Infantile Epilepsy Associated with Mosaic 2Q24 Duplication Including SCN2A

View metadata, citation and similar papers at core.ac.uk brought to you by CORE

provided by Elsevier - Publisher Connector

Seizure 20 (2011) 813–816

Contents lists available at ScienceDirect

Seizure

jou rnal homepage: www.elsevier.com/locate/yseiz

Case report

Infantile epilepsy associated with mosaic 2q24 duplication including SCN2A

and SCN3A

a,c b,c b b a a

Marilena Vecchi , Matteo Cassina , Alberto Casarin , Chiara Rigon , Paola Drigo , Luca De Palma , b,

Maurizio Clementi *

Pediatric Neurology and Clinical Neurophysiology Unit, Department of Pediatrics, University of Padova, Italy

Clinical Genetics Unit, Department of Pediatrics, University of Padova, Via Giustiniani 3, 35128 Padova, Italy

A R T I C L E I N F O A B S T R A C T

Article history: Epilepsies can be caused by speciﬁc genetic anomalies or by non-genetic factors, but in many cases the

Received 9 May 2011

underlying cause is unknown.

Received in revised form 14 July 2011

Mutations in the SCN1A and SCN2A genes are reported in childhood epilepsies; in particular SCN1A

Accepted 16 July 2011

was found mutated in patients with Dravet syndrome and with generalized epilepsy with febrile

seizures plus (GEFS+).

Keywords:

In this paper we report a patient presenting with an atypical epileptic syndrome whose phenotype

Dravet syndrome

partially overlaps both Dravet syndrome and benign familial neonatal-infantile seizures (BFNIS).

BFNIS

Array-CGH analysis suggested the presence of a mosaic duplication (about 12 Mb) at the level of

Array-CGH

Genetics chromosome 2q23.3q24.3 involving SCN2A and SCN3A genes. Additional analyses (radiolabeled RFLP

and quantitative PCR) conﬁrmed the mosaicism of the duplication.

We suggest that the array-CGH analysis is mandatory for children presenting with epilepsy and

psycho-motor retardation even without dysmorphisms or other clinical features suggesting a speciﬁc

genetic/epileptic syndrome. The analysis must nevertheless be performed taking into account the

possibility of a mosaicism.

1. Introduction infants at about 6 months of age and worsens during the second

year of life causing drug resistant seizures and cognitive and motor

Epilepsies are a group of heterogeneous neurological disorders skill deterioration. Mutations in SCN2A have been found in families

characterized by recurrent and unprovoked seizures due to an with benign familial neonatal-infantile seizures (BFNIS), a self-

abnormal electrical activity in the central nervous system. limiting disorder generally presenting between 2 days and 7

While they can be caused by speciﬁc genetic anomalies months with a spontaneous remission of seizures at about 18

1 2 7

(cytogenetic abnormalities, single gene mutations ) and by months and normal cognitive outcome. Shi et al. screened 59

non-genetic factors (infections, stroke, head trauma and brain patients with Dravet syndrome for mutations of SCN1A, SCN2A and

tumors), in most cases the underlying cause is unknown. GABRG2 and found three missense SCN2A mutations. Mutations of

Isolated epilepsy has been recently associated with mutations sodium channel SCN3A were recently found in a patient with

in a number of genes, the majority of which encode ion channels or cryptogenic pediatric partial epilepsy. Functional analysis of

receptors, including voltage-gated sodium, potassium, calcium, sodium channel mutations (SCN1A, SCN2A and SCN3A) revealed

and chloride channels and receptors for acetylcholine and Y- that they are implicated in neuronal excitability suggesting that

2–6

aminobutyric acid (GABA). they play a role in the pathogenesis of epilepsy.

Mutations in the sodium channel genes (SCN1A and SCN2A) We report a patient affected with infantile epilepsy associated

have been identiﬁed in monogenic childhood epilepsies. SCN1A with mosaicism for a 12.01 Mb duplication of the long arm of

mutations have been found in patients with generalized epilepsy chromosome 2 including SCN2A and SCN3A genes.

with febrile seizures plus (GEFS+) and with Dravet syndrome; the

latter typically presents with prolonged febrile convulsions in

2. Clinical report

The propositus is a Caucasian male who was referred to our

institute for evaluation of developmental delay and epilepsy. He was

* Corresponding author. Tel.: +39 0498213572; fax: +39 0498211425.

E-mail address: [email protected] (M. Clementi). born at 38 weeks of gestation via spontaneous vaginal delivery to

These authors contributed equally to this work. unrelated healthy parents following an uncomplicated pregnancy.

814 M. Vecchi et al. / Seizure 20 (2011) 813–816

Birth weight was 3385 g (50th–75th centile), length was 49 cm duce/eliminate a consensus sequence for a restriction enzyme.

(25th–50th centile), and head circumference was 34 cm (25th–50th Only one SNP corresponding to the features described above was

centile). At 3 months of age he presented with clusters of focal found: rs582447.

seizures with secondary generalization. The electroencephalogram A couple of primers were designed to amplify a 199 bp fragment

(EEG) showed multifocal poly-spike activity and the brain magnetic (forward: CATCAGTGGACAGGAATGGTT and reverse: CACCATTG-

resonance imaging was unremarkable. The seizures were controlled GAGAATAAGACAGGA) encompassing a HindIII site.

with carbamazepine and treatment was discontinued at 13 months The PCR product was then radiolabeled with a32PdCTP (Perkin

of age. The psychomotor development was mildly delayed during Elmer), using the ‘last cycle hot’ method.

the ﬁrst year of life. At two years of age, he presented with daily head The radiolabeled products were subsequently digested over-

nodding and obtundation status associated with neurological night using HindIII restriction endonuclease (New England

regression. Video-EEG showed atonic seizures, and a diagnosis of Biolabs) according to the manufacturer’s protocol and separated

myoclonic-astatic epilepsy was proposed. Sodium valproate suc- by PAGE. Detection of radioactivity and image analysis were

cessfully controlled the seizures and, even though clumsiness performed as previously described.

persisted, the child’s language improved. At ﬁve years of age, some

absences were noted by the parents and the EEG showed multiple 3.4. Quantitative PCR

spikes at the vertex with normal background activity; the physical

examination did not document any signiﬁcant dysmorphisms. At Quantitative PCR, used to conﬁrm the duplication detected by

the moment, the patient is seven years old and seizure-free. Since array-CGH analysis, was performed on a RotorGene 6000 (Corbett

the family history was positive for epilepsy and febrile convulsions, Research, Mortlake, Australia) using Takara Ex Taq R-PCR custom

SCN1A mutations were excluded by sequence analysis and (Takara Bio Inc., Otsu, Shiga, Japan) and the same primers designed

multiplex ligation-dependent probe ampliﬁcation (MLPA). More- for radiolabeled RFLP were used (see above).

over, an array-CGH analysis was performed because of persisting The reaction was run in a ﬁnal volume of 25 ml, containing

clumsiness and cognitive impairment. 100 ng genomic DNA, 1 PCR buffer, 1.5 mM MgCl2, 0.2 mM

dNTPs, 300 nM of each primer, 1.5 mM EvaGreen (Biotium,

3. Materials and methods Hayward, CA) 1.25 IU Taq DNA polymerase (Takara Bio). PCR

was performed in triplicate for each sample and cycling conditions

3.1. DNA extraction were: 95 8C 3 min and 40 cycles 95 8C 30 s, 57 8C 30 s, 72 8C 30 s.

A 280 base-pair DNA fragment within the NF1 gene (forward:

Genomic DNA of the proband and his parents was extracted ATTCCTTCTGAAAACCAAGG and reverse: AAGGCAGACTGAGCTTA-

from peripheral blood using a High Pure PCR Template Preparation CAG) was used as a reference amplicon.

Kit (Roche Diagnostics GmbH, Mannheim, Germany). Gene dosage was determined using Comparative Quantitation

software (Corbett Research) which calculates the ampliﬁcation

3.2. Array-CGH analysis rate on the basis of the increase in ﬂuorescence during the PCR

exponential phase and determines the take off point that is the last

Molecular karyotyping was performed through array-CGH with point before the signal emerges from the noise level as described in

the Agilent Human Genome CGH Microarray Kit 244A, which the 2002 technical bulletin ‘‘An explanation of the comparative

consists of 236,000 60-mer oligonucleotide probes covering the quantitation technique used in the Rotor-Gene analysis software’’

entire genome with an overall median probe spacing of 8.9 kb (M. Hermann, Corbett Research).

(7.4 kb in Refseq genes). The slope of the line from the take off point until exponential

Briefly, 500 ng of DNA from the test and a sex-matched pooled amplification stops is used to calculate the amplification efficiency.

normal reference (Promega, Madison, WI, USA) were double- The quantiﬁcation of test genes relative to a designated control

digested with RsaI (Promega) and AluI (Promega) for 2 h at 37 8C one was then calculated using the formula: (E)^[(control take-off

according to the manufacturer’s protocol. point) (sample take-off point)] where (E) is the ampliﬁcation

The digested samples were labeled by random priming using an efﬁciency.

Agilent labeling kit (Agilent Technologies, Santa Clara, CA, USA) The experiments were repeated ﬁve times and the average

according to the manufacturer’s instructions. Patient and reference comparative concentration in the gene tested was calculated.

DNAs were labeled with Cy5-dUTP and Cy3-dUTP, respectively.

Labeled products were puriﬁed using Microcon YM-30 ﬁlter units 4. Results

(Millipore, Billerica, MA, USA).

Patient and control DNAs were combined and mixed with Cot-1 Array-CGH analysis detected a log ratio = 0.3 at the level of

DNA (Invitrogen) blocking agent and hybridization buffer follow- chromosome 2q23.3q24.3 (154370122 bp–166384278 bp) sug-

ing the protocol provided by Agilent. After denaturation at 95 8C gesting that there was a duplication of the region spanning about

and pre-annealing at 37 8C, hybridization was performed at 65 8C 12.01 Mb (Fig. 1). Since a non-mosaic duplication would have

with rotation for 24 h. given a log ratio of 0.58 (log2 3/2), a value of 0.3 means that 51% of

After two washing steps, the array was analyzed using an the cells carry the duplication (0.3/0.58) (Fig. 1).

Agilent scanner (G2505C) and Feature Extraction software Two different experiments – a Real-Time quantitative PCR and a

V.10.1.1.1. A graphical overview of the results was obtained using densitometric analysis of a radiolabeled RFLP – were carried out to

DNA Analytics software V.4.0.76. DNA sequence information refers conﬁrm the array-CGH data.

to the public UCSC database [Human Genome Browser, March A RFLP analysis on radiolabeled PCR was performed to conﬁrm

2006, assembly hg18 (NCBI Build 36.1)]. mosaicism of the duplication, to deﬁne its value, and to determine

the allele in which the alteration arose. The ‘‘last cycle hot’’

3.3. Radiolabeled RFLP procedure avoids the formation of heteroduplexes which can lead

to imprecision in the quantitation of individual alleles. The unique

The entire hypothetic duplicated region was screened using polymorphism situated in the region of interest resulting both

NCBI dbSNP (http://www.ncbi.nlm.nih.gov/snp/) to ﬁnd a high- heterozygous in the patient and detectable by RFLP was tested. An

frequency single nucleotide polymorphism (SNP) that can intro- intra-lane comparison between the values obtained from cut and

M. Vecchi et al. / Seizure 20 (2011) 813–816 815

Fig. 1. Array-CGH; graphical output of mosaic duplication in 2q23.3q24.3. (A) Chromosome view. (B) Gene view (the genes potentially involved in the described phenotype

are highlighted).

uncut bands (T and G, respectively), that stay for the fraction Array-CGH analysis suggested the presence of a mosaic

representing the two different alleles in each single ampliﬁcation 2q23.3q24.3 duplication (about 12 Mb). Additional analyses

(G + T = 1.00), were performed using a densitometric test. In a (radiolabeled RFLP and quantitative PCR) conﬁrmed the mosaicism

normal heterozygous sample we observed the expected values of of the duplication, deﬁned its value, and determined from which

about 50% (0.50) for each band. In the proband, the uncut band (G) allele the alteration arose. These techniques, which are not

was about 70% (0.70) and the cut band (T) was about 30% (0.30) of routinely used for the characterization of genomic anomalies

the total ampliﬁcation. These data indicate that the G-variant allele identiﬁed by array-CGH analysis, detected the duplication in the

was duplicated in about 40% (0.40) of the cells, and the formula fraction between 40 and 51% of blood cells.

used to calculate it was: The duplication identiﬁed in our patient involves SCN2A and

SCN3A genes.

G allele : 2a 0:5 þ ð1 aÞ 0:5 ¼ G SCN1A, SCN2A and SCN3A, a cluster of genes localized at 2q24.3,

encode the alpha subunits of three voltage gated sodium channels

(Nav1.1, Nav1.2, Nav1.3) expressed in the central nervous system.

T allele : 1 ½2a 0:5 þ ð1 aÞ 0:5 ¼ T

Voltage gated sodium channels are also fundamental to the

where a is the fraction of cells with duplication. generation and propagation of action potentials in the brain and

These formulas describe the fraction of each single allele in a muscle cells. Mutations of these three genes have been described

heterozygous state. In this case, since the G fraction was 0.70, the a in patients with seizure disorders including generalized epilepsy

value was 0.40 or 40% of the duplicate cells (in a normal with febrile seizures plus (GEFS+, OMIM no. 604233), severe

heterozygous state, the a value should be 0 and the G value myoclonic epilepsy in infancy (SMEI or Dravet syndrome; OMIM

should be 0.50). The duplicate allele was found to be paternal, since no. 607208), borderline SMEI (SMEB) and benign familial neonatal-

the patient’s father was homozygous for the G variant, while the infantile seizures (BFNIS).

mother was heterozygous (G/T). Duplications involving SCN genes on 2q24.3 chromosome have

The result of Real-Time quantitative PCR was 1.222 0.118. A been observed in only a few cases until now. Marini et al.

sample with no duplication produces a value of 100% (1.00 or 2/2), reported on a family with classical Dravet syndrome and an

while an increased value of 50% (1.50 or 3/2) means that duplication intragenic duplication of SCN1A. A duplication involving SCN2A,

involves all the cells. The increment of 22.2% according to our data SCN3A and the last exon of SCN1A was recently identiﬁed in a

indicates that 44% of the cells were involved in duplication (1.222 or patient with ‘‘familial neonatal seizures and intellectual disabili-

11 12

2.444/2). ty’’. Raymond et al. have, moreover, described a female patient

with neonatal-infantile epilepsy and a 2 Mb duplication at 2q24.3

5. Discussion including SCN1A, SCN2A and SCN3A.

In this report we described the ﬁrst case of an epileptic patient

We reported the case of a child with atypical epileptic with a genomic duplication involving SCN2A and SCN3A and

syndrome: while the type of seizure, the drug response, and the excluding SCN1A.

time of onset are similar to the ﬁndings observed in BFNIS, our As missense, gain of function mutations of SCN2A and SCN3A,

proband presented seizure recurrence at the age of two years with leading to increased sodium current, have been previously

3,4,13

intellectual disability and motor impairment, characteristic of the reported in patients with epilepsy, duplication of these two

Dravet syndrome. genes could potentially result in an increased expression of their

816 M. Vecchi et al. / Seizure 20 (2011) 813–816

hyperexcitability in hippocampal neurons. Experimental Neurology

transcript with subsequent increased sodium current and neuronal 2010;224:362–8.

excitability.

5. Aridon P, Marini C, Di Resta C, Brilli E, De Fusco M, Politi F, et al. Increased

The other genes included in the duplication with a possible role sensitivity of the neuronal nicotinic receptor alpha 2 subunit causes familial

epilepsy with nocturnal wandering and ictal fear. American Journal of Human

in the pathogenesis of neurological anomalies are KCNJ3,

Genetics 2006;79:342–50.

KIAA1189, TANC1, TBR1, SLC4A10, KCNH7 and COBLL1. All these

6. Lachance-Touchette P, Brown P, Meloche C, Kinirons P, Lapointe L, Lacasse H,

genes have been shown to be expressed in the brains of humans et al. Novel a1 and g2 GABAA receptor subunit mutations in families with

idiopathic generalized epilepsy. The European Journal of Neuroscience 2011. and experimental animals. In particular, SLC4A10 is a sodium

10.1111/j. 1460-9568.2011.07767.x.

bicarbonate transporter gene and was recently found to be

7. Shi X, Yasumoto S, Nakagawa E, Fukasawa T, Uchiya S, Hirose S. Missense

disrupted in a balanced reciprocal translocation t(2;13)(q24;q31) mutation of the sodium channel gene SCN2A causes Dravet syndrome. Brain

14,15

or deleted in patients with seizures and mental impairment. Development 2009;31:758–62.

8. Karadimas CL, Salviati L, Sacconi S, Chronopoulou P, Shanske S, Bonilla E, et al.

In conclusion, the array-CGH analysis is mandatory for children

Mitochondrial myopathy and ophthalmoplegia in a sporadic patient with the

presenting with epilepsy and psychomotor retardation even

G12315A mutation in mitochondrial DNA. Neuromuscular Disorders

without dysmorphisms or other clinical features suggesting a 2002;12:865–8.

9. Forzan M, Salviati L, Pertegato V, Casarin A, Bruson A, Trevisson E, et al. Is CFTR

speciﬁc genetic/epileptic syndrome. The analysis must neverthe-

621 + 3 A > G a cystic ﬁbrosis causing mutation? Journal of Human Genetics

less be performed taking into account the possibility of a 2010;55:23–6.

mosaicism (i.e. analyzing DNA extracted from several tissues 10. Marini C, Scheffer IE, Nabbout R, Mei D, Cox K, Dibbens LM, et al. SCN1A

duplications and deletions detected in Dravet syndrome: implications for

and conﬁrming the obtained results with different techniques).

molecular diagnosis. Epilepsia 2009;50:1670–8.

Moreover, molecular analysis of SCN2A and SCN3A genes

11. Heron SE, Scheffer IE, Grinton BE, Eyre H, Oliver KL, Bain S, et al. Familial

should be performed in those children with no features of any neonatal seizures with intellectual disability caused by a microduplication of

chromosome 2q24.3. Epilepsia 2010;51:1865–9.

speciﬁc epileptic syndrome described in the literature.

12. Raymond G, Wohler E, Dinsmore C, Cox J, Johnston M, Batista D, et al. An

interstitial duplication at 2q24.3 involving the SCN1A, SCN2A, SCN3A genes

References

associated with infantile epilepsy. American Journal of Medical Genetics Part A

2011;155:920–3.

1. Davidsson J, Collin A, Olsson ME, Lundgren J, Soller M. Deletion of the SCN gene 13. Scalmani P, Rusconi R, Armatura E, Zara F, Avanzini G, Franceschetti S, et al.

cluster on 2q24.4 is associated with severe epilepsy: an array-based genotype– Effects in neocortical neurons of mutations of the Nav1.2 Na channel causing

phenotype correlation and a comprehensive review of previously published benign familial neonatal-infantile seizures. The Journal of Neuroscience

cases. Epilepsy Research 2008;81:69–79. 2006;26:10100–9.

2. Kamiya K, Kaneda M, Sugawara T, Mazaki E, Okamura N, Montal M, et al. A 14. Gurnett CA, Veile R, Zempel J, Blackburn L, Lovett M, Bowcock A. Disruption

nonsense mutation of the sodium channel gene SCN2A in a patient with intrac- of sodium bicarbonate transporter SLC4A10 in a patient with complex

table epilepsy and mental decline. The Journal of Neuroscience 2004;24:2690–8. partial epilepsy and mental retardation. Archives of Neurology 2008;65:

3. Holland KD, Kearney JA, Glauser TA, Buck G, Keddache M, Blankston JR, et al. 550–3.

Mutation of sodium channel SCN3A in a patient with cryptogenic pediatric 15. Krepischi AC, Knijnenburg J, Bertola DR, Kim CA, Pearson PL, Bijlsma E, et al.

partial epilepsy. Neuroscience Letters 2008;433:65–70. Two distinct regions in 2q24.2-q24.3 associated with idiopathic epilepsy.

4. Estacion M, Gasser A, Dib-Hajj SD, Waxman SG. A sodium channel mutation Epilepsia 2010;51:2457–60.

linked to epilepsy increases ramp and persistent current of Nav1.3 and induces