DOCSLIB.ORG

DNA Methylation Changes in Multiple Myeloma

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
DNA Methylation Changes in Multiple Myeloma Leukemia (2004) 18, 1687–1692 & 2004 Nature Publishing Group All rights reserved 0887-6924/04 $30.00 www.nature.com/leu DNA methylation changes in multiple myeloma O Galm1, S Wilop1, J Reichelt1, E Jost1, G Gehbauer1, JG Herman2 and R Osieka1 1Medizinische Klinik IV, Universitaetsklinikum Aachen, 52074 Aachen, Germany; and 2The Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins, Baltimore, MD 21231, USA Using a candidate gene approach, we analyzed the methylation It could be demonstrated that there are specific methylation status of the promoter-associated CpG islands of 11 well- patterns in various types of human malignancies.13 Unlike characterized tumor suppressor genes by methylation-specific genetic alterations in cancer, epigenetic changes are potentially polymerase chain reaction in five multiple myeloma (MM) cell 0 lines and 56 patients with malignant plasma cell disorders. The reversible. Demethylating agents such as 5-aza-2 -deoxycyti- frequency of aberrant methylation among the patient samples dine are capable of reactivating tumor suppressor genes that are was 46.4% for SOCS-1, 35.7% for p16, 21.4% for E-cadherin, silenced by promoter hypermethylation.4,14 Characterization of 12.5% for DAP kinase and p73, 1.8% for p15, MGMT as well as the methylation profile of candidate tumor suppressor genes that RARb, and 0% for TIMP-3, RASSF1A and hMLH1. We found at have been established to play a role in tumorigenesis may least one hypermethylated gene in 80.4% of the primary patient samples, while 33.9% harbored two or more hypermethylated provide significant insight into the molecular pathogenesis of genes. For the first time, we show that p73 may be hypermethy- MM. Furthermore, methylation patterns may be predictive for 15,16 lated in MM and thus be involved in the pathogenesis of plasma clinical behavior and response to therapy. cell disorders. Hypermethylation of p16 at diagnosis was To gain further insight into specific pathways that are relevant associated with a poorer prognosis. In patients with plasma in the multistep transformation process of normal plasma cells to cell leukemia, we found frequent simultaneous hypermethyla- MM, we have therefore applied methylation analysis of 11 tion of p16, E-cadherin and DAP kinase. We conclude that aberrant methylation of tumor suppressor genes is a common candidate genes to five MM cell lines and 56 samples from event in malignant plasma cell disorders and that there is a patients with plasma cell disorders as well as 20 nonmalignant correlation between methylation patterns and clinical charac- bone marrow samples. The list of tumor suppressor genes teristics in MM patients. includes the cell cycle regulators p15, p16 and p73, the tissue Leukemia (2004) 18, 1687–1692. doi:10.1038/sj.leu.2403434 inhibitor of matrix metalloproteinases-3 (TIMP-3), E-cadherin, Published online 19 August 2004 the DNA repair genes O6-methylguanine DNA methyltransfer- Keywords: DNA methylation; tumor suppressor genes; multiple myeloma; epigenetics; tumor marker; methylation profile ase (MGMT) and hMLH1, DAP kinase, RASSF1A, the retinoic acid receptor b (RARb) and the cytokine regulator SOCS-1. It could be shown that each of these genes may be affected by aberrant CpG island methylation in association with transcrip- Introduction tional silencing in various types of human malignancies.17–27 Multiple myeloma (MM) is a B-cell neoplasm that is character- ized by the accumulation of malignant plasma cells in the bone Material and methods marrow. Previous molecular studies have largely focused on acquired genetic aberrations in MM. Important changes in DNA Human tissue samples sequence include chromosomal translocations involving the immunoglobulin heavy chain locus on chromosome 14q32 and Bone marrow (BM) and peripheral blood (PB) specimens were various partner genes such as cyclin D1, cyclin D3, fibroblast obtained during routine clinical assessment of 53 MM patients growth factor receptor 3 and c-maf, as well as mutations of N- and three patients with monoclonal gammopathy of undeter- ras and K-ras.1–3 The accumulation of genetic events is thought mined significance (MGUS), who presented at the University to be crucial for the malignant transformation of plasma cells.1 Hospital Aachen, Germany, between 1995 and 2002. MM There is increasing evidence that in addition to genetic diagnosis and staging classification were made in accordance aberrations epigenetic processes play a major role in carcino- with standard criteria.28 The main clinical characteristics of the genesis. Aberrant methylation of gene promoter regions is the patient cohort are summarized in Table 1. Control BM samples most widely studied epigenetic abnormality in human malig- were aspirated from 20 patients with nonmetastatic solid tumors nancies and is associated with loss of gene function. This or malignant lymphoma without BM infiltration or hematopoie- epigenetic event acts as an alternative to mutations and tic dysfunction as part of the routine staging procedures. deletions to disrupt tumor suppressor gene function.4,5 It was Informed consent was obtained from all patients following reported previously that hypermethylation of the cell cycle institutional guidelines. Normal PB samples were collected from inhibitors p15 and p16,6–9 the apoptosis regulator DAP kinase10 healthy volunteers. Mononuclear cells from BM and PB were and the tumor suppressor RASSF1A11 may occur in MM separated by density gradient centrifugation prior to further patients. Additionally, we have recently identified hypermethy- analysis. lation-associated silencing of the suppressor of cytokine signal- ing-1 (SOCS-1) gene to be a frequent epigenetic aberration in 12 MM. Cell lines Correspondence: Dr O Galm, Medizinische Klinik IV, Universitaets- We obtained the MM cell lines U266, OPM-2, RPMI8226 and klinikum Aachen, Pauwelsstrasse 30, 52074 Aachen, Germany; Fax: þ 49 241 8082449; E-mail: [email protected] LP-1 from the German Collection of Microorganisms and Cell Received 25 March 2004; accepted 11 June 2004; Published online Cultures (Braunschweig, Germany). XG1 cells were kindly 19 August 2004 provided by PC Heinrich (RWTH Aachen, Germany). DNA methylation in multiple myeloma O Galm et al 1688 Table 1 Patient characteristics specific for either the methylated or the unmethylated sequence. Primers for MSP analysis are designed to discriminate between Number of patients 56 methylated and unmethylated alleles after bisulfite treatment Median age, years (range) 65.5 (40–81) and to anneal only to DNA that has been bisulfite-converted. A purification of plasma cells prior to further analysis was not Gender (n) performed because of the high sensitivity of the MSP technique Male 35 Female 21 with a detection limit of approximately 0.1% of methylated DNA present in an otherwise unmethylated sample.29 Paraprotein isotype (n) Genomic DNA was isolated from cell lines and primary IgA 12 tissues using standard methods. Approximately 1 mg of DNA was IgG 33 sodium bisulfite-modified and subjected to MSP as described IgM 1 previously.29 A detailed list of MSP primers that specifically Light chain only 6 Nonsecretory 4 recognize either unmethylated (U) or methylated (M) gene sequences is given in Table 2. Reactions were hot-started at Stage (n) 951C for 5 min and held at 801C before addition of 0.625 U of MGUS 3 Taq polymerase (Sigma, St Louis, MO, USA). Temperature I2conditions for PCR for all genes except TIMP-3 were as follows: II 12 35 cycles of 951C for 30 s, 601C for 30 s and 721C for 30 s, III 39 followed by one cycle of 721C for 5 min. For TIMP-3 analysis, Plasma cell leukemia (n) 5 conditions were 35 cycles of 951C for 30 s, 591C for 30 s and 721C for 30 s, followed by one cycle of 721C for 5 min. PCR Lytic bone lesions (n) products were separated on 2.5% agarose gels and visualized by Yes 44 ethidium bromide staining. No 12 At diagnosis (n)36 During follow-up (n) 20 Statistical methods WBC, G/l (range) 6.2 (0.9–63.4) Hb, g/l (range) 113.5 (57–192) Overall survival curves were plotted according to the method of PLT, G/l (range) 225.5 (22–479) Kaplan and Meier, and compared using the log-rank test. LDH, U/l (range) 185.5 (63–908) Survival was calculated from the date of diagnosis until the Creatinine, mg/dl (range) 1.1 (0.3–6.9) patients’ death or last visit. Correlation between variables was Serum calcium, mmol/l (range) 2.3 (2.04–4.41) estimated using the Fisher’s exact two-sided test. All calculations were performed using the SAS statistical software (version 8.02, SAS Institute, Cary, NC, USA). Methylation-specific polymerase chain reaction (MSP) MSP29 was used for qualitative analysis of the methylation status Results of the 11 tumor suppressor genes. After bisulfite treatment of genomic DNA, which converts all unmethylated cytosines to We determined the methylation status of 11 tumor suppressor uracils, the subsequent PCR amplification is performed in two genes in five MM cell lines, 56 patients with neoplastic plasma separate reactions with two different primer pairs that are cell disorders and 20 nonmalignant BM specimens. Figure 1 Table 2 Primer sets for MSP analysis Gene Forward primer (50- 30) Reverse primer (50-30) p15 U: GGTTGGTTTTTTATTTTGTTAGAGTGAGGT AACCACTCTAACCACAAAATACAAACACA M GGTTTTTTATTTTGTTAGAGCGAGGC TAACCGCAAAATACGAACGCG p16 U: TTATTAGAGGGTGGGGTGGATTGT CAACCCCAAACCACAACCATAA M: TTATTAGAGGGTGGGGCGGATCGC GACCCCGAACCGCGACCGTAA TIMP-3 U: TTTTGTTTTGTTATTTTTTGTTTTTGGTTTT CCCCCAAAAACCCCACCTCA M: CGTTTCGTTATTTTTTGTTTTCGGTTTC CCGAAAACCCCGCCTCG E-cadherin
Load more

Recommended publications
  • The P16 (Cdkn2a/Ink4a) Tumor-Suppressor Gene in Head
    The p16 (CDKN2a/INK4a) Tumor-Suppressor Gene in Head and Neck Squamous Cell Carcinoma: A Promoter Methylation and Protein Expression Study in 100 Cases Lingbao Ai, M.D., Krystal K. Stephenson, Wenhua Ling, M.D., Chunlai Zuo, M.D., Perkins Mukunyadzi, M.D., James Y. Suen, M.D., Ehab Hanna, M.D., Chun-Yang Fan, M.D., Ph.D. Departments of Pathology (LA, KKS, CZ, PM, CYF) and Otolaryngology-Head and Neck Surgery (CYF, JYS, EH), University of Arkansas for Medical Sciences; and School of Public Health (LA, WL), Sun-Yat Sen University, Guangzhou, China apparent loss of p16 protein expression appears to The p16 (CDKN2a/INK4a) gene is an important be an independent prognostic factor, although loss tumor-suppressor gene, involved in the p16/cyclin- of p16 protein may be used to predict overall pa- dependent kinase/retinoblastoma gene pathway of tient survival in early-stage head and neck squa- cell cycle control. The p16 protein is considered to mous cell carcinoma. be a negative regulator of the pathway. The gene encodes an inhibitor of cyclin-dependent kinases 4 KEY WORDS: Gene inactivation, Head and and 6, which regulate the phosphorylation of reti- neck squamous cell carcinoma, p16, Promoter noblastoma gene and the G1 to S phase transition of hypermethylation. the cell cycle. In the present study, p16 gene pro- Mod Pathol 2003;16(9):944–950 moter hypermethylation patterns and p16 protein expression were analyzed in 100 consecutive un- The development of head and neck squamous cell treated cases of primary head and neck squamous carcinoma is believed to be a multistep process, in cell carcinoma by methylation-specific PCR and im- which genetic and epigenetic events accumulate as munohistochemical staining.
    [Show full text]
  • The P53/P73 - P21cip1 Tumor Suppressor Axis Guards Against Chromosomal Instability by Restraining CDK1 in Human Cancer Cells
    Oncogene (2021) 40:436–451 https://doi.org/10.1038/s41388-020-01524-4 ARTICLE The p53/p73 - p21CIP1 tumor suppressor axis guards against chromosomal instability by restraining CDK1 in human cancer cells 1 1 2 1 2 Ann-Kathrin Schmidt ● Karoline Pudelko ● Jan-Eric Boekenkamp ● Katharina Berger ● Maik Kschischo ● Holger Bastians 1 Received: 2 July 2020 / Revised: 2 October 2020 / Accepted: 13 October 2020 / Published online: 9 November 2020 © The Author(s) 2020. This article is published with open access Abstract Whole chromosome instability (W-CIN) is a hallmark of human cancer and contributes to the evolvement of aneuploidy. W-CIN can be induced by abnormally increased microtubule plus end assembly rates during mitosis leading to the generation of lagging chromosomes during anaphase as a major form of mitotic errors in human cancer cells. Here, we show that loss of the tumor suppressor genes TP53 and TP73 can trigger increased mitotic microtubule assembly rates, lagging chromosomes, and W-CIN. CDKN1A, encoding for the CDK inhibitor p21CIP1, represents a critical target gene of p53/p73. Loss of p21CIP1 unleashes CDK1 activity which causes W-CIN in otherwise chromosomally stable cancer cells. fi Vice versa 1234567890();,: 1234567890();,: Consequently, induction of CDK1 is suf cient to induce abnormal microtubule assembly rates and W-CIN. , partial inhibition of CDK1 activity in chromosomally unstable cancer cells corrects abnormal microtubule behavior and suppresses W-CIN. Thus, our study shows that the p53/p73 - p21CIP1 tumor suppressor axis, whose loss is associated with W-CIN in human cancer, safeguards against chromosome missegregation and aneuploidy by preventing abnormally increased CDK1 activity.
    [Show full text]
  • P14ARF Inhibits Human Glioblastoma–Induced Angiogenesis by Upregulating the Expression of TIMP3
    P14ARF inhibits human glioblastoma–induced angiogenesis by upregulating the expression of TIMP3 Abdessamad Zerrouqi, … , Daniel J. Brat, Erwin G. Van Meir J Clin Invest. 2012;122(4):1283-1295. https://doi.org/10.1172/JCI38596. Research Article Oncology Malignant gliomas are the most common and the most lethal primary brain tumors in adults. Among malignant gliomas, 60%–80% show loss of P14ARF tumor suppressor activity due to somatic alterations of the INK4A/ARF genetic locus. The tumor suppressor activity of P14ARF is in part a result of its ability to prevent the degradation of P53 by binding to and sequestering HDM2. However, the subsequent finding of P14ARF loss in conjunction with TP53 gene loss in some tumors suggests the protein may have other P53-independent tumor suppressor functions. Here, we report what we believe to be a novel tumor suppressor function for P14ARF as an inhibitor of tumor-induced angiogenesis. We found that P14ARF mediates antiangiogenic effects by upregulating expression of tissue inhibitor of metalloproteinase–3 (TIMP3) in a P53-independent fashion. Mechanistically, this regulation occurred at the gene transcription level and was controlled by HDM2-SP1 interplay, where P14ARF relieved a dominant negative interaction of HDM2 with SP1. P14ARF-induced expression of TIMP3 inhibited endothelial cell migration and vessel formation in response to angiogenic stimuli produced by cancer cells. The discovery of this angiogenesis regulatory pathway may provide new insights into P53-independent P14ARF tumor-suppressive mechanisms that have implications for the development of novel therapies directed at tumors and other diseases characterized by vascular pathology. Find the latest version: https://jci.me/38596/pdf Research article P14ARF inhibits human glioblastoma–induced angiogenesis by upregulating the expression of TIMP3 Abdessamad Zerrouqi,1 Beata Pyrzynska,1,2 Maria Febbraio,3 Daniel J.
    [Show full text]
  • Deciphering the Nature of Trp73 Isoforms in Mouse
    cancers Article Deciphering the Nature of Trp73 Isoforms in Mouse Embryonic Stem Cell Models: Generation of Isoform-Specific Deficient Cell Lines Using the CRISPR/Cas9 Gene Editing System Lorena López-Ferreras 1,2,†, Nicole Martínez-García 1,3,†, Laura Maeso-Alonso 1,2,‡, Marta Martín-López 1,4,‡, Ángela Díez-Matilla 1,‡ , Javier Villoch-Fernandez 1,2, Hugo Alonso-Olivares 1,2, Margarita M. Marques 3,5,* and Maria C. Marin 1,2,* 1 Instituto de Biomedicina (IBIOMED), Universidad de León, 24071 León, Spain; [email protected] (L.L.-F.); [email protected] (N.M.-G.); [email protected] (L.M.-A.); [email protected] (M.M.-L.); [email protected] (Á.D.-M.); [email protected] (J.V.-F.); [email protected] (H.A.-O.) 2 Departamento de Biología Molecular, Universidad de León, 24071 León, Spain 3 Departamento de Producción Animal, Universidad de León, 24071 León, Spain 4 Biomar Microbial Technologies, Parque Tecnológico de León, Armunia, 24009 León, Spain 5 Instituto de Desarrollo Ganadero y Sanidad Animal (INDEGSAL), Universidad de León, 24071 León, Spain * Correspondence: [email protected] (M.M.M.); [email protected] (M.C.M.); Tel.: +34-987-291757 Citation: López-Ferreras, L.; (M.M.M.); +34-987-291490 (M.C.M.) Martínez-García, N.; Maeso-Alonso, † Equal contribution. ‡ Equal contribution. L.; Martín-López, M.; Díez-Matilla, Á.; Villoch-Fernandez, J.; Simple Summary: The Trp73 gene is involved in the regulation of multiple biological processes Alonso-Olivares, H.; Marques, M.M.; Marin, M.C. Deciphering the Nature such as response to stress, differentiation and tissue architecture.
    [Show full text]
  • Involvement of the Cyclin-Dependent Kinase Inhibitor P16 (Ink4a) in Replicative Senescence of Normal Human Fibroblasts
    Proc. Natl. Acad. Sci. USA Vol. 93, pp. 13742–13747, November 1996 Biochemistry Involvement of the cyclin-dependent kinase inhibitor p16 (INK4a) in replicative senescence of normal human fibroblasts DAVID A. ALCORTA*†,YUE XIONG‡,DAWN PHELPS‡,GREG HANNON§,DAVID BEACH§, AND J. CARL BARRETT* *Laboratory of Molecular Carcinogenesis, National Institute of Environmental Health Sciences, Research Triangle Park, NC 27709; ‡Lineberger Comprehensive Cancer Center, University of North Carolina, Chapel Hill, NC 27599; and §Howard Hughes Medical Institute, Cold Spring Harbor Laboratories, Cold Spring Harbor, NY 11724 Communicated by Raymond L. Erickson, Harvard University, Cambridge, MA, September 19, 1996 (received for review on May 15, 1996) ABSTRACT Human diploid fibroblasts (HDFs) can be viewed in ref. 5). In senescent fibroblasts, CDK2 is catalytically grown in culture for a finite number of population doublings inactive and the protein down-regulated (7). CDK4 is also before they cease proliferation and enter a growth-arrest state reported to be down-regulated in senescent cells (8), while the termed replicative senescence. The retinoblastoma gene prod- status of CDK6 has not been previously addressed. The uct, Rb, expressed in these cells is hypophosphorylated. To activating cyclins for these CDKs, cyclins D1 and E, are present determine a possible mechanism by which senescent human in senescent cells at similar or elevated levels relative to early fibroblasts maintain a hypophosphorylated Rb, we examined passage cells (8). A role of the CDK inhibitors in senescence the expression levels and interaction of the Rb kinases, CDK4 was revealed by the isolation of a cDNA of a highly expressed and CDK6, and the cyclin-dependent kinase inhibitors p21 message in senescent cells that encoded the CDK inhibitor, p21 and p16 in senescent HDFs.
    [Show full text]
  • TP63 Is Significantly Upregulated in Diabetic Kidney
    International Journal of Molecular Sciences Article TP63 Is Significantly Upregulated in Diabetic Kidney Sitai Liang 1, Bijaya K. Nayak 1, Kristine S. Vogel 1 and Samy L. Habib 1,2,* 1 Department of Cell Systems and Anatomy, The University of Texas Health Science Center, San Antonio, TX 78229, USA; [email protected] (S.L.); [email protected] (B.K.N.); [email protected] (K.S.V.) 2 South Texas, Veterans Healthcare System, San Antonio, TX 78229, USA * Correspondence: [email protected]; Tel.: +1-21-0567-3816; Fax: +1-21-0567-3802 Abstract: The role of tumor protein 63 (TP63) in regulating insulin receptor substrate 1 (IRS-1) and other downstream signal proteins in diabetes has not been characterized. RNAs extracted from kidneys of diabetic mice (db/db) were sequenced to identify genes that are involved in kidney complications. RNA sequence analysis showed more than 4- to 6-fold increases in TP63 expression in the diabetic mice’s kidneys, compared to wild-type mice at age 10 and 12 months old. In addition, the kidneys from diabetic mice showed significant increases in TP63 mRNA and protein expression compared to WT mice. Mouse proximal tubular cells exposed to high glucose (HG) for 48 h showed significant decreases in IRS-1 expression and increases in TP63, compared to cells grown in normal glucose (NG). When TP63 was downregulated by siRNA, significant increases in IRS-1 and activation of AMP-activated protein kinase (AMPK (p-AMPK-Th172)) occurred under NG and HG conditions. Moreover, activation of AMPK by pretreating the cells with AICAR resulted in significant down- regulation of TP63 and increased IRS-1 expression.
    [Show full text]
  • Transcriptional Regulation of the P16 Tumor Suppressor Gene
    ANTICANCER RESEARCH 35: 4397-4402 (2015) Review Transcriptional Regulation of the p16 Tumor Suppressor Gene YOJIRO KOTAKE, MADOKA NAEMURA, CHIHIRO MURASAKI, YASUTOSHI INOUE and HARUNA OKAMOTO Department of Biological and Environmental Chemistry, Faculty of Humanity-Oriented Science and Engineering, Kinki University, Fukuoka, Japan Abstract. The p16 tumor suppressor gene encodes a specifically bind to and inhibit the activity of cyclin-CDK specific inhibitor of cyclin-dependent kinase (CDK) 4 and 6 complexes, thus preventing G1-to-S progression (4, 5). and is found altered in a wide range of human cancers. p16 Among these CKIs, p16 plays a pivotal role in the regulation plays a pivotal role in tumor suppressor networks through of cellular senescence through inhibition of CDK4/6 activity inducing cellular senescence that acts as a barrier to (6, 7). Cellular senescence acts as a barrier to oncogenic cellular transformation by oncogenic signals. p16 protein is transformation induced by oncogenic signals, such as relatively stable and its expression is primary regulated by activating RAS mutations, and is achieved by accumulation transcriptional control. Polycomb group (PcG) proteins of p16 (Figure 1) (8-10). The loss of p16 function is, associate with the p16 locus in a long non-coding RNA, therefore, thought to lead to carcinogenesis. Indeed, many ANRIL-dependent manner, leading to repression of p16 studies have shown that the p16 gene is frequently mutated transcription. YB1, a transcription factor, also represses the or silenced in various human cancers (11-14). p16 transcription through direct association with its Although many studies have led to a deeper understanding promoter region.
    [Show full text]
  • The P16 Status of Tumor Cell Lines Identifies Small Molecule Inhibitors Specific for Cyclin-Dependent Kinase 41
    Vol. 5, 4279–4286, December 1999 Clinical Cancer Research 4279 The p16 Status of Tumor Cell Lines Identifies Small Molecule Inhibitors Specific for Cyclin-dependent Kinase 41 Akihito Kubo,2 Kazuhiko Nakagawa,2, 3 CDK4 kinase inhibitors that may selectively induce growth Ravi K. Varma, Nicholas K. Conrad, inhibition of p16-altered tumors. Jin Quan Cheng, Wen-Ching Lee, INTRODUCTION Joseph R. Testa, Bruce E. Johnson, INK4A 4 The p16 gene (also known as CDKN2A) encodes p16 , Frederic J. Kaye, and Michael J. Kelley which inhibits the CDK45:cyclin D and CDK6:cyclin D com- Medicine Branch [A. K., K. N., N. K. C., F. J. K., B. E. J.] and plexes (1). These complexes mediate phosphorylation of the Rb Developmental Therapeutics Program [R. K. V.], National Cancer Institute, Bethesda, Maryland 20889; Department of Medical protein and allow cell cycle progression beyond the G1-S-phase Oncology, Fox Chase Cancer Center, Philadelphia, Pennsylvania checkpoint (2). Alterations of p16 have been described in a wide 19111 [J. Q. C., W-C. L., J. R. T.]; and Department of Medicine, variety of histological types of human cancers including astro- Duke University Medical Center, Durham, North Carolina 27710 cytoma, melanoma, leukemia, breast cancer, head and neck [M. J. K.] squamous cell carcinoma, malignant mesothelioma, and lung cancer. Alterations of p16 can occur through homozygous de- ABSTRACT letion, point mutation, and transcriptional suppression associ- ated with hypermethylation in cancer cell lines and primary Loss of p16 functional activity leading to disruption of tumors (reviewed in Refs. 3–5). the p16/cyclin-dependent kinase (CDK) 4:cyclin D/retino- Whereas the Rb gene is inactivated in a narrow range of blastoma pathway is the most common event in human tumor cells, the pattern of mutational inactivation of Rb is tumorigenesis, suggesting that compounds with CDK4 ki- inversely correlated with p16 alterations (6–8), suggesting that nase inhibitory activity may be useful to regulate cancer cell a single defect in the p16/CDK4:cyclin D/Rb pathway is suffi- growth.
    [Show full text]
  • Are Interactions with P63 and P73 Involved in Mutant P53 Gain of Oncogenic Function?
    Oncogene (2007) 26, 2220–2225 & 2007 Nature Publishing Group All rights reserved 0950-9232/07 $30.00 www.nature.com/onc REVIEW Are interactions with p63 and p73 involved in mutant p53 gain of oncogenic function? Y Li and C Prives Department of Biological Sciences, Columbia University, New York, NY, USA Although still controversial, the presence of mutant p53 in deletion or frameshift mutations resulting in their lack cancer cells mayresult in more aggressive tumors and of expression, however, many tumor-derived p53 muta- correspondinglyworse outcomes. The means bywhich tions are of the missense variety. These mutations are mutant p53 exerts such pro-oncogenic activityare usually located within the central conserved region of currentlyunder extensive investigation and different p53 that binds to DNA in a sequence-specific manner models have been proposed. We focus here on a proposed and result in either direct loss of DNA contact or gross mechanism bywhich a subset of tumor-derived p53 mut- change of the conformation that no longer permits p53 ants physically interact with p53 family members, p63 and to recognize its wild-type DNA targets (reviewed by p73, and negativelyregulate their proapoptotic function. Vousden and Lu, 2002). Approximately 30% of these Both cell-based assays and knock-in mice expressing tumor-derived p53 mutations affect only six ‘hot-spot’ mutant forms of p53 support this model. As more than half residues (175, 245, 248, 249, 273 and 282). In many cases of human tumors harbor mutant forms of p53 protein, tumor-derived p53 mutants are expressed at far higher approaches aimed at disrupting the pathological interac- levels than wild-type p53 protein due in part to their tions among p53 familymembers might be of clinical failure to be degraded by Mdm2.
    [Show full text]
  • AP-1 in Cell Proliferation and Survival
    Oncogene (2001) 20, 2390 ± 2400 ã 2001 Nature Publishing Group All rights reserved 0950 ± 9232/01 $15.00 www.nature.com/onc AP-1 in cell proliferation and survival Eitan Shaulian1 and Michael Karin*,1 1Laboratory of Gene Regulation and Signal Transduction, Department of Pharmacology, University of California San Diego, 9500 Gilman Drive, La Jolla, California, CA 92093-0636, USA A plethora of physiological and pathological stimuli extensively discussed previously (Angel and Karin, induce and activate a group of DNA binding proteins 1991; Karin, 1995). that form AP-1 dimers. These proteins include the Jun, The mammalian AP-1 proteins are homodimers and Fos and ATF subgroups of transcription factors. Recent heterodimers composed of basic region-leucine zipper studies using cells and mice de®cient in individual AP-1 (bZIP) proteins that belong to the Jun (c-Jun, JunB proteins have begun to shed light on their physiological and JunD), Fos (c-Fos, FosB, Fra-1 and Fra-2), Jun functions in the control of cell proliferation, neoplastic dimerization partners (JDP1 and JDP2) and the closely transformation and apoptosis. Above all such studies related activating transcription factors (ATF2, LRF1/ have identi®ed some of the target genes that mediate the ATF3 and B-ATF) subfamilies (reviewed by (Angel eects of AP-1 proteins on cell proliferation and death. and Karin, 1991; Aronheim et al., 1997; Karin et al., There is evidence that AP-1 proteins, mostly those that 1997; Liebermann et al., 1998; Wisdom, 1999). In belong to the Jun group, control cell life and death addition, some of the Maf proteins (v-Maf, c-Maf and through their ability to regulate the expression and Nrl) can heterodimerize with c-Jun or c-Fos (Nishiza- function of cell cycle regulators such as Cyclin D1, p53, wa et al., 1989; Swaroop et al., 1992), whereas other p21cip1/waf1, p19ARF and p16.
    [Show full text]
  • Alterations of P14arf, P53, and P73 Genes Involved in the E2F-1-Mediated Apoptotic Pathways in Non-Small Cell Lung Carcinoma
    [CANCER RESEARCH 61, 5636–5643, July 15, 2001] Alterations of p14ARF, p53, and p73 Genes Involved in the E2F-1-mediated Apoptotic Pathways in Non-Small Cell Lung Carcinoma Siobhan A. Nicholson,1 Nader T. Okby,1 Mohammed A. Khan, Judith A. Welsh, Mary G. McMenamin, William D. Travis, James R. Jett, Henry D. Tazelaar, Victor Trastek, Peter C. Pairolero, Paul G. Corn, James G. Herman, Lance A. Liotta, Neil E. Caporaso, and Curtis C. Harris2 Laboratory of Human Carcinogenesis, National Cancer Institute, Bethesda, Maryland 20892 [S. A. N., M. A. K., J. A. W., M. G. M., L. A. L., N. E. C., C. C. H.]; Orange Pathology Associates, Middleton, New York 10940 [N. T. O.]; Armed Forces Institute of Pathology, Washington, DC 20306 [S. A. N., W. D. T.]; Mayo Clinic, Rochester, Minnesota 55905 [J. R. J., H. D. T., V. T., P. C. P.]; and The Johns Hopkins Oncology Center, Baltimore, Maryland 21231 [P. G. C., J. G. H.] ABSTRACT encoded by a separate exon 1␤ that lies ϳ20 kb upstream of exon 1␣ and shares exons 2 and 3 as read in an ARF, giving rise to a protein ARF Overexpression of E2F-1 induces apoptosis by both a p14 -p53- and INK4a ARF completely unrelated to p16 (14). Despite its unrelated structure, a p73-mediated pathway. p14 is the alternate tumor suppressor prod- ARF p14 also is capable of causing cell cycle arrest in G1 and G2. uct of the INK4a/ARF locus that is inactivated frequently in lung carci- ARF nogenesis. Because p14ARF stabilizes p53, it has been proposed that the loss p14 binds to and antagonizes the actions of MDM2, a negative of p14ARF is functionally equivalent to a p53 mutation.
    [Show full text]
  • Regulation of P27kip1 and P57kip2 Functions by Natural Polyphenols
    biomolecules Review Regulation of p27Kip1 and p57Kip2 Functions by Natural Polyphenols Gian Luigi Russo 1,* , Emanuela Stampone 2 , Carmen Cervellera 1 and Adriana Borriello 2,* 1 National Research Council, Institute of Food Sciences, 83100 Avellino, Italy; [email protected] 2 Department of Precision Medicine, University of Campania “Luigi Vanvitelli”, 81031 Napoli, Italy; [email protected] * Correspondence: [email protected] (G.L.R.); [email protected] (A.B.); Tel.: +39-0825-299-331 (G.L.R.) Received: 31 July 2020; Accepted: 9 September 2020; Published: 13 September 2020 Abstract: In numerous instances, the fate of a single cell not only represents its peculiar outcome but also contributes to the overall status of an organism. In turn, the cell division cycle and its control strongly influence cell destiny, playing a critical role in targeting it towards a specific phenotype. Several factors participate in the control of growth, and among them, p27Kip1 and p57Kip2, two proteins modulating various transitions of the cell cycle, appear to play key functions. In this review, the major features of p27 and p57 will be described, focusing, in particular, on their recently identified roles not directly correlated with cell cycle modulation. Then, their possible roles as molecular effectors of polyphenols’ activities will be discussed. Polyphenols represent a large family of natural bioactive molecules that have been demonstrated to exhibit promising protective activities against several human diseases. Their use has also been proposed in association with classical therapies for improving their clinical effects and for diminishing their negative side activities. The importance of p27Kip1 and p57Kip2 in polyphenols’ cellular effects will be discussed with the aim of identifying novel therapeutic strategies for the treatment of important human diseases, such as cancers, characterized by an altered control of growth.
    [Show full text]