The Journal of Immunology

Lysozyme-Modified Probiotic Components Protect Rats against Polymicrobial Sepsis: Role of and -Related Innate Immunity1

Heng-Fu Bu,*† Xiao Wang,*† Ya-Qin Zhu,*‡ Roxanne Y. Williams,* Wei Hsueh,† Xiaotian Zheng,† Ranna A. Rozenfeld,‡ Xiu-Li Zuo,† and Xiao-Di Tan2*†‡

Severe sepsis is associated with dysfunction of the /, an important cellular effector of the . Previous investigations suggested that probiotic components effectively enhance effector cell functions of the immune system in vivo. In this study, we produced bacteria-free, -modified probiotic components (LzMPC) by treating the probiotic bacteria, Lactobacillus sp., with lysozyme. We showed that oral delivery of LzMPC effectively protected rats against lethality from polymicrobial sepsis induced by cecal ligation and puncture. We found that orally administrated LzMPC was engulfed by cells such as macrophages in the liver after crossing the intestinal barrier. Moreover, LzMPC-induced protection was associated with an increase in bacterial clearance in the liver. In vitro, LzMPC up-regulated the expression of cathelicidin-related antimicrobial (CRAMP) in macrophages and enhanced bactericidal activity of these cells. Furthermore, we demonstrated that surgical stress or cecal ligation and puncture caused a decrease in CRAMP expression in the liver, whereas enteral admin- istration of LzMPC restored CRAMP expression in these animals. Using a neutralizing Ab, we showed that protection against sepsis by LzMPC treatment required endogenous CRAMP. In addition, macrophages from LzMPC-treated rats had an enhanced capacity of cytokine production in response to LPS or LzMPC stimulation. Together, our data suggest that the protective effect of LzMPC in sepsis is related to an enhanced cathelicidin-related innate immunity in macrophages. Therefore, LzMPC, a novel probiotic product, is a potent immunomodulator for macrophages and may be beneficial for the treatment of sepsis. The Journal of Immunology, 2006, 177: 8767–8776.

evere sepsis is a serious and extremely costly medical potent anti-inflammatory mediators, which often results in the de- problem in the U.S. The disease develops in Ͼ750,000 sensitization of effector cells (such as phagocytes) and the devel- S people annually, and ϳ30% of them die (1, 2). It is often opment of immunosuppression. Both the excessive inflammation caused by infection of commensal bacteria derived from mucosal and the profound immunosuppression are major determinants to an or surfaces. In past decades, extensive efforts have been made adverse clinical outcome in sepsis. Furthermore, physiological to understand how microbes trigger the innate immune response to functions of cellular effectors of the innate immune system such as infections and the pathophysiology of sepsis (3, 4). We have macrophages/ and are altered in sepsis. learned that the innate immune system (including humoral and Recently, several investigations suggested that modulation of cellular components) is in a dynamic state during sepsis (reviewed immune cell function might be a novel therapeutic strategy for in Refs. 3, 5, and 6). The sepsis syndrome is associated with an attenuation of sepsis (7–12). initially overwhelming innate immune response, characterized by Cathelicidin is a protein stored in granules as inactive propep- unabated activation and release of proinflammatory mediators, i.e., tide precursors in polymorphonuclear leukocytes (PMN)3 and humoral effectors. Subsequently, the exaggerated systemic inflam- monocytes/macrophages (13–15). Upon stimulation, cathelicidin matory response is counterbalanced by a sustained expression of is released from phagocytes. After release, the C-terminal end of cathelicidin is processed into active . It has been demon- strated that human and rodent phagocytes express a single cathe- *Molecular and Cellular Pathobiology Program, Children’s Memorial Research Cen- licidin peptide, namely, hCAP-18/LL-37 in humans and cathelici- ter, Children’s Memorial Hospital, Chicago, IL 60614; †Department of Pathology, din-related antimicrobial peptide (CRAMP) in rodents (16, 17). ‡ Feinberg School of Medicine, Northwestern University, Chicago, IL 60611; and De- hCAP-18/LL-37 and CRAMP are effective killers of a variety of partment of Pediatrics, Feinberg School of Medicine, Northwestern University, Chi- cago, IL 60611 bacteria, including Escherichia coli, Pseudomonas aeruginosa, Received for publication March 27, 2006. Accepted for publication October 4, 2006. and Staphylococcus aureus (14, 16–19). CRAMP has been shown The costs of publication of this article were defrayed in part by the payment of page to impair intracellular replication of pathogens (20). Apart from its charges. This article must therefore be hereby marked advertisement in accordance antimicrobial properties, hCAP-18/LL-37 has also been demon- with 18 U.S.C. Section 1734 solely to indicate this fact. strated to neutralize LPS and protect mice from LPS lethality (14, 1 This work was supported in part by Excellence in Academic Medicine Award from 18). CRAMP-deficient mice are susceptible to severe bacterial in- Illinois Department of Public Aid (to X.-D.T.), Grant R01DK064240 (to X.-D.T.) from National Institutes of Health, and Eloise and Warren Batts Investigator Chair (to fection (21). Administration of hCAP-18/LL-37 protects against X.-D.T.). X.-L.Z. is a visiting scholar supported by Department of Gastroenterology, sepsis in neonatal rats (22). Thus, cathelicidin-related peptides Qilu Hospital, Medical College of Shandong University, Jinan, Shandong, People’s Republic of China. 2 Address correspondence and reprint requests to Dr. Xiao-Di Tan, Molecular and 3 Abbreviations used in this paper: PMN, polymorphonuclear leukocyte; CRAMP, Cellular Pathobiology Program, Children’s Memorial Research Center, Children’s cathelicidin-related antimicrobial peptide; CLP, cecal ligation and puncture; DAPI, Memorial Hospital, 2300 Children’s Plaza, Box 217, Chicago, IL 60614. E-mail 4Ј,6Ј-diamidino-2-phenylindole; LzMEcC, lysozyme-modified E. coli component; address: [email protected] LzMPC, lysozyme-modified probiotic component; pAb, polyclonal Ab.

Copyright © 2006 by The American Association of Immunologists, Inc. 0022-1767/06/$02.00 8768 REGULATION OF INNATE IMMUNE EFFECTOR BY PROBIOTIC COMPONENTS

play an important role in the maintenance of protective innate min. Then it was cooled down to room temperature and centrifuged at immunity. 10,000 ϫ g for 30 min at 4°C. The supernatant (i.e., LzMPC or LzMEcC) Probiotics are nonpathogenic microorganisms, which confer was used in various in vivo experiments in the present study. In preps used for in vivo experiments, 1 ml of LzMPC contains probiotic components benefits to the host when administrated in sufficient amounts (23). derived from 109 bacteria. The LzMPC prep was gavaged to rats at a dose Previous studies have shown that oral administration of probiotics of 10 ml/kg. modulates intestinal immunity, improves the balance of the gut Preparation of preps for in vitro experiments. Fresh cultured bacteria (1 microflora, enhances the recovery of the disturbed gut mucosal g) were washed with PBS and digested with lysozyme (2 mg/ml) in PBS, barrier, and prevents microbial translocation (23, 24). Experimen- as described above. After the digestion, cells were processed for centrifu- gation at 7000 ϫ g for 30 min at 4°C. The supernatant was collected, and tal and clinical studies have provided evidence for the possible use cell pellets were discarded. To inactivate lysozyme, the supernatant was of probiotics in several inflammatory diseases, including inflam- boiled for 30 min. Then it was cooled down to room temperature and matory bowel disease, enteritis, diarrhea, and pancreatitis (24–27). centrifuged at 10,000 ϫ g for 30 min at 4°C. The supernatant was col- In addition, studies have shown that the protective effect of pro- lected, processed for column chromatography on a Detoxi-gel to remove ␮ biotics is not limited to the gut (24, 28, 29). However, enteral endotoxin from the prep, and then filtrated through a 0.2- m filter before applying to in vitro experiments. An aliquot of preps was routinely pro- delivery of intact probiotic bacteria has not been shown to prevent cessed for Limulus amebocyte lysate assay to ensure no contamination with sepsis. Although probiotics have been suggested to enhance natu- endotoxin. Our preliminary data showed that LzMPC prep activates mac- ral and acquired immunity, it is unclear whether their effects are rophages at a dose of 10 ␮l/ml. associated with cathelicidin-related innate immunity. There have been a few reports indicating that heat-killed probiotics or their Polymicrobial sepsis induced by cecal ligation cell wall fractions effectively enhance effector cell functions of the and puncture (CLP) immune system in vivo (30–32). Despite these promising results, The CLP procedure was modified from previously described protocols (36, the effect of probiotic components in the prevention and treatment 37). All surgical instruments were steam autoclaved. Male Sprague Dawley of sepsis has not been investigated. In this study, we sought to use rats (120–150 g) were purchased from Harlan Sprague-Dawley. They were anesthetized by i.p. injection of Nembutal (65 mg/kg) and placed under a probiotic bacteria treated in vitro with lysozyme, an enzyme break- heating lamp. A 2-cm midline incision was made through the abdominal ing down bacterial cell walls and releasing bacterial cell wall com- wall. The cecum was identified and removed from the abdominal cavity. ponents. Then we tested the hypothesis that oral delivery of ly- The distal portion (30%) of the cecum was ligated with 5-0 silk suture. The sozyme-modified probiotic components (LzMPC) modulates the ligated cecum was then punctured twice with an 18-gauge needle and innate immunity and protects against sepsis-induced lethality in slightly compressed with an applicator until a small amount of stool ap- peared. On sham-operated animals, the cecum was manipulated, but with- rats. We also sought to determine the tissue uptake of LzMPC and out ligation and puncture. Thereafter, the cecum was replaced in the peri- study whether LzMPC targets macrophages. Furthermore, we in- toneum. The incision was closed using a two-layer procedure: 5-0 silk vestigated the mechanism of LzMPC action by examining the reg- suture on the muscle layer and surgical staples (9 mm) on the skin. Rats ulatory effect of LzMPC on the cathelicidin-related innate immune were monitored and weighed on a daily basis until the end of the experi- ments. The protocol was approved by the Institutional Animal Care and capacity of macrophages and studied whether CRAMP mediates Use Committee. the protective effect of LzMPC on sepsis. Bacterial load of liver tissues Materials and Methods Materials Rats were sacrificed 3 days after CLP. Liver tissues were collected, weighed, extensively washed with sterile PBS four times, and homoge- All cell culture medium was obtained from Invitrogen Life Technologies. nized in sterile PBS (1 ml/g). Serial dilutions of liver homogenates in PBS Lactobacillus sp. (ATCC 53103) and E. coli (ATCC 25922) strains were were placed on Luria-Bertani agar plates. Bacteria colonies were counted obtained from American Type Culture Collection. Chicken egg white ly- after incubation overnight at 37°C. Bacterial counts were expressed as sozyme (Sigma-Aldrich; L-6876), chemicals, and molecular biology re- CFU/g tissue. agents were purchased from Sigma-Aldrich. Limulus amebocyte lysate as- say for measuring endotoxin contents was obtained from Cambrex. Fluorescent labeling of LzMPC prep with BacLight Green Stain BacLight Green Stain was provided by Molecular Probes. Rat TNF-␣ QuantiKine Colormetric Sandwich ELISA Kit was purchased from R&D The BacLight Green Stain is a nonnucleic acid fluorescent labeling reagent. Systems. RNA extraction kit and real-time PCR reagents were supplied by It has a high affinity to the bacterial cell wall. The reagent is nonfluorescent Qiagen. PCR primers were synthesized from Integrated DNA Technolo- when not associated with bacteria or cell wall components. The protocol ␮ gies. All tissue culture plasticwares were supplied by Costar. Goat poly- suggested by the manufacturer was followed. Briefly, 1 l of working dye clonal Ab (pAb) against rat CRAMP (catalog SC-34170) was purchased solution was added into 1 ml of LzMPC prep, followed by incubation of from Santa Cruz Biotechnology. The Ab used for in vivo neutralization of samples at room temperature for 15 min. The intensity of fluorescence in CRAMP did not contain sodium azide and gelatin. the labeled LzMPC was determined with LS55 Luminescence Spectrom- eter (PerkinElmer) with excitation at 480 nm and emission at 516 nm to Preparation of LzMPC and lysozyme-modified E. coli ensure labeling efficiency. components (LzMEcC) Preparation and examination of tissue sections for determining Lactobacillus sp. was used for preparation of LzMPC. Lactobacillus is a bacterial genus, which is the most often used probiotic (33). The safety and tissue uptake of LzMPC labeled with BacLight Green Stain the risk-to-benefit ratio of Lactobacillus have been carefully studied and The labeled LzMPC (450,000 fluorescent U/kg) was gavaged to rats. At the assessed (34, 35). Previous studies have shown that enteral administration end of the experiments, the rats were sacrificed. Tissues were extensively of cell wall components of Lactobacillus provides enhancement of immu- washed with cold saline, embedded into the OCT compound, and snap nity in animals (28, 31). Thus, this commercially available strain was used frozen in liquid nitrogen. Cryosections were cut at 10 ␮m, postfixed in 10% in this study. The bacteria were cultured in Lactobacillus MRS broth neutral buffered formalin for 10 min, washed with PBS, and mounted in (Difco 0881) at 37°C with 5% CO2. A commensal E. coli strain was used VECTASHIELD Mounting Medium with 4Ј,6Ј-diamidino-2-phenylindole for LzMEcC. The E. coli bacteria were cultured in Luria-Bertani medium (DAPI; Vector Laboratories). Slides were visualized under an upright flu- at 37°C. orescence microscope (model MD R; Leica Microsystems). The filter set Preparation of preps for in vivo experiments. Fresh cultured bacteria for fluorescein was used for detecting LzMPC labeled with BacLight Green (1011 CFU) were washed with PBS (pH 7.0) three times, suspended in 100 Stain in cells, and the filter set for DAPI was used for visualizing nuclei. ml of PBS (pH 7.0) containing lysozyme (2 mg/ml), and incubated at 37°C Images were acquired with a digital camera (model C4742-95; Hamamatsu). for 60 min. After the digestion, cell suspension was centrifuged at 7000 ϫ They were transferred to a G4 Macintosh computer (Apple Computer), ana- g for 30 min at 4°C. Supernatant was collected and cell pellets were dis- lyzed by the image-analysis software Openlab, and assembled with software carded. To inactivate lysozyme, supernatant was heated at 100°C for 30 Adobe Photoshop 8.0. The Journal of Immunology 8769

Isolation of peritoneal residential macrophages Western blotting (41)

Rats were sacrificed with inhalation of CO2 and used for isolation of peri- Total cellular protein was isolated from macrophages, resolved on 4–20% toneal residential macrophages. The protocol described by Davies and Gor- SDS-PAGE gel, and transferred onto a nitrocellulose membrane, as de- don (38) was followed. Briefly, the peritoneum was lavaged with cold scribed previously (42). The membranes containing sample proteins were serum-free RPMI 1640 several times. The exudate cells were washed and used for immunodetection of CRAMP protein. Briefly, blots preincubated plated at 1 ϫ 106 cells/ml in cell culture plates. After incubation for2hat with PBS containing 5% nonfat dry milk (Bio-Rad; 170-6404) were re-

37°C in a humidified air atmosphere containing 5% CO2, nonadherent cells acted with primary Ab against CRAMP (1:100) for1hatroom tempera- were removed by washing with HBSS buffered with 10 mM HEPES. Cells ture. After incubation, the blot was washed four times with PBS containing were then cultured with RPMI 1640 medium with 10% FBS overnight and 0.05% Tween 20 (PBS-T), and then incubated with PBS-T containing used for various experiments. 1/2,000 diluted HRP-conjugated donkey anti-goat IgG for1hatroom temperature. After additional washing with PBS-T, immune complexes Rat PMN isolation on the blot were visualized by the ECL system. Blots were stripped and ␤ A standard method in our laboratory was used (39). Briefly, rats were reprobed with mAb against -actin (1/10,000) following a standard injected i.p. with 10 ml of 10% casein (in sterile water) under anesthesia. procedure (43). After 4 h, the peritoneal cavity was lavaged with 10 ml of sterile Hank’s Statistics salt solution, centrifuged at 500 ϫ g. Contaminated RBC were removed by hypotonic shock. Then the cells were resuspended in DMEM with 10% Data are expressed as means Ϯ SEM. ANOVA and one-way ANOVA, FBS, counted, and used. PMNs were Ͼ95% pure, as assessed by May- followed by Fisher’s least significant difference post hoc test were used to Giemsa staining. assess the significant of differences; p Ͻ 0.05 was considered significant. Survival was analyzed and plotted by the Kaplan-Meier method using Macrophage bactericidal assay GraphPad Prism version 4.0 for Macintosh (GraphPad). Intracellular bacterial killing was determined with a method described by Hamrick et al. (40). Briefly, macrophages were exposed to E. coli at 37°C Results for 15 min with a multiplicity of infection rate at 10 bacteria per macro- Preparation and characterization of LzMPC phage. Extracellular bacteria were removed by washing twice with PBS and further killed by culturing macrophages with RPMI 1640 containing 5 LzMPC were prepared from Lactobacillus sp. (ATCC 53103), a ␮ g/ml gentamicin for 30 min. Then wells were randomly named as T0 (for probiotic strain isolated from human feces, with a protocol de- determining initial count Tinitial) and T90 (for determining final count Tfinal), scribed in Materials and Methods. LzMPC prep contains heat- respectively. In T0 wells, the medium was discarded and macrophages stable molecules and is free of bacteria. LzMPC used for in vitro were lysed with 0.1% Triton X-100. Cell lysates were immediately used to studies was further subjected to column chromatography on a De- determine remaining intracellular bacterial counts by incubation of serial 10-fold dilutions of the lysates on Luria-Bertani agar plates at 37°C for toxi gel to remove endotoxin from the prep. To ensure removal of

24 h. In T90 wells, cells were cultured with RPMI 1640 for an additional endotoxin from the prep, LzMPC was processed for the Limulus 90 min and then processed for determining intracellular bacterial counts amebocyte lysate assay. LzMPC used for cell culture experiments with the same procedure as for T0 wells described above. The intracellular contained Ͻ0.4 EU/ml endotoxin. As a control for LzMPC, we bacterial killing efficiency was determined as follows: percentage of kill- ϭ ϫ also prepared components named LzMEcC using a commensal ing (Tinitial – Tfinal)/Tinitial 100. bacteria strain (ATCC 25922) utilizing the same procedure. Isolation of RNA, reverse transcription, and conventional and real-time RT-PCR LzMPC specifically protects against sepsis-induced lethality in rats Total RNA from rat liver or peritoneal macrophages was extracted with an RNeasy Mini Kit (Qiagen). The protocol provided by the manufacturer was To investigate the role of LzMPC in sepsis in vivo, a polymicrobial followed. Exactly 1 ␮g of total RNA from each tissue was annealed at sepsis model of CLP was used (44). The CLP procedure involves 42°C with random hexamers for 30 min in the iScript reaction mix (Bio- surgical stress and triggers disseminated infection. It leads to de- Rad) containing dNTP and1UofMoloney murine leukemia virus-derived iScript reverse transcriptase (Bio-Rad), which was preblended with RNase velopment of peritonitis, bacteremia, and polymicrobial sepsis. In inhibitor. The resulting cDNA was then amplified with the specific primers many respects, this model mimics the clinical course of sepsis for rats. For conventional PCR, the primers for the rat housekeeping gene in humans (45, 46). Thus, this model was used in the present Ј GAPDH are as follows: forward, 5 -TGAAGGTCGGAGTCAACGGATT study. To test the hypothesis that oral delivery of LzMPC pro- TGGT-3Ј and reverse, 5Ј-CATGTGGGCCATGAGGTCCACCAC-3Ј. The primers for the rat target gene CRAMP are as follows: forward, 5Ј-TCT vides protection against sepsis-induced lethality, we randomly GAGCCCCAAGGGGATGAGGA-3Ј and reverse, 5Ј-CCAAGGCAGGC assigned rats to either an experimental or several control CTACTGCTCTAT-3Ј. PCR was performed with a melting temperature of groups, including the following: 1) LzMPC ϩ CLP (i.e., ex- 94°C for 30 s, followed by annealing at 61°C for 30 s, extension at 72°C perimental group, enteral administration of LzMPC and opera- for 1 min for a total of 35 cycles, and then a final extension at 72°C for 7 tion with CLP; n ϭ 18); 2) vehicle ϩ CLP (enteral adminis- min. The PCR products were separated on a 2% agarose gel and photo- ϭ graphed using Alpha Imager 2200 (Alpha Innotech). In some experiments, tration of vehicle and operation with CLP; n 18); 3) viable the resulting cDNA was also amplified by quantitative RT-PCR, using the Lactobacillus ϩ CLP (enteral administration of Lactobacillus 7500 real-time PCR system (Applied Biosystems). Two microliters of (109 CFU/gavage) and operation with CLP; n ϭ 10); 4) cDNA product and QuantiTect SYBR Green PCR kit (Qiagen) were used LzMEcC ϩ CLP (enteral administration of LzMEcC and oper- to perform the PCR. Rat 18S housekeeping gene primers are as follows: ϭ forward, 5Ј-TTG ATT AAG TCC CTG CCC TTT GT-3Ј and reverse, ation with CLP; n 10); and 5) sham operated (enteral admin- 5Ј-CGA TCC GAG GGC CTA ACT A-3Ј. The rat CRAMP target gene istration of vehicle and sham surgery; n ϭ 6). The enteral ad- primers are as follows: forward, GCGCTCACTGTCACTGCTAT and re- ministration of vehicle or bacterial components and CLP were verse, 5Ј-GTCCAAAGACTGCTGGTTGA-3Ј. These primers were used conducted using a protocol described in Fig. 1A. Survival was with the following thermal cycle profile: initiation step at 50°C for 5 min, monitored for 9 days after CLP or sham surgery. In vehicle ϩ hold at 95°C for 10 min, 40 cycles of 95°C for 15 s, and 60°C for 1 min ϩ for annealing and extension. Data were analyzed with 7500 SDS software. CLP and LzMEcC CLP groups, as shown in Fig. 1B, survival was 83 and 80%, respectively, 24 h after CLP. This diminished ELISA for quantitation of TNF in conditioned medium progressively each day until day 6, at which time only 33 and Conditional medium from macrophage culture was collected, and TNF was 40% were alive, respectively, in these groups. LzMPC mark- detected using rat TNF-␣ Quantikine colorimetric sandwich ELISA kit, as edly improved the survival. In the LzMPC ϩ CLP group, ϳ15% described previously (41). The protocol provided by the manufacturer was followed. Standard curves were generated for TNF using the standard pro- of rats died by day 1 and 75% of animals survived by day 9 after vided in the kit, and the concentration of TNF in the cell supernatant was the CLP challenge. In contrast, 60% of animals in alive Lacto- determined by interpreting from the appropriate standard curve. bacillus ϩ CLP group died within 9 days after CLP. All rats in 8770 REGULATION OF INNATE IMMUNE EFFECTOR BY PROBIOTIC COMPONENTS

FIGURE 1. LzMPC protects rats against polymicrobial sepsis-induced lethality. A, Pro- tocol for delivery of LzMPC and induction of sepsis by CLP. Rats were gavaged with vehi- cle, LzMPC, or other bacteria components, and subjected to CLP at time points indicated in the figure. B, Survival rate of animals after CLP. Rats were randomly assigned to four groups, including the following: 1) LzMPC ϩ CLP, n ϭ 18; 2) vehicle ϩ CLP, n ϭ 18; 3) alive Lactobacillus (LB) ϩ CLP, n ϭ 10; and 4) LzMEcC ϩ CLP, n ϭ 10. The protocol shown in A was used for enteral administration of vehicle or bacterial components and con- ducting CLP. An 18-gauge needle was used for puncturing the cecum in CLP. Survival was p Ͻ 0.05 ,ء .monitored for 9 days after CLP compared with the vehicle ϩ CLP group. C and D, Enteral delivery of LzMPC does not preserve rat intestinal mucosa in polymicrobial sepsis. Rats were subjected to vehicle ϩ CLP or LzMPC ϩ CLP treatment, as described in A. Tissues of the small intestine were taken from animals on day 3 after CLP for histological examination. Typical sections are shown in vehicle ϩ CLP (C), and LzMPC ϩ CLP (D). H&E staining, origi- nal magnification ϫ100. the sham-operated group survived during the 9-day interval sections of the liver from rats 16 h after enteral feeding with the (data not shown). labeled LzMPC. As illustrated in Fig. 3, particles with green flu- In addition, small intestinal tissue samples were taken from orescence were found in the liver sinusoids and cells in the liver LzMPC ϩ CLP and vehicle ϩ CLP groups on day 3 after CLP for sections from rats fed with LzMPC labeled with BacLight Green histological examination. We found extensive small intestinal in- Stain (Fig. 3A). Some of these cells displayed a distinct morphol- jury in animals from both groups (Fig. 1, C and D). ogy of Kupffer cells (Fig. 3B), the residential macrophages in the Taken together, the data indicated that oral administration of liver. In contrast, the green fluorescent signal was barely found in LzMPC protected rats against CLP-induced death, whereas oral the liver sections from normal control animals (Fig. 3C). The data delivery of LzMEcC or live probiotics was ineffective. However, indicated the uptake of LzMPC into the liver and macrophages. enteral delivery of LzMPC did not ameliorate intestinal injury in Furthermore, we examined cryosections of the small intestine sepsis or preserve mucosal barrier function. from rats 90 min after enteral feeding with the labeled LzMPC. This effort enabled us to identify labeled LzMPC at the early stages Oral administration of LzMPC enhances bacterial clearance in after it crossed the intact mucosal barrier. When comparing sec- the liver during post-CLP period tions from rats fed with labeled LzMPC with sections from con- Invasion by enteral commensal bacteria contributes to the devel- trols, cells throughout the lamina propria contained particles with opment of sepsis in the CLP model. The level of the bacterial count in tissues is known to be associated with the severity of CLP- induced inflammatory response (45–47). Because the liver is a major organ responsible for bacterial clearance in abdominal in- fection, we examined whether the survival benefit afforded by LzMPC was related to bacterial elimination function in the liver. Briefly, rats were subjected to vehicle ϩ CLP or LzMPC ϩ CLP treatment, as described above. Livers were harvested 72 h after CLP and processed for measurement of bacterial load. As shown in Fig. 2, livers isolated from animals in vehicle ϩ CLP group (n ϭ 10) contained a substantial amount of bacteria. In contrast, the bacterial load in the liver of LzMPC ϩ CLP group (n ϭ 9) was markedly reduced ( p Ͻ 0.01). The data indicated that LzMPC treatment reduced bacterial load in sepsis.

Orally administrated LzMPC is engulfed by cells in the liver after crossing the intestinal barrier FIGURE 2. Effect of LzMPC treatment on bacterial clearance in the liver of septic rats. Rats were subjected to vehicle ϩ CLP (n ϭ 10) or Because oral administration of LzMPC results in the enhancement LzMPC ϩ CLP (n ϭ 9) treatment, as described in Fig. 1A. Livers were of bactericidal activity in the liver, we investigated whether harvested 72 h after CLP and processed for measurement of the bacterial p Ͻ 0.01 compared with ,ءء .LzMPC is translocated into the liver. To this end, we gavaged rats load, as described in Materials and Methods with BacLight Green-labeled LzMPC. Then we examined cryo- the vehicle ϩ CLP group. The Journal of Immunology 8771

FIGURE 4. LzMPC induces protective innate immunity of macrophage in vitro. A and B, LzMPC activates macrophages. Rat peritoneal macro- phages were treated with LzMPC (10 ␮l/ml) or vehicle for 6 h. The cells were examined under a microscope. Typical photographs are shown in LzMPC (A) and vehicle (B). Original magnification, ϫ400. C, LzMPC enhances macrophage’s bactericidal activity. Peritoneal macrophages were pretreated with LzMPC (10 ␮l/ml) or medium (control) overnight. Cells were then processed for a bacterial killing assay, as described in Materials and Methods. The mean Ϯ SEM of three experiments are shown; n ϭ 5 per .p Ͻ 0.05 compared with the vehicle group ,ء ;FIGURE 3. LzMPC is distributed in the liver after passing the intact group intestinal barrier. A–C, Uptake of LzMPC by liver cells. Rats were gavaged with LzMPC labeled with BacLight Green Stain. The control animals were fed with normal diet. Sixteen hours after enteral feeding, the liver tissues were sectioned with a cryostat. Slides were counterstained with DAPI, mation in rat macrophages, as compared with the control group followed by examination under a fluorescent microscope. Typical sections (Fig. 4B). are shown in rats fed with the labeled LzMPC (A and B) and the normal Furthermore, rat residential peritoneal macrophages were pre- control rats (C). Original magnification, ϫ400 in A and C; ϫ630 in B. The treated with LzMPC (10 ␮l/ml) or vehicle (control) overnight, then arrows indicate Kupffer cells. D and E, Absorption of LzMPC by intestinal mucosa. Rats were gavaged with LzMPC labeled with BacLight Green processed for a bacterial killing assay. As shown in Fig. 4C, mac- ϳ Stain. The control animals were fed with normal diet. Ninety minutes after rophages from the control group killed 50% of ingested bacteria enteral feeding, the small intestinal tissues were taken and sectioned with within 90 min. Pretreatment with LzMPC led to a significant in- a cryostat. Slides were counterstained with DAPI, followed by examination crease in intracellular killing of bacteria by macrophages ( p Ͻ under a fluorescent microscope. Typical sections are shown in rats fed with 0.05). Together, the data suggested that LzMPC activated bacte- the labeled LzMPC (D) and the normal control rats (E). Original magni- ricidal activity of macrophages in vitro. fication, ϫ200. LzMPC induces expression of CRAMP in macrophages To understand the mechanism whereby LzMPC stimulates protec- a strong degree of green fluorescence (Fig. 3D), whereas they ex- tive innate immunity of macrophages against invasion of bacteria hibited only a weak autofluorescence in the controls (Fig. 3E). The induced by CLP, we determined whether LzMPC modulated the data suggested translocation of LzMPC from the gut lumen into expression of CRAMP gene, which encodes an important antimi- intestinal lamina propria. crobial peptide in rat phagocytes (17). Residential peritoneal mac- rophages were stimulated with LzMPC (10 ␮l/ml) for 2 h. In con- LzMPC activates macrophage’s bactericidal activity trol groups, cells were treated with LPS (1 ␮g/ml) or medium Macrophages play an essential role in the innate immune response instead. Total cellular RNA was then isolated, and CRAMP gene against bacterial invasion. They eliminate bacteria from tissues expression was determined with semiquantitative conventional during sepsis. Because LzMPC enhances bacterial clearance, we RT-PCR. As shown in Fig. 5A, CRAMP gene was constitutively further examined whether LzMPC directly targeted the innate im- expressed in rat macrophages. LzMPC, but not LPS, enhanced mune activity of macrophages. First, freshly isolated rat residential CRAMP . peritoneal macrophages were treated with LzMPC (10 ␮l/ml) or Next, we stimulated macrophages with LPS (1 ␮g/ml) or vehicle (control) for 6 h and examined under a microscope. As LzMPC (10 ␮l/ml) for 6 h, and determined CRAMP gene expres- illustrated in Fig. 4A, LzMPC profoundly induced pseudopod for- sion quantitatively with real-time RT-PCR. As shown in Fig. 5B, 8772 REGULATION OF INNATE IMMUNE EFFECTOR BY PROBIOTIC COMPONENTS

FIGURE 6. Effects of surgical stress, CLP, or LzMPC on CRAMP ex- pression in the liver. Rats were divided into groups of the following: 1) normal control, n ϭ 7; 2) sham surgery, n ϭ 7; 3) CLP, n ϭ 6; and 4) LzMPC ϩ CLP, n ϭ 7. The enteral feeding of LzMPC was conducted using a protocol described in Fig. 1A. Animals were sacrificed 72 h after surgery. Total cellular RNA was isolated from the liver, and CRAMP gene expression was quantitatively determined with real-time RT-PCR. Results .p Ͻ 0.01 compared with the control group ,ءء ;are the means Ϯ SEM

Surgical stress or CLP causes decrease in CRAMP expression in the rat liver, whereas LzMPC restores CRAMP gene expression in the liver of septic rats To assess the in vivo contribution of LzMPC treatment on CRAMP expression during the development of sepsis triggered by CLP, rats were divided into groups of the following: 1) normal control, 2) sham surgery, 3) CLP, and 4) LzMPC ϩ CLP. The enteral feeding of LzMPC was conducted using the protocol de- scribed in Fig. 1A. Animals were sacrificed 72 h after surgery, total cellular RNA of liver was isolated, and CRAMP gene expression was determined with real-time RT-PCR. As shown in Fig. 6, FIGURE 5. LzMPC up-regulates CRAMP gene expression in macro- CRAMP gene was constitutively expressed in the rat liver. The phages. A, Effect of bacterial components on CRAMP expression. Rat res- gene expression was down-regulated in the liver 72 h after sham idential peritoneal macrophages were stimulated with LPS (1 ␮g/ml) or surgery or CLP. Oral administration of LzMPC prevented or re- ␮ LzMPC (10 l/ml) for 2 h. Then total cellular RNA was isolated and used versed the down-regulation of CRAMP gene expression in the for detection of CRAMP gene expression with conventional RT-PCR. The liver of septic rats. Taken together, the data suggested that: 1) PCR products were size fractionized with 2% agarose gel. Data are rep- surgical stress or CLP inhibited CRAMP-associated innate im- resentative of three separate experiments. B, CRAMP gene in macrophages is up-regulated by LzMPC in vitro. Macrophages were stimulated with LPS mune capacity in tissues, and 2) LzMPC restored the capacity of (1 ␮g/ml) or LzMPC (10 ␮l/ml) for 6 h, total cellular RNA was isolated, CRAMP. and CRAMP gene transcripts were quantitatively determined with real time p Ͻ 0.01 Oral administration of LzMPC enhances the expression of ,ءء ;RT-PCR; n ϭ 3 per group. Results are the means Ϯ SEM compared with the control group. C, LzMPC and LPS induce TNF pro- CRAMP mRNA and protein in macrophages, but not in duction in macrophage in vitro. Peritoneal macrophages were subjected to neutrophils ␮ ␮ stimulation with LPS (1 g/ml) or LzMPC (10 l/ml) for 6 h. The culture To examine whether LzMPC modulates CRAMP gene expression supernatants were processed for measuring the TNF-␣ level, as described in macrophages in vivo, rats were gavaged with LzMPC for 5 in Materials and Methods; n ϭ 3 per group. Results are the means Ϯ SEM; p Ͻ 0.01 compared with the control group. days. Peritoneal macrophages were then isolated, and total cellular ,ءء RNA and protein were extracted, respectively. Then CRAMP mRNA was measured with real-time RT-PCR and CRAMP pro- LPS had no effect on CRAMP expression in macrophages. In con- tein was analyzed with Western blotting. As demonstrated in Fig. trast, the gene expression was increased Ͼ14-fold within6hin 7A, CRAMP mRNA was constitutively expressed in macrophages. response to LzMPC stimulation ( p Ͻ 0.01 compared with control). Treatment with LzMPC in vivo resulted in a marked up-regulation To confirm that both LPS and LzMPC activated macrophages, of CRAMP mRNA in the peritoneal residential macrophages. Fur- the culture supernatants were assayed for TNF using ELISA. As thermore, we found that LzMPC up-regulated the expression of shown in Fig. 5C, TNF production was increased by ϳ50-fold in CRAMP protein in macrophages (Fig. 7B). LPS-stimulated cells and 10-fold in LzMPC-treated cells, indicat- Neutrophils/PMNs also express CRAMP and play a critical role ing that cells were activated by both stimulations, although only in killing bacteria (17). Thus, we further examined whether LzMPC induced CRAMP gene expression. Together, these obser- LzMPC modulates CRAMP gene expression in PMNs in vivo. As vations suggested that LzMPC specifically up-regulated CRAMP- demonstrated in Fig. 7C, LzMPC does not modulate CRAMP gene associated innate immune capacity of macrophages. expression in PMNs. The Journal of Immunology 8773

FIGURE 8. Anti-CRAMP Ab blocks the protective effect of LzMPC on sepsis. A, Protocol for delivery of LzMPC, induction of sepsis by CLP, and administration of Abs. Rats were gavaged with LzMPC, subjected to CLP, and i.p. injected with Abs at time points indicated in the figure. Abs, Abs such as anti-CRAMP pAb and normal IgG. B, Survival rate of animals after CLP and Ab treatment. Rats were randomly assigned to three groups, in- cluding the following: 1) LzMPC ϩ CLP, n ϭ 10; 2) LzMPC ϩ CLP ϩ control IgG, n ϭ 13; and 3) LzMPC ϩ CLP ϩ anti-CRAMP pAb, n ϭ 17. The protocol shown in A was used for enteral feeding of LzMPC, con- ducting CLP, and i.p. injection of Abs. An 18-gauge needle was used for puncturing the cecum in CLP. Survival was monitored for 10 days after FIGURE 7. Effect of LzMPC treatment on CRAMP gene expression in CLP. CRAMP-Ab, anti-CRAMP pAb. phagocytes in vivo. A and B, LzMPC up-regulates CRAMP gene expres- sion in macrophages in vivo. Rats were gavaged with LzMPC or vehicle for 5 days. Then animals were sacrificed and peritoneal macrophages were isolated from animals. Total cellular RNA and protein were isolated from to that in LzMPC ϩ CLP group, indicating that administration of macrophages. Then CRAMP mRNA was quantitatively determined with control goat IgG (i.e., IgG prepared from nonimmunized animals) real-time RT-PCR, and CRAMP protein was analyzed with Western blot- did not result in any change in survival rate. In contrast, rats in ting, respectively. A, Data of real-time PCR. Results are the mean Ϯ SEM; LzMPC ϩ CLP ϩ anti-CRAMP pAb group had worse survival p Ͻ 0.05 compared with untreated group. B, Typical ,ء ;n ϭ 3 per group Western blot for detection of CRAMP protein. C, LzMPC does not mod- after CLP. The data suggest that endogenous CRAMP is a medi- ulate CRAMP gene expression in PMNs in vivo. Rats were gavaged with ator for LzMPC action. LzMPC for 5 days. Peritoneal neutrophils were isolated from rats 4 h after peritoneal injection of 10% casein, total cellular RNA was extracted, and Effect of repeated enteral delivery of LzMPC on 1) cytokine CRAMP gene expression was quantitatively determined with real-time RT- production by peritoneal macrophages and 2) enteral PCR. Results are the mean Ϯ SEM; n ϭ 3 per group. flora in cecum Pretreatment with LPS (a bacterial component) could result in the development of tolerance, which may lead to protection against Ab against CRAMP blocks the protective effect of LzMPC on septic peritonitis (48). Because LzMPC is also derived from bac- sepsis teria, we investigated whether treatment with LzMPC would alter Because the survival benefit of administrating LzMPC is associ- cytokine production by phagocytes. Briefly, rats were subjected to ated with induction of CRAMP, we next examined the role of LzMPC or vehicle treatment for 5 days. Peritoneal macrophages cathelicidin-related innate immunity in LzMPC-induced protection were then isolated and stimulated with LzMPC (10 ␮l/ml) for 6 h, against sepsis by using an Ab against CRAMP. To accomplish and TNF secretion was determined by ELISA. As shown in Fig. 9, this, we divided rats into groups of the following: 1) LzMPC ϩ macrophages spontaneously secreted TNF in vitro. Oral adminis- CLP (n ϭ 10); 2) LzMPC ϩ CLP ϩ control IgG (n ϭ 13); and 3) tration of LzMPC had no effect on the basal level of TNF produc- LzMPC ϩ CLP ϩ anti-CRAMP pAb (n ϭ 17). Animals were tion in macrophages. However, TNF secretion by macrophages subjected to treatment with LzMPC and challenged with lethal was increased by LzMPC stimulation in vitro. Macrophages from CLP using a protocol described in Fig. 8A. As stated above, LzMPC-treated animals had an increased capacity of TNF produc- LzMPC treatment resulted in a marked decrease in mortality 2 tion in response to LzMPC stimulation in vitro. In addition, cells days after CLP challenge (Fig. 1B). Animals who survived 2 days were also stimulated with LPS (1 ␮g/ml) for 6 h, and TNF secre- after CLP were then treated with goat anti-CRAMP Ab (0.75 mg/ tion was determined. We found that LPS induced TNF production kg, i.p.). The normal goat IgG was used as a control. The animals at 954 Ϯ 26.35 pg/106 cells in macrophages of vehicle group and were continuously treated with LzMPC and monitored for an ad- 1033 Ϯ 16.95 pg/106 cells in LzMPC group ( p Ͻ 0.05; vehicle vs ditional 8 days after administration of Abs. As illustrated in Fig. LzMPC). Together, the data indicated that enteral treatment with 8B, survival in LzMPC ϩ CLP ϩ control IgG group was similar LzMPC caused an increase in the capacity of cytokine production 8774 REGULATION OF INNATE IMMUNE EFFECTOR BY PROBIOTIC COMPONENTS

FIGURE 9. Enteral delivery of LzMPC results in an increase in the FIGURE 11. Effect of LzMPC treatment on serum TNF level during ϭ capacity of cytokine production by phagocytes. Rats were subjected to CLP-induced sepsis. Rats were divided into groups of CLP alone (n 3), ϩ ϭ ϩ ϩ ϭ LzMPC or vehicle treatment on a daily basis for 5 days. Macrophages were LzMPC CLP (n 5), and LzMPC CLP LzMPC (n 6), as stated isolated from peritoneum and then treated with medium or stimulated with in Results. LzMPC serum samples were obtained from rats 6 h after CLP. LzMPC (10 ␮l/ml) for 6 h ex vivo. The culture supernatants were used for ELISA analysis for serum TNF was conducted, as described in Materials Ϯ measuring TNF by ELISA, as described in Materials and Methods; n ϭ 3 and Methods. Results are the means SEM. p Ͻ 0.05 compared with the ,ء ;per group. Results are the means Ϯ SEM control group (i.e., fed with vehicle). ing with CLP, and enteral feeding LzMPC 2 h after CLP; n ϭ 6). by macrophages rather than tolerance against LzMPC or cross- All rats were sacrificed 6 h after CLP. ELISA analysis of serum tolerance against bacterial component stimulation. TNF level of rats in each group demonstrated a similar degree of Enteral delivery of probiotics may influence the status of the gut TNF production 6 h after CLP stimulation (Fig. 11). The data flora. To examine the effect of LzMPC on bacterial growth in the suggested that LzMPC treatment did not lead to the alteration of cecum, we subjected rats to LzMPC or vehicle treatment for 5 systemic TNF level in response to acute polymicrobial sepsis. days, collected lumenal contents from the cecum by needle-punc- ture, and processed samples for measurement of bacterial count. Discussion As shown in Fig. 10, cecal bacterial colony count in the LzMPC Treatment of severe sepsis is still a major challenge in clinical practice group was similar to the count in the control, indicating that (1, 3, 6, 49). In the past decade, many therapeutic approaches have LzMPC did not modulate bacterial growth in the gut. This obser- focused on targeting humoral effectors (such as pro- or anti- vation suggested that LzMPC-induced protective effect in sepsis inflammatory cytokines) of the innate immune system, which govern was derived from mechanisms other than reduction of the amount the development of pathophysiological disorders (such as hyper- or of commensal bacteria in the intestine. hypoinflammation) in sepsis (50, 51). However, attempts to neutralize proinflammatory cytokines such as TNF or IL-1␤ have failed to sig- Effect of LzMPC treatment on serum TNF level during nificantly improve the outcome of sepsis (52–54). In contrast, target- CLP-induced sepsis ing anti-inflammatory cytokines such as IL-10 has been shown to be As stated above, LzMPC induces the capacity of TNF production a complicated issue (55–60). Thus, it is a great practical and intel- by macrophages (Fig. 9). Therefore, we further analyzed the effect lectual challenge to use immunoregulation as a means to prevent and of LzMPC treatment on systemic TNF level during the develop- treat sepsis. In the present study, we found that oral delivery of ment of sepsis. Rats were divided into the following groups: 1) LzMPC protected rats against CLP-induced death. LzMPC enhanced CLP alone (n ϭ 3); 2) LzMPC ϩ CLP (i.e., enteral feeding bacterial killing and proinflammatory cytokine production by macro- LzMPC for 5 days, followed by CLP; n ϭ 5); and 3) LzMPC ϩ phages. The protective effect of LzMPC in sepsis was associated with CLP ϩ LzMPC (i.e., enteral feeding LzMPC for 5 days, challeng- augmentation of innate immunity in macrophages rather than induc- tion of tolerance to bacterial products in macrophages or modulation of enteral flora. Previously, Iwata et al. (7) demonstrated that over- expression of Bcl-2 in phagocytes enhanced survival of the cells, thereby providing protection in experimental sepsis. Administration of molecules targeting phagocytes has been shown to be effective in the prevention and treatment of sepsis (8–11). Recently, Chung et al. (12) showed that preserving functional capacity of macrophages re- sulted in improvement of survival to sepsis. Taken together, our find- ings in this study in conjunction with these previous studies suggest that the immunomodulatory strategy to modulate macrophage/mono- cyte function should be pursued as a treatment for sepsis. A growing body of evidence has suggested the potential usage of probiotic bacteria for therapy and immunomodulation (reviewed in Refs. 23 and 29). Because severe sepsis is associated with dys- FIGURE 10. Effect of LzMPC on bacterial growth in the cecum. Rats were subjected to LzMPC or vehicle treatment on a daily basis for 5 days. function of the innate immune system, theoretically, using probi- Then lumen contents of the cecum were collected by needle-puncture. otic bacteria should be an ideal immunomodulatory strategy to Samples were processed for measurement of bacterial count, as described prevent or fight the disease. However, recent clinical studies using in Materials and Methods; n ϭ 13 per group. Horizontal bars represent the live probiotics yielded discouraging results: enteral delivery of live mean for each group. probiotics to patients at high risk of sepsis could cause secondary The Journal of Immunology 8775 nosocomial infections in these individuals, because the gut muco- (i.e., LzMPC) had potent immune-enhancing properties and in- sal barrier function is impaired during sepsis (61–63). Thus, we crease resistance against sepsis. In contrast, LzMEcC did not protect prepared a novel, bacteria-free probiotic product, namely LzMPC, against sepsis. Our observation suggests that lysozyme is an important by digesting the probiotic bacteria with lysozyme. We demon- host factor, which may mediate probiotic function in vivo. strated for the first time that oral delivery of LzMPC resulted in CRAMP is a unique antimicrobial peptide expressed in phago- improvement in the survival of animals challenged with lethal CLP. cytes and epithelial cells (17). Recently, Nizet et al. (21) demon- The beneficial effect of oral administration of LzMPC was associated strated that CRAMP-deficient mice lack innate immunity against with enhancement of bacterial clearance in tissues. In contrast, enteral bacterial infection, suggesting that CRAMP plays an essential role delivery of live probiotic bacteria increased death rate after CLP. in the host defense. In addition, CRAMP-related peptides have These observations suggested a potential clinical use of LzMPC to also been demonstrated to neutralize LPS, protect mice from LPS protect against polymicrobial sepsis, or as a supplement for patients lethality, and attenuate sepsis triggered by bacterial infection (14, with immature mucosal barrier who are at high risk for sepsis. 18, 22, 72). In the present study, we found that: 1) LzMPC up- For decades, probiotics have been defined as a live microbial regulated the expression of CRAMP in macrophages; 2) LzMPC food ingredient that is beneficial to health (reviewed in Ref. 33). preserved CRAMP expression in tissues, which was correlated to This concept guides investigators to study the effects of probiotics the protective effect of LzMPC on sepsis; and 3) anti-CRAMP Ab in vivo. Recently, Salminen and colleagues (23, 64, 65) proposed attenuated LzMPC protection against CLP-induced death in rats. that components of probiotic bacteria should also be included in Collectively, these findings suggest that the protective effect of the probiotic family. This updated definition for probiotics is sup- LzMPC in sepsis is related to increase of cathelicidin-associated ported by several studies. For example, Jijon et al. (66) reported innate immunity of macrophages and is mediated by CRAMP. It is that DNA from killed probiotics inhibits the production of IL-8 likely that LzMPC targets cellular effectors such as macrophages, and IFN-␥ by intestinal epithelial cells in response to commensal thereby enhancing CRAMP-related protective innate immune ca- bacterial DNA. Several investigators demonstrated that functions pacity of macrophages and protecting against sepsis. of immune cells are modulated by oral administration of compo- nents derived from probiotic bacteria (31, 32). In addition, enteral Acknowledgments delivery of killed probiotics results in enhancement of the host We thank Dr. Shane Greenstein for advice on statistic analysis and Mari- systemic innate immunity (28, 30). LzMPC is also a bacteria-free anne Reed for preparation of the manuscript. product derived from a probiotic bacteria strain. Our data sug- gested that ingesting LzMPC resulted in not only an improvement Disclosures of innate immune capacity, but also an increased resistance to severe The authors have no financial conflict of interest. systemic inflammation. Thus, we believe that the study of probiotic References elements is at least as important as the study of probiotics themselves. 1. Angus, D. C., W. T. Linde-Zwirble, J. Lidicker, G. Clermont, J. Carcillo, and Another important issue concerns the tissue uptake of LzMPC M. R. Pinsky. 2001. Epidemiology of severe sepsis in the United States: analysis of and its active ingredients. In the present study, we showed that incidence, outcome, and associated costs of care. Crit. Care Med. 29: 1303–1310. 2. Angus, D. C., A. A. Musthafa, G. Clermont, M. F. Griffin, W. T. Linde-Zwirble, LzMPC crossed the mucosal barrier and was then distributed in the T. T. Dremsizov, and M. R. Pinsky. 2001. Quality-adjusted survival in the first liver. However, mechanisms of the gastrointestinal uptake of LzMPC year after the acute respiratory distress syndrome. Am. J. Respir. Crit. Care Med. remain undetermined. Previous investigations have demonstrated a 163: 1389–1394. 3. Annane, D., E. Bellissant, and J. M. Cavaillon. 2005. Septic shock. Lancet normal physiological event called persorption, the paracellular uptake 365: 63–78. of substances from the digestive tract into the body (reviewed in Ref. 4. Beutler, B., K. Hoebe, X. Du, and R. J. Ulevitch. 2003. How we detect microbes and respond to them: the Toll-like receptors and their transducers. J. Leukocyte 67). It is possible that LzMPC crosses the gut barrier via the Biol. 74: 479–485. mechanism of persorption. In addition, LzMPC is a complex 5. Hotchkiss, R. S., and I. E. Karl. 2003. The pathophysiology and treatment of preparation. It contains heat-stable components derived from sepsis. N. Engl. J. Med. 348: 138–150. 6. Bone, R. C., C. L. Sprung, and W. J. Sibbald. 1992. Definitions for sepsis and probiotics. Previous investigations demonstrated that oral feed- organ failure. Crit. Care Med. 20: 724–726. ing heat-killed probiotics resulted in modulation of host immune 7. Iwata, A., V. M. Stevenson, A. Minard, M. Tasch, J. Tupper, E. Lagasse, function (28, 30). Hydrolysis of the bacterial cell wall with lysozyme I. Weissman, J. M. Harlan, and R. K. Winn. 2003. Over-expression of Bcl-2 provides protection in septic mice by a trans effect. J. Immunol. 171: 3136–3141. yields several components such as N-acetylglucosamine-N-acetylmu- 8. Yan, J. J., J. S. Jung, J. E. Lee, J. Lee, S. O. Huh, H. S. Kim, K. C. Jung, ramic acid peptides and polysaccharides, which are resistant to heat. J. Y. Cho, J. S. Nam, H. W. Suh, et al. 2004. Therapeutic effects of lysophos- phatidylcholine in experimental sepsis. Nat. Med. 10: 161–167. Further investigations will be required to examine whether these com- 9. Weighardt, H., C. Feterowski, M. Veit, M. Rump, H. Wagner, and B. Holzmann. ponents play a role in the modulation of sepsis. 2000. Increased resistance against acute polymicrobial sepsis in mice challenged The mechanisms of action of probiotics are multiple (reviewed with immunostimulatory CpG oligodeoxynucleotides is related to an enhanced innate effector cell response. J. Immunol. 165: 4537–4543. in Ref. 24). Lactobacillus is the most commonly used probiotic 10. Stephens, D. P., D. A. Fisher, and B. J. Currie. 2002. An audit of the use of strain. Perdigon et al. (68) have shown that oral administration of colony-stimulating factor in septic shock. Intern. Med. J. 32: lactobacilli activated macrophages in mice. However, it has not 143–148. 11. Docke, W. D., F. Randow, U. Syrbe, D. Krausch, K. Asadullah, P. Reinke, been elucidated whether any host factors in the intestinal lumen H. D. Volk, and W. Kox. 1997. Monocyte deactivation in septic patients: resto- play a role in mediating the beneficial effect of probiotics. Ly- ration by IFN-␥ treatment. Nat. Med. 3: 678–681. 12. Chung, C. S., G. Y. Song, J. Lomas, H. H. Simms, I. H. Chaudry, and A. Ayala. 2003. sozyme is a peptidoglycan (an essential cell wall component of Inhibition of Fas/Fas ligand signaling improves septic survival: differential effects on bacteria) recognition protein (69, 70). It is an important bacterial- macrophage apoptotic and functional capacity. J. Leukocyte Biol. 74: 344–351. recognizing molecule secreted by phagocytes and Paneth cells in 13. Zanetti, M., R. Gennaro, and D. Romeo. 1995. : a novel protein family with a common proregion and a variable C-terminal antimicrobial domain. the small intestine (69, 71). In the intestinal lumen, host lysozyme FEBS Lett. 374: 1–5. interacts with ingested probiotic bacteria and releases components 14. Larrick, J. W., M. Hirata, R. F. Balint, J. Lee, J. Zhong, and S. C. Wright. 1995. from bacterial cells. However, little is known about whether com- Human CAP18: a novel antimicrobial lipopolysaccharide-binding protein. Infect. Immun. 63: 1291–1297. ponents derived from lysozyme-modified probiotics play a role in 15. Zanetti, M. 2004. Cathelicidins, multifunctional peptides of the innate immunity. vivo. In the present study, we mimicked this event by modifying J. Leukocyte Biol. 75: 39–48. 16. Turner, J., Y. Cho, N. N. Dinh, A. J. Waring, and R. I. Lehrer. 1998. Activities Lactobacillus bacteria with lysozyme in vitro and administering of LL-37, a cathelin-associated antimicrobial peptide of human neutrophils. An- them into the intestinal lumen. We showed that these components timicrob. Agents Chemother. 42: 2206–2214. 8776 REGULATION OF INNATE IMMUNE EFFECTOR BY PROBIOTIC COMPONENTS

17. Gallo, R. L., K. J. Kim, M. Bernfield, C. A. Kozak, M. Zanetti, L. Merluzzi, and 44. Wichterman, K. A., A. E. Baue, and I. H. Chaudry. 1980. Sepsis and septic shock: R. Gennaro. 1997. Identification of CRAMP, a cathelin-related antimicrobial pep- a review of laboratory models and a proposal. J. Surg. Res. 29: 189–201. tide expressed in the embryonic and adult mouse. J. Biol. Chem. 272: 45. Fink, M. P., and S. O. Heard. 1990. Laboratory models of sepsis and septic shock. 13088–13093. J. Surg. Res. 49: 186–196. 18. Ciornei, C. D., T. Sigurdardottir, A. Schmidtchen, and M. Bodelsson. 2005. An- 46. Buras, J. A., B. Holzmann, and M. Sitkovsky. 2005. Animal models of sepsis: timicrobial and chemoattractant activity, lipopolysaccharide neutralization, cyto- setting the stage. Nat. Rev. Drug Discov. 4: 854–865. toxicity, and inhibition by serum of analogs of human cathelicidin LL-37. Anti- 47. Ashare, A., L. S. Powers, N. S. Butler, K. C. Doerschug, M. M. Monick, and microb. Agents Chemother. 49: 2845–2850. G. W. Hunninghake. 2005. Anti-inflammatory response is associated with mor- 19. Travis, S. M., N. N. Anderson, W. R. Forsyth, C. Espiritu, B. D. Conway, tality and severity of infection in sepsis. Am. J. Physiol. 288: L633–L640. E. P. Greenberg, P. B. McCray, Jr., R. I. Lehrer, M. J. Welsh, and B. F. Tack. 48. Astiz, M. E., D. C. Saha, K. Brooks, C. M. Carpati, and E. C. Rackow. 1993. Com- 2000. Bactericidal activity of mammalian cathelicidin-derived peptides. Infect. parison of the induction of endotoxin tolerance in endotoxemia and peritonitis by Immun. 68: 2748–2755. monophosphoryl lipid A and lipopolysaccharide. Circ. Shock 39: 194–198. 20. Rosenberger, C. M., R. L. Gallo, and B. B. Finlay. 2004. Interplay between 49. Angus, D. C., and R. S. Wax. 2001. Epidemiology of sepsis: an update. Crit. Care antibacterial effectors: a macrophage antimicrobial peptide impairs intracellular Med. 29: S109–S116. Salmonella replication. Proc. Natl. Acad. Sci. USA 101: 2422–2427. 21. Nizet, V., T. Ohtake, X. Lauth, J. Trowbridge, J. Rudisill, R. A. Dorschner, 50. Riedemann, N. C., and P. A. Ward. 2003. Anti-inflammatory strategies for the V. Pestonjamasp, J. Piraino, K. Huttner, and R. L. Gallo. 2001. Innate antimicrobial treatment of sepsis. Exp. Opin. Biol. Ther. 3: 339–350. peptide protects the skin from invasive bacterial infection. Nature 414: 454–457. 51. Riedemann, N. C., R. F. Guo, and P. A. Ward. 2003. Novel strategies for the 22. Fukumoto, K., I. Nagaoka, A. Yamataka, H. Kobayashi, T. Yanai, Y. Kato, and treatment of sepsis. Nat. Med. 9: 517–524. T. Miyano. 2005. Effect of antibacterial cathelicidin peptide CAP18/LL-37 on 52. Abraham, E., P. F. Laterre, J. Garbino, S. Pingleton, T. Butler, T. Dugernier, sepsis in neonatal rats. Pediatr. Surg. Int. 21: 20–24. B. Margolis, K. Kudsk, W. Zimmerli, P. Anderson, et al. 2001. Lenercept (p55 23. Isolauri, E., P. V. Kirjavainen, and S. Salminen. 2002. Probiotics: a role in the tumor necrosis factor receptor fusion protein) in severe sepsis and early septic treatment of intestinal infection and inflammation? Gut 50(Suppl. 3): III54–III59. shock: a randomized, double-blind, placebo-controlled, multicenter phase III trial 24. Cong, Y., A. Konrad, N. Iqbal, and C. O. Elson. 2003. Probiotics and immune with 1,342 patients. Crit. Care Med. 29: 503–510. regulation of inflammatory bowel diseases. Curr. Drug Targets Inflamm. Allergy 53. Abraham, E., A. Anzueto, G. Gutierrez, S. Tessler, P. G. San, R. Wunderink, 2: 145–154. N. A. Dal, S. Nasraway, S. Berman, R. Cooney, et al. 1998. Double-blind ran- 25. Caplan, M. S., R. Miller-Catchpole, S. Kaup, T. Russell, M. Lickerman, domized controlled trial of monoclonal antibody to human tumor necrosis factor M. Amer, Y. Xiao, and R. Thomson, Jr. 1999. Bifidobacterial supplementation in treatment of septic shock: NORASEPT II Study Group. Lancet 351: 929–933. reduces the incidence of necrotizing enterocolitis in a neonatal rat model. Gas- 54. Fisher, C. J., Jr., J. F. Dhainaut, S. M. Opal, J. P. Pribble, R. A. Balk, G. J. Slotman, troenterology 117: 577–583. T. J. Iberti, E. C. Rackow, M. J. Shapiro, and R. L. Greenman. 1994. Recombinant 26. Paton, A. W., M. P. Jennings, R. Morona, H. Wang, A. Focareta, L. F. Roddam, human interleukin 1 receptor antagonist in the treatment of patients with sepsis syn- and J. C. Paton. 2005. Recombinant probiotics for treatment and prevention of drome: results from a randomized, double-blind, placebo-controlled trial: Phase III enterotoxigenic Escherichia coli diarrhea. Gastroenterology 128: 1219–1228. rhIL-1ra Sepsis Syndrome Study Group. J. Am. Med. Assoc. 271: 1836–1843. 27. Akyol, S., M. R. Mas, B. Comert, U. Ateskan, M. Yasar, H. Aydogan, S. Deveci, 55. Kalechman, Y., U. Gafter, R. Gal, G. Rushkin, D. Yan, M. Albeck, and B. Sredni. C. Akay, N. Mas, N. Yener, and I. H. Kocar. 2003. The effect of antibiotic and 2002. Anti-IL-10 therapeutic strategy using the immunomodulator AS101 in pro- probiotic combination therapy on secondary pancreatic infections and oxidative tecting mice from sepsis-induced death: dependence on timing of immunomodu- stress parameters in experimental acute necrotizing pancreatitis. Pancreas 26: lating intervention. J. Immunol. 169: 384–392. 363–367. 56. Lyons, A., A. Goebel, J. A. Mannick, and J. A. Lederer. 1999. Protective effects 28. Gill, H. S., K. J. Rutherfurd, J. Prasad, and P. K. Gopal. 2000. Enhancement of of early interleukin 10 antagonism on injury-induced immune dysfunction. Arch. natural and acquired immunity by Lactobacillus rhamnosus (HN001), Lactoba- Surg. 134: 1317–1323. cillus acidophilus (HN017) and Bifidobacterium lactis (HN019). Br. J. Nutr. 83: 57. Song, G. Y., C. S. Chung, I. H. Chaudry, and A. Ayala. 1999. What is the role 167–176. of interleukin 10 in polymicrobial sepsis: anti-inflammatory agent or immuno- 29. Macfarlane, G. T., and J. H. Cummings. 2002. Probiotics, infection, and immu- suppressant? Surgery 126: 378–383. nity. Curr. Opin. Infect. Dis. 15: 501–506. 58. Ayala, A., P. J. O’Neill, S. A. Uebele, C. D. Herdon, and I. H. Chaudry. 1997. 30. Gill, H. S., and K. J. Rutherfurd. 2001. Viability and dose-response studies on the Mechanism of splenic immunosuppression during sepsis: key role of Kupffer cell effects of the immunoenhancing lactic acid bacterium Lactobacillus rhamnosus in mediators. J. Trauma 42: 882–888. mice. Br. J. Nutr. 86: 285–289. 31. Davidkova, G., P. Popova, G. Guencheva, A. Bogdanov, E. Pacelli, A. Auteri, 59. Rogy, M. A., T. Auffenberg, N. J. Espat, R. Philip, D. Remick, G. K. Wollenberg, and V. Mincheva. 1992. Endogenous production of tumor necrosis factor in nor- E. M. Copeland III, and L. L. Moldawer. 1995. Human tumor necrosis factor mal mice orally treated with Deodan: a preparation from Lactobacillus bulgari- receptor (p55) and interleukin 10 gene transfer in the mouse reduces mortality to cus“LB51.” Int. J. Immunopharmacol. 14: 1355–1362. lethal endotoxemia and also attenuates local inflammatory responses. J. Exp. 32. Sasaki, T., S. Fukami, and S. Namioka. 1994. Enhancement of cytotoxic activity Med. 181: 2289–2293. of lymphocytes in mice by oral administration of peptidoglycan (PG) derived 60. Howard, M., T. Muchamuel, S. Andrade, and S. Menon. 1993. Interleukin 10 from Bifidobacterium thermophilum. J. Vet. Med. Sci. 56: 1129–1133. protects mice from lethal endotoxemia. J. Exp. Med. 177: 1205–1208. 33. Salminen, S., C. Bouley, M. C. Boutron-Ruault, J. H. Cummings, A. Franck, 61. De Groote, M. A., D. N. Frank, E. Dowell, M. P. Glode, and N. R. Pace. 2005. G. R. Gibson, E. Isolauri, M. C. Moreau, M. Roberfroid, and I. Rowland. 1998. Lactobacillus rhamnosus GG bacteremia associated with probiotic use in a child Functional food science and gastrointestinal physiology and function. Br. J. Nutr. with short gut syndrome. Pediatr. Infect. Dis. J. 24: 278–280. 80(Suppl. 1): S147–S171. 62. Land, M. H., K. Rouster-Stevens, C. R. Woods, M. L. Cannon, J. Cnota, and 34. Salminen, S., A. von Wright, L. Morelli, P. Marteau, D. Brassart, W. M. de Vos, A. K. Shetty. 2005. Lactobacillus sepsis associated with probiotic therapy. Pe- R. Fonden, M. Saxelin, K. Collins, G. Mogensen, et al. 1998. Demonstration of diatrics 115: 178–181. safety of probiotics: a review. Int. J. Food Microbiol. 44: 93–106. 63. Kunz, A. N., J. M. Noel, and M. P. Fairchok. 2004. Two cases of Lactobacillus 35. Salminen, S., and A. von Wright. 1998. Current probiotics: safety assured? Mi- bacteremia during probiotic treatment of short gut syndrome. J. Pediatr. Gas- crob. Ecol. Health Dis. 10: 68–72. troenterol. Nutr. 38: 457–458. 36. Ebong, S., D. Call, J. Nemzek, G. Bolgos, D. Newcomb, and D. Remick. 1999. 64. Salminen, S., A. Ouwehand, Y. Benno, and Y. K. Lee. 1999. Probiotics: how Immunopathologic alterations in murine models of sepsis of increasing severity. should they be defined? Trends Food Sci. Technol. 10: 107–110. Infect. Immun. 67: 6603–6610. 65. Ouwehand, A., E. Isolauri, and S. Salminen. 2002. The role of the intestinal 37. Singleton, K. D., and P. E. Wischmeyer. 2003. Distance of cecum ligated influ- microflora for the development of the immune system in early childhood. Eur. ences mortality, tumor necrosis factor-␣ and interleukin-6 expression following J. Nutr. 41(Suppl. 1): I32–I37. cecal ligation and puncture in the rat. Eur. Surg. Res. 35: 486–491. 66. Jijon, H., J. Backer, H. Diaz, H. Yeung, D. Thiel, C. McKaigney, S. C. De, and 38. Davies, J. Q., and S. Gordon. 2005. Isolation and culture of murine macrophages. K. Madsen. 2004. DNA from probiotic bacteria modulates murine and human Methods Mol. Biol. 290: 91–103. epithelial and immune function. Gastroenterology 126: 1358–1373. 39. De Plaen, I. G., X. W. Qu, H. Wang, X. D. Tan, L. Wang, X. B. Han, 67. Volkheimer, G., and F. H. Schulz. 1968. The phenomenon of persorption. Di- R. A. Rozenfeld, and W. Hsueh. 2002. Endotoxin, but not platelet-activating gestion 1: 213–218. factor, activates nuclear factor-␬B and increases I␬B␣ and I␬B␤ turnover in enterocytes. Immunology 106: 577–583. 68. Perdigon, G., M. E. de Macias, S. Alvarez, G. Oliver, and A. A. de Ruiz Holgadoqq. 40. Hamrick, T. S., E. A. Havell, J. R. Horton, and P. E. Orndorff. 2000. Host and 1986. Effect of perorally administered lactobacilli on macrophage activation in mice. Infect. Immun. bacterial factors involved in the innate ability of mouse macrophages to eliminate 53: 404–410. internalized unopsonized Escherichia coli. Infect. Immun. 68: 125–132. 69. Dziarski, R. 2003. Recognition of bacterial peptidoglycan by the innate immune 41. Zhu, Y. Q., and X. D. Tan. 2005. TFF3 modulates NF-␬B and a novel negative system. Cell Mol. Life Sci. 60: 1793–1804. regulatory molecule of NF-␬B in intestinal epithelial cells via a mechanism dis- 70. Jolles, P., and J. Jolles. 1984. What’s new in lysozyme research? Always a model tinct from TNF-␣. Am. J. Physiol. 289: C1085–C1093. system, today as yesterday. Mol. Cell. Biochem. 63: 165–189. 42. Zhu, Y. Q., Y. Lu, and X. D. Tan. 2003. Monochloramine induces reorganization 71. Muller, C. A., I. B. Autenrieth, and A. Peschel. 2005. Innate defenses of the of nuclear speckles and phosphorylation of SRp30 in human colonic epithelial intestinal epithelial barrier. Cell Mol. Life Sci. 62: 1297–1307. cells: role of protein kinase C. Am. J. Physiol. 285: C1294–C1303. 72. Giacometti, A., O. Cirioni, R. Ghiselli, C. Bergnach, F. Orlando, G. D’Amato, 43. Tan, X. D., Y. Chen, Q. Liu, F. Gonzalez-Crussi, and X. Liu. 2000. Prostanoids F. Mocchegiani, C. Silvestri, M. S. Del Prete, B. Skerlavaj, et al. 2004. The mediate the protective effect of trefoil factor 3 in oxidant-induced intestinal ep- antimicrobial peptide BMAP-28 reduces lethality in mouse models of staphylo- ithelial cell injury: role of cyclooxygenase-2. J. Cell Sci. 113: 2149–2155. coccal sepsis. Crit. Care Med. 32: 2485–2490.