COLQ (NM 005677) Human Untagged Clone – SC303680 | Origene

Total Page:16

File Type:pdf, Size:1020Kb

Load more

OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC303680 COLQ (NM_005677) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: COLQ (NM_005677) Human Untagged Clone Tag: Tag Free Symbol: COLQ Synonyms: CMS5; EAD Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >OriGene sequence for NM_005677 edited TAACTTGACCCTCGCCAGACCCTGGCCAGCATGGTTGTCCTGAATCCAATGACTTTGGGA ATTTATCTTCAGCTTTTCTTCCTCTCTATCGTGTCTCAGCCGACTTTCATCAACAGCGTT CTTCCAATCTCAGCAGCCCTTCCCAGCCTGGATCAGAAGAAGCGTGGTGGCCACAAAGCA TGCTGCCTGCTGACGCCTCCTCCACCACCACTGTTCCCACCACCATTCTTCAGAGGTGGC CGAAGTCCGCTTCTCTCCCCAGACATGAAGAATCTCATGCTGGAACTGGAGACCTCGCAG TCCCCGTGCATGCAAGGCTCGCTAGGCTCCCCTGGGCCTCCCGGCCCCCAGGGTCCACCG GGGCTTCCTGGCAAGACAGGACCAAAGGGAGAAAAGGGGGAGCTTGGCCGACCAGGAAGG AAGGGTAGACCTGGCCCCCCAGGTGTTCCTGGCATGCCTGGGCCCATCGGTTGGCCAGGC CCTGAAGGACCCAGGGGTGAAAAAGGTGACCTGGGTATGATGGGCTTGCCAGGGTCAAGA GGACCAATGGGCTCCAAGGGCTACCCTGGATCCAGAGGGGAAAAGGGATCCAGAGGTGAA AAGGGTGACCTGGGTCCCAAAGGAGAAAAGGGTTTCCCAGGATTTCCTGGAATGTTGGGG CAGAAAGGTGAAATGGGTCCAAAAGGTGAACCTGGGATAGCAGGACACCGAGGACCCACA GGAAGACCAGGAAAACGAGGCAAGCAGGGACAGAAAGGGGATAGTGGAGTTATGGGCCCA CCAGGCAAGCCTGGGCCTTCTGGTCAACCTGGCCGTCCGGGGCCCCCAGGCCCCCCACCT GCAGGACAACTTATAATGGGACCCAAAGGGGAAAGAGGATTTCCCGGGCCTCCAGGAAGA TGTCTTTGTGGACCCACTATGAATGTGAATAACCCTTCCTACGGGGAATCTGTGTATGGG CCCAGTTCCCCGCGAGTTCCTGTGATTTTTGTGGTCAACAACCAGGAGGAGCTTGAGAGG CTGAACACCCAAAACGCCATTGCCTTCCGCAGAGACCAGAGATCTCTGTACTTCAAGGAC AGCCTTGGCTGGCTCCCCATCCAGCTGACCCCTTTCTACCCTGTGGATTACACTGCAGAC CAGCACGGCACCTGTGGGGATGGGCTCCTGCAGCCTGGGGAGGAGTGTGACGACGGTAAC AGCGATGTGGGTGACGACTGCATCCGCTGTCACCGTGCCTACTGTGGAGATGGTCACCGG CATGAGGGTGTGGAGGACTGTGACGGCTCTGACTTTGGCTACCTGACATGCGAGACCTAT CTCCCTGGGTCATATGGAGACCTGCAATGCACCCAGTACTGCTACATCGACTCCACGCCC TGCCGCTACTTCACCTGAGGGCCGTGAGGAGAAGGTGGGCTGCGCCCCACAGAACTGGCA GCAGCTTC Restriction Sites: Please inquire This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 COLQ (NM_005677) Human Untagged Clone – SC303680 ACCN: NM_005677 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). OTI Annotation: The ORF of this clone is found to be a perfect match to NM_005677.2. RefSeq: NM_005677.2, NP_005668.2 RefSeq Size: 3011 bp RefSeq ORF: 1368 bp Locus ID: 8292 UniProt ID: Q9Y215 Protein Families: Druggable Genome, Transmembrane Gene Summary: This gene encodes the subunit of a collagen-like molecule associated with acetylcholinesterase in skeletal muscle. Each molecule is composed of three identical subunits. Each subunit contains a proline-rich attachment domain (PRAD) that binds an acetylcholinesterase tetramer to anchor the catalytic subunit of the enzyme to the basal lamina. Mutations in this gene are associated with endplate acetylcholinesterase deficiency. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (I) encodes the longest protein. This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2.
Recommended publications
  • The First Case of Congenital Myasthenic Syndrome Caused by A

    The First Case of Congenital Myasthenic Syndrome Caused by A

    G C A T T A C G G C A T genes Case Report The First Case of Congenital Myasthenic Syndrome Caused by a Large Homozygous Deletion in the C-Terminal Region of COLQ (Collagen Like Tail Subunit of Asymmetric Acetylcholinesterase) Protein Nicola Laforgia 1 , Lucrezia De Cosmo 1, Orazio Palumbo 2 , Carlotta Ranieri 3, Michela Sesta 4, Donatella Capodiferro 1, Antonino Pantaleo 3 , Pierluigi Iapicca 5 , Patrizia Lastella 6, Manuela Capozza 1 , Federico Schettini 1, Nenad Bukvic 7 , Rosanna Bagnulo 3 and Nicoletta Resta 3,7,* 1 Section of Neonatology and Neonatal Intensive Care Unit, Department of Biomedical Science and Human Oncology (DIMO), University of Bari “Aldo Moro”, 70124 Bari, Italy; [email protected] (N.L.); [email protected] (L.D.C.); [email protected] (D.C.); [email protected] (M.C.); [email protected] (F.S.) 2 Division of Medical Genetics, Fondazione IRCCS Casa Sollievo della Sofferenza, 71013 San Giovanni Rotondo, Italy; [email protected] 3 Division of Medical Genetics, Department of Biomedical Sciences and Human Oncology (DIMO), University of Bari “Aldo Moro”, 70124 Bari, Italy; [email protected] (C.R.); [email protected] (A.P.); [email protected] (R.B.) 4 Neurology Unit, University Hospital Consortium Corporation Polyclinic of Bari, 70124 Bari, Italy; [email protected] 5 SOPHiA GENETICS SA HQ, 1025 Saint-Sulpice, Switzerland; [email protected] 6 Rare Diseases Centre—Internal Medicine Unit “C. Frugoni”, Polyclinic of Bari, 70124 Bari, Italy; [email protected] 7 Medical Genetics Section, University Hospital Consortium Corporation Polyclinic of Bari, 70124 Bari, Italy; [email protected] * Correspondence: [email protected]; Tel.: +39-0805593619 Received: 17 November 2020; Accepted: 15 December 2020; Published: 18 December 2020 Abstract: Congenital myasthenic syndromes (CMSs) are caused by mutations in genes that encode proteins involved in the organization, maintenance, function, or modification of the neuromuscular junction.
  • S41598-021-87168-0 1 Vol.:(0123456789)

    S41598-021-87168-0 1 Vol.:(0123456789)

    www.nature.com/scientificreports OPEN Multi‑omic analyses in Abyssinian cats with primary renal amyloid deposits Francesca Genova1,50,51, Simona Nonnis1,50, Elisa Mafoli1, Gabriella Tedeschi1, Maria Giuseppina Strillacci1, Michela Carisetti1, Giuseppe Sironi1, Francesca Anna Cupaioli2, Noemi Di Nanni2, Alessandra Mezzelani2, Ettore Mosca2, Christopher R. Helps3, Peter A. J. Leegwater4, Laetitia Dorso5, 99 Lives Consortium* & Maria Longeri1* The amyloidoses constitute a group of diseases occurring in humans and animals that are characterized by abnormal deposits of aggregated proteins in organs, afecting their structure and function. In the Abyssinian cat breed, a familial form of renal amyloidosis has been described. In this study, multi‑omics analyses were applied and integrated to explore some aspects of the unknown pathogenetic processes in cats. Whole‑genome sequences of two afected Abyssinians and 195 controls of other breeds (part of the 99 Lives initiative) were screened to prioritize potential disease‑ associated variants. Proteome and miRNAome from formalin‑fxed parafn‑embedded kidney specimens of fully necropsied Abyssinian cats, three afected and three non‑amyloidosis‑afected were characterized. While the trigger of the disorder remains unclear, overall, (i) 35,960 genomic variants were detected; (ii) 215 and 56 proteins were identifed as exclusive or overexpressed in the afected and control kidneys, respectively; (iii) 60 miRNAs were diferentially expressed, 20 of which are newly described. With omics data integration, the general conclusions are: (i) the familial amyloid renal form in Abyssinians is not a simple monogenic trait; (ii) amyloid deposition is not triggered by mutated amyloidogenic proteins but is a mix of proteins codifed by wild‑type genes; (iii) the form is biochemically classifable as AA amyloidosis.
  • Clinical/Scientific Notes

    Clinical/Scientific Notes

    Clinical/Scientific Notes Wei Wang, MD COPY NUMBER ANALYSIS REVEALS A NOVEL decrement without facilitation. Biceps muscle Yanhong Wu, PhD MULTIEXON DELETION OF THE COLQ GENE IN biopsy was without vacuoles, dystrophic changes, Chen Wang, PhD CONGENITAL MYASTHENIA or tubular aggregates. Sanger sequencing for Jinsong Jiao, MD GFPT1, DOK-7,andCOLQ showed only a hetero- 1 / Christopher J. Klein, MD Congenital myasthenic syndrome (CMS) is geneti- zygous variant (IVS16 3A G) in the COLQ cally and clinically heterogeneous.1 Despite a consid- gene, a previously reported mutation but only dele- Neurol Genet terious in homozygous state.4 This variant was in- 2016;2:e117; doi: 10.1212/ erable number of causal genes discovered, many NXG.0000000000000117 patients are left without a specific diagnosis after herited from her father. No genetic diagnosis could genetic testing. The presumption is that novel genes be made at that time (figure). yet to be discovered will account for the majority of We recently developed a targeted NGS panel such patients. However, it is also possible that we are including 21 known CMS genes and applied it to this neglecting a type of genetic variation: copy number patient. Because a copy number variation (CNV) anal- changes (.50 bp) as causal for some of these patients. ysis algorithm (PatternCNV) is incorporated in the bi- Next-generation sequencing (NGS) can simulta- oinformatics evaluation, this panel has a capability of neously screen all known causal genes2 and is increas- detecting nucleotide changes, small insertion/deletions, 3 ingly being validated to have a potential to identify and CNVs. The result from this panel confirmed the 1 / copy number changes.3 We present a CMS case who IVS16 3A G variant and identified a heterozygous did not receive a genetic diagnosis from previous copy number deletion encompassing exons 14 and 15 ; – Sanger sequencing, but through a novel copy number of the COLQ gene ( 1 kb) (figure, A C).
  • Variation in Protein Coding Genes Identifies Information Flow

    Variation in Protein Coding Genes Identifies Information Flow

    bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 1 1 2 3 4 5 Variation in protein coding genes identifies information flow as a contributor to 6 animal complexity 7 8 Jack Dean, Daniela Lopes Cardoso and Colin Sharpe* 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Institute of Biological and Biomedical Sciences 25 School of Biological Science 26 University of Portsmouth, 27 Portsmouth, UK 28 PO16 7YH 29 30 * Author for correspondence 31 [email protected] 32 33 Orcid numbers: 34 DLC: 0000-0003-2683-1745 35 CS: 0000-0002-5022-0840 36 37 38 39 40 41 42 43 44 45 46 47 48 49 Abstract bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 2 1 Across the metazoans there is a trend towards greater organismal complexity. How 2 complexity is generated, however, is uncertain. Since C.elegans and humans have 3 approximately the same number of genes, the explanation will depend on how genes are 4 used, rather than their absolute number.
  • COLQ-MUTANT CONGENITAL MYASTHENIC SYNDROME with MICROCEPHALY: a UNIQUE CASE Sulaiman Bazee Al-Mobarak1, with LITERATURE REVIEW Mohammad A

    COLQ-MUTANT CONGENITAL MYASTHENIC SYNDROME with MICROCEPHALY: a UNIQUE CASE Sulaiman Bazee Al-Mobarak1, with LITERATURE REVIEW Mohammad A

    Case Report • DOI: 10.1515/tnsci-2017-0011 • Translational Neuroscience • 8 • 2017 • 65-69 Translational Neuroscience COLQ-MUTANT CONGENITAL MYASTHENIC SYNDROME WITH MICROCEPHALY: A UNIQUE CASE Sulaiman Bazee Al-Mobarak1, WITH LITERATURE REVIEW Mohammad A. Al-Muhaizea1,2* Abstract 1King Faisal Specialist Hospital & Research Center, Congenital Myasthenic Syndrome (CMS) is a group of inherited neuromuscular junction disorders caused by Riyadh, Saudi Arabia 2Alfaisal University, College of medicine, defects in several genes. Clinical features include delayed motor milestones, recurrent respiratory illnesses Riyadh Saudi Arabia and variable fatigable weakness. The central nervous system involvement is typically not part of the CMS. We report here a Saudi girl with genetically proven Collagen Like Tail Subunit Of Asymmetric Acetylcholinesterase (COLQ) mutation type CMS who has global developmental delay, microcephaly and respiratory failure. We have reviewed the literature regarding COLQ-type CMS and to the best of our knowledge this is the first ever reported association of congenital myasthenia syndrome with microcephaly. Keywords Received 23 January 2017 • COLQ mutant • congenital myasthenic syndrome • microcephaly • Saudi Arabia • pediatrics • Genetics accepted 15 May 2017 Introduction/Literature review decremental EMG response of the compound currents which in turn leads to an overloading muscle action potential (CMAP) on low- of cations at the synaptic space and eventually CMS comprises a heterogeneous group of frequency (2-3 Hz) stimulation, a positive causing endplate myopathy with the loss of rare inherited diseases where neuromuscular response to acetylcholinesterase (AChE) acetylcholine receptors [6]. transmission in the motor plate is compromised inhibitors, an absence of anti-acetylcholine We present here a unique case of COLQ- by one or more of the genetic pathophysiological receptor (AChR) and anti‐muscle specific mutant congenital myasthenic syndrome specific mechanisms [1].
  • COLQ Variant Associated with Devon Rex and Sphynx Feline Hereditary Myopathy

    COLQ Variant Associated with Devon Rex and Sphynx Feline Hereditary Myopathy

    UC Davis UC Davis Previously Published Works Title COLQ variant associated with Devon Rex and Sphynx feline hereditary myopathy. Permalink https://escholarship.org/uc/item/1gq3v10s Journal Animal genetics, 46(6) ISSN 0268-9146 Authors Gandolfi, Barbara Grahn, Robert A Creighton, Erica K et al. Publication Date 2015-12-01 DOI 10.1111/age.12350 Peer reviewed eScholarship.org Powered by the California Digital Library University of California SHORT COMMUNICATION doi: 10.1111/age.12350 COLQ variant associated with Devon Rex and Sphynx feline hereditary myopathy Barbara Gandolfi1, Robert A. Grahn2, Erica K. Creighton1, D. Colette Williams3, Peter J. Dickinson4, Beverly K. Sturges4, Ling T. Guo4, G. Diane Shelton5, Peter A. J. Leegwater6, Maria Longeri7, Richard Malik8 and Leslie A. Lyons1 1Department of Veterinary Medicine and Surgery, College of Veterinary Medicine, University of Missouri – Columbia, Columbia, MO 65211, USA. 2Veterinary Genetics Laboratory, School of Veterinary Medicine, University of California – Davis, Davis, CA 95616, USA. 3The William R. Pritchard Veterinary Medical Teaching Hospital, School of Veterinary Medicine, University of California – Davis, Davis, CA 95616, USA. 4Department of Surgical and Radiological Sciences, School of Veterinary Medicine, University of California – Davis, Davis, CA 95616, USA. 5Department of Pathology, University of California – San Diego, La Jolla, CA 92093, USA. 6Department of Clinical Sciences of Companion Animals, Faculty of Veterinary Medicine, Utrecht University, 3508 TD, Utrecht, The Netherlands. 7Dipartimento di Scienze Veterinarie e Sanita Pubblica, University of Milan, Milan, Italy. 8Centre for Veterinary Education, University of Sydney, Sydney, NSW 2006, Australia. Summary Some Devon Rex and Sphynx cats have a variably progressive myopathy characterized by appendicular and axial muscle weakness, megaesophagus, pharyngeal weakness and fatigability with exercise.
  • COLQ (NM 080539) Human Untagged Clone Product Data

    COLQ (NM 080539) Human Untagged Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC305790 COLQ (NM_080539) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: COLQ (NM_080539) Human Untagged Clone Tag: Tag Free Symbol: COLQ Synonyms: CMS5; EAD Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_080539, the custom clone sequence may differ by one or more nucleotides ATGGTTGTCCTGAATCCAATGACTTTGGGAATTTATCTTCAGCTTTTCTTCCTCTCTATCGTGTCTCAGC CGACTTTCATCAACAGCGTTCTTCCAATCTCAGCAGCCCTTCCCAGCCTGGATCAGAAGAAGCGTGGTGG CCACAAAGCATGCTGCCTGCTGACGCCTCCTCCACCACCACTGTTCCCACCACCATTCTTCAGAGGTGGC CGAAGTCCGGGTCCACCGGGGCTTCCTGGCAAGACAGGACCAAAGGGAGAAAAGGGGGAGCTTGGCCGAC CAGGAAGGAAGGGTAGACCTGGCCCCCCAGGTGTTCCTGGCATGCCTGGGCCCATCGGTTGGCCAGGCCC TGAAGGACCCAGGGGTGAAAAAGGTGACCTGGGTATGATGGGCTTGCCAGGGTCAAGAGGACCAATGGGC TCCAAGGGCTACCCTGGATCCAGAGGGGAAAAGGGATCCAGAGGTGAAAAGGGTGACCTGGGTCCCAAAG GAGAAAAGGGTTTCCCAGGATTTCCTGGAATGTTGGGGCAGAAAGGTGAAATGGGTCCAAAAGGTGAACC TGGGATAGCAGGACACCGAGGACCCACAGGAAGACCAGGAAAACGAGGCAAGCAGGGACAGAAAGGGGAT AGTGGAGTTATGGGCCCACCAGGCAAGCCTGGGCCTTCTGGTCAACCTGGCCGTCCGGGGCCCCCAGGCC CCCCACCTGCAGGACAACTTATAATGGGACCCAAAGGGGAAAGAGGATTTCCCGGGCCTCCAGGAAGATG TCTTTGTGGACCCACTATGAATGTGAATAACCCTTCCTACGGGGAATCTGTGTATGGGCCCAGTTCCCCG CGAGTTCCTGTGATTTTTGTGGTCAACAACCAGGAGGAGCTTGAGAGGCTGAACACCCAAAACGCCATTG CCTTCCGCAGAGACCAGAGATCTCTGTACTTCAAGGACAGCCTTGGCTGGCTCCCCATCCAGCTGACCCC
  • Gene Expression Changes in the Ventral Tegmental Area of Male Mice with Alternative Social Behavior Experience in Chronic Agonistic Interactions

    Gene Expression Changes in the Ventral Tegmental Area of Male Mice with Alternative Social Behavior Experience in Chronic Agonistic Interactions

    International Journal of Molecular Sciences Article Gene Expression Changes in the Ventral Tegmental Area of Male Mice with Alternative Social Behavior Experience in Chronic Agonistic Interactions Olga Redina 1,* , Vladimir Babenko 1,2 , Dmitry Smagin 1 , Irina Kovalenko 1, Anna Galyamina 1, Vadim Efimov 1,2 and Natalia Kudryavtseva 1 1 FRC Institute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, 630090 Novosibirsk, Russia; [email protected] (V.B.); [email protected] (D.S.); [email protected] (I.K.); [email protected] (A.G.); efi[email protected] (V.E.); [email protected] (N.K.) 2 Department of Natural Sciences, Novosibirsk State University, 630090 Novosibirsk, Russia * Correspondence: [email protected] Received: 27 July 2020; Accepted: 4 September 2020; Published: 9 September 2020 Abstract: Daily agonistic interactions of mice are an effective experimental approach to elucidate the molecular mechanisms underlying the excitation of the brain neurons and the formation of alternative social behavior patterns. An RNA-Seq analysis was used to compare the ventral tegmental area (VTA) transcriptome profiles for three groups of male C57BL/6J mice: winners, a group of chronically winning mice, losers, a group of chronically defeated mice, and controls. The data obtained show that both winners and defeated mice experience stress, which however, has a more drastic effect on defeated animals causing more significant changes in the levels of gene transcription. Four genes (Nrgn, Ercc2, Otx2, and Six3) changed their VTA expression profiles in opposite directions in winners and defeated mice. It was first shown that Nrgn (neurogranin) expression was highly correlated with the expression of the genes involved in dopamine synthesis and transport (Th, Ddc, Slc6a3, and Drd2) in the VTA of defeated mice but not in winners.
  • A COLQ Missense Mutation in Sphynx and Devon Rex Cats with Congenital Myasthenic Syndrome

    RESEARCH ARTICLE A COLQ Missense Mutation in Sphynx and Devon Rex Cats with Congenital Myasthenic Syndrome Marie Abitbol1,2,3,4*, Christophe Hitte5, Philippe Bossé1,2,3,4, Nicolas Blanchard- Gutton1,2,3,4, Anne Thomas6, Lionel Martignat7, Stéphane Blot1,2,3,4, Laurent Tiret1,2,3,4 1 Inserm, IMRB U955-E10, 94000, Créteil, France, 2 Université Paris Est, Ecole nationale vétérinaire d'Alfort, 94700, Maisons-Alfort, & Faculté de médecine, 94000, Créteil, France, 3 Etablissement Français du Sang, 94017, Créteil, France, 4 APHP, Hôpitaux Universitaires Henri Mondor, DHU Pepsy & Centre de référence des maladies neuromusculaires GNMH, 94000 Créteil, France, 5 Institut de Génétique et Développement de Rennes IGDR, UMR6290 CNRS—Université de Rennes 1, Rennes, France, 6 Antagene, Animal Genetics Laboratory, La Tour de Salvagny, France, 7 ONIRIS, UP Sécurité Sanitaire en Biotechnologies de la Reproduction, Nantes, France * [email protected] OPEN ACCESS Abstract Citation: Abitbol M, Hitte C, Bossé P, Blanchard- Gutton N, Thomas A, Martignat L, et al. (2015) A An autosomal recessive neuromuscular disorder characterized by skeletal muscle weak- COLQ Missense Mutation in Sphynx and Devon Rex Cats with Congenital Myasthenic Syndrome. PLoS ness, fatigability and variable electromyographic or muscular histopathological features has ONE 10(9): e0137019. doi:10.1371/journal. been described in the two related Sphynx and Devon Rex cat breeds (Felis catus). Collec- pone.0137019 tion of data from two affected Sphynx cats and their relatives pointed out a single disease Editor: Vincent Mouly, Institut de Myologie, FRANCE candidate region on feline chromosome C2, identified following a genome-wide SNP-based Received: May 8, 2015 homozygosity mapping strategy.
  • COLQ Gene Collagen Like Tail Subunit of Asymmetric Acetylcholinesterase

    COLQ gene collagen like tail subunit of asymmetric acetylcholinesterase Normal Function The COLQ gene provides instructions for making a protein that plays an important role in the neuromuscular junction. The neuromuscular junction is the area between the ends of nerve cells and muscle cells where signals are relayed to trigger muscle movement. The ColQ protein anchors another protein called acetylcholinesterase to the muscle cell membrane at the neuromuscular junction. The ColQ protein is made up of three identical parts (subunits). Each subunit attaches (binds) to a bundle of four acetylcholinesterase proteins. Acetylcholinesterase plays a role in regulating the length of signaling between nerve cells and muscle cells by breaking down the signaling protein acetylcholine. Health Conditions Related to Genetic Changes Congenital myasthenic syndrome More than 35 mutations in the COLQ gene have been found to cause congenital myasthenic syndrome. Most of these mutations change single protein building blocks ( amino acids) in the ColQ protein or lead to the production of a shortened, nonfunctional protein. A lack of functional ColQ protein leads to a reduction in the amount of acetylcholinesterase that is available in the neuromuscular junction. As a result, acetylcholine is not broken down so signaling between nerve and muscle cells is prolonged. This signaling overload can damage muscle cells, leading to the muscle weakness characteristic of congenital myasthenic syndrome. Other Names for This Gene • acetylcholinesterase collagenic tail peptide
  • Exploring Molecular Mechanism of Traditional Chinese Medicine

    Exploring Molecular Mechanism of Traditional Chinese Medicine

    Exploring Molecular Mechanism of Traditional Chinese Medicine Euphorbiae Semen on Reversing of Multidrug Resistance in Leukemia Based on Network Pharmacology Strategy and Molecular Docking Technology Xiao Song School of Pharmaceutical Sciences, Shandong University of Traditional Chinese Medicine, Jinan 250355, PR China Fei Guo The Aliated Hospital of Shandong University of Traditional Chinese Medicine, Jinan 250011, PR China Xiao-Chen Sun School of Pharmaceutical Sciences, Shandong University of Traditional Chinese Medicine, Jinan 250355, PR China Shu-Yue Wang School of Pharmaceutical Sciences, Shandong University of Traditional Chinese Medicine, Jinan 250355, PR China Yao-Hui Yuan School of Pharmaceutical Sciences, Shandong University of Traditional Chinese Medicine, Jinan 250355, PR China Chao Zhang ( [email protected] ) School of Pharmaceutical Sciences, Shandong University of Traditional Chinese Medicine, Jinan 250355, PR China https://orcid.org/0000-0001-9533-3737 Hua-Ying Lv Shandong College of Traditional Chinese Medicine, Yantai 264199, PR China Zhi Chen School of Pharmaceutical Sciences, Shandong University of Traditional Chinese Medicine, Jinan 250355, PR China Research Keywords: Euphorbiae semen, network pharmacology, molecular docking, leukemia, multidrug resistance Posted Date: August 11th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-55927/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/23 Abstract Background: Leukemia was listed by the World Health Organization as one of the ve most intractable diseases in the world. The multi-drug resistance (MDR) of leukemia cells limits the ecacy of anti-tumor drugs and is the major reason for the chemotherapy failure and recurrence of leukemia chemotherapy.
  • Identification of Key Genes in Atrial Fibrillation Using Bioinformatics Analysis Yueheng Liu†, Rui Tang†, Ye Zhao, Xuan Jiang, Yuchao Wang and Tianxiang Gu*

    Identification of Key Genes in Atrial Fibrillation Using Bioinformatics Analysis Yueheng Liu†, Rui Tang†, Ye Zhao, Xuan Jiang, Yuchao Wang and Tianxiang Gu*

    Liu et al. BMC Cardiovascular Disorders (2020) 20:363 https://doi.org/10.1186/s12872-020-01653-4 RESEARCH ARTICLE Open Access Identification of key genes in atrial fibrillation using bioinformatics analysis Yueheng Liu†, Rui Tang†, Ye Zhao, Xuan Jiang, Yuchao Wang and Tianxiang Gu* Abstract Background: Atrial fibrillation (AF) is one of the most common arrhythmia, which brings huge burden to the individual and the society. However, the mechanism of AF is not clear. This paper aims at screening the key differentially expressed genes (DEGs) of atrial fibrillation and to construct enrichment analysis and protein-protein interaction (PPI) network analysis for these DEGs. Methods: The datasets were collected from the Gene Expression Omnibus database to extract data of left atrial appendage (LAA) RNA of patients with or without AF in GSE79768, GSE31821, GSE115574, GSE14975 and GSE41177. Batch normalization, screening of the differential genes and gene ontology analysis were finished by R software. Reactome analysis was used for pathway analysis. STRING platform was utilized for PPI network analysis. At last, we performed reverse transcription-quantitative polymerase chain reaction (RT-qPCR) to validate the expression of key genes in 20 sinus rhythm (SR) LAA tissues and 20 AF LAA tissues. Results: A total of 106 DEGs were screened in the merged dataset. Among these DEGs, 74 genes were up- regulated and 32 genes down-regulated. DEGs were mostly enriched in extracellular matrix organization, protein activation cascade and extracellular structure organization. In PPI network, we identified SPP1, COL5A1 and VCAN as key genes which were associated with extracellular matrix. RT-qPCR showed the same expression trend of the three key genes as in our bioinformatics analysis.