Editas Medicine Corporate Presentation

Corporate Presentation

January 13, 2020

PIONEERING THE POSSIBLE

This presentation contains forward-looking statements within the meaning of the “safe harbor” provisions of The Private Securities Litigation Reform Act of 1995. All statements, other than statements of historical facts, contained in this presentation, including statements regarding the Company’s strategy, future operations, future financial position, future revenue, projected costs, prospects, plans, and objectives of management, are forward-looking statements. The words ‘‘anticipate,’’ ‘‘believe,’’ ‘‘continue,’’ ‘‘could,’’ ‘‘estimate,’’ ‘‘expect,’’ ‘‘intend,’’ ‘‘may,’’ ‘‘plan,’’ ‘‘potential,’’ ‘‘predict,’’ ‘‘project,’’ ‘‘target,’’ ‘‘should,’’ ‘‘would,’’ and similar expressions are intended to identify forward-looking statements, although not all forward-looking statements contain these identifying words. Forward-looking statements in this presentation include statements regarding the clinical trial timelines for EDIT-101 (AGN-151587) and EDIT-301. The Company may not actually achieve the plans, intentions, or expectations disclosed in these forward-looking statements, and you should not place undue reliance on these forward-looking statements. Actual results or events could differ materially from the plans, intentions and expectations disclosed in these forward-looking statements as a result of various factors, including: uncertainties inherent in the initiation and completion of preclinical studies and clinical trials and clinical development of the Company’s product candidates; whether interim results from a clinical trial will be predictive of the final results of the trial or the results of future trials; expectations for regulatory approvals to conduct trials or to market products; availability of funding sufficient for the Company’s foreseeable and unforeseeable operating expenses and capital expenditure requirements; and other factors discussed in the “Risk Factors” section of the Company’s most recent Quarterly Report on Form 10-Q, which is on file with the Securities and Exchange Commission, and in other filings that the Company may make with the Securities and Exchange Commission in the future. In addition, the forward-looking statements included in this presentation represent the Company’s views as of the date of this presentation. The Company anticipates that subsequent events and developments will cause its views to change. However, while the Company may elect to update these forward-looking statements at some point in the future, it specifically disclaims any obligation to do so. These forward-looking statements should not be relied upon as representing the Company’s views as of any date subsequent to the date of this presentation.

CRISPR Gene Editing to Develop Differentiated, Transformational Medicines for High Unmet Need

In Vivo CRISPR Medicines Engineered Cell Medicines

Develop best-in-class medicines for Leverage AAV-mediated editing with SaCas9 hemoglobinopathies using Cas12a and solid into additional therapeutic areas tumors using iPSC-derived cells

Maintain Best-in-class Platform & Intellectual Property, and Advance Organizational Excellence

CRISPR: clustered regularly interspaced short palindromic repeat; SaCas9: Staphylococcus aureus CRISPR-associated protein 9; Cas12a: CRISPR-associated protein 12a; iPSC: induced pluripotent stem cell © 2020 Editas Medicine 3 2019 Achievements

In Vivo CRISPR Medicines Engineered Cell Medicines

Initiated first ever clinical trial of an in vivo CRISPR medicine Initiated IND-enabling activities and presented preclinical data with EDIT-101 for Leber congenital amaurosis 10 (LCA10) for EDIT-301, for sickle cell disease and β-thalassemia

Achieved in vivo preclinical proof-of-concept and declared EDIT- CANCER FOCUS 102 development candidate for Usher syndrome 2A (USH2A) Focused collaboration with Bristol-Myers Squibb on αβ Advanced autosomal dominant retinitis pigmentosa 4 (RP4) T cell medicines program Advanced engineered iPSC-derived NK (iNK) cell medicine Expanded into neurological diseases in partnership with AskBio for solid tumors using technology from BlueRock Therapeutics

Dose first EDIT-101 patient Generated edited NK cells from healthy donors and iPSCs with significantly increased anti-cancer activity

Maintain Best-in-class Platform & Intellectual Property, and Advance Organizational Excellence Hired Chief Executive Officer, Grew team to 196 Editors Added $75M through business Chief Medical Officer, Chief Financial Officer, development activity and Senior Vice President of Operations

PROGRAM (OR DISCOVERY LEAD IND ENABLING EARLY-STAGE LATE-STAGE PARTNER STRUCTURE DISEASE/CANDIDATE) OPTIMIZATION CLINICAL CLINICAL IN VIVO CRISPR MEDICINES

OCULAR

EDIT-101 (AGN-151587): Partnered Leber Congenital Amaurosis 10 EDIT-102: Usher Syndrome 2A Collaboration Autosomal Dominant Retinitis Collaboration Pigmentosa 4

OTHER ORGANS

Duchenne Muscular Dystrophy Wholly-owned (Muscle) Neurological Diseases Collaboration

ENGINEERED CELL MEDICINES

HEMATOLOGY

EDIT-301: Wholly-owned Sickle Cell Disease β-Thalassemia Wholly-owned

CANCER

Healthy Donor NK Cells Collaboration

iPSC NK Cells Wholly-owned / Collaboration

 T Cells Wholly-owned

In Vivo CRISPR Medicines Engineered Cell Medicines

Dose first EDIT-101 patient in Q1 File EDIT-301 IND for sickle cell disease

EDIT -101: complete adult low and mid-dose cohorts CANCER FOCUS by year-end Initiate IND-enabling studies for an engineered healthy Achieve in vivo preclinical proof-of-concept for a donor NK (HDNK) cell medicine to treat solid tumors neurological indication Achieve in vivo preclinical proof-of-concept for an Nominate development candidate for RP4 engineered iNK cell medicine to treat solid tumors

Advance αβ T cell medicines in collaboration with Bristol-Myers Squibb

Maintain Best-in-class Platform & Intellectual Property, and Advance Organizational Excellence Build out clinical and medical affairs organization Advance manufacturing and operations to support clinical activity

EDIT-101

Remove genetic mutation to restore CEP290 protein and rebuild photoreceptors in patients with Leber congenital amaurosis 10

DISEASE EPIDEMIOLOGY PROGRAM STATUS Degeneration of 2-5K First patient photoreceptors leading to patients in US dosing expected in Q1 2020 blindness in childhood and Europe with potential for data this year

LCA10 Photoreceptor EDIT-101 Rescued Photoreceptor

Outer Segment Outer Segment

Outer segment Editing removes Outer segment degenerates due to disease-causing regenerates with CEP290 deficiency mutation CEP290 protein

CEP290 GENE EDITING MOUSE FULL-THICKNESS RETINA

100% 100% 1E+13 vg/mL n = 10 mice EDIT-101 1E+12 vg/mL n = 8 mice n = 13-75 mice 80

log scale log 10

– 40 Editing Editing

Transduced Region Transduced 20 Productive Editing in in Editing Productive Therapeutic Threshold 1 0 1 6 11 16 21 26 100 1010 1011 1012 Week post dosing Vector Dose (vg/mL)

Rapid, therapeutically relevant editing at AAV dose that has been safely administered to humans

AAV: adeno-associated virus Maeder et al. Development of a gene-editing approach to restore vision loss in Leber congenital amaurosis type 10. Nat Med. 2019 Jan 21; 25:229-233 © 2020 Editas Medicine 10 First In Vivo CRISPR Clinical Trial Initiated

LCA10 PHASE 1/2 STATUS Enrolling CLINICAL TRIAL

PATIENTS Approximately 18 patients, aged 3 years and above

INTERVENTION Single dose of EDIT-101 administered via subretinal injection to eye with worse vision

Open-label, dose escalation CONTROL Patient’s own baseline value for each efficacy measure

study to evaluate safety, ENDPOINTS • Primary: Safety including frequency and number of adverse tolerability, and efficacy of events related to drug, procedure, and dose limiting toxicities EDIT-101 (AGN-151587) in • Secondary: Efficacy including visual acuity, mobility course, patients with CEP290 IVS26 macula thickness, pupillometry, and electroretinogram mutation* FOLLOW-UP Core measurements every 3 months for 1st year

EDIT-102

Rescue vision by restoring USH2A protein leveraging same proprietary SaCas9 enzyme, vector, and promoter as EDIT-101

DISEASE EPIDEMIOLOGY PROGRAM STATUS Progressive vision loss 4K EDIT-102 leading to blindness due patients with target development candidate to degeneration of mutation declared photoreceptors Additional 10K potentially addressable

increases USH2A mRNA and restores Deleting exon 13 Message box lackingMessage exon box 13 functionalMessage protein box human cell line at 4 days human retinal organoids at 120-140 days

USH2A Gene Productive Editing ∆13 USH2A mRNA

c.2299delG 100% 100% Healthy retina

Ex12 *Ex13 Ex14

USH2A retina Gene editing to remove exon13 61% 47% Edited Ex12 Ex14 0% 1% 0%0 0%0 USH2A retina Unedited USH2AEdited Unedited USH2AEdited Edited Edited Usherin Protein Complex n = 2 technical replicates Photoreceptor Protein

AUTOSOMAL DOMINANT RETINITIS PIGMENTOSA 4 (RP4) Preventing blindness by replacing defective rhodopsin using same proprietary SaCas9 enzyme and vector as EDIT-101

DISEASE EPIDEMIOLOGY PROGRAM STATUS Progressive decline in 26K Development night vision, followed by patients with target candidate peripheral vision, and mutation eventual blindness by year-end due to degeneration of photoreceptors

Central nervous system

Peripheral nervous system Cardiology

Neuromuscular Additional therapeutic areas Ocular • LCA10 Liver • USH2A • RP4

• AAV delivery enabled by development of proprietary SaCas9 • Leverage ocular experience to expand into neurological diseases and other therapeutic areas

EDIT-301 Editing hematopoietic stem cells to increase fetal hemoglobin that durably alleviates morbidity and mortality

DISEASE EPIDEMIOLOGY PROGRAM STATUS

Deformed and diminished blood cells causing anemia, pain crises, 42-47 years File IND median life expectancy by year-end organ failure, and mortality Over 100K hospitalizations annually in US alone

EDIT-301 (HBG1/2 Editing) BCL11Ae Editing Lentiviral Gene Therapy

+++ HbF ++ HbF ++ HbA-T87Q EFFICACY Reduces sickle globin Reduces sickle globin No impact on sickle globin

Strongly supported by Not supported by human human genetics genetics

SAFETY No lineage skewing in mice Lineage skewing in mice

Targeted genetic change Targeted genetic change Random integration with some cells >20 VCN

TSS:-130 Cas12a SpCas9 TSS:-92 Identified key regulatory region in β-globin locus consistent with human CCAGCCTTGCCTTGACCAATAGCCTTGACAAGGCAAAC genetics implying human safety GGTCGGAACGGAACTGGTTATCGGAACTGTTCCGTTTG

Large deletions induce Large NHEJ deletions, but Cas12a induces more large higher HbF in cultured cells not MMEJ, are maintained in vivo NHEJ deletions than SpCas9

40% 100% 100% 11% 49% 24%

 67%

G 59% NHEJ Indels Indels MMEJ 30% 65%

22% 13% 22% 0 0 0 ≤3bp >3bp Pre-infusion Bone marrow SpCas9 Cas12a (Cpf1) at 16 weeks n = 2 healthy human donors in NBSGW mice <=3bp >3bp MMEJ >3bp NHEJ

HBG1/2 EDITING BCL11Ae EDITING EDITAS MEDICINE STRATEGY COMPETING STRATEGY

SIMILAR LEVELS OF SIMILAR LEVELS REDUCED INCREASED ERYTHROID OUTPUT OF CELL DEATH ERYTHROID OUTPUT CELL DEATH

120% 6% 120% *** 6% ***

100 100

80 4 80 4

60 60 100% 106% 100% 5%

40 2 40 2

Caspase+ Cells Caspase+

Caspase+ Cells Caspase+ Control (Erythroid) Control Control (Erythroid) Control 20 2% 2% 20 2% 20% 0 0 0 0 Unedited HBG1/2 Unedited HBG1/2 Unedited BCL11Ae Unedited BCL11Ae Edited Edited Edited Edited

n = 5 healthy human donors in NBSGW mice at 16 weeks

***p<0.001 Chang et al., Genome Editing of HBG1/2 Promoter Leads to Robust HbF Induction In Vivo While Editing of BCL11A Erythroid Enhancer Shows Erythroid Defect, 60th ASH Annual Meeting & Exposition © 2020 Editas Medicine 20 Editing HBG1/2 Induces Robust Fetal Hemoglobin In Vivo

Robust HbF in human CD34+ cells in vivo High pan-cellular human HbF in red blood cells

100%100 100%100

) 80 80 HbA + + 60 60

HbF 89%

/ ( / 40 40 + Red Blood Cells Blood + Red HbF 52% 20 HbF 20 4% 4% 0 0 Unedited EDIT-301HBG1/2 Unedited HBG1/2HBG1/2 Edited Edited

n = 5 healthy human donors in NBSGW mice at 16 weeks

1 2 3

CELL SOURCE Patient Donor Healthy Donor Universal (iPSC)

ABILITY TO MULTIPLEX Lower Medium Higher

COST Higher Medium Lower

Pluripotent Stem Cell

CD34+ Cells

ab T cells  T cells NK cells

Immune System ADAPTIVEAdaptive INNATEInnate

Tumor Recognition • ab T cell receptor •  T cell receptor • Innate receptors • CAR • Innate receptors • Antibody-directed • CAR • CAR

Graft-vs-Host Risk Higher Lower

Multiple innate receptors Multiple NK CELL innate receptors CARs Multiple innate receptors NK CELL ADCC

ADCC CRISPR editing NK CELL Antibody-directed cellular cytotoxicity (ADCC) CRISPR editing

Improved ADCC, persistence, Improved ADCC, persistence, and and tumor micro-environment additional TME resistance (TME) resistance Improved recognition of tumor cells lacking T cell antigens for PD-1 nonresponding tumors with innate receptors and CARs

Pooled healthy NK cells Edited NK Cells donor blood

Efficient editing of HDNK cells improves tumor killing

100%100 100%100

80 80

60 60

Indels 85% 83%

40 40 74% Cytolysis 20 20 20% 0 0 Single KO Double KO Unedited Double KO

n = 3 healthy human donors; editing and tumor cell killing measured 4 days after electroporation

Differentiated iPSC Edited clonal iPSC line iNK cells somatic cell

Editing + Dedifferentiate Differentiate clonal identification 0 0 Technology from High editing efficiency Infinitely renewable Developing a Highly engineered line BlueRock Therapeutics with engineered Cas12a proprietary, scalable Defined genome differentiation method Low COGs Genome characterization builds Off-the-shelf on in vivo editing capabilities

Differentiated iPSC Edited clonal iPSC line iNK cells somatic cell

Efficient knock out of multiple genes in iNKs Editing iNKs increases tumor killing

100%100 100%100 80 80

60 60

40 40 Editing 100% 100% 75% 74% 70%

Cytolysis 74% 20 20 2% 0 0 KO 1 KO 2 KO 3 KO 4 KO 5 Unedited Single KO DNA harvested from cells 4 days after electroporation

PARTNERS PATENTS OCULAR MEDICINES ENGINEERED CELL MEDICINES FOR CANCER BROADEST & DEEPEST PORTFOLIO OF CRISPR IP

DEVELOPMENT & αβ T cell medicines to treat cancer and COMMERCIALIZATION Option to license up to 5 ocular programs autoimmune diseases $90 million upfront plus > $1 billion contingent milestones and tiered royalties; option for $100 million upfront to date plus potential 50/50 profit split in US on 2 programs for milestones & tiered royalties Exclusive access to foundational Cas9 and Cas12a patent estates

NEUROLOGICAL MEDICINES ENGINEERED CELL MEDICINES FOR CANCER Exclusive access to multiple species and engineered forms of Sandhill Cas9 and Cas12a Therapeutics Over 70 issued patents and over RESEARCH Collaboration bringing Collaboration to create novel, Collaboration using BINATE 600 patent applications pending COLLABORATION leading capsid development, allogeneic pluripotent stem cell technology to develop clinical stage AAV vector (PSC) lines using BlueRock’s engineered HDNK cell Issued patents covering EDIT-101 delivery system, and induced pluripotent stem cell medicines manufacturing expertise (iPSC) platform to develop engineered iNK cell medicines

CRISPR Gene Editing to Develop Differentiated, Transformational Medicines for High Unmet Need

In Vivo CRISPR Medicines Engineered Cell Medicines

Develop best-in-class medicines for Leverage AAV-mediated editing with SaCas9 hemoglobinopathies with Cas12a and solid into additional therapeutic areas tumors using iPSC-derived cells

Maintain Best-in-class Platform & Intellectual Property, and Advance Organizational Excellence