The Cellular RNA-Binding Protein EAP Recognizes a Conserved Stem:Loop in the Epstein-Barr Virus Small RNA EBER 1 DAVID P

Total Page:16

File Type:pdf, Size:1020Kb

Load more

MOLECULAR AND CELLULAR BIOLOGY, Jan. 1993, p. 703-710 Vol. 13, No. 1 0270-7306/93/010703-08$02.00/0 Copyright © 1993, American Society for Microbiology The Cellular RNA-Binding Protein EAP Recognizes a Conserved Stem:Loop in the Epstein-Barr Virus Small RNA EBER 1 DAVID P. TOCZYSKI* AND JOAN A. STEITZ Department ofMolecular Biophysics and Biochemistry, Howard Hughes Medical Institute, Yale University, 295 Congress Avenue, New Haven, Connecticut 06536-0812 Received 17 August 1992/Returned for modification 1 October 1992/Accepted 23 October 1992 EAP (EBER-associated protein) is an abundant, 15-kDa cellular RNA-binding protein which associates with certain herpesvirus small RNAs. We have raised polyclonal anti-EAP antibodies against a glutathione S-transferase-EAP fusion protein. Analysis of the RNA precipitated by these antibodies from Epstein-Barr virus (EBV)- or herpesvirus papio (HVP)-infected cells shows that >95% of EBER 1 (EBV-encoded RNA 1) and the majority of HVP 1 (an HVP small RNA homologous to EBER 1) are associated with EAP. RNase protection experiments performed on native EBER 1 particles with affinity-purified anti-EAP antibodies demonstrate that EAP binds a stem-loop structure (stem-loop 3) of EBER 1. Since bacterially expressed glutathione S-transferase-EAP fusion protein binds EBER 1, we conclude that EAP binding is independent of any other cellular or viral protein. Detailed mutational analyses of stem-loop 3 suggest that EAP recognizes the majority of the nucleotides in this hairpin, interacting with both single-stranded and double-stranded regions in a sequence-specific manner. Binding studies utilizing EBER 1 deletion mutants suggest that there may also be a second, weaker EAP-binding site on stem-loop 4 of EBER 1. These data and the fact that stem-loop 3 represents the most highly conserved region between EBER 1 and HVP 1 suggest that EAP binding is a critical aspect of EBER 1 and HVP 1 function. Epstein-Barr virus (EBV) is a B-cell lymphotrophic her- EBERs. Whereas previous experiments had suggested that pesvirus which is able to transform primary cells in vitro (for EAP bound both EBER 1 and EBER 2 (32), the binding a review, see references 18 and 25). During latency, most studies presented here indicate that EAP's association with EBV genes are transcriptionally silent (for a review, see EBER 1 is by far the more significant. In contrast to that of reference 19). A striking exception, however, is the genes for many other RNA-binding proteins, EAP's ability to bind the two small RNAs called EBER 1 and EBER 2 (for Epstein- third stem-loop of EBER 1 is reduced by many mutations in Barr-encoded RNA). These RNAs are each present at ap- double-stranded regions, even when secondary structure is proximately 5 x 10' copies per cell in latently infected B-cell maintained. Characterization of this binding site should aid lines (22). Herpesvirus papio (HVP), a related virus which in identifying the cellular RNAs associated with EAP. infects baboons, encodes a homologous pair of small RNAs. These RNAs, HVP 1 and HVP 2, are 83 and 65% identical to the EBERs and are present at approximately 5 x 106 and 5 MATERIALS AND METHODS x 105 to 10 x 105 copies per cell, respectively (15). The EBER genes are unusual in that they are transcribed Glutathione transferase fusion protein and antibody pro- by RNA polymerase III and yet they utilize promoter duction. A glutathione S-transferase (GST)-EAP fusion vec- elements normally associated with protein-coding (class II) tor was prepared by inserting an EAP-encoding DNA frag- genes (16). As with most RNA polymerase III transcripts, ment containing a 5'-terminal BamHI site into an expression the 3' ends of the EBERs (and those of the HVPs) are vector (pGEX) (2) encoding 27 kDa of the GST protein with composed of a short stretch of uridine residues. The La a BamHI site at its 3' end. The EAP-encoding insert con- protein, a 50-kDa phosphoprotein first identified as an au- tained an open reading frame with a BamHI site followed by toantigen, binds this poly(U) tail on >90% of the EBER and a factor X cleavage site and the entire EAP sequence, HVP RNAs (15). We previously identified a second protein, excluding the initiating methionine. A stop codon immedi- EAP (EBER-associated protein), which also binds to these ately after the EAP C terminus was followed by a short viral small RNAs (32). EAP is an abundant, 15-kDa cellular polylinker including a BamHI and a Sall site. This insert was protein which appears to be the mammalian homolog of a generated by the polymerase chain reaction from an EAP previously identified sea urchin protein. A cDNA encoding cDNA template. The terminal restriction sites and factor X the sea urchin protein, which was called 217, was identified cleavage site were included in the deoxyoligonucleotides: 5', in a screen for genes expressed in a developmentally specific CGGATCCTGATCGAGGGCAGGGCCCCCGTGAAGAA manner (8, 12). EAP and the 217 protein are 77% identical. GCTGGTGGTGAAGGGCGGAAAGAAGAAGAAGCA, Unfortunately, the functions of both remain a mystery. and 3', GGGATCCAGCTGTCGACTJAATCCTCGTCTT We have now raised anti-EAP antibodies and have used CCTCCTCTTCTTCGTCCTGG. The polymerase chain re- them to characterize the interaction between EAP and the action was carried out as described by Toczyski and Steitz (32). The EAP insert was cloned into pGEX-3X after diges- tion of both the insert and the vector with BamHI. The entire EAP insert was sequenced. T7 transcription, molecular * Corresponding author. cloning, bacterial techniques, DNA sequencing, and tissue 703 704 TOCZYSKI AND STEITZ MOL. CELL. BIOL. culture were carried out as described by Toczyski and Steitz varying amounts of antibody and determining, by Northern (32). (RNA) blot analysis, how much antibody was required to The GST-EAP fusion protein was isolated by inoculating deplete EBER 1. Two microliters of affinity-purified serum 12 1-liter flasks of Luria broth containing 200 ,g of carben- or 10 pl of whole serum was required for such a depletion. At icillin with 2 ml from a fresh overnight culture ofEscherichia least a twofold excess of serum was used unless otherwise coli (DH 1) transformed with the fusion protein-bearing or noted. wild-type GST plasmid. The cells were grown to an optical Immunoprecipitation, Northern blotting, RNA affinity se- density at 590 nm of 0.75 to 0.90. IPTG (isopropyl-O-D- lection, and RNase protection assays. Twelve-hour 32PO4 in thiogalactopyranoside) was then added to 0.05 mM, and the vivo labelling and immunoprecipitation were performed as cells were grown for another 2 to 3 h. Cells were harvested, described in reference 22. Urea polyacrylamide gels were sonicated in Tris-buffered saline (150 mM NaCl, 50 mM Tris Northern blotted onto Zeta-probe nylon membranes and [pH 7.5]) containing 1% Triton X-100 six times for 30 s on a probed with full-length antisense RNAs as specified by the Branson Sonifier at setting 7, and centrifuged for 15 min at 15 supplier (Bio-Rad). krpm in a Sorvall SA600 rotor. At this point, the cell sonicate 3'-end labelling of RNA for affinity selection was carried could be frozen after the addition of glycerol to 10%. The out by using 32pCp and RNA ligase (10). Fifty microliters of extract was then run over a 3- to 4-ml glutathione agarose (S bacterial sonicate (see "Affinity purification and Western linkage, Sigma) column and washed with 300 ml of Tris- blotting [immunoblotting]") was incubated with 20 mg of buffered saline containing 1% Triton X-100. After being glutathione agarose in 1 ml of TBS (50 mM Tris, 150 mM washed with 50 ml of 50 mM Tris, pH 8.0, the column was NaCl [pH 7.5]). The resin was then washed 10 times with 15 eluted with the same buffer containing 10 mM glutathione. A ml of TBS-1% Triton X-100 and incubated with pCp-labelled portion of this material was then boiled in 0.1% sodium RNA from 105 Raji cells. After a 15-min incubation at 25°C, dodecyl sulfate (SDS) for 5 min and used to raise antibodies the mixture was washed seven times with NET-2 (50 mM in rabbits; antibodies were produced by the Berkeley Anti- Tris, 150 mM NaCl, 0.05% Nonidet P-40 [pH 7.5]) at 4°C. body Company. RNA was then extracted with phenol-chloroform-isoamyl Affinity purification and Western blotting (immunoblot- alcohol (25:25:1), ethanol precipitated, and electrophoresed ting). The polymerase chain reaction EAP-encoding frag- on a urea polyacrylamide gel. ment mentioned above was cut with BamHI and SalI and For RNase protection experiments, sonicate from 106 cells cloned into pUR-292, an expression vector containing the was incubated with 50 ,ul of whole anti-EAP serum bound to entire 3-galactosidase gene with a polylinker at the carboxy 5 pLg of protein A-Sepharose. After 90 min at 4°C, samples terminus (29). This protein was overexpressed and purified were washed five times with 1 ml of NET-2 and once with according to the method described in reference 13. Approx- NET (NET-2 without Nonidet P-40). Samples were adjusted imately 50 mg of the 3-galactosidase-EAP fusion was dia- to 250 ,ul with NET containing 1,250 U of RNase T1 lyzed against 0.1 M borate-0.75 M NaCl-3 mM P-mercap- (Calbiochem). After being incubated at 30°C, samples were toethanol (pH 8.3) and incubated with 7 ml of CNBr- washed four times with cold NET-2 and incubated with activated Sepharose (Pharmacia; prewashed according to NET-2 containing 0.5% SDS-0.5 mg of proteinase K per ml the manufacturer's specifications) for 12 h at 4°C.
Recommended publications
  • Non-Coding Rnas: Strategy for Viruses' Offensive

    Non-Coding Rnas: Strategy for Viruses' Offensive

    non-coding RNA Review Non-Coding RNAs: Strategy for Viruses’ Offensive Alessia Gallo 1,*, Matteo Bulati 1, Vitale Miceli 1 , Nicola Amodio 2 and Pier Giulio Conaldi 1,3 1 Department of Research, IRCCS ISMETT (Istituto Mediterraneo per i Trapianti e Terapie ad alta specializzazione), Via E.Tricomi 5, 90127 Palermo, Italy; [email protected] (M.B.); [email protected] (V.M.); [email protected] (P.G.C.) 2 Department of Experimental and Clinical Medicine, Magna Graecia University of Catanzaro, 88100 Catanzaro, Italy; [email protected] 3 UPMC Italy (University of Pittsburgh Medical Center Italy), Discesa dei Giudici 4, 90133 Palermo, Italy * Correspondence: [email protected]; Tel.: +39-91-21-92-649 Received: 7 August 2020; Accepted: 8 September 2020; Published: 10 September 2020 Abstract: The awareness of viruses as a constant threat for human public health is a matter of fact and in this resides the need of understanding the mechanisms they use to trick the host. Viral non-coding RNAs are gaining much value and interest for the potential impact played in host gene regulation, acting as fine tuners of host cellular defense mechanisms. The implicit importance of v-ncRNAs resides first in the limited genomes size of viruses carrying only strictly necessary genomic sequences. The other crucial and appealing characteristic of v-ncRNAs is the non-immunogenicity, making them the perfect expedient to be used in the never-ending virus-host war. In this review, we wish to examine how DNA and RNA viruses have evolved a common strategy and which the crucial host pathways are targeted through v-ncRNAs in order to grant and facilitate their life cycle.
  • Emerging Roles for Natural Microrna Sponges

    Emerging Roles for Natural Microrna Sponges

    Emerging Roles for Natural MicroRNA Sponges The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Ebert, Margaret S., and Phillip A. Sharp. “Emerging Roles for Natural MicroRNA Sponges.” Current Biology 20, no. 19 (October 2010): R858–R861. © 2010 Elsevier. As Published http://dx.doi.org/10.1016/j.cub.2010.08.052 Publisher Elsevier B.V. Version Final published version Citable link http://hdl.handle.net/1721.1/96080 Terms of Use Article is made available in accordance with the publisher's policy and may be subject to US copyright law. Please refer to the publisher's site for terms of use. Current Biology 20, R858–R861, October 12, 2010 ª2010 Elsevier Ltd All rights reserved DOI 10.1016/j.cub.2010.08.052 Emerging Roles for Natural MicroRNA Minireview Sponges Margaret S. Ebert and Phillip A. Sharp miRNAs in a variety of systems: in vitro differentiation of neurons [3] and mesenchymal stem cells [4]; xenografts of cancer cell lines [5,6]; and bone marrow reconstitutions Recently, a non-coding RNA expressed from a human from hematopoietic stem/progenitor cells [7–9]. Germline pseudogene was reported to regulate the corresponding transgenic fruitflies have been shown to generate hypomor- protein-coding mRNA by acting as a decoy for microRNAs phic miRNA phenotypes when sponge expression is induced (miRNAs) that bind to common sites in the 30 untranslated in a tissue-specific manner via the Gal4–UAS system [10]. regions (UTRs). It was proposed that competing for miRNAs might be a general activity of pseudogenes.
  • A Tale of Two Rnas During Viral Infection: How Viruses Antagonize Mrnas and Small Non-Coding Rnas in the Host Cell

    A Tale of Two Rnas During Viral Infection: How Viruses Antagonize Mrnas and Small Non-Coding Rnas in the Host Cell

    viruses Review A Tale of Two RNAs during Viral Infection: How Viruses Antagonize mRNAs and Small Non-Coding RNAs in The Host Cell Kristina M. Herbert 1,* and Anita Nag 2,* 1 Department of Experimental Microbiology, Center for Scientific Research and Higher Education of Ensenada (CICESE), Ensenada, Baja California 22860, Mexico 2 Department of Chemistry, Florida A&M University, Tallahassee, FL 32307, USA * Correspondence: [email protected] (K.M.H.); [email protected] (A.N.); Tel.: +52-646-175-0500 (K.M.H.); +1-850-399-5658 (A.N.) Academic Editor: Alexander Ploss Received: 29 March 2016; Accepted: 20 May 2016; Published: 2 June 2016 Abstract: Viral infection initiates an array of changes in host gene expression. Many viruses dampen host protein expression and attempt to evade the host anti-viral defense machinery. Host gene expression is suppressed at several stages of host messenger RNA (mRNA) formation including selective degradation of translationally competent messenger RNAs. Besides mRNAs, host cells also express a variety of noncoding RNAs, including small RNAs, that may also be subject to inhibition upon viral infection. In this review we focused on different ways viruses antagonize coding and noncoding RNAs in the host cell to its advantage. Keywords: mRNA; endonuclease; host shut-off; virus; RNAi 1. Introduction Viral infection has significant effects on the host’s gene expression program. Upon viral infection, mammalian cells activate specific gene expression pathways as a defense response. To assure survival, viruses manipulate the host’s gene expression response pattern in order to maximize viral replication and/or to evade detection by, and block the, host immune responses.
  • Murine Cytomegalovirus Encodes a Mir-27 Inhibitor Disguised As a Target

    Murine Cytomegalovirus Encodes a Mir-27 Inhibitor Disguised As a Target

    Murine cytomegalovirus encodes a miR-27 inhibitor disguised as a target Valentina Libria,1, Aleksandra Helwakb,1, Pascal Miesenc, Diwakar Santhakumara,d, Jessica G. Borger a, Grzegorz Kudlab, Finn Greye, David Tollerveyb, and Amy H. Bucka,d,2 aCentre for Immunity, Infection and Evolution, University of Edinburgh, Edinburgh EH9 3JT, United Kingdom; bWellcome Trust Centre for Cell Biology, University of Edinburgh, Edinburgh EH9 3JR, United Kingdom; cDepartment of Medical Microbiology, Nijmegen Centre for Molecular Life Sciences, Radboud University Nijmegen Medical Centre, 6500 HB, Nijmegen, The Netherlands; dDivision of Pathway Medicine, University of Edinburgh, Edinburgh EH16 4SB, United Kingdom; and eThe Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Easter Bush, Midlothian EH25 9RG, United Kingdom Edited* by Norman R. Pace, University of Colorado, Boulder, CO, and approved November 29, 2011 (received for review September 1, 2011) Individual microRNAs (miRNAs) are rapidly down-regulated during involved (16). A small nuclear RNA (snRNA) in Herpesvirus conditions of cellular activation and infection, but factors mediat- saimiri (HVS), HSUR-1, was recently shown to bind to miR-27 ing miRNA turnover are poorly understood. Infection of mouse and mediate its degradation (17). However, no homolog of cells with murine cytomegalovirus (MCMV) induces the rapid HSUR-1 has been identified in other viral families. miRNA down-regulation of an antiviral cellular miRNA, miR-27. Here, we turnover mechanisms in animals remain poorly characterized identify a transcript produced by MCMV that binds to miR-27 and (18). The aim of this work was to identify miR-27 interaction sites mediates its degradation.
  • Viral Noncoding Rnas: More Surprises

    Viral Noncoding Rnas: More Surprises

    Downloaded from genesdev.cshlp.org on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW Viral noncoding RNAs: more surprises Kazimierz T. Tycowski, Yang Eric Guo, Nara Lee, Walter N. Moss, Tenaya K. Vallery, Mingyi Xie, and Joan A. Steitz Department of Molecular Biophysics and Biochemistry, Howard Hughes Medical Institute, Boyer Center for Molecular Medicine, Yale University School of Medicine, New Haven, Connecticut 06536, USA Eukaryotic cells produce several classes of long and small • As for all investigations of viral infection, studying viral noncoding RNA (ncRNA). Many DNA and RNA viruses ncRNAs has richly enhanced our understanding of their synthesize their own ncRNAs. Like their host counter- host cells. In particular, surprising insights into the evo- parts, viral ncRNAs associate with proteins that are essen- lutionary relationships between viruses and their hosts tial for their stability, function, or both. Diverse biological have emerged. With increasing frequency, studies of vi- roles—including the regulation of viral replication, viral ral ncRNAs have led to novel insights into host cell persistence, host immune evasion, and cellular transfor- functioning. — mation have been ascribed to viral ncRNAs. In this re- • In some cases, synthesizing a ncRNA rather than a view, we focus on the multitude of functions played by protein may be the preferred mode of accomplishing a ncRNAs produced by animal viruses. We also discuss function for a virus. RNAs are less immunogenic and their biogenesis and mechanisms of action. therefore can more easily slip under the radar of the host cell immune system. • All viral ncRNAs—like host ncRNAs—associate with — — Like their host cells, many but not all viruses make proteins that are integral to their function.
  • Herpesvirus Saimiri Noncoding RNA Demián Cazalla, Et Al

    Herpesvirus Saimiri Noncoding RNA Demián Cazalla, Et Al

    Down-Regulation of a Host MicroRNA by a Herpesvirus saimiri Noncoding RNA Demián Cazalla, et al. Science 328, 1563 (2010); DOI: 10.1126/science.1187197 This copy is for your personal, non-commercial use only. If you wish to distribute this article to others, you can order high-quality copies for your colleagues, clients, or customers by clicking here. Permission to republish or repurpose articles or portions of articles can be obtained by following the guidelines here. The following resources related to this article are available online at www.sciencemag.org (this infomation is current as of December 1, 2010 ): A correction has been published for this article at: http://www.sciencemag.org/content/329/5998/1467.3.full.html Updated information and services, including high-resolution figures, can be found in the online version of this article at: http://www.sciencemag.org/content/328/5985/1563.full.html Supporting Online Material can be found at: on December 1, 2010 http://www.sciencemag.org/content/suppl/2010/06/15/328.5985.1563.DC1.html A list of selected additional articles on the Science Web sites related to this article can be found at: http://www.sciencemag.org/content/328/5985/1563.full.html#related This article cites 24 articles, 16 of which can be accessed free: http://www.sciencemag.org/content/328/5985/1563.full.html#ref-list-1 This article has been cited by 1 articles hosted by HighWire Press; see: www.sciencemag.org http://www.sciencemag.org/content/328/5985/1563.full.html#related-urls This article appears in the following subject collections: Molecular Biology http://www.sciencemag.org/cgi/collection/molec_biol Downloaded from Science (print ISSN 0036-8075; online ISSN 1095-9203) is published weekly, except the last week in December, by the American Association for the Advancement of Science, 1200 New York Avenue NW, Washington, DC 20005.
  • Identification of Factors Involved in Target RNA-Directed Microrna

    Identification of Factors Involved in Target RNA-Directed Microrna

    Published online 24 January 2016 Nucleic Acids Research, 2016, Vol. 44, No. 6 2873–2887 doi: 10.1093/nar/gkw040 Identification of factors involved in target RNA-directed microRNA degradation Gabrielle Haas†,SemihCetin†,Melanie´ Messmer, Beatrice´ Chane-Woon-Ming, Olivier Terenzi, Johana Chicher, Lauriane Kuhn, Philippe Hammann and Sebastien´ Pfeffer* Architecture and Reactivity of RNA, Institut de biologie moleculaire´ et cellulaire du CNRS, Universite´ de Strasbourg, 15 rue Rene´ Descartes, 67084 Strasbourg, France Downloaded from https://academic.oup.com/nar/article-abstract/44/6/2873/2499455 by guest on 01 February 2019 Received March 09, 2015; Revised January 12, 2016; Accepted January 13, 2016 ABSTRACT Consequently, their synthesis and turnover must be tightly controlled. Briefly, miRNAs are transcribed in the nucleus The mechanism by which micro (mi)RNAs control as a primary transcript (pri-miRNA) containing a hairpin their target gene expression is now well understood. structure, which is recognized and cleaved by the RNase III It is however less clear how the level of miRNAs them- Drosha. This cleavage generates a precursor miRNA (pre- selves is regulated. Under specific conditions, abun- miRNA) which will be exported to the cytoplasm, where a dant and highly complementary target RNA can trig- second cleavage by the RNase III Dicer gives rise to a ≈22 ger miRNA degradation by a mechanism involving nucleotides (nt) miRNA duplex (1). One strand of the du- nucleotide addition and exonucleolytic degradation. plex (guide strand) is loaded in the RISC (RNA-Induced One such mechanism has been previously observed Silencing Complex) and becomes the active miRNA, while to occur naturally during viral infection.
  • Copyright by Rachel Priya Chirayil 2017

    Copyright by Rachel Priya Chirayil 2017

    Copyright by Rachel Priya Chirayil 2017 The Thesis Committee for Rachel Priya Chirayil Certifies that this is the approved version of the following thesis: IMPACT OF NON-CODING RNAS IN GENETIC DISEASE AND PAPILLOMAVIRUS LIFECYCLE APPROVED BY SUPERVISING COMMITTEE: Supervisor: Christopher S. Sullivan Jason Upton IMPACT OF NON-CODING RNAS IN GENETIC DISEASE AND PAPILLOMAVIRUS LIFECYCLE by Rachel Chirayil Thesis Presented to the Faculty of the Graduate School of The University of Texas at Austin in Partial Fulfillment of the Requirements for the Degree of Master of Arts The University of Texas at Austin August 2017 Dedication I would like to dedicate this thesis to my mother, my first inspiration to study science and my first role model, personally and professionally. Without your love and support, as well as your tireless work ethic and sacrifices, I would know what it means to be a strong and independent scientist. From the first lesson in my graduate studies at UT, that I would have to work my butt out, to my last, that things aren’t always fair, and what defines us is how we move forward from monumental setbacks, you have been there by my side for every step of the way. Any good that I do in the sphere of science, and in the world, I do because you led the way, and I will forever be grateful for that. Acknowledgements I would like to thank all of the members of the Sullivan lab for their support and guidance. From fielding endless and inane questions to taking Topo Chico or coffee breaks with me, you have all helped me in ways big and small to get through my graduate studies.
  • RNA-Mediated Degradation of Micrornas

    This article was downloaded by: [The University of Edinburgh] On: 19 July 2015, At: 13:08 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: 5 Howick Place, London, SW1P 1WG RNA Biology Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/krnb20 RNA-mediated degradation of microRNAs: A widespread viral strategy? Jana McCaskillab, Pairoa Praihirunkitab, Paul M Sharpbc & Amy H Buckab a Institute of Immunology and Infection Research; School of Biological Sciences; University of Edinburgh; Edinburgh, UK b Centre for Immunity, Infection, and Evolution; University of Edinburgh; Edinburgh, UK c Institute of Evolutionary Biology; School of Biological Sciences; University of Edinburgh; Edinburgh, UK Accepted author version posted online: 07 Apr 2015. Click for updates To cite this article: Jana McCaskill, Pairoa Praihirunkit, Paul M Sharp & Amy H Buck (2015) RNA-mediated degradation of microRNAs: A widespread viral strategy?, RNA Biology, 12:6, 579-585, DOI: 10.1080/15476286.2015.1034912 To link to this article: http://dx.doi.org/10.1080/15476286.2015.1034912 PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information.
  • Viral Small Nuclear Ribonucleoproteins Bind a Protein Implicated in Messenger RNA Destabilization Vic E

    Proc. Natd. Acad. Sci. USA Vol. 89, pp. 1296-1300, February 1992 Biochemistry Viral small nuclear ribonucleoproteins bind a protein implicated in messenger RNA destabilization Vic E. MYER, SUSANNA I. LEE*, AND JOAN A. STEITZ Department of Molecular Biophysics and Biochemistry, Howard Hughes Medical Institute, Yale University, Boyer Center for Molecular Medicine, 295 Congress Avenue, New Haven, CT 06536-0182 Contributed by Joan A. Steitz, November 15, 1991 ABSTRACT Herpesvirus saimiri (HVS) is one of several AUUUA motifs are thus the best characterized of several primate viruses that carry genes for small RNAs. The five H. signals that dictate mRNA instability (12-18). sami-encoded U RNAs (HSURs) are the most abundant viral Recently, using either RNA bandshift assays or UV transcripts expressed in transformed marmoset T lympho- crosslinking analyses, a number of investigators have iden- cytes. They assemble with host proteins common to spliceoso- tified human proteins that specifically recognize the A+U- mal small nuclear ribonucleoproteins (snRNPs). HSURs 1, 2, rich mRNA destabilization signal in vitro (19-24). These and 5 exhibit sequences at their 5' ends identical to the AUUUA polypeptides range in size from 15 to 45 kDa. Their relation- motif, which targets a number ofprotooncogene, cytokine, and ships to one another remain unclear, as do their exact roles lymphokine mRNAs for rapid degradation. We show that a in mRNA degradation. In one case, however, the binding of 32-kDa protein previously demonstrated to bind to the 3' a 32-kDa protein in HeLa cell nuclear extract to transcripts untranslated region of several unstable messages can be UV containing mutated A+U-rich sequences was correlated with crosslinked specifically to HSUR 1, 2, and 5 transcripts in vitro, the mutant sequences' ability to function as mRNA destabi- as well as to endogenous HSUR snRNPs.
  • Implications of the Virus-Encoded Mirna and Host Mirna in The

    Implications of the virus-encoded miRNA and host miRNA in the pathogenicity of SARS-CoV-2 Zhi Liu1,2, Jianwei Wang1,2, Yuyu Xu1,2, Mengchen Guo1,2, Kai Mi1,2, Rui Xu1,2, Yang Pei1,2, Qiangkun Zhang1,2, Xiaoting Luan1,2, Zhibin Hu3, Xingyin Liu1,2# 1State Key Laboratory of Reproductive Medicine, Department of Pathogen Biology-Microbiology Division, Nanjing Medical University, Nanjing, 211166, China. 2Key Laboratory of Pathogen of Jiangsu Province and Key Laboratory of Human Functional Genomics of Jiangsu Province, Nanjing Medical University, Nanjing, 211166, China. 3State Key Laboratory of Reproductive Medicine, School of Public Health, Nanjing Medical University, Nanjing, 211166, China. Correspondence: Dr. Xingyin Liu, [email protected], 1 Abstract The outbreak of COVID-19 caused by SARS-CoV-2 has rapidly spread worldwide and has caused over 1,400,000 infections and 80,000 deaths. There are currently no drugs or vaccines with proven efficacy for its prevention and little knowledge was known about the pathogenicity mechanism of SARS-CoV-2 infection. Previous studies showed both virus and host-derived MicroRNAs (miRNAs) played crucial roles in the pathology of virus infection. In this study, we use computational approaches to scan the SARS-CoV-2 genome for putative miRNAs and predict the virus miRNA targets on virus and human genome as well as the host miRNAs targets on virus genome. Furthermore, we explore miRNAs involved dysregulation caused by the virus infection. Our results implicated that the immune response and cytoskeleton organization are two of the most notable biological processes regulated by the infection-modulated miRNAs.
  • Dissertation / Doctoral Thesis

    Dissertation / Doctoral Thesis

    DISSERTATION / DOCTORAL THESIS Titel der Dissertation / Title of the Doctoral Thesis Unsupervised construction, evaluation and visualisation of RNA family models. verfasst von / submitted by Mag. rer. nat. Florian Eggenhofer angestrebter akademischer Grad / in partial fulfillment of the requirements for the degree of Doctor of Philosophy (PhD) Wien, 2016 / Vienna, 2016 Studienkennzahl lt. Studienblatt / A 794 685 490 degree programme code as it appears on the student record sheet: Dissertationsgebiet lt. Studienblatt / Molekulare Biologie field of study as it appears on the student record sheet: Betreut von / Supervisor: Univ.-Prof. Dipl.-Phys. Dr. Ivo L. Hofacker III Acknowledgments/Danksagung I would like to acknowledge some outstanding persons and institutions that supported me and my work for this thesis. Ivo, my sincere thanks for sharing your wisdom and knowledge, but also for your good-will and patience. Your enthusiasm for science has set an shining example for me, what it means to be a scientist. It has been a privilege to have you as an advisor, for which I will be always grateful. Christian, I want to express my deepest gratitude for the countless instances where you have supported me. Your expertise and dedication have been truly inspiring for me. A heartily thank you for introducing me to functional pro- gramming and Haskell. I consider myself very fortunate having you as co- advisor and collaborator. I want to thank my collaborators from the ViennaNGS team: Michael for initiating and leading the ViennaNGS project, for guiding me through the intricacies hub construction (and for Speck) J¨org, for hacking, thinking and discussing with me, instantly finding the most elusive of bugs and being the truest of friends.