result of increased relative brain-size of smaller ants, see 2B, top right. Conclusion Plotting expression of the two genes against each other removes this, (1C). The lines • Diferences in tachykinin expression may contribute to the increased were ftted using a standardized major-axis: the lines have equal slope (p=0.39), but difer in elevation (p<0.001). aggression of workers: the major workers have the highest tachykinin levels relative to the receptor, and the reproductives the lowest. The major workers have the highest relative tachykinin levels (1C), consistent with their role in colony defence. • Tachykinin signalling does not appear to control aggression changes Expression of both genes is reduced in the founding-queens, inconsistent in response to wing-loss in the reproductive caste— suggesting that with their increased aggression. It is consistent, however, with a long-term future tachykinin may set a rigid threshold (perhaps during development), as a queen, and suggests that ephemeral increased aggression triggered by wing- but that other genes modify this in response to extrinsic or intrinsic loss after mating is induced by expression changes at diferent genes. conditions.

References: Special thanks are reserved for the Smithsonian Tropical Research 1. Larsen, Janni, et al. “Variation in nestmate recognition ability among polymor- Institute, Panama, where samples were collected. phic leaf-cutting ant workers.” Journal of insect physiology 70 (2014): 59-66. 2. Nehring, Volker, Jacobus J. Boomsma, and Patrizia d’Ettorre. “Wingless virgin queens assume helper roles in Acromyrmex leaf-cutting ants.” Current Biology 22.17 (2012): R671-R673. 3. Asahina, Kenta, et al. “Tachykinin-expressing neurons control male-specifc aggressive arousal in Drosophila.” Cell 156.1 (2014): 221-235. Danish National Research Foundation Centre for Social Evolution

ESEB Poster 2015: The gene expression and morphological data from chapter 2 were presented at the biannual conference of the European Society of Evolutionary Biology at the University of Lausanne in August of 2015

140 Acknowledgements

Particular thanks must be expressed to Morten Schiøtt, whose saintly patience for my never- ending questions in the lab have been invaluable, and to Koos Boomsma for providing me with this opportunity, and guiding me during my ﬁrst real foray into academia.

Thanks also to all at CSE, especially to Sylvia Mathiasan for showing me the ropes in both the lab and with the ants. I have thoroughly enjoyed the last 2 years, and look forward to the next three.

Enormous gratitude is also directed at Pepijn Kooij and Andrea Baquero (and poesje) for giving me a home when I was desperate.

Final thanks to friends and family, both in Denmark and back home, for their support.

141