Identification of Mucorales Isolates from Soil Using Morphological and Molecular Methods
Total Page：16
File Type：pdf, Size：1020Kb
Curr Med Mycol, 2016 Mar, 2(1): 13-19 ــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــOriginal Articleـــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــ Identification of Mucorales isolates from soil using morphological and molecular methods Bayat M1, Hashemi J3 ,٭Ziaee A1, Zia M2 1 Department of Medical and Veterinary Mycology, Faculty of Veterinary Specialized Sciences, Science and Research Branch, Islamic Azad University, Tehran, Iran 2 Department of Basic Sciences, Isfahan (Khorasgan) Branch, Islamic Azad University, Isfahan, Iran 3 Department of Mycology and Parasitology, Faculty of Public Health, Tehran University of Medical Sciences, Tehran, Iran *Corresponding author: Mohammadali Zia, Department of Basic Sciences, Isfahan (Khorasgan) Branch, Islamic Azad University, Isfahan, Iran. Email: [email protected] (Received: 17 December 2015; Revised: 5 March 2016; Accepted: 29 March 2016) Abstract Background and Purpose: Soil is the main habitat of saprophytic and pathogenic fungi. Mucoromycotina constitutes a large group of soil fungi, with certain opportunistic members causing systemic infections in immunocompromised hosts. The majority of human and animal infections are caused by the members of the genera Rhizopus, Mucor, Rhizomucor, Lichtheimia (Absidia), Cunninghamella, and Mortierella. Accordingly, in the present study, we aimed to isolate and identify the main genera of the order Mucorales, using molecular assays and morphological features. Materials and Methods: In total, 340 soil samples were collected from seven public parks throughout the city and sidewalk gardens in 14 municipal districts in Isfahan, Iran. All the samples were cultured on the appropriate media, incubated at 27°C for 2- 4 days, and examined daily for visible fungal growth. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method was applied and macroscopic, microscopic, and physiological characteristics were assessed to identify fungal colonies. Results: 400 pure colonies, belonging to the orders Mucorales and Mortierellales, including the genera Lichtheimia, Rhizopus, Rhizomucor, Mucor, Cunninghamella, and Mortierella, were identified. The genus Rhizopus (35.5%) was the most frequent isolate, followed by Mucor (32.25%) and Rhizomucor (27.5%). Conclusion: The results emphasize the importance of opportunistic fungi in public areas and indicate the risk of exposure for immunocompromised individuals. Keywords: Mucorales, Mucor, Rhizopus, Lichtheimia, Rhizomucor, Mortierella, PCR-RFLP How to cite this paper: Ziaee A, Zia M, Bayat M, Hashemi J. Identification of Mucorales isolates from soil using morphological and molecular methods. Curr Med Mycol. 2016; 2(1): 13-19. Introduction n the literature, no relationship has been soil disturbances and enter the respiratory tract [2, established between the distribution of fungal 6]. Mucorales is an order of mostly saprophytic Ispecies and environmental factors [1]. The fungi, growing on organic substances, such as amount and type of microorganisms in a particular food, dead plants, or animal waste materials in soil section of soil are associated with several factors, [7, 8]. These organisms may survive in the soil for such as sunlight, temperature, moisture, soil pH, a long time before infecting humans who are in nutrients, and reduction potential [2]. contact with contaminated soil [9]. Fungi, as a group of microorganisms with a wide In 2007, in a taxonomic reclassification, distribution in soil, play important roles in the soil Zygomycetes was abolished as a class, and ecosystem and soil-borne fungal diseases. Today, zygomycosis is now mainly attributed to the order it is well established that soil can be a reservoir Mucorales of subphylum Mucoromycotina [10]. of most pathogenic and opportunistic fungi [3-6]. Therefore, the term “mucormycosis”, previously In fact, soil-borne pathogenic fungi may enter the known as zygomycosis, is currently used for human body via direct inoculation into wounds, opportunistic infections caused by the order direct soil ingestion, or indirect ingestion via Mucorales [11]. contaminated food. Mucormycosis is the third most common Fungal spores can be dispersed in different invasive fungal infection, following aspergillosis environments through dust or mud particles from and candidiasis [12]. The importance of Official publication of Iranian Society of Medical Mycology (ISMM) and Invasive Fungi Research Center (IFRC) All rights reserved. For permissions, please e-mail: [email protected] 13 Ziaee A et al. mucormycosis has been highlighted in recent features. Definite identification of Rhizopus, years as a consequence of the dramatic increase Mucor, Lichtheimia, and Rhizomucor at the in the number of patients with predisposing species level was performed, based on molecular factors [13-15]. In general, six families, analysis and morphological and physiological including Cunninghamellaceae, Lichtheimiaceae, studies. Moreover, identification of Mortierella Mucoraceae, Saksenaeaceae, Syncephalastraceae, and Cunninghamella species was based on the and Thamnidiaceae, have been described to be morphological characteristics [20]. responsible for human infections [14]. With this background in mind, the main aim of Macroscopic and microscopic features this study was to investigate the diversity of fungi Mucorales colonies are typically floccose and belonging to the subphylum Mucormycotina, dense. These colonies rapidly fill the entire Petri particularly the order Mucorales, in the soil of dish with abundant intertwined aerial mycelium, different public places and sidewalk gardens, resembling gray cotton candy. The hyphae are located in the populated areas of municipal predominantly aseptate or very sparsely septate districts of Isfahan, Iran, using molecular and and wide. Features which are most useful for morphological assays. distinguishing Mucorales include the presence DNA-based molecular assays have been shown of rhizoids, shape of sporangium, length of to be rapid and highly reliable tools, especially for sporangiophore, shape of columella, presence rRNA genes. These assays have become widely or absence of apophysis and collarette, and accepted for phylogenetic identification of various organization and branching of stolons [15, 21]. fungi [8]. In the present study, polymerase chain reaction-restriction fragment length polymorphism Molecular studies (PCR-RFLP) method was applied to identify Genomic DNA, pertaining to all pure the important genera of the order Mucorales, as Mucorales colonies, was extracted, using successfully performed in previous studies [16, 17]. the phenol-chloroform method [22]. A mixture of specific sense primers (MucL1: 5’ Materials and Methods TGATCTACGTGACATATTTCT 3’; AbsL1: 5’ During August 2014 to October 2015, a total TGA TCTACACGGCATCAAAT 3’; RpL1: 5’ of 340 soil samples were gathered from different TGATCTACGTGACAAATTCT 3’; and RmL1: sites, i.e., seven public parks and different 5’ TGATCTACGCGAGCGAACAA 3’) was sidewalk gardens located in 14 municipal districts used, corresponding to Mucor, Lichtheimia, of Isfahan, Iran. First, all the debris, present on the Rhizopus, and Rhizomucor species, respectively. soil surface, was removed. Then, approximately Also, an antisense degenerate primer (MR1: 400 g of soil at a depth of 5-10 cm was collected 5’ AGTAGTTTGTCTTCGGTCAA 3’) from the surface layer and stored in sterile bags, corresponding to Mucorales was applied for the using a sterile stainless steel spoon. All the samples amplification of the purified extracted DNA. In were immediately transferred to the laboratory for a previous study by Machouart and colleagues, the next processing stage. these primers had been successfully applied The samples were crushed in a mortar for the detection of the abovementioned genera under sterile conditions and then homogenized. belonging to the order Mucorales [17]. Afterwards, 5 g of each soil sample was suspended The following temperature program was in 20 ml of sterile double-distilled water and applied for the amplification of the extracted shaken for 5 min to prepare a soil suspension [18, DNA: primary denaturation at 94°C for 3 min, 19]. Approximately 0.5 ml of the suspension was 30 cycles of denaturation at 94°C for 1 min, poured in the bottom of a Petri dish. Then, cooled annealing at 60°C for 1 min, extension at 72°C molten agar medium of Sabouraud dextrose for 1 min, and final extension at 72°C for 7 min agar (SDA) or potato dextrose agar (PDA), [23]. The PCR products of Mucorales were supplemented with chloramphenicol (50 mg/l), digested individually with the selected restriction was added to the suspension and entirely mixed. enzymes, as presented in Table 1. All the samples were incubated at 27°C for 2-4 days For PCR-RFLP analysis, a mixture was and were observed daily in terms of fungal colony prepared, using the following components in a growth. The primary identification was performed final volume of 25 µl: restriction enzyme (2 µl), on the basis of macroscopic and microscopic enzyme buffer (2.5 µl), PCR product (10 µl), and 14 Curr Med Mycol, 2016, 2(1): 13-19. Identification of pathogenic Zygomycetes Figure 2. Agarose gel electrophoresis of 18S rRNA PCR Figure 1. Agarose gel electrophoresis of 18S rRNA PCR products of different species of Mucorales after restriction products of different species of Mucorales after restriction digestion with BmgBI (Lanes 1, 2, & 3), AfIII (Lanes 4, 5, 8, &