Enrichment and Isolation of Acid-Tolerant Sulfate-Reducing

FEMS Microbiology Ecology, 95, 2019, fiz175

doi: 10.1093/femsec/fiz175 Advance Access Publication Date: 30 October 2019 Research Article Downloaded from https://academic.oup.com/femsec/article-abstract/95/12/fiz175/5610214 by Universidad San Sebastian user on 31 March 2020

RESEARCH ARTICLE Enrichment and isolation of acid-tolerant sulfate-reducing microorganisms in the anoxic, acidic hot spring sediments from Copahue volcano, Argentina Graciana Willis1,*,†, Ivan Nancucheo2, Sabrina Hedrich3, Alejandra Giaveno4, Edgardo Donati1 and David Barrie Johnson5

1CINDEFI (CONICET-UNLP), Facultad de Ciencias Exactas, Universidad Nacional de La Plata, Calle 47 y 115, 1900 La Plata, Argentina, 2Facultad de Ingenier´ıa y Tecnolog´ıa, Universidad San Sebastian,´ Lientur 1457, Concepcion´ 4080871, Chile, 3Federal Institute for Geosciences and Natural Resources, Resource Geochemistry, Stilleweg 2, 30655 Hannover, Germany, 4PROBIEN (CONICET-UNCo), Departamento de Qu´ımica, Facultad de Ingenier´ıa, Universidad Nacional del Comahue, Buenos Aires 1400, 8300 Neuquen,´ Argentina and 5School of Natural Sciences, Bangor University, Deiniol Road, Bangor, LL57 2UW, UK

∗Corresponding author: CINDEFI (CONICET-UNLP), Universidad Nacional de La Plata, Calle 47 y 115, La Plata, 1900 Buenos Aires, Argentina. Tel: +54 221 483 3794; E-mail: [email protected] One sentence summary: This study explores, for the first time, the anaerobic environments at Copahue volcano focusing on the enrichment and isolation of acidophilic/acid-tolerant sulfate-reducing bacteria and their characterization by 16S rRNA gene sequencing. Editor: Tillmann Lueders †Graciana Willis, http://orcid.org/0000-0002-1397-9778

ABSTRACT The geothermal Copahue-Caviahue (GCC) system (Argentina) is an extreme acidic environment, dominated by the activity of Copahue volcano. Environments characterised by low pH values, such as volcanic areas, are of particular interest for the search of acidophilic microorganisms with application in biotechnological processes. In this work, sulfate-reducing microorganisms were investigated in geothermal acidic, anaerobic zones from GCC system. Sediment samples from Agua del Limon´ (AL1), Las Maquinas´ (LMa2), Las Maquinitas (LMi) and Bano˜ 9 (B9–2, B9–3) were found to be acidic (pH values 2.1–3.0) to moderate acidic (5.1–5.2), containing small total organic carbon values, and ferric iron precipitates. The organic electron donor added to the enrichment was completely oxidised to CO2. Bacteria related to ‘Desulfobacillus acidavidus’strain CL4 were found to be dominant (67–83% of the total number of clones) in the enrichment cultures, and their presence was confirmed by their isolation on overlay plates. Other bacteria were also detected with lower abundance (6–20% ofthetotal number of clones), with representatives of the genera Acidithiobacillus, Sulfobacillus, Alicyclobacillus and Athalassotoga/Mesoaciditoga. These enrichment and isolates found at low pH confirm the presence of anaerobic activities in the acidic sediments from the geothermal Copahue-Caviahue system.

Received: 4 June 2019; Accepted: 28 October 2019

1 2 FEMS Microbiology Ecology, 2019, Vol. 95, No. 12

Keywords: acidophilic/acid-tolerant SRB; extremophiles; biosulfidogenesis; microbial sulfur cycle; volcanic environments; Copahue-Caviahue

INTRODUCTION able to grow at low pH (Johnson et al. 2009), were responsible for precipitation of copper sulfide (CuS) in an abandoned copper Sulfate-reducing prokaryotes (SRP) are mostly obligatory anaer- mine in south-west Spain (Peptoccocaceae bacterium strain CL4). obic bacteria and archaea that are widespread in anoxic envi- Downloaded from https://academic.oup.com/femsec/article-abstract/95/12/fiz175/5610214 by Universidad San Sebastian user on 31 March 2020 More recently Nancucheoˇ and Johnson (2012) described novel ronments. They gain energy from coupling electron transfer consortia of acidophilic SRB (Peptoccocaceae strain CEB3 and D. between various donors (organic compounds, hydrogen or car- acididuransT) and other acidophiles, maintained in a sulfidogenic bon monoxide) to sulfate, generating hydrogen sulfide (Muyzer bioreactor that was operated at pH as low as 2.2, that were and Stams 2008). The general reaction is stated in equations 1 used to remove transition metals (copper, nickel, cobalt and and 2, where CH O represents a simple organic carbon source 2 zinc) from synthetic acidic mine waters. On the other hand, the (Johnson 2012). first thermophilic acid-tolerant SRB was isolated by Mori et al. 2003 from a hot spring. This isolate, described as Thermodesul- − − − + + 2 → + + T 2CH2 O SO4 HS 2HCO3 H (1) fobium narugense , was found to be an autotroph with an optimum growth pH between 5.5 and 6.0. Elsewhere, novel ther- (at neutral/moderately alkaline pH.) mophilic and acid-tolerant SRB, Desulfothermobacter acidiphilusT and Thermodesulfobium acidiphilumT, were isolated from terres- + 2− + + → + + trial hot springs at Kamchatka peninsula, and were reported 2CH2 O SO4 2H H2 S 2CO2 2 H2 O (2) to be autotrophic and use hydrogen as energy source (Frolov et al. 2017, 2018). Other thermophilic acid-tolerant SRB of the (at low pH.) genus Thermodesulfobium (Thermodesulfobium sp. strain 3baa) was The sulfide (H SandHS−) reacts with many transition metal 2 recently isolated from sediments from an acidic mine pit lake in ions, such as Cd, Cu, Fe, Ni, to form highly insoluble sulfide Germany (Ruffel et al. 2018). phases (equation 3). SRB are versatile in terms of growth conditions and they can develop in a range of different environmental conditions + 2+ → ↓+ + H2 S M MS 2H (3) (Muyzer and Stams 2008). Extreme environments such as hot water pools, acidic hot springs, hydrothermal systems in shal- SRP include members of the four taxonomic groups: (i) the δ- low and deep sea, and mining-impacted areas are a source of proteobacteria subdivision, containing diverse genera of Gram- sulfate reducers that can grow at elevated temperatures and negative, mesophilic sulfate-reducing bacteria (SRB); (ii) Gram- low pH values. Many studies have focused on the geochem- positive, spore-forming SRB, that can resist higher temperatures istry and microbiology of these environments not only because ◦ ◦ than the mesophilic group (between 40 Cand60C; Aullo¨ et al. of their ecological implications, but also because indigenous 2013); (iii) thermophilic SRB that inhabit high temperature envi- microorganisms have potential application in many biotechno- ◦ ronments, with an optimal growth temperature between 65 C logical processes, such as bioprecipitation of transition met- ◦ and 70 C; and (iv) thermophilic sulfate-reducing archaea that als from industrial and mine-impacted wastewaters (Johnson ◦ thrive at temperatures above 80 C, currently represented by the 2012; Nancucheoˇ and Johnson 2012; Santos and Johnson 2018; genus Archaeoglobus found only in marine hydrothermal envi- Gonzalez´ et al. 2019) and the use of microbial electrochemi- ronments (Rabus et al. 2015). cal systems (MESs, Pozo et al. 2017;Niet al. 2018). Many stud- For many years it was known that sulfidogenesis occurred ies where acidophilic/acid-tolerant SRB were detected, using in acidic environments even though the only known SRP were, both culture-dependent and -independent approaches, have at the time, extremely intolerant of low pH (e.g. Tuttle, Dugan been carried out with AMD streams, microbial mats, pit lakes and Randles 1969). The first acidophilic SRB isolated in pure cul- (e.g. Rowe et al. 2007;Falagan´ et al. 2014) and acidic rivers (e.g. ture and later described as a novel species was Desulfosporosi- Sanchez-Andrea´ et al. 2011, 2013). Regarding volcanic environ- nus acididurans strain M1T, which was obtained from a geother- ments with extreme temperature and/or pH conditions, several mal site on the Caribbean island of Montserrat and was shown hot spring from the Kamchatka peninsula (Russia) and from the to grow in pure culture within a pH range from 3.8 to 7.0 using Yellowstone National Park were widely characterised in terms glycerol as the electron donor (Sen and Johnson 1999;Sanchez-´ of microbial ecology (e.g. Johnson et al. 2001; Fishbain et al. 2003; Andrea et al. 2015). This SRB is an ‘incomplete oxidiser’ and Meyer-Dombard 2005; Burgess et al. 2012; Chernyh et al. 2015; produces equimolar amounts of acetic acid when growing on Mardanov et al. 2018) and isolation of acidophilic/acid-tolerant glycerol as electron donor, though in co-culture with the type SRB (Frolov et al. 2016, 2017, 2018). Other studies related to vol- strain of Acidocella aromatica (Jones, Hedrich and Johnson 2013), canic areas were conducted at the Tans-Mexican volcanic belt the acetic acid was oxidised to CO2 and the mixed culture was (Souza Brito et al. 2014; Medrano-Santillana et al. 2017; Prieto- consequently able to grow at lower pH than pure cultures of D. Barajas et al. 2018), Narugo hot spring in Japan (Mori et al. 2003) acididuransT (Kimura et al. 2006). Another acid-tolerant SRB Desul- and geothermal water from a gold mine in Japan (Hirayama et al. fosporosinus sp. strain GBSRB4.2, able to grow at pH 4.8, was iso- 2005) among others. lated by Senko et al. (2009) in sediments from a coal mine, which The geothermal Copahue-Caviahue (GCC) system is a vol- could reduce sulfate, iron(III), manganese(IV) and uranium (VI). canic extreme environment located in the north west of Also, Alazard et al. (2010) described a novel species, Desulfosporos- Neuquen´ province, Argentina (Fig. 1). Copahue volcano (37◦51S, inus acidiphilus, isolated from an acidic mining effluent decanta- 71◦10.2 W), 2977 m.a.s.l., is an andesitic stratovolcano with a tion pond sediment. This species was demonstrated to be a small acidic crater lake. Its activity dominates the biogeochem- moderately acidophile, with an optimum at pH 5.2. Rowe et al. istry of the environment, which is characterised by wide ranges (2007) reported that SRB other than Desulfosporosinus species, of temperature and pH (<1–8) and the presence of heavy metals Willis et al. 3 Downloaded from https://academic.oup.com/femsec/article-abstract/95/12/fiz175/5610214 by Universidad San Sebastian user on 31 March 2020

Figure 1. Locations of the geothermal fields within the Copahue geothermal system and sampling points (indicated with black arrows):aquinas LasM´ (LMa), Las Maquinitas (LMi), Bano˜ 9 (B9–2 and B9–3) and Agua del Limon´ (AL). Other sample points indicated in the map, belonging to the Rio Agrio, were not included in this study (Chiacchiarini et al. 2010).

(Chiacchiarini et al. 2010). This volcanic area has been subject elevated temperatures around 92 ± 2◦C in the thermal ponds. to studies of geology, geochemistry, volcanism and hydrother- Some visible sulfur deposits were observed in the coldest walls apy over the last decades (Varekamp 2004;Pedrozoet al. 2008; of the ponds. In recent years, this area has suffered several Agusto et al. 2013; Chiodini et al. 2015; Roulleau et al. 2016). Most human impacts as its sediments are used for health treatments. investigations on ecology, biodiversity and microbiology in this Copahue village is the biggest thermal spring at Copahue system geothermal environment are relatively recent. Some of these and has been greatly affected by infrastructure works during the have been focused on the isolation and characterization of the construction of the village. The area comprises the therapeutic aerobic, acidophilic iron- and sulfur- oxidizing microorganisms thermal complex, the section called Bano˜ 9 (B9) and Agua del (e.g. Acidithiobacillus ferrooxidans, Acidithiobacillus thiooxidans) due Limon (AL), among other thermal springs. The area is of inter- to their potential applications in biomining processes (Lavalle est due to its wide range of pH (2–7) and temperature (15–90◦C), et al. 2005; Chiacchiarini et al. 2010; Giaveno et al. 2013;Urbieta and CO2 and H2S emanate from several ponds and hot springs et al. 2014, 2015; Castro and Donati 2016). However, few stud- within it (Varekamp 2004;Pedrozoet al. 2008; Chiacchiarini et al. ies have been previously carried out with anaerobic sediments 2010; Chiodini et al. 2015). from Copahue volcano and these have tended to be restricted to At these sites, sediment samples were collected from five dif- water and sediments from the Rio Agrio and the recipient lake ferent acidic hot springs (Table 1), AL1, LMa2, LMi, B9–2 and B9–3, Caviahue (Wendt-Potthoff and Koschorreck 2002; Koschorreck et referred to in the geothermal location described above. In gen- al. 2003) and neutrophilic SRP (Chiacchiarinni et al. 2010), even eral, the water layer in the hot springs was approximately 10 cm though most of the geothermal ponds have extremely low pH deep and sediments below were collected in sterile polypropy- values. lene bottles to avoid evaporation and the entry of oxygen. Sam- The general aim of this study was to demonstrate the pres- ples were kept at 4◦C until processing on return to the labora- ence of SRB with the ability to grow at low pH values. The cur- tory. Water samples were also collected and filtered through 0.22 rent study focused on the enrichment, isolation and identifica- μm (pore size) cellulose acetate membrane filters (Millipore) to tion by 16S rRNA sequencing of SRB from the anaerobic zones of determine sulfate and metal concentrations. Copahue-Caviahue areas.

MATERIALS AND METHODS Enrichment and isolation Site description and sampling To obtain active sulfidogenic consortia at acidic pH conditions, five sediment samples from Copahue volcano were inoculated Three sampling points were chosen for this study, represent- into specific liquid medium. The growth medium was prepared ing different geothermal fields within the Copahue system and sparged with nitrogen to displace oxygen, autoclaved at (indicated by arrows in Fig. 1): Las Maquinas,´ Las Maquinitas 121◦C for 20 minutes and dispensed into sterile 50 mL flasks. and Copahue village. Las Maquinas´ (LMa) presents a temper- Sediment samples were added to the flasks (approximately in ature ∼40 ± 2◦CandpH∼3 and was selected for its physic- a 1:3 ratio), which were then sealed. Cultures were incubated ochemical conditions but also for being the site less affected at 30◦C for 30 days using the AnaeroGen system (Oxoid, UK) by infrastructure and anthropogenic activities. Las Maquinitas to create an anaerobic environment. The growth medium con- (LMi) is the smallest thermal spring at Copahue system and has tained: 3 mM glycerol (as electron donor), 0.1 g/L yeast extract, 4 FEMS Microbiology Ecology, 2019, Vol. 95, No. 12

Table 1. Physicochemical parameters of Copahue samples determined in situ, dissolved iron concentration (mM) and in sediments (mg/g of dry sample).

Fe Sediment 2- SO4 Sulfide (mg/g dry Water Site Sample Location pH T [◦C] E’[mV] (mM) (mM) DOa TOC (%)b Humidity (%) sample) (mM) Downloaded from https://academic.oup.com/femsec/article-abstract/95/12/fiz175/5610214 by Universidad San Sebastian user on 31 March 2020 Bano˜ 9 B9 (2) 37◦49’0.20’’S 5.1 57 -131 16.87 ND ND 0.8 63 16.8 0.26 71◦5’50.41’’W B9 (3) 37◦49’0.87’’S 5.1 67 -290 15.10 ND ND 1.0 42 40.0 0.23 71◦5’50.46’’W Las LMi 37◦49’0.9’’S 5.2 90 -126 31.35 0.020 0.60 0.7 47 26.3 2.14 Maquinitas´ 71◦5’12’’W Las LMa2 37◦50’2.61’’S 3.0 38 -70 15.31 0.028 1.0 0.8 69 22.1 0.31 Maquinas´ 71◦5’3.20’’W Agua del AL1 37◦49’0.13’’S 2.1 41 -200 27.39 0.011 0.30 2.2 53 25.3 0.25 Limon´ 71◦5’36.18’’W

ND: not determined aDO: Dissolved Oxygen bTOC: Total Organic Carbon (determined in 0.1 g of sediment corrected with humidity)

4mMZnSO4, 100 μMFeSO4,5mMK2SO4, basal salts and trace For all analytical measurements, samples were filtered elements (Nancucheo˜ et al. 2016), and was adjusted to pH 3.0. through 0.22 μm (pore size) cellulose acetate membranes.

FeSO4 and ZnSO4 were added from 1M stock solutions pre- Sulfate was determined by turbidimetry using a Beckman DU pared from the heptahydrate salts. Sulfate reducing activity was 640 spectrophotometer (Fullerton, CA, USA) at 450 nm (Green- determined by measuring differences in concentrations of glyc- berg et al. 1985). Glycerol was determined by an enzymatic colori- erol, sulfate and acetic acid at the beginning and after 1 month metric method using a commercial kit (TG color, Wiener Lab) fol- of incubation. The formation of off-white precipitates (ZnS), lowing the manufacturer’s instructions. Concentrations of acetic changes to pH and microscopic confirmation of the presence of acid were measured by high performance liquid chromatogra- microorganisms were also used as indicators of SRB activity. phy (Waters 1525) equipped with a Diode Array Detector (Waters Isolation of acidophilic SRB from the enrichment cul- 2996) at 210 nm and a PRP-X300 column (Hamilton) at room tures was performed by streaking liquid samples from enrich- temperature. Sulfuric acid (0.5 mM) was used as mobile phase ment onto the overlay medium described by Nancucheo˜ et al. (2.0 mL/min). Concentration of transitions metals (in both acid (2016) and incubated anaerobically (AnaeroGen system) at digestion and water samples) were measured using an atomic ◦ 30 C. Colonies were purified by repeated single colony isola- absorption spectrophotometer (Shimadzu AA-6650, Shimadzu tion. Cells were resuspended in 0.05 M NaOH and 0.25% SDS Corporation, Kyoto, Japan). at 90◦C for 20 minutes, and 16S rRNA genes amplified and sequenced. Colonies were inoculated into 3 mL liquid medium and analysed for glycerol and sulfate consumption and acetate Microscopic observations production. Bacterial morphology in enrichment cultures was investigated by using an optical microscope with phase contrast. Fluores- cence in situ hybridisation (FISH) was performed for rapid iden- Chemical analysis tification of cultures at domain level. For this, 1 mL of each enrichment culture was centrifuged at 2000–3000 rpm to remove At each sampling point, redox potential (E’) and pH values were metal sulfides. Fixation of samples was performed as described measured in situ using a multiparameter Hanna HI 8424 meter by Urbieta et al. (2015) and hybridizations as described by Amann coupled to a HI 1043 pH electrode and a combination redox (1995) with CY3-labelled probes for the Bacteria domain EUB338 potential electrode with an integral Ag/AgCl reference. Dissolved (5 GCTGCCTCCCGTAGGAGT 3; Amann et al. 1990)andArchaea oxygen (DO) concentrations in the water in contact with sedi- domain (5 GTGCTCCCCCGCCAATTCCT 3; Stahl and Amann ments was determined using a JPB-607A portable DO analyser 1991). Pure cultures of Desulfovibrio vulgaris DSM 644 and Acid- (Hinotek, China), and sulfide was measured with a Hach DR-850 ianus copahuensis DSM 29038 were used as positive controls for equipment using the methylene blue technique-equivalent to − Bacteria and Archaea, respectively. Samples were observed with USEPA method 376.2 or Standard Method 4500-S2 D (Greenberg an epifluorescence microscope (Leica 2500) and images were et al. 1985). Total Organic Carbon (TOC), heavy metals and water taken using a Leica DFC 300 FX camera and its corresponding content in sediments were determined in duplicate. Water con- ◦ software (Leica Microscopy Systems Ltd., Heerbrugg, Switzer- tent was determined by weight loss at 105 Cwhendrying1g land). of sample. TOC was determined by oxidation of 6 g of sediment with potassium dichromate in acidic conditions according to the Walkley–Black procedure (Schumacher 2002). Heavy metals were 16S rRNA gene analysis measured according to the USEPA method 3050 B, using approximately 2 g of wet sediment. The amount of transition metals DNA was extracted from each of the sulfidogenic cultures in sediments, expressed in milligram of metal per grams of dry using the Ultra–CleanTM Soil DNA Isolation Kit (MoBio Labora- sample, was calculated then using the water content determine tories, USA) according to the manufacturer’s instruction. The for each sample. starting material was prepared by filtering 5.0 mL of each Willis et al. 5

culture through 0.22 um cellulose acetate membranes and the Table 2. Stoichiometry of glycerol oxidised and sulfate reduced in low filters used for DNA extraction. The 16S rRNA genes were ampli- pH enrichment cultures (acetic acid was not detected in any of the fied by PCR as previously described (Okibe et al. 2003) using experiments). the universal bacterial primers 27F-CM (5 AGAGTTTGATCMTG- Enrichment Glycerol Sulfate reduced ZnS/ H S GCTCAG 3) and 1387R (5GGGCGGWGTGTACAAGGC 3)and 2 culture oxidised (mM) (mM) generation archaeal primers A-21F (5 TTCCGGTTGATCCYGCCGGA 3)and 915R (5 GTGCTCCCCCGCCAATTCCT 3 ). The PCR products were AL1 2.3 4.2 + checked by electrophoresis on 1% agarose gel. B9–2 2.5 4.4 + Downloaded from https://academic.oup.com/femsec/article-abstract/95/12/fiz175/5610214 by Universidad San Sebastian user on 31 March 2020 16S rRNA gene clone libraries were constructed to analyse B9–3 2.2 3.9 + the microbial composition of the sulfidogenic consortia. Positive LMa2 2.2 3.7 + PCR products from each enrichment culture (pooled from three LMi 2.4 4.2 + independent reactions) were purified using the Ultra CleanR PCR Clean-Up Kit (MOBIO Laboratories) and ligated using the pGEM-T Easy Vector System (Promega, USA). Before cloning samples contained relatively high sulfate and low dissolved DNA concentration of PCR products was determined using the sulfide concentrations in the water in contact with sediments. NanoDrop 2000 (Thermo Fisher Scientific). The resulting liga- Furthermore, TOC results showed low values of organic mat- tion products were transformed into Escherichia coli strain DH5α ter (in general lower than 2%) compared to those reported for according to the manufacturer’s instructions. For each library, other volcanic environments with similar characteristics (Lan- 32 white colonies were randomly picked and selected for the tican et al. 2011). Iron was the only metal present in both water correct insert size by colony PCR with vector primers, resulting and sediments in relatively high concentrations (16–40 mg/g dry in 30 clones with the correct insert size per sample. The plas- sample). mid from each of these clones was purified using the Concert Rapid miniprep system (Life Technologies) and DNA inserts were subjected to restriction fragment length polymorphism (RFLP) Sulfate reduction at acidic pH in enrichment from analysis, using the restriction enzymes MspI and CfoI to deter- Copahue mine the number of different 16S rRNA genes that had been cloned. The restriction fragment length polymorphism analy- Sulfate-reducing activity was detected in cultures at low pH in all sis revealed five restriction pattern groups, and 14 clones were sediments from Copahue volcano, as indicated by the formation sequenced in total. Plasmids of at least one or two representa- of ZnS precipitates, detection of H2S odour and consumption of tive clones for each restriction fragment length polymorphism sulfate (26% in AL1 culture, and 33% in LMi culture) and glycerol pattern were sequenced using the primers SP6 and T7 from the (94–99%). The latter were stoichiometric with no accumulation p-GEM-T Easy Vector System. The sequencing reactions were of acetate production (Table 2) suggesting that glycerol was com- performed by Macrogen Inc. (Seoul, Korea). Sequences were pletely oxidised to CO2. According to equation 5 the stoichiom- assembled with preGap and Gap 4 software from Staden Pack- etry between glycerol oxidised (to CO2) and sulfate reduced is age (Bonfield, Smith and Staden 1995) and plasmid sequences 1:1.75, which correlates with the results shown in Table 2. were manually removed using the NCBI VecScreen tool. All sequences were checked for chimeras using the online analysis + 2− + + → + + 4C3 H8 O3 7SO4 7H 12CO2 7H2 S 16H2 O (5) Bellerophon (Huber et al. 2004). The taxonomic identification of the sequences was performed using the public databases SILVA, EzBioCloud and GenBank (Altschul et al. 1997;Quastet al. 2013; Microscopic observations showed that enrichment cultures Yoon et al. 2017). MEGA 6 was used to establish the phylogenetic consisted mostly of rod-shaped and spore-forming bacteria with affiliations of the 16S rRNA gene sequences from SRB isolates ellipsoidal spores causing the swelling of the cells, as common (Tamura et al. 2013). A consensus tree was generated, and boot- features of the enrichment cultures. Other bacterial morpholo- strap analysis was performed. gies, including smaller bacilli, were also detected in smaller numbers in all cultures, indicating the existence of mixed populations. FISH analysis revealed that in all enrichment cultures RESULTS all cells stained with DAPI showed positive hybridisation with Characteristics and physicochemical analysis of the Bacteria-specific probe. In contrast, no hybridisation was detected when the Archaea-specific probe was used, indicating Copahue hot springs that enrichment cultures where dominated by Bacteria (see Sup- The main physicochemical characteristics of sediment and plementary Material Figure S1, Supporting Information). Other water samples, and concentrations of transition metals in water cultures showed similar hybridisation efficiency. samples, are shown in Table 1. Total soluble Cu, Pb, Ni and Cr were measured in water in contact with sediments, but Phylogenetic identification of clones from Copahue their concentrations were below the detection limits (0.02; 0.5; sulfidogenic enrichment cultures 0.05; 0.06 mg/L, respectively) of atomic absorption spectropho- tometry. The samples were found to be acidic (AL1 and LMa2) None of the enrichment cultures showed positive results when to moderately acidic (LMi, B9–2 and B9–3) suggesting that the Archaea-specific primers were used, which correlates with neg- microbial communities present might be resistant or toler- ative Archaea FISH hybridisation. On the other hand, positive ant to acidic conditions. Temperatures varied from mesophilic amplification with Bacteria-specific primers was achieved with (LMa2 and AL1 samples) to moderately thermophilic and DNA extracted from enrichment cultures. The distribution and hyperthermophilic conditions (B9–2, B9–3 and LMi samples). percentage of taxonomic units of each clone library were also DO measurements revealed anoxic environments and a highly calculated (Fig. 2). The 16S rRNA gene sequences from all reducing conditions indicated by negative redox potentials. All sulfidogenic cultures were classified into three different phyla: 6 FEMS Microbiology Ecology, 2019, Vol. 95, No. 12 Downloaded from https://academic.oup.com/femsec/article-abstract/95/12/fiz175/5610214 by Universidad San Sebastian user on 31 March 2020

Figure 2. Relative abundance of 16S rRNA genes from enrichment cultures originated from Agua del Limon´ (AL1), Las Maquinas´ (LMa2), Las Maquinitas (LMi) and Bano˜ 9 (B9–2, B9–3) hot spring sediments. Light grey bars correspond to Sulfobacillus clones; dark grey bars correspond to Peptococcaceae bacterium CL4 clones and lined bars corresponds to Alicyclobacillus clones. The affiliation is based on EZBioCloud database.

Firmicutes (Bacilli and Clostridia classes); Thermotogae (Ther- thermophilic bacteria related to Sulfobacillus and Alicyclobacil- motogae class) and Proteobacteria (Gammaproteobacteria class). lus were detected between 13% and 23%. The Acidithiobacil- Although the method (cloning/sequencing) used to describe the lus genus was represented by three distinct species At. bacterial structure and composition provides lower diversity ferriduransT, At. ferriphilus T and At. ferrooxidans T. These bacteria coverage compared to high-throughput sequencing (HTS) meth- are facultatively anaerobic, mesophilic, chemolitho-autotrophic ods, it was possible to identify the sulfate-reducing microorgan- sulfur/iron-oxidisers (some species and strains also oxidise isms in the enrichment cultures and other bacteria present in hydrogen) that have been isolated from acidic environments minor numbers. Moreover, cloning/sequencing approach gener- with moderate temperature values, such as mine-impacted ates longer sequences than the high-throughput sequencing’s waters and geothermal sites (Kelly and Wood 2000; Hedrich and short reads, thereby providing a more robust phylogenetic affil- Johnson 2013;Falagan´ and Johnson 2016). Other sequences in iation (Medrano-Santillana et al. 2017). Biomolecular analysis AL1 and LMa2 enrichment cultures were found to be distantly of the enrichment cultures showed that members of genera related to anaerobic, moderately thermophilic fermentative reported as spore-forming sulfate reducers were found as the bacteria Mesoaciditoga lauensisT and Athalassotoga saccharophilaT dominant bacteria in all enrichment cultures. (Reysenbach et al. 2013;Itohet al. 2016). The closest culti- Sequences distantly related to the genus Desulfitobacterium vated relatives of the sequences retrieved from cultures LMi, dominated the low pH enrichment cultures AL1(83%), LMa2 B9–2 and B9–3 samples were found in a gold-recovery plant (73%), LMi (67%), B9–3 (63%) and B9–2 (80%) (Fig. 2). The clos- (DQ124681), lead-zinc ore (AF137502) and geothermal sites est relative (98% sequence identity) was Peptoccocaceae bac- (AY007662, AY371274, AF450135). The sequences had a high sim- terium strain CL4 (EF061086, ‘Desulfobacillus acidavidus’ strain ilarity to Sulfobacillus thermotolerans Kr1, Alicyclobacillus tolerans CL4) (Table 3). ‘D. acidavidus’ was described as a mesophilic, K1 and unidentified strains that have been tentatively assigned strictly anaerobic, spore-forming bacterium able to metabolise to the genus Alicyclobacillus (Johnson et al. 2001, 2003,Yahya glycerol completely to CO2 coupled to sulfate reduction (John- et al. 2008). Sulfobacillus and Alicyclobacillus are also faculta- son et al. 2009). This metabolism was observed in all enrichment tively anaerobic, acidophilic iron/sulfur oxidizing bacteria, but cultures from Copahue sediments (Table 2). with the ability to grow at higher temperatures than species of The other clones with lower abundance (6–20%) in enrich- Acidithiobacillus genus (20–60◦C and 20–55◦C, respectively) (Kara- ment cultures at low pH were affiliated to Alicyclobacillus, Sul- vaiko et al. 2005;Bogdanovaet al. 2006). fobacillus, Acidithiobacillus (At.) and Athalassotoga/Mesoaciditoga, In view of their metabolic features and the fact that they are the latter with low sequence identity. Members of these gen- present in low relative abundance, the latter groups of microor- era have been identified in natural acidic environments and ganisms would seemingly not be contributing to the sulfidogenic those associated with mining activities and are involved in activity of the enrichment cultures (Fig. 2). However, their pres- the biogeochemical cycling of iron and sulfur. Some differ- ence might be attributable to their ability to grow and resist fac- ences in their distribution among the enrichment cultures were ultative/anaerobic conditions and the fact that they might be observed. Sequences related to Acidithiobacillus and Athalasso- present in the original sample. Bacteria related to Acidithiobacil- toga/Mesoaciditoga (7–13%) were only present in cultures orig- lus, Sulfobacillus and Alicyclobacillus genera have been previ- inating from samples AL1 and LMa2, the ponds with mod- ously detected at geothermal Copahue area (Lavalle et al. 2005; erate temperature similar to the optimal growth tempera- Chicacchiarini et al. 2010;Urbietaet al. 2014). Also, members tures of these genera. In contrast, in enrichment cultures of of Sulfobacillus and Alicyclobacillus form endospores, which can higher temperature ponds, B9–2, B9–3 and LMi, acidophilic, survive in environments with low oxygen conditions (Karavaiko Willis et al. 7

Table 3. Phylogenetic affiliation of sequences from low pH enrichment clones, based on EZBioCloud database.

Top-hit strain; accession no.; % similarity Clone Accession no. (EzBioCloud) Phylogenetic assignment Class, family, genus

AL1ac a1 MK450144 Peptoccocaceae bacterium CL4 (‘D. acidavidus’); Bacteria, Firmicutes, Clostridia, Clostridiales, EF061086; 98% Peptoccocaceae, Desulfitobacterium B9–3ac a8 MK450147 Downloaded from https://academic.oup.com/femsec/article-abstract/95/12/fiz175/5610214 by Universidad San Sebastian user on 31 March 2020 LMa2ac a17 MK450146 B9–2ac a2 MK450143 LMiac a12 MK450145 B9–2ac b3 MK450148 Alicyclobacillus tolerans strain K1T; AF137502; Bacteria, Firmicutes, Bacilli, Bacillales, 99.4% Alicyclobacillaceae, Alicyclobacillus B9–3ac b10 MK450149 LMiac b5 MK450150 LMiac c14 MK450151 Sulfobacillus thermotolerans strain Kr1T; Bacteria, Firmicutes, Clostridia, Clostridiales, DQ124681; 98.1% Family XVII, Sulfobacillus B9–3ac c11 MK450152 AL1ac d6 MK450153 Acidithiobacillus (At.) ferriphilus strain M20T; Bacteria, Proteobacteria, KR905751; 99% At. ferridurans strain ATCC Gammaproteobacteria, Acidithiobacillales, 33020T; AJ278719; 98.9% Acidithiobacillaceae, Acidithiobacillus LMa2ac e4 MK450154 At. ferridurans strain ATCC 33 020T; KR905751; 99.9% At. ferriphilus strain M20T; AJ278719; 99.1% AL1ac f9 MK450155 Athalassotoga saccharophila NAS-01T; AB898788; Bacteria; Thermotogae; Thermotogae c; 94.9% Mesoaciditogales; Mesoaciditogaceae; Athalassotoga LMa2ac f16 MK450156

(T)Type strain et al. 2005;Bogdanovaet al. 2006). To confirm the viability of expense of sulfate reduction, as no acetate was detected after these bacteria, a 10 mL aliquot of each enrichment culture was cultivation on liquid medium at pH 3.0. All isolates were closely incubated under aerobic conditions (at 30◦Cand45◦C) using related to Peptoccoaceae bacterium strain CL4 (EF061086, ‘D. aci- sulfur and iron as energy source (Johnson 1995). A decrease in davidus’; 99% 16S rRNA gene sequence similarity) (Fig. 3). These pH was observed, confirming sulfur oxidation. The 16S rRNA results support those found in enrichment cultures with culture- gene sequences retrieved from these cultures, using the same independent techniques, where Peptoccoaceae bacterium strain methodology described for anaerobic enrichment, showed sim- CL4 was implicated to be the main bacterium to be responsible ilar sequences to the ones previously described (see Supple- for sulfate reduction. mentary Material Table 1, Supporting Information). On the other hand, in cultures from samples AL1 and LMa2 some sequences (6–13.3%, Fig. 2) were only remotely related to the DISCUSSION recently described Athalassotoga/Mesoaciditoga genera. The only two species described for these genera were found to be mod- It is generally assumed, that exposure to low pH leads to the erately thermophilic (30–60◦C), acid-tolerant, heterotrophic and establishment of a tolerant and resistant microbial popula- anaerobic bacteria, able to use sulfur compounds as electron tion. However, very few acidophilic SRP have been described acceptor and metabolise a variety of complex organic com- despite of the facts that sulfate is usually present in elevated pounds as carbon and energy sources (Itoh et al. 2016; Reysen- concentrations in extremely acidic environments. A previous bach et al. 2013). In addition, species related to the Thermotogae study performed in sediments at the naturally acidified (pH 1.8) phylum were not detected in previous studies from Copahue glacial lake Caviahue at the geothermal Copahue system (Fig. 1) volcano but are widespread in many anaerobic environments found high sulfate consumption and sulfide production at low such as hydrothermal vents, marine sediments and terrestrial pH values, predicting that microbial sulfate reduction occurs in hot springs, among others (Tobler and Benning 2011; Souza Brito this ecosystem (Koschorreck et al. 2003). However, until now et al. 2014), and therefore they might also be present in the orig- no studies focused on the isolation of acidophilic/acid-tolerant inal sediments samples. The low sequence similarity to this SRPs. Indeed, the sulfidogenic enrichment cultures and, most taxon suggests the presence of a novel genus in our samples. important, pure cultures of SRBs obtained in this study revealed the existence of viable SRB in several anaerobic sediments from Copahue volcano and based on activity data are likely to be Isolation and phylogenetic identification of sulfidogenic adapted to acidic conditions. This indicates that the sulfidogenic bacteria metabolic process was not adversely affected nor inhibited by the initial low pH. Several isolates were recovered from enrichment cultures of Previous studies reported the enrichment and isolation of all samples on overlay plates at 30◦C: LMa2 E2; LMi H1; B93 E2; acidophilic/acid-tolerant SRB from acidic environments. Rowe B92 C3; AL1 C1. These grew as ZnS-encrusted colonies on over- et al. 2007 found Peptococcaceae bacterium strain CL4 (EF061086) in lay plates and were Gram-positive, spore-forming, rod-shaped acidic sediments from an abandoned copper sulfide mine, which bacteria. All isolates oxidised glycerol completely to CO2 at the was physiologically characterised by Johnson et al. 2009.This 8 FEMS Microbiology Ecology, 2019, Vol. 95, No. 12 Downloaded from https://academic.oup.com/femsec/article-abstract/95/12/fiz175/5610214 by Universidad San Sebastian user on 31 March 2020

Figure 3. Phylogenetic affiliations of the complete 16S rRNA gene sequences (1421 bp) of five sulfidogenic isolates. The consensus phylogeneticed treewasgenerat using MEGA with different sets of filters, which showed stable branching. Maximum Likelihood was used as the statistical method and five hundredplicates bootstrapre were performed. The bar indicates a 10% estimated sequence divergence, and Bacillus methanolicus strain NCIMB 13113 was used to root the tree. The sequences from the isolates are indicated in boldface type and light grey colour. Designations after the organism names or identifiers are GenBank accession numbers. isolate was distantly related to Desulfitobacterium acidophilic sulfate reducing strains described above were also aromaticivoransT and Desulfosporosinus acidophilusT,there- isolated from natural environments or engineered systems at fore was proposed as a new genus and specie: ‘D. acidavidus’. low pH and low organic matter content: 2.65–2.75 for strain CL4, Later, Sanchez- Andrea et al. (2013) reported the isolation of a 3.2 for isolate I-I and 2.4 for strain CEB3. Among the closest sulfate-reducing bacterium (isolate I-i) in Tinto River natural cultivated relatives from our isolates, Peptococcaceae bacterium acid rock drainage. This isolate clustered into a group without CL4 is more acidophilic (capable of growing in pure culture in close representatives and the closest sequence belongs to the pH 3.0 liquid media; Johnson et al. 2009)thanDesulfosporosinus clone HQ730640 retrieved in a former study of Tinto River acididuransT (optimum pH 5.5; Sanchez- Andrea et al. 2015). sediments (Sanchez-Andrea et al. 2011). Moreover, strain CEB3 Although not fully characterised Peptococcaceae bacterium CEB3 isolated by Nancucheo and Johnson (2012) from an acidic appears to be more thermotolerant rather than mesophilic sulfidogenic bioreactor treating mine water (pH 2.4) was also SRB and was found to be dominant in a bioreactor operating classified into Peptococcaceae family. From the latter, it can be at 40◦C and pH 4.0 (Santos and Johnson 2018). Therefore, one suggested that all these isolates, including the ones obtained of the reasons that Copahue Peptococcaceae bacterium-solates in this study, could form a distinct taxon of acidophilic/acid could thrive in Copahue ponds rather than for example Desul- tolerant SRB positioned between Desulfosporosinus and Desulfi- fosporosinus acididuransT, is because of their capability to grow tobacterium genera. The sequences and isolates retrieved from at higher temperatures and lower pH values. Bioremediation our study have the same 16S rRNA sequence similarity with of acidic, metal-contaminated waters using acidophilic SRPs is cultivated species of Desulfitobacterium than those found in attractive due to the possibility to avoid a neutralization step to the studies mentioned above, therefore falling into the same contact the acidic mine water with neutrophilic SRPs. Since D. taxon (Table 2 and Fig. 3). Moreover, BLAST analysis performed acididuransT is an incomplete oxidiser of glycerol, condition not with 16SrRNA sequences from SRB isolates from this study desirable in a bioremediation context as less electrons are avail- shows that they have 97% sequence similarity with clone able for sulfate reduction and acetic acid generated increases HQ730640. To our knowledge, this study is the first report of the chemical demand of water discharged from the process. this acidophilic/acid-tolerant group of SRB in an acidic volcanic Therefore, the fact of obtaining acidophilic SRPs (related to Pep- environment. Other studies performed in acidic pools of the toccoaceae bacterium strain CL4) from different global locations volcanic area of Kamchatka Peninsula regarding microbial and with the ability to oxidise completely glycerol is crucial and ecology or isolation of SRB have found sequences or acidophilic expand the sources to find acidophilic SRPs. On the other hand, SRB isolates related with Thermodesulfobium, Thermodesulfovibrio, the use of SRPs in MESs to treat mine-impacted waters at low pH Desulfobaba and Desulfothermobacter genera (Burgess et al. 2012; and generate energy has not been widely investigated. Recently, Frolov et al. 2016, 2017, 2018), which are phylogenetically very Pozo et al. (2016, 2017) described the removal of sulfate from acid distant from our SRB. mine drainage using neutrophilic SRPs in a bioelectrochemical Some of the ponds from Copahue volcano, where cell with a previous neutralization step. The tolerance to acidic acidophilic/acid-tolerant SRB were isolated in this study, conditions of the SRPs from Copahue volcano obtained in this present low pH values (Agua del Limon´ pH 2.1 and Las work, make them candidates for implementing a MES where Maquinas´ pH 3.0) and low organic matter content. All the operational costs of neutralization steps will be avoided. Willis et al. 9

The presence of Peptococcaceae bacterium CL4- related species source of novel anaerobic species, which require further isola- in high temperature ponds could be associated with their ability tion and characterization. The sulfate-reducing bacteria SRB iso- to form endospores. However, the existence of other acidophilic lated in the present study have potential applications in biore- SRP able to grow at extreme temperatures is not excluded, since mediation processes, especially those related with the treat- the enrichment cultures and isolation in this study were set ment of mine-impacted waters and energy generation in MESs. up at 30◦C while most samples had higher in situ tempera- This study is the first report of the microbial exploration ofthe tures. Also, the use of glycerol as the only electron donor could anaerobic zones of Caviahue-Copahue geothermal system and have been limited the range of SRP able to grow autotroph- gives more insights in the field of SRPs thriving this type of envi- Downloaded from https://academic.oup.com/femsec/article-abstract/95/12/fiz175/5610214 by Universidad San Sebastian user on 31 March 2020 ically. For example, Frishbain et al. (2003) enriched SRB from ronments.

Yellowstone hot springs using acetate and/or H2 as electron donors. Bacteria detected includes Desulfobacula, Desulfotomac- ulum and Desulfomicrobium genera, who are known to be neu- DATA AVAILABILITY trophilic rather than acidophilic/acid—tolerant bacteria (Rabus Sequencing data have been submitted to GenBank: The 16S et al. 2015). Moderately thermophilic, chemolitho-autotrophic rRNA gene sequences determined for the isolates are deposited and acidophilic/acid-tolerant SRMs of the genera Thermodesul- under accession numbers: KT952395, KT952393, MK733921, fobium and Desulfothermobacter have recently been isolated and MK733922, MK733923. The 16S rRNA gene sequences deter- detected in acidic thermal springs and mud pools (Souza Brito mined in the clone libraries are deposited under accession num- et al. 2014;Frolovet al. 2017, 2018). bers: MK450143-MK450156 and MN453463-MN453469 (Supple- In the study performed by Urbieta et al. (2014) a prelimi- mentary Material, Supporting Information). nary geomicrobiological model of sulfur metabolism operating in the upper zones of Copahue hot springs was outlined. Aci- dophilic, sulfur-oxidizing bacteria of the genus Acidithiobacil- SUPPLEMENTARY DATA lus and Thiomonas and archaea related to Sulfolobus and A. copahuensisT were postulated to have key roles in aerobic sul- Supplementary data are available at FEMSEC online. fur and carbon cycles. Based on results obtained by culture- dependent approaches and the related metabolisms described, sulfate-reducers and other anaerobic bacteria reported in this ACKNOWLEDGEMENTS study also contribute to these cycles via their anaerobic sulfur Willis G, Giaveno A and Donati E want to specially thank to EPRO- and carbon metabolisms. Elemental sulfur and other reduced TEN and Direccion´ de Areas´ Naturales Protegidas of Neuquen´ sulfur compounds (S O 2− and SO 2−), which are present in con- 2 3 3 province for the authorization and collaboration in accessing siderable amounts in Copahue hot springs due to continuous to the sampling sites. Willis G. wants to specially thank to Inti volcanic activity and microbial sulfur oxidation (Chiacchiarini Gadda, Federico Giagante and Camila Castro for their contribu- et al. 2010), could serve as electron acceptors under anaerobic tion in processing the images. conditions for many of the microbial species in the environment. Sulfate reduction might be carried out by SRB, such as ‘Desulfobacillus’, due to their presence and isolation from acidic FUNDING pH cultures originating from sediments. On the other hand, other obligate anaerobes able to reduce elemental sulfur (but not This work was supported by the Agencia Nacional de Pro- sulfate) have also been detected: Athalassotoga/Mesoaciditoga- mocion´ Cient´ıficayTecnologica´ (ANPCyT), Argentinian Govern- related species may reduce elemental sulfur under anoxic con- ment [Grant Numbers PICT 2012 0623, PICT 2013 0630 and PICT ditions. These bacteria can also ferment or respire complex 2015 0463] and Consejo Nacional de Investigacion´ Cient´ıfica y organic matter, generating a pool of intermediates that can be Tecnica´ (CONICET), Argentinian Government. act as substrates for the metabolism of SRB (Reysenbach et al. Conflicts of interest. None declared. 2013;Itohet al. 2016). Furthermore, chemolithotrophic bacteria related to Acidithiobacillus, Sulfobacillus and Alicyclobacillus may act as primary producers contributing to the carbon cycle REFERENCES and oxidizing elemental sulfur or sulfide under both aerobic and anaerobic conditions competing with thermophilic archaea Agusto M, Tassi F, Caselli AT et al. Gas geochemistry of the (Urbieta et al. 2014). magmatic-hydrothermal fluid reservoir in the Copahue- Caviahue Volcanic Complex (Argentina). J Volcanol Geoth Res CONCLUSIONS 2013;257:44–56. Alazard D, Joseph M, Battaglia-Brunet F et al. Desulfosporosinus Several studies have been carried out at the geothermal acidiphilus sp. nov.: a moderately acidophilic sulfate-reducing Caviahue-Copahue system in Patagonia, Argentina, but rela- bacterium isolated from acid mining drainage sediments. tively few explored its anaerobic zones. As demonstrated in this Extremophiles 2010;14:305–12. study, this extreme environment has great potential for isolation Altschul SF, Madden TL, Schaffer AA et al. Gapped BLAST and of anaerobic microorganisms, particularly sulfate-reducing bac- PSI-BLAST: a new generation of protein database search pro- teria. The results indicate that sulfidogenic bacteria can thrive grams. Nucleic Acids Res 1997;25:3389–402. under acidic conditions found in hot spring sediments from Amann RI, Binder BJ, Olson RJ et al. Combination of 16S rRNA- Las Maquinas,´ Las Maquinitas and Agua del Limon´ and Bano˜ 9. targeted oligonucleotide probes with flowcytometry for ana- Other anaerobic or facultative anaerobic microorganisms were lyzing mixed microbial populations. Appl Environ Microbiol also detected in enrichment cultures. Considering that some of 1990;56:1919–25. these sequences were distantly related to cultivated species, we Amann RI. In situ identification of microorganisms by whole consider Copahue volcano hot spring sediments to be a potential cell hybridization with rRNA-targeted nuclei acid probes. In: 10 FEMS Microbiology Ecology, 2019, Vol. 95, No. 12

Akkermans ADL, van Elsas JD , de Bruijn FJ (eds). Molecu- Hedrich S, Johnson DB. Acidithiobacillus ferridurans sp. nov., lar Microbial Ecology Manual. Dordrecht, Netherlands: Kluwer an acidophilic iron-, sulfur- and hydrogen- metabolizing Academic Publishers, 1995, 1–15. chemolithorophic gamma proteobacterium. Intl J Syst Evol Aullo¨ T, Ranchou-Peyruse A, Ollivier B et al. Desulfotomaculum Microbiol 2013;63:4018–25. spp. and related gram-positive sulfate reducing bacteria in Hirayama H, Takai EK, Inagaki F et al. Bacterial community shift deep subsurface environments. Front Microbiol 2013;4:1–12. along a subsurface geothermal water stream in Japanese Bogdanova TI, Tsaplina IA, Kondrat’eva TF et al. Sulfobacillus ther- gold mine. Extremophiles 2005;9:169–84. motolerans sp. nov., a thermotolerant, chemolithotrophic bac- Huber T, Faulkner G, Hugenholtz P. Bellerophon; a program to Downloaded from https://academic.oup.com/femsec/article-abstract/95/12/fiz175/5610214 by Universidad San Sebastian user on 31 March 2020 terium. Int J Syst Evol Microbiol 2006;56:1039–42. detect chimeric sequences in multiple sequence alignments. Bonfield JK, Smith KF, Staden R. A new DNA sequence assembly Bioinformatics 2004;20:2317–9. program. Nucleic Acids Res 1995;23:4992–9. Itoh T, Onishi M, Kato S et al. Athalassotoga saccharophila gen. nov., Burgess EA, Unrine JM, Mills GL et al. Comparative geochem- sp. nov., isolated from an acidic terrestrial hot spring, and ical and microbiological characterization of two thermal proposal of Mesoaciditogales ord. nov. and Mesoaciditogaceae pools in the Uzon Caldera, Kamchatka, Russia. Microbiol Ecol fam. nov. in the phylum Thermotogae. Int J Syst Evol Microbiol 2012;63:471–89. 2016;66:1045–51. Castro C, Donati E. Effect of different energy sources on the Johnson DB, Body DA, Bridge TAM et al. Biodiversity of aci- adhesion and bioleaching of a chalcopyrite concentrate by dophilic, moderate thermophiles isolated from two sites in the extremophilic archaeon Acidianus copahuensis. Hydromet- Yellowstone National Park, and their roles in the dissimila- allurgy 2016;162:49–56. tory oxido-reduction of iron.In: Thermophiles: Biodiversity, Ecol- Chernyh NA, Mardanov AV, Gumerov VM et al. Microbial life ogy and Evolution. Reysenbach AL , Voytek A (eds). New York: in Bourlyashchy, the hottest thermal pool of Uzon Caldera, Kluwer Academic/Plenum Publishers, 2001, 23–39. Kamchatka. Extremophiles 2015;19:1157–71. Johnson DB, Jameson E, Rowe OF et al. Sulfidogenesis at low Chiacchiarini P, Lavalle L, Giaveno A et al. First assessment pH by acidophilic bacteria and its potential for the selective of acidophilic microorganisms from geothermal Copahue- recovery of transition metals from mine waters. Adv Mat Res Caviahue system. Hydrometallurgy 2010;104:334–41. 2009;71–73:693–6. Chiodini G, Cardellini C, Lamberti MC et al. Carbon diox- Johnson DB, Okibe N, Roberto FF. et al. Novel thermoaci- ide diffuse emission and thermal energy release from dophilic bacteria isolated from geothermal sites in Yellow- hydrothermal systems at Copahue-Caviahue volcanic com- stone National Park: physiological and phylogenetic charac- plex (Argentina). J Volcanol Geoth Res 2015;304:294–303. teristics. Arch Microbiol 2003;180:60–68. Falagan´ C, Johnson DB. Acidithiobacillus ferriphilus sp. nov.: a fac- Johnson DB. Reductive dissolution of minerals and selective ultatively anaerobic iron- and sulfur- metabolising extreme recovery of metals using iron- and sulfate-reducing aci- acidophile. Int J Syst Evol Microbiol 2016;66:206–11. dophiles. Hydrometallurgy 2012;127–128:172–7. Falagan´ C, Sanchez-Espa´ na˜ J, Johnson DB. New insights into Johnson DB. Selective solid media for isolating and enumerating the biogeochemistry of extremely acidic environments acidophilic bacteria. J Microbiol Meth 1995;23:205–18. revealed by a combined cultivation-based and culture- Jones RM, Hedrich S, Johnson DB. Acidocella aromatica sp. nov.: independent study of two stratified pit lakes. FEMS Microbiol an acidophilic heterotrophic alphaproteobacterium with Ecol 2014;87:231–43. unusual phenotypic traits. Extremophiles 2013;17:841–50. Fishbain S, Dillon JG, Gough HL et al. Linkage of high rates of Karavaiko GI, Bogdanova TI, Tourova TP et al. Reclassification of sulfate reduction in Yellowstone hot springs to unique types ‘Sulfobacillus thermosulfidooxidans subsp. thermotolerans’strain in the dissimilatory sulfate respiration pathway. Appl Environ K1 as Alicyclobacillus tolerans sp. nov. and Sulfobacillus disulfi- Microbiol 2003;69:3663–7. dooxidans Dufresne et al. 1996 as Alicyclobacillus disulfidooxi- Frololov EN, Merkel AY, Pimenov NV et al. Sulfate reduction and dans comb. nov., and emended description of the genus Ali- inorganic carbon assimilation in acidic thermal springs of cyclobacillus. Int J Syst Evol Micr 2005;55:941–7. Kamchatka Peninsula. Microbiology 2016;85:471–80. Kelly DP, Wood AP. Reclassification of some species of Thiobacil- Frolov EN, Kublanov IV, Toshchakov SV et al. Thermodesulfobium lus to the newly designated genera Acidithiobacillus gen. nov., acidiphilum sp. nov., a thermoacidophilic, sulfate-reducing, Halothiobacillus gen. nov. and Thermithiobacillus gen. nov. Int J chemoautotrophic bacterium from a thermal site. Int J Syst Syst Evol Microbiol 2000;50:511–6. Evol Microbiol 2017;67:1482–5. Kimura S, Hallberg KB, Johnson DB. Sulfidogenesis in low pH (3.8 Frolov EN, Zayulina KS, Kopitsyn DS et al. Desulfothermobacter – 4.2) media by a mixed population of acidophilic bacteria. acidiphilus gen. nov., sp. nov., a thermoacidophilic sulfate- Biodegradation 2006;17:57–65. reducing bacterium isolated from a terrestrial hot spring. Int Koschorreck M, Wendt-Potthoff K, Geller W. Microbial sulfate J Syst Evol Microbiol 2018;68:871–5. reduction at low pH in sediments of an acidic lake in Giaveno A, Urbieta MS, Ulloa JR et al. Physiologic versatility Argentina. Environ Sci Technol 2003;37:1159–62. and growth flexibility as the main characteristics of a novel Lantican NB, Diaz MGQ, Cantera JJL et al. Microbial community thermoacidophilic Acidianus strain isolated from copahue of a volcanic mudspring in the Philippines as revealed by 16S geothermal area in argentina. Microb Ecol 2013;65:336–46. rDNA sequence analysis and fluoresce in situ hybridization. Gonzalez´ D, Liu Y, Villa Gomez D et al. Performance of a sulfido- World J Microb Biot 2011;27:859–67. genic bioreactor inoculated with indigenous acidic commu- Lavalle L, Chiacchiarini P, Pogliani C et al. Isolation and charac- nities for treating an extremely acidic mine water. Min Eng terization of acidophilic bacteria from Patagonia, Argentina. 2019;131:370–5. Process Biochem 2005;40:1095–9. Greenberg AE, Trussell RR, Clesceri LS. Standard Methods for Mardanov AV, Gumerov VM, Beletsky AV et al. Microbial diver- the Examination of Water and Wastewater. Washington: APHA- sity in acidic thermal pools in the uzon caldera, Kamchatka. AWWA-WPCF, 1985. Antonie Van Leeuwenhoek 2018;111:35. Willis et al. 11

Medrano-Santillana M, Souza-Brito EM, Duran R et al. Bacterial forming biofilms triggered by mineral precipitation. Environ diversity in fumaroles environments of the paricut´ın vol- Microbiol 2018;20:3717–31. cano, Michoacan´ (Mexico).´ Extremophiles 2017;21:499–511. Sanchez-Andrea´ I, Rodriguez N, Amils R et al. Microbial diversity Meyer-Dombard DR, Shock EL, Amend JP. Archaeal and bacterial in anaerobic sediments at Rio Tinto, a naturally acidic envi- communities in geochemically diverse hot spring of Yellow- ronment with high heavy metal content. Appl Environ Microb stone National Park, USA. Geobiology 2005;3:211–27. 2011;77:6085–93. Mori K, Kim H, Kakegawa T et al. A novel lineage of sulfate- Sanchez-Andrea´ I, Stams AJM, Amils R et al. Enrichment and reducing microorganisms: Thermodesulfobiaceae fam. nov., isolation of acidophilic sulfate-reducing bacteria from Tinto Downloaded from https://academic.oup.com/femsec/article-abstract/95/12/fiz175/5610214 by Universidad San Sebastian user on 31 March 2020 Thermodesulfobium narugense, gen. nov., sp. nov., a new ther- River sediments. Environ Microbiol Rep 2013;5:672–8. mophilic isolate from a hot spring. Extremophiles 2003;7:283– Sanchez-Andrea´ I, Stams AJM, Hedrich S et al. Desulfosporos- 90. inus acididurans sp. nov.: an acidophilic sulfate-reducing Muyzer G, Stams AJM. The ecology and biotechnology of bacterium isolated from acidic sediments. Extremophiles sulphate-reducing bacteria. Nat Rev Microbiol 2008;6:441–54. 2015;19:39–47. Nancucheo I, Johnson DB. Selective removal of transition met- Santos AL, Johnson DB. Design and application of a low pH als from acidic mine waters by novel consortia of acidophilic upflow biofilm sulfidogenic bioreactor for recovering transi- sulfidogenic bacteria. Microb Biotechnol 2012;5:34–44. tion metals from synthetic waste water at Brazilian copper Nancucheo I, Rowe OF, Hedrich S et al. Solid and liq- mine. Front Microbiol 2018;9:1–11. uid media for isolating and cultivating acidophilic and Schumacher B. Methods for the determination of total organic acid-tolerant sulfate-reducing bacteria. FEMS Microbiol Lett carbon in soils and sediments.In: Soils and Sediments.Wash- 2016;363:pii:fnw083. ington DC: U.S. Environmental Protection Agency, 2002. Ni G, Harnawan P, Seidel L et al. Haloalkalophilic microorgan- Sen AM, Johnson DB. Acidophilic sulphate-reducing bacteria: isms assists sulfide removal in a microbial electrolysis cell. J candidates for bioremediation of acid mine drainage. In: Hazard Mat 2018;363:197–204. Amils R, Ballester A. (eds). Biohydrometallurgy and the Envi- Okibe N, Gericke M., Hallberg KB et al. Enumeration and char- ronment Toward the Mining of the 21st Century. Process Metallurgy acterization of acidophilic microorganisms isolated from a 9A. Amsterdam: Elsevier, 1999, 709–18. pilot plant stirred tank bioleaching operation. Appl Environ Senko JM, Zhang G, Mc Donough JT et al. Metal reduction at Microbiol 2003;69:1936–43. lowpHbyaDesulfosporosinus species: implications for the Pedrozo FL, Temporetti PF, Beamud G et al. Volcanic nutri- biological treatment of acid mine drainage. Geomicrobiol J ent inputs and topic state of Lake Caviahue, Patagonia, 2009;26:71–82. Argentina. J Volcanol Geoth Res 2008;178:205–12. Souza Brito EM, Villegas-Negrete N, Sotelo-Gonzalez´ IA Pozo G, Jourdin L, Lu Y et al. Cathodic biofilm activates electrode et al. Microbial diversity in Los Azufres geothermal field. surface and achieves efficient autotrophic sulfate reduction. Extremophiles 2014;18:385–98. Electrochim Acta 2016;213:66–74. Stahl DA, Amann R. Development and application of nucleic acid Pozo G, Pongy S, Keller J et al. A novel bioelectrochemical sys- probes. In: Stackebrandt E , Goodfellow M . (eds). Nucleic Acid tem for chemical-free permanent treatment of acid mine Techniques in Bacterial Systematics. Chichester: John Wiley & drainage. Water Res 2017;126:411–20. Sons Ltd., 1991, 205–48. Prieto-Barajas CM, Alcaraz LD, Valencia-Cantero E et al. Life in Tamura K, Stecher G, Peterson D et al. MEGA6: Molecular hot spring microbial mats located in the Trans-Mexican vol- Evolutionary Genetics Analysis version 6.0. Mol Biol Evol canic belt: A 16S/18S rRNA gene and metagenomic analysis. 2013;30:2725–9. Geomicrobiol J 2018;35:704–12. Tobler DJ, Benning LG. Bacterial diversity in five Icelandic Quast C, Pruesse E, Yilmaz P et al. The SILVA ribosomal RNA gene geothermal waters: temperature and sinter growth rate database project: improved data processing and web-based effects. Extremophiles 2011;15:473–85. tools. Nucl Acids Res 2013;41:D590–6. Tuttle JH, Dugan PR, Randles CI. Microbial dissimilatory sulfur Rabus R, Venceslau SS, Wohlbrand¨ L et al. A post-genomic view cycle in acid mine water. J Bacteriol 1969;97:594–602. of the ecophysiology, catabolism and biotechnological rele- Urbieta MS, Gonzalez-Toril E, Giaveno MA et al. Archaeal and bac- vance of sulphate-reducing prokaryotes. In: Poole RK (ed). terial diversity in five different hydrothermal ponds in the Advances in Microbial Physiology. Amsterdam, The Nether- Copahue region in Argentina. Syst Appl Microbiol 2014;37:429– lands: Elsevier, 2015, 55–321. 41. Reysenbach AL, Liu Y, Lindgren AR et al. Mesoaciditoga lauensis Urbieta MS, Gozalez-Toril´ E, Aguilera Bazan A et al. Comparison gen. nov., sp. nov., a moderately thermoacidophilic mem- of the microbial communities of hot springs waters and the ber of the order Thermotogales from a deep-sea hydrothermal microbial biofilms in the acidic geothermal area of Copahue vent. Int J Syst Evol Microbiol 2013;63:4724–9. (Neuquen,´ Argentina). Extremophiles 2015;19:437–50. Roulleau E, Tardani D, Sano Y et al. New insights from noble Varekamp JC. Copahue volcano: a modern terrestrial analog for gas and stable isotopes of geothermal/hydrothermal fluids at the opportunity landing site. EOS 2004;85:401–7. Caviahue-Copahue volcanic complex: Boiling steam separa- Wendt-Potthoff K, Koschorreck M. Functional groups and activ- tion and water-rock interactions at shallow depth. J Volcanol ities of bacteria in a highly acidic volcanic mountain Geoth Res 2016;328:70–83. stream and lake in Patagonia, Argentina. Microb Ecol 2002;43: Rowe OF, Sanchez-Espana˜ J, Hallberg KB et al. Microbial com- 92–106. munities and geochemical dynamics in an extremely acidic, Yahya A, Hallberg KB, Johnson DB. Iron and carbon metabolism metal-rich stream at an abandoned sulfide mine (Huelva, by a mineral-oxidizing Alicyclobacillus-like bacterium. Arch Spain) underpinned by two functional primary production Microbiol 2008;189:305–12. systems. Environ Microbiol 2007;9:1761–71. Yoon SH, Ha SM, Kwon S et al. Introducing EzBioCloud: a taxo- Ruffel¨ V, Maar M, Dammbruck¨ MN et al. Thermodesulfobium nomically united database of 16S rRNA and whole genome sp. strain 3baa, an acidophilic sulfate reducing bacterium assemblies. Int J Syst Evol Microbiol 2017;67:1613–7.