DOCSLIB.ORG

US 2003/0040089 A1 Legrain Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

US 200300.40089A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2003/0040089 A1 Legrain et al. (43) Pub. Date: Feb. 27, 2003 (54) PROTEIN-PROTEIN INTERACTIONS IN Publication Classification ADIPOCYTE CELLS (76) Inventors: Pierre Legrain, Paris (FR); Stefano (51) Int. Cl." .......................... G01N 33/53; G06F 19/00; Marullo, Paris (FR); Jockers Ralf, G01N 33/48; G01N 33/50; Bures Sur Yvette (FR) C07H 21/04; C12N 9/00 (52) U.S. Cl. ......................... 435/183; 435/69.1; 435/7.1; Correspondence Address: 435/325; 435/320.1; 536/23.2; LERNER, DAVID, LITTENBERG, 702/19 KRUMHOLZ & MENTLIK 600 SOUTHAVENUE WEST (57) ABSTRACT WESTFIELD, NJ 07090 (US) Disclosed are protein-protein interactions in adipocytes. Also disclosed are complexes of polypeptides or polynucle (21) Appl. No.: 10/038,010 otides encoding the polypeptides, fragments of the polypep (22) Filed: Jan. 2, 2002 tides, antibodies to the complexes, Selected Interacting Domains (SID(R) which are identified due to the protein Related U.S. Application Data protein interactions, methods for Screening drugs for agents which modulate the interaction of proteins and pharmaceu (60) Provisional application No. 60/259,377, filed on Jan. tical compositions that are capable of modulating the pro 2, 2001. tein-protein interactions. Patent Application Publication Feb. 27, 2003 Sheet 1 of 19 US 2003/0040089 A1 pBl Alias: pAS2DD Application: 2HY (bait) --- Backbone: Specificity: 287 NSBfrB Selection:rare a amplicillin0 - Scal 6720 287 Ppu 1 Of COIStructedConstructed by:by Bpm 6327 1285 x 1288 B.Se R AWN 5760 pBl -- 1748 Bsp El 841 Pn Sap 5226 7159 base pairs 1956 Apa Bf Unique Sites 2. 2174 BSX Pst 4776 Sa 4770 Bar H 4764 Xnal 4759 Sgt E. 2880 Dra Nicolty 4749 2986 Naee Bst DS 4749 3289 Npe Ngo MIV Sf 4747 32.93 EC 136 MSc 4746 3293 Sac Hpal 4570 3384 Mill C BSf B 426 3465 Ppu M BSa B 3797 3515 ReA Oligo 160 gagagtagtaacaaaggtel AAAGACAGTTGACTGTATCGCCG GAA TTT AT Sf S" BamHI sali Pst G GCC ATG GAG GCC CCG GGG ATC CGT CGA CCT GCA GCC Nico I Oligo 161 AAG CTA ATT ccggg.cgaatttctatg Oligo 1605 GAGAGTAGTAACAAAGGTC3 Oligo 161 5’ CATAAGAAATTCGCCCGG 3 FIGURE I Patent Application Publication Feb. 27, 2003 Sheet 2 of 19 US 2003/0040089 A1 Alias: paS2DDNSI Application: 2HY (bait) 287 Bfirst Backbone: pAS2DD 287 NS Specificity. Sfinon-oriented Sca. 6761 287 Ppu 1 Ol Selection: ampicillin V Constructed by SW Bpm. 6368 1285 Xern 1288 Bse R Awn 5801 pB5 -- 18411748 BspPrin El Sap 5267 7200 base pairs s: 2E S Unique Sites 2124 Bst 36 2174 BSf X Pst 4817 a Bsp. 120 4805 Apa 4805 oSf 4797 Pac 4788 Bri 4782 2880 Dra Spe. 4774 V 2986 Nae Eagt 4767 2986 Ngo MV Not 4766 3289 N. Sac 4764 3293 Ech 136 MI 113 4764 3293 Sac a S. 4753 3384 Mul Styl 4749 3465 Ppu Mi Nico 4749 3515 ReA Msc 4746 Hpal 4570 BSfB 4026 Bsa B 3797 Oligo 160 gagagtagtaacaaaggtelAAAGACAGTTGACTGTATCGCCG GAA TTT ATG Sf Sac II Spe I Ban HI GCC ATG GCC GCA GGG GCC GCG GCC GCA CTA GTG GGG ATC C Nico I Not STOP Sf Pst TT AAT TAAGGG CCA CTG GGG CCC CTC GAC CTG CAGCCA Pac Oligo 161 AGC TAA TT|ccgggcgaatttctatg Oligo 160 5 GAGAGTAGTAACAAAGGTC3 Oligo 161 5’ CATAAGAAATTCGCCCGG3 FIGURE 2 Patent Application Publication Feb. 27, 2003 Sheet 3 of 19 US 2003/0040089 A1 pB6 Application: 2HY (bait) 287 Bir B Backbone: pAS2DD 287 NS Specificity: Sfi oriented Scat 6761 287 Ppu 10) Selection: ampicillin Constructed by: SW Bpm 6368 1285 Xcin 288 Bse R Afwn 5801 pB6 -- 1748 Bsp El 1841 Pri Sap 15267 7200 base pairs 1956 Apa B Unique Sites 1956 BSAP 2124 Bsu 36 2174 BSX Pst 4817 Bsp120 4805 Apa 4805 oS 4797 Pact 4788 Ban H 4782 2880 Dral Spel 4774 2986 Nae Eag 4767 2986 Ngo MV No. 4766 3289 Niru Saci. 4764 3293 EC 136 M113 4764 3293 Sac Sf 4753 3384 Mill Styl 4749 3465 Ppu Mi Nico 4749 3515 ReA Aisc 4746 HpaI 4570 Est B 4026 Bsa B 3797 Oligo 160 gagagtagtaacaaaggtoAAAGACAGTTGACTGTATCGCCG GAATTT ATG Sf Sac II Spe I Ban HI GCC ATG GCC GGA CGG GCC GCG GCC GCA CTA GTG GGG ATC C Nico I Not STOP sf, I Apal Pst TT AAT TAAGGG CCA CTGGGG CCC CTC GAC CTG CAGCCA Pac Oligo 161 AGC TAA TTccgggegaatcitatg Oligo 160 5 GAGAGTAGTAACAAAGGTC3 Oligo 161 5’ CATAAGAAATTCGCCCGG3? FIGURE 3 Patent Application Publication Feb. 27, 2003 Sheet 4 of 19 US 2003/0040089 A1 pB13 Alias: pGBT9NSl Application: 2HY (bait) Backbone: pCBT9 165 Bsts 651 Scil Specificity. Sfinon-oriented 651 Xho Selection: amplicillin 709 Hpa Constructed by: CR 724 BSrG 885 MSc 888 Nicol 888 Sty Ppu 10 5290 903 Milu 113 Wsi 5290 903 Sac Birs 5290 905. Not w 906 Eag 913 Spel Sna B 4936 921 Barr H 927 Pac 944. Apa 944 Bsp 12O 2 g56 Psi 1168 Nae pB13 1168 Ngo MW Aat 4160 -- 1440 BSF 5580 base pairs Unique Sites 1590 estx 1604 corv 1645 Bsu 36 1747 Mife Scal 3720 1803 Xibal 1809 Apa Bl Pwu 3609 809 BSAP 1929 Piml 217 Pvu Bpn 3327 V 2226 Sap Ahd 3237 2349 Af 2349 Bsp U11 2760 Alwin Oligo 160 AAAGACAGTTGACTGTATCGCCG GAA TTT ATG Sfi Sac II Spe I Bam H. GCC ATG GCC GCA GGG GCC GCG GCC GCA CTA GTG GGG ATC C Nico Not STOP Sf Pst TT AAT GGG CCA CTG GGG CCC CTC GAC CTG CAG CCA Pac Oligo 161 AGC TAA TT ccgggcgaatttctatg Oligo 1605 GAGAGTAGTAACAAAGGTC3 Oligo 161 5’ CATAAGAAATTCGCCCGG 3 FIGURE A Patent Application Publication Feb. 27, 2003 Sheet 5 of 19 US 2003/0040089 A1 pB14 Alias: pgET9NS2 Application: 2HY (bait) 165 Bst B Backbone: pCBT9 651 Sci Specificity. Sfi oriented 651 Xho Selection: ampicillin 709 Hipal 724 BSFG Constructed by: CR 885 Msc 888 Nool B88 Sty Ppu 10 529D 903 Milu 113 Nisi 5290 903 Sac. It 905 Nof Birb 5290, 906 Eagi 13 Spel Sna B 4936 21 Ban.H. g27 Pac 944 Apa 944 Bsp 12Ol 2. 956 Psf 1168 Nae pB14 1168 Ngo MV Aat 4160 -- 1440 BSF 5580 base pairs Unique Sites 1590 BSfx 1604 EcoRV 1645 Bsu 36 1747 Mife Scal 3720 1803 Xiba Pyu 3609 1809. Apa Bl 1809 BsfAP w 1929 Piral 2171 Pvt. Bpm. 3327 V 2226 Sap Ahd 3237 2349A 2349 Bsp U11 2760 Awn Oligo 160 gagagtagtaacaaaggte AAAGACAGTTGACTGTATCGCCG GAA TTT ATG Sf Sac Spe I Bam H. GCC ATG GCC GGA CGG GCC GCG GCC GCA CTA GTG GGG ATC C Nico Not I STOP sfi I Apa I Pst TT AAT GGG CCA CTG GGG CCC CTC GAC CTG CAG CCA Pac Oligo 161 AGC TAA TT ccggg.cgaatttctatg Oligo 160 5 GAGAGTAGTAACAAAGGTC3 Oligo 161 5’ CATAAGAAATTCGCCCGG3 FTCURE 5 Patent Application Publication Feb. 27, 2003 Sheet 6 of 19 US 2003/0040089 A1 pB20 Alias: plex10NS2 Application: 2HY (bait) 161 BSB Backbone: plex 10 (p59) 447 Hic Specificity. Sfi-oriented 447486 Hpal BC Selection:rass a amplicillin- 517 Mul Constructed by: LD 759 BSI 957 Pre 975 Bgll 998 XC Ppu 1 O 5451 04.5 EcoR Nsi 5451 1053 S 8 Bfirst 5451 1064. BSDS Ni387f7 5445 1064 Mu 113 Ava 5445 1064 Sacil O66 No tO67 Eag 1074 Spel 1082 Bar 188 Pac 1097 Sio 1105 Apal 1105 Bsp 120 1117 Ps pB20 1329 Nae - 1329 Ngo MM Aat 4321 -- 5746 base pairs Unique Sites 1601 BSF 1751 BSX Sca. 3881 1806 Est 36 Pyut 3770 1964 xibal 1970 Apa Bl 970 BSAP Bpm 3488 2090 Pin Bsa 3470 2332 Pyt Ahd 3398 2387 Sap AWN 292 2510 Bsp LU11 EcoRI Sf Not Spe I BamHI GAA TTC GGG GCC GGA CGG, GCC GCG GCC GCA CTA GTG GGG ATC C Sac II STOP TT AAT TAAGGG CoA CTG GGG coC CTC GAC CTG CAG Pac Sf Pst FIGURE 6 Patent Application Publication Feb. 27, 2003 Sheet 7 of 19 US 2003/0040089 A1 pP1 Alias: paCTIst Application:2FY (prey) Backbone: paCTI s E; 377 BSa H Specificity: . Xibala 7533 435 Scai Selection: ampicillin 846 BSa Constructed by: SnaB 71.94 913 Ahd 1392 AWNE Hpal 6552 pPl Nr. 646 Bip 6111 1928 Sap Bael 6056 -- 2059 Th111 8134 base pairs 2157 BSnB Sse 8647. 5778 Unique Sites BSEI 5622 Cal 5506 257575 BsgB Age 5407 2764 RSr. 2905 Sex A 2934 M. EcoRV 4909 SES. BSrG 4536 3106 Sma St Oral 4092 I SA 31.17 EcoR 3123 Banil 312.3 Ec136 3123 Sac 3143 Sci 3143Xho ABS GATGTTTAATACCACTACAATGGATGATGTATATAACTATCTATT JC90 Bgl II cgatgatgaagataccCCaCCaaa CCCAAAAAAAGAGATCTGTATGGCTTACCCATACGATGTTCCAG Sf Sna I BamH I ATTACGCTAGCTTGGGTGGTCATATGGCC ATG GAG GCC CCG GGG ATC CGA ATT Nico Sac XhoI Bg II capacoelocaGreeggaeacaceaeCGA GCT CGA CTA GCT AGC TGA CTC GAG AGA TCT ATGAAT 162 ABS2 53 ABS1 5 CGTTTGGAATCACTACAGG 3' JC90. 5’ CGATGATGAAGATACCCCACCAAA 3 162 5 GGGGTTTTTCAGTATCTACG3 ABS2 5’ CACGATGCACAGTTGAAGTG 3' 53 5 GAAATTGAGATGGTGCACGATGCAC3 FIGURE 7 Patent Application Publication Feb. 27, 2003 Sheet 8 of 19 US 2003/0040089 A1 pP2 Application: 2HY (prey) Backbone: paCTIIst Specificity:Sfinon-oriented BC. 7947 95. Selection: amplicillin Xibal 7548 Constructed by:SW 846 Bsal Sna B 7209 913 Ahdi 1392 Alwini Hpa 6567 pP2 Nr. 616 1928 Sap E;2 -- 2O59 Tith 11 8149 base pairs 2157 BSIB Sse 8647. 5793 Unique Sites Bst 5.E. 56375521 2575 Bsg Agel 5422 2764 RSri 2905 Sex A 2934 M. EcoRV 4924 :: Brel 49, i-Si3111 M113 3135 Pac 344 So 3152 Apal 352 Bar 3152 Bsp120) 358 Sci 3158 Xho ABS1 CG cgttggaatcactacagg GATGTTTAATACCACTACAATGGATGATGTATATAACTATCTATT JC90 Bg II cgatgatgaagataccccaccaaa CCCAAAAAAAGAGATCTGTATGGCTTACCCATACGATGTTCCAG Sf Sac ATTACGCTAGCTTGGGTGGTCATATGGCC ATG GCC GCA GGG GCC GCG GCC GCA BamHI -- Pac- Nico CTA GTG.
Recommended publications
  • Systems and Chemical Biology Approaches to Study Cell Function and Response to Toxins

    Systems and Chemical Biology Approaches to Study Cell Function and Response to Toxins

    Dissertation submitted to the Combined Faculties for the Natural Sciences and for Mathematics of the Ruperto-Carola University of Heidelberg, Germany for the degree of Doctor of Natural Sciences Presented by MSc. Yingying Jiang born in Shandong, China Oral-examination: Systems and chemical biology approaches to study cell function and response to toxins Referees: Prof. Dr. Rob Russell Prof. Dr. Stefan Wölfl CONTRIBUTIONS The chapter III of this thesis was submitted for publishing under the title “Drug mechanism predominates over toxicity mechanisms in drug induced gene expression” by Yingying Jiang, Tobias C. Fuchs, Kristina Erdeljan, Bojana Lazerevic, Philip Hewitt, Gordana Apic & Robert B. Russell. For chapter III, text phrases, selected tables, figures are based on this submitted manuscript that has been originally written by myself. i ABSTRACT Toxicity is one of the main causes of failure during drug discovery, and of withdrawal once drugs reached the market. Prediction of potential toxicities in the early stage of drug development has thus become of great interest to reduce such costly failures. Since toxicity results from chemical perturbation of biological systems, we combined biological and chemical strategies to help understand and ultimately predict drug toxicities. First, we proposed a systematic strategy to predict and understand the mechanistic interpretation of drug toxicities based on chemical fragments. Fragments frequently found in chemicals with certain toxicities were defined as structural alerts for use in prediction. Some of the predictions were supported with mechanistic interpretation by integrating fragment- chemical, chemical-protein, protein-protein interactions and gene expression data. Next, we systematically deciphered the mechanisms of drug actions and toxicities by analyzing the associations of drugs’ chemical features, biological features and their gene expression profiles from the TG-GATEs database.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Origins and Functional Impact of Copy Number Variation in the Human Genome

    Origins and Functional Impact of Copy Number Variation in the Human Genome

    doi:10.1038/nature08516 ARTICLES Origins and functional impact of copy number variation in the human genome Donald F. Conrad1*, Dalila Pinto2*, Richard Redon1,3, Lars Feuk2,4, Omer Gokcumen5, Yujun Zhang1, Jan Aerts1, T. Daniel Andrews1, Chris Barnes1, Peter Campbell1, Tomas Fitzgerald1, Min Hu1, Chun Hwa Ihm5, Kati Kristiansson1, Daniel G. MacArthur1, Jeffrey R. MacDonald2, Ifejinelo Onyiah1, Andy Wing Chun Pang2, Sam Robson1, Kathy Stirrups1, Armand Valsesia1, Klaudia Walter1, John Wei2, Wellcome Trust Case Control Consortium{, Chris Tyler-Smith1, Nigel P. Carter1, Charles Lee5, Stephen W. Scherer2,6 & Matthew E. Hurles1 Structural variations of DNA greater than 1 kilobase in size account for most bases that vary among human genomes, but are still relatively under-ascertained. Here we use tiling oligonucleotide microarrays, comprising 42 million probes, to generate a comprehensive map of 11,700 copy number variations (CNVs) greater than 443 base pairs, of which most (8,599) have been validated independently. For 4,978 of these CNVs, we generated reference genotypes from 450 individuals of European, African or East Asian ancestry. The predominant mutational mechanisms differ among CNV size classes. Retrotransposition has duplicated and inserted some coding and non-coding DNA segments randomly around the genome. Furthermore, by correlation with known trait-associated single nucleotide polymorphisms (SNPs), we identified 30 loci with CNVs that are candidates for influencing disease susceptibility. Despite this, having assessed the completeness of our map and the patterns of linkage disequilibrium between CNVs and SNPs, we conclude that, for complex traits, the heritability void left by genome-wide association studies will not be accounted for by common CNVs.
  • Análise Integrativa De Perfis Transcricionais De Pacientes Com

    Análise Integrativa De Perfis Transcricionais De Pacientes Com

    UNIVERSIDADE DE SÃO PAULO FACULDADE DE MEDICINA DE RIBEIRÃO PRETO PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Ribeirão Preto – 2012 ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Tese apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo para obtenção do título de Doutor em Ciências. Área de Concentração: Genética Orientador: Prof. Dr. Eduardo Antonio Donadi Co-orientador: Prof. Dr. Geraldo A. S. Passos Ribeirão Preto – 2012 AUTORIZO A REPRODUÇÃO E DIVULGAÇÃO TOTAL OU PARCIAL DESTE TRABALHO, POR QUALQUER MEIO CONVENCIONAL OU ELETRÔNICO, PARA FINS DE ESTUDO E PESQUISA, DESDE QUE CITADA A FONTE. FICHA CATALOGRÁFICA Evangelista, Adriane Feijó Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas. Ribeirão Preto, 2012 192p. Tese de Doutorado apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo. Área de Concentração: Genética. Orientador: Donadi, Eduardo Antonio Co-orientador: Passos, Geraldo A. 1. Expressão gênica – microarrays 2. Análise bioinformática por module maps 3. Diabetes mellitus tipo 1 4. Diabetes mellitus tipo 2 5. Diabetes mellitus gestacional FOLHA DE APROVAÇÃO ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas.
  • Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses

    Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses

    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes.
  • WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT

    WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT

    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT (51) International Patent Classification: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, C12Q 1/68 (2018.01) A61P 31/18 (2006.01) DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, C12Q 1/70 (2006.01) HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, (21) International Application Number: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, PCT/US2018/056167 OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, (22) International Filing Date: SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 16 October 2018 (16. 10.2018) TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, (30) Priority Data: UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, 62/573,025 16 October 2017 (16. 10.2017) US TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, ΓΕ , IS, IT, LT, LU, LV, (71) Applicant: MASSACHUSETTS INSTITUTE OF MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TECHNOLOGY [US/US]; 77 Massachusetts Avenue, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, Cambridge, Massachusetts 02139 (US).
  • An Investigation of the Contribution of Centrosomal Genes to Schizophrenia and Cognitive Function

    An Investigation of the Contribution of Centrosomal Genes to Schizophrenia and Cognitive Function

    Provided by the author(s) and NUI Galway in accordance with publisher policies. Please cite the published version when available. Title An investigation of the contribution of centrosomal genes to schizophrenia and cognitive function Author(s) Flynn, Mairéad Publication Date 2020-03-11 Publisher NUI Galway Item record http://hdl.handle.net/10379/15846 Downloaded 2021-09-25T16:18:14Z Some rights reserved. For more information, please see the item record link above. An investigation of the contribution of centrosomal genes to schizophrenia and cognitive function By Mairéad Flynn, B.Sc. A thesis submitted for the Degree of Doctor of Philosophy to the Discipline of Biochemistry, School of Natural Sciences, National University of Ireland, Galway. Supervisor: Dr Derek Morris Discipline of Biochemistry, School of Natural Sciences, National University of Ireland, Galway Co-Supervisor: Prof Ciaran Morrison Discipline of Biochemistry, School of Natural Sciences, National University of Ireland, Galway August 2019 Table of Contents Table of Contents Table of Contents ............................................................................................................. I Declaration .................................................................................................................... VI Statement of Contribution ......................................................................................... VII Acknowledgements .................................................................................................... VIII List
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD

    Supplementary Table S4. FGA Co-Expressed Gene List in LUAD

    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
  • Downloaded the “Top Edge” Version

    Downloaded the “Top Edge” Version

    bioRxiv preprint doi: https://doi.org/10.1101/855338; this version posted December 6, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Drosophila models of pathogenic copy-number variant genes show global and 2 non-neuronal defects during development 3 Short title: Non-neuronal defects of fly homologs of CNV genes 4 Tanzeen Yusuff1,4, Matthew Jensen1,4, Sneha Yennawar1,4, Lucilla Pizzo1, Siddharth 5 Karthikeyan1, Dagny J. Gould1, Avik Sarker1, Yurika Matsui1,2, Janani Iyer1, Zhi-Chun Lai1,2, 6 and Santhosh Girirajan1,3* 7 8 1. Department of Biochemistry and Molecular Biology, Pennsylvania State University, 9 University Park, PA 16802 10 2. Department of Biology, Pennsylvania State University, University Park, PA 16802 11 3. Department of Anthropology, Pennsylvania State University, University Park, PA 16802 12 4 contributed equally to work 13 14 *Correspondence: 15 Santhosh Girirajan, MBBS, PhD 16 205A Life Sciences Building 17 Pennsylvania State University 18 University Park, PA 16802 19 E-mail: [email protected] 20 Phone: 814-865-0674 21 1 bioRxiv preprint doi: https://doi.org/10.1101/855338; this version posted December 6, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 22 ABSTRACT 23 While rare pathogenic copy-number variants (CNVs) are associated with both neuronal and non- 24 neuronal phenotypes, functional studies evaluating these regions have focused on the molecular 25 basis of neuronal defects.
  • Metastatic Adrenocortical Carcinoma Displays Higher Mutation Rate and Tumor Heterogeneity Than Primary Tumors

    Metastatic Adrenocortical Carcinoma Displays Higher Mutation Rate and Tumor Heterogeneity Than Primary Tumors

    ARTICLE DOI: 10.1038/s41467-018-06366-z OPEN Metastatic adrenocortical carcinoma displays higher mutation rate and tumor heterogeneity than primary tumors Sudheer Kumar Gara1, Justin Lack2, Lisa Zhang1, Emerson Harris1, Margaret Cam2 & Electron Kebebew1,3 Adrenocortical cancer (ACC) is a rare cancer with poor prognosis and high mortality due to metastatic disease. All reported genetic alterations have been in primary ACC, and it is 1234567890():,; unknown if there is molecular heterogeneity in ACC. Here, we report the genetic changes associated with metastatic ACC compared to primary ACCs and tumor heterogeneity. We performed whole-exome sequencing of 33 metastatic tumors. The overall mutation rate (per megabase) in metastatic tumors was 2.8-fold higher than primary ACC tumor samples. We found tumor heterogeneity among different metastatic sites in ACC and discovered recurrent mutations in several novel genes. We observed 37–57% overlap in genes that are mutated among different metastatic sites within the same patient. We also identified new therapeutic targets in recurrent and metastatic ACC not previously described in primary ACCs. 1 Endocrine Oncology Branch, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892, USA. 2 Center for Cancer Research, Collaborative Bioinformatics Resource, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892, USA. 3 Department of Surgery and Stanford Cancer Institute, Stanford University, Stanford, CA 94305, USA. Correspondence and requests for materials should be addressed to E.K. (email: [email protected]) NATURE COMMUNICATIONS | (2018) 9:4172 | DOI: 10.1038/s41467-018-06366-z | www.nature.com/naturecommunications 1 ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/s41467-018-06366-z drenocortical carcinoma (ACC) is a rare malignancy with types including primary ACC from the TCGA to understand our A0.7–2 cases per million per year1,2.
  • Transcriptomic and Proteomic Profiling Provides Insight Into

    Transcriptomic and Proteomic Profiling Provides Insight Into

    BASIC RESEARCH www.jasn.org Transcriptomic and Proteomic Profiling Provides Insight into Mesangial Cell Function in IgA Nephropathy † † ‡ Peidi Liu,* Emelie Lassén,* Viji Nair, Celine C. Berthier, Miyuki Suguro, Carina Sihlbom,§ † | † Matthias Kretzler, Christer Betsholtz, ¶ Börje Haraldsson,* Wenjun Ju, Kerstin Ebefors,* and Jenny Nyström* *Department of Physiology, Institute of Neuroscience and Physiology, §Proteomics Core Facility at University of Gothenburg, University of Gothenburg, Gothenburg, Sweden; †Division of Nephrology, Department of Internal Medicine and Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, Michigan; ‡Division of Molecular Medicine, Aichi Cancer Center Research Institute, Nagoya, Japan; |Department of Immunology, Genetics and Pathology, Uppsala University, Uppsala, Sweden; and ¶Integrated Cardio Metabolic Centre, Karolinska Institutet Novum, Huddinge, Sweden ABSTRACT IgA nephropathy (IgAN), the most common GN worldwide, is characterized by circulating galactose-deficient IgA (gd-IgA) that forms immune complexes. The immune complexes are deposited in the glomerular mesangium, leading to inflammation and loss of renal function, but the complete pathophysiology of the disease is not understood. Using an integrated global transcriptomic and proteomic profiling approach, we investigated the role of the mesangium in the onset and progression of IgAN. Global gene expression was investigated by microarray analysis of the glomerular compartment of renal biopsy specimens from patients with IgAN (n=19) and controls (n=22). Using curated glomerular cell type–specific genes from the published literature, we found differential expression of a much higher percentage of mesangial cell–positive standard genes than podocyte-positive standard genes in IgAN. Principal coordinate analysis of expression data revealed clear separation of patient and control samples on the basis of mesangial but not podocyte cell–positive standard genes.
  • The Function and Evolution of C2H2 Zinc Finger Proteins and Transposons

    The Function and Evolution of C2H2 Zinc Finger Proteins and Transposons

    The function and evolution of C2H2 zinc finger proteins and transposons by Laura Francesca Campitelli A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Molecular Genetics University of Toronto © Copyright by Laura Francesca Campitelli 2020 The function and evolution of C2H2 zinc finger proteins and transposons Laura Francesca Campitelli Doctor of Philosophy Department of Molecular Genetics University of Toronto 2020 Abstract Transcription factors (TFs) confer specificity to transcriptional regulation by binding specific DNA sequences and ultimately affecting the ability of RNA polymerase to transcribe a locus. The C2H2 zinc finger proteins (C2H2 ZFPs) are a TF class with the unique ability to diversify their DNA-binding specificities in a short evolutionary time. C2H2 ZFPs comprise the largest class of TFs in Mammalian genomes, including nearly half of all Human TFs (747/1,639). Positive selection on the DNA-binding specificities of C2H2 ZFPs is explained by an evolutionary arms race with endogenous retroelements (EREs; copy-and-paste transposable elements), where the C2H2 ZFPs containing a KRAB repressor domain (KZFPs; 344/747 Human C2H2 ZFPs) are thought to diversify to bind new EREs and repress deleterious transposition events. However, evidence of the gain and loss of KZFP binding sites on the ERE sequence is sparse due to poor resolution of ERE sequence evolution, despite the recent publication of binding preferences for 242/344 Human KZFPs. The goal of my doctoral work has been to characterize the Human C2H2 ZFPs, with specific interest in their evolutionary history, functional diversity, and coevolution with LINE EREs.