DOCSLIB.ORG

Molecular Detection of Oxyspirura Larvae in Arthropod Intermediate Hosts

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Detection of Oxyspirura Larvae in Arthropod Intermediate Hosts Parasitology Research (2018) 117:819–823 https://doi.org/10.1007/s00436-018-5756-3 ORIGINAL PAPER Molecular detection of Oxyspirura larvae in arthropod intermediate hosts Sadia Almas1 & Anna G. Gibson1 & Steven M. Presley1 Received: 8 September 2017 /Accepted: 8 January 2018 /Published online: 25 January 2018 # The Author(s) 2018. This article is an open access publication Abstract To determine potential intermediate hosts of Oxyspirura petrowi, a common nematode eyeworm of wild gallinaceous birds, various arthropod species including red harvester ants, beetles, wood cockroaches, crickets, grasshoppers, katydids, and desert termites were screened for the presence of O. petrowi using specific polymerase chain reaction (PCR) primers targeting the internal transcribed spacer 2 region (ITS2) of the eyeworm ribosomal deoxyribonucleic acid (rDNA). This is the first study to investigate the intermediate hosts of O. petrowi utilizing molecular techniques. We determined 38% (13/34) of the cockroaches, 27% (3/11) of the crickets, and 23% (68/289) of the grasshoppers which were positive for O. petrowi. Identifying potential intermediate hosts of O. petrowi is essential to better understanding the epizoology of the eyeworm’s transmission mechanics and to controlling infections in wild gallinaceous birds. Keywords Oxyspirura petrowi . Intermediate hosts . Galliformes . Parasitic nematodes . Bobwhite quail . Grasshopper . Cockroach Introduction reported an O. petrowi prevalence of 56% in scaled quail (Callipepla squamata) surveyed in Texas (Landgrebe et al. The long-term, and recently (2011–2013) more rapid, decline 2007). Oxyspirura petrowi is widely geographically dis- of northern bobwhite (Colinus virginianus) numbers in the tributed and occurs in a wide range of definitive hosts. Rolling Plains ecoregion of Texas and Oklahoma was inves- Oxyspirura petrowi commonly infects wild birds of the tigated to determine factors that may be influencing their order Galliformes in North America and was first reported abundance (Fig. 1). During this study, 348 northern bobwhites in Michigan, USA in 1931, and has been reported infect- were screened for different pathogens. Infection rates of ing ruffed grouse (Bonasa umbellus), greater prairie chick- 41.4% of bobwhite collected from individual sites in the en (Tympanuchus cupido), ring-necked pheasant Rolling Plains ecoregion by the parasitic nematode eyeworm (Phasianus colchicus), and sharp-tailed grouse Oxyspirura petrowi (Spirurida:Thelaziidae) was reported (Tympanuchus phasianellus) (Cram 1937; Mcclure 1949; (Dunham et al. 2016). Pence 1972; Pence 1975; Pence et al. 1980). Oxyspirura Typically, these eyeworms are observed on the corneal spp. are spiruroid nematodes and include approximately 70 surface under the nictitating membrane, in nasolacrimal known species, three of which (O. mansoni, O. petrowi, ducts and in conjunctival sacs, causing cellular damage and O. pusillae) have been reported in North America to these tissues; however, their effect on the survivability (Pence and Sell 1979). Typically these eyeworms are ob- of their hosts is unknown. (Rodriguez-Tovar et al. 2008; served on the corneal surface under the nictitating mem- Bruno et al. 2015). Previously, Landgrebe et al. 2007 brane, in nasolacrimal ducts, and in conjunctival sacs, causing cellular damage to these tissues (Rodriguez-Tovar et al. 2008; Bruno et al. 2015). The life cycle of O. petrowi is not well described, but it is * Steven M. Presley assumed to be similar to that of O. mansoni, a common [email protected] eyeworm of poultry. Oxyspirura mansoni requires an interme- 1 The Institute of Environmental and Human Health, Texas Tech diate host such as a cockroach (Blattodea) to facilitate trans- University, Box 41163, Lubbock, TX 79409-1163, USA mission to its definitive host. The eyeworm life cycle involves 820 Parasitol Res (2018) 117:819–823 was chosen as target for developing species-specific primers. Materials and methods This study was conducted in accordance with ethical stan- dards and approved animal care and use protocols (Texas Tech University, Institutional Animal Care and Use Committee protocol No. 11049–070). Eyeworms were col- lected from the eyes of euthanized bobwhite and stored in 70% ethanol, then identified initially on the basis of morpho- logical characteristics using a Nikon microscope (TE 2000 U) at 400× and 1000× magnification, after which they were sub- mitted to the U.S. National Parasite Collection for confirma- tion (USNPC 106874). Deoxyribonucleic acid (DNA) was Fig. 1 Map of the geographic area designated as the Rolling Plains extractedfromsinglenematodeusingtheDNeasyBlood& ecoregion of Texas and Oklahoma, USA. Tissue Kit (QIAGEN, Maryland, USA) according to the man- ufacturer’s instructions. The internal transcribed spacer (ITS) region was amplified using the forward primer SPIR 18 and the reverse primer 28S/408R/20 (Ivanova et al. 2007; 50–100 days of stadial progression in the intermediate host, Makouloutou et al. 2013).The PCR product, ~ 1200 base pair and 48 days in the definitive host (e.g., chicken) (Mcclure (bp), was excised and cloned into JM109 competent cells 1949). The importance of the intermediate hosts in the life (Promega Corp., Wisconsin, USA.) according to the manufac- cycle of O. mansoni was confirmed after futile attempts to turer’s instructions. Plasmids were extracted and submitted for directly infect chickens one to another using embryonated genetic sequencing to the University of Maine DNA nematode eggs or first-stage eyeworm larvae (Cram 1937). Sequencing Facility (Orono, Maine, USA). Based on the se- Observational reports suggest various insects such as flies quence obtained, the primers OP3,5′ TGTTGTGGAGCAGT and grasshoppers may serve as intermediate hosts for TAAAATCC-3′,andOP4,5′AACGTTATTGTTGCCATATG O. petrowi (Mcclure 1949). CT-3′, were designed to amplify a 197-bp region of ITS2. ThehighprevalenceofO. petrowi reported in bob- To ensure specificity, the intraspecific variation in the ITS white and other wild game birds, and the limited knowl- region of this genus was investigated. The sequence of the edge of its transmission mechanisms, necessitate the de- ITS1 region of O. petrowi was aligned with the corresponding velopment of a sensitive, specific, and reliable method region of O. conjunctivalis, which was the only Oxyspirura to screen different arthropods for the presence of spp. with a sequence available in the National Center for eyeworms. Typically, detection of nematodes in insects Biotechnology Information (NCBI) database (accession num- involves dissecting the insect and recovering nematodes, ber EF417873). Primers were synthesized by Integrated DNA then identifying different specimens based on morpho- Technologies, Inc. (IDT) (Iowa, USA). PCR conditions in- logical characteristics. This process can be time con- cluded a 2-minute denaturation step at 94 °C, followed by suming and its accuracy is highly dependent on the 35 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for experience of the investigator, as it may be difficult to 1 min, with a final elongation step at 72 °C for 10 min. The distinguish between different species of nematodes, es- specificity of primers was verified using the Basic Local pecially the larval stages (Perera et al. 2013). We report Alignment Search Tool (BLAST) against the NCBI database. here the development of a polymerase chain reaction To further confirm the specificity of the primers, DNA isolated (PCR)-based technique for the detection of any from the nematode Strongyloides stercoralis was used as a O. petrowi life stages in arthropods, for the purpose of negative control. To determine the sensitivity of the primers, learning more about its potential intermediate hosts. PCR was performed with 100 ng–1 pg of template DNA from This is the first study to identify a range of potential O. petrowi. arthropod intermediate hosts of O. petrowi based on Arthropod specimens were collected during biannual trap- molecular techniques. Due to their rapid evolution, high ping of quail during the months of August and October (2012 variation in their length and nucleotide contents between and 2013) from several ranches across the Rolling Plains closely related species, the internal transcribed spacer ecoregion of Texas and western Oklahoma. Various insects, (ITS) region of the ribosomal nucleic acid (rRNA) gene including red harvester ants (Order: Hymenoptera), beetles Parasitol Res (2018) 117:819–823 821 (Order: Coleoptera), wood cockroaches (Order: Blattodea), were determined to contain DNA of O. petrowi. All of the red crickets (Order: Orthoptera), grasshoppers (Order: ants, beetles, katydids, and termites were determined to be Orthoptera), katydids (Order: Orthoptera), and desert termites negative for the eyeworm. Out of the 15 different species of (Order: Isoptera) were collected in close proximity to bob- grasshoppers screened for the presence of O. petrowi, six dif- white quail trapping sites using baited petri plates, insect ferent species of grasshoppers including Melanoplus sweep nets, commercially available pheromone traps, and differentialis, Melanoplus femurrubrum, Trimerotropis bread- and beer-baited traps as described by Pechal and others pallidipennis, Melanoplus ponderosus, Opeia obscura, and (Pechal et al. 2007). Collected specimens were preserved in Hippiscus ocelote were positive for O. petrowi. Other than 70% ethanol and stored at − 20 °C until analysis. Arthropods these grasshopper species, Texas field cricket
Load more

Recommended publications
  • SEVEN PREVIOUSLY UNDOCUMENTED ORTHOPTERAN SPECIES in LUNA COUNTY, NEW MEXICO Niccole D
    International Journal of Science, Environment ISSN 2278-3687 (O) and Technology, Vol. 10, No 4, 2021, 105 – 115 2277-663X (P) SEVEN PREVIOUSLY UNDOCUMENTED ORTHOPTERAN SPECIES IN LUNA COUNTY, NEW MEXICO Niccole D. Rech1*, Brianda Alirez2 and Lauren Paulk2 1Western New Mexico University, Deming, New Mexico 2Early College High School, Deming, New Mexico E-mail: [email protected] (*Corresponding Author) Abstract: The Chihuahua Desert is the largest hot desert (BWh) in North America. Orthopterans are an integral part of desert ecosystems. They include grasshoppers, katydids and crickets. A large section of the Northern Chihuahua Desert is in Luna County, New Mexico. There is a dearth of information on the Orthopterans in this area. Between May and October of 2020, sixty adult grasshoppers, two katydids and one camel cricket were captured from a 5-hectare (ha) area at base of the Florida Mountains, which is the extreme southern portion of Luna County. Luna County was in a severe drought during 2020. The insects were identified using several taxonomic keys (Cigliano, Braun, Eades & Otte, 2018; Guala & Doring, 2019; Triplehorn & Johnson, 2005; Richman, Lightfoot, Sutherland & Fergurson, 1993, Otte, 1984, 1981; Tinkham, 1944). A previous New Mexico State University (NMSU) survey from 1993 had only documented grasshoppers in the Acrididae and Romaleidae families. The objective of this continuing study is to identify and document all species of Orthopterans found in Luna County, and correlate the populations with changing weather patterns. In this portion of the study, the majority of Orthopterans captured were Leprus wheeleri (Thomas), a previously documented specie. However, seven undocumented species were also captured.
    [Show full text]
  • Working List of Prairie Restricted (Specialist) Insects in Wisconsin (11/26/2015)
    Working List of Prairie Restricted (Specialist) Insects in Wisconsin (11/26/2015) By Richard Henderson Research Ecologist, WI DNR Bureau of Science Services Summary This is a preliminary list of insects that are either well known, or likely, to be closely associated with Wisconsin’s original native prairie. These species are mostly dependent upon remnants of original prairie, or plantings/restorations of prairie where their hosts have been re-established (see discussion below), and thus are rarely found outside of these settings. The list also includes some species tied to native ecosystems that grade into prairie, such as savannas, sand barrens, fens, sedge meadow, and shallow marsh. The list is annotated with known host(s) of each insect, and the likelihood of its presence in the state (see key at end of list for specifics). This working list is a byproduct of a prairie invertebrate study I coordinated from1995-2005 that covered 6 Midwestern states and included 14 cooperators. The project surveyed insects on prairie remnants and investigated the effects of fire on those insects. It was funded in part by a series of grants from the US Fish and Wildlife Service. So far, the list has 475 species. However, this is a partial list at best, representing approximately only ¼ of the prairie-specialist insects likely present in the region (see discussion below). Significant input to this list is needed, as there are major taxa groups missing or greatly under represented. Such absence is not necessarily due to few or no prairie-specialists in those groups, but due more to lack of knowledge about life histories (at least published knowledge), unsettled taxonomy, and lack of taxonomic specialists currently working in those groups.
    [Show full text]
  • Invertebrate Distribution and Diversity Assessment at the U. S. Army Pinon Canyon Maneuver Site a Report to the U
    Invertebrate Distribution and Diversity Assessment at the U. S. Army Pinon Canyon Maneuver Site A report to the U. S. Army and U. S. Fish and Wildlife Service G. J. Michels, Jr., J. L. Newton, H. L. Lindon, and J. A. Brazille Texas AgriLife Research 2301 Experiment Station Road Bushland, TX 79012 2008 Report Introductory Notes The invertebrate survey in 2008 presented an interesting challenge. Extremely dry conditions prevailed throughout most of the adult activity period for the invertebrates and grass fires occurred several times throughout the summer. By visual assessment, plant resources were scarce compared to last year, with few green plants and almost no flowering plants. Eight habitats and nine sites continued to be sampled in 2008. The Ponderosa pine/ yellow indiangrass site was removed from the study after the low numbers of species and individuals collected there in 2007. All other sites from the 2007 survey were included in the 2008 survey. We also discontinued the collection of Coccinellidae in the 2008 survey, as only 98 individuals from four species were collected in 2007. Pitfall and malaise trapping were continued in the same way as the 2007 survey. Sweep net sampling was discontinued to allow time for Asilidae and Orthoptera timed surveys consisting of direct collection of individuals with a net. These surveys were conducted in the same way as the time constrained butterfly (Papilionidea and Hesperoidea) surveys, with 15-minute intervals for each taxanomic group. This was sucessful when individuals were present, but the dry summer made it difficult to assess the utility of these techniques because of overall low abundance of insects.
    [Show full text]
  • Spur-Throated Grasshoppers of the Canadian Prairies and Northern Great Plains
    16 Spur-throated grasshoppers of the Canadian Prairies and Northern Great Plains Dan L. Johnson Research Scientist, Grassland Insect Ecology, Lethbridge Research Centre, Agriculture and Agri-Food Canada, Box 3000, Lethbridge, AB T1J 4B1, [email protected] The spur-throated grasshoppers have become the most prominent grasshoppers of North Ameri- can grasslands, not by calling attention to them- selves by singing in the vegetation (stridulating) like the slant-faced grasshoppers, or by crackling on the wing (crepitating) like the band-winged grasshoppers, but by virtue of their sheer num- bers, activities and diversity. Almost all of the spur-throated grasshoppers in North America are members of the subfamily Melanoplinae. The sta- tus of Melanoplinae is somewhat similar in South America, where the melanopline Dichroplus takes the dominant role that the genus Melanoplus pated, and hiding in the valleys?) scourge that holds in North America (Cigliano et al. 2000). wiped out so much of mid-western agriculture in The biogeographic relationships are analysed by the 1870’s. Chapco et al. (2001). The grasshoppers are charac- terized by a spiny bump on the prosternum be- Approximately 40 species of grasshoppers in tween the front legs, which would be the position the subfamily Melanoplinae (mainly Tribe of the throat if they had one. This characteristic is Melanoplini) can be found on the Canadian grass- easy to use; I know elementary school children lands, depending on weather and other factors af- who can catch a grasshopper, turn it over for a fecting movement and abundance. The following look and say “melanopline” before grabbing the notes provide a brief look at representative next.
    [Show full text]
  • List of Insect Species Which May Be Tallgrass Prairie Specialists
    Conservation Biology Research Grants Program Division of Ecological Services © Minnesota Department of Natural Resources List of Insect Species which May Be Tallgrass Prairie Specialists Final Report to the USFWS Cooperating Agencies July 1, 1996 Catherine Reed Entomology Department 219 Hodson Hall University of Minnesota St. Paul MN 55108 phone 612-624-3423 e-mail [email protected] This study was funded in part by a grant from the USFWS and Cooperating Agencies. Table of Contents Summary.................................................................................................. 2 Introduction...............................................................................................2 Methods.....................................................................................................3 Results.....................................................................................................4 Discussion and Evaluation................................................................................................26 Recommendations....................................................................................29 References..............................................................................................33 Summary Approximately 728 insect and allied species and subspecies were considered to be possible prairie specialists based on any of the following criteria: defined as prairie specialists by authorities; required prairie plant species or genera as their adult or larval food; were obligate predators, parasites
    [Show full text]
  • Large-Scale Experimental Landscapes Reveal Distinctive Effects of Patch Shape and Connectivity on Arthropod Communities
    Landscape Ecol (2011) 26:1361–1372 DOI 10.1007/s10980-011-9656-5 RESEARCH ARTICLE Large-scale experimental landscapes reveal distinctive effects of patch shape and connectivity on arthropod communities John L. Orrock • Gregory R. Curler • Brent J. Danielson • David R. Coyle Received: 26 October 2010 / Accepted: 2 September 2011 / Published online: 14 September 2011 Ó Springer Science+Business Media B.V. 2011 Abstract The size, shape, and isolation of habitat nectivity (via habitat corridors) independently of area patches can affect organism behavior and population and edge effects. We found that patch shape, rather dynamics, but little is known about the relative role of than connectivity, affected ground-dwelling arthropod shape and connectivity in affecting ecological com- richness and beta diversity (i.e. turnover of genera munities at large spatial scales. Using six sampling among patches). Arthropod communities contained sessions from July 2001 until August 2002, we fewer genera and exhibited less turnover in high-edge collected 33,685 arthropods throughout seven 12-ha connected and high-edge unconnected patches relative experimental landscapes consisting of clear-cut to low-edge unconnected patches of similar area. patches surrounded by a matrix of mature pine forest. Connectivity, rather than patch shape, affected the Patches were explicitly designed to manipulate con- evenness of ground-dwelling arthropod communities; regardless of patch shape, high-edge connected patches had lower evenness than low- or high-edge unconnected patches. Among the most abundant arthropod orders, increased richness in low-edge unconnected patches was largely due to increased Electronic supplementary material The online version of richness of Coleoptera, whereas Hymenoptera played this article (doi:10.1007/s10980-011-9656-5) contains an important role in the lower evenness in connected supplementary material, which is available to authorized users.
    [Show full text]
  • Elements for the Sustainable Management of Acridoids of Importance in Agriculture
    African Journal of Agricultural Research Vol. 7(2), pp. 142-152, 12 January, 2012 Available online at http://www.academicjournals.org/AJAR DOI: 10.5897/AJAR11.912 ISSN 1991-637X ©2012 Academic Journals Review Elements for the sustainable management of acridoids of importance in agriculture María Irene Hernández-Zul 1, Juan Angel Quijano-Carranza 1, Ricardo Yañez-López 1, Irineo Torres-Pacheco 1, Ramón Guevara-Gónzalez 1, Enrique Rico-García 1, Adriana Elena Castro- Ramírez 2 and Rosalía Virginia Ocampo-Velázquez 1* 1Department of Biosystems, School of Engineering, Queretaro State University, C.U. Cerro de las Campanas, Querétaro, México. 2Department of Agroecology, Colegio de la Frontera Sur, San Cristóbal de las Casas, Chiapas, México. Accepted 16 December, 2011 Acridoidea is a superfamily within the Orthoptera order that comprises a group of short-horned insects commonly called grasshoppers. Grasshopper and locust species are major pests of grasslands and crops in all continents except Antarctica. Economically and historically, locusts and grasshoppers are two of the most destructive agricultural pests. The most important locust species belong to the genus Schistocerca and populate America, Africa, and Asia. Some grasshoppers considered to be important pests are the Melanoplus species, Camnula pellucida in North America, Brachystola magna and Sphenarium purpurascens in northern and central Mexico, and Oedaleus senegalensis and Zonocerus variegatus in Africa. Previous studies have classified these species based on specific characteristics. This review includes six headings. The first discusses the main species of grasshoppers and locusts; the second focuses on their worldwide distribution; the third describes their biology and life cycle; the fourth refers to climatic factors that facilitate the development of grasshoppers and locusts; the fifth discusses the action or reaction of grasshoppers and locusts to external or internal stimuli and the sixth refers to elements to design management strategies with emphasis on prevention.
    [Show full text]
  • The Taxonomy of Utah Orthoptera
    Great Basin Naturalist Volume 14 Number 3 – Number 4 Article 1 12-30-1954 The taxonomy of Utah Orthoptera Andrew H. Barnum Brigham Young University Follow this and additional works at: https://scholarsarchive.byu.edu/gbn Recommended Citation Barnum, Andrew H. (1954) "The taxonomy of Utah Orthoptera," Great Basin Naturalist: Vol. 14 : No. 3 , Article 1. Available at: https://scholarsarchive.byu.edu/gbn/vol14/iss3/1 This Article is brought to you for free and open access by the Western North American Naturalist Publications at BYU ScholarsArchive. It has been accepted for inclusion in Great Basin Naturalist by an authorized editor of BYU ScholarsArchive. For more information, please contact [email protected], [email protected]. IMUS.COMP.ZSOL iU6 1 195^ The Great Basin Naturalist harvard Published by the HWIilIijM i Department of Zoology and Entomology Brigham Young University, Provo, Utah Volum e XIV DECEMBER 30, 1954 Nos. 3 & 4 THE TAXONOMY OF UTAH ORTHOPTERA^ ANDREW H. BARNUM- Grand Junction, Colorado INTRODUCTION During the years of 1950 to 1952 a study of the taxonomy and distribution of the Utah Orthoptera was made at the Brigham Young University by the author under the direction of Dr. Vasco M. Tan- ner. This resulted in a listing of the species found in the State. Taxonomic keys were made and compiled covering these species. Distributional notes where available were made with the brief des- criptions of the species. The work was based on the material in the entomological col- lection of the Brigham Young University, with additional records obtained from the collection of the Utah State Agricultural College.
    [Show full text]
  • Effect of Increased Soil Moisture and Reduced Soil Temperature on a Desert Soil Arthropod Community
    Effect of Increased Soil Moisture and Reduced Soil Temperature on a Desert Soil Arthropod Community WILLIAM P. MACKAY, SOLANGE SILVA, DAVID C. LIGHTFOOT, MARIA INEZ PAGANI and WALTER G. WHITFORD' Department of Biology, Box 3AFJ New Mexico State University, Las Cruces 88003 ABSTRACT: The effects of soil moisture and temperature on arthropod communi- ties were experimentally examined in the northern Chihuahuan Desert of New Mex- ico. Shaded plots were established which lowered the soil temperature several degrees; some plots received artificial rainfall to increase soil moisture. Shading reduced soil temperature at 5-cm depth 7-10 C. Soil moisture at 5 cm accounted for most of the variation in surface activity of subterranean termites (r values between 0.3 and 0.7). Termites did not respond to temperature differences. When all soils were at field capacity, there was no difference in termite activity in shaded and unshaded plots. There were higher densities of mi- croarthropods in litter bags on the shaded plots than on the unshaded plots. Numbers of microarthropods were an order of magnitude larger in litter bags on watered and shaded plots than on other plots. Lower litter temperatures apparently affect litter ar- thropods more than increased soil moisture. Shade had no effect on ant colonies but there were fewer colonies on the watered plots. There was between 40 to 50% mass loss from creosotebush leaf litter after 7 months on all plots. Water and soil temperature had no effect on decomposition rates. INTRODUCTION Temperature extremes and water availability are considered to be the most impor- tant factors limiting production, activity of desert organisms and ecosystem processes in deserts (Noy-Meir, 1973, 1974; Whitford et al., 1981, Whitford et al., 1983).
    [Show full text]
  • Formate Dehydrogenese Gene Phylogeny in Higher Termites
    3-1 Formate dehydrogenese gene phylogeny in higher termites suggests gut microbial communities have undergone an evolutionary bottleneck, convergent evolution, and invasion Abstract The majority of termites and termite species on the planet belong to the phylogenetically ‘higher’ termite family Termitidae. Higher termites thrive on diverse lignocellulosic substrates with the aid of symbiotic gut microbiota. H2 consuming CO2 reductive acetogenic bacteria are an important group of symbionts that produce a significant fraction of the acetate used by their insect host as its primary carbon and energy source. A recent metagenomic analysis of the hindgut paunch bacterial community of a wood- feeding higher termite suggested spirochetes are the dominant acetogens in higher termites, as they appear to be in phylogenetically lower termites. However, a certain genetic feature of actogenesis in higher termites was not resolved. Genes for hydrogenase-linked formate dehydrogenase (FDHH), an enzyme implicated in H2 turnover and CO2 fixing capacities of a termite gut acetogenic spirochete isolate and many uncultured lower termite gut acetogens, were notably depleted with respect to abundance and diversity relative to other acetogenesis genes in the metagenome and the gut communities of lower termites. Here, we use FDHH primers to determine whether higher termite gut communities are as poor in FDHH genes as previous data suggest. We 3-2 report that each and every FDHH gene inventory generated from the whole gut communities of 8 species of taxonomically and nutritionally diverse higher termites (subfamilies Nasutitermitinae and Termitinae) was considerably more diverse than the metagenomic data set (4-15 phylotypes versus 1 phylotype), indicating the near absence of FDHH genes in the metagenomic data set may result from artifacts of sampling or methodology.
    [Show full text]
  • Insect-Mediated Nitrogen Dynamics in Decomposing Wood
    Ecological Entomology (2015), 40 (Suppl. 1), 97–112 DOI: 10.1111/een.12176 INSECTS AND ECOSYSTEM SERVICES SPECIAL ISSUE Insect-mediated nitrogen dynamics in decomposing wood MICHAEL D. ULYSHEN USDA Forest Service, Athens, Georgia, U.S.A. Abstract. 1. Wood decomposition is characterised by complex and poorly understood nitrogen (N) dynamics with unclear implications for forest nutrient cycling and productivity. Wood-dwelling microbes have developed unique strategies for coping with the N limitations imposed by their substrate, including the translocation of N into wood by cord-forming fungi and the fixation of atmospheric nitrogen2 (N ) by bacteria and Archaea. 2. By accelerating the release of nutrients immobilised in fungal tissues and promoting N2 fixation by free-living and endosymbiotic prokaryotes, saproxylic insects have the potential to influence N dynamics in forests. 3. Prokaryotes capable of fixing N2 appear to be commonplace among wood-feeding insects, with published records from three orders (Blattodea, Coleoptera and Hymenoptera), 13 families, 33 genera and at least 60 species. These organisms appear to play a significant role in the N economies of their hosts and represent a widespread solution to surviving on a diet of wood. 4. While agricultural research has demonstrated the role that termites and other insects can play in enhancing crop yields, the importance of saproxylic insects to forest productivity remains unexplored. Key words. Arthropods, diazotroph, ecosystem services, Isoptera, mineralisation, saproxylic, symbiosis. Introduction the N-rich tissues of particular insect and fungal species. For example, Baker (1969) reported that Anobium punctatum (De Nitrogen (N) is the limiting nutrient in many systems (Vitousek Geer) developing in dry wood acquired 2.5 times the amount & Howarth, 1991; LeBauer & Treseder, 2008) and this is espe- of N provided by the wood itself.
    [Show full text]
  • Proc Ent Soc Mb 2019, Volume 75
    Proceedings of the Entomological Society of Manitoba VOLUME 75 2019 T.D. Galloway Editor Winnipeg, Manitoba Entomological Society of Manitoba The Entomological Society of Manitoba was formed in 1945 “to foster the advancement, exchange and dissemination of Entomological knowledge”. This is a professional society that invites any person interested in entomology to become a member by application in writing to the Secretary. The Society produces the Newsletter, the Proceedings, and hosts a variety of meetings, seminars and social activities. Persons interested in joining the Society should consult the website at: http://home. cc.umanitoba.ca/~fieldspg, or contact: Sarah Semmler The Secretary Entomological Society of Manitoba [email protected] Contents Photo – Adult male European earwig, Forficula auricularia, with a newly arrived aphid, Uroleucon rudbeckiae, on tall coneflower, Rudbeckia laciniata, in a Winnipeg garden, 2017-08-05 ..................................................................... 5 Scientific Note Earwigs (Dermaptera) of Manitoba: records and recent discoveries. Jordan A. Bannerman, Denice Geverink, and Robert J. Lamb ...................... 6 Submitted Papers Microscopic examination of Lygus lineolaris (Hemiptera: Miridae) feeding injury to different growth stages of navy beans. Tharshi Nagalingam and Neil J. Holliday ...................................................................... 15 Studies in the biology of North American Acrididae development and habits. Norman Criddle. Preamble to publication
    [Show full text]