Leukemia (2004) 18, 1687–1692 & 2004 Nature Publishing Group All rights reserved 0887-6924/04 $30.00 www.nature.com/leu DNA methylation changes in multiple myeloma O Galm1, S Wilop1, J Reichelt1, E Jost1, G Gehbauer1, JG Herman2 and R Osieka1 1Medizinische Klinik IV, Universitaetsklinikum Aachen, 52074 Aachen, Germany; and 2The Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins, Baltimore, MD 21231, USA Using a candidate gene approach, we analyzed the methylation It could be demonstrated that there are specific methylation status of the promoter-associated CpG islands of 11 well- patterns in various types of human malignancies.13 Unlike characterized tumor suppressor genes by methylation-specific genetic alterations in cancer, epigenetic changes are potentially polymerase chain reaction in five multiple myeloma (MM) cell 0 lines and 56 patients with malignant plasma cell disorders. The reversible. Demethylating agents such as 5-aza-2 -deoxycyti- frequency of aberrant methylation among the patient samples dine are capable of reactivating tumor suppressor genes that are was 46.4% for SOCS-1, 35.7% for p16, 21.4% for E-cadherin, silenced by promoter hypermethylation.4,14 Characterization of 12.5% for DAP kinase and p73, 1.8% for p15, MGMT as well as the methylation profile of candidate tumor suppressor genes that RARb, and 0% for TIMP-3, RASSF1A and hMLH1. We found at have been established to play a role in tumorigenesis may least one hypermethylated gene in 80.4% of the primary patient samples, while 33.9% harbored two or more hypermethylated provide significant insight into the molecular pathogenesis of genes. For the first time, we show that p73 may be hypermethy- MM. Furthermore, methylation patterns may be predictive for 15,16 lated in MM and thus be involved in the pathogenesis of plasma clinical behavior and response to therapy. cell disorders. Hypermethylation of p16 at diagnosis was To gain further insight into specific pathways that are relevant associated with a poorer prognosis. In patients with plasma in the multistep transformation process of normal plasma cells to cell leukemia, we found frequent simultaneous hypermethyla- MM, we have therefore applied methylation analysis of 11 tion of p16, E-cadherin and DAP kinase. We conclude that aberrant methylation of tumor suppressor genes is a common candidate genes to five MM cell lines and 56 samples from event in malignant plasma cell disorders and that there is a patients with plasma cell disorders as well as 20 nonmalignant correlation between methylation patterns and clinical charac- bone marrow samples. The list of tumor suppressor genes teristics in MM patients. includes the cell cycle regulators p15, p16 and p73, the tissue Leukemia (2004) 18, 1687–1692. doi:10.1038/sj.leu.2403434 inhibitor of matrix metalloproteinases-3 (TIMP-3), E-cadherin, Published online 19 August 2004 the DNA repair genes O6-methylguanine DNA methyltransfer- Keywords: DNA methylation; tumor suppressor genes; multiple myeloma; epigenetics; tumor marker; methylation profile ase (MGMT) and hMLH1, DAP kinase, RASSF1A, the retinoic acid receptor b (RARb) and the cytokine regulator SOCS-1. It could be shown that each of these genes may be affected by aberrant CpG island methylation in association with transcrip- Introduction tional silencing in various types of human malignancies.17–27 Multiple myeloma (MM) is a B-cell neoplasm that is character- ized by the accumulation of malignant plasma cells in the bone Material and methods marrow. Previous molecular studies have largely focused on acquired genetic aberrations in MM. Important changes in DNA Human tissue samples sequence include chromosomal translocations involving the immunoglobulin heavy chain locus on chromosome 14q32 and Bone marrow (BM) and peripheral blood (PB) specimens were various partner genes such as cyclin D1, cyclin D3, fibroblast obtained during routine clinical assessment of 53 MM patients growth factor receptor 3 and c-maf, as well as mutations of N- and three patients with monoclonal gammopathy of undeter- ras and K-ras.1–3 The accumulation of genetic events is thought mined significance (MGUS), who presented at the University to be crucial for the malignant transformation of plasma cells.1 Hospital Aachen, Germany, between 1995 and 2002. MM There is increasing evidence that in addition to genetic diagnosis and staging classification were made in accordance aberrations epigenetic processes play a major role in carcino- with standard criteria.28 The main clinical characteristics of the genesis. Aberrant methylation of gene promoter regions is the patient cohort are summarized in Table 1. Control BM samples most widely studied epigenetic abnormality in human malig- were aspirated from 20 patients with nonmetastatic solid tumors nancies and is associated with loss of gene function. This or malignant lymphoma without BM infiltration or hematopoie- epigenetic event acts as an alternative to mutations and tic dysfunction as part of the routine staging procedures. deletions to disrupt tumor suppressor gene function.4,5 It was Informed consent was obtained from all patients following reported previously that hypermethylation of the cell cycle institutional guidelines. Normal PB samples were collected from inhibitors p15 and p16,6–9 the apoptosis regulator DAP kinase10 healthy volunteers. Mononuclear cells from BM and PB were and the tumor suppressor RASSF1A11 may occur in MM separated by density gradient centrifugation prior to further patients. Additionally, we have recently identified hypermethy- analysis. lation-associated silencing of the suppressor of cytokine signal- ing-1 (SOCS-1) gene to be a frequent epigenetic aberration in 12 MM. Cell lines Correspondence: Dr O Galm, Medizinische Klinik IV, Universitaets- We obtained the MM cell lines U266, OPM-2, RPMI8226 and klinikum Aachen, Pauwelsstrasse 30, 52074 Aachen, Germany; Fax: þ 49 241 8082449; E-mail: [email protected] LP-1 from the German Collection of Microorganisms and Cell Received 25 March 2004; accepted 11 June 2004; Published online Cultures (Braunschweig, Germany). XG1 cells were kindly 19 August 2004 provided by PC Heinrich (RWTH Aachen, Germany). DNA methylation in multiple myeloma O Galm et al 1688 Table 1 Patient characteristics specific for either the methylated or the unmethylated sequence. Primers for MSP analysis are designed to discriminate between Number of patients 56 methylated and unmethylated alleles after bisulfite treatment Median age, years (range) 65.5 (40–81) and to anneal only to DNA that has been bisulfite-converted. A purification of plasma cells prior to further analysis was not Gender (n) performed because of the high sensitivity of the MSP technique Male 35 Female 21 with a detection limit of approximately 0.1% of methylated DNA present in an otherwise unmethylated sample.29 Paraprotein isotype (n) Genomic DNA was isolated from cell lines and primary IgA 12 tissues using standard methods. Approximately 1 mg of DNA was IgG 33 sodium bisulfite-modified and subjected to MSP as described IgM 1 previously.29 A detailed list of MSP primers that specifically Light chain only 6 Nonsecretory 4 recognize either unmethylated (U) or methylated (M) gene sequences is given in Table 2. Reactions were hot-started at Stage (n) 951C for 5 min and held at 801C before addition of 0.625 U of MGUS 3 Taq polymerase (Sigma, St Louis, MO, USA). Temperature I2conditions for PCR for all genes except TIMP-3 were as follows: II 12 35 cycles of 951C for 30 s, 601C for 30 s and 721C for 30 s, III 39 followed by one cycle of 721C for 5 min. For TIMP-3 analysis, Plasma cell leukemia (n) 5 conditions were 35 cycles of 951C for 30 s, 591C for 30 s and 721C for 30 s, followed by one cycle of 721C for 5 min. PCR Lytic bone lesions (n) products were separated on 2.5% agarose gels and visualized by Yes 44 ethidium bromide staining. No 12 At diagnosis (n)36 During follow-up (n) 20 Statistical methods WBC, G/l (range) 6.2 (0.9–63.4) Hb, g/l (range) 113.5 (57–192) Overall survival curves were plotted according to the method of PLT, G/l (range) 225.5 (22–479) Kaplan and Meier, and compared using the log-rank test. LDH, U/l (range) 185.5 (63–908) Survival was calculated from the date of diagnosis until the Creatinine, mg/dl (range) 1.1 (0.3–6.9) patients’ death or last visit. Correlation between variables was Serum calcium, mmol/l (range) 2.3 (2.04–4.41) estimated using the Fisher’s exact two-sided test. All calculations were performed using the SAS statistical software (version 8.02, SAS Institute, Cary, NC, USA). Methylation-specific polymerase chain reaction (MSP) MSP29 was used for qualitative analysis of the methylation status Results of the 11 tumor suppressor genes. After bisulfite treatment of genomic DNA, which converts all unmethylated cytosines to We determined the methylation status of 11 tumor suppressor uracils, the subsequent PCR amplification is performed in two genes in five MM cell lines, 56 patients with neoplastic plasma separate reactions with two different primer pairs that are cell disorders and 20 nonmalignant BM specimens. Figure 1 Table 2 Primer sets for MSP analysis Gene Forward primer (50- 30) Reverse primer (50-30) p15 U: GGTTGGTTTTTTATTTTGTTAGAGTGAGGT AACCACTCTAACCACAAAATACAAACACA M GGTTTTTTATTTTGTTAGAGCGAGGC TAACCGCAAAATACGAACGCG p16 U: TTATTAGAGGGTGGGGTGGATTGT CAACCCCAAACCACAACCATAA M: TTATTAGAGGGTGGGGCGGATCGC GACCCCGAACCGCGACCGTAA TIMP-3 U: TTTTGTTTTGTTATTTTTTGTTTTTGGTTTT CCCCCAAAAACCCCACCTCA M: CGTTTCGTTATTTTTTGTTTTCGGTTTC CCGAAAACCCCGCCTCG E-cadherin