First Line of Title

RNA-BINDING PROTEIN MEDIATED POST-TRANSCRIPTIONAL CONTROL OF GENE EXPRESSION IN EYE DEVELOPMENT AND DISEASE

Soma Dash

A dissertation submitted to the Faculty of the University of Delaware in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biological Sciences

Spring 2018

RNA-BINDING PROTEIN MEDIATED POST-TRANSCRIPTIONAL CONTROL OF GENE EXPRESSION IN EYE DEVELOPMENT AND DISEASE

by Soma Dash

Approved: ______E. Fidelma Boyd, Ph.D. Chair of the Department of Biological Sciences

Approved: ______George H. Watson, Ph.D. Dean of the College of Arts and Sciences

Approved: ______Ann L. Ardis, Ph.D. Senior Vice Provost for Graduate and Professional Education

I certify that I have read this dissertation and that in my opinion it meets the academic and professional standard required by the University as a dissertation for the degree of Doctor of Philosophy.

Signed: ______Salil A. Lachke, Ph.D. Professor in charge of dissertation

Signed: ______Melinda K. Duncan, Ph.D. Member of dissertation committee

Signed: ______Robert W. Mason, Ph.D. Member of dissertation committee

Signed: ______Jia L. Song, Ph.D. Member of dissertation committee

Signed: ______Donna S. Woulfe, Ph.D. Member of dissertation committee

ACKNOWLEDGMENTS

First, thank you Dr. Lachke. I am most thankful for all the opportunities that you have provided me through the five years. None of this would have been possible if not for your foresight, planning, collaborations and relentless training and mentoring. Of all things, you have lead by example. And for reminding me that hard work always pays. Dr. Melinda Duncan, thank you for all the guidance you have provided me. But most of all, I am amazed by how you have always made time for all the graduate students who wanted to talk to you and how no topic is off limit with you. Dr. Jia Song, Dr. Robert Mason and Dr. Donna Woulfe, thank you for all your contributions in my committee meetings and for keeping me on my toes. I am still learning how to defend my thought process and I am getting better because of all your support. Dr. Patricia DeLeon, thank you for providing me the first opportunity to explore myself as a bench scientist when I joined UD as a Professional Science Masters Student. You took me on as a volunteer and trusted me with experiments required to finish two manuscripts, which solidified my plans for pursuing a doctoral degree. Department of Biology… In the last 5 years I have asked for help from almost everyone in the department, professors, students, staff and I have been given help generously.

v My lab members Carrie and Archana have made significant contributions to both my professional and personal life. Carrie has been my sounding board and the person who reminded me not to be full of myself. Archana, my partner in crime, I will always cherish all our crimes and fun we had along the way. Sandeep, Shaili, Salma, Kimia you have been awesome labmates. From intellectual to most insipid discussions, you have made lab a fun place. I cannot imagine my life UD without my support system here in the form of my friends Dr. Aasma Khan, Dr. Sona Lakshme Balasubramaniam, Anagha Kulkarni, Dr. Devesh Radhakrishnan, Dr. Hemanth Akkiraju and Dr. Abhishek Sahasrabudhe. Aasma taught me everything I needed to know before I actually started work in my lab: cell culture, immunoprecipitation and cloning. For the first two years of my PhD, I would be seen more in Woulfe lab than in my lab. Whenever I had to bounce ideas or troubleshoot, I would go in search of her. Apart from the Science, she is a dear friend who has done her best to keep me sane through my PhD. Sona, Hemanth and Devesh have always supported me irrespective of the situation, be it random “I want to eat sushi” or “I don’t understand why my experiment didn’t work”. Anagha, thank you for all the laughs. Abhishek, all the credit for my working cloning experiment goes to you. Apart from them I want to acknowledge my friends from the Batatas and Ultimate group. I saw a little sun because of all of you. Sumedha, you have been my unofficial therapist. Apart from getting too much detail of my life in US, you also had the unique opportunity (disadvantage) of listening to all my miseries. That you respond to each of my narcissistic rant with patience and understanding, makes me feel like a petulant child and most blessed human at the same time.

vi I thank the staff at Bioimaging facility, specially Deborah Powell for teaching me SEM imaging and Michael Moore for teaching me Confocal imaging. Thank you, biology administrative staff, especially Betty Cowgill for answering all my miscellaneous questions at all random times throughout the time I have spent here. I also thank all the professors for whom I have been a teaching assistant. I gained new experience every semester and I will carry this experience with me to my future career. At last, I thank the people responsible for my existence, my parents for their continuous support throughout my life. Papa keeps reminding me to make use of my wings and take flight. And Mama you keep me grounded, reminding me to do the necessary, prioritize. While Mom and Dad know roughly about my triumphs and challenges, my sister Ruma knows all the unnecessary details. You have supported me in every way possible reminding me to have fun along the way. Thank you for being you.

vii TABLE OF CONTENTS

LIST OF TABLES ...... xii LIST OF FIGURES ...... xiii ABSTRACT ...... xxiii

Chapter

1 INTRODUCTION ...... 1

1.1 Eye Development in Mammals ...... 1 1.2 Transcriptional Regulation of Early Eye Development ...... 5 1.3 Signaling Pathway in Early Eye Development ...... 8 1.4 Cellular Features That Suggest the Requirement of Post- Transcriptional Control in the Eye ...... 10

1.4.1 Evidence for Cell-Specific Translational Control in the Lens .... 11 1.4.2 Evidence for mRNA Decay in Lens Development ...... 13 1.4.3 miRNA Regulated Post-Transcriptional Regulation in the Lens 13 1.4.4 The function of RNA Granules and potentially RNA Regulons in Lens Fiber Differentiation ...... 14

1.5 Discovery of Genes Linked to Eye Disorders ...... 19 1.6 Identification of New RNA-Binding Proteins Using iSyTE ...... 21

1.6.1 Rbm24 as a promising candidate in vertebrate eye development ...... 21

1.6.1.1 Function of Rbm24 in Zebrafish ...... 21 1.6.1.2 Function of Rbm24 in Xenopus ...... 23 1.6.1.3 Function of Rbm24 in Mouse ...... 23 1.6.1.4 Transcriptional regulation of Rbm24 expression ...... 23 1.6.1.5 Molecular function of Rbm24 ...... 25

1.6.2 Caprin2 as a promising candidate gene required for eye development ...... 25

viii 2 MATERIALS AND METHODS ...... 28

2.1 Animals ...... 28

2.1.1 Generation of Rbm24 target deletion knockout mouse ...... 28 2.1.2 Generation of Caprin2 target deletion knockout mouse ...... 28

2.2 Genotyping Rbm24-/- and Caprin2cKO/cKO Mice...... 30 2.3 Zebrafish Maintenance ...... 31

2.3.1 Knockdown of rbm24a in zebrafish by morpholinos ...... 31 2.3.2 CRISPR/Cas9 Gene Targeting ...... 32

2.4 Morphological Analysis ...... 33 2.5 In situ hybridization in Zebrafish ...... 33 2.6 In situ hybridization in Mouse ...... 34 2.7 Scanning Electron Microscopy ...... 34 2.8 Western Blotting ...... 35 2.9 Immunofluorescence ...... 36 2.10 RNA isolation and RT-qPCR in zebrafish ...... 38 2.11 RNA isolation and RT-qPCR in mouse ...... 38 2.12 RNA-Immunoprecipitation (RIP assay) ...... 39 2.13 RNA EMSA ...... 40 2.14 TUNEL Labeling ...... 40 2.15 Cell culture ...... 41 2.16 Generating Wildtype and Mutated Sox2 Reporter Vector ...... 41 2.17 Sox2 mRNA Decay Assay ...... 42 2.18 Rbm24 Over-Expression Assay ...... 43 2.19 F-actin and Wheat Germ Agglutinin (WGA) Staining and Calculation of Nuclear Fiber Cell Area ...... 43 2.20 Statistical Analysis ...... 44

3 RBM24 POST-TRANSCRIPTIONALLY REGULATES SOX2 TO CONTROL EYE DEVELOPMENT AND PLURIPOTENCY FACTORS .... 45

3.1 Introduction ...... 45 3.2 Results ...... 46

3.2.1 Rbm24 Deficiency Causes Microphthalmia and Anophthalmia in Mouse ...... 46 3.2.2 rbm24a Deficiency Causes Eye Defects in Zebrafish ...... 51 3.2.3 Rbm24 Deficient Ocular Tissue Exhibit Apoptotic Defects ...... 53 3.2.4 Rbm24 Deficiency Leads to Downregulation of Key Eye Development Markers ...... 53

ix 3.2.5 Sox2 is a Direct Target of Rbm24 ...... 55 3.2.6 Rbm24 Positively Controls Sox2 mRNA Stability ...... 59 3.2.7 Rbm24 is a Positive Regulator of Pluripotency Factors ...... 61

3.3 Discussion ...... 63

4 DEFICIENCY OF THE RNA BINDING PROTEIN CAPRIN2 CAUSES LENS DEFECTS AND FEATURES OF PETERS ANOMALY ...... 66

4.1 Introduction ...... 66 4.2 Results ...... 68

4.2.1 Expression of Caprin2 in the Mouse Lens ...... 68 4.2.2 Generation of Caprin2cKO/cKO Lens-Knockout Mice ...... 70 4.2.3 Caprin2cKO/cKO Conditional Lens-Knockout Mice Exhibit Lens Defects ...... 72 4.2.4 Caprin2cKO/cKO Lens-Knockout Mice Exhibit Features of Peters Anomaly ...... 76 4.2.5 WGA Staining of Caprin2cKO/cKO Embryonic Lenses Suggests Fiber Cell Membrane Abnormalities ...... 78 4.2.6 Caprin1 expression is unaltered in the Caprin2cKO/cKO lenses ..... 81

4.3 Discussion ...... 83

4.3.1 Distinct Ocular Defects in Caprin2 Mutants ...... 83 4.3.2 Caprin2, Granules, and Signaling: A Speculation ...... 86 4.3.3 Low Penetrance of the Lens-Cornea Stalk Phenotype ...... 88 4.3.4 Conclusion ...... 89

5 DISCUSSION AND FUTURE DIRECTIONS...... 90

5.1 Genome-Level Identification of Rbm24-Target Genes in the Eye ...... 90 5.2 Genome-Level Identification of Direct RNA Targets of Rbm24 Protein ...... 91 5.3 Identification of Alternatively Spliced Transcripts in Rbm24-/- Ocular Tissue ...... 92 5.4 Understanding the Mechanism and Outcome of Rbm24-Mediated Induction of Pluripotency Factors in Differentiated Cells ...... 94 5.5 Rbm24 Mediated Regulation of Lhx2 and Pax6 ...... 94 5.6 Tissue Specific Requirement of Rbm24 in the Eye ...... 95 5.7 Redundancy in Function of Rbm Family of Proteins During Development ...... 96 5.8 Functional Significance of Alanine-rich Regions in Rbm24 ...... 96 5.9 Functional Characterization of Caprin2 in the Lens ...... 101

x REFERENCES ...... 103

Appendix

A IACUC APPROVAL ...... 124 B REPRINT PERMISSIONS ...... 149

xi LIST OF TABLES

Table 1. Antibodies and immunofluorescence conditions ...... 37

Table 2. Frequency of Ocular Phenotypes in Caprin2cKO/cKO Mutants ...... 72

xii LIST OF FIGURES

Figure 1.1 Eye development in mammals. (A) During gastrulation, the ectoderm is divided into three distinct regions - Neural ectoderm, non-neural ectoderm and the border ectoderm region between these tissues. (B) The border ectoderm gives rise to pre-placodal ectoderm neural crest cells. Red dotted rectangle indicates a section through the embryo that is represented in (C). (C) The neural ectoderm cells comprising the neural plate fold inwards to form the neural tube. (D) A region of cells within the neural ectoderm (anterior neural plate) is specified by eye field transcription factors to form a single eye field, which by Sonic Hedgehog signaling, is partitioned into bilateral optic sulci. (E) Each of the optic sulci develops into an optic vesicle that migrates towards the non-neural ectoderm, which is specified as the surface ectoderm or pre-placodal ectoderm. (F) Interactions between the optic vesicle and the pre-placodal ectoderm results into the latter forming the lens placode. The surrounding peri-ocular mesenchyme inhibits the surface ectoderm that does not appose the optic vesicle from acquiring lens fate. (G) Subsequently, the lens placode and the optic vesicle coordinately invaginate to form the lens pit and optic cup, respectively. (H) The lens pit continues to invaginate the optic cup until it pinches off to form the lens, while the overlying surface ectoderm contributes toward the cornea. The optic cup forms the neuro-retina and the retinal pigment epithelium. (I) Subsequent development and differentiation results in the formation of a multicomponent eye. In the anterior region, the adult eye contains the outer cornea, the iris, the lens, the ciliary body and ciliary zonules, while in the posterior region, it contains the retina. The space between the cornea and the lens is occupied by aqueous humor, while that between the lens and the retina is occupied by the vitreous humor. Light is focused by the cornea and the lens on the retina. The iris responds to the intensity of the light and changes its pinhole similar to the aperture of a camera. The focusing power of the lens is mediated by the ciliary zonules, arising from the ciliary body. Photoreceptor cells within the retina convert the photon energy in light into electrical signals that are transmitted by the optic nerve to the brain where it is interpreted as an image. The retinal pigment epithelium has several functions such as light absorption, nutrient transport, and reduction of

xiii photo-oxidative stress by photoreceptor membrane renewal. The fovea is a location in the retina where there is a high concentration of cone photoreceptor cells and where visual sharpness is high. (Dash et al., 2016) ...... 4

Figure 1.2. Transcription and signaling factors essential during early eye development in mouse. Early eye development requires precise coordinated expression and regulation of numerous transcription and signaling factors beginning at E8.5. Note that the transcriptional activation of genes in retina has not been studied in detail at E12.5, hence not mentioned. The network is explained in detail in the text (Dash and Lachke, unpublished)...... 9

Figure 1.3 Control of the eukaryotic mRNA by RNA-binding proteins. RNA- binding proteins (RBPs) function in distinct regulatory events in the mRNA life-cycle. During transcription of a gene to pre-mRNA, the nascent transcript is capped with 7-methylguanosine to stabilize the mRNA, a process that is facilitated by RBPs such as RAM. RBPs bind to the 5’-Cap to form the Cap binding complex and mediate further control. Excision of the intronic regions from the pre-mRNA can occur co-transcriptionally, a process in which RBPs can bind to the splicing machinery or the exon-intron junctions to drive tissue- specific splicing reactions. The 3’ end of the pre-mRNA is cleaved at a specific site followed by addition of 150-200 adenosine residues (Poly(A) tail) to form a mature mRNA, a process that is facilitated by RBPs such as Poly(A)-binding protein (Pabp). The mature mRNA is then bound by specialized RBPs and exported to the cytosol. In the cytosol, binding of RBPs (e.g. Stau1 or Zbp1) to either the 3’ UTR or the 5’ UTR facilitate the localization mRNA to specific regions for site-specific translation in cells such as neurons or fibroblasts. The localized mRNA is either stabilized or degraded by RBPs binding to sequence-specific sites such as the ARE (AU-rich element) in its 3’UTR. Within the cytosol, RBPs facilitate translation of mRNA into polypeptide. Alternately, mRNA can be recruited to RNA granules such as Processing bodies (P-bodies), Stress granules or other ribonucleoprotein (RNP) complexes for stability, localized translation, silencing or decay (not shown). (Dash et al., 2015) ...... 16

Figure 1.4 RBP deficiencies linked to ocular development defects. (A) Deficiency of TDRD7 causes cataract in humans, mice and chicken (Lachke et al., 2011). (B) Deficiency of Celf1 causes ocular defects in mouse, frog and fish (Siddam et al. 2018 PLOS Genetics, in revision, Siddam, 2017) ...... 18

xiv Figure 1.5. iSyTE predicts genes based on lens-enriched expression by comparing expression level in the lens to whole body thus prioritizing lens-specific genes...... 20

Figure 1.6 Rbm24 protein sequence is highly conserved in vertebrates. Rbm24 contains a conserved RNA Recognition Motif (RRM) near its N- terminus and two conserved alanine rich domains near its C-terminus. . 22

Figure 1.7 Rbm24 expression is conserved in vertebrates. Rbm24 is expressed in the eye (arrow), heart (h) and somites (s) in zebrafish (A), Xenopus (B) and mouse (C). Within the eye, Rbm24 exhibits enriched expression in the lens (l) in zebrafish (D), Xenopus (E) and mouse (F). Anterior epithelium of the lens (e), retina (r) (Oberleitner, 2008; Poon et al., 2012; Lachke et al., 2012) ...... 24

Figure 1.8 Caprin2 protein domains are conserved in vertebrates. Basic helix and RGG box domains have strong and weak RNA-binding abilities, respectively while C1q domain enables protein-protein interactions. .... 26

Figure 1.9 Caprin2 expression is induced by Fgf signaling. Treatment of Chick lens explant culture with Fgf8 inhibitor SU5402 leads to downregulation of Caprin2 expression. However, inhibition of Fgf signaling does not affect the expression of lens fiber cell marker, δ- crystallin and retinal marker, Chx10. (Lorén et al., 2009) ...... 26

Figure 3.1 Rbm24 is expressed during eye development. (A) iSyTE prioritizes Rbm24 as a gene with potential function in the eye based on high lens- enriched expression. Heat map red intensity indicates high lens- enrichment. (B) During mouse development, Rbm24 protein is expressed in the presumptive lens ectoderm (*) and optic vesicle (**) at embryonic day (E)9.5, (C) in the lens pit (lpt) and optic cup (oc) at E10.5, (D) in the lens vesicle (lv) and retina (r) at E11.5 and (E) in cornea, lens anterior epithelial cells and fiber cells at E14.5. Scale bar in A, B is 70 µm...... 47

Figure 3.2 Generation of Rbm24-/- mice. (A) Generation of Rbm24-/- mice using floxed Rbm24 alleles and CMV promoter-driven Cre recombinase. (B) RT-qPCR demonstrates Rbm24 down-regulation in Rbm24-/- embryos at E7.5. (C) Western blot analysis confirms absence of Rbm24 protein in Rbm24-/- mouse embryonic tissue at E14.5. (D, E) Immunostaining show absence of Rbm24 protein in Rbm24-/- mouse eye tissue at E14.5. Scale bar for D, E is 140 µm...... 49

xv Figure 3.3 Rbm24-/- mice exhibit anophthalmia and microphthalmia (A-B”) At E11.5, 50% of Rbm24-/- mice exhibit anophthalmia (*) on one side and microphthalmia on the other side (**). The other 50% exhibit bilateral microphthalmia...... 50

Figure 3.4 rbm24a is required for zebrafish eye development. (A) in situ hybridization (ISH) shows rbm24a transcript expression in the eye (arrowhead), heart and somites at 20 somite stage. (B) At stage 2dpf rbm24a transcript expression is strong in the eye region (arrowhead). (C) ISH section shows strong rbm24a transcript expression in the lens at 2dpf. (D-E’) While control eyes are normal, rbm24a morpholino injected embryos exhibit microphthalmia (asterisk). (F-G’) CRISPR/Cas9-based targeted rbm24a deletion zebrafish exhibit microphthalmia (asterisk). Abbr.: dpf, day post fertilization; MO, morpholino; KO, knockout; l, lens; r, retina...... 52

Figure 3.5 rbm24b expression in zebrafish. (A) In situ hybridization demonstrates that rbm24b mRNA is expressed in somites in zebrafish at 2 dpf. (A’) Weak expression of rbm24b is detected in the ocular region at this stage...... 52

Figure 3.6 Rbm24 deficiency causes apoptotic defects and downregulation of eye development markers. (A-D) Compared to control, Rbm24-/- mice have high number of TUNEL positive nuclei (arrowhead) in the ocular region at E10.5 and E12.5. (E) Quantification of TUNEL immunofluorescence indicates significantly higher number of apoptotic nuclei in Rbm24-/- ocular region. (F) RT-qPCR analysis indicates significant Jag1 down-regulation in Rbm24-/- compared to controls. (G, H) Immunostaining analysis indicates Jag1 is downregulated in E12.5 Rbm24-/- lenses compared to control. Asterisks in E, F indicate a p-value < 0.05. Scale bar for A-D, G, H is 70 µm; # indicates whole body tissue...... 54

Figure 3.7 Eye development markers are downregulated in Rbm24-/- mice. (A- D) E-cad and γ-Cry are severely downregulated in lens epithelial and lens fiber cells, respectively at E12.5 and E14.5 in Rbm24-/- compared to control. (E, F) Lhx2 is significantly downregulated in the optic vesicle of Rbm24-/- at E9.5 compared to control. Scale bar for A-F is 70 µm...... 56

xvi Figure 3.8 Pax6 expression in Rbm24-/- mice. (A) RT-qPCR shows that Pax6 is not significantly altered in Rbm24 -/- mouse mutants at E7.5 (whole embryonic tissue, indicated by #) and E14.5 eye tissue. (B, C) Pax6 protein expression is unaltered in Rbm24-/- mouse mutant ocular tissue at E10.5, and (D-F) in both severe and mild phenotypes of Rbm24-/- mouse mutant ocular tissue at E11.5. Scale bar in B-F is 70 µm...... 57

Figure 3.9 Rbm24 regulates Sox2 expression by post-transcriptional mechanism. (A-B’) At early eye development stage E9.5, Rbm24-/- mice exhibit significant reduction of Sox2 in the surface ectoderm (future lens) and the optic vesicle (future retina). (C-D’) By E14.5, even the Rbm24-/- mice with less severe eye phenotype exhibit severe reduction of Sox2 in the lens and retina. High-magnification of dotted-line areas in A, B, C, D are show in A’, B’, C’, D’, respectively. (E) RT-qPCR analysis confirms significant Sox2 downregulation in Rbm24-/- mice, and (F) rbm24a morphant zebrafish. Asterisks in E, F indicate p-value < 0.05. Scale bar in A, B, C’, D’ is 70 µm, C-D is 140 µm, A’, B’ is 12 µm; # indicates whole embryonic tissue...... 58

Figure 3.10 Rbm24 binds to the AU-rich region of Sox2 3’UTR and stabilizes it. (A) Schematic representation of Sox2 mRNA, which has a single exon and three AU-rich elements (AREs; A1, A2 and A3) in the 3’UTR. (B) RNA EMSA demonstrates that Rbm24 protein binds to Sox2 3’UTR by directly interacting with its AU rich element to form a protein-RNA complex that can be competed away by un-labelled wildtype ARE containing oligomer but not by un-labelled mutant ARE. (C) RNA immunoprecipitation with Rbm24 antibody on mouse embryonic eye tissue shows enrichment of Sox2 mRNA. (D) Rbm24- overexpression in NIH3T3 cells results in significant increase in the half-life of luciferase mRNA fused to Sox2 3’UTR. (E) Upon Rbm24-overexpression and 2 hours of Actinomycin D treatment, luciferase reporter fused to wild-type Sox2 3’UTR mRNA exhibits elevated stability. However, under these conditions, the luciferase reporters fused to Sox2 3’UTR mRNA containing individual mutations in the AREs A1, A2 and A3 (*) or combined mutations in all three AREs (A1*2*3*) do not exhibit elevated stability. Asterisks in C indicate p-value < 0.05...... 60

xvii Figure 3.11 Rbm24 positively controls Yamanaka/reprogramming and other pluripotency factors. (A) Rbm24-overexpression in mouse fibroblast NIH3T3 cells results in up-regulation of the pluripotency factors Sox2, Klf4 and Oct4 as demonstrated by RT-qPCR. (B) Immunostaining demonstrates that Rbm24-overexpression leads to elevated Oct4 and Sox2 levels in NIH3T3 cells. (C) Rbm24- overexpression in mouse lens epithelial 21EM15 cells leads to significant upregulation of Sox2, Oct4 and Klf4. (D) Rbm24- overexpression in mouse myoblast C2C12 cells leads to significant upregulation of Sox2, Oct4, Klf4, Nanog and c-Myc. Abbr.: f.c., fold- change; n.s., not significant. Asterisks in A, C and D indicate p-value < 0.05; scale bar in B is 50 µm...... 62

Figure 4.1 Caprin2 exhibits highly enriched expression in mouse lens. A: iSyTE identifies Caprin2 as a highly lens-enriched gene, as evidenced by intense red color at embryonic stage (E) E12.5. B: Meta-analysis of mouse lens developmental microarrays ranging from E10.5 to P56 indicates highly lens-enriched expression of Caprin2 compared with embryonic whole body (WB). C: Western blotting demonstrates high Caprin2 protein expression in early postnatal mouse lens (P0, P15) that is progressively reduced (P56), and eventually undetected at P135. D,E: ISH indicates highly specific expression of Caprin2 transcripts in fiber cells (f) of the lens, while the lens epithelium (e) or retina (r) exhibits no expression. F: Low magnification of mouse head tissue section at E14.5 indicates the high specificity and intensity of Caprin2 expression in the lens (asterisk). G–I: Immunostaining of mouse head tissue at E13.5, E15.5, and E19.5 demonstrates that Caprin2 protein is highly expressed in fiber cells and not the epithelium (e), validating ISH data. Scale bar 70 µm in G–I...... 69

xviii Figure 4.2 Generation of conditional deletion Caprin2 mice. A: Structure of the Caprin2 gene locus and depiction of Caprin2 protein. The Caprin2 knockout allele carries exon 5 flanked by loxP sites (closed arrowheads). Mouse crosses with a line (Pax6GFPCre) that expresses Cre recombinase in lens cells beginning at the placode stage results in the excision of Caprin2 exon 5. This is predicted to generate an abnormal Caprin2 splice form joining exons 4 and 6, in turn leading to a frame-shift and premature stop codon. B: Reverse transcriptase polymerase chain reaction (RT-PCR) demonstrates the absence of Caprin2 mRNA in homozygous conditional deletion Caprin2cKO/cKO mouse mutant lens. C: Western blotting demonstrates the absence of Caprin2 protein in C Caprin2cKO/cKO mutant lens at P56. β-actin was used as a loading control. D,E: Immunostaining analysis at E12.5 exhibits severely reduced but detectable levels of Caprin2 in Caprin2cKO/cKO lenses. F,G: By P4 there is no detectable expression of Caprin2 protein in the mutant lens. Scale bar.70 µm in D,E. Abbreviation: e, epithelium; f, fiber cells...... 71

Figure 4.3 Caprin2cKO/cKO mouse mutants exhibit lens defects. A,B: Imaging under bright field microscopy revealed subtle differences between control and Caprin2cKO/cKO (B) lenses at age 2 months (2 mo.). While a demarcation can be observed in the fiber cell compartment in the controls, it is absent (asterisk) in the mutants. C,D: Histological analysis demonstrates no obvious defects in Caprin2cKO/cKO mutant lenses at age 1 month (1 mo.). E–H: Scanning electron microscopy of lenses at age 1 month (1 mo.), demonstrates that at comparable depth in the fiber cell compartment, the lens Caprin2cKO/cKO mutants exhibit cortical fiber cells instead of nuclear fiber cells, which are observed in control lenses. Asterisks in E and F denote areas observed at high magnification in G, H...... 74

xix Figure 4.4 Wheat germ agglutinin and Phalloidin staining of Caprin2cKO/cKO mutant lens. A, B: Wheat germ agglutinin (WGA) staining of control (A) and mutant (B) sections was performed to observe lens cell membranes at stage P0. The area of the nuclear fiber cells with a sharp decrease in WGA staining intensity is indicated by a dotted circle and is reduced in mutants. High magnification images of control (A’, A”) and mutant lenses (B’, B”) show that cortical fibers (cf) exhibit higher WGA staining compared with nuclear fiber (nf). C: Comparisons between the area of the nf and the area of the lens revealed that mutants have a smaller nf area corroborating the SEM results. D–G: Section (D,E) and whole (F,G) lens immunostaining with phalloidin suggests no obvious cytoskeletal defects in the Caprin2cKO/cKO lenses. Scale bar.140 mm in A, B; 45 mm in A’–B”; 140 mm in D,E; 140 mm in F,G. These data demonstrate that although Caprin2cKO/cKO lenses do not exhibit lens opacity, they exhibit an overall reduction in the size of the lens nucleus. Abbreviations: cf, cortical fibers; nf, nuclear fibers; e, epithelium; f, fiber cells...... 75

Figure 4.5 Caprin2cKO/cKO mouse mutants exhibit features of Peters anomaly. A: Images of the eye (inset, high magnification) from control and representative mild (Mutant 1) and severe (Mutant 2) cases of corneal and lens defects. White arrowheads indicate corneal opacity and asterisk denotes reflection of light. B: Darkfield imaging and histology demonstrate that Caprin2cKO/cKO mutants exhibit a lenti- corneal stalk similar to Peters anomaly at 8% penetrance (n.108 eyes for Caprin2cKO/cKO mutants; none exhibit this defect in Pax6GFPCre: Caprin2+/cKO controls, n.121 eyes). C: Immunostaining demonstrates the localization of Caprin2 protein in cells of the anterior rim of the lens pit (marked by dotted line) at stage E10.5. C0: Immunostaining with Jag1 provides better visualization of E10.5 lens pit structure. Broken line boxes in C indicate the regions shown in D, E, and F at high magnification. D: Caprin2 protein expression is low in the bottom region of the pit. E, F: However, in cells of the anterior rim region of the lens pit, Caprin2 protein is detected in a granular pattern (white arrowheads). Asterisk indicates a cell that may have originated in the epithelium. Scale bar 28 mm in C; 7 mm in D–F...... 77

xx Figure 4.6 Epithelial cell marker and WGA analysis for mouse embryonic Caprin2cKO/cKO mutant lens. A–C0: Wheat germ agglutinin (WGA) staining reveals higher intensity staining (asterisk) in Caprin2cKO/cKO mutant lenses compared with control lenses at E12.5 (A, A’), at E14.5 (B, B’), and at E16.5 (C, C’). D–F’: Immunostaining with Pax6- specific antibody reveals no change between control and Caprin2cKO/cKO mutant lens at E12.5 (D, D’), at E14.5 (E, E’), and at E16.5 (F, F’). G–I’: Immunostaining with Foxe3-specific antibody reveals no change between control (Pax6GFPCre: Caprin2+/cKO) and Caprin2cKO/cKO mutants at E12.5 (G, G’), at E14.5 (H, H’), and at E16.5 (I, I’). Abbreviations: e, epithelium; f, fiber cells; r, retina. Scale bar 70 mm...... 79

Figure 4.7 Fiber cell marker analysis Caprin2cKO/cKO mouse mutant lens. A–E’: Immunostaining with Crystallin gamma (Cryg) specific antibody reveals no change between control (Pax6GFPCre: Caprin2+/cKO) and Caprin2cKO/cKO mutants at E12.5 (A, A’), at E14.5 (B, B’), at E16.5 (C, C’), at P0 (D, D’), and at P30 (E, E’). F–J’: Immunostaining with Aquaporin 0 (Aqp0) specific antibody reveals no change between control (Pax6GFPCre: Caprin2+/cKO) and Caprin2cKO/cKO mutants at E12.5 (F, F’), at E14.5 (G, G’), at E16.5 (H, H’), at P0 (I, I’), and at P30 (J, J’). K–O’: Immunostaining with N-cadherin (N-cad) specific antibody reveals no change between control (Pax6GFPCre: Caprin2+/cKO) and Caprin2cKO/cKO mutants at E12.5 (K, K’), at E14.5 (L, L’), at E16.5 (M, M’), at P0 (N, N’), and at P30 (O, O’)...... 80

xxi Figure 4.8 Analysis of Caprin1 expression in mouse lens development and Caprin2cKO/cKO mutants. A: iSyTE indicates that Caprin1 does not exhibit lens-enriched expression. B: Analysis of mouse lens microarrays at developmental stages ranging from E10.5 to P56 indicates that Caprin1 is expressed in the mouse lens. C: Although expressed in the lens, Caprin1 is not lens enriched as demonstrated by fold-change comparison of the microarray probe signal binding intensity of Caprin1 to embryonic whole body (WB) in microarray datasets. D: RT-PCR analysis of Caprin1 in control and Caprin2cKO/cKO mutant lenses suggest no significant alteration in Caprin1 mRNA expression. E: Western blot analysis indicates no significant difference in Caprin1 protein expression in control and Caprin2cKO/cKO mutant lenses. F–H: Immunostaining of wild type lens demonstrates high Caprin1 protein expression in lens pit cells (F), including the anterior rim regions (G, H). Broken line box in F indicates the area that is highlighted in G, H. I–N: Immunostaining with Caprin1-specific antibody reveals no significant difference in control and mutant lenses in E12.5 (I, J), E14.5 (K, L), and E16.5 (M, N)...... 82

Figure 5.1 Direct mRNA targets of Rbm24. RNA-Immunoprecipitation assay identifies on mouse E14.5 eye lysates indicates that Rbm24 directly binds to Itgb1 (β1-integrin) and Lhx2 mRNAs. Itgb1 was previously shown to be a direct target of Rbm24 and was used as positive control for the RIP experiment...... 93

Figure 5.2 Rbm24cKO/cKO mouse do not exhibit lens defects. Scanning electron microscopy of lenses at age 6 month (6 mo.), demonstrates that at comparable depth in the fiber cell compartment, Rbm24cKO/cKO mutants exhibit normal cortical fiber cells similar to control lenses...... 98

Figure 5.3 Caprin2+/- and Caprin2-/- lenses have no difference in fiber cell ultrastructure. Scanning electron microscopy of Caprin2-/- mutant lenses and age matched controls at age 3 months (n= 3) reveals no obvious differences in cortical or nuclear fiber cell ultrastructure...... 99

Figure 5.4 Caprin1 expression in Caprin2-/- lens. At E11.5, no significant difference was observed in Caprin1 immunostaining between Caprin2+/- and Caprin2-/- lenses. However, at E14.5 higher expression of Caprin1 was observed in lens fiber cells as well in the cornea of the Caprin2-/- mice compared to controls...... 100

xxii ABSTRACT

Eye development in vertebrates is initiated in late gastrulation and involves coordinated morphogenesis between the optic vesicle and the non-neural surface ectoderm resulting in the formation of the neural retina and the lens, respectively. While transcription and signaling events required for eye development are well understood, post-transcriptional control of gene expression, especially mediated by RNA-binding proteins (RBPs) is less clear. This represents a significant knowledge- gap as RBPs are important regulatory molecules in the cell that can control the fate of their target mRNAs by interacting with them throughout the mRNA life-cycle and mediating their processing, intra-cellular transport and localization, stability, translation into protein, and ultimately, their degradation. This is also a significant knowledge gap because there are similar number of RBPs encoded by the human genome as there are transcription factors, but the former class of proteins are not as well understood in the context of organogenesis and birth defects as compared to the latter. While high-throughput sequencing has identified several RBPs to be expressed in the eye, the functional significance in eye development for the vast majority of these factors is yet to be determined. Recently, the Lachke laboratory has identified two conserved RBPs required for eye development, Tdrd7 and Celf1, whose deficiency in the lens results in cataract in vertebrates. To further investigate the importance of RBP-mediated post-transcriptional gene expression control in eye development, I applied a systems-based bioinformatics tool iSyTE (integrated Systems

xxiii Tool for Eye gene discovery) to identify two new RBPs, Rbm24 and Caprin2, which are enriched during early mouse lens development, but whose molecular function in eye development had thus far not been determined. In this research dissertation, I have characterized the function of both Rbm24 and Caprin2 using constitutive and conditional targeted gene deletion mouse models. Further, in collaboration with Dr. Diane Slusarski’s laboratory (University of Iowa), zebrafish rbm24a knockout (by CRISPR/Cas9) and knockdown (by morpholino) mutants were generated and characterized. Together, these findings have led to a comprehensive understanding of the function of these RBPs in vertebrate eye development. Rbm24-targeted deletion in mouse and rbm24a-CRISPR/Cas9-targeted knockout or morpholino-knockdown in zebrafish causes the developmental defects microphthalmia (small eye) or anophthalmia (no eye). Rbm24 deficiency leads to apoptotic defects in the mouse ocular tissue as well as downregulation of eye development markers such as Sox2, Lhx2, Jag1, E-cadherin and γ-Crystallins. Further, similar to the observations in the mouse, sox2 expression is also found to be reduced in rbm24a-morphant zebrafish, indicating the conservation of the Rbm24-Sox2 regulatory module in vertebrate eye development. About 20% of human anophthalmia cases are linked to SOX2 mutations alone. Therefore, I focused on investigating the post-transcriptional molecular mechanism of Rbm24-mediated Sox2 regulation. Sox2 is an intronless gene whose encoded mRNA contains AU-rich regions (ARE) in its 3’UTR. Interestingly, Rbm24 is known to bind to ARE sites in target mRNA. Therefore, to test if Rbm24 directly binds to Sox2 mRNA in vitro and in vivo, I performed RNA-Electrophoretic Mobility Shift assay (EMSA) and RNA- Immunoprecipitation (RIP), respectively. RNA-EMSA showed that Rbm24 protein

xxiv directly binds to a 20 bp oligomer based on the mouse Sox2 mRNA sequence, and that an intact ARE is necessary for this protein-RNA binding. In turn, RIP assay on E14.5 wildtype mouse ocular tissue suggests that Rbm24 directly binds to Sox2 mRNA in vivo in eye development. To understand the biological significance of this direct Rbm24 protein-Sox2 mRNA molecular interaction, I performed an RNA-decay assay in NIH3T3 cells by co-transfected them with an Rbm24-overexpression vector and a Renilla luciferase reporter vector. In this assay, the Renilla luciferase gene ORF (open reading frame) is fused with the mouse Sox2 mRNA 3’UTR, which contains the three intact ARE sites, and reporter transcripts were quantified after Actinomycin-D treatment to transfected cells. This analysis demonstrates that in conditions of Rbm24 over-expression, the intact Sox2 3’UTR can render increased stability to the reporter transcript. Thus, Rbm24 positively controls Sox2 expression by binding to ARE sites in its 3’UTR and increasing its mRNA stability. Further, mutation analysis in the RNA-decay assay extends the in vitro observation that the binding of Rbm24 to the Sox2 mRNA 3’UTR depends on ARE by providing in vivo evidence that the presence of the ARE sites is necessary for the stability effect rendered by the Sox2 mRNA 3’UTR upon Rbm24 overexpression. Further, because Sox2 is one of the original four Yamanaka pluripotency/cellular reprogramming factor (along with Oct4, Klf4 and c- Myc), I investigated the impact of Rbm24 on the expression of other reprogramming factors such as Oct4, Klf4, c-Myc as well as, Nanog, another established pluripotency factor. I find that over-expression of Rbm24 in several different cell lines such as NIH3T3 (mouse embryo fibroblast cell line), 21EM15 (mouse lens epithelial cell line) and C2C12 (mouse myoblast cell line) results in the up-regulation of Sox2, Oct4 and Klf4. Further, in Rbm24-overexpressed C2C12 cells, Nanog and c-Myc are also

xxv upregulated. These data highlight that Rbm24 mediates post-transcriptional control of key transcription and pluripotency factors in vertebrate development. To gain insight into the function of the other newly identified RBP, Caprin2, in lens biology, I first performed expression analysis of Caprin2 in mouse lens development using in situ hybridization, western blotting and immunostaining. These experiments validate the iSyTE prediction that Caprin2 mRNA and protein are highly expressed and enriched in mouse embryonic and postnatal lens. I generated lens- specific Caprin2 conditional knockout (cKO) mouse mutants using a lens-Cre deleter line Pax6GFPCre. Phenotypic analysis of Caprin2cKO/cKO mice, wherein Caprin2 is expected to be deleted in the lens starting from E9.5 due to Cre-mediated re- arrangement of the Caprin2 alleles, revealed two distinct eye defects at variable penetrance. Wheat germ agglutinin staining and scanning electron microscopy demonstrated that Caprin2cKO/cKO mutants have an abnormally compact “lens nucleus”, which is the core of the lens comprised of centrally located terminally differentiated fiber cells. Further, at a reduced penetrance (8%), I find that Caprin2cKO/cKO mutants exhibit an ocular defect wherein the lens and the cornea remain attached by a persistent stalk, resembling the human developmental defect termed Peters anomaly. These data suggest that a conserved RBP Caprin2 functions in distinct morphological events in mammalian eye development. Together the findings in this dissertation have demonstrated that conserved RBPs such as Rbm24 and Caprin2 have evolved distinct functions in vertebrate eye development and their deficiency leads to microphthalmia and anophthalmia, and lens defects and Peters anomaly, respectively, thus impacting the study of ocular defects in humans

xxvi Chapter 1

INTRODUCTION

The eye is a specialized organ that enables visual perception in animals. In vertebrates, it is composed of several distinct tissues, including the cornea, the lens and the retina (Fig 1.1). In a healthy individual, the cornea and the lens are transparent tissues that focus light on the retina, where light is observed by specialized cells called photoreceptors and converted to electric signals that are relayed to the brain through the optic nerve.

1.1 Eye Development in Mammals Eye development in vertebrates is a complex process that involves multiple tissues. It begins late during gastrulation from the ectodermal tissue when the eye field (future retina) within the neural ectoderm in the anterior neural plate responds to sonic hedgehog signaling and bifurcates to two optic sulci in the eye field at E8.5 in mouse (Chiang et al., 1996). This is followed by evagination of lateral walls of diencephalon leading to the formation of the optic vesicle on both sides (Sinn and Wittbrodt, 2013). Factors such as Bmp4 and activities of other transcription factors such as Hes1, Rax, Lhx2, and Mab21l2 in the optic vesicle induce the overlying surface ectoderm to thicken to form a lens placode (Furuta and Hogan, 1998; Lee et al., 2005; Thein et al., 2016; Yamada et al., 2004). Activities of transcription factors Sox2, Six3 and Pax6 within the lens placode are important for its subsequent development (Liu et al., 2006; Smith et al., 2009). Reciprocally, the lens placode signals to optic vesicle resulting in

1 the formation of a double-layered optic cup. The inner cell layer of the optic cup will form the neural retina and the outer cell layer will differentiate into the retinal pigment epithelium later in development. At the same time, lens placode invaginates the developing optic cup to form the lens pit. Subsequently, it separates from the surface ectoderm to form the lens vesicle and the overlying ectoderm contributes to the formation of cornea (Cvekl and Ashery-Padan, 2014). Activities of Pax6 and Foxe3 are necessary for this separation event, without which an abnormal tissue connection between the lens and cornea remains, which is a feature of a human eye disorder called Peters anomaly (Blixt et al., 2000a; Ormestad et al., 2002a). While anterior cells of the lens vesicle form the anterior epithelium of the lens (AEL), the posterior cells of the lens vesicle terminally differentiate into primary fiber cells, a process that requires activity of transcription factors such as Prox1 (Wigle et al., 1999). These fiber cells elongate to fill the lumen of the lens vesicle. Cells of AEL that are near the equator of the lens exit cell cycle and initiate differentiation into secondary fiber cells. The secondary fiber cells lose their organelles and migrate toward the center of the lens. This process of epithelial to fiber cell differentiation occurs throughout the life of the animal. Meanwhile, subsequent differentiation of cells within the optic cup results in mature retinal tissue that is composed of 11 distinct layers of cells. The retinal tissue contains the rod and cone photoreceptors that sense light and convert it into electrical signals, which are then transferred by ganglion cells through the optic nerve to the brain for interpretation of vision. Other cell types such as RPE function to absorb light and recycle photo-oxidized components of the photoreceptor cells. The adult eye has multiple distinct components such as the outer cornea, iris, lens, ciliary body and zonules, retina, sclera, and choroid (Fig 1.1) (Graw, 2010).

3 Figure 1.1 Eye development in mammals. (A) During gastrulation, the ectoderm is divided into three distinct regions - Neural ectoderm, non-neural ectoderm and the border ectoderm region between these tissues. (B) The border ectoderm gives rise to pre-placodal ectoderm neural crest cells. Red dotted rectangle indicates a section through the embryo that is represented in (C). (C) The neural ectoderm cells comprising the neural plate fold inwards to form the neural tube. (D) A region of cells within the neural ectoderm (anterior neural plate) is specified by eye field transcription factors to form a single eye field, which by Sonic Hedgehog signaling, is partitioned into bilateral optic sulci. (E) Each of the optic sulci develops into an optic vesicle that migrates towards the non-neural ectoderm, which is specified as the surface ectoderm or pre-placodal ectoderm. (F) Interactions between the optic vesicle and the pre-placodal ectoderm results into the latter forming the lens placode. The surrounding peri-ocular mesenchyme inhibits the surface ectoderm that does not appose the optic vesicle from acquiring lens fate. (G) Subsequently, the lens placode and the optic vesicle coordinately invaginate to form the lens pit and optic cup, respectively. (H) The lens pit continues to invaginate the optic cup until it pinches off to form the lens, while the overlying surface ectoderm contributes toward the cornea. The optic cup forms the neuro-retina and the retinal pigment epithelium. (I) Subsequent development and differentiation results in the formation of a multicomponent eye. In the anterior region, the adult eye contains the outer cornea, the iris, the lens, the ciliary body and ciliary zonules, while in the posterior region, it contains the retina. The space between the cornea and the lens is occupied by aqueous humor, while that between the lens and the retina is occupied by the vitreous humor. Light is focused by the cornea and the lens on the retina. The iris responds to the intensity of the light and changes its pinhole similar to the aperture of a camera. The focusing power of the lens is mediated by the ciliary zonules, arising from the ciliary body. Photoreceptor cells within the retina convert the photon energy in light into electrical signals that are transmitted by the optic nerve to the brain where it is interpreted as an image. The retinal pigment epithelium has several functions such as light absorption, nutrient transport, and reduction of photo-oxidative stress by photoreceptor membrane renewal. The fovea is a location in the retina where there is a high concentration of cone photoreceptor cells and where visual sharpness is high. (Dash et al., 2016)

4 1.2 Transcriptional Regulation of Early Eye Development Deficiency of several TFs such as Rax, Six3, Pax6, Sox2, Chx10, Lhx2 and Mab21l2 results in early eye defects in mouse and human (Williamson and FitzPatrick, 2014). The following section briefly summarizes the function of some of the genes (Fig 1.2). Rax: Eye field specification is characterized by the expression of Rax (Rx, retina and anterior neural fold homeobox) in the anterior neural plate. Deficiency or mutations in Rax results in anophthalmia (absence of eye) in zebrafish, Xenopus, mouse and human (Abouzeid et al., 2012; Mathers et al., 1997; Tucker et al., 2001; Voronina et al., 2004). In mice Rax germline null ocular tissue is arrested at the OV stage (Mathers et al., 1997). Conditional retinal knockout (cKO) of Rax in mouse suggests that Rax is also required in later embryonic stages for neural retina development (Muranishi et al., 2012). Six3: Six3 (Sine oculis related homeobox 3) is expressed throughout the anterior neural ectoderm during development before becoming restricted to the forebrain and eye field (Oliver et al., 1995). It is implicated in bilateral division of diencephalon resulting in the formation of two optic sulci (Geng et al., 2008). While Six3 null mice exhibit anophthalmia, 10% of Six3 heterozygous mice exhibit holoprosoencephaly (failure of bifurcation of diencephalon) and cyclopia (failure of the embryonic forebrain to subdivide properly) (Geng et al., 2008; Lagutin et al., 2003). Further, Six3 activates other TFs such as Pax6 (Paired box 6), and Sox2 (SRY related homeobox 2) in the presumptive lens ectoderm (Liu et al., 2006).

Pax6: In vertebrates, Pax6 is initially expressed in the head neural ectoderm which includes the anterior neural plate and the single eye field (Grindley et al., 1995). Its expression is then progressively restricted to the optic vesicle where it is strongest

5 near the rim of the developing optic cup. Additionally, Pax6 is expressed in the head surface ectoderm that lies over the prosencephalon at E8.0 in mouse. By E9.0 its expression is restricted to the developing lens and nasal placodes. By E10.0, Pax6 expression is further restricted to the lens pit and the optic cup (Grindley et al., 1995; Walther and Gruss, 1991). Pax6 auto-regulates to enhance its expression and controls the expression of many other TFs in the eye including Six3, Sox2, Chx10 (also known as Vsx2, Visual system homeobox 2) and Mitf (microphthalmia-associated transcription factor) (Bäumer et al., 2003; Huang et al., 2011; Matsushima et al., 2011; Smith et al., 2009; Sun et al., 2015; Yamada et al., 2004). PAX6 mutations in humans and homozygous Pax6 null mice exhibit anophthalmia, microphthalmia (small eye) and aniridia (absence of iris) (Chograni et al., 2014; Glaser et al., 1994; Jordan et al., 1992). Conditional deletion of Pax6 in preplacodal ectoderm results in arrest of lens placode development (Ashery-Padan et al., 2000). Conditional deletion of Pax6 in retinal progenitor cells results in microphthalmia in mice, in which retinal cells are not discernable (Klimova and Kozmik, 2014). Finally, overexpression of both Six3 and Pax6 induces ectopic eyes in medaka fish and Xenopus, respectively, indicating their sufficiency to drive the eye development program (Chow et al., 1999; Lagutin et al., 2001). Sox2: Sox2 is expressed in the inner cell mass of murine blastocyst and subsequently in the primitive ectoderm, extraembryonic ectoderm and the developing nervous system (Avilion et al., 2003; Collignon et al., 1996). Later during development, Sox2 is required for hypothalamo-pituitary-gonadal axis, eye, inner ear and taste bud cell development (Kamachi et al., 1998; Kelberman et al., 2006; Kiernan et al., 2005; Okubo et al., 2006). Sox2 germline null mice exhibit embryonic lethality

6 after implantation (Avilion et al., 2003). Conditional knockout of Sox2 in mice and human patients with mutations in the SOX2 gene exhibit anophthalmia due to eye development being arrested at the OV stage (Hever et al., 2006; Kamachi et al., 1998; Kelberman et al., 2006; Smith et al., 2009). Sox2 regulates the expression of the early eye development regulator Rax in conjunction with another early eye TF, Otx2 (Danno et al., 2008; Matsushima et al., 2011). In microphthalmic cases arising from SOX2 mutations, the retina remains functional (Fitzpatrick and van Heyningen, 2005). Interestingly, Sox2 is required for the proliferative and differentiation capacity of retinal progenitors in a dose dependent manner in mouse (Taranova et al., 2006). Conditional deletion of Sox2 in the lens placode results in lens development arrested at the lens pit stage (Smith et al., 2009), and Sox2 and Oct1 have been shown to be synergistically necessary for sustained Pax6 expression in the lens placode (Donner et al., 2007a). Further, in lens precursor cells, Sox2 has also been shown to positively auto-regulate its expression in cooperation with Pax6 (Inoue et al., 2007). Thus, Sox2 has been identified as a critical TF regulating distinct stages of eye development. Chx10, Lhx2, Mab21l2, Mitf: The TF Lhx2 (LIM homeobox 2) is required for the transition of the OV to the OC stage, and the TF Chx10 is essential for maintaining OC structure and development of neural retina. Indeed, deficiency of Lhx2 or Chx10 results in anophthalmia in mice (Dorval et al., 2006; Yun et al., 2009; Zou and Levine, 2012). Further, mice germline null for the TF gene Mab21l2 (Mab-21 like 2) exhibit loss of Chx10 expression and develop anophthalmia (Yamada et al., 2004). Finally the TF Mitf is essential for the development of non-neural retina and its deficiency in mice (Mitf -/-) and in humans results in microphthalmia (Williamson and FitzPatrick, 2014).

7 In addition to the early eye development TFs described above, TFs such as Foxe3 (Forkhead box E3) (Blixt et al., 2000a; Ormestad et al., 2002b), c-Maf (Musculoaponeurotic fibrosarcoma) (Kim et al., 1999) and Prox1 (Prospero homeobox 1) (Audette et al., 2015; Wigle et al., 1999) are essential for other ocular tissue development such as lens, and their deficiency results in severe lens disorders and cataracts.

1.3 Signaling Pathway in Early Eye Development In addition to the various transcription factors that regulate in eye development (discussed in the previous section), five major signaling pathways are known to function in eye development: Hh (Hedgehog), Bmp (Bone morphogenic protein), RA (Retinoic acid) signaling, Wnt (Wingless and integrated1) and Fgf (Fibroblast growth factor) (Lachke and Maas, 2010). Early in eye formation, component of the Hh signaling, Sonic hedgehog is required for the bilateral separation of a single eye field into two optic sulci as demonstrated by cyclopia (presence of only one eye in an individual) in Shh null mouse mutants (Chiang et al., 1996). Further, sonic hedgehog is implicated in the proximo-distal patterning of the OC resulting in the formation of retina at the distal end and the optic stalk at the proximal end (Amato et al., 2004). During eye field specification, the network of eye field TFs inhibit both Bmp and canonical Wnt signaling (Atkinson-Leadbeater et al., 2014; Behesti et al., 2006; Carpenter et al., 2015). Bmp4 germline null mouse mutants exhibit anophthalmia (Bakrania et al., 2008; Behesti et al., 2006; Furuta and Hogan, 1998). Bmp4 further regulates the expression of Sox2 and Six3 in the lens and retina, and Lhx2 in the retina.

9 RA is important in OC and anterior segment formation (Duester, 2008). Deficiency of five components of RA signaling, Rbp1 (retinol binding protein 1), Raldh1 (Retinaldelhyde dehydrogenase 1), Rarb (retinoic acid receptor, beta), Rbp4 (retinol binding protein 4) and Stra6 (stimulated by retinoic acid gene 6) in the human and mouse eye result in anophthalmia (Aldahmesh et al., 2013; Cvekl and Wang, 2009; Isken et al., 2008; Srour et al., 2013). Inhibition of Wnt by lens-specific β- catenin disruption leads to the formation of lentoid bodies in the adjacent nasal periocular ectoderm (Kreslova et al., 2007; Smith et al., 2005). However both Wnt and Bmp signaling along with Fgf signaling are switched on in the OV where they regulate Tbx (T-box) super family of proteins implicated in dorsoventral patterning of the retina (Atkinson-Leadbeater et al., 2014; Behesti et al., 2006; Carpenter et al., 2015). Fgf signaling is required in later eye development stages for lens fiber cell differentiation and closure of optic fissure (Cai et al., 2013; Garcia et al., 2011a). The lens bathes in a gradient of Fgf signaling (low-high, antero-posterior) originating from the retina (Chamberlain and McAvoy, 1987). It is observed that high Fgf signaling causes fiber cell differentiation where as low Fgf causes epithelial cell proliferation (Lovicu et al., 1995; McAvoy and Chamberlain, 1989) (Fig 1.2).

1.4 Cellular Features That Suggest the Requirement of Post-Transcriptional Control in the Eye In addition to the transcription factors and signaling cascades involved in eye development, there is cellular evidence that suggests the involvement of post- transcriptional control in eye development – which I shall discuss below. As described earlier, the lens is made of two types of cells, the anteriorly located epithelial cells and the posteriorly located fiber cells. Like stem cells in other tissues, lens epithelial cells

10 hold the capacity to proliferate and, within a specific region near the equator of the lens, to begin differentiation into elongated fiber cells. Epithelial cells exhibit a gene expression pattern distinct from fiber cells (De Maria and Bassnett, 2015; Hoang et al., 2014; Ivanov et al., 2005; Sun et al., 2015; Terrell et al., 2015). While epithelial gene expression enables these cells to stay in the cell cycle, fiber gene expression is dedicated toward building the high levels of proteins such as crystallins, which are required for lens transparency. Thus, it is important to regulate the formation of distinct proteomes of these cells (Bassnett et al., 2009; Shang et al., 2014). The principle challenges recognized for post-transcriptional control in the lens are: (1) translational repression of some of the fiber transcripts that are also expressed in the epithelium, (2) decay of epithelial transcripts in early differentiating fiber cells, beyond the transition zone, (3) decay and/or translational repression of early differentiating fiber cell factors in late fiber cells, and (4) translation of usually high levels of proteins that are essential for rendering the lens its principle properties of transparency and high refractive index, and indeed whose deficiency or mutations cause congenital cataracts in humans (Shiels and Hejtmancik, 2013). Below, I discuss in further detail the molecular evidence in support of these events.

1.4.1 Evidence for Cell-Specific Translational Control in the Lens Even as early as 1981, Beebe and Piatigorsky provided the initial evidence for translational-level control of expression in the lens. They demonstrated that δ- crystallin mRNA was translated less efficiently in late chicken lens development compared to early stages (Beebe and Piatigorsky, 1981). Further, experimentally increasing the levels of δ-crystallin mRNA in older lens cells did not result in an increase in δ-crystallin protein even though the ribosome profile for untreated and

11 treated epithelial cells was similar (Milstone et al., 1976). This implies that the amount of transcript does not directly correlate with the rate of protein synthesis, suggesting that a new post-transcriptional mechanism of regulating gene expression. Another example of potential translational control in the lens was provided by Cenedella who showed that HMGR (3-Hydroxy-3-MethylGlutaryl coenzyme A Reductase) protein levels could be increased in the lens without a similar increase in mRNA (Cenedella, 1995). More recently, Dr. Beebe’s group showed that transcripts encoding γ- crystallins, but not the proteins themselves, are present in mouse lens epithelial cells at birth (Wang et al., 2004). Similar to that, βb1-crystallin mRNA expression is high in the lens epithelial cells, while its protein expression is very low (Taube et al., 2002). While they are translated in fiber cells at early stages, (Bassnett et al., 2009; McAvoy, 1978) in the epithelium these mRNAs are translated only at later postnatal stages (Wang et al., 2004). Similarly, there is evidence that Prox1 and Sox1 mRNAs are transcribed in epithelial cells, but its protein is highly expressed in fiber cells and not in epithelial cells in late embryonic stages (Audette et al., 2015; Donner et al., 2007b). Further, Dr. Beebe’s findings have also shown that in addition to γ-crystallin mRNAs, those encoding other fiber cell-enriched proteins such as Mip (aquaporin 0) and certain transcription factors are expressed early in lens development prior to their translation (Wolf et al., 2013a; Xie et al., 2013). Indeed, Mip transcripts are present in lens epithelial cells from the placode stage through adulthood but are only translated in fiber cells. Two general observations can be interpreted from the above data: (1) mRNAs that encode lens crystallins, lens membrane proteins, and fiber cell-‘enriched’ transcription factors accumulate early in lens development, before they are translated, and, in some cases, before fiber cells form, and (2) while their transcriptome is largely

12 distinct from that of fiber cells, lens epithelial cells do express some fiber cell transcripts, but these are not translated into protein, at least until later stages in life. Thus, these data suggest that post-transcriptional mechanisms are likely recruited for inhibiting translation in a spatiotemporal manner in the lens.

1.4.2 Evidence for mRNA Decay in Lens Development There are several molecular evidences that warrant close examination of mRNA decay during lens development, especially in the events wherein epithelial cells in the transition zone begin differentiation into fiber cells. There is evidence that downregulation of epithelial gene transcription and the effective removal/silencing of any residual epithelial transcripts is critical during commitment to differentiation. For example, Peter Carlsson’s group has demonstrated that transcriptional mis-expression of an epithelial cell transcription factor Foxe3 just a few cells beyond its normal zone of downregulation results in defective fiber cell differentiation and abnormal epithelialization (Landgren et al., 2008). Similarly, precise control of Pax6 levels in cells of the transition zone and beyond is necessary for proper fiber cell differentiation (Duncan et al., 2004; Shaham et al., 2009). It is therefore plausible that differentiating fiber cells recruit regulatory mechanisms such as miRNA- or RBP-mediated control to decay transcripts (such as potentially Foxe3).

1.4.3 miRNA Regulated Post-Transcriptional Regulation in the Lens miRNA (micro-RNA) are noncoding RNA molecules that regulate gene expression by translational repression of target mRNA or mRNA degradation mechanism. Dicer is a ribonuclease that is involved in miRNA processing by cleaving double stranded RNA into small single stranded miRNA. Targeted deletion of Dicer in

13 the mouse lens leads to severe microphthalmia and disruption of corneal epithelium suggesting that miRNAs have a major function in lens development (Li and Piatigorsky, 2009). Several miRNAs have been implicated in vertebrate eye development. In Xenopus, misexpression of miR-196a in the entire embryo leads to eye defects due to downregulation of eye-field TFs such as Rx1, Six3, Pax6 and Lhx2 in the eye field and OC (Qiu et al., 2009). In medaka fish, miR-204 regulates the expression of Meis2 which in turn regulates Pax6 expression (Conte et al., 2010). In mouse, Pax6 regulates miR-204, which regulates downstream transcription factors such as Sox11 (Shaham et al., 2013). miR29c has been shown to regulate translation of tropomyosin in rat lens (Kubo et al., 2013). Further, 131 miRNAs have been identified to be regulated by Fgf2 during fiber cell differentiation in a rat epithelial explant culture system (Wolf et al., 2013b). These results indicate that post- transcriptional regulation of mRNA transcripts in the eye via miRNA mediated gene silencing is essential for eye development.

1.4.4 The function of RNA Granules and potentially RNA Regulons in Lens Fiber Differentiation Besides the spatiotemporal control of translation that is necessary in the lens, there are three other challenges posed by the fiber cell differentiation process: (1) fiber cells have to translate unusually high levels of specific proteins, i.e., crystallins, whose concentrations reach ~450 mg/ml in the human lens (Bassnett et al., 2009; Shang et al., 2014), (2) while translating the abundant mRNA levels of various crystallins, differentiating fibers also have to translate sufficient levels of other key fiber proteins such as c-Maf, Mafg, Mafk, Sox1, and Prox1 whose mRNAs are not as abundant as crystallins, and (3) because of their elongated nature and high protein levels, fiber cells

14 may need to harbor mechanisms for transport of biomolecules to preferred locations. As a further requirement of forming a transparent tissue, lens fiber cells undergo a terminal differentiation program wherein their organelles and nuclei are degraded. However unusual they may seem, these lens fiber cell features are analogous to other specialized cells in the body. For example, lens fiber cells: 1) are long and therefore may share some of the cellular challenges faced by neurons, 2) become transcriptionally inactive analogous to differentiating sperm, and 3) analogous to migrating fibroblasts, exhibit polarity (e.g. Cdk5 is localized to fiber tips, and myosin IIB is localized to posterior fiber tips). Interestingly, neurons, differentiating sperm and migrating fibroblasts all involve an RNA-binding protein mediated post- transcriptional regulatory function in the generation of their specialized morphologies. RNA-binding proteins regulate the proteome of the cell by various post- transcriptional mechanisms such as those involving regulation of specific events in the life of an mRNA that determine its splicing, export, localization, stability, decay, silencing, and ultimately the extent of its translation into protein (Fig 1.3).

Figure 1.3 Control of the eukaryotic mRNA by RNA-binding proteins. RNA- binding proteins (RBPs) function in distinct regulatory events in the mRNA life-cycle. During transcription of a gene to pre-mRNA, the nascent transcript is capped with 7-methylguanosine to stabilize the mRNA, a process that is facilitated by RBPs such as RAM. RBPs bind to the 5’-Cap to form the Cap binding complex and mediate further control. Excision of the intronic regions from the pre-mRNA can occur co- transcriptionally, a process in which RBPs can bind to the splicing machinery or the exon-intron junctions to drive tissue-specific splicing reactions. The 3’ end of the pre-mRNA is cleaved at a specific site followed by addition of 150-200 adenosine residues (Poly(A) tail) to form a mature mRNA, a process that is facilitated by RBPs such as Poly(A)-binding protein (Pabp). The mature mRNA is then bound by specialized RBPs and exported to the cytosol. In the cytosol, binding of RBPs (e.g. Stau1 or Zbp1) to either the 3’ UTR or the 5’ UTR facilitate the localization mRNA to specific regions for site-specific translation in cells such as neurons or fibroblasts. The localized mRNA is either stabilized or degraded by RBPs binding to sequence-specific sites such as the ARE (AU-rich element) in its 3’UTR. Within the cytosol, RBPs facilitate translation of mRNA into polypeptide. Alternately, mRNA can be recruited to RNA granules such as Processing bodies (P-bodies), Stress granules or other ribonucleoprotein (RNP) complexes for stability, localized translation, silencing or decay (not shown). (Dash et al., 2015)

16 So far, two RNA-binding protein and RNA granule (RG) components, namely Tdrd7 and Celf1, have been shown to have conserved expression in vertebrate lens development. Deficiency of a putative RBP and RG component Tdrd7 (Tudor domain containing 7) causes juvenile cataracts in human, mouse, and chicken (Lachke et al., 2011; Tanaka et al., 2011) (Fig. 1.4A). In Tdrd7-deficient mouse and human patients, elevated intraocular pressure, a feature of glaucoma, was also observed (Lachke et al., 2011). Further, Tdrd7 deletion results in downregulation of key lens mRNAs such as Hspb1 (Hsp27) and Crybb3, which are also found to be enriched in Tdrd7-protein pulldowns. Because both Hspb1 and Crybb3 are involved in lens transparency, this may suggest regulation of functionally related mRNAs by Tdrd7. Further, mRNAs for other factors linked to cataract (Epha2, Sparc) reduced in Tdrd7 null lenses are found to be among the mRNAs enriched in Stau1 pulldowns, albeit in non-lens cells (Furic et al., 2008). Because Tdrd7 partially co-localizes with Stau1 RNPs in the lens this may suggest a combinatorial level of control by distinct RNA granule components and RBPs over functionally related RNAs. The second RBP and RG component gene, Celf1, is expressed in the mouse lens from E10.5 and is sharply elevated at E12.5. Celf1 homozygous targeted knockout mice exhibit severe lens defects early in development (Fig 1.4B). Celf1 regulates the stability, splicing and translational repression of distinct mRNAs of key factors in lens development (Siddam et al. 2018 PLOS Genetics, in revision).

18 1.5 Discovery of Genes Linked to Eye Disorders Thus far, identification of genetic mutations linked to congenital defects has involved positional mapping of genetic loci through linkage analysis or DNA sequencing and candidate gene investigation, which is time consuming (Lachke et al., 2012a; Shiels and Hejtmancik, 2015; Shiels et al., 2010). To a priori predict genes linked to eye disorders Lachke et al. developed a bioinformatics tool called iSyTE (integrated Systems Tool for Eye gene discovery) (Kakrana et al.2018 Nucleic Acids Res. 46:D875-885; Lachke et al., 2012a) (Fig 1.5). iSyTE is based on the hypothesis that genes that are highly enriched in specific eye tissues, as compared to a reference dataset representing whole embryonic body tissue (WB), may potentially function in eye development. To identify genes enriched in the eye, microarray expression profiling datasets for wild type mouse lens was compared to WB minus the lens tissue at different stages of development. This “in- silico subtraction” approach filters housekeeping genes which are expressed ubiquitously and allows identification of candidate genes with high lens-enriched expression, regardless of their absolute expression. iSyTE has led to successful identification of a number of cataract-linked genetic loci such as Sep15, Pvrl3, Mafg and Mafk (Agrawal et al., 2015; Kasaikina et al., 2011; Lachke et al., 2011, 2012b). Further, iSyTE has also led to the characterization of other factors that function in the lens (Cbp, p300; Sip1, etc.) and to the development of newer approaches in data interpretation in lens studies (Anand et al., 2015; Manthey et al., 2014b, 2014a; Terrell et al., 2015; Wolf et al., 2013a). iSyTE has also led to the identification of another class of proteins linked to cataract, the RNA binding proteins (RBPs) such as Tdrd7 and Celf1, which are necessary for post transcriptional regulation in lens (Lachke et al., 2011).

Figure 1.5. iSyTE predicts genes based on lens-enriched expression by comparing expression level in the lens to whole body thus prioritizing lens- specific genes.

20 1.6 Identification of New RNA-Binding Proteins Using iSyTE Using the iSyTE enrichment scores I identified two new RNA-binding proteins essential for eye development, Rbm24 and Caprin2. Rbm24 and Caprin2 are among the top 1-2 percentile genes enriched early in the mouse lens at E11.5, suggesting that both Rbm24 and Caprin2 may potentially function in eye development.

1.6.1 Rbm24 as a promising candidate in vertebrate eye development Rbm24 (also known as Seb4) encodes a highly conserved RBP with a single RNA recognition motif domain (RRM) located near its N-terminus and two alanine rich regions whose function is not known yet (Fetka et al., 2000; Grifone et al., 2014) (Fig 1.6).

1.6.1.1 Function of Rbm24 in Zebrafish In zebrafish, Rbm24 has two orthologs, rbm24a and rbm24b. Both rbm24a and rbm24b are highly similar to each other. rbm24a is 79% similar to mouse Rbm24 while rbm24b is 88% similar to mouse Rbm24. In zebrafish rbm24 is expressed in the lens, otic vesicle, somite, heart, fin buds, facial muscle and lateral mesoderm (Maragh et al., 2014) (Fig. 1.7A, D). Zebrafish rbm24b KD exhibit cardiac edema and distorted cardiac chambers resulting in blood circulation deficiency and death by 6 days post fertilization (dpf) due to downregulation of genes involved in cardiac contractile machinery and energy production (Poon et al., 2012). Multiple defects in somite and abnormal craniofacial morphology are observed in rbm24b KD zebrafish such as shortened mandible, reduction in the size of the otic vesicle, microphthalmia and microcephaly (Maragh et al., 2014).

Figure 1.6 Rbm24 protein sequence is highly conserved in vertebrates. Rbm24 contains a conserved RNA Recognition Motif (RRM) near its N-terminus and two conserved alanine rich domains near its C-terminus.

22 1.6.1.2 Function of Rbm24 in Xenopus In Xenopus, Rbm24 expression is observed in lens, otic vesicle, myocardium and tail bud (Fetka et al., 2000) (Fig. 1.7B, E). The heart phenotype in Rbm24 mutant frogs is similar to that of zebrafish, which results in embryonic lethality (Grifone et al., 2014; Li et al., 2010). Rbm24 KD leads to downregulation of αA-crystallin expression in frog lens (Oberleitner, 2008). αA-crystallin is expressed in the mouse lens pit at E10.5, and becomes fiber cell specific at E12.5 (Brady et al., 1997). Downregulation of αA-crystallin in Rbm24 morphants suggests that Rbm24 is required for proper eye development.

1.6.1.3 Function of Rbm24 in Mouse In mouse, Rbm24 is expressed in the developing lens at E11.5 (Lachke et al., 2012a) , somites and striated muscles (Grifone et al., 2014; Yang et al., 2014) (Fig. 1.7C, F). Rbm24 germline KO mouse also exhibit defects in cardiac and skeletal muscles leading to lethality at E14.5 (Grifone et al., 2014). However, eye defects have not been described or investigated in these mice.

1.6.1.4 Transcriptional regulation of Rbm24 expression Myogenic regulatory factor, MyoD, directly regulates the Rbm24 gene expression during gastrulation in frogs by binding to its highly conserved consensus cis-regulatory element CANNTG within the Rbm24 promoter sequence. Once induced, Rbm24 is required for myogenesis and functions in cooperation with MyoD (Grifone et al., 2014; Li et al., 2010). In mice, Rbm24 regulates sarcomeric assembly and cardiac contractibility. Rbm24 is suggested to be involved in skeletal muscle differentiation by reciprocally regulating myogenic regulatory factors, MyoD and myogenin (Grifone et al., 2014).

24 1.6.1.5 Molecular function of Rbm24 Rbm24 binds to sequence specific regions to mediate either alternative splicing or mRNA decay (Grifone et al., 2014; Xu et al., 2014). In mouse striated muscles, Rbm24 facilitates exon skipping when it binds to exonic splicing silencer containing pyrimidine rich regions and Rbm24 binding to intronic splicing enhancer region G (A/U) GUG causes exon inclusion (Fig 10) (Yang et al., 2014). Out of the 68 alternatively spliced isoforms identified in Rbm24 null mutant mouse heart tissue, 34 encode cytoskeletal proteins that have an important function in maintaining the contractibility of the cardiac muscle. Rbm24 also binds to the transcripts of genes involved in ubiquitin mediated proteolysis, focal adhesion, adipocytokine signaling pathway, cell cycle and apoptosis, among others (Lin et al., 2018). Studies in C2C12 cell lines suggest that Rbm24 also plays a role in maintaining mRNA stability and decay of its target mRNA. It binds to the AU rich element (ARE) in the 3’UTR of Myog to increase its stability, to ARE in 3’UTR of p63 to cause mRNA decay (Jin et al., 2010; Xu et al., 2014) and to the coding region of Chrm2 to cause mRNA decay (Lin et al., 2018).

1.6.2 Caprin2 as a promising candidate gene required for eye development Caprin family proteins are conserved among metazoans, and human CAPRIN2 protein shares 51% identity and 73% similarity with Drosophila CAPR across a conserved region termed Homology Region 1 (Papoulas et al., 2010). Interestingly, Caprin2 was first isolated as EEG-1 from human bone marrow and erythroid progenitor cells (Aerbajinai et al., 2004), where it was associated with terminal differentiation of erythroblasts from a proliferative state into cells devoid of nuclei,

Figure 1.9 Caprin2 expression is induced by Fgf signaling. Treatment of Chick lens explant culture with Fgf8 inhibitor SU5402 leads to downregulation of Caprin2 expression. However, inhibition of Fgf signaling does not affect the expression of lens fiber cell marker, δ-crystallin and retinal marker, Chx10. (Lorén et al., 2009)

26 analogous to the transition of lens epithelial cells into terminally differentiated fiber cells. Caprin2 has multiple conserved domains including the coiled-coil and the RGG domains, and the C1q domain found in the TNF protein super-family, which facilitate protein-RNA and protein-protein interactions, respectively (Shiina and Tokunaga, 2010a) (Fig 1.8). Caprin2 binds directly to Wnt receptor Lrp5/6 and facilitates its phosphorylation, thereby positively regulates canonical Wnt signaling in HEK-293T cells (Ding et al., 2008; Wang et al., 2016) Interestingly, Caprin2 has recently been independently recognized as a gene responsive to induction by FGF8 in chicken lens fiber cells (Lorén et al., 2009) (Fig 1.9), supporting the hypothesis for its potential function in the lens. Together, these findings suggest the importance of post-transcriptional mechanisms driven by the RBPs, Rbm24 and Caprin2, in development of different tissues across various vertebrate models, and taken together with the prediction of iSyTE, strengthen their candidacy for detailed investigation in mouse eye development.

27 Chapter 2

MATERIALS AND METHODS

2.1 Animals All mouse experiments described in this study conform to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and were approved by the University of Delaware Institutional Animal Care and Use Committee under protocol #1226. All mice were maintained and bred at the University of Delaware animal facility in specific pathogen free conditions under a 14/10-hour light/dark cycle.

2.1.1 Generation of Rbm24 target deletion knockout mouse A new conditional knockout mouse model was generated wherein exons 1, 2 and 3 of Rbm24 is flanked by loxP sites (Rbm24flox/flox) (Genoway, Lyon, France). The Rbm24flox/flox mice were crossed with B6-Tg(CMV-Cre)1Cgn mice carrying Cre recombinase under the influence of CMV promoter to generate constitutive knockout (KO) alleles of Rbm24 (Rbm24-/-). The Rbm24-/- mice have a pure C57Bl/6J background.

2.1.2 Generation of Caprin2 target deletion knockout mouse Caprin2tm2a(EUCOMM)Wtsi allele (henceforth referred to as Caprin2flox/flox) carrying mice generated by the Welcome Trust Sanger Institute (WTSI) were obtained from the European Mouse Mutant Archive (EMMA) (EMMA ID, EM:05381). Full

28 description of the construct and deletion strategy is available at http://www.infrafrontier.eu/ and http://www.informatics.jax.org/allele/MGI:4434168. Briefly, a L1L2_gt0 cassette carrying lacZ/neomycin ORFs flanked by FRT sites and followed by a loxP site was first inserted upstream of Caprin2 exon 5 and subsequently a second loxP site was inserted downstream of exon 5. Thus, Cre-based recombination activity is expected to remove Caprin2 exon 5. To generate Caprin2 conditional knockout (cKO) mice, we used the Pax6GFPCre mouse line established by Drs. Sheldon Rowan and Richard Maas that expresses Cre recombinase driven by the activity of a conserved Pax6 ectodermal enhancer with P0 promoter starting at E8.75 in the presumptive lens ectoderm (Rowan et al., 2008, 2010). Crosses between Caprin2flox mutant allele carrying mice and Pax6GFPCre: Caprin2flox mice led to generation of Pax6GFPCre:Caprin2flox/flox mice in which Caprin2 was deleted in lens cells (henceforth referred to as Caprin2cKO/cKO). This is because excision of Caprin2 exon 5 leads to the splicing of exon 4 and 6 in the resulting Caprin2 transcripts. This leads to a frame-shift in the Caprin2 ORF, which is subjected to nonsense-mediated decay of the transcript. These animals were maintained on a mixed background of C57BL/6J and FVB/N strains. The Pax6GFPCre line was always maintained on a Cre heterozygous background and was never found to exhibit any ocular defects in our analysis of these animals over a period of 6 months. Because the mice had contributions from the FVB/N strain that carries the Bfsp2 (CP49) mutation, I performed genotyping for Bfsp2 (CP49) mutation as described (Simirskii et al., 2007) and no correlation was observed between the presence/absence of Bfsp2 (CP49) mutant allele and the ocular phenotypes in Caprin2 mutant animals. All animals used

29 for the generating data shown in the figures were confirmed to have no Bfsp2 (CP49) mutant alleles. Embryo staging was done by designating the day that the vaginal plug was observed in the dam as embryonic day (E) 0.5. Post-natal mice were staged by designating the day of birth as P0.

2.2 Genotyping Rbm24-/- and Caprin2cKO/cKO Mice Tail DNA was digested by adding 200μl of Direct PCR lysis reagent (Viagen Biotech, #102-T) with 0.4 μl of proteinase K (Qiagen, #158918) and incubated at 57°C overnight on a shaker. Proteinase K was inactivated after tail was digested at 85°C for 45 minutes. The digested tail was centrifuged on high speed for a minute to separate indigested material from genomic DNA. PCR reactions to genotype Rbm24 and Caprin2 mutant mice was set up as follows: 20.375 μl of molecular grade water (Fisher Scientific), 2.5 μl 10X Coral red PCR buffer (Qiagen, #201207), 0.5 μl dNTPs (10 μM) (Qiagen, #201913), 0.5 μl forward primer (100 μM), 0.5 μl reverse primer (100 μM), 0.125 μl Taq polymerase (5 units/μl) (Qiagen, #201207), and 0.5 μl of isolated DNA (approximately 100 ng). To identify germline deletion of Rbm24 PCR reactions were performed with 30 cycles of 94°C for 2 minutes, 94°C for 15 seconds, 58°C for 30 seconds, 72°C for 30 seconds with a final extension at 72°C for 7 minutes. To identify floxed allele of Rbm24 PCR reactions were performed with 35 cycles of 94°C for 3 minutes, 94°C for 30 seconds, 65°C for 30 seconds, 65°C for 5 minutes with a final extension at 68°C for 8 minutes. Cre PCR reactions were performed with 30 cycles of 95°C for 30 seconds, 52°C for 30 seconds, 72°C for 40 seconds with a final extension at 72°C for 5 minutes. Caprin2 floxed allele was identified with the 35 cycles of following PCR reaction, 94°C for 5

30 minutes, 94°C for 30 seconds, 58°C for 30 seconds, 72°C for 45 seconds with a final extension at 72°C for 5 minutes. Gel electrophoresis was performed on 1% agarose (The Lab Depot, # TLDA1705) gel made in 1X Tris-Boric acid-EDTA buffer. A 100- bp ladder (Fisher Scientific, #SM0242) was used to determine the molecular weight of PCR products. Rbm24 germline deletion allele is amplified by primers: 5’- CAAGGACAGCCTGGGATACACAATACC-3’ and 5’- GCTATGTCCATCTTGGTTCAGGATTCAG-3’. Rbm24 floxed allele is amplified by primers: 5’-TAGCTCAGGGGCAACTAGTGTTGGG-3’ and 5’- TTTAAGCCAGCTCGTTGGCAGTTCT-3’. Primers used in for Caprin2 mice genotyping were: for wild-type allele, 5’ GCCTACCTTTCTGTGCCTCC 3’ and 5’ CCAGGCTACTCTCCCCAAAG 3’; for Caprin2 mutant allele 5’ GCCTACCTTTCTGTGCCTCC 3’ and 5’ TCGTGGTATCGTTATGCGCC 3’; for Cre allele, 5’ TTCAATTTACTGACCGTACACC 3’ and 5’ CCGACGATGAAGCATGTTTAG 3’.

2.3 Zebrafish Maintenance All work involving zebrafish was performed in Dr. Diane Slusarski’s laboratory and approved by the University of Iowa’s Institutional Animal Care and Use Committee, PHS Assurance No. A3021-01, under animal protocol No. 5091513. Zebrafish embryos were raised between 28.5°C and 30°C with no more than 50 embryos per 100 mm plate.

2.3.1 Knockdown of rbm24a in zebrafish by morpholinos Zebrafish embryos collected from natural mating were pressure injected at the 1-4 cell stage with 1-7 nanogram per embryo of translation blocking rbm24a

31 morpholino with the following sequence 5′- GCATCCTCACGAAACGCTCAAGTGC -3′ (Gene Tools LLC, Philomath, OR). Standard control MO (5’-CCTCTTACCTCAGTTACAATTTATA-3’) was injected to generate “control” zebrafish at an equal quantity as the experimental MO for each experiment. Microinjection volume was measured in a 1µl capillary tube and calculated using the Microinjection Calculator Android app (available from Google Play Store).

2.3.2 CRISPR/Cas9 Gene Targeting A vector containing the coding sequence for Cas9 protein flanked by two nuclear localization signals (nls) (pT3TS) was used to generate nls-Cas9-nls mRNA (Hwang et al., 2013). Two single guide RNAs (sgRNAs) were designed and constructed to target 20 bp sequences starting with guanine and preceding the Protospacer adjacent motif (PAM) motif (5′-NGG-3′) to create a 252 bp deletion in rbm24a (Fu et al., 2014). Potential off-target effects of sgRNA candidates were analyzed using the online tool CRISPR Design developed by Zhang's laboratory (http://crispr.mit.edu/). An injection mixture was made containing 300ng/µl Cas9 mRNA, 12.5 ng/µl of each guide RNA 5’- TAATACGACTCACTATAGGGGGAGATTGAAGAAGCTGGTTTTAGAGCTAG AA-3’ and 5’- TAATACGACTCACTATAGGCCTTCATGCAACCAAGTGGTTTTAGAGCTAGA A-3’.

32 2.4 Morphological Analysis For gross documentation of alterations in mouse embryos and lens structure, embryos and lenses were dissected in 1X PBS and imaged by light microscopy (Zeiss Stemi SV dissecting microscope). For histological analysis, eyes (postnatal mice) or heads (embryos) were isolated and immediately fixed overnight in 4% paraformaldehyde (PFA, Fisher Scientific, Waltham, MA; #T-353–500). The samples were then dehydrated with ethanol, and embedded in paraffin for microtome sectioning. Sagittal paraffin sections (5 µm) were stained with H&E according to standard protocol (Manthey et al., 2014a) and visualized using light microscopy (Zeiss Axiophot) and a Nikon digital camera.

2.5 In situ hybridization in Zebrafish Total RNA was isolated from twenty 2-day post fertilization (dpf) zebrafish embryos. This total RNA was reverse transcribed into cDNA using SMART MMLV Reverse Transcriptase (Clonetech) primed with oligo-dT primers. cDNA obtained was then used to clone a portion of rbm24a and rbm24b using the following primers: rbm24a-Forward-5’-CCAGGGGTTATGGATTTGTG-3’, rbm24a-Reverse-5’- TGCAGTTGTTGGGGTTGATA-3’, rbm24b-Forward-5’- CGGAGGTCTTCCCTATCACA-3’ and rbm24b-Reverse-5’- CCAAACGCACACAAGAGCTA-3’. The products were ligated into a TOPO-TA PCR-II vector (ThermoFisher Scientific, # K461020) following the manufacturers protocol. DIG-labeled RNA-probes (DIG labeling Mix, Roche, #11277073910) were synthesized using T7 and SP6 Maxi-script kits (ThermoFisher Scientific, #AM1320) following the manufacturers protocol. Embryos at 1-2 dpf were fixed with 4% PFA and in situ hybridization was performed as described previously (Schneider et al.,

33 2008; Thisse et al., 1993). Post in situ hybridization, embryos underwent cryoprotection by sequential transfer from 1X PBST, to 15%, 30% sucrose, then to O.C.T. embedding medium overnight. The following day, embryos were placed in blocks containing fresh O.C.T., aligned as desired, and frozen. 8μm sections were collected and imaged.

2.6 In situ hybridization in Mouse In situ hybridization (ISH) analysis was performed as described in detail (Lachke et al., 2012b). Embryonic head tissue was obtained from E12.5 and E14.5 wild-type ICR mice and fixed overnight in 4% PFA, cryoprotected using 30% sucrose overnight, and embedded in tissue freezing media, OCT (Tissue Tek, Torrance, CA). Frozen sections (coronal) were prepared at 16μm thickness. Primers were designed with either T7 or SP6 promoter sequences upstream of Caprin2 cDNA-specific region as follows: SP6_Caprin 2-F, 5’ GCTATTTAGGTGACACTATAGATGAAGTCAGCCAAGTCCCA 3’; T7_Caprin 2-R, 5’ TTGTAATACGACTCACTATAGGGCGAAGCTTTTTCTTCTCAGT 3’. These primers were used in PCR to amplify Caprin2 cDNA region that was subjected to in vitro transcription, to in turn generate RNA probes for ISH analysis. Slides hybridized with Caprin2-specific antisense probe were viewed and imaged using a light microscope (Zeiss Axiophot) with a Nikon digital camera.

2.7 Scanning Electron Microscopy Scanning electron microscopy (SEM) was performed on 1-month-old control

(Pax6GFPCre:Caprin2+/cKO) and Caprin2cKO/cKO mutant lenses as previously described (Scheiblin et al., 2014). Briefly, whole eyes were dissected without delay

34 from control and mutant mice after sacrificing and treated with a fixative containing 0.08 M sodium cacodylate pH 7.4, 1.25% glutaraldehyde, 1% paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA) for 3 hr. The lenses were dissected from the eye and transferred to fresh cold fixative for 48 hr. The lenses were washed and the lens capsule along with a few layers of fiber cells were removed from one hemisphere of the lens to view the fiber cell ultrastructure. The peeled lenses were then dehydrated through an alcohol dilution series and hexamethyldisilazane (HMDS, Sigma, St. Louis, MO) dilution series (diluted in ethanol). Lenses were then subjected to sputter coating with gold/palladium for 2.5 min before imaging with Hitachi S-4700 Field Emission Scanning Electron Microscope (Tokyo, Japan). The analysis was performed on eight biological replicates for both control and mutants.

2.8 Western Blotting Whole embryonic tissue from control (Rbm24+/+) and Rbm24-/- mice at E14.5 was collected. Lenses were enucleated from control (Pax6GFPCre:Caprin2+/cKO) and Caprin2cKO/cKO mutant mice. The collected tissue was dissolved in lysis buffer (50 mM Tris HCl pH 8.0, 150 mM NaCl, 0.1% sodium dodecyl sulfate (SDS), 1% NP-40 (Tergitol, Sigma-Aldrich, St. Louis, MO; #NP40S) and 0.8% sodium deoxycholate) on ice. Lysed samples were then spun at 14,000 g at 4°C for 30 min. The supernatant was collected and protein content was estimated using NanoDrop. Total protein (100 mg) was denatured using 4X Laemmli buffer and loaded and run on a 7% SDS- polyacrylamide gel electrophoresis at 90V for 90 min. Protein was then transferred to a polyvinylidene fluoride membrane (Fisher Scientific, Waltham, MA; #PI88518) treated with 100% methanol for 5 min at 100 V for 1 hr at 4°C. Membrane was blocked with 5% milk in TBST (Tris buffered saline with 1% Tween 20) for 1 hr and

35 incubated overnight at 4°C with Rbm24 antibody (diluted 1:200 in 5% milk in TBST) (Abcam, #ab174919), β-actin antibody (diluted 1:500 in 5% milk in TBST) (Abcam, #ab8227) or Caprin1 and Caprin2 antibody (diluted 1:200 in 5% milk in TBST) (Proteintech Group, Chicago). After overnight incubation, the blot was subjected to three 15 min washes with TBST and incubated for an hour at room temperature with anti-rabbit secondary antibody conjugated with HRP (horse radish peroxidase) (Cell Signaling, Beverly, MA; #7074). This was followed by three 15 min washes with TBST for 15 min before the blot was incubated with the chemiluminescence substrate (GE Healthcare Life Sciences, Pittsburgh, PA; #RPN2235) and imaged using AlphaImager HP MultiImage II (ProteinSimple, San Jose, CA).

2.9 Immunofluorescence Mouse embryonic head tissue at various stages were embedded in tissue freezing media, OCT (Tissue Tek, Torrance, CA) and frozen sections (coronal) were prepared at 16mm thickness as described (Lachke et al., 2011). Sections were fixed with 4% paraformaldehyde in 1x PBS for 20 min at room temperature followed by two 1x PBS washes and were blocked for 1 hr at room temperature in blocking buffer. The sections were then incubated primary antibody overnight at 4°C. Slides were washed three times in 1x PBS and incubated for 1 hr at room temperature with appropriate secondary antibody conjugated to Alexa Fluor 488 or 594 (Thermo Fisher Scientific, Waltham, MA; #B00101) at 1:200 dilution mixed with 1:500 dilution of DAPI (40,6-diamidine-2-phenylidole-dihydrochloride; Life Technologies, Carlsbad, CA; #D21490). Slides were then washed three times with 1 PBS, mounted, and stored at 4°C until imaging using Zeiss LSM 780 confocal configured with Argon/Krypton laser (488 nm and 561 nm excitation) and Helium Neon laser (633 nm excitation)

36 (Carl Zeiss Inc., Gottingen, Germany). Optimal adjustment of brightness/contrast was performed in Adobe Photoshop (Adobe, San Jose, CA) and applied consistently for all images.

Table 1. Antibodies and immunofluorescence conditions

Primary antibody, source Dilution Blocking buffer and catalog number Rbm24 (Abcam, 1:100 5% chicken serum (Abcam, Cambridge, MA, Cambridge, MA), 0.3% ab94567) triton X-100 in 1X PBS Sox2 (EMD Millipore, 1:100 5% chicken serum (Abcam, Billerica, MA, AB5603) Cambridge, MA), 0.3% triton X-100 in 1X PBS Lhx2 (SantaCruz 1:100 5% chicken serum (Abcam, Biotechnology, Dallas, Cambridge, MA), 0.3% TX, sc-19344) triton X-100 in 1X PBS Foxe3 (Santa Cruz 1:100 5% chicken serum (Abcam, Biotechnology, Dallas, Cambridge, MA), 0.1% TX, sc-134536) triton X-100 in 1X PBS Pax6 (Millipore, 1:200 5% chicken serum (Abcam, Billerica, MA, AB2237) Cambridge, MA), 1% BSA, 0.1% triton X-100 in 1X TBS N-cad (Abcam, 1:100 1% BSA in PBS Cambridge, MA ab18203) E-cad (Cell Signaling 1:100 in 1% BSA, 2 % 5% chicken serum, 0.3% Technology, Beverly, chicken serum, 0.3% triton X-100 in 1X PBS MA, 3195S) TritonX-100 in 1X PBS Aqp0 (Millipore, 1:200 2% BSA in PBS Billerica, MA, AB3071) Jag1 (Santa Cruz 1:50 in 2% BSA, 0.1% 5% goat serum, 0.3% triton Biotechnology, Dallas, Triton X-100 in TBS X-100 in 1X TBS TX, sc-8303) Gamma crystallin (Santa 1:100 in 1% BSA, 2 % 5% chicken serum, 0.3% Cruz Biotechnology, chicken serum, 0.3% triton X-100 in 1X PBS Dallas, TX, sc-22415) TritonX-100 in 1X PBS, 4 hour incubation at RT

37 2.10 RNA isolation and RT-qPCR in zebrafish RNA was isolated from control (injected with control morpholino) and rbm24a knockdown 1dpf embryos and used to synthesize cDNA as described above. Samples were prepared in a 96-well reaction plate with four biological replicates. qRT-PCR was performed with the LightCycler480 System (Roche Applied Sciences) using SYBR Green I Master Mix (Roche, # 04707516001). Samples were normalized to elongation factor 1 alpha (elfa). Log fold-change was determined using 2-ΔΔCT method and statistical significance was calculated using nested ANOVA. The following primers were used for RT-qPCR: sox2-Forward-5’- AACCAGAAAAACAGCCCGGA-3’, sox2-Reverse-5’- AATGGTCGCTTCTCGCTCTC3’, elfa-Forward-5’- GATGCACCACGAGTCTCTGA-3’, and elfa-Reverse-5’- TGATGACCTGAGCGTTGAAG-3’.

2.11 RNA isolation and RT-qPCR in mouse Mouse E7.5 whole embryonic tissue and E14.5 ocular tissue was dissected in 1X PBS for RNA isolation. Each E7.5 whole embryonic tissue and four E14.5 eyes were treated as one biological replicate, and total RNA was extracted from three biological replicates. Total RNA was extracted using RNeasy mini kit (Qiagen, #74104). cDNA synthesis and RT-qPCR was performed as described (Agrawal et al., 2015) on ABI7300 Real-Time PCR system (Applied Biosystems) using Fast SYBR Green PCR master mix (Invitrogen Life technologies, # 4367659). Hprt was used as a control housekeeping gene to normalize transcript levels. The experiment was performed three times with three biological replicates. Differential expression of each transcript was determined using 2-ΔΔCT method. The following primers were used for

38 qRT-PCR: Rbm24-Forward-5’-TCTTCGGAGACATCGAGGAA-3’, Rbm24- Reverse-5’- AAAACCTGGCTGCATGATTC-3’, Sox2-Forward-5’- TTAACGCAAAAACCGTGATG-3’, Sox2-Reverse-5’- GAAGCGCCTAACGTACCACT-3’, Jag1-Forward-5’- TAGCTGCCTGCCGAACCCCT-3’, Jag1-Reverse-5’- GCTGGAGGCTGGAGGACCGA-3’, Oct4-Forward-5’- AGTTGGCGTGGAGACTTTGC-3’, Oct4-Reverse-5’- CAGGGCTTTCATGTCCTGG-3’, Klf4-Forward-5’- GCGAACTCACACAGGCGAGAAACC-3’, Klf4-Reverse-5’- TCGCTTCCTCTTCCTCCGACACA-3’, Nanog-Forward-5’- AGGGTCTGCTACTGAGATGCTCTG, Nanog-Reverse-5’- CAACCACTGGTTTTTCTGCCACCG, c-Myc-Forward-5’- TGACCTAACTCGAGGAGGAGCTGGAATC, c-Myc-Reverse-5’- AAGTTTGAGGCAGTTAAAATTATGGCTGAAGC, Pax6-Forward-5’- AGTTCTTCGCAACCTGGCTA-3’ and Pax6-Reverse-5’- ACTTGGACGGGAACTGACAC-3’. Statistical significance for RT-qPCR data was determined using nested ANOVA (Bookout and Mangelsdorf, 2003).

2.12 RNA-Immunoprecipitation (RIP assay) Wild-type E14.5 mouse eye lysates were used (n=6 eyes per replicate). Preconjugation of Rbm24 antibody (Abcam, ab174919) and IgG antibody with magnetic beads was performed for 45 min at room temperature. Manufacturer’s instructions were followed for the EZ-Nuclear RIP Kit (EMD Millipore 17-10523) for the immunoprecipitation, followed by qPCR for Sox2 and Lhx2.

39 2.13 RNA EMSA Full length Rbm24 CDS fused with GST was cloned in PGEX-6P3 vector (GE Healthcare life sciences, #28-9546-51) and transformed in competent BL21 bacterial cells (ThermoFisher Scientific, #C600003). Glutathione sepharose bead (Sigma Aldrich, #GE17-0756-01) was used to affinity purify Rbm24 protein from BL21 lysate, following which GST was cleaved from the fused protein using PreScissionTM Protease (GE Healthcare LifeSciences, #27-0843-01). RNA EMSA was performed using manufacturer’s instruction for Chemiluminescent RNA EMSA (ThermoFisher Scientific, #20158). Briefly, biotinylated and unbiotinylated RNA oligos designed on the ARE site A1 of Sox2 3’UTR were heated at 80°C for 5 minutes to relax RNA folding. Following RNA oligos were used: ATTTGAACATTTTAGTTTTA-biotin, ATTTGAACATTTTAGTTTTA, ATTTGAACAGGGGAGTTTTA-biotin. Rbm24 purified protein (1mg/ml) was allowed to bind to the relaxed oligo for 30 minutes at room temperature. The samples were run on a 6% native gel polyacrylamide gel made in 0.5X TBE and then transferred to a nylon membrane. RNA was crosslinked to the membrane by irradiating the membrane with 254 nm UV lamp for 3 minutes. The membrane was then blocked, washed and biotinylated RNA was detected with chemiluminescent substrate provided in the kit.

2.14 TUNEL Labeling Embryonic head tissue was excised, fixed for two hours at room temperature in 4% paraformaldehyde, and transferred to 70% ethanol prior to paraffin embedding. Six micron thick sections were prepared, and nuclear DNA fragmentation was detected by TUNEL staining using the In-Situ Cell Death Detection Kit, Fluorescein (Roche Diagnostics, Indianapolis, IN, #11684795910) following the manufacturer's

40 directions. Slides were counterstained with 1:2000 Draq-5 in 1X PBS to visualize cell nuclei. Following two, five-minute 1X PBS washes, slides were mounted in mounting media.

2.15 Cell culture The mouse fibroblast NIH3T3 cells were cultured under standard conditions (10 mL of DMEM with 4.5 g/L glucose and L-glutamine (Corning Cellgro, #10-017- CV)), 10% Fetal Bovine Serum (Gemini Bio-products, # 900-208), and 1% penicillin- streptomycin (GE Healthcare Life Sciences, # SV30010). Cells were incubated at 37°C in a humid chamber with 5% CO2 as described (Lachke et al., 2011).

2.16 Generating Wildtype and Mutated Sox2 Reporter Vector To generate wildtype Sox2 reporter vector wherein Renilla luciferase is fused to 3’UTR of Sox2 mRNA, wild-type mouse Sox2 3’UTR was cloned downstream of the firefly luciferase gene in the pmirGlo vector (Promega, # E1330) with the following primers: 5’-GACGAGCTCGGGCTGGACTGCGAACTGGAGA-3’ and 5’- AGGCTCTAGATTCAGTGTCCATATTTCAAA-3’. Mutated Sox2 reporter vector were generated following manufacturer’s instructions for QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies, #200523) using the below mentioned HPLC purified primers: A1*-Forward-5’- TGTTTTCCTTTTGTACAATTTTAAAACTCCCCTGTTCAAATCCGAATAAACT CCTTCCTTGTTTGTAACGG-3’, A1*-Reverse-5’- CCGTTACAAACAAGGAAGGAGTTTATTCGGATTTGAACAGGGGAGTTTTA AAATTGTACAAAAGGAAAACA-3’, A2*-Forward-5’- GAAATATTTTCTTATGGTTTGTAATATTTCTGTAAATTGTGATACCCCAAGG

41 TTTTTCCCCCCTTTTATTTTCCG-3’, A2*-Reverse-5’- CGGAAAATAAAAGGGGGGAAAAACCTTGGGGTATCACAATTTACAGAAAT ATTACAAACCATAAGAAAATATTTC-3’, A3*-Forward-5’- CTGATTCCAATAACAGAGCCGAATCTTTTGGGGTACAACTACGGAAAATA AAAGGGGGGAAA-3’ and A3*-Reverse-5’- TTTCCCCCCTTTTATTTTCCGTAGTTGTACCCCAAAAGATTCGGCTCTGTTA TTGGAA TCAG-3’. pmiRGlo dual luciferase vector with wildtype 3’UTR of Sox2 vector was used as a template for site directed mutagenesis. Cloning was confirmed by Sanger sequencing.

2.17 Sox2 mRNA Decay Assay To generate the Rbm24 over-expression plasmid, Rbm24 ORF was cloned to pcDNA3.1 vector (ThermoFisher Scientific, # V79020) using the following primers: Forward-5’-ATTAGAATTCATGCACACCACCCAGAA-3’ and Reverse-5’- CTTCTCGAGCTACTGCATTCGGTCTGTCT-3’ and was confirmed by Sanger Sequencing. Both Rbm24 over-expression plasmid and the dual luciferase-Sox2 3’UTR plasmid were transiently transfected into NIH3T3 cells for 48 hours using the Lipofectamine® 3000 Transfection Reagent (ThermoFisher Scientific, #L3000015). Control cells were transfected with empty pcDNA3.1 vector and dual luciferase-Sox2 3’UTR plasmid. Transfected cells were treated with 5µg/ml actinomycin D to halt general transcription. Cells were collected every hour up to after 4 hours of actinomycin D treatment, total RNA was isolated and cDNA were synthesized, and RT-qPCRs were performed as described above using the following primers to amplify the luciferase product: 5’-GCTCAGCAAGGAGGTAGGTG-3’ and 5’-

42 TCTTACCGGTGTCCAAGTCC-3’. The assay was performed multiple times with three biological replicates and three technical replicates.

2.18 Rbm24 Over-Expression Assay Rbm24 over-expression plasmid was transiently transfected into NIH3T3, 21EM15 and C2C12 cells for 48 hours using the Lipofectamine® 3000 Transfection Reagent (ThermoFisher Scientific, #L3000015). Control cells were transfected with empty pcDNA3.1 vector. Assay was performed with three biological replicates each of control and Rbm24 overexpressed cells. Cells were collected, total RNA was isolated and cDNA were synthesized, and RT-qPCRs were performed with primers as described above.

2.19 F-actin and Wheat Germ Agglutinin (WGA) Staining and Calculation of Nuclear Fiber Cell Area Section and whole lens F-actin and WGA staining were performed as reported (Scheiblin et al., 2014). Briefly, embryonic head tissue from Caprin2 cKO/cKO mutant and control (Pax6GFPCre:Caprin2+/cKO) mice (Stages E12.5, E14.5, E16.5, P0) was fixed in 4% PFA for 30 minutes on ice at 4ºC and treated with 30% sucrose overnight at 4ºC, followed by embedding in OCT. Frozen sections were prepared at 16μm thickness. Sections were blocked in blocking buffer (2% BSA in 1x PBS) for 1 hour at RT. They were then incubated in Phalloidin conjugated with Alexa flour 568 and Wheat Germ Agglutinin (Invitrogen, Grand Island, NY) conjugated with Alexa flour 488 (diluted 1:200 in blocking buffer along with 1:500 DAPI) for one hour at RT following which the slides were washed with 1x PBS and mounted. The stained slides were imaged using Confocal 780 (Carl Zeiss Inc.). Lens tissue images at various stages were processed using Photoshop. Because WGA binds preferentially to the ball

43 and socket junctions in the lens, higher intensity of WGA staining is generally observed in the cortical fiber zone while nuclear fiber zone is stained at reduced intensity (Kistler et al., 1986). The ImageJ (NIH, Bethesda, MD) software was used to calculate the area and fluorescence intensity of the nuclear fiber region (WGA stained at low intensity) and that of the whole lens. Fluorescence intensity of below 30 was described as lower staining and above 30 was described as higher staining. The ratio of the area of the nuclear fiber region to the entire area of the lens was calculated for control and Caprin2cKO/cKO mutants in three biological replicates and statistical significance for their difference was estimated using a student t-test.

2.20 Statistical Analysis All experiments were performed in a minimum of three biological replicates unless stated otherwise. Statistical significance for RT-qPCR data was determined using nested ANOVA (Bookout and Mangelsdorf, 2003).

44 Chapter 3

RBM24 POST-TRANSCRIPTIONALLY REGULATES SOX2 TO CONTROL EYE DEVELOPMENT AND PLURIPOTENCY FACTORS

3.1 Introduction Developmental eye disorders such as microphthalmia and anophthalmia affect

1 in 7,000 and 1 in 30,000 live human births, respectively (Shah et al., 2011). About 20% of human anophthalmic cases are linked to mutations in the SOX2 gene alone, which encodes a transcription factor that functions in early eye development and is also one of the Yamanaka/reprogramming factors that controls induction of pluripotent stem cells (Fantes et al., 2003; Takahashi and Yamanaka, 2006; Williamson and FitzPatrick, 2014). While transcriptional regulation of Sox2 is characterized in detail in various developmental tissues (Wu and Belmonte, 2016), the impact of post-transcriptional regulatory mechanisms, particularly those regulated by RNA-binding proteins (RBPs), on the fate of its transcribed mRNA is less clear. Indeed, there are approximately the same number of transcription factors and RBPs encoded by the human genome, but the functional significance of the latter in development is not well described (Gerstberger et al., 2014). Here I report a conserved RBP, Rbm24, which directly binds to the AU-rich elements (AREs) within the 3’UTR of Sox2 mRNA and this interaction leads to the stabilization of the Sox2 transcript, which is necessary for its developmental expression. Rbm24-deficiency in mouse or fish results in down-regulation of Sox2 and causes microphthalmia or anophthalmia. Rbm24 mutant mice show elevated apoptosis in developing ocular

45 tissue and abnormal expression of eye development regulators and markers such as Lhx2, Jag1, E-cadherin and γ-Crystallin. Further, Rbm24 overexpression in different cultured cell types results in elevated expression of Sox2 and other Yamanaka/reprogramming factors namely Oct4, Klf4, c-Myc and Nanog. These data provide a transformational understanding of RNA-binding protein-mediated control of key transcriptional regulators, particularly Sox2, in organogenesis and in the post- transcriptional control of pluripotency factors.

3.2 Results

3.2.1 Rbm24 Deficiency Causes Microphthalmia and Anophthalmia in Mouse Using the bioinformatics tool iSyTE (integrated Systems Tool for Eye gene discovery), which prioritizes genes based on eye-tissue enrichment scores (Dash et al., 2015; Kakrana et al.; Lachke et al., 2011, 2012a), Rbm24 was identified as a potential regulator of eye development (Fig. 3.1A). In mouse, Rbm24 is expressed in the presumptive lens ectoderm and the optic vesicle at embryonic day (E) 9.5 (Fig. 3.1B), and later in the lens and the retina (Fig. 3.1C-E), suggesting that Rbm24 functions in eye development from early stages.

47 To investigate Rbm24 function in development, I generated a new Rbm24 constitutive knockout mouse line, Rbm24-/-, and validated the absence of Rbm24 at both RNA and protein levels in mutant whole body as well as ocular tissue (Fig. 3.2A- E). Rbm24-/- mice die at variable frequency after E7.5 and do not survive after E14.5, and further, after stage E9.5 they are smaller compared to control. The embryonic lethality defect is observed in an independently generated Rbm24 null mouse line and is attributed to cardiac abnormalities (Yang et al., 2014). In addition to these phenotypes, this study demonstrates that Rbm24-/- mice exhibit severe ocular defects at 100% penetrance. At E11.5, approximately half of the Rbm24-/- mice exhibit anophthalmia (absent/rudimentary ocular tissue due to arrested eye development) on one side and microphthalmia (small eye) on the other, while the remainder of the mutants exhibit bilateral microphthalmia (Fig. 3.3).

Figure 3.3 Rbm24-/- mice exhibit anophthalmia and microphthalmia (A-B”) At E11.5, 50% of Rbm24-/- mice exhibit anophthalmia (*) on one side and microphthalmia on the other side (**). The other 50% exhibit bilateral microphthalmia.

50 3.2.2 rbm24a Deficiency Causes Eye Defects in Zebrafish In zebrafish, one of the Rbm24 orthologs, rbm24a, is expressed in early eye development beginning at the 20-somite stage and, analogous to mouse, is later enriched in the lens at 2-day post fertilization (dpf) (Fig. 3.4A-C). The other zebrafish Rbm24 ortholog, rbm24b, exhibits high expression in heart and somites but low expression in the developing eye tissue (Fig. 3.5). These data were suggestive of rbm24a as the ortholog that likely functions in the eye, and therefore in collaboration with Dr. Slusarski’s laboratory, morpholinos and CRISPR/Cas9 were used to generate rbm24a-knockdown and deletion, respectively, in zebrafish. In a dose-dependent manner, rbm24a morphants exhibit progressively severe microphthalmia at high frequency or anophthalmia (rudimentary or diffused ocular tissue) at 1-5% penetrance at 3dpf stage (Fig. 3.4D-E’). To confirm the zebrafish rbm24a-knockdown phenotypes, CRISPR/Cas9 was used to generate deletions in rbm24a, which resulted in microphthalmia in F0 embryos at 3dpf stage (Fig. 3.4F-G’). Together, these data identify Rbm24 as a new post-transcriptional regulator necessary for eye development in vertebrates.

52 3.2.3 Rbm24 Deficient Ocular Tissue Exhibit Apoptotic Defects Because microphthalmia/anophthalmia can result from elevated apoptosis in development (French et al., 2013; den Hollander et al., 2010; Silver and Hughes, 1974), cell death analysis was performed, which demonstrated Rbm24-/- ocular tissue to have high number of TUNEL positive cells (Fig. 3.6A-E). Notch pathway effector Jag1, which positively control apoptosis inhibitors and functions in eye development (Fiaschetti et al., 2014; Le et al., 2012), is downregulated at both the mRNA and protein levels in Rbm24-/- mice (Fig. 3.6F-H). These data suggest that Rbm24- mediated positive control of Jag1 is necessary for cell viability in eye development, and the disruption of this regulatory module contributes to the pathology of the ocular defects in Rbm24 mutants.

3.2.4 Rbm24 Deficiency Leads to Downregulation of Key Eye Development Markers To gain further insight into the molecular basis of the ocular phenotype in

Rbm24-/- mice, expression of lens development markers E-cad (E-Cadherin) and γ-Cry (gamma-Crystallins) was examined. E-cad is downregulated and γ-Cry is absent in severely affected mutant lenses, while both markers are significantly reduced in less- severely affected mutant lenses, suggesting abnormalities in lens epithelial and fiber cells, and therefore lens differentiation, in Rbm24-/- embryos (Fig. 3.7A-D). Next, early eye development markers namely Lhx2, Pax6 and Sox2 were examined, which are also linked to anophthalmia. While Pax6 is unaltered at E10.5 (Fig. 3.8A-C), Lhx2 is downregulated in Rbm24-/- mice at E9.5 (Fig. 3.7E, F). However, in the severely affected Rbm24-/- embryos, Pax6 is undetected in the region where lens vesicle is normally formed; however, Pax6 expression in the retina of Rbm24-/- embryos is unaltered (Fig. 3.8D-F).

Figure 3.6 Rbm24 deficiency causes apoptotic defects and downregulation of eye development markers. (A-D) Compared to control, Rbm24-/- mice have high number of TUNEL positive nuclei (arrowhead) in the ocular region at E10.5 and E12.5. (E) Quantification of TUNEL immunofluorescence indicates significantly higher number of apoptotic nuclei in Rbm24-/- ocular region. (F) RT-qPCR analysis indicates significant Jag1 downregulation in Rbm24-/- compared to controls. (G, H) Immunostaining analysis indicates Jag1 is downregulated in E12.5 Rbm24-/- lenses compared to control. Asterisks in E, F indicate a p-value < 0.05. Scale bar for A-D, G, H is 70 µm; # indicates whole body tissue.

54 Because, Sox2 is required for the sustained expression of Pax6 in early lens development I next investigated the expression of Sox2 in Rbm24-/- mice.

3.2.5 Sox2 is a Direct Target of Rbm24 Interestingly, Sox2 protein is significantly downregulated in Rbm24-/- mice during early eye development at E9.5 in the presumptive lens ectoderm and optic vesicle (Fig. 3.9A-B’), and is undetected in mutant ocular tissue at later developmental stages (Fig. 3.9 C-D’). While Sox2 mRNA is expectedly found to be severely downregulated in Rbm24-/- eye tissue, it is also reduced in whole embryonic tissue (Fig. 3.9E). Moreover, sox2 mRNA is also found to be downregulated in rbm24a morphants zebrafish (Fig. 3.9F), suggesting that the function of Rbm24 is conserved during development in vertebrates. Interestingly, Sox2 mRNA 3’UTR has three AU-rich elements (AREs) (Fig. 3.10 A), henceforth referred as A1, A2, and A3, and Rbm24 can bind AREs in other mRNAs (namely p21 and p63) in human colorectal carcinoma cells (Jiang et al., 2014; Xu et al., 2014). Therefore, I hypothesized that Rbm24 regulates Sox2 through the AREs and first tested the possibility that Rbm24 directly binds to Sox2 ARE by performing electrophoretic mobility shift assay (EMSA). Full-length Rbm24 protein binds, in a sequence-specific manner, to a 20-bp biotin-labeled RNA-oligomer that contains the Sox2 3’UTR ARE site A1 (Fig. 3.10 B). The Rbm24 protein-Sox2 3’UTR RNA complex can be competed out with a 1000-fold excess of the non- biotinylated wild-type ARE oligomer, but not with the non-biotinylated mutant ARE oligomer (Fig. 3.10 B).

Figure 3.7 Eye development markers are downregulated in Rbm24-/- mice. (A-D) E-cad and γ-Cry are severely downregulated in lens epithelial and lens fiber cells, respectively at E12.5 and E14.5 in Rbm24-/- compared to control. (E, F) Lhx2 is significantly downregulated in the optic vesicle of Rbm24-/- at E9.5 compared to control. Scale bar for A-F is 70 µm.

Figure 3.8 Pax6 expression in Rbm24-/- mice. (A) RT-qPCR shows that Pax6 is not significantly altered in Rbm24 -/- mouse mutants at E7.5 (whole embryonic tissue, indicated by #) and E14.5 eye tissue. (B, C) Pax6 protein expression is unaltered in Rbm24-/- mouse mutant ocular tissue at E10.5, and (D-F) in both severe and mild phenotypes of Rbm24-/- mouse mutant ocular tissue at E11.5. Scale bar in B-F is 70 µm.

Figure 3.9 Rbm24 regulates Sox2 expression by post-transcriptional mechanism. (A-B’) At early eye development stage E9.5, Rbm24-/- mice exhibit significant reduction of Sox2 in the surface ectoderm (future lens) and the optic vesicle (future retina). (C-D’) By E14.5, even the Rbm24-/- mice with less severe eye phenotype exhibit severe reduction of Sox2 in the lens and retina. High-magnification of dotted-line areas in A, B, C, D are show in A’, B’, C’, D’, respectively. (E) RT-qPCR analysis confirms significant Sox2 down-regulation in Rbm24-/- mice, and (F) rbm24a morphant zebrafish. Asterisks in E, F indicate p-value < 0.05. Scale bar in A, B, C’, D’ is 70 µm, C-D is 140 µm, A’, B’ is 12 µm; # indicates whole embryonic tissue.

58 Furthermore, I performed RNA-immunoprecipitation (RIP) assay using Rbm24 antibody on wild-type whole eye lysates that shows enrichment of Sox2 mRNA in the Rbm24 antibody pulldown (Fig. 3.10 C). Together, these findings demonstrate that Rbm24 directly binds to Sox2 mRNA through interaction with its 3’UTR ARE.

3.2.6 Rbm24 Positively Controls Sox2 mRNA Stability To understand the biological significance of Rbm24 binding with Sox2 mRNA, and thereby investigate the molecular mechanism by which it regulates Sox2 expression, I next performed reporter analysis. I co-transfected NIH3T3 cells with an Rbm24 overexpression vector and a Sox2 reporter vector, which carries the Renilla luciferase open reading frame (ORF) fused to Sox2 3’UTR. After treating co- transfected cells with the general transcriptional inhibitor Actinomycin D, the rate of luciferase mRNA decay was measured. Rbm24 overexpression causes an increase in the half-life of luciferase-Sox2 3’UTR fusion reporter transcript (Fig. 3.10 D), indicating that Rbm24 stabilizes Sox2 transcript through interactions with its 3’UTR. Next, I performed mRNA decay assay on Rbm24 overexpressing NIH3T3 cells co- transfected with reporter vector wherein luciferase is fused with various mutated versions of Sox2 3’UTR. Unlike wild-type Sox2 3’UTR that contains intact ARE sites, mutation of the ARE sites A1, A2 or A3 individually, or all three sites concomitantly, did not result in a similar increase in the half-life of luciferase-Sox2 reporter vector (Fig. 3.10 E). These findings demonstrate that Rbm24 directly controls Sox2 mRNA stability, which requires the presence of all three ARE sites in the Sox2 3’UTR.

Figure 3.10 Rbm24 binds to the AU-rich region of Sox2 3’UTR and stabilizes it. (A) Schematic representation of Sox2 mRNA, which has a single exon and three AU-rich elements (AREs; A1, A2 and A3) in the 3’UTR. (B) RNA EMSA demonstrates that Rbm24 protein binds to Sox2 3’UTR by directly interacting with its AU rich element to form a protein-RNA complex that can be competed away by un-labelled wildtype ARE containing oligomer but not by un-labelled mutant ARE. (C) RNA immunoprecipitation with Rbm24 antibody on mouse embryonic eye tissue shows enrichment of Sox2 mRNA. (D) Rbm24-overexpression in NIH3T3 cells results in significant increase in the half-life of luciferase mRNA fused to Sox2 3’UTR. (E) Upon Rbm24-overexpression and 2 hours of Actinomycin D treatment, luciferase reporter fused to wild-type Sox2 3’UTR mRNA exhibits elevated stability. However, under these conditions, the luciferase reporters fused to Sox2 3’UTR mRNA containing individual mutations in the AREs A1, A2 and A3 (*) or combined mutations in all three AREs (A1*2*3*) do not exhibit elevated stability. Asterisks in C indicate p-value < 0.05.

60 3.2.7 Rbm24 is a Positive Regulator of Pluripotency Factors Beyond its function in the eye, Sox2 is required for cell reprograming, and is one of the four originally described Yamanaka factors, as well as one of the two (the other being Oct4) factors, which are indispensable for generating induced pluripotent stem cells (Rizzino, 2013). Thus, because Rbm24 regulates the expression of Sox2, I investigated its regulatory relationship with other pluripotency factors such as Klf4 and Oct4. Rbm24 overexpression in mouse fibroblast cell line NIH3T3 or the mouse lens epithelial cell line 21EM15 leads to significant up-regulation of Oct4 and Klf4 in addition to Sox2 (Fig. 3.11 A-C). Moreover, in mouse myoblast cell line C2C12, in addition to Sox2, Oct4, and Klf4, the other pluripotency factors Nanog and c-Myc are also found to be upregulated (Fig. 3.11 D). These findings indicate that Rbm24 can positively regulate the expression of Yamanaka reprogramming/pluripotency factors in diverse cell types.

Figure 3.11 Rbm24 positively controls Yamanaka/reprogramming and other pluripotency factors. (A) Rbm24-overexpression in mouse fibroblast NIH3T3 cells results in up-regulation of the pluripotency factors Sox2, Klf4 and Oct4 as demonstrated by RT-qPCR. (B) Immunostaining demonstrates that Rbm24-overexpression leads to elevated Oct4 and Sox2 levels in NIH3T3 cells. (C) Rbm24-overexpression in mouse lens epithelial 21EM15 cells leads to significant upregulation of Sox2, Oct4 and Klf4. (D) Rbm24-overexpression in mouse myoblast C2C12 cells leads to significant upregulation of Sox2, Oct4, Klf4, Nanog and c-Myc. Abbr.: f.c., fold-change; n.s., not significant. Asterisks in A, C and D indicate p-value < 0.05; scale bar in B is 50 µm.

62 3.3 Discussion RNA-binding proteins directly bind to their target mRNAs and mediate control over their different fates, such as their intracellular localization, stability/decay or translation –defined as post-transcriptional regulation of gene expression (Anderson, 2010; Dash et al., 2016). While RBPs play a key role in determining the cellular proteome, their function in development and their relevance to developmental defects and disease, as well as to cellular reprogramming, is not well defined compared to transcription and signaling factors. This is a profound knowledge gap because understanding post-transcriptional control is recognized as a critical factor for comprehensively defining human developmental defects (Manning and Cooper, 2017), and presently there is limited understanding of RBP function in control of pluripotency (Park et al., 2008; Ye and Blelloch, 2014). Thus, our findings in this report have the following novelty and broad impact: (1) identification of Rbm24 as the pioneering example of a conserved RNA-binding protein that mediates post- transcriptional gene expression control necessary in vertebrate early eye development, (2) Rbm24 as a new gene linked to anophthalmia/microphthalmia ocular defects, (3) identification of Sox2 as a novel target of Rbm24, (4) identification of an AU-rich element-based mechanism for positively controlling Sox2 mRNA, and (5) Rbm24 as a new positive regulator of the pluripotency factors Sox2, Oct4, Klf4, c-Myc and Nanog is different cell types. Previously, Rbm24 has been linked to cardiac defects in vertebrates (Fetka et al., 2000; Grifone et al., 2014; Maragh et al., 2014). Specifically, it is shown to regulate alternative splicing in the derivation of cardiac lineage from embryonic stem cells, in addition to functioning in muscle development (Yang et al., 2014; Zhang et al., 2016b). In zebrafish, rbm24a and rbm24b knockdown is linked to craniofacial

63 defects and microcephaly (Maragh et al., 2014). While these studies also cursorily mention microphthalmia, the mechanism of these pathologies, or the universal requirement of Rbm24 in vertebrate eye development is undefined. My findings show that in addition to gene expression defects, Rbm24-/- mice exhibit reduced Jag1, which offers an explanation for the elevated apoptosis in these mutants (Fiaschetti et al., 2014). Here as well, reduced Sox2 levels in the Rbm24 mutants contribute to increased cell death in the eye because Sox2 has been shown to regulate apoptosis through the Map4K4/survivin pathway in human lung cancer cells (Chen et al., 2014). Further, in human mesenchymal stem cells, another RBP – HuR – has been shown to control Sox2 mRNA decay via the ARE sites, a direct interaction of the RBP-mRNA is not described (Latorre et al., 2016). But importantly, the outcome of the HuR-based control is the negative regulation of the Sox2 transcript. In contrast, here my present data presents the first evidence that Rbm24 directly binds to the ARE sites of Sox2 3’UTR and stabilizes its transcript, perhaps by preventing the recruitment of RISC RNA decay complex to mRNA by other RBPs such as HuR and therefore protecting it from degradation. These findings inform on the complexity of combinatorial control mediated by distinct RBPs, and on their exquisite specificity on key regulatory factors in development and disease. Further, the post-transcriptional control of Sox2 may represent an important regulatory mechanism as this gene is among the rare 3% genes encoded by just one exon (Grzybowska, 2012) and thus the Sox2 transcript – devoid of binding with proteins such as the exon-junction complex – may have evolved distinct mechanisms for controlling mRNA stability and half-life. Thus, my findings present a new molecular mechanism of Rbm24-mediated post- transcriptional control of gene expression of the Sox2 mRNA, which is required for

64 proper development of the eye, and deficiency of which causes the ocular developmental defects anophthalmia and microphthalmia. Further, these data identify Rbm24 as a new positive regulator of the pluripotency factors Sox2, Oct4, Klf4, c- Myc and Nanog in a variety of different cells, and therefore represent transformative advances in the profoundly understudied area of post-transcriptional control of pluripotency.

65 Chapter 4

DEFICIENCY OF THE RNA BINDING PROTEIN CAPRIN2 CAUSES LENS DEFECTS AND FEATURES OF PETERS ANOMALY

4.1 Introduction During early stages of anterior eye chamber/segment (comprising of cornea, lens, iris, and ciliary body) development, cells of the lens placode invaginate together to form a lens pit that subsequently develops into a lens vesicle, while overlying cells that reconstitute the ectodermal surface contribute toward corneal epithelium tissue (Cvekl and Duncan, 2007). In later stages, cells of mesenchymal origin migrate to contribute to the corneal endothelium tissue (Cvekl and Tamm, 2004; Hay, 1980). During these critical developmental events controlled by an interplay of transcription factors and signaling molecules, cells of the surface ectoderm undergo substantial changes in their shape as well as in their adhesion properties (Hendrix and Zwaan, 1974; Lang et al., 2014a; Plageman et al., 2010, 2011, Pontoriero et al., 2008a, 2009a). Indeed, perturbation of these complex processes leads to incomplete separation of the lens vesicle from the overlying corneal ectoderm in turn resulting in the presence of an abnormal lenticorneal stalk, which is a feature associated with the human developmental defect called Peters anomaly (Bhandari et al., 2011; Reis and Semina, 2011a). In the normally formed lens vesicle, anteriorly localized cells contribute to the epithelium of the lens while posteriorly localized cells begin differentiation into

66 primary fiber cells that elongate to fill up the lens vesicle and contribute to the “nucleus” of the lens (Cvekl and Duncan, 2007). Through development and adulthood, cells of the anterior lens epithelium remain in the cell cycle and undergo division in a specific region of the lens called the proliferation zone. Just beyond the proliferation zone near the equator of the lens, epithelial cells respond to signaling cues and exit the cell cycle to begin differentiation into secondary fiber cells (Lovicu and McAvoy, 2005). Fiber cells undergo a terminal differentiation program that results in high levels of expression of structural proteins such as crystallins as well as transport proteins such as aquaporins and gap junction proteins, followed by the loss of their nuclei and organelles (Bassnett et al., 2011; Cvekl and Duncan, 2007). Perturbations in fiber cell differentiation or homeostasis result in lens defects that include cataracts (Churchill and Graw, 2011; Shiels and Hejtmancik, 2013). Furthermore, morphological changes in the lens, such as compaction of the lens nucleus due to genetic perturbation or aging are also associated with cataract (Al-Ghoul et al., 2001a; Fudge et al., 2011a). I used iSyTE to identify a second RBP/RG component Caprin2 (Cytoplasmic activation- and proliferation-associated protein 2; also known as RNA granule protein 140, RNG140; C1q Domain-containing protein 1, C1qdc1; EEG1) as a candidate that likely functions in lens development. Caprin2 deficiency results in two distinct ocular defects at variable penetrance, one affecting the lens fiber cell core and the other impairing the separation of the lens and cornea tissue.

67 4.2 Results

4.2.1 Expression of Caprin2 in the Mouse Lens Analysis of iSyTE tracks identified Caprin2 among the top 1% of lens- enriched genes starting at E12.5 (Fig. 4.1A). To extend Caprin2 expression beyond the above three embryonic stages, I analyzed publicly available mouse lens microarray datasets at developmental stages between E16.5, E17.5, P0, P2, and P56. Together these analyses indicated that Caprin2 exhibits significant lens-enriched expression in all stages tested (Fig. 4.1B). Further, Caprin2 expression progressively increased in lens development with highest expression at P0 prior to being reduced at P56. Interestingly, western blot analysis demonstrated that Caprin2 protein is highly expressed in early postnatal stages, as expected from the microarray data, but its expression is down-regulated to undetectable levels at age 4.5 months (Fig. 4.1C). To further investigate its expression within the lens, in situ hybridization was performed at E12.5 and E14.5 and detected Caprin2 transcripts specifically in fiber cells (Fig. 4.1D, E). Moreover, this analysis indicated Caprin2 expression to be highly lens-enriched compared to other regions of the embryonic head tissue (Fig. 4.1F), partially explaining its high enrichment score in iSyTE. Immunostaining of mouse embryonic head tissue with a Caprin2-specific antibody corroborated this data, demonstrating that Caprin2 protein expression is restricted to lens fiber cells, while being undetected in lens epithelial cells (Fig 4.1G-I). Further, this analysis revealed that Caprin2 protein localizes predominantly in the cytoplasm of fiber cells. Together, these analyses support iSyTE’s prediction of high Caprin2 expression in the lens.

69 4.2.2 Generation of Caprin2cKO/cKO Lens-Knockout Mice Caprin2cKO/cKO conditional knockout mouse mutants were generated by deleting in lens lineage cells the fifth exon of Caprin2, which codes for a basic helix domain involved in RNA binding (see Experimental Procedures for details) (Fig. 4.2A). This was achieved by crossing mice carrying Caprin2 conditional null alleles (Caprin2 exon 5 flanked by loxP sites; Caprin2flox) with Pax6GFPCre mice, in which beginning at E8.75 Cre recombinase expression is driven by the Pax6 ectodermal enhancer and P0 promoter in surface ectodermal cells fated to become lens (Rowan et al., 2008, 2010). Deletion of Caprin2 exon 5 is expected to lead to de novo splicing of exon 4 and exon 6, causing a frame-shift in the Caprin2 open reading frame (ORF) and resulting in a downstream pre-mature stop codon (Fig. 4.2A). This in turn is expected to lead to nonsense-mediated decay of the truncated Caprin2 transcript expressed from the recombined allele in cells fated to become the lens. These expected results were confirmed by semi-quantitative reverse transcriptase PCR (RT- PCR), which demonstrated that Caprin2 transcripts were undetected in Caprin2cKO/cKO lenses (Fig. 4.2B). Further, western blot analysis confirmed that Caprin2 protein expression is undetected in Caprin2cKO/cKO lenses at P56 (Fig. 4.2C). Finally, immunostaining demonstrated that Caprin2 protein is present in traceable amounts in E12.5 Caprin2cKO/cKO lens (Fig. 4.2D, E), while it is undetected in the Caprin2cKO/cKO lens at stage P4 (Fig. 4.2F, G). These analyses indicate that genetic deletion of Caprin2 exon 5 that leads to the absence of Caprin2 transcripts and protein was achieved in the lenses of Caprin2cKO/cKO mutant mice.

Figure 4.2 Generation of conditional deletion Caprin2 mice. A: Structure of the Caprin2 gene locus and depiction of Caprin2 protein. The Caprin2 knockout allele carries exon 5 flanked by loxP sites (closed arrowheads). Mouse crosses with a line (Pax6GFPCre) that expresses Cre recombinase in lens cells beginning at the placode stage results in the excision of Caprin2 exon 5. This is predicted to generate an abnormal Caprin2 splice form joining exons 4 and 6, in turn leading to a frame- shift and premature stop codon. B: Reverse transcriptase polymerase chain reaction (RT-PCR) demonstrates the absence of Caprin2 mRNA in homozygous conditional deletion Caprin2cKO/cKO mouse mutant lens. C: Western blotting demonstrates the absence of Caprin2 protein in C Caprin2cKO/cKO mutant lens at P56. β-actin was used as a loading control. D,E: Immunostaining analysis at E12.5 exhibits severely reduced but detectable levels of Caprin2 in Caprin2cKO/cKO lenses. F,G: By P4 there is no detectable expression of Caprin2 protein in the mutant lens. Scale bar.70 µm in D,E. Abbreviation: e, epithelium; f, fiber cells.

71 4.2.3 Caprin2cKO/cKO Conditional Lens-Knockout Mice Exhibit Lens Defects To investigate whether Caprin2 deletion causes ocular defects in mice, phenotypic characterization of Caprin2cKO/cKO mutants was initiated. Lenses from mutant and control (Pax6GFPCre:Caprin2+/cKO) animals were imaged by bright field microscopy at various stages. Although no lens opacities or overt cataracts were detected in majority of the Caprin2cKO/cKO lenses (n=108), subtle differences near the putative cortical-nuclear boundary could be discerned in Caprin2cKO/cKO lenses (Fig. 4.3A, B) at high penetrance (65%) at age 2 months (P60) (Table 2).

Table 2. Frequency of Ocular Phenotypes in Caprin2cKO/cKO Mutants

Pax6GFPCre:Caprin2+/cKO Caprin2cKO/cKO Total No. of lenses 121 108 Normal lenses 118 34 (32%) Abnormal lensesa 3 65 (60%) Peters anomaly 0 9 (8%) aLenses were recognized as such, based on abnormalities detected near the central region under light microscopy. It should be noted that the reduced lens nucleus defect was observed in 100% of Caprin2cKO/cKO mutant lenses when analyzed by scanning electron microscopy (n=16) or WGA staining (n=8). Therefore, subtle defects may not be detected by light microscopy-based imaging, potentially leading to a higher estimate of false negatives.

Specifically, while a ring-like demarcation between the cortical and nuclear fiber cells is apparent in control lenses (Fig. 4.3A), it is absent in majority of Caprin2cKO/cKO mutant lenses (Fig. 4.3B). In order to understand this defect, histological analysis was performed on Caprin2cKO/cKO mutant and control lenses at 1 month (P30). Histological analysis suggested no fiber cell or nuclear degradation defects in mutant lenses (Fig. 4.3C-F). To further investigate this abnormality, scanning electron microscopy (SEM) was performed on control and mutant lenses at age 1 month. SEM analysis demonstrated that deep into the lens tissue, nuclear fibers were observed in controls as expected (Fig. 4.3G). However, at comparable depths into the lens, in place of nuclear

72 fibers Caprin2cKO/cKO mutant lenses exhibited cortical fiber cell morphology (Fig. 4.3G-J). This suggests that the region that forms the lens nucleus is potentially reduced in Caprin2cKO/cKO mutants. To test this possibility, mutant and control lenses at P0 were immunostained with wheat germ agglutinin (WGA) staining. WGA preferentially stains the ball and socket (now referred as membrane protrusions; while other structures in cortical fiber regions are termed as ball and sockets) regions of secondary fiber cells (Kistler et al., 1986). Hence it differentially marks the lens cortex region (which stains at higher intensity) compared to the lens nucleus region (which stains at lower intensity). WGA is a lectin molecule that preferentially binds to sialic acid and N-acetyl-D-glucosaminyl residues within cell membranes. I measured the area of nuclear fibers (reduced WGA stained) compared to the total area of the lens in control and mutants. This analysis indicates that as expected from bright field imaging and SEM data, Caprin2cKO/cKO mutant lenses exhibit a significantly reduced area of lens nucleus compared to controls (Fig. 4.4A-F). Together, these data suggest that Caprin2cKO/cKO mutants exhibit fiber cell nuclear compaction defects. F-actin deposition pattern is unaltered in Caprin2cKO/cKO mutant lenses suggesting that fiber cell architecture is maintained in these lenses (Fig. 4.4E-H).

Figure 4.4 Wheat germ agglutinin and Phalloidin staining of Caprin2cKO/cKO mutant lens. A, B: Wheat germ agglutinin (WGA) staining of control (A) and mutant (B) sections was performed to observe lens cell membranes at stage P0. The area of the nuclear fiber cells with a sharp decrease in WGA staining intensity is indicated by a dotted circle and is reduced in mutants. High magnification images of control (A’, A”) and mutant lenses (B’, B”) show that cortical fibers (cf) exhibit higher WGA staining compared with nuclear fiber (nf). C: Comparisons between the area of the nf and the area of the lens revealed that mutants have a smaller nf area corroborating the SEM results. D–G: Section (D,E) and whole (F,G) lens immunostaining with phalloidin suggests no obvious cytoskeletal defects in the Caprin2cKO/cKO lenses. Scale bar.140 mm in A, B; 45 mm in A’–B”; 140 mm in D,E; 140 mm in F,G. These data cKO/cKO demonstrate that although Caprin2 lenses do not exhibit lens opacity, they exhibit an overall reduction in the size of the lens nucleus. Abbreviations: cf, cortical fibers; nf, nuclear fibers; e, epithelium; f, fiber cells.

75 4.2.4 Caprin2cKO/cKO Lens-Knockout Mice Exhibit Features of Peters Anomaly Of the 108 Caprin2cKO/cKO mutant eyes analyzed, 8% exhibited corneal and lens opacities at variable intensities (Fig. 4.5A) (Table 2). This subset of mutant eyes also exhibited a persistent lenti-corneal stalk (Fig. 4.4B), which is commonly observed in the human developmental defect Peters anomaly. Except in the case of one mutant that exhibited this defect in both eyes, eight other Caprin2cKO/cKO mutants exhibited the lenti-corneal stalk in a unilateral manner. This phenotype suggested that Caprin2 may potentially also function in an early phase in eye development, perhaps in lens vesicle closure. To gain insights into how Caprin2 deficiency may cause an abnormal lenti-corneal stalk, I investigated Caprin2 expression in early eye development by immunostaining E10.5 wild type mouse lenses with Caprin2-specific antibody. This analysis demonstrated that Caprin2 protein is expressed in the lens at this stage (Fig. 4.4C) and exhibits higher expression in cells located in the anterior region of the lens pit near the “rim” (Fig. 4.4D-F). Interestingly, at higher magnification, Caprin2 staining in these cells appeared granular (Fig. 4.4E, F). To aid in visualization of the E10.5 lens morphology, I stained a wildtype E10.5 with Jag1. Jag1 is a notch effector and is highly expressed in the cytoplasm of E10.5 lens pit cells (Rowan et al, 2008). This expression analysis indicates that at E10.5, Caprin2 is detected specifically in cells that likely undergo dynamic changes during separation of the lens vesicle from the surface ectoderm. Thus, in addition to its function in lens fiber cells, Caprin2 may function in an early phase of eye development, as indicated by its perhaps efficient early deletion in a subset of mutants, which causes a persistent lenti-corneal stalk.

Figure 4.5 Caprin2cKO/cKO mouse mutants exhibit features of Peters anomaly. A: Images of the eye (inset, high magnification) from control and representative mild (Mutant 1) and severe (Mutant 2) cases of corneal and lens defects. White arrowheads indicate corneal opacity and asterisk denotes reflection of light. B: Darkfield imaging and histology demonstrate that Caprin2cKO/cKO mutants exhibit a lenti-corneal stalk similar to Peters anomaly at 8% penetrance (n.108 eyes for Caprin2cKO/cKO mutants; none exhibit this defect in Pax6GFPCre: Caprin2+/cKO controls, n.121 eyes). C: Immunostaining demonstrates the localization of Caprin2 protein in cells of the anterior rim of the lens pit (marked by dotted line) at stage E10.5. C0: Immunostaining with Jag1 provides better visualization of E10.5 lens pit structure. Broken line boxes in C indicate the regions shown in D, E, and F at high magnification. D: Caprin2 protein expression is low in the bottom region of the pit. E, F: However, in cells of the anterior rim region of the lens pit, Caprin2 protein is detected in a granular pattern (white arrowheads). Asterisk indicates a cell that may have originated in the epithelium. Scale bar 28 mm in C; 7 mm in D–F.

77 4.2.5 WGA Staining of Caprin2cKO/cKO Embryonic Lenses Suggests Fiber Cell Membrane Abnormalities To gain insights into the molecular basis of the lens defects in Caprin2cKO/cKO mice, various lens marker genes at mouse embryonic stages E12.5, E14.5 and E16.5 were analyzed. Specifically, Caprin2cKO/cKO mutant and control lenses were immunostained with well-characterized molecular markers of the lens, namely, Pax6, Foxe3, gamma Crystallin (Cryg), N-cadherin (N-cad) and Aquaporin-0 (Aqp0) proteins. While Pax6 and Foxe3 are transcription factors expressed in the lens epithelium, gamma crystallin and Aqp0 are markers of lens fiber cells and N-cad is a component of cell-cell junctions. There is no significant difference in the staining pattern of Pax6 and Foxe3 markers between control and Caprin2cKO/cKO mutant lenses (Fig. 4.6A-F’). Interestingly, Caprin2cKO/cKO mutant lenses exhibit higher intensity of WGA staining compared to control lenses at mouse embryonic stages E12.5, E14.5 and E16.5 (Fig. 4.6G-I’’). To study the molecular composition of fiber cells of Caprin2cKO/cKO lenses, control and Caprin2cKO/cKO mutant lenses at stages E12.5, E14.5, E16.5, P0 and P30 were immunostained with Cryg, Aqp0 and N-cad and no significant staining pattern difference between the control and the mutant lenses were observed (Fig. 4.7A-O’). These data indicate that while there are no overt defects in epithelium, differentiation or cell adhesion marker genes in Caprin2cKO/cKO mutant lenses, they exhibit abnormalities in fiber cell membrane composition that are evident in embryonic stages.

Figure 4.6 Epithelial cell marker and WGA analysis for mouse embryonic Caprin2cKO/cKO mutant lens. A–C0: Wheat germ agglutinin (WGA) staining reveals higher intensity staining (asterisk) in Caprin2cKO/cKO mutant lenses compared with control lenses at E12.5 (A, A’), at E14.5 (B, B’), and at E16.5 (C, C’). D–F’: Immunostaining with Pax6-specific antibody reveals no change between control and Caprin2cKO/cKO mutant lens at E12.5 (D, D’), at E14.5 (E, E’), and at E16.5 (F, F’). G–I’: Immunostaining with Foxe3-specific antibody reveals no change between control (Pax6GFPCre: Caprin2+/cKO) and Caprin2cKO/cKO mutants at E12.5 (G, G’), at E14.5 (H, H’), and at E16.5 (I, I’). Abbreviations: e, epithelium; f, fiber cells; r, retina. Scale bar 70 mm.

Figure 4.7 Fiber cell marker analysis Caprin2cKO/cKO mouse mutant lens. A–E’: Immunostaining with Crystallin gamma (Cryg) specific antibody reveals no change between control (Pax6GFPCre: Caprin2+/cKO) and Caprin2cKO/cKO mutants at E12.5 (A, A’), at E14.5 (B, B’), at E16.5 (C, C’), at P0 (D, D’), and at P30 (E, E’). F–J’: Immunostaining with Aquaporin 0 (Aqp0) specific antibody reveals no change between control (Pax6GFPCre: Caprin2+/cKO) and Caprin2cKO/cKO mutants at E12.5 (F, F’), at E14.5 (G, G’), at E16.5 (H, H’), at P0 (I, I’), and at P30 (J, J’). K– O’: Immunostaining with N-cadherin (N-cad) specific antibody reveals no change between control (Pax6GFPCre: Caprin2+/cKO) and Caprin2cKO/cKO mutants at E12.5 (K, K’), at E14.5 (L, L’), at E16.5 (M, M’), at P0 (N, N’), and at P30 (O, O’).

80 4.2.6 Caprin1 expression is unaltered in the Caprin2cKO/cKO lenses Since Caprin2cKO/cKO mutant lenses exhibit variable phenotypes out of which the extreme phenotype of Peters anomaly is not 100% penetrant, I hypothesized that the loss of Caprin2 is compensated by its paralog Caprin1. Caprin1 is a RNA granule protein and contains RGG boxes and basic helix domains like Caprin2 (Shiina and Tokunaga, 2010). Microarray on lens tissue at various embryonic and postnatal developmental stages suggests that Caprin1 is highly expressed in the lens, however on comparison with its expression in the whole body, it is not lens enriched (Fig. 4.8A-B). There is no significant difference in the expression levels of RNA or protein nor does the protein localization change of Caprin1 in control and Caprin2cKO/cKO mutant lenses (Fig. 4.8C-J). Caprin1 protein is highly expressed in E12.5 and it consequently reduces significantly. These data show that while the high expression of Caprin1 during early embryonic stages might compensate for the absence of Caprin2, Caprin2 does not alter the expression of Caprin1 in mouse lenses.

Figure 4.8 Analysis of Caprin1 expression in mouse lens development and Caprin2cKO/cKO mutants. A: iSyTE indicates that Caprin1 does not exhibit lens-enriched expression. B: Analysis of mouse lens microarrays at developmental stages ranging from E10.5 to P56 indicates that Caprin1 is expressed in the mouse lens. C: Although expressed in the lens, Caprin1 is not lens enriched as demonstrated by fold-change comparison of the microarray probe signal binding intensity of Caprin1 to embryonic whole body (WB) in microarray datasets. D: RT-PCR analysis of Caprin1 in control and Caprin2cKO/cKO mutant lenses suggest no significant alteration in Caprin1 mRNA expression. E: Western blot analysis indicates no significant difference in Caprin1 protein expression in control and Caprin2cKO/cKO mutant lenses. F–H: Immunostaining of wild type lens demonstrates high Caprin1 protein expression in lens pit cells (F), including the anterior rim regions (G, H). Broken line box in F indicates the area that is highlighted in G, H. I–N: Immunostaining with Caprin1-specific antibody reveals no significant difference in control and mutant lenses in E12.5 (I, J), E14.5 (K, L), and E16.5 (M, N).

82 4.3 Discussion In this study, I have applied iSyTE to identify a second RNA binding protein and RNA granule component Caprin2 to be a highly enriched in the lens. Our findings that Caprin2 exhibits highly enriched expression in mouse fiber cells beyond the lens pit stage in lens development is in agreement with a previous report that analyzed its expression in chicken and mouse lenses (Lorén et al., 2009). However, in the previous study Caprin2 expression was not detected in the lens prior to stage E11.5 (Lorén et al., 2009), while our current analysis demonstrates that Caprin2 exhibits a unique expression pattern at stage E10.5, being localized to granules that are around 0.7 µm in diameter, specifically in cells located at the anterior rim of the lens pit. The difference in these findings may be due to the use of different Caprin2-specific antibodies in these studies. Interestingly, both studies demonstrate that as lens development progresses, Caprin2 expression is restricted to fiber cells and is undetected in the anterior epithelium. This staining pattern – from being initially restricted to cells of the apical rim of lens pit to highly enriched expression in fiber cells – suggests that Caprin2 may have distinct functions in different stages of lens development.

4.3.1 Distinct Ocular Defects in Caprin2 Mutants To investigate its function in lens development, I generated conditional knockout Caprin2cKO/cKO mice and characterized these mutants to uncover two distinct ocular defects at variable penetrance: 1) a reduced lens nucleus region, and 2) presence of lenti-corneal stalk. At embryonic stages, Caprin2cKO/cKO lenses stain with WGA at higher intensity compared to control. Interestingly, higher intensity WGA staining of fiber cells is

83 observed in cataractous lenses, albeit in aged lenses (Kistler et al., 1986). As WGA is known to recognize sugar moieties within membranes, the above result is suggestive of an alteration in membrane composition in Caprin2cKO/cKO embryonic lens fiber cells. Moreover, WGA is described to stain “ball and socket” junctions (referred to as “membrane protrusions” in recent reports), which are features of cortical fiber cells (Bassnett et al., 2011; Kistler et al., 1986; Scheiblin et al., 2014). Thus, these findings also suggest a pre-mature cortical-fiber cell characteristic that is acquired during embryonic development by these cells, which contribute to the lens nucleus in later stages. Nevertheless, these data suggest that although fiber cell differentiation appears to be unperturbed in Caprin2cKO/cKO lenses as suggested by normal staining of gamma Crystallins, these mutant lenses exhibit an alteration in fiber cell membrane composition, indicating that Caprin2 is important for acquiring the full characteristics of fiber cells. This alteration in fiber cell biology likely contributes to a reduction in the size of the lens nucleus, which is detected by both WGA staining and SEM analyses in post-natal stages in Caprin2cKO/cKO mutants. Reduction in the lens nucleus, termed as “nuclear compaction”, occurs in human lenses as a process of aging (Augusteyn, 2010) and is associated with human age-related lamellar cataracts as well as to the loss of accommodative capability (al- Ghoul and Costello, 1996, 1996; Al-Ghoul et al., 2001b; Augusteyn, 2010; Costello et al., 2013; Dubbelman et al., 2003; Michael and Bron, 2011). However, Caprin2cKO/cKO mutants do not exhibit cataracts even in mice tested at age 6 months. Interestingly, a similar reduction of the lens nucleus is observed in Bfsp2 (CP49) knockout lenses (Fudge et al., 2011b). However, the lens nucleus reduction in Bfsp2 (CP49) knockout lenses and Caprin2cKO/cKO mutant lenses may have different

84 underlying molecular mechanisms of pathogenesis. This is because while the fiber cell ultrastructure is severely disrupted in Bfsp2 (CP49) knockout lenses (Fudge et al., 2011), SEM analysis demonstrates that the fiber cell ultrastructure appears normal in Caprin2cKO/cKO lenses. These analyses were performed on animals in which the naturally occurring Bfsp2 (CP49) mutation contributed by the FVB/N background was confirmed to be absent (see Experimental Procedures for details), and I further validated by RT-PCR that Bfsp2 (CP49) expression was unaltered in control and mutant lenses (data not shown). It will be intriguing to investigate the full implication of the reduced lens nucleus defect and its underlying molecular pathogenic mechanism in Caprin2cKO/cKO lenses in future studies. In addition to the above phenotype, a subset of Caprin2cKO/cKO mutants exhibit a lenti-corneal stalk, which is observed in a human ocular developmental defect termed Peters anomaly (Bhandari et al., 2011; Reis and Semina, 2011b). Mutations or functional compromise in several genes have been linked to Peters anomaly in humans and mice. These are B3GLCT (B3GALTL), Cdh1 and Cdh2 (E- and N-Cadherin), Cdo, Cited2, COL4A1, CYP1B1, Fgfr, FLNA, FOXC1, FOXE3, HCCS, Msx2, c-Myc, NDP, PAX6, PITX2, PITX3, Pxdn, RIEG1, Shroom3, SLC4A11, Sox11, Spry1, Spry2, TFAP2A (AP2α), Zeb2 (Sip1) (Blixt et al., 2000b; Brownell et al., 2000; Cavalheiro et al., 2014; Chen et al., 2008; Collinson et al., 2001; Deml et al., 2014; Dimanlig et al., 2001; Doward et al., 1999; Favor et al., 1997; Hanson et al., 1994; Hill et al., 1991; Honkanen et al., 2003; Kuracha et al., 2011; Lang et al., 2014b; Medina-Martinez et al., 2005; Okajima et al., 1999; Ormestad et al., 2002a; Ozeki et al., 2001; Pontoriero et al., 2008b, 2009b; Reis et al., 2008; Reneker et al., 2000; Rieger et al., 2001; Saika et al., 2001; Vincent et al., 2001; Weh et al., 2014; Wurm et al., 2008; Yan et al.,

85 2014; Yoshimoto et al., 2005; Zhang et al., 2009; Zhao et al., 2012). It is interesting to note that Caprin2 protein is expressed in cells located at the anterior rim region of the lens pit at E10.5. During the process of lens vesicle separation, these opposing cells of the anterior rim of the lens pit have to come close together and form adherens junctions with each other. Thus, this process involves the dissolution of existing contacts with old cell neighbors and the initiation of new contacts with prospective cell neighbors. It can be speculated that recruitment of Caprin2 in these cells may be reflective of its function in facilitating lens vesicle closure and separation and therefore, absence of Caprin2 leads to persistence of a lenti-corneal stalk. This is discussed further in the following section.

4.3.2 Caprin2, Granules, and Signaling: A Speculation Previously, Fgf signaling has been shown to induce Caprin2 expression in chicken lens explant tissue culture (Lorén et al., 2009). Thus, it is possible that Fgf signaling may be involved in modulating Caprin2 function in early and/or later phases of mouse lens development. Although Fgfr1 and Fgfr2 conditional double knockout mouse mutants indicate that Fgf signaling is not required for lens induction, lens development in these mutants is arrested at an early stage, with no lens tissue detected at stage E12.5 (Garcia et al., 2011b). Therefore, from these studies, it is not possible to interpret the full significance of Fgf signaling in separation of the lens vesicle from the surface ectoderm. Interestingly, downstream targets of Fgfr signaling Spry1 and Spry2, which are involved in its negative feedback regulation, when deleted in mice individually or together, lead to formation of a lenti-corneal stalk (Kuracha et al., 2011). Spry1 and 2 negatively modulate Fgfr signaling by antagonizing other Fgfr downstream targets, such as Ras-Raf-ERK (Hanafusa et al., 2002). Interestingly,

86 Spry1 and Spry2 conditional double knockout mice exhibit ectopic expression of pERK and p63 in cells of the anterior margins of the lens pit, which are likely the same cells in which Caprin2 granules are enriched. These findings indicate that in the early phase of lens development, deletion of three targets of Fgfr signaling, Spry1, Spry2 (Kuracha et al., 2011) and Caprin2 result in a lenti-corneal stalk. Thus, future studies can be aimed toward addressing the function of Caprin2 granules in these early events in lens development. Previously, Caprin granules have been implicated in post-transcriptional regulation by inhibition of protein translation from specific transcripts, a function that is conserved in Drosophila and human (Papoulas et al., 2010; Shiina and Tokunaga, 2010b). It can be speculated that Caprin2 is involved in localized control of expression of specific proteins in the anterior rim of the lens pit. It will be interesting to test expression of markers such as pERK and p63 in Caprin2 knockout mutants that exhibit a lenti- corneal stalk, and conversely testing Caprin2 expression in Spry1 and Spry2 mutant lenses in future studies. As discussed above, extensive re-arrangements of cell-cell contacts need to take place during lens vesicle separation from the surface ectoderm. Not surprisingly, the cell adhesion molecules E-cadherin and N-cadherin, when deleted together in mouse mutant lenses lead to a lens vesicle separation defect and the presence of an abnormal lenti-corneal stalk (Pontoriero et al., 2009b). Cadherin proteins interact with β-catenin at adherens junctions and function to provide a connection between the actin cytoskeleton and the extracellular environment (Perez-Moreno and Fuchs, 2006). Expectedly, the E-cadherin/N-cadherin lens-knockout double mutants exhibit a defect in β-catenin expression in the lens (Pontoriero et al., 2009b) suggesting a connection

87 with Wnt signaling. Interestingly, Caprin2 has been shown to interact with and regulate phosphorylation of LRP5/6 (low-density lipoprotein receptor-related protein 5 and 6) receptors via GSK3 activity, resulting in activation of Wnt signaling and accumulation of cytosolic β-catenin (Ding et al., 2008). Thus, we speculated that Caprin2 potentially functions in lens vesicle closure and separation by mediating distinct signaling pathways. Finally, recent research findings have identified new connections of Caprin2 to lens biology. For example, Caprin2 and Tdrd7 have been identified as specific targets of Calpain-mediated protein fragmentation in ubiquitin (K6W-Ub) mutant transgenic mice, which develop cataracts (Liu et al., 2015). Moreover, microarrays on Hsf4 knockout lenses at P0 identify Caprin2 among the significantly down-regulated genes (data not shown), as do microarrays on transgenic mouse lenses at P2 that support ectopic mis-expression of Foxe3 in fiber cells (Landgren et al., 2008). Together, these data suggest that diverse control mechanisms have evolved to regulate Caprin2 expression in the lens.

4.3.3 Low Penetrance of the Lens-Cornea Stalk Phenotype It can be speculated that the low penetrance of the lenti-corneal stalk phenotype in Caprin2cKO/cKO mutants is due to the high lens expression of a Caprin2 paralog called Caprin1 as revealed by Western blot analysis. Caprin1 and Caprin2 share conserved regions such as RGG and basic helix domains that are essential for their function (Shiina and Tokunaga, 2010a; Solomon et al., 2007). Moreover, analysis of iSyTE indicates high-level expression of Caprin1 in the lens, especially in the early developmental stages at E10.5, when Caprin2 expression is still low, and thus may compensate for the loss of Caprin2. In later stages, Caprin2 expression in

88 the lens is higher compared to Caprin1. Finally, residual Caprin2 protein that may be expressed in Caprin2cKO/cKO mutants prior to Cre-mediated recombination may still be present at E10.5, further contributing to the low penetrance of the phenotype. Low penetrance of Peters anomaly could be because Caprin2cKO/cKO mice were maintained on a mixed background of FVB/N and C57/Bl6. Further, to generate Caprin2cKO/cKO mouse mutants Pax6GFPCre transgenic animals were used (Aota et al., 2003; Pinson et al., 2006). Because mutations in PAX6 have been linked to Peters anomaly in humans and mice (Hanson et al., 1994), Pax6GFPCre background in Caprin2cKO/cKO mouse mutants could sensitize the mutants – by sequestering Pax6 protein to the transgene Pax6 enhancer – to exhibit the Peters anomaly phenotype.

4.3.4 Conclusion In summary, these findings provide new insights into the function of a second RNA binding protein / RNA granule component in mammalian eye development by demonstrating that Caprin2 deficiency causes distinct defects such as reduction in the size of the lens nucleus and presence of a stalk between the lens and the cornea. Finally, besides Bfsp2, Caprin2 is identified here as a second candidate gene implied in nuclear compaction in the mammalian lens.

89 Chapter 5

DISCUSSION AND FUTURE DIRECTIONS

The conserved RNA-binding proteins, Rbm24 and Caprin2, regulate their target genes through various mechanisms in many different cell and tissue types. In this dissertation, I provide new evidence for the function of these RBPs in eye development. I demonstrated that Rbm24 positively regulates Sox2 mRNA stability by binding to AU-rich elements in its 3’UTR. Further, I showed that Sox2 downregulation contributes to the anophthalmia and microphthalmia eye defects in Rbm24-/- mice. I also showed that Rbm24 over-expression in different cell types is sufficient to up-regulate several pluripotency transcription factor genes. In this chapter, I propose the directions that would build on these findings and reveal as yet unresolved functions of Rbm24 in eye development and pluripotency. Further, the experiments proposed here will also help elucidate the basis for the low penetrance of the Peters anomaly defect and mild nature of the lens defect observed in Caprin2cKO/cKO mice.

5.1 Genome-Level Identification of Rbm24-Target Genes in the Eye Using a candidate gene approach, my work identified Sox2, Lhx2 and Jag1 to be downregulated in Rbm24-/- whole body tissue at E7.5 and in eye tissue at E14.5. However, to comprehensively identify the genes that are differentially regulated in the Rbm24-/- ocular tissue, a high-throughput RNA-sequencing (RNA-seq) must be performed. Because microphthalmia and anophthalmia phenotypes are observed at

90 E10.5 in Rbm24-/- mice, RNA-seq must be performed on E9.5 ocular tissue when it consists of lens placode and optic vesicle. Alternately, laser capture microdissection (LCM) can be used to specifically collect sub-ocular component tissues such as lens placode, lens pit, optic vesicle and optic cup from the eye region of the embryos as described previously (Huang et al., 2011, 2015; Wolf et al., 2013a). This will allow the identification of genes mis-regulated in specific Rbm24-/- ocular tissue prior to the onset of the anophthalmia and microphthalmia phenotype, thereby identifying genes that are directly or indirectly under the regulation of Rbm24.

5.2 Genome-Level Identification of Direct RNA Targets of Rbm24 Protein My dissertation reports the use of RIP-RT-qPCR assays to investigate the Rbm24 protein-RNA interaction for a subset of the Rbm24-targets that were identified using a candidate gene approach. This approach led to the identification of several potential direct binding targets of Rbm24 in the eye such as Sox2, Lhx2 and Itgb1(Fig 3.10 and 5.1). To further expand our knowledge on the direct targets of Rbm24 in the eye on the genome-level, CLIP (cross-linked immunoprecipitation) combined with high-throughput RNA-sequencing (CLIP-seq) of the Rbm24-pulldown RNA needs to be performed. Integration of Rbm24 regulated genes (from RNA-seq experiments discussed in the previous section) with the direct targets of Rbm24 (discussed in this section) will allow the definition of the Rbm24-mediated post-transcriptional gene regulatory network in the eye. Further integration of this network with the gene regulatory networks of other RNA-binding proteins (Tdrd7 and Celf1) that function in the eye will provide a detailed understanding of the extent of the post-transcriptional regulatory cross-talk in eye development. In addition, incorporation of these networks

91 to the known gene regulatory network of the developing lens and retina will lead to the definition of a comprehensive gene regulatory network of the eye during development and lead to the definition of the “developmental oculome” (Lachke and Maas 2010).

5.3 Identification of Alternatively Spliced Transcripts in Rbm24-/- Ocular Tissue Rbm24 has been shown to bind directly to specific pre-mRNAs and control their alternative splicing fates in the striated muscle tissues of Zebrafish, Xenopus and Mouse (Maragh et al., 2014; Poon et al., 2012; Yang et al., 2014; Zhang et al., 2016b). While this dissertation has addressed Rbm24 function in one aspect of post- transcriptional control (i.e. Sox2 mRNA stability), it has not addressed if Rbm24 has any function in alternative splicing in eye development. To identify potential Rbm24- mediated alternative splicing events in ocular tissue, as a first step, a high-throughput RNA-sequencing must be performed on wild-type and Rbm24-/- mouse ocular tissue and analyzed to identify differentially expressed spliced isoforms that arise due to Rbm24 deficiency. This will suggest that Rbm24 functions to control alternative splicing in ocular development. Depending on the target transcripts identified, specific molecular experiments to test the direct nature and involvement of Rbm24 in this process can be designed. These approaches will provide new insights into the post- transcriptional regulatory function of Rbm24 in the eye.

93 5.4 Understanding the Mechanism and Outcome of Rbm24-Mediated Induction of Pluripotency Factors in Differentiated Cells I have found that Rbm24 overexpression results in the upregulation of the cellular reprogramming transcription factors Sox2, Klf4, Oct4, Nanog and c-Myc in various cell lines (Fig 3.11). This finding suggests that Rbm24 positively regulates the expression of these reprogramming factors and therefore represents a significant advance in the grossly understudied area of post-transcriptional control of gene expression in cellular reprogramming and pluripotency. Future studies should investigate whether Rbm24 ectopic expression in differentiated cells induces them to become pluripotent. This can be done as follows: differentiated cell lines overexpressing Rbm24 can be cultured in induced pluripotent stem cell (iPS) conducive conditions with appropriate media and growth factors and on a feeder cell layer. These induced cells can be investigated for markers of pluripotency such as alkaline phosphatase, SSEA1, Sox2, Oct4, Klf4 and c-Myc. Further, these cells can be transplanted to the liver of a nude mouse to analyze differentiation of developed tumors into all three germ layers (Takahashi and Yamanaka, 2006; Takahashi et al., 2007). These approaches will elucidate the function of a second RNA-binding protein apart from Lin28 in inducing pluripotency (Zhang et al., 2016a). Further, the mechanism of how Rbm24 controls the transcription factors Oct4, Klf4, c-Myc and Nanog should be further investigated by molecular approaches that test direct binding by RIP, CLIP and EMSA, reporter analysis to test for mRNA stability and alternative splicing, among others.

5.5 Rbm24 Mediated Regulation of Lhx2 and Pax6 I find that Lhx2 is downregulated at both mRNA and protein levels in Rbm24-/- ocular tissue. Interestingly, Lhx2 is a direct target of Rbm24 as indicated by RIP assay.

94 However, the mechanism of Rbm24-mediated regulation of Lhx2 expression is not clear. The possible mechanisms of Lhx2 regulation are mRNA stability and indirect control via regulation of an upstream regulator of Lhx2. However, Lhx2 mRNA does not contain AU-rich elements in its 3’UTR that Rbm24 may bind to and regulate its stability. Hence, Rbm24 must control the expression of an upstream regulator of Lhx2, which needs to be identified. Alternately Rbm24 may bind to Lhx2 mRNA through a different consensus motif such as GUG rich regions in its exon-intron junctions to regulate its alternative splicing or to its coding sequence to regulates its degradation. While Pax6 expression is unaltered in Rbm24-/- optic cup, its expression is severely reduced in the Rbm24-/- head surface ectoderm region that in wildtype mice would be specified to the lens lineage. This suggests that Pax6 is specifically downregulated in the lens in Rbm24-/- ocular tissue. In future experiments, the expression of upstream regulators of Pax6 during lens placode development such as Six3 must be investigated.

5.6 Tissue Specific Requirement of Rbm24 in the Eye To evaluate the function of Rbm24 in the lens, I generated lens-specific conditional deletion mouse mutants of Rbm24. Rbm24cko/cko was generated by breeding Rbm24flox/flox mice with Pax6GFPCre mice wherein Cre recombinase is driven by Pax6-P0 promoter that is active at E8.75 in the presumptive lens ectoderm. Surprisingly, in my initial analysis, I did not detect lens or any other obvious eye defects in Rbm24cko/cko mice. Scanning electron microscopy performed on 6-month old Rbm24cko/cko lenses reveal no defects in fiber cell architecture (Fig. 5.2). This may suggest that Rbm24 is required during early eye development and during later developmental stages other Rbm family of proteins such as Rbm20 and Rbm38

95 compensate for the loss of Rbm24. Therefore, deletion of Rbm24 in the optic vesicle using Rax-CreERT2 mice would reveal the function of Rbm24 in early stages of eye development. However, Rbm24cko/cko lenses should be investigated in more detail to determine whether Rbm24 knockout was efficient in these animals, which may offer explanations on these observations.

5.7 Redundancy in Function of Rbm Family of Proteins During Development Rbm family members that contain a single RRM domain function cooperatively during development. For example, Rbm20 and Rbm24 synergistically regulate alternative splicing of Enh1, a PDZ-LIM protein required for heart development (Ito et al., 2016). Further, Rbm24 and Rbm38 share several targets including p21 and p63 (Jiang et al., 2014; Xu et al., 2014; Zhang et al., 2016b). To understand the interaction of Rbm family member proteins in eye development, various combinations of double and triple knockout mouse mutants of Rbm20, Rbm24 and Rbm38 can be generated and characterized in future. Further, these approaches will provide an insight to the functional redundancy of Rbm family of proteins during development and morphogenesis.

5.8 Functional Significance of Alanine-rich Regions in Rbm24 Rbm24 protein consists of two conserved alanine rich regions consisting of 11- 13 alanine residues each near its C-terminus, whose function is as yet unknown. In zebrafish, while one of the orthologs (rbm24a) contains the alanine rich regions, the other (rbm24b) does not. Interestingly, the zebrafish ortholog expressed strongly in eye development is rbm24a, and the mouse Rbm24 also has the alanine-rich regions, in turn, suggesting that these alanine-rich regions may be important for Rbm24

96 function in eye development. To further investigate its function, mouse mutants with various truncated forms of Rbm24 protein can be generated and characterized. Further, differentially regulated genes can be identified in various cell lines transfected with plasmids containing different truncated Rbm24 isoforms to understand their molecular impact.

100 5.9 Functional Characterization of Caprin2 in the Lens Caprin2cKO/cKO mice exhibit a mild 100% penetrant nuclear compaction defect and a severe 8% penetrant Peters anomaly defect. I speculated that the low penetrance of features of Peters Anomaly in Caprin2cKO/cKO mouse could be due to presence of residual protein in Caprin2cKO/cKO lenses at E12.5. To address this hypothesis, constitutive targeted deletion Caprin2 mouse mutants (Caprin2-/-) were generated (Nathaniel Borders Undergraduate thesis). However, these mouse mutants do not exhibit a lenti-corneal stalk defect or nuclear compaction defect unlike Caprin2cKO/cKO mouse mutants (Fig. 5.3). This could be because Caprin2-/- mice were maintained on C57/Bl6 background while Caprin2cKO/cKO mice were maintained on a mixed background of FVB/N and C57/Bl6. Further, to generate Caprin2cKO/cKO mouse mutants Pax6GFPCre transgenic animals were used where Cre recombinase is driven by the Pax6 P03.9 promoter upstream region that contains the conserved ectodermal enhancer, which is known to support Pax6 auto-regulation (Aota et al., 2003; Pinson et al., 2006). Because mutations in PAX6 have been linked to Peters anomaly in humans and mice (Hanson et al., 1994), Pax6GFPCre background in Caprin2cKO/cKO mouse mutants could sensitize the mutants – by sequestering Pax6 protein to the transgene Pax6 enhancer – to exhibit the Peters anomaly phenotype. To test this hypothesis, Caprin2-/- mice can be crossed with Pax6+/Sey mice and Caprin2-/-; Pax6+/Sey mouse mutants can be characterized.

Interestingly, Caprin1 protein is upregulated in E14.5 Caprin2-/- mouse lenses, which is not observed in Caprin2cKO/cKO mouse lenses (Fig. 5.4). This may be due to the differences in the timing/specific of Caprin2 deletion in development (germline deletion vs. lens deletion). Although this preliminary data is promising to offer an explanation for the mitigation of the phenotype in germline Caprin2 null mice, the

101 molecular interaction between Caprin1 and Caprin2 has yet to be elucidated. Further, expression of Caprin1 in Caprin2-/- mouse lenses at several different developmental stages also needs to be evaluated. Finally, generation of double knockout mouse for the genes Caprin1 and Caprin2 may elucidate any potential genetic interactions between Caprin1 and Caprin2, especially if Caprin1 compensates for the loss of Caprin2 in Caprin2-/- mouse. These experiments will help further elucidate the function of these Caprin-family proteins in eye development. While transcription and signaling factors required for eye development are well understood, the function of RNA-binding proteins is understudied. This work sheds light on the post-transcriptional regulation of gene expression required during early eye development and later lens development. Further, we have gained insights into the control of key transcription factors and pluripotency-inducing factors by RNA-binding proteins.

102 REFERENCES

Abouzeid, H., Youssef, M.A., Bayoumi, N., ElShakankiri, N., Marzouk, I., Hauser, P., and Schorderet, D.F. (2012). RAX and anophthalmia in humans: evidence of brain anomalies. Mol. Vis. 18, 1449–1456.

Aerbajinai, W., Lee, Y.T., Wojda, U., Barr, V.A., and Miller, J.L. (2004). Cloning and characterization of a gene expressed during terminal differentiation that encodes a novel inhibitor of growth. J. Biol. Chem. 279, 1916–1921.

Agrawal, S.A., Anand, D., Siddam, A.D., Kakrana, A., Dash, S., Scheiblin, D.A., Dang, C.A., Terrell, A.M., Waters, S.M., Singh, A., et al. (2015). Compound mouse mutants of bZIP transcription factors Mafg and Mafk reveal a regulatory network of non-crystallin genes associated with cataract. Hum. Genet. 134, 717–735.

Aldahmesh, M.A., Khan, A.O., Hijazi, H., and Alkuraya, F.S. (2013). Mutations in ALDH1A3 cause microphthalmia. Clin. Genet. 84, 128–131. al-Ghoul, K.J., and Costello, M.J. (1996). Fiber cell morphology and cytoplasmic texture in cataractous and normal human lens nuclei. Curr. Eye Res. 15, 533–542.

Al-Ghoul, K.J., Nordgren, R.K., Kuszak, A.J., Freel, C.D., Costello, M.J., and Kuszak, J.R. (2001a). Structural evidence of human nuclear fiber compaction as a function of ageing and cataractogenesis. Exp. Eye Res. 72, 199–214.

Al-Ghoul, K.J., Nordgren, R.K., Kuszak, A.J., Freel, C.D., Costello, M.J., and Kuszak, J.R. (2001b). Structural evidence of human nuclear fiber compaction as a function of ageing and cataractogenesis. Exp. Eye Res. 72, 199–214.

Amato, M.A., Boy, S., and Perron, M. (2004). Hedgehog signaling in vertebrate eye development: a growing puzzle. Cellular and Molecular Life Sciences 61, 899–910.

Anand, D., Agrawal, S., Siddam, A., Motohashi, H., Yamamoto, M., and Lachke, S.A. (2015). An integrative approach to analyze microarray datasets for prioritization of genes relevant to lens biology and disease. Genom Data 5, 223–227.

Anderson, P. (2010). Post-transcriptional regulons coordinate the initiation and resolution of inflammation. Nat. Rev. Immunol. 10, 24–35.

103 Aota, S., Nakajima, N., Sakamoto, R., Watanabe, S., Ibaraki, N., and Okazaki, K. (2003). Pax6 autoregulation mediated by direct interaction of Pax6 protein with the head surface ectoderm-specific enhancer of the mouse Pax6 gene. Dev. Biol. 257, 1– 13.

Ashery-Padan, R., Marquardt, T., Zhou, X., and Gruss, P. (2000). Pax6 activity in the lens primordium is required for lens formation and for correct placement of a single retina in the eye. Genes Dev 14, 2701–2711.

Atkinson-Leadbeater, K., Hehr, C.L., and Mcfarlane, S. (2014). Fgfr signaling is required as the early eye field forms to promote later patterning and morphogenesis of the eye. Dev. Dyn. 243, 663–675.

Audette, D.S., Anand, D., So, T., Rubenstein, T.B., Lachke, S.A., Lovicu, F.J., and Duncan, M.K. (2015). Prox1 and fibroblast growth factor receptors form a novel regulatory loop controlling lens fiber differentiation and gene expression. Development.

Augusteyn, R.C. (2010). On the growth and internal structure of the human lens. Exp. Eye Res. 90, 643–654.

Avilion, A.A., Nicolis, S.K., Pevny, L.H., Perez, L., Vivian, N., and Lovell-Badge, R. (2003). Multipotent cell lineages in early mouse development depend on SOX2 function. Genes Dev. 17, 126–140.

Bakrania, P., Efthymiou, M., Klein, J.C., Salt, A., Bunyan, D.J., Wyatt, A., Ponting, C.P., Martin, A., Williams, S., Lindley, V., et al. (2008). Mutations in BMP4 Cause Eye, Brain, and Digit Developmental Anomalies: Overlap between the BMP4 and Hedgehog Signaling Pathways. Am J Hum Genet 82, 304–319.

Bassnett, S., Wilmarth, P.A., and David, L.L. (2009). The membrane proteome of the mouse lens fiber cell. Mol. Vis. 15, 2448–2463.

Bassnett, S., Shi, Y., and Vrensen, G.F.J.M. (2011). Biological glass: structural determinants of eye lens transparency. Philos. Trans. R. Soc. Lond., B, Biol. Sci. 366, 1250–1264.

Bäumer, N., Marquardt, T., Stoykova, A., Spieler, D., Treichel, D., Ashery-Padan, R., and Gruss, P. (2003). Retinal pigmented epithelium determination requires the redundant activities of Pax2 and Pax6. Development 130, 2903–2915.

Beebe, D.C., and Piatigorsky, J. (1981). Translational regulation of delta-crystallin synthesis during lens development in the chicken embryo. Dev. Biol. 84, 96–101.

104 Behesti, H., Holt, J.K.L., and Sowden, J.C. (2006). The level of BMP4 signaling is critical for the regulation of distinct T-box gene expression domains and growth along the dorso-ventral axis of the optic cup. BMC Dev. Biol. 6, 62.

Bhandari, R., Ferri, S., Whittaker, B., Liu, M., and Lazzaro, D.R. (2011). Peters anomaly: review of the literature. Cornea 30, 939–944.

Blixt, A., Mahlapuu, M., Aitola, M., Pelto-Huikko, M., Enerbäck, S., and Carlsson, P. (2000a). A forkhead gene, FoxE3, is essential for lens epithelial proliferation and closure of the lens vesicle. Genes Dev. 14, 245–254.

Blixt, A., Mahlapuu, M., Aitola, M., Pelto-Huikko, M., Enerbäck, S., and Carlsson, P. (2000b). A forkhead gene, FoxE3, is essential for lens epithelial proliferation and closure of the lens vesicle. Genes Dev. 14, 245–254.

Bookout, A.L., and Mangelsdorf, D.J. (2003). Quantitative real-time PCR protocol for analysis of nuclear receptor signaling pathways. Nucl Recept Signal 1, e012.

Brady, J.P., Garland, D., Duglas-Tabor, Y., Robison, W.G., Groome, A., and Wawrousek, E.F. (1997). Targeted disruption of the mouse αA-crystallin gene induces cataract and cytoplasmic inclusion bodies containing the small heat shock protein αB- crystallin. Proc Natl Acad Sci U S A 94, 884–889.

Brownell, I., Dirksen, M., and Jamrich, M. (2000). Forkhead Foxe3 maps to the dysgenetic lens locus and is critical in lens development and differentiation. Genesis 27, 81–93.

Cai, Z., Tao, C., Li, H., Ladher, R., Gotoh, N., Feng, G.-S., Wang, F., and Zhang, X. (2013). Deficient FGF signaling causes optic nerve dysgenesis and ocular coloboma. Development 140, 2711–2723.

Carpenter, A.C., Smith, A.N., Wagner, H., Cohen-Tayar, Y., Rao, S., Wallace, V., Ashery-Padan, R., and Lang, R.A. (2015). Wnt ligands from the embryonic surface ectoderm regulate ‘bimetallic strip’ optic cup morphogenesis in mouse. Development 142, 972–982.

Cavalheiro, G.R., Matos-Rodrigues, G.E., Gomes, A.L., Rodrigues, P.M.G., and Martins, R.A.P. (2014). c-Myc regulates cell proliferation during lens development. PLoS ONE 9, e87182.

Cenedella, R.J. (1995). Role of transcription, translation, and protein turnover in controlling the distribution of 3-hydroxy-3-methylglutaryl coenzyme A reductase in the lens. Invest. Ophthalmol. Vis. Sci. 36, 2133–2141.

105 Chamberlain, C.G., and McAvoy, J.W. (1987). Evidence that fibroblast growth factor promotes lens fibre differentiation. Curr. Eye Res. 6, 1165–1169.

Chen, S., Li, X., Lu, D., Xu, Y., Mou, W., Wang, L., Chen, Y., Liu, Y., Li, X., Li, L.- Y., et al. (2014). SOX2 regulates apoptosis through MAP4K4-survivin signaling pathway in human lung cancer cells. Carcinogenesis 35, 613–623.

Chen, Y., Doughman, Y., Gu, S., Jarrell, A., Aota, S., Cvekl, A., Watanabe, M., Dunwoodie, S.L., Johnson, R.S., van Heyningen, V., et al. (2008). Cited2 is required for the proper formation of the hyaloid vasculature and for lens morphogenesis. Development 135, 2939–2948.

Chiang, C., Litingtung, Y., Lee, E., Young, K.E., Corden, J.L., Westphal, H., and Beachy, P.A. (1996). Cyclopia and defective axial patterning in mice lacking Sonic hedgehog gene function. Nature 383, 407–413.

Chograni, M., Derouiche, K., Chaabouni, M., Lariani, I., and Bouhamed, H.C. (2014). Molecular analysis of the PAX6 gene for aniridia and congenital cataracts in Tunisian families. Human Genome Variation 1, 14008.

Chow, R.L., Altmann, C.R., Lang, R.A., and Hemmati-Brivanlou, A. (1999). Pax6 induces ectopic eyes in a vertebrate. Development 126, 4213–4222.

Churchill, A., and Graw, J. (2011). Clinical and experimental advances in congenital and paediatric cataracts. Philos Trans R Soc Lond B Biol Sci 366, 1234–1249.

Collignon, J., Sockanathan, S., Hacker, A., Cohen-Tannoudji, M., Norris, D., Rastan, S., Stevanovic, M., Goodfellow, P.N., and Lovell-Badge, R. (1996). A comparison of the properties of Sox-3 with Sry and two related genes, Sox-1 and Sox-2. Development 122, 509–520.

Collinson, J.M., Quinn, J.C., Buchanan, M.A., Kaufman, M.H., Wedden, S.E., West, J.D., and Hill, R.E. (2001). Primary defects in the lens underlie complex anterior segment abnormalities of the Pax6 heterozygous eye. Proc. Natl. Acad. Sci. U.S.A. 98, 9688–9693.

Conte, I., Carrella, S., Avellino, R., Karali, M., Marco-Ferreres, R., Bovolenta, P., and Banfi, S. (2010). miR-204 is required for lens and retinal development via Meis2 targeting. Proc. Natl. Acad. Sci. U.S.A. 107, 15491–15496.

Costello, M.J., Mohamed, A., Gilliland, K.O., Fowler, W.C., and Johnsen, S. (2013). Ultrastructural analysis of the human lens fiber cell remodeling zone and the initiation of cellular compaction. Exp. Eye Res. 116, 411–418.

106 Cvekl, A., and Ashery-Padan, R. (2014). The cellular and molecular mechanisms of vertebrate lens development. Development 141, 4432–4447.

Cvekl, A., and Duncan, M.K. (2007). Genetic and epigenetic mechanisms of gene regulation during lens development. Prog Retin Eye Res 26, 555–597.

Cvekl, A., and Tamm, E.R. (2004). Anterior eye development and ocular mesenchyme: new insights from mouse models and human diseases. Bioessays 26, 374–386.

Cvekl, A., and Wang, W.-L. (2009). Retinoic acid signaling in mammalian eye development. Exp. Eye Res. 89, 280–291.

Danno, H., Michiue, T., Hitachi, K., Yukita, A., Ishiura, S., and Asashima, M. (2008). Molecular links among the causative genes for ocular malformation: Otx2 and Sox2 coregulate Rax expression. Proc. Natl. Acad. Sci. U.S.A. 105, 5408–5413.

Dash, S., Dang, C.A., Beebe, D.C., and Lachke, S.A. (2015). Deficiency of the RNA binding protein caprin2 causes lens defects and features of peters anomaly. Dev. Dyn.

Dash, S., Siddam, A.D., Barnum, C.E., Janga, S.C., and Lachke, S.A. (2016). RNA Binding Proteins in Eye Development and Disease: Implication of Conserved RNA Granule Components. Wiley Interdiscip Rev RNA 7, 527–557.

De Maria, A., and Bassnett, S. (2015). Birc7: A Late Fiber Gene of the Crystalline Lens. Invest Ophthalmol Vis Sci 56, 4823–4834.

Deml, B., Reis, L.M., Maheshwari, M., Griffis, C., Bick, D., and Semina, E.V. (2014). Whole exome analysis identifies dominant COL4A1 mutations in patients with complex ocular phenotypes involving microphthalmia. Clin. Genet. 86, 475–481.

Dimanlig, P.V., Faber, S.C., Auerbach, W., Makarenkova, H.P., and Lang, R.A. (2001). The upstream ectoderm enhancer in Pax6 has an important role in lens induction. Development 128, 4415–4424.

Ding, Y., Xi, Y., Chen, T., Wang, J., Tao, D., Wu, Z.-L., Li, Y., Li, C., Zeng, R., and Li, L. (2008). Caprin-2 enhances canonical Wnt signaling through regulating LRP5/6 phosphorylation. J Cell Biol 182, 865–872.

Donner, A.L., Episkopou, V., and Maas, R.L. (2007a). Sox2 and Pou2f1 interact to control lens and olfactory placode development. Dev Biol 303, 784–799.

Donner, A.L., Ko, F., Episkopou, V., and Maas, R.L. (2007b). Pax6 is misexpressed in Sox1 null lens fiber cells. Gene Expr. Patterns 7, 606–613.

107 Dorval, K.M., Bobechko, B.P., Fujieda, H., Chen, S., Zack, D.J., and Bremner, R. (2006). CHX10 targets a subset of photoreceptor genes. J. Biol. Chem. 281, 744–751.

Doward, W., Perveen, R., Lloyd, I.C., Ridgway, A.E., Wilson, L., and Black, G.C. (1999). A mutation in the RIEG1 gene associated with Peters’ anomaly. J. Med. Genet. 36, 152–155.

Dubbelman, M., Van der Heijde, G.L., Weeber, H.A., and Vrensen, G.F.J.M. (2003). Changes in the internal structure of the human crystalline lens with age and accommodation. Vision Res. 43, 2363–2375.

Duester, G. (2008). Retinoic Acid Synthesis and Signaling during Early Organogenesis. Cell 134, 921–931.

Duncan, M.K., Xie, L., David, L.L., Robinson, M.L., Taube, J.R., Cui, W., and Reneker, L.W. (2004). Ectopic Pax6 expression disturbs lens fiber cell differentiation. Invest. Ophthalmol. Vis. Sci. 45, 3589–3598.

Fantes, J., Ragge, N.K., Lynch, S.-A., McGill, N.I., Collin, J.R.O., Howard-Peebles, P.N., Hayward, C., Vivian, A.J., Williamson, K., van Heyningen, V., et al. (2003). Mutations in SOX2 cause anophthalmia. Nat. Genet. 33, 461–463.

Favor, J., Grimes, P., Neuhäuser-Klaus, A., Pretsch, W., and Stambolian, D. (1997). The mouse Cat4 locus maps to chromosome 8 and mutants express lens-corneal adhesion. Mamm. Genome 8, 403–406.

Fetka, I., Radeghieri, A., and Bouwmeester, T. (2000). Expression of the RNA recognition motif-containing protein SEB-4 during Xenopus embryonic development. Mech. Dev. 94, 283–286.

Fiaschetti, G., Schroeder, C., Castelletti, D., Arcaro, A., Westermann, F., Baumgartner, M., Shalaby, T., and Grotzer, M.A. (2014). NOTCH ligands JAG1 and JAG2 as critical pro-survival factors in childhood medulloblastoma. Acta Neuropathol Commun 2, 39.

Fitzpatrick, D.R., and van Heyningen, V. (2005). Developmental eye disorders. Curr. Opin. Genet. Dev. 15, 348–353.

French, C.R., Stach, T.R., March, L.D., Lehmann, O.J., and Waskiewicz, A.J. (2013). Apoptotic and proliferative defects characterize ocular development in a microphthalmic BMP model. Invest. Ophthalmol. Vis. Sci. 54, 4636–4647.

108 Fu, Y., Sander, J.D., Reyon, D., Cascio, V.M., and Joung, J.K. (2014). Improving CRISPR-Cas nuclease specificity using truncated guide RNAs. Nat. Biotechnol. 32, 279–284.

Fudge, D.S., McCuaig, J.V., Van Stralen, S., Hess, J.F., Wang, H., Mathias, R.T., and FitzGerald, P.G. (2011a). Intermediate filaments regulate tissue size and stiffness in the murine lens. Invest. Ophthalmol. Vis. Sci. 52, 3860–3867.

Fudge, D.S., McCuaig, J.V., Van Stralen, S., Hess, J.F., Wang, H., Mathias, R.T., and FitzGerald, P.G. (2011b). Intermediate filaments regulate tissue size and stiffness in the murine lens. Invest. Ophthalmol. Vis. Sci. 52, 3860–3867.

Furic, L., Maher-Laporte, M., and DesGroseillers, L. (2008). A genome-wide approach identifies distinct but overlapping subsets of cellular mRNAs associated with Staufen1- and Staufen2-containing ribonucleoprotein complexes. RNA 14, 324–335.

Furuta, Y., and Hogan, B.L.M. (1998). BMP4 is essential for lens induction in the mouse embryo. Genes Dev 12, 3764–3775.

Garcia, C.M., Huang, J., Madakashira, B.P., Liu, Y., Rajagopal, R., Dattilo, L., Robinson, M.L., and Beebe, D.C. (2011a). The function of FGF signaling in the lens placode. Dev. Biol. 351, 176–185.

Garcia, C.M., Huang, J., Madakashira, B.P., Liu, Y., Rajagopal, R., Dattilo, L., Robinson, M.L., and Beebe, D.C. (2011b). The function of FGF signaling in the lens placode. Dev. Biol. 351, 176–185.

Geng, X., Speirs, C., Lagutin, O., Inbal, A., Liu, W., Solnica-Krezel, L., Jeong, Y., Epstein, D.J., and Oliver, G. (2008). Haploinsufficiency of Six3 fails to activate Sonic hedgehog expression in the ventral forebrain and causes holoprosencephaly. Dev. Cell 15, 236–247.

Gerstberger, S., Hafner, M., and Tuschl, T. (2014). A census of human RNA-binding proteins. Nat. Rev. Genet. 15, 829–845.

Glaser, T., Jepeal, L., Edwards, J.G., Young, S.R., Favor, J., and Maas, R.L. (1994). PAX6 gene dosage effect in a family with congenital cataracts, aniridia, anophthalmia and central nervous system defects. Nat. Genet. 7, 463–471.

Graw, J. (2010). Eye development. Curr. Top. Dev. Biol. 90, 343–386.

Grifone, R., Xie, X., Bourgeois, A., Saquet, A., Duprez, D., and Shi, D.-L. (2014). The RNA-binding protein Rbm24 is transiently expressed in myoblasts and is required for myogenic differentiation during vertebrate development. Mech. Dev. 134, 1–15.

109 Grindley, J.C., Davidson, D.R., and Hill, R.E. (1995). The role of Pax-6 in eye and nasal development. Development 121, 1433–1442.

Grzybowska, E.A. (2012). Human intronless genes: functional groups, associated diseases, evolution, and mRNA processing in absence of splicing. Biochem. Biophys. Res. Commun. 424, 1–6.

Hanafusa, H., Torii, S., Yasunaga, T., and Nishida, E. (2002). Sprouty1 and Sprouty2 provide a control mechanism for the Ras/MAPK signalling pathway. Nat. Cell Biol. 4, 850–858.

Hanson, I.M., Fletcher, J.M., Jordan, T., Brown, A., Taylor, D., Adams, R.J., Punnett, H.H., and van Heyningen, V. (1994). Mutations at the PAX6 locus are found in heterogeneous anterior segment malformations including Peters’ anomaly. Nat. Genet. 6, 168–173.

Hay, E.D. (1980). Development of the vertebrate cornea. Int. Rev. Cytol. 63, 263–322.

Hendrix, R.W., and Zwaan, J. (1974). Cell shape regulation and cell cycle in embryonic lens cells. Nature 247, 145–147.

Hever, A.M., Williamson, K.A., and van Heyningen, V. (2006). Developmental malformations of the eye: the role of PAX6, SOX2 and OTX2. Clin. Genet. 69, 459– 470.

Hill, R.E., Favor, J., Hogan, B.L., Ton, C.C., Saunders, G.F., Hanson, I.M., Prosser, J., Jordan, T., Hastie, N.D., and van Heyningen, V. (1991). Mouse small eye results from mutations in a paired-like homeobox-containing gene. Nature 354, 522–525.

Hoang, T.V., Kumar, P.K.R., Sutharzan, S., Tsonis, P.A., Liang, C., and Robinson, M.L. (2014). Comparative transcriptome analysis of epithelial and fiber cells in newborn mouse lenses with RNA sequencing. Mol. Vis. 20, 1491–1517. den Hollander, A.I., Biyanwila, J., Kovach, P., Bardakjian, T., Traboulsi, E.I., Ragge, N.K., Schneider, A., and Malicki, J. (2010). Genetic defects of GDF6 in the zebrafish out of sight mutant and in human eye developmental anomalies. BMC Genet. 11, 102.

Honkanen, R.A., Nishimura, D.Y., Swiderski, R.E., Bennett, S.R., Hong, S., Kwon, Y.H., Stone, E.M., Sheffield, V.C., and Alward, W.L.M. (2003). A family with Axenfeld-Rieger syndrome and Peters Anomaly caused by a point mutation (Phe112Ser) in the FOXC1 gene. Am. J. Ophthalmol. 135, 368–375.

110 Huang, J., Rajagopal, R., Liu, Y., Dattilo, L.K., Shaham, O., Ashery-Padan, R., and Beebe, D.C. (2011). The Mechanism of Lens Placode Formation: a Case of Matrix- Mediated Morphogenesis. Dev Biol 355, 32–42.

Huang, J., Liu, Y., Oltean, A., and Beebe, D.C. (2015). Bmp4 from the optic vesicle specifies murine retina formation. Dev. Biol. 402, 119–126.

Hwang, W.Y., Fu, Y., Reyon, D., Maeder, M.L., Kaini, P., Sander, J.D., Joung, J.K., Peterson, R.T., and Yeh, J.-R.J. (2013). Heritable and precise zebrafish genome editing using a CRISPR-Cas system. PLoS ONE 8, e68708.

Inoue, M., Kamachi, Y., Matsunami, H., Imada, K., Uchikawa, M., and Kondoh, H. (2007). PAX6 and SOX2-dependent regulation of the Sox2 enhancer N-3 involved in embryonic visual system development. Genes Cells 12, 1049–1061.

Isken, A., Golczak, M., Oberhauser, V., Hunzelmann, S., Driever, W., Imanishi, Y., Palczewski, K., and von Lintig, J. (2008). RBP4 Disrupts Vitamin A Uptake Homeostasis in a STRA6-Deficient Animal Model for Matthew-Wood Syndrome. Cell Metabolism 7, 258–268.

Ito, J., Iijima, M., Yoshimoto, N., Niimi, T., Kuroda, S., and Maturana, A.D. (2016). RBM20 and RBM24 cooperatively promote the expression of short enh splice variants. FEBS Lett. 590, 2262–2274.

Ivanov, D., Dvoriantchikova, G., Pestova, A., Nathanson, L., and Shestopalov, V.I. (2005). Microarray analysis of fiber cell maturation in the lens. FEBS Lett. 579, 1213– 1219.

Jiang, Y., Zhang, M., Qian, Y., Xu, E., Zhang, J., and Chen, X. (2014). Rbm24, an RNA-binding protein and a target of p53, regulates p21 expression via mRNA stability. J. Biol. Chem. 289, 3164–3175.

Jin, D., Hidaka, K., Shirai, M., and Morisaki, T. (2010). RNA-binding motif protein 24 regulates myogenin expression and promotes myogenic differentiation. Genes Cells 15, 1158–1167.

Jordan, T., Hanson, I., Zaletayev, D., Hodgson, S., Prosser, J., Seawright, A., Hastie, N., and van Heyningen, V. (1992). The human PAX6 gene is mutated in two patients with aniridia. Nat. Genet. 1, 328–332.

Kakrana, A., Yang, A., Anand, D., Djordjevic, D., Ramachandruni, D., Singh, A., Huang, H., Ho, J.W.K., and Lachke, S.A. iSyTE 2.0: a database for expression-based gene discovery in the eye. Nucleic Acids Res.

111 Kamachi, Y., Uchikawa, M., Collignon, J., Lovell-Badge, R., and Kondoh, H. (1998). Involvement of Sox1, 2 and 3 in the early and subsequent molecular events of lens induction. Development 125, 2521–2532.

Kasaikina, M.V., Fomenko, D.E., Labunskyy, V.M., Lachke, S.A., Qiu, W., Moncaster, J.A., Zhang, J., Wojnarowicz, M.W., Natarajan, S.K., Malinouski, M., et al. (2011). Roles of the 15-kDa selenoprotein (Sep15) in redox homeostasis and cataract development revealed by the analysis of Sep 15 knockout mice. J. Biol. Chem. 286, 33203–33212.

Kelberman, D., Rizzoti, K., Avilion, A., Bitner-Glindzicz, M., Cianfarani, S., Collins, J., Chong, W.K., Kirk, J.M.W., Achermann, J.C., Ross, R., et al. (2006). Mutations within Sox2/SOX2 are associated with abnormalities in the hypothalamo- pituitary-gonadal axis in mice and humans. J Clin Invest 116, 2442–2455.

Kiernan, A.E., Pelling, A.L., Leung, K.K.H., Tang, A.S.P., Bell, D.M., Tease, C., Lovell-Badge, R., Steel, K.P., and Cheah, K.S.E. (2005). Sox2 is required for sensory organ development in the mammalian inner ear. Nature 434, 1031–1035.

Kim, J.I., Li, T., Ho, I.C., Grusby, M.J., and Glimcher, L.H. (1999). Requirement for the c-Maf transcription factor in crystallin gene regulation and lens development. Proc. Natl. Acad. Sci. U.S.A. 96, 3781–3785.

Kistler, J., Gilbert, K., Brooks, H.V., Jolly, R.D., Hopcroft, D.H., and Bullivant, S. (1986). Membrane interlocking domains in the lens. Invest. Ophthalmol. Vis. Sci. 27, 1527–1534.

Klimova, L., and Kozmik, Z. (2014). Stage-dependent requirement of neuroretinal Pax6 for lens and retina development. Development 141, 1292–1302.

Kreslova, J., Machon, O., Ruzickova, J., Lachova, J., Wawrousek, E.F., Kemler, R., Krauss, S., Piatigorsky, J., and Kozmik, Z. (2007). Abnormal lens morphogenesis and ectopic lens formation in the absence of beta-catenin function. Genesis 45, 157–168.

Kubo, E., Hasanova, N., Sasaki, H., and Singh, D.P. (2013). Dynamic and differential regulation in the microRNA expression in the developing and mature cataractous rat lens. J. Cell. Mol. Med. 17, 1146–1159.

Kuracha, M.R., Burgess, D., Siefker, E., Cooper, J.T., Licht, J.D., Robinson, M.L., and Govindarajan, V. (2011). Spry1 and Spry2 are necessary for lens vesicle separation and corneal differentiation. Invest. Ophthalmol. Vis. Sci. 52, 6887–6897.

112 Lachke, S.A., and Maas, R.L. (2010). Building the developmental oculome: systems biology in vertebrate eye development and disease. Wiley Interdiscip Rev Syst Biol Med 2, 305–323.

Lachke, S.A., Alkuraya, F.S., Kneeland, S.C., Ohn, T., Aboukhalil, A., Howell, G.R., Saadi, I., Cavallesco, R., Yue, Y., Tsai, A.C.-H., et al. (2011). Mutations in the RNA granule component TDRD7 cause cataract and glaucoma. Science 331, 1571–1576.

Lachke, S.A., Ho, J.W.K., Kryukov, G.V., O’Connell, D.J., Aboukhalil, A., Bulyk, M.L., Park, P.J., and Maas, R.L. (2012a). iSyTE: integrated Systems Tool for Eye gene discovery. Invest. Ophthalmol. Vis. Sci. 53, 1617–1627.

Lachke, S.A., Higgins, A.W., Inagaki, M., Saadi, I., Xi, Q., Long, M., Quade, B.J., Talkowski, M.E., Gusella, J.F., Fujimoto, A., et al. (2012b). The cell adhesion gene PVRL3 is associated with congenital ocular defects. Hum. Genet. 131, 235–250.

Lagutin, O., Zhu, C.C., Furuta, Y., Rowitch, D.H., McMahon, A.P., and Oliver, G. (2001). Six3 promotes the formation of ectopic optic vesicle-like structures in mouse embryos. Dev. Dyn. 221, 342–349.

Lagutin, O.V., Zhu, C.C., Kobayashi, D., Topczewski, J., Shimamura, K., Puelles, L., Russell, H.R.C., McKinnon, P.J., Solnica-Krezel, L., and Oliver, G. (2003). Six3 repression of Wnt signaling in the anterior neuroectoderm is essential for vertebrate forebrain development. Genes Dev 17, 368–379.

Landgren, H., Blixt, A., and Carlsson, P. (2008). Persistent FoxE3 expression blocks cytoskeletal remodeling and organelle degradation during lens fiber differentiation. Invest. Ophthalmol. Vis. Sci. 49, 4269–4277.

Lang, R.A., Herman, K., Reynolds, A.B., Hildebrand, J.D., and Plageman, T.F. (2014a). p120-catenin-dependent junctional recruitment of Shroom3 is required for apical constriction during lens pit morphogenesis. Development 141, 3177–3187.

Lang, R.A., Herman, K., Reynolds, A.B., Hildebrand, J.D., and Plageman, T.F. (2014b). p120-catenin-dependent junctional recruitment of Shroom3 is required for apical constriction during lens pit morphogenesis. Development 141, 3177–3187.

Latorre, E., Carelli, S., Caremoli, F., Giallongo, T., Colli, M., Canazza, A., Provenzani, A., Di Giulio, A.M., and Gorio, A. (2016). Human Antigen R Binding and Regulation of SOX2 mRNA in Human Mesenchymal Stem Cells. Mol. Pharmacol. 89, 243–252.

113 Le, T.T., Conley, K.W., Mead, T.J., Rowan, S., Yutzey, K.E., and Brown, N.L. (2012). Requirements for Jag1-Rbpj mediated Notch signaling during early mouse lens development. Dev. Dyn. 241, 493–504.

Lee, H.Y., Wroblewski, E., Philips, G.T., Stair, C.N., Conley, K., Reedy, M., Mastick, G.S., and Brown, N.L. (2005). Multiple requirements for Hes1 during early eye formation. Dev Biol 284, 464–478.

Li, Y., and Piatigorsky, J. (2009). Targeted deletion of Dicer disrupts lens morphogenesis, corneal epithelium stratification, and whole eye development. Dev. Dyn. 238, 2388–2400.

Li, H.-Y., Bourdelas, A., Carron, C., and Shi, D.-L. (2010). The RNA-binding protein Seb4/RBM24 is a direct target of MyoD and is required for myogenesis during Xenopus early development. Mech. Dev. 127, 281–291.

Lin, Y., Tan, K.T., Liu, J., Kong, X., Huang, Z., and Xu, X.Q. (2018). Global profiling of Rbm24 bound RNAs uncovers a multi-tasking RNA binding protein. The International Journal of Biochemistry & Cell Biology 94, 10–21.

Liu, K., Lyu, L., Chin, D., Gao, J., Sun, X., Shang, F., Caceres, A., Chang, M.-L., Rowan, S., Peng, J., et al. (2015). Altered ubiquitin causes perturbed calcium homeostasis, hyperactivation of calpain, dysregulated differentiation, and cataract. Proc Natl Acad Sci U S A 112, 1071–1076.

Liu, W., Lagutin, O.V., Mende, M., Streit, A., and Oliver, G. (2006). Six3 activation of Pax6 expression is essential for mammalian lens induction and specification. EMBO J. 25, 5383–5395.

Lorén, C.E., Schrader, J.W., Ahlgren, U., and Gunhaga, L. (2009). FGF signals induce Caprin2 expression in the vertebrate lens. Differentiation 77, 386–394.

Lovicu, F.J., and McAvoy, J.W. (2005). Growth factor regulation of lens development. Dev. Biol. 280, 1–14.

Lovicu, F.J., Chamberlain, C.G., and McAvoy, J.W. (1995). Differential effects of aqueous and vitreous on fiber differentiation and extracellular matrix accumulation in lens epithelial explants. Invest. Ophthalmol. Vis. Sci. 36, 1459–1469.

Manning, K.S., and Cooper, T.A. (2017). The roles of RNA processing in translating genotype to phenotype. Nat Rev Mol Cell Biol 18, 102–114.

114 Manthey, A.L., Terrell, A.M., Lachke, S.A., Polson, S.W., and Duncan, M.K. (2014b). Development of novel filtering criteria to analyze RNA-sequencing data obtained from the murine ocular lens during embryogenesis. Genom Data 2, 369–374.

Manthey, A.L., Terrell, A.M., Wang, Y., Taube, J.R., Yallowitz, A.R., and Duncan, M.K. (2014a). The Zeb proteins δEF1 and Sip1 may have distinct functions in lens cells following cataract surgery. Invest. Ophthalmol. Vis. Sci. 55, 5445–5455.

Maragh, S., Miller, R.A., Bessling, S.L., Wang, G., Hook, P.W., and McCallion, A.S. (2014). Rbm24a and Rbm24b are required for normal somitogenesis. PLoS ONE 9, e105460.

Mathers, P.H., Grinberg, A., Mahon, K.A., and Jamrich, M. (1997). The Rx homeobox gene is essential for vertebrate eye development. Nature 387, 603–607.

Matsushima, D., Heavner, W., and Pevny, L.H. (2011). Combinatorial regulation of optic cup progenitor cell fate by SOX2 and PAX6. Development 138, 443–454.

McAvoy, J.W. (1978). Cell division, cell elongation and the co-ordination of crystallin gene expression during lens morphogenesis in the rat. J Embryol Exp Morphol 45, 271–281.

McAvoy, J.W., and Chamberlain, C.G. (1989). Fibroblast growth factor (FGF) induces different responses in lens epithelial cells depending on its concentration. Development 107, 221–228.

Medina-Martinez, O., Brownell, I., Amaya-Manzanares, F., Hu, Q., Behringer, R.R., and Jamrich, M. (2005). Severe defects in proliferation and differentiation of lens cells in Foxe3 null mice. Mol. Cell. Biol. 25, 8854–8863.

Michael, R., and Bron, A.J. (2011). The ageing lens and cataract: a model of normal and pathological ageing. Philos. Trans. R. Soc. Lond., B, Biol. Sci. 366, 1278–1292.

Milstone, L.M., Zelenka, P., and Piatigorsky, J. (1976). Delta-crystallin mRNA in chick lens cells: mRNA accumulates during differential stimulation of delta-crystallin synthesis in cultured cells. Dev. Biol. 48, 197–204.

Muranishi, Y., Terada, K., and Furukawa, T. (2012). An essential role for Rax in retina and neuroendocrine system development. Dev. Growth Differ. 54, 341–348.

Oberleitner, S. (2008). Seb4 – an RNA-binding protein as a novel regulator of myogenesis during early development in Xenopus laevis. PhD disseration thesis. Ludwig-Maximilians-Universität München.

115 Okajima, K., Robinson, L.K., Hart, M.A., Abuelo, D.N., Cowan, L.S., Hasegawa, T., Maumenee, I.H., and Jabs, E.W. (1999). Ocular anterior chamber dysgenesis in craniosynostosis syndromes with a fibroblast growth factor receptor 2 mutation. Am. J. Med. Genet. 85, 160–170.

Okubo, T., Pevny, L.H., and Hogan, B.L.M. (2006). Sox2 is required for development of taste bud sensory cells. Genes Dev. 20, 2654–2659.

Oliver, G., Mailhos, A., Wehr, R., Copeland, N.G., Jenkins, N.A., and Gruss, P. (1995). Six3, a murine homologue of the sine oculis gene, demarcates the most anterior border of the developing neural plate and is expressed during eye development. Development 121, 4045–4055.

Ormestad, M., Blixt, A., Churchill, A., Martinsson, T., Enerbäck, S., and Carlsson, P. (2002a). Foxe3 haploinsufficiency in mice: a model for Peters’ anomaly. Invest. Ophthalmol. Vis. Sci. 43, 1350–1357.

Ormestad, M., Blixt, A., Churchill, A., Martinsson, T., Enerbäck, S., and Carlsson, P. (2002b). Foxe3 haploinsufficiency in mice: a model for Peters’ anomaly. Invest. Ophthalmol. Vis. Sci. 43, 1350–1357.

Ozeki, H., Ogura, Y., Hirabayashi, Y., and Shimada, S. (2001). Suppression of lens stalk cell apoptosis by hyaluronic acid leads to faulty separation of the lens vesicle. Exp. Eye Res. 72, 63–70.

Papoulas, O., Monzo, K.F., Cantin, G.T., Ruse, C., Yates, J.R., Ryu, Y.H., and Sisson, J.C. (2010). dFMRP and Caprin, translational regulators of synaptic plasticity, control the cell cycle at the Drosophila mid-blastula transition. Development 137, 4201–4209.

Park, I.-H., Zhao, R., West, J.A., Yabuuchi, A., Huo, H., Ince, T.A., Lerou, P.H., Lensch, M.W., and Daley, G.Q. (2008). Reprogramming of human somatic cells to pluripotency with defined factors. Nature 451, 141–146.

Perez-Moreno, M., and Fuchs, E. (2006). Catenins: keeping cells from getting their signals crossed. Dev. Cell 11, 601–612.

Pinson, J., Simpson, T.I., Mason, J.O., and Price, D.J. (2006). Positive autoregulation of the transcription factor Pax6 in response to increased levels of either of its major isoforms, Pax6 or Pax6(5a), in cultured cells. BMC Developmental Biology 6, 25.

Plageman, T.F., Chung, M.-I., Lou, M., Smith, A.N., Hildebrand, J.D., Wallingford, J.B., and Lang, R.A. (2010). Pax6-dependent Shroom3 expression regulates apical constriction during lens placode invagination. Development 137, 405–415.

116 Plageman, T.F., Chauhan, B.K., Yang, C., Jaudon, F., Shang, X., Zheng, Y., Lou, M., Debant, A., Hildebrand, J.D., and Lang, R.A. (2011). A Trio-RhoA-Shroom3 pathway is required for apical constriction and epithelial invagination. Development 138, 5177–5188.

Pontoriero, G.F., Deschamps, P., Ashery-Padan, R., Wong, R., Yang, Y., Zavadil, J., Cvekl, A., Sullivan, S., Williams, T., and West-Mays, J.A. (2008a). Cell autonomous roles for AP-2alpha in lens vesicle separation and maintenance of the lens epithelial cell phenotype. Dev. Dyn. 237, 602–617.

Pontoriero, G.F., Deschamps, P., Ashery-Padan, R., Wong, R., Yang, Y., Zavadil, J., Cvekl, A., Sullivan, S., Williams, T., and West-Mays, J.A. (2008b). Cell autonomous roles for AP-2alpha in lens vesicle separation and maintenance of the lens epithelial cell phenotype. Dev. Dyn. 237, 602–617.

Pontoriero, G.F., Smith, A.N., Miller, L.-A.D., Radice, G.L., West-Mays, J.A., and Lang, R.A. (2009a). Co-operative roles for E-cadherin and N-cadherin during lens vesicle separation and lens epithelial cell survival. Dev. Biol. 326, 403–417.

Pontoriero, G.F., Smith, A.N., Miller, L.-A.D., Radice, G.L., West-Mays, J.A., and Lang, R.A. (2009b). Co-operative roles for E-cadherin and N-cadherin during lens vesicle separation and lens epithelial cell survival. Dev. Biol. 326, 403–417.

Poon, K.L., Tan, K.T., Wei, Y.Y., Ng, C.P., Colman, A., Korzh, V., and Xu, X.Q. (2012). RNA-binding protein RBM24 is required for sarcomere assembly and heart contractility. Cardiovasc. Res. 94, 418–427.

Qiu, R., Liu, Y., Wu, J.Y., Liu, K., Mo, W., and He, R. (2009). Misexpression of miR- 196a induces eye anomaly in Xenopus laevis. Brain Res. Bull. 79, 26–31.

Reis, L.M., and Semina, E.V. (2011a). Genetics of anterior segment dysgenesis disorders. Curr Opin Ophthalmol 22, 314–324.

Reis, L.M., and Semina, E.V. (2011b). Genetics of anterior segment dysgenesis disorders. Curr Opin Ophthalmol 22, 314–324.

Reis, L.M., Tyler, R.C., Abdul-Rahman, O., Trapane, P., Wallerstein, R., Broome, D., Hoffman, J., Khan, A., Paradiso, C., Ron, N., et al. (2008). Mutation analysis of B3GALTL in Peters Plus syndrome. Am. J. Med. Genet. A 146A, 2603–2610.

Reneker, L.W., Silversides, D.W., Xu, L., and Overbeek, P.A. (2000). Formation of corneal endothelium is essential for anterior segment development - a transgenic mouse model of anterior segment dysgenesis. Development 127, 533–542.

117 Rieger, D.K., Reichenberger, E., McLean, W., Sidow, A., and Olsen, B.R. (2001). A double-deletion mutation in the Pitx3 gene causes arrested lens development in aphakia mice. Genomics 72, 61–72.

Rizzino, A. (2013). The Sox2-Oct4 Connection: Critical players in a much larger interdependent network integrated at multiple levels. Stem Cells 31, 1033–1039.

Rowan, S., Conley, K.W., Le, T.T., Donner, A.L., Maas, R.L., and Brown, N.L. (2008). Notch signaling regulates growth and differentiation in the mammalian lens. Dev. Biol. 321, 111–122.

Rowan, S., Siggers, T., Lachke, S.A., Yue, Y., Bulyk, M.L., and Maas, R.L. (2010). Precise temporal control of the eye regulatory gene Pax6 via enhancer-binding site affinity. Genes Dev. 24, 980–985.

Saika, S., Saika, S., Liu, C.Y., Azhar, M., Sanford, L.P., Doetschman, T., Gendron, R.L., Kao, C.W., and Kao, W.W. (2001). TGFbeta2 in corneal morphogenesis during mouse embryonic development. Dev. Biol. 240, 419–432.

Scheiblin, D.A., Gao, J., Caplan, J.L., Simirskii, V.N., Czymmek, K.J., Mathias, R.T., and Duncan, M.K. (2014). Beta-1 integrin is important for the structural maintenance and homeostasis of differentiating fiber cells. Int. J. Biochem. Cell Biol. 50, 132–145.

Schneider, I., Houston, D.W., Rebagliati, M.R., and Slusarski, D.C. (2008). Calcium fluxes in dorsal forerunner cells antagonize beta-catenin and alter left-right patterning. Development 135, 75–84.

Shah, S.P., Taylor, A.E., Sowden, J.C., Ragge, N.K., Russell-Eggitt, I., Rahi, J.S., Gilbert, C.E., and Surveillance of Eye Anomalies (SEA-UK) Special Interest Group (2011). Anophthalmos, microphthalmos, and typical coloboma in the United Kingdom: a prospective study of incidence and risk. Invest. Ophthalmol. Vis. Sci. 52, 558–564.

Shaham, O., Smith, A.N., Robinson, M.L., Taketo, M.M., Lang, R.A., and Ashery- Padan, R. (2009). Pax6 is essential for lens fiber cell differentiation. Development 136, 2567–2578.

Shaham, O., Gueta, K., Mor, E., Oren-Giladi, P., Grinberg, D., Xie, Q., Cvekl, A., Shomron, N., Davis, N., Keydar-Prizant, M., et al. (2013). Pax6 Regulates Gene Expression in the Vertebrate Lens through miR-204. PLoS Genet 9, e1003357.

Shang, F., Wilmarth, P.A., Chang, M., Liu, K., David, L.L., Caceres, M.A., Wawrousek, E., and Taylor, A. (2014). Newborn Mouse Lens Proteome and Its Alteration by Lysine 6 Mutant Ubiquitin. J Proteome Res 13, 1177–1189.

118 Shiels, A., and Hejtmancik, J. (2013). Genetics of human cataract. Clin Genet 84, 120–127.

Shiels, A., and Hejtmancik, J.F. (2015). Molecular Genetics of Cataract. Prog Mol Biol Transl Sci 134, 203–218.

Shiels, A., Bennett, T.M., and Hejtmancik, J.F. (2010). Cat-Map: putting cataract on the map. Mol Vis 16, 2007–2015.

Shiina, N., and Tokunaga, M. (2010a). RNA granule protein 140 (RNG140), a paralog of RNG105 localized to distinct RNA granules in neuronal dendrites in the adult vertebrate brain. J. Biol. Chem. 285, 24260–24269.

Shiina, N., and Tokunaga, M. (2010b). RNA Granule Protein 140 (RNG140), a Paralog of RNG105 Localized to Distinct RNA Granules in Neuronal Dendrites in the Adult Vertebrate Brain. Journal of Biological Chemistry 285, 24260–24269.

Siddam, A.D. (2017). Celf1 (Cugbp1) mediated post-transcriptional gene regulation in vertebrate lens development. University of Delaware.

Silver, J., and Hughes, A.F.W. (1974). The relationship between morphogenetic cell death and the development of congenital anophthalmia. The Journal of Comparative Neurology 157, 281–301.

Simirskii, V.N., Wang, Y., and Duncan, M.K. (2007). Conditional deletion of beta1- integrin from the developing lens leads to loss of the lens epithelial phenotype. Dev. Biol. 306, 658–668.

Sinn, R., and Wittbrodt, J. (2013). An eye on eye development. Mech. Dev. 130, 347– 358.

Smith, A.N., Miller, L.-A.D., Song, N., Taketo, M.M., and Lang, R.A. (2005). The duality of beta-catenin function: a requirement in lens morphogenesis and signaling suppression of lens fate in periocular ectoderm. Dev. Biol. 285, 477–489.

Smith, A.N., Miller, L.-A., Radice, G., Ashery-Padan, R., and Lang, R.A. (2009). Stage-dependent modes of Pax6-Sox2 epistasis regulate lens development and eye morphogenesis. Development 136, 2977–2985.

Solomon, S., Xu, Y., Wang, B., David, M.D., Schubert, P., Kennedy, D., and Schrader, J.W. (2007). Distinct structural features of caprin-1 mediate its interaction with G3BP-1 and its induction of phosphorylation of eukaryotic translation initiation factor 2alpha, entry to cytoplasmic stress granules, and selective interaction with a subset of mRNAs. Mol. Cell. Biol. 27, 2324–2342.

119 Srour, M., Chitayat, D., Caron, V., Chassaing, N., Bitoun, P., Patry, L., Cordier, M.- P., Capo-Chichi, J.-M., Francannet, C., Calvas, P., et al. (2013). Recessive and Dominant Mutations in Retinoic Acid Receptor Beta in Cases with Microphthalmia and Diaphragmatic Hernia. Am J Hum Genet 93, 765–772.

Sun, J., Rockowitz, S., Xie, Q., Ashery-Padan, R., Zheng, D., and Cvekl, A. (2015). Identification of in vivo DNA-binding mechanisms of Pax6 and reconstruction of Pax6-dependent gene regulatory networks during forebrain and lens development. Nucleic Acids Res. 43, 6827–6846.

Takahashi, K., and Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663–676.

Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., and Yamanaka, S. (2007). Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131, 861–872.

Tanaka, T., Hosokawa, M., Vagin, V.V., Reuter, M., Hayashi, E., Mochizuki, A.L., Kitamura, K., Yamanaka, H., Kondoh, G., Okawa, K., et al. (2011). Tudor domain containing 7 (Tdrd7) is essential for dynamic ribonucleoprotein (RNP) remodeling of chromatoid bodies during spermatogenesis. Proc. Natl. Acad. Sci. U.S.A. 108, 10579– 10584.

Taranova, O.V., Magness, S.T., Fagan, B.M., Wu, Y., Surzenko, N., Hutton, S.R., and Pevny, L.H. (2006). SOX2 is a dose-dependent regulator of retinal neural progenitor competence. Genes Dev. 20, 1187–1202.

Taube, J.R., Gao, C.Y., Ueda, Y., Zelenka, P.S., David, L.L., and Duncan, M.K. (2002). General utility of the chicken betaB1-crystallin promoter to drive protein expression in lens fiber cells of transgenic mice. Transgenic Res. 11, 397–410.

Terrell, A.M., Anand, D., Smith, S.F., Dang, C.A., Waters, S.M., Pathania, M., Beebe, D.C., and Lachke, S.A. (2015). Molecular characterization of mouse lens epithelial cell lines and their suitability to study RNA granules and cataract associated genes. Exp. Eye Res. 131, 42–55.

Thein, T., de Melo, J., Zibetti, C., Clark, B.S., Juarez, F., and Blackshaw, S. (2016). Control of lens development by Lhx2-regulated neuroretinal FGFs. Development 143, 3994–4002.

Thisse, C., Thisse, B., Schilling, T.F., and Postlethwait, J.H. (1993). Structure of the zebrafish snail1 gene and its expression in wild-type, spadetail and no tail mutant embryos. Development 119, 1203–1215.

120 Tucker, P., Laemle, L., Munson, A., Kanekar, S., Oliver, E.R., Brown, N., Schlecht, H., Vetter, M., and Glaser, T. (2001). The eyeless mouse mutation (ey1) removes an alternative start codon from the Rx/rax homeobox gene. Genesis 31, 43–53.

Vincent, A., Billingsley, G., Priston, M., Williams-Lyn, D., Sutherland, J., Glaser, T., Oliver, E., Walter, M.A., Heathcote, G., Levin, A., et al. (2001). Phenotypic heterogeneity of CYP1B1: mutations in a patient with Peters’ anomaly. J. Med. Genet. 38, 324–326.

Voronina, V.A., Kozhemyakina, E.A., O’Kernick, C.M., Kahn, N.D., Wenger, S.L., Linberg, J.V., Schneider, A.S., and Mathers, P.H. (2004). Mutations in the human RAX homeobox gene in a patient with anophthalmia and sclerocornea. Hum. Mol. Genet. 13, 315–322.

Walther, C., and Gruss, P. (1991). Pax-6, a murine paired box gene, is expressed in the developing CNS. Development 113, 1435–1449.

Wang, X., Garcia, C.M., Shui, Y.-B., and Beebe, D.C. (2004). Expression and regulation of alpha-, beta-, and gamma-crystallins in mammalian lens epithelial cells. Invest. Ophthalmol. Vis. Sci. 45, 3608–3619.

Wang, X., Jia, Y., Fei, C., Song, X., and Li, L. (2016). Activation/Proliferation- associated Protein 2 (Caprin-2) Positively Regulates CDK14/Cyclin Y-mediated Lipoprotein Receptor-related Protein 5 and 6 (LRP5/6) Constitutive Phosphorylation. J Biol Chem 291, 26427–26434.

Weh, E., Reis, L.M., Happ, H.C., Levin, A.V., Wheeler, P.G., David, K.L., Carney, E., Angle, B., Hauser, N., and Semina, E.V. (2014). Whole exome sequence analysis of Peters anomaly. Hum. Genet. 133, 1497–1511.

Wigle, J.T., Chowdhury, K., Gruss, P., and Oliver, G. (1999). Prox1 function is crucial for mouse lens-fibre elongation. Nat Genet 21, 318–322.

Williamson, K.A., and FitzPatrick, D.R. (2014). The genetic architecture of microphthalmia, anophthalmia and coloboma. Eur J Med Genet 57, 369–380.

Wolf, L., Harrison, W., Huang, J., Xie, Q., Xiao, N., Sun, J., Kong, L., Lachke, S.A., Kuracha, M.R., Govindarajan, V., et al. (2013a). Histone posttranslational modifications and cell fate determination: lens induction requires the lysine acetyltransferases CBP and p300. Nucleic Acids Res. 41, 10199–10214.

Wolf, L., Gao, C.S., Gueta, K., Xie, Q., Chevallier, T., Podduturi, N.R., Sun, J., Conte, I., Zelenka, P.S., Ashery-Padan, R., et al. (2013b). Identification and characterization

121 of FGF2-dependent mRNA: microRNA networks during lens fiber cell differentiation. G3 (Bethesda) 3, 2239–2255.

Wu, J., and Belmonte, J.C.I. (2016). The Molecular Harbingers of Early Mammalian Embryo Patterning. Cell 165, 13–15.

Wurm, A., Sock, E., Fuchshofer, R., Wegner, M., and Tamm, E.R. (2008). Anterior segment dysgenesis in the eyes of mice deficient for the high-mobility-group transcription factor Sox11. Exp. Eye Res. 86, 895–907.

Xie, Q., Yang, Y., Huang, J., Ninkovic, J., Walcher, T., Wolf, L., Vitenzon, A., Zheng, D., Götz, M., Beebe, D.C., et al. (2013). Pax6 interactions with chromatin and identification of its novel direct target genes in lens and forebrain. PLoS ONE 8, e54507.

Xu, E., Zhang, J., Zhang, M., Jiang, Y., Cho, S.-J., and Chen, X. (2014). RNA-binding protein RBM24 regulates p63 expression via mRNA stability. Mol. Cancer Res. 12, 359–369.

Yamada, R., Mizutani-Koseki, Y., Koseki, H., and Takahashi, N. (2004). Requirement for Mab21l2 during development of murine retina and ventral body wall. Dev. Biol. 274, 295–307.

Yan, X., Sabrautzki, S., Horsch, M., Fuchs, H., Gailus-Durner, V., Beckers, J., Hrabě de Angelis, M., and Graw, J. (2014). Peroxidasin is essential for eye development in the mouse. Hum. Mol. Genet. 23, 5597–5614.

Yang, J., Hung, L.-H., Licht, T., Kostin, S., Looso, M., Khrameeva, E., Bindereif, A., Schneider, A., and Braun, T. (2014). RBM24 is a major regulator of muscle-specific alternative splicing. Dev. Cell 31, 87–99.

Ye, J., and Blelloch, R. (2014). Regulation of Pluripotency by RNA Binding Proteins. Cell Stem Cell 15, 271–280.

Yoshimoto, A., Saigou, Y., Higashi, Y., and Kondoh, H. (2005). Regulation of ocular lens development by Smad-interacting protein 1 involving Foxe3 activation. Development 132, 4437–4448.

Yun, S., Saijoh, Y., Hirokawa, K.E., Kopinke, D., Murtaugh, L.C., Monuki, E.S., and Levine, E.M. (2009). Lhx2 links the intrinsic and extrinsic factors that control optic cup formation. Development 136, 3895–3906.

Zhang, J., Ratanasirintrawoot, S., Chandrasekaran, S., Wu, Z., Ficarro, S.B., Yu, C., Ross, C.A., Cacchiarelli, D., Xia, Q., Seligson, M., et al. (2016a). LIN28 Regulates

122 Stem Cell Metabolism and Conversion to Primed Pluripotency. Cell Stem Cell 19, 66– 80.

Zhang, T., Lin, Y., Liu, J., Zhang, Z.G., Fu, W., Guo, L.Y., Pan, L., Kong, X., Zhang, M.K., Lu, Y.H., et al. (2016b). Rbm24 Regulates Alternative Splicing Switch in Embryonic Stem Cell Cardiac Lineage Differentiation. Stem Cells 34, 1776–1789.

Zhang, W., Mulieri, P.J., Gaio, U., Bae, G.-U., Krauss, R.S., and Kang, J.-S. (2009). Ocular abnormalities in mice lacking the immunoglobulin superfamily member Cdo. FEBS J. 276, 5998–6010.

Zhao, J., Kawai, K., Wang, H., Wu, D., Wang, M., Yue, Z., Zhang, J., and Liu, Y.-H. (2012). Loss of Msx2 function down-regulates the FoxE3 expression and results in anterior segment dysgenesis resembling Peters anomaly. Am. J. Pathol. 180, 2230– 2239.

Zou, C., and Levine, E.M. (2012). Vsx2 controls eye organogenesis and retinal progenitor identity via homeodomain and non-homeodomain residues required for high affinity DNA binding. PLoS Genet. 8, e1002924.

123 Appendix A

IACUC APPROVAL

124

125 126

127

128

129

130

131

132

133

134

135

136

137

138

139

140

141

142

143

144

145

146 147

148 Appendix B

REPRINT PERMISSIONS

149

150

151

152

153

154

155

156