1
SUPPLEMENTARY METHODS
Animal treatment protocols.
To examine the expression of KLF4 in mice with proteinuria, 8 week-old male Balb/c mice and C57BL/6J mice were obtained from Sankyo Laboratory and injected with adriamycin (ADM). Preliminary dose-response studies confirmed that the optimal dose of ADM administration was 11 mg/kg iv for Balb/c mice, and 18 mg/kg iv for
C57BL/6J mice and mixed strains as reported previously (1-4). Puromycin aminonucleotide (Sigma) was administered at a dose of 500 mg/kg sc (5, 6). For the experiments using podocyte-specific inducible KLF4 transgenic mice
(Pod/Tet-O/KLF4), 8-week-old male mice and control littermates were injected with
ADM (18 mg/kg iv) to induce nephropathy. The mice were administered doxycycline (2 mg/ml) 4 weeks after the ADM injection for 28 days to induce KLF4 expression in glomerular podocytes. In vivo siRNA experiments were performed using the method reported by Okamoto et al (7). In brief, KLF4 SiRNA (In vivo grade Mission siRNATM,
Mm_KLF4_8987, Sigma-Aldrich) or control siRNA were dissolved in 0.8 ml PBS at a concentration of 500 ug/ml, and delivered by rapid tail injection to deliver 400 ug/mouse. Injections were performed twice with a 7-day interval between injections.
The siRNA sequences are shown in Supplementary Table 2. 2
Cloning and methylation of the human nephrin gene promoter.
DNA fragments (A: bp-1884 to + 156, B: bp-767 to -377 and C: bp-520 to +280 relative to the transcription start site (TSS)) of the human nephrin gene were obtained by PCR, using human genomic DNA as the template. The generated DNA fragments were subcloned into pGL3-basic plasmid (Promega), and transfected into podocytes using lipofectamine. Luciferase assays were performed using a commercial kit (Promega), with Renilla luciferase as the transfection control. For the KRE deletion studies, the
KRE in the nephrin promoter (shown boxed in Supplementary Fig. 8) was deleted from the promoter region by PCR-based mutagenesis using the In-Fusion HD Cloning system (Clontech), as recommended by the manufacturers. For the analysis of the effects of promoter methylation on nephrin promoter activity, DNA fragments were subcloned into a CpG-sequence free promoter plasmid (pCpGfree-promoter, InVivogen) which lacks intrinsic CpG sequences in the vector sequence, and therefore allows comparison of the effects of methylation on promoter activity. The plasmid DNA was methylated with the bacterial methyltransferase SssI, transfected into podocytes, and then SEAP activity was assayed using a commercial kit (Clontech).
Microarray-based genome-wide DNA methylation profiling and expression analysis. 3
Microarray-based DNA methylation profiling was performed on DNA samples from podocytes transfected with pCMV-SPORT6-KLF4 or empty vector using the
HumanMethylation450 DNA Analysis BeadChip (Illumina) for the analysis of DNA methylation sites in the promoter and non-promoter regions, as defined by the manufacturer (8, 9). This array allows analysis of over 450,000 genome-wide methylation sites per sample at single-nucleotide resolution. Genomic DNA was subjected to bisulfite conversion using the EZ DNA Methylation Kit (Zymo Research,
Orange County, CA). Processed DNA samples were hybridized to the BeadChip, and the methylation level for each locus was determined by calculating the ratio of the fluorescent signals from the methylated versus unmethylated sites. 4
References
1. Wang Y, Wang YP, Tay YC, and Harris DC. Progressive adriamycin nephropathy
in mice: sequence of histologic and immunohistochemical events. Kidney
international. 2000;58(4):1797-804.
2. Dai C, Stolz DB, Kiss LP, Monga SP, Holzman LB, and Liu Y. Wnt/beta-catenin
signaling promotes podocyte dysfunction and albuminuria. J Am Soc Nephrol.
2009;20(9):1997-2008.
3. Dai C, Saleem MA, Holzman LB, Mathieson P, and Liu Y. Hepatocyte growth
factor signaling ameliorates podocyte injury and proteinuria. Kidney
international. 2010;77(11):962-73.
4. Hayashi K, Sasamura H, Ishiguro K, Sakamaki Y, Azegami T, and Itoh H.
Regression of glomerulosclerosis in response to transient treatment with
angiotensin II blockers is attenuated by blockade of matrix metalloproteinase-2.
Kidney international. 2010;78(1):69-78.
5. Wang L, Fields TA, Pazmino K, Dai Q, Burchette JL, Howell DN, Coffman TM,
and Spurney RF. Activation of Galpha q-coupled signaling pathways in
glomerular podocytes promotes renal injury. J Am Soc Nephrol.
2005;16(12):3611-22.
6. Wang L, Ellis MJ, Fields TA, Howell DN, and Spurney RF. Beneficial effects of
the Rho kinase inhibitor Y27632 in murine puromycin aminonucleoside
nephrosis. Kidney & blood pressure research. 2008;31(2):111-21.
7. Okamoto K, Tokunaga K, Doi K, Fujita T, Suzuki H, Katoh T, Watanabe T,
Nishida N, Mabuchi A, Takahashi A, et al. Common variation in GPC5 is
associated with acquired nephrotic syndrome. Nature genetics. 5
2011;43(5):459-63.
8. Wilop S, Fernandez AF, Jost E, Herman JG, Brummendorf TH, Esteller M, and
Galm O. Array-based DNA methylation profiling in acute myeloid leukaemia.
Br J Haematol. 2011;155(1):65-72.
9. Calvanese V, Fernandez AF, Urdinguio RG, Suarez-Alvarez B, Mangas C,
Perez-Garcia V, Bueno C, Montes R, Ramos-Mejia V, Martinez-Camblor P, et al.
A promoter DNA demethylation landscape of human hematopoietic
differentiation. Nucleic acids research. 2012;40(1):116-31.
6
SUPPLEMENTARY TABLES
Supplementary Table 1. Clinical profiles of patients with proteinuric glomerular diseases.
Normal MCD FSGS DN (n=9) (n=10) (n=11) (n=9) Age at biopsy (yr; mean and range) 53 (35-71) 48 (31-74) 50 (33-65) 52 (40-70) Sex (male/ female) 7/2 6/4 8/3 8/1 Serum creatinine (mg/dl; mean±SEM) 1.06±0.11 1.01±0.09 1.17±0.10 1.24±0.20 Serum albumin (g/dl; mean±SEM) 4.30±0.11 3.06±0.42 3.58±0.26 3.54±0.17 Proteinuria (g/d; mean±SEM) nd 2.75±0.87 2.58±0.50 3.48±1.00
MCD: minimal change disease, FSGS: focal segmental glomerulosclerosis, DN: diabetic nephropathy, nd: not detectable
7
Supplementary Table 2. Sequence of oligonucleotide primers.
Cloning primers Name F/R Target sequence Human nephrin promoter A F CGACGCGTGGTGACAGAGCAAGACTCCC (with a MluI restriction site) R CCCTCGAGCACAGGTCCCCCTACTGTG (with a XhoI restriction site) Human nephrin promoter B F TTACGCGTGTATCAGGGCAAGGAAGAGCTGG (with a MluI restriction site) R TACTCGAGTCTCACTACTCACAGCCTTTCAAGA (with a XhoI restriction site) Human nephrin promoter C F TACTCGAGTTGCACTGTGAGAATGAGCT (with XhoI restriction site) R CGAAGCTTGTCTAGGGAAGGTAAGTG (with HindIII restriction site) Human nephrin promoter A F ATAGTACTGGTGACAGAGCAAGACTCCC (SEAP) (with a ScaI restriction site) R ATGGATCCCACAGGTCCCCCTACTGTG (with a BamHI restriction enzyme cutting site) MSP/BGS primers Name F/R Target sequence Human nephrin promoter F AGTTTGAGTAATAGAGTAAGAT MSP R CACATACCAAACGCGTTCCTCG (Methyl primer) R CACATACCAAACACATTCCTCA (Unmethyl primer) Human nephrin promoter F CATCATTTAGGCACTGATGTCTACT MSP control primer R CTTGTCTCACTACTCACAGCCTTTC Human nephrin promoter F AGAGATTTGTTAAGGTTATGTATTAGG BGS1 R TCAATCTCTATCTTCTCTCCTACCACC Human nephrin promoter F GTATTAGGGTAAGGAAGAGTTGG BGS2 R TCTCACTACTCACAACCTTTCAAAA Human vimentin promoter F AAAGAGGTTTGTTTAAAGAAGTTAGA BGS1 R AACTCAATAATCAATAATTTTTACCCTA Human vimentin promoter F AGAATTAATTTTATAGTGGTTTTGTAGT 8
BGS2 R ACAACAATACACAATACAAAATTCAC ChIP primers Name F/R Target sequence Human nephrin promoter B F GTATCAGGGCAAGGAAGAGCTGG R TCTCACTCATCACAGCCTTTCAAGA Human nephrin promoter F TCTTGAAAGGCTGTGAGTAGTGAGA (negative control) R CACAGGTCCCCCTACTGTG Human vimentin promoter F AGAATCAATTTTACAGTGGTTCTGCAGT R ACAGCAATGCACAGTACAGGGTTCAC Real-time PCR primers Name No. KLF4 ABI Hs00358836_m1, Mm00516104_m1 NPHS1 (Nephrin) ABI Hs00190446_m1, Mm01176615_g1 NPHS2 (Podocin) ABI Hs00922492_m1, Mm01292252_m1 CDH3 (P-cadherin) ABI Hs00999918_m1 WT1 ABI Hs01103751_m1 SYNPO (Synaptopodin) ABI Mm03413333_m1 ACTA2 (αSMA) ABI Hs00909449_m1 VIM (Vimentin) ABI Hs00185584_m1, Mm01333430_m1 KLF2 ABI Hs00360439_g1 KLF3 ABI Hs00974383_g1, Mm00492956_m1 KLF6 ABI Hs00810569_m1, Mm00516184_m1 KLF15 ABI Hs00362736_m1, Mm00517792_m1 GAPDH ABI Hs00266705_g1, Mm99999915_g1 siRNA oligonucleotides Name Sequence KLF4-HSS190182s UUCAGCACGAACUUGCCCAUCAGCC KLF4-HSS190182as GGCUGAUGGGCAAGUUCGUGCUGAA Mm_Klf4_8987s rGrGrCUrGrAUrGrGrGrCrArArGUUUrGUTT Mm_Klf4_8987_as rArCrArArArCUUrGrCrCrCrAUrCrArGrCrCTT EMSA oligonucleotides Name Sequence KRE (s) CACCGAGGAACGCGCCTGGCATGTG KRE deletion oligo (s) CACCGAGGAACGCATGTG
9
Supplementary Table 3. Antibodies for immunofluorescent labeling and Western blot analysis.
Name Source Type Anti-KLF4 antibody Sigma-Aldrich Goat, polyclonal Anti-KLF4 antibody Santa Cruz Biotechnology Rabbit, polyclonal Anti-Nephrin antibody PROGEN Guinea-pig, polyclonal Anti-Podocin antibody (IF) IBL Rabbit, polyclonal Anti-Podocin antibody (Western) Abcam Rabbit, polyclonal Anti-P-cadherin antibody Santa Cruz Biotechnology Rabbit, polyclonal Anti-WT1 antibody Santa Cruz Biotechnology Rabbit, polyclonal Anti-Synaptopodin antibody Synaptic systems Rabbit, polyclonal Anti-Vimentin antibody Sigma-Aldrich Goat, polyclonal Anti-Alpha-SMA antibody Sigma-Aldrich Mouse, monoclonal Anti-vWF antibody Dako Rabbit, polyclonal Anti-Desmin antibody Dako Mouse, monoclonal Anti-Acetyl-H3K9 antibody Abcam Rabbit, polyclonal Anti-Dnmt1 antibody Santa Cruz Biotechnology Rabbit, polyclonal Anti-Dnmt3a antibody Santa Cruz Biotechnology Rabbit, polyclonal Anti-Dnmt3b antibody Santa Cruz Biotechnology Rabbit, polyclonal Anti-CtBP antibody Santa Cruz Biotechnology Rabbit, polyclonal Anti-Alpha-tubulin antibody Sigma-Aldrich Mouse, monoclonal
10
SUPPLEMENTARY FIGURE LEGENDS
Supplementary Figure 1. KLF4 expression is decreased in proteinuric glomerular disease models.
Details of the experimental protocol are provided in Fig. 1(D-G). (Upper panel) western blots and (lower panel) real-time PCR analysis of KLF4 and nephrin expression in the kidney cortex in ADM nephropathy model of Balb/c mice (A) or C57BL/6J mice (B),
PAN nephropathy model (C) and diabetic nephropathy model (db/db) (D) (n=5-6 per time points).
Supplementary Figure 2. Gene transfer of KLF4 attenuates proteinuria and restores nephrin expression in adriamycin nephropathy in Balb/c mice.
(A) Experimental protocol. 2 weeks after injection of Balb/c mice with ADM (11 mg/kg iv), either pCMV-Vector (Vector) or pCMV-KLF4 (KLF4) were administered by tail vein injection, as described in Methods. Mice per group were sacrificed before ADM injection, and at days 0, 1, 7, 14, and 28 after plasmid injection in ADM nephropathy
(n=5-6 per time point). (B) (Left panels) Representative photomicrographs of immunofluorescence staining of KLF4 and nephrin in mice injected with pCMV-KLF4 or control vector. (Right panels) Quantification of the immunolabeled area. (C) Time course of changes in albuminuria in mice injected with pCMV-KLF4 or control vector.
(D) (Left panel) Representative photomicrographs and (right panel) quantification of 11
podocyte foot process effacement in mice injected with pCMV-KLF4 or control vector.
Scale bar, 5 um. (E) (Upper panel) Representative photomicrographs of light microscopy of glomeruli (PAS staining) and (lower panel) quantification of
PAS-positive area in mice injected with pCMV-KLF4 or control vector. (F) (Upper panel) Representative photomicrographs of light microscopy of glomeruli
(WT1-staining) and (lower panel) quantification of WT-1 positive cells per glomerulus at 14 days after plasmid injection. *: p<0.05, **: p<0.01 vs controls.
Supplementary Figure 3. Gene transfer of KLF4 attenuates proteinuria and restores nephrin expression in adriamycin nephropathy in C57BL/6J mice.
(A) Experimental protocol. 4 weeks after injection of C57BL/6J mice with ADM (18 mg/kg iv), either pCMV-Vector (Vector) or pCMV-KLF4 (KLF4) were administered by tail vein injection, as described in Methods. Mice were sacrificed at days 0, 1, 7, 28, 84, and 168 after plasmid injection (n=5-6 per time point). (B) Representative photomicrographs and (C) quantification of immunofluorescence staining of KLF4, nephrin, podocin, synaptopodin, and vimentin in pCMV-KLF4-injected mice. (D)
Representative low power photomicrograph of kidney KLF4 immunofluorescence staining 1 day after injection of pCMV-KLF4 (Scale bar, 100 um). (E) (Upper panel)
Western blot and (Lower panel) real-time RT-PCR analysis of KLF4 and nephrin 12
expression in the kidney cortex at the indicated days after injection of pCMV-KLF4. *: p<0.05, **: p<0.01 vs day 0. (F) Time course of changes in albuminuria in mice injected with pCMV-KLF4 or control vector. *: p<0.05, **: p<0.01 vs controls.
Supplementary Figure 4. Gene transfer of KLF4 attenuates proteinuria and restores nephrin expression in diabetic nephropathy in db/db mice.
(A) Experimental protocol. db/db mice were administered either pCMV-Vector (Vector) or pCMV-KLF4 (KLF4) by tail vein injection, as described in Methods. Mice were sacrificed at days 0, 1, 7, 14, and 28 after plasmid injection (n=5-6 per time point). (B)
(Left panels) Representative photomicrographs of immunofluorescence staining of
KLF4 and nephrin in mice injected with pCMV-Vector (Vector) or pCMV-KLF4
(KLF4). (Right panels) Quantification of the immunolabeled area. (C) Time course of changes in albuminuria in mice injected with pCMV-Vector (Vector) or pCMV-KLF4
(KLF4). (D) (Left panel) Representative photomicrographs of light microscopy of glomeruli (PAS staining) and (right panel) quantification of PAS-positive area in mice injected with pCMV-KLF4 or control vector. (E) (Upper panel) Representative photomicrographs of light microscopy of glomeruli (WT1-staining) and (lower panel) quantification of WT-1 positive cells per glomerulus at 28 days after plasmid injection.
*: p<0.05, **: p<0.01 vs controls. 13
Supplementary Figure 5. Restoration of podocyte KLF4 expression in diseased glomeruli alters phenotype marker expression.
Details of the experiment protocol are provided in Fig. 2. (Upper panel) Western blot and (lower panel) real-time RT-PCR analysis of podocin, synaptopodin and vimentin expression in the kidney cortex of KLF4 transgenic mice or controls at the indicated times after starting Dox treatment (n=5-6 per time points).
Supplementary Figure 6. Transient overexpression of KLF4 results in sustained changes in podocyte morphology and nephrin expression.
Serial changes in (upper panel) cell morphology and (lower panel) Western blots of
KLF4, nephrin, αSMA, and vimentin in podocytes with tetracycline-inducible KLF expression (Tet-O/KLF4) and control cells (Tet-O/Vector) after 7 days treatment with doxycycline (1 ug/ml), followed by 7 days wash-out.
Supplementary Figure 7. Transient overexpression of KLF4 results in changes in promoter methylation of epithelial and mesenchymal genes.
DNA samples from KLF4-expressing podocytes and their controls were subjected to microarray-based DNA methylation profiling. Changes in methylation of (A) promoter regions and (B) non-promoter regions of (upper panel) all genes included in the array or
(lower panel) epithelial and mesenchymal marker genes are shown. 14
Supplementary Figure 8. Nucleotide sequences of the human nephrin promoter and human vimentin promoter region adjacent to the transcription start site (TSS) examined by BGS and ChIP assays.
In both cases, KLF4-response elements (KRE) were identified (boxed), and several
CpG binucleotides were found in the analyzed region.
Supplementary Figure 9. (A) Chromatin immunoprecipitation (ChIP) assay for
DNMT1 in the promoter regions of nephrin, vimentin, and the control promoter. The control was an adjacent region of the nephrin promoter (-401 ~ +156 relative to the
TSS), which does not contain the KRE. The amplified fragment for nephrin corresponds to region B in Fig. 8A. The bar graph shows the quantification of DNMT1 /input intensity (n=4). (B) ChIP assay for DNMT1, 3a, and 3b in the promoter regions of nephrin, vimentin, and control promoter. (Upper panel of DNMT1 is the same figure as
Supplementary Fig. 9A.) (C) ChIP assay for the acetylated H3K9 in the promoter regions of nephrin, vimentin, and control promoter. The bar graph shows the quantification of acetyl-H3K9 /input intensity (n=4). KLF4: KLF4-overexpressing podocytes; Empty: empty vector-transfected control podocytes. *: p<0.05, **: p<0.01 vs controls. ND: not detectable.
Supplementary Fig. 1
Western blot Western blot
KLF4 55 kD KLF4 55 kD ABNephrin 185 kD Nephrin 185 kD αtubulin 50 kD αtubulin 50 kD 0 14 0 14 days after ADM injection days after ADM injection
qPCR qPCR 1.5 KLF4 1.5 KLF4 Nephrin Nephrin 1 1 * * 0.5 ** 0.5 ** levels mRNA mRNA levels levels mRNA 0 0 014 014 days after ADM injection days after ADM injection
Western blot Western blot KLF4 55 kD D KLF4 55 kD C Nephrin 185 kD Nephrin 185 kD αtubulin 50 kD αtubulin 50 kD 0 14 db/m db/db days after PAN injection
qPCR qPCR 1.5 KLF4 KLF4 Nephrin 1.5 Nephrin 1 * 1 * * 0.5 *
mRNA levels levels mRNA 0.5 mRNA levels levels mRNA 0 0 014 db/m db/db days after PAN injection Age 18 weeks A B Supplementary Fig. 2 ADM pCMV-Vector iv KLF4 2w 10 1. Vector 0 1 7 14 28 (days) Vector KLF4
ADM pCMV-KLF4 iv 5 **
2w KLF4 2. 0 1 7 14 28 (days) 0 KLF4 ADM (-) 0171428 C ADM (-) 0 1 7 14 28 (days) days after plasmid injection 6000 days after plasmid injection Nephrin ADM (+)
Vector 8 Vector KLF4 KLF4 Vector 3000 4 * ** Nephrin KLF4 * ** * ** 0 0 ADM (-) 0171428 ADM (-) 0 1 7 14 28 (days) days after plasmid injection Urine albumin (mg/ gCr) albumin Urine 017142128 days after plasmid injection days after plasmid injection ADM (+) E Vector KLF4 Vector KLF4 D Vector KLF4 F Day 0 Day
Vector KLF4 Day 0 Day * 10 Day 14 Day
5 2
60 Vector 1 glomerulus
perof GBM um KLF4 0
Day 14 Day 0 01440
WT1-positive cells per cells WT1-positive Vector KLF4 Number of foot processes foot of Number
days after plasmid injection 20
0 PAS positive area (%) (%) area positive PAS 014 days after plasmid injection pCMV-Vector iv ADM 4w Supplementary Fig. 3 A 1. 0 1 7 28 84 168 (days) pCMV-KLF4 iv ADM 4w 2. 0 1 7 28 84 168 (days)
6 ** B KLF4 C ** ** ** 4 2 *
KLF4 2 1 Nephrin 0 Nephrin 0 0 1 7 28 84 168 0 1 7 28 84 168 days after plasmid injection days after plasmid injection
2 *** * 10 * * Podocin 1 5 Podocin 0 0 Synaptopodin 0172884168 0172884168 Synaptopodin days after plasmid injection days after plasmid injection
1 ** * 0.5
Vimentin Vimentin 0 0 1 7 28 84 168 days after plasmid injection Vector 0 1 7 28 84 168 (days) KLF4 KLF4 D KLF4 55 kD E F 2000 Nephrin 185 kD 50 kD 1500 αtubulin 0 1 7 28 1000 days after plasmid injection * 500 ** * * * * 3 * 3 2 2 (mg/ gCr) albumin Urine 0 1 1 KLF4
Nephrin 1 5 7 14 28 84 168 0 0 mRNA levels levels mRNA 01728 levels mRNA 01728 days after plasmid injection days after plasmid injection days after plasmid injection A Supplementary Fig. 4 pCMV-Vector iv B KLF4 1. db/db 3 Vector 0 1 7 14 28 Vector ** 2 KLF4 Age 18 weeks (days)
KLF4 1 pCMV-KLF4 iv KLF4 0 2. db/db 0171428 days after plasmid injection 0 1 7 14 28 0 1 7 14 28 (days) days after plasmid injection Age 18 weeks (days) Nephrin C Vector Vector KLF4 800 KLF4 3 Vector * 2 *
* 1 Nephrin 400 ** KLF4 0 0171428 days after plasmid injection 0 1 7 14 28 (days)
Urine albumin (mg/ gCr) albumin Urine 0 days after plasmid injection 071428 days after plasmid injection
D Vector KLF4 E Vector KLF4
Day 0 Day Vector KLF4
10 40
20 5 PAS positive PAS area (%) Day 28 Day 0 028 0 per glomerulus per
days after plasmid injection cells WT1-positive Vector KLF4 Supplementary Fig. 5
Podocin 42 kD
Synaptopodin 100 kD
Vimentin 58 kD αtubulin 50 kD
Cont KLF4-Tg Cont KLF4-Tg Cont KLF4-Tg days after 0 0 28 28 84 84 starting Dox Control KLF4-Tg
Dox 2 Dox 2 * * 1 1
0 0
podocin mRNA levels 02884 02884 levels mRNA synpon days after starting Dox days after starting Dox
2 Dox 1 *
0
vimenitn mRNA levels levels mRNA vimenitn 02884 days after starting Dox Supplementary Fig. 6
Dox (+) Dox (-)
0 7 14 (days)
Tet-O/ Vector Tet-O/ KLF4 Tet-O/ Vector Tet-O/ KLF4 Tet-O/ Vector Tet-O/ KLF4
KLF4 55kD KLF4 KLF4 nephrin nephrin 185kD nephrin α αSMA 42kD αSMA SMA Vimentin Vimentin Vimentin 58kD αtubulin αtubulin αtubulin 50kD Supplementary Fig. 7 A B Promoter regions Non-Promoter regions All genes All genes -0.9% 0.6%
-100 0 100 -100 0 100
-42% nephrin -12% -13% podocin 1% Epithelial markers -12% p-cadherin 3% -4% synaptopodin -0.2%
-5% ZO-1 2%
12% αSMA -4% 5% desmin -6% 74% -3% Mesenchymal vimentin markers 32% 39% CTGF 24% -6% MMP-9 3% FSP-1 9% 1% Collagen I 2%
-100 0 100 -100 0 100 Percent increase in methylation Percent increase in methylation Supplementary Fig. 8 Nephrin promoter
-787 agagacttg ccaaggtcat gtatcagggc aaggaagagc tgggggccca gctggctgct cccctgctga
-717 gctgggagac caccttgatc tgacttctcc catcttccca gcctaagcca ggccctgggg tcacggaggc KRE CpG1 -647 tggggaggca ccgaggaacg cgcctggcat gtgctgacag gggattttat gctccagctg ggccagctgg CpG2 CpG3 CpG4 -577 gaggagcctg ctgggcagag gccagagctg ggggctctgg aaggtacctg ggggaggttg cactgtgaga
-507 atgagctcaa gctgggtcag agagcagggc tgactctgcc agtgcctgca tcagcctcat cgctctccta CpG5 -437 ggctcctggc ctgctggact ctgggctgca ggtccttctt gaaaggctgt gagtagtgag a
Vimentin promoter
-736 agaatcaatt ttacagtggt tctgcagtta atcctttcag tacaccataa atctaaatac tcaaaaaaac
-666 ctgtgccttt tcaattgcta ctaaatcacg agaagactga tttacatagt ctccttttat ctcccttggc CpG1 CpG2 -596 gggtaagtac tcagctctgc tcgttactaa tattgaaaca acagcccttg aattgagtga tttccctaga CpG3 -526 aaggttaagg tgaccgaatc tgaacactcc ctccatgtct tggacacgaa gttttttgct gcgtagacag KRE CpG4 CpG5 CpG6 -456 ttttatcccc ctcaccccaa ggtcaattgc acgaattctt ttggaaaaca ggacctatgg catttcccag CpG7 -386 acaaatcacc gtgaaccctg tactgtgcat tgctgt
KRE: KLF4 responsive element BGS primers MSP primers Nephrin Nephrin Supplementary Vimentin A C Vimentin Fig. 9 control control
Empty KLF4 Empty KLF4 Empty KLF4 Empty KLF4 Empty KLF4 Empty KLF4 input Dnmt1 IgG input acH3K9 IgG Nephrin Vimentin Nephrin Vimentin * 3
2 ** *
1 1 Dnmt1 / input Dnmt1 / input 1 1 acH3K9/ input acH3K9/ input acH3K9/ 0.5 0.5 0.5 ND ND
0 0 0 0 Empty KLF4 Empty KLF4 Empty KLF4 Empty KLF4
B dnmt1 dnmt3a dnmt3b
Nephrin Vimentin control
Empty KLF4 Empty KLF4 Empty KLF4 Empty KLF4 Empty KLF4 Empty KLF4 Empty KLF4 Empty KLF4 Empty KLF4 input Dnmt1 IgG input Dnmt3a IgG input Dnmt3b IgG Nephrin Vimentin control Empty KLF4 Empty KLF4 Empty KLF4 Empty KLF4 Empty KLF4 Empty KLF4 Empty KLF4 Empty KLF4 Empty KLF4 input Dnmt1 IgG input Dnmt3a IgG input Dnmt3b IgG
Nephrin Vimentin control
Empty KLF4 Empty KLF4 Empty KLF4 Empty KLF4 Empty KLF4 Empty KLF4 Empty KLF4 Empty KLF4 Empty KLF4 input Dnmt1 IgG input Dnmt3a IgG input Dnmt3b IgG