Phloem-Conducting Cells in Haustoria of the Root-Parasitic Plant Phelipanche Aegyptiaca Retain Nuclei and Are Not Mature Sieve Elements

Article Phloem-Conducting Cells in Haustoria of the Root-Parasitic Plant Phelipanche aegyptiaca Retain Nuclei and Are Not Mature Sieve Elements

Minako Ekawa and Koh Aoki * ID

Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-Cho, Naka-Ku, Sakai, Osaka 599-8531, Japan; [email protected] * Correspondence: [email protected]; Tel.: +81-72-254-9421

Received: 3 November 2017; Accepted: 3 December 2017; Published: 5 December 2017

Abstract: Phelipanche aegyptiaca parasitizes a wide range of plants, including important crops, and causes serious damage to their production. P. aegyptiaca develops a specialized intrusive organ called a haustorium that establishes connections to the host’s xylem and phloem. In parallel with the development of xylem vessels, the differentiation of phloem-conducting cells has been demonstrated by the translocation of symplasmic tracers from the host to the parasite. However, it is unclear yet whether haustorial phloem-conducting cells are sieve elements. In this study, we identiﬁed phloem-conducting cells in haustoria by the host-to-parasite translocation of green ﬂuorescent protein (GFP) from AtSUC2pro::GFP tomato sieve tubes. Haustorial GFP-conducting cells contained nuclei but not callose-rich sieve plates, indicating that phloem-conducting cells in haustoria differ from conventional sieve elements. To ascertain why the nuclei were not degenerated, expression of the P. aegyptiaca homologs NAC-domain containing transcription factor (NAC45), NAC45/86-dependent exonuclease-domain protein 1 (NEN1), and NEN4 was examined. However, these genes were more highly expressed in the haustorium than in tubercle protrusion, implying that nuclear degradation in haustoria may not be exclusively controlled by the NAC45/86-NEN regulatory pathway. Our results also suggest that the formation of plasmodesmata with large size exclusion limits is independent of nuclear degradation and callose deposition.

Keywords: haustorium; NAC45; NEN1; NEN4; Phelipanche aegyptiaca; phloem; sieve element

1. Introduction Parasitic plants belonging to the genera Orobanche and Phelipanche are obligate parasites that subsist on hosts’ roots. Phelipanche aegyptiaca parasitizes a wide range of plants, including important crops such as tomato, melon, and legumes, and causes serious damage to crop production [1]. P. aegyptiaca develops a radicle upon germination when perceiving a stimulant exuded from the hosts’ roots. When the radicle contacts the host root, a haustorium (a specialized intrusive organ) differentiates from the terminus of the radicle and reaches the host’s vascular tissues, and the vascular conducting tissues then differentiate. After establishing the conducting tissues, P. aegyptiaca initiates the development of a tubercle, which is a storage organ developed from the seedling remaining outside the host’s root [2]. Formation of vascular conducting tissue in haustoria is necessary for obligate parasitic plants to absorb water and nutrients from the hosts, because they lack roots or photosynthetic organs. Xylem and phloem differentiation in haustoria are pivotal steps in the successful establishment of a parasitic connection. Xylem differentiation is characterized by the formation of vessel elements with highly ligniﬁed cell walls [3]. Elongated cells in the haustorial tips of Striga hermonthica perforate cell walls of the host’s xylem vessel, and the invading part of the contact cell (the osculum) loses its cytoplasmic contents and differentiates into a water-conducting vessel element [3]. In a

Plants 2017, 6, 60; doi:10.3390/plants6040060 www.mdpi.com/journal/plants Plants 2017, 6, 60 2 of 12

P. aegyptiaca-Arabidopsis thaliana parasitic complex, exogenous auxin application decreases the infection rate, suggesting that auxin flow plays an important role in xylem continuity [4]. Open xylem connections at the parasite-host interface allow a flow of water and minerals to the parasitic plant. Haustorial phloem differentiation has also been described. Studies on the haustiorial phloem of various parasitic plants showed that the presence of sieve elements (SEs) in haustoria depends upon the species in question. A morphological study using light microscopy on the structure of the haustorium of a stem parasitic plant, Cuscuta gronovii, has demonstrated that most of the cells in sieve tubes have prominent nuclei and sieve plates, and no sieve-tube members reach the host phloem [5]. In contrast, morphological studies of haustoria of a stem obligate parasitic plant, Cuscuta odorata, using electron microscopy have demonstrated that there are sieve element (SE)-companion cell (CC) complexes in haustoria that are directly in contact to host SEs [6]. A root facultative parasitic plant in the Orobancaceae family, Lathraea, does not develop phloem in haustoria, and it takes organic substances through xylem. Another root facultative parasitic plant, Alectra vogelii, develops SEs in haustoria, but they do not have a direct contact to the host’s SE [6]. In secondary haustoria of a root obligate parasitic plant, Phelipanche ramosa, SEs appear to develop, however, a final cell that attaches to host’s SE is of parenchymatous nature [6]. On the other hand, transport function of haustorial phloem has been demonstrated by using symplasmic tracers. Studies using fluorescent symplasmic tracers have demonstrated that carboxyfluorescein or CC-expressed green fluorescent protein (GFP) can be transported from host to parasite through haustoria in Cuscuta reflexa [7,8], Phelipanche ramosa [9], and P. aegyptiaca [10]. In haustoria of a facultative parasitic plant, Phtheirospermum japonicum, carboxyfluorescein was transported from the host’s sieve tubes to haustoria, but CC-expressed GFP was not, implying the lack of phloem-to-phloem connection between the host and parasite, or difficulty in GFP movement due to its size [11]. Despite the exception of Lathraea and P. japonicum, these studies on the cell morphology and the transport function collectively suggested that it is likely that phloem contents should be transported from the host to parasitic plants by haustorial phloem. However, because few previous studies examined the cell morphology and transport function of the haustorial phloem simultaneously, it is still unclear whether the pathway in which phloem contents are transported occurs in SEs. In this study, we observed the transport function of phloem-conducting cells in haustoria and their morphology at the same time. We identified phloem-conducting cells in haustoria by the plant-to-plant translocation of GFP from AtSUC2pro::GFP tomato sieve tubes. GFP-conducting cells contained nuclei but not callose-rich sieve plates, indicating that phloem-conducting cells in haustoria differ from conventional sieve elements (SE). However, normal SEs were present in phloem-conducting cells in tubercle protrusions. The retention of nuclei and lack of sieve plates suggest that SE maturation is retarded in the haustoria. We also investigated the expression profiles of genes involved in SE differentiation, including homologs of NAC-DOMAIN CONTAINING TRANSCRIPTION FACTOR (NAC45), NAC45/86-DEPENDENT EXONUCLEASE-DOMAIN PROTEIN 1 (NEN1), and NEN4. The relative expression levels of these genes were higher in haustoria than in the tubercle protrusions. This result was not consistent with the immaturity of sieve elements; therefore, nuclear degradation in haustorial GFP-conducting cells may not be controlled exclusively by the NAC45/86-NEN regulatory pathway. Our results also suggest that formation of plasmodesmata with a large size exclusion limit (SEL) is independent of nuclear degradation and callose deposition.

2. Results

2.1. GFP Expressed in Phloem of Host Plant Visualized a Symplasmic Pathway of a Parasitic Plant We traced a symplasmic pathway between AtSUC2pro::GFP tomato and P. aegyptiaca. The developmental stages of the P. aegyptiaca tubercles were judged by their diameters, which were 1.5 mm, 3 mm, and 1 cm (Figure1A–C). In the 3-mm-diameter tubercle, GFP was clearly detected in the haustoria and tubercle protrusions (Figure2A), so it was transported a long distance from host Plants 2017, 6, 60 3 of 12 Plants 2017, 6, 60 3 of 12 Plants 2017, 6, 60 3 of 12 sievetube to tube the to haustoria the haustoria and andprotrusions protrusions through through the the symplasmic symplasmic pathway. pathway. To To visualize visualize the the cell architecturetube to the moremorehaustoria clearly,clearly, and we we madeprotrusions made parafﬁn paraffin through sections sections th ande and symplasmic detected detected GFP GFPpathway. by immunostainingby immunostaining To visualize (Figure the(Figure 2cellB). In2B).architecture the In protrusions, the protrusions, more GFPclearly, was GFP we detected was made detected inparaffin two polesin sections two in poles the and stele in detected (Figurethe stele2 GFPC), (Figure suggesting by immunostaining 2C), suggesting that in protrusion, (Figurethat in phloem-conductingprotrusion,2B). In the protrusions,phloem-conducting cells GFP are spatiallywas cells detected are arranged spatially in two in arra poles a similarnged in inthe manner a similarstele (Figure to manner that in2C), theto thatsuggesting roots in the of vascular roots that ofin plants.vascularprotrusion, In plants. contrast, phloem-conducting In incontrast, haustoria, in cells haustoria, GFP-conducting are spatially GFP-conducting arra cellsnged appeared in acells similar toappeared be manner arranged to to be that more arranged in the irregularly roots more of (Figureirregularlyvascular2D). plants. (Figure In 2D). contrast, in haustoria, GFP-conducting cells appeared to be arranged more irregularly (Figure 2D). A Sl SlSl B Sl C A Sl SlSl B Sl C Pa Pr Pa Pr Pa Tu Pa Tu TuPa PaTu Tu Tu Pr Pr Pr Sl Pr Sl

Figure 1. Appearance of Phelipanche aegyptiaca tubercles at different parasitic stages. The tubercle Figure 1. Appearance of Phelipanche aegyptiaca tubercles at different parasitic stages. The tubercle diametersFigure 1. Appearanceare (A) 1.5 mm, of Phelipanche (B) 3 mm, andaegyptiaca (C) 1 cm.tubercles Scale bar:at different 1 mm. Tu, parasitic tubercle; stages. Pr, protrusion; The tubercle Sl, diameters are (A) 1.5 mm, (B) 3 mm, and (C) 1 cm. Scale bar: 1 mm. Tu, tubercle; Pr, protrusion; Sl, tomato;diameters Pa, are P. aegyptiaca(A) 1.5 mm,. (B) 3 mm, and (C) 1 cm. Scale bar: 1 mm. Tu, tubercle; Pr, protrusion; Sl, tomato; Pa, P. aegyptiaca. tomato; Pa, P. aegyptiaca. C Pr Pr Pr C A B Pr C Pr Pr Pr B Pr C Pr A Pr Tu Tu Pr Pr Pr Pr Pr Pr Pr Pr D t Pr D Pr D oo Pa r t D to o Pr Pa a ro Sl m o Pr Pr To at X Tomato root Sl m P X Pr Ha To X Tomato root P P X Ha P

Figure 2. Translocation of green fluorescent protein (GFP, green) from AtSUC2::GFP tomato roots to Figurea tubercle. 2.2. Translocation (A) GFP in ofof greenagreen 3-mm-diameter fluorescentfluorescent protein proteintubercle. (GFP, (GFP, Scale green) green) bar: from from 500AtSUC2::GFP AtSUC2::GFPμm. (B) GFPtomato tomato detected roots roots toby to a tubercle.immunostaininga tubercle. (A ) GFP(A) inGFP in a 3-mm-diameterparaffin in a 3-mm-diameter section tubercle.of a 3-mm-diameter tubercle. Scale bar: 500Scale tubercle.µm. bar: (B ) Scale GFP500 detectedμbar:m. 250(B) byμGFPm. immunostaining ( Cdetected) Magnified by inimageimmunostaining a paraffin of the rectangle section in a ofparaffin C a in 3-mm-diameter Panel section (B). GFPof a 3-mm-diameter tubercle.in a protrusion. Scale bar:Scaletubercle. 250 bar: µScale 100m. μ ( Cbar:m.) Magnified( D250) Magnified μm. (C image) Magnified image of the of rectangletheimage rectangle of the C in rectangleD Panel in Panel (B). C GFP(B).in Panel GFP in a in protrusion.(B). the GFP tomato- in a Scale protrusion.Phelipanche bar: 100 Scaleaegyptiacaµm. (bar:D) Magnified 100interface. μm. (D imageScale) Magnified bar: of the 100 rectangleimage μm. Tu, of Dtubercle;the in rectangle Panel Ha, (B). haustorium;D GFP in Panel in the (B). tomato-Pr, GFP protrusion; inPhelipanche the tomato- X, xylem aegyptiacaPhelipanche of tomato;interface. aegyptiaca P, phloem Scale interface. bar: of tomato; 100 Scaleµm. Sl, Tu,bar: tomato; tubercle; 100 μm. Pa, Ha,Tu, P. haustorium;aegyptiacatubercle; Ha,. Pr, haustorium; protrusion; Pr, X, protrusion; xylem of tomato; X, xylem P, phloem of tomato; of tomato; P, phloem Sl, tomato; of tomato; Pa, P.Sl, aegyptiaca tomato; Pa,. P. aegyptiaca. 2.2. Nuclei Were Present in GFP-Conducting Cells 2.2. Nuclei Were Present in GFP-Conducting Cells Most ofof thethe GFP-conducting GFP-conducting cells cells in thein haustoriathe haustoria contained contained nuclei. nuclei. We stained We stained haustorial haustorial sections fromsectionsMost the from 1.5-mm-diameter of thethe 1.5-mm-diameterGFP-conducting and 3-mm-diameter andcells 3-mm-diameter in the tubercleshaustoria tubercles with contained 406-diamidino-2-phenylindole with nuclei.4′6-diamidino-2-phenylindole We stained haustorial (DAPI) (Figure(DAPI)sections 3(Figure A,B),from the and 3A,B), 1.5-mm-diameter we foundand we that found GFP-conducting and that 3-mm-diameter GFP-conducting cells tubercles in haustoria cells with in haustoria of4′6-diamidino-2-phenylindole both the of 1.5-mm-diameterboth the 1.5-mm- tubercle,diameter(DAPI) (Figure whichtubercle, did3A,B), which not and seem did we tonot found have seem anythat to protrusions, haveGFP-conducting any protrusions, and the cells 3-mm-diameter inand haustoria the 3-mm-diameter of tubercle, both the which tubercle,1.5-mm- had elongatedwhichdiameter had tubercle, protrusions, elongated which protrusions, contained did not nuclei. seemcontained to This have nuclei. suggests any Thisprotrusions, that suggests GFP-conducting and that the GFP- 3-mm-diameter cellsconducting in the haustoria cells tubercle, in the do nothaustoriawhich develop had do elongated intonot maturedevelop protrusions, SEs. into mature contained SEs. nuclei. This suggests that GFP-conducting cells in the haustoria do not develop into mature SEs. Plants 2017, 6, 60 4 of 12 Plants 2017, 6, 60 4 of 12 Plants 2017, 6, 60 4 of 12 A B A B

Figure 3. Green fluorescent protein (GFP)-conducting cells containing nuclei in the haustoria of (A) a Figure 3. Green fluorescent protein (GFP)-conducting cells containing nuclei in the haustoria of (A) a 1.5-mm-diameterFigure 3. Green fluorescent tubercle and protein (B) a (GFP)-conducting 3-mm-diameter tubercle. cells containing White a rrowsnuclei indicatein the haustoria nuclei. Mostof (A )of a 1.5-mm-diameter1.5-mm-diameter tubercletubercle and and ( B(B) a) a 3-mm-diameter 3-mm-diameter tubercle. tubercle. White White arrows arrows indicate indicate nuclei. nuclei. Most Most of the of the GFP-conducting cells contained nuclei. Scale bar:µ 50 μm. GFP-conductingthe GFP-conducting cells cells contained contained nuclei. nuclei. Scale Scale bar: bar: 50 50m. μm. 2.3. GFP-Conducting Cells in Haustoria Were Not Mature SEs 2.3. GFP-Conducting Cells in Haustoria Were NotNot MatureMature SEsSEs To ascertain whether GFP-conducting cells in haustoria are SEs, we detected nuclei with DAPI To ascertain whether GFP-conducting cells in haustoria are SEs, we detected nuclei with DAPI stainingTo ascertainand callose-rich whether sieve GFP-conducting plate with Aniline cells in Blue haus stainingtoria are using SEs, thewe detecteddeveloped, nuclei 1-cm-diameter with DAPI staining and callose-rich sieve plate with Aniline Blue staining using the developed, 1-cm-diameter tubercle.staining andIn thecallose-rich haustoria, sieve nucl plateei werewith Anilineco-localized Blue stainingwith GFP-conducting using the developed, cells (Figure 1-cm-diameter 4A–C); tubercle. In the haustoria, nuclei were co-localized with GFP-conducting cells (Figure4A–C); however, however,tubercle. calloseIn the depositionhaustoria, wasnucl einot were detected co-localized in cell walls with between GFP-conducting adjacent GFP-conductingcells (Figure 4A–C); cells, callose deposition was not detected in cell walls between adjacent GFP-conducting cells, indicating indicatinghowever, callosethat no depositionsieve plates was had not developed detected (Figure in cell 4G–I).walls betweenHowever, adjacent in the protrusions, GFP-conducting few nuclei cells, that no sieve plates had developed (Figure4G–I). However, in the protrusions, few nuclei were found wereindicating found that in GFP-conductingno sieve plates ha cellsd developed (Figure 4D–F), (Figure whereas 4G–I). However,callose deposition in the protrusions, was clearly few detected nuclei in GFP-conducting cells (Figure4D–F), whereas callose deposition was clearly detected between betweenwere found neighboring in GFP-conducting GFP-conducting cells (Figure cells, indicating4D–F), whereas the presence callose ofdeposition sieve plates was (Figure clearly 4J–L). detected To neighboring GFP-conducting cells, indicating the presence of sieve plates (Figure4J–L). To confirm confirmbetween thatneighboring the nuclei GFP-conducting were retained, cells, we counteindicatingd the the number presence of of GFP-cond sieve platesucting (Figure cells 4J–L). with Toor that the nuclei were retained, we counted the number of GFP-conducting cells with or without withoutconfirm nucleithat the in nucleithe haustorial were retained, and protrusion we counte sectdions the (Figurenumber 4M). of GFP-cond In the haustoria,ucting cells nuclei with were or nuclei in the haustorial and protrusion sections (Figure4M). In the haustoria, nuclei were detected in detectedwithout nucleiin approximately in the haustorial 62% of and GFP-conducting protrusion sect cellionss. In(Figure the protrusions, 4M). In the nuclei haustoria, were nucleidetected were in approximately 62% of GFP-conducting cells. In the protrusions, nuclei were detected in approximately approximatelydetected in approximately 7% of GFP-conducting 62% of GFP-conducting cells, which was cell s.a significantlyIn the protrusions, lower nucleipercentage were than detected that inin 7% of GFP-conducting cells, which was a significantly lower percentage than that in the haustoria. theapproximately haustoria. This 7% ofresult GFP-conducting demonstrates cells, that whichGFP-conducting was a significantly cells in haustoria lower percentage are not maturethan that SEs, in This result demonstrates that GFP-conducting cells in haustoria are not mature SEs, whereas those in whereasthe haustoria. those Thisin protrusions result demonstrates are. that GFP-conducting cells in haustoria are not mature SEs, protrusionswhereas those are. in protrusions are. GFP DAPI Merged ABGFP DAPI C Merged AB C

Ha Ha

DE F DE F

Pr Pr

Figure 4. Cont. Plants 2017, 6, 60 5 of 12 Plants 2017, 6, 60 5 of 12

GFP Aniline Blue Merged GH I

JKL

M p= 0.0001 70 60 50 40 30 20 10 0 Ha Pr to GFP-conducting all cells (%) (n=6) (n=3)

Ratio of nucleated GFP-conducting cells GFP-conducting nucleated of Ratio

FigureFigure 4.4. DetectionDetection of of nuclei nuclei and and callose-rich callose-rich sieve sieve plates plates in green in ﬂuorescent green fluorescent protein (GFP)-conducting protein (GFP)- conductingcells in a 1-cm-diameter cells in a 1-cm-diameter tubercle. (A tubercle.–C) 406-diamidino-2-phenylindole (A–C) 4′6-diamidino-2-phenylindole (DAPI) staining (DAPI) of staining haustorial of haustorialcells; (A) GFP, cells; ( B(A) DAPI,) GFP, ( andB) DAPI, (C) merged. and (C) ( Dmerged.–F) DAPI (D– stainingF) DAPI of staining protrusion of protrusion cells; (D) GFP,cells; ((ED)) DAPI, GFP, (andE) DAPI, (F) merged. and (F White) merged. arrows White indicate arrows nuclei. indicate (G–I )nuclei. Aniline (G Blue–I) Aniline staining Blue of haustorial staining cells;of haustorial (G) GFP, cells;(H) Aniline (G) GFP, Blue, (H and) Aniline (I) merged. Blue, and (J–L ()I Aniline) merged. Blue (J– stainingL) Aniline of Blue protrusion staining cells; of protrusion (J) GFP, (H )cells; Aniline (J) GFP,Blue, ( andH) Aniline (I) merged. Blue, Whiteand (I) trianglesmerged. indicateWhite triangles sieve plates. indicate Scale sieve bar: plates. 50 µ m.Scale (M bar:) Percentage 50 μm. (M of) Percentagenucleated GFP-conducting of nucleated GFP-conducting cells to all GFP-conducting cells to all cells. GFP-conducting Ha, haustorium; cell Pr,s. protrusion.Ha, haustorium; The means Pr, protrusion.and standard The deviations means and of sixstandard and three deviations different of haustorialsix and three and different protrusion ha specimens,ustorial and respectively, protrusion specimens,are presented. respectiven: numberly, are of presented. specimens. n: number of specimens.

2.4.2.4. SE SE Differentiation-Related Differentiation-Related Genes Genes Were Expressed in Haustoria SESE differentiation is regulated byby thethe transcriptiontranscription factorfactor NAC45/86NAC45/86 [[12].12]. NAC45/86NAC45/86 positively positively controlscontrols the the expression expression of of NEN1NEN1 toto NEN4NEN4, which, which are are responsible responsible for for the the degradation degradation of nuclei of nuclei in SE in precursorSE precursor cells cells (Figure (Figure 5A).5A). Nuclear Nuclear retention retention in in haustorial haustorial GFP-conducting GFP-conducting cells cells may have beenbeen causedcaused by by the the suppression suppression of of NAC45NAC45/86/86 andand NENNEN expressionexpression to to lower lower than than that that in in the the protrusions, protrusions, which resulted resulted in in the the inhibition inhibition of of nuclear nuclear degradation degradation in inthe the haustoria. haustoria. To test To testthis thishypothesis, hypothesis, we dissectedwe dissected a tomato a tomato root root containing containing the the haustorium haustorium and and the the rest rest of of the the tubercle tubercle (diameter (diameter 3 ± 11 mm), mm), andand quantified quantiﬁed the the relative relative expression expression levels levels of ofPaNAC45PaNAC45, PaNEN1,, PaNEN1 and, and PaNEN4PaNEN4. Unexpectedly,. Unexpectedly, the relativethe relative expression expression levels levels of all of allthree three genes genes were were significantly signiﬁcantly higher higher in in the the haustorium haustorium than than in in the the protrusion (Figure 5 5B–D),B–D), suggestingsuggesting thatthat SESE differentiationdifferentiationis is indeed indeed activated activated in in the the haustorium. haustorium. Plants 2017, 6, 60 6 of 12 Plants 2017, 6, 60 6 of 12

A Stage1 Stage2 Stage3 Nuclear structure modified Nucleus becomes distorted Enucleation completed

NNsp sp NAC45/86 NEN1/2 spNEN4 sp

BCDp=0.02 p=0.02 p=0.02 ) ) ) 20 14 14 12 12 15 PaUBQ PaUBQ PaUBQ 10 10 8 8 10 6 6 5 4 4 Relative expression Relative expression Relative expression 2 2 (normalized by (normalized (normalized by (normalized (normalized by (normalized 0 0 0 Ha Pr Ha Pr Ha Pr PaNAC45 PaNEN1 PaNEN4

FigureFigure 5. (5.A )(A Stages) Stages of of sieve sieve element element differentiation. differentiation. N,N, nucleus;nucleus; sp, sp, sieve sieve plate plate pore. pore. (B (B–D–D) Relative) Relative expressionexpression levels levels of of (B ()BPaNAC45) PaNAC45,(,C (C) )PaNEN1 PaNEN1,, and and ((DD)) PaNEN4 inin a a surgically surgically separated separated haustorium haustorium (Ha)(Ha) and and protrusion protrusion (Pr). Expression(Pr). Expression levels levels were normalized were normalized to that oftoPhelipanche that of Phelipanche aegyptiaca UBIQUITINaegyptiaca (PaUBQUBIQUITIN). The means (PaUBQ and). The standard means deviationsand standard of threedeviations replicates of three are replicates presented. are NAC presented. = NAC-domain NAC = containingNAC-domain transcription containing factor; transcription NEN = NAC45/86-dependent factor; NEN = NAC45/86-dependent exonuclease-domain exonuclease-domain protein. protein. 3. Discussion 3. Discussion 3.1. Haustorial Phloem-Conducting Cells Are Not Mature SEs 3.1. Haustorial Phloem-Conducting Cells Are Not Mature SEs The movement of GFP that is expressed in the host’s CCs to parasitic plants has been reported in The movement of GFP that is expressed in the host’s CCs to parasitic plants has been reported a stem parasitic plant (Cuscuta reflexa)[7,8] and root parasitic plants (P. ramosa and P. aegyptiaca)[9,10]. in a stem parasitic plant (Cuscuta reflexa) [7,8] and root parasitic plants (P. ramosa and P. aegyptiaca) GFP is smaller (27 kDa) than the typical size exclusion limit (SEL) of plasmodesmata between CCs [9,10]. GFP is smaller (27 kDa) than the typical size exclusion limit (SEL) of plasmodesmata between and SEs (that can be as large as 67 kDa) [13], so GFP synthesized in CCs can be translocated to CCs and SEs (that can be as large as 67 kDa) [13], so GFP synthesized in CCs can be translocated to SEs. In addition, in Arabidopsis and tobacco plants that express AtSUC2pro::GFP, GFP is restricted to SEs. In addition, in Arabidopsis and tobacco plants that express AtSUC2pro::GFP, GFP is restricted to thethe phloem phloem [14 [14].]. These These results results suggest suggest that that GFPGFP expressedexpressed in CCs is is translocated translocated within within the the SE-CC SE-CC complex,complex, and and the the translocation translocation of of GFP GFP into into parasitic parasiti plantsc plants means means that that there there should should be be a a continuity continuity of sieveof tubessieve acrosstubes across the boundary the boundary between between the host th ande host parasitic and parasitic plants, andplants, GFP and moves GFP non-selectivelymoves non- fromselectively the source from (host) the source to the sink(host) (parasite) to the sink following (parasite) the following phloem the translocation phloem translocation stream. stream. GFP-conductingGFP-conducting cells cells in in the the haustoriahaustoria ofof P.P. aegyptiacaaegyptiaca contained nuclei nuclei but but not not sieve sieve plates plates (Figures(Figures3A,B 3A,B and and4C). 4C). Conventional Conventional sieve sieve tube tube elements elements are are characterized characterized byby thethe eliminationelimination of of cellularcellular components, components, includingincluding nuclei nuclei during during develo developmentpment [15] [and15] callose and callose deposition deposition in sieve inplates sieve plates[16]. [ 16The]. apparent The apparent lack of lack these of attrib theseutes attributes first led us first to ledexamine us to whether examine P. whetheraegyptiacaP. is aegyptiacacapable of is capabledeveloping of developing SEs in other SEs organs. in other In the organs. tubercles, In theGFP tubercles,moved a long GFP distance moved to a the long protrusions, distance toand the protrusions,GFP-conducting and GFP-conducting cells were clearly cells werevisible clearly there visible (Figure there 2C). (Figure In contrast2C). In to contrast in haustoria, to in haustoria, GFP- GFP-conductingconducting cells cells in inthe the protrusions protrusions had had sieve sieve plat plates,es, and and fewer fewer nuclei nuclei than than the the surrounding surrounding cells cells (Figure(Figure4J–L). 4J–L). Therefore, Therefore,P. P. aegyptiaca aegyptiacashould should not not have have any any defects defects inin thethe development of of SEs. SEs. TheThe presence presence of of nucleated nucleated SEs SEs inin haustoriahaustoria have have been been reported reported in inC. C.gronovii gronovii [5].[ 5In]. C. In gronoviiC. gronovii, it , it hashas been been reported reported that that most most of the of cellsthe incells haustorial in haustorial sieve tubes, sieve whichtubes, were which recognized were recognized as continuous as continuous strands of elongated cells which made connection with the host phloem, had prominent strands of elongated cells which made connection with the host phloem, had prominent nuclei [5]. nuclei [5]. The nucleated phloem-conducting cells of P. aegyptiaca are similar to SEs of C. gronovii. The nucleated phloem-conducting cells of P. aegyptiaca are similar to SEs of C. gronovii. However, However, the study using C. gronovii did not clarify whether phloem transport occurred in “the the study using C. gronovii did not clarify whether phloem transport occurred in “the continuous continuous strands of elongated cells”. In this study, we clearly identified phloem-conducting cells strands of elongated cells”. In this study, we clearly identified phloem-conducting cells in P. aegyptiaca in P. aegyptiaca haustoria by tracing the transport of contents of host’s sieve tubes (i.e., GFP), and Plants 2017, 6, 60 7 of 12 haustoria by tracing the transport of contents of host’s sieve tubes (i.e., GFP), and demonstrated that the GFP-conducting cells were nucleated and lacked sieve plates (Figures3 and4). To explain the retention of nuclei, we first hypothesized that SE differentiation activity could be low in haustoria, and, consequently, SE maturation is retarded. However, the expression level of PaNAC45, which is responsible for the regulation of SE differentiation, and the expression levels of PaNEN1 and PaNEN4, which are responsible for nuclear degeneration [12], were higher in the haustoria than in the protrusions (Figure5B–D), which does not support the hypothesis that SE differentiation activity is low in haustoria.

3.2. Why Do Haustorial Phloem-Conducting Cells Fail to Undergo Nuclear Degradation? It has recently been reported that nucleated SEs were present in an Arabidopsis loss-of-function mutant of genes similar to SUPPRESSOR OF MAX2 1-LIKE (SMXL), smxl4;smxl5 [17]. Although functions of SMXL4 and SMXL5 were finally shown to be independent of strigolactone and karrikin signaling [17], they were shown to be involved in differentiation of protophloem in the root, since in cells located at positions expected for SEs, degradation of nuclei did not occur [17]. However, expression levels of genes involved in SE differentiation, including NEN4, NAC86 [12], ALTERED PHLOEM DEVELOPMENT (APL)[18], and CALLOSE SYNTHASE 7 (CALS7)[19], were lower than those of wild type Arabidopsis during induction of phloem differentiation using VISUAL [20], which is different from the gene expression profiles observed in haustoria of P. aegyptiaca (Figure5B–D). SMXL4 and SMXL5 might regulate the NAC-NEN regulatory pathway of phloem differentiation [21]. We thus speculate that retention of nuclei in haustorial GFP-conducting cells may not be due to the repression of SMXLs. Retention of nuclei in the root protophloem was also observed in a triple mutant of brassinosteroid (BR) receptor genes, brassinosteroid insensitive 1 (bri1); bri1-like 1 (brl1); bri1-like 3 (brl3)[22]. The BR signaling pathway is known to be activated by a polarly localized membrane-associated protein OCTOPUS (OPS) [23]. Morphologies of SEs in bri1;brl1;brl3 and ops mutants were similar to that of haustorial GFP-conducting cells. In roots of bri1;brl1;brl3 and ops mutants, differentiation of SEs in the protophloem cell file was discontinuous, and nuclear degradation or callose deposition were not seen in the protophloem cell file gaps, indicating that loss-of-function of BR receptor genes and OPS delays protophloem differentiation [22,24]. A loss-of-function mutant of a homolog of OPS, OCTOPUS-LIKE 2 (OPL2), also had a defect in metaphloem differentiation [25]. It has been proposed that the NAC-NEN regulatory pathway is not directly coupled to the BR signaling pathway including OPS, although a crosstalk between these pathways has not been studied in detail [21]. If repression of OPS does not down-regulate NEN genes, expression levels of NEN genes could stay high in differentiating SEs, and SEs possibly retain nuclei like in the ops mutant. This argument tempts us to hypothesize that nuclear retention in haustorial GFP-conducting cells may be due to the repression in the BR-perception associated with the downregulation of an OPS ortholog of P. aegyptiaca. Identification of P. aegyptiaca OPS is currently underway. A hypothesis from a different point of view for the nuclear retention is that exonuclease activities of NEN1 and NEN4 may be repressed by an inhibitor protein. In the case of apoptosis, a major apoptotic nuclease, Caspase-activated DNase (CAD), is deactivated by complex formation with the inhibitor of CAD (ICAD) [26]. During apoptotic execution of nuclear degradation, ICAD is cleaved by a protease, caspase, and then CAD is liberated to form an active homo-dimer [27]. We speculate that NEN1 and NEN4 might be deactivated in haustorial GFP-conducting cells by a nuclease inhibitor, although the inhibitor needs to be identified.

3.3. Retention of Nuclei Is Independent of Other SE Differentiation Processes In the haustorial GFP-conducting cells, the nuclei were retained not only in developing tubercles that were 1.5 mm and 3 mm in diameter (Figure3A,B), but also in developed, 1-cm-diameter tubercles (Figure4A–C). This suggests that nuclear retention in phloem-conducting cells occur in haustoria in Plants 2017, 6, 60 8 of 12 an organ-speciﬁc manner. Our ﬁndings clearly demonstrate that phloem-conducting cells retain their nuclei and do not develop sieve plates even after an array of cells has started transporting phloem materials, suggesting that nuclear degradation and sieve plate formation are coordinated, while the formation of plasmodesmata with large SEL is independent of them. It has been suggested that degradation of nucleus controlled by the NAC45-dependent regulatory pathway is independent of the callose accumulation [12]. Regarding the formation of plasmodesmata with large SEL, it has been reported that development of the sieve plate pores is affected by CHOLINE TRANSPORTER-LIKE 1 (CHER1), since cher1-1 mutant of Arabidopsis has been shown to have reduced phloem conductivity [28]. It is currently unclear whether CHER1 is controlled by the same upstream transcriptional regulator as those controlling the nuclear degradation or callose deposition. Taken together, it can be hypothesized that the processes of sieve element differentiation, such as nuclear degeneration, sieve plate formation, and formation of plasmodesmata with large SELs, may be controlled independently. Regulatory relationships between the pathways that lead to these cellular events remain to be investigated.

4. Materials and Methods

4.1. Plant Materials P. aegyptiaca seeds were stored at 4 ◦C in the dark. The seeds were surface-sterilized with 1 mL of 99.5% (v/v) ethanol for 1 min and 1 mL of 1% (v/v) sodium hypochlorite (Wako Pure Chemical Industries, Ltd., Osaka, Japan) for 10 min, twice. After washing with sterile distilled water three times, the seeds were spread on sterilized glass filter paper (ADVANTEC, Tokyo, Japan) with 3 mL of sterile distilled water inside a plastic dish and incubated in the dark at 25 ◦C for 3 days. One day after applying the synthetic germination stimulant rac-GR24 (Chiralix, Nijmegen, Netherlands) (final concentration, 2 mg/L) to induce germination, the seeds on the glass filter paper were placed on Murashige and Skoog (MS) solid medium supplemented with MS Plant Salt Mixture (Wako Pure Chemical Industries, Ltd.), 3% (w/v) of sucrose (Wako Pure Chemical Industries, Ltd.), MS modified vitamin solution (1000×) (final concentration, 1×) (MP Biomedicals, Santa Ana, CA, USA), and 0.8% (w/v) of agarose with the pH adjusted to 5.8. The paper was then removed and the seeds were incubated in the dark at 25 ◦C. The host plants, Solanum lycopersicum ‘Micro-Tom’ (accession number TOMJPF00001, National Bioresource Project, Japan) and transgenic tomato plants (Solanum lycopersicum ‘M82’) expressing AtSUC2pro::GFP, were grown on rhizotrons under a 16/8 h light/dark cycle at 25 ◦C. Three days after the GR24 treatment, germinated P. aegyptiaca seeds were inoculated to 3-week-old host plants in rhizotrons and grown under a 16/8 h light/dark cycle at 25 ◦C.

4.2. Cloning Complementary DNA (cDNA) of PaNEN1, PaNEN4, and PaNAC45 To select P. aegyptiaca target genes, contigs of the Parasitic Plant Genome Project OrAeBC5 dataset (http://ppgp.huck.psu.edu/) were compared with the protein sequence of Sesamum indicum provided in Sinbase (http://ocri-genomics.org/Sinbase/)[29] using BLASTx [30]. Based on the top hits, OrAeBC5_5123, OrAeBC5_14368.1, and OrAeBC5_32545.1 were chosen for PaNEN1, PaNEN4, and PaNAC45, respectively. For cloning, gene-specific primers were designed based on the sequence of each contig (Table1). For cDNA isolation, P. aegyptiaca tubercles that were frozen in liquid nitrogen were homogenized using a pestle and mortar. Total RNA was extracted using a Qiagen RNeasy Plant Mini Kit (Qiagen, Hilden, Germany), according to the manufacturer’s protocol. cDNA was synthesized using a ReverTra Ace® quantitative polymerase chain reaction (qPCR) reverse transcription (RT) kit (Toyobo, Osaka, Japan) and an oligo (dT) primer (Toyobo). Using gene-specific primers, partial sequences of the target genes were amplified, extracted from agarose gel using a Wizard® SV Gel and PCR Clean-Up System (Promega, Madison, WI, USA), and cloned into a pCR™-Blunt II TOPO® vector using a Zero Blunt® TOPO® PCR Cloning Kit (Thermo Fisher Scientific, Waltham, MA, USA). The cDNA sequences of PaNAC45, PaNEN1, and PaNEN4 are provided in Supplementary Table S1. Plants 2017, 6, 60 9 of 12

The nucleotide sequences reported in this paper have been submitted to the DNA Data Bank of Japan under accession numbers; PaNAC45: LC333147, PaNEN1: LC333148, and PaNEN4: LC333149.

Table 1. Primers used in this study.

Primer ID Sequence (50 → 30) PaNEN1 forward ACAAGCAAGCTATACATAACCGTG PaNEN1 reverse TAACAGCACCAAAGTTAAATCAAACC PaNEN1 qPCR forward ACAAGCAAGCTATACATAACCGTG PaNEN1 qPCR reverse TATTCAGGAAATAAAGAATAATGGGAGC PaNEN4 forward ACAGATGTAGTGTATGCTAGGATTACC PaNEN4 reverse ATAACGACACCATCTTACAAAGTTTGAAC PaNEN4 qPCR forward AGGAAGAACTCATTCTTGCTAACAAC PaNEN4 qPCR reverse TGACATTGTCAGTTGTAACATACTG PaNAC45 forward ATTTCAAAAAAGGACCAGGAGACTGG PaNAC45 reverse AGTTCATTGGCATTGGATATTCAGAAG PaNAC45 qPCR forward ATCAATGGCCGCAAAATCGATC PaNAC45 qPCR reverse TACCATTCAAGATCTTTGCTTGGC PaUBQ1 qPCR forward ATCACTGCCTGATTATCAGACGC PaUBQ1 qPCR reverse TAGGGAATCAACTCGATTATGGCG

4.3. Real Time PCR Two weeks after parasitization on the ‘Micro-Tom’ plant, parasitic interface tissues were surgically separated into ‘haustorium’ (Ha) and ‘protrusion’ (Pr) samples. RNA was extracted from each sample (approximately 100 mg) and treated with DNase using a TURBO DNA-free™ Kit (Thermo Fisher Scientific). cDNA was synthesized using a ReverTra Ace® qPCR RT kit (Toyobo) and an oligo (dT) primer (Toyobo). Based on previous studies [31,32], the stable-expression gene Ubiquitin1 (PaUBQ1) (OrAeBC4_32941) was chosen as a reference gene for normalization. In order to avoid amplification of the host’s genes, primers were designed based on untranslated region sequence of each contig and confirmed parasite-specific amplification. qRT-PCR was performed using SYBR® Green on Applied Biosystems StepOne™ Real Time PCR System (Thermo Fisher Scientific). PCR reactions were performed in 20-µL total volume (per well) that contained 1 µL of cDNA, 0.4 µL each of the gene-specific primers (10 µM), 10 µL of Fast SYBR™ Green Master Mix (Thermo Fisher Scientific), and water, according to the manufacturer’s protocol. The annealing temperature was set at 56 ◦C. For generating standard curves of target genes, cDNA from P. aegyptiaca protrusion tissue was diluted to 1:5, 1:25, 1:125, and 1:625. Data were analyzed using StepOneTM Software v2.3 (Thermo Fisher Scientific) and normalized to the PaUBQ1 expression level.

4.4. Preparation and Imaging of Agarose-Embedded Sections Two weeks after parasitization on AtSUC2pro::GFP tomato plants, parasitic interface tissues were cut and embedded in 5% (w/v) agarose without ﬁxation, and cut using MicroSlicerTM ZERO 1N (DOSAKA, Kyoto, Japan) into 100-µm sections. The sections were then stained with 1% (w/v) Aniline Blue (WALDECK GmbH & Co., KG, Waldeck, Germany) at room temperature for 2 h and washed with phosphate-buffered saline (PBS) (137 mM NaCl, 2.7 mM KCl, 8.1 mM Na2HPO4, and 1.47 mM KH2PO4) three times.

4.5. Immunostaining Immunostaining was performed as previously described [33], with slight modifications. Two weeks after parasitization on AtSUC2pro::GFP tomato plants, parasitic interface tissues were fixed with 4% (w/v) paraformaldehyde phosphate buffer solution (Wako Pure Chemical Industries Ltd., Richmond, VA, USA) and embedded in paraffin (Paraplast, Leica Biosystems, Richmond, VA, USA) according to the conventional protocol [34]. Paraffin blocks were cut with a microtome (PR-50, Plants 2017, 6, 60 10 of 12

Yamato Kohki, Saitama, Japan) into 10-µm sections and fixed on glass slides at 40 ◦C for 1 day. After deparaffinization, the sections were treated with blocking buffer (1% w/v bovine serum albumin (Nacalai Tesque, Kyoto, Japan) in PBS pH 7.0) for 2 h at room temperature in a humidified chamber and washed three times with PBS. They were then incubated with primary antibodies (monoclonal mouse anti-GFP antibody (Nacalai Tesque, Kyoto, Japan, 4363-24) 1:1000 in blocking buffer, and normal rat IgG 1:1000 in blocking buffer) over night at 4 ◦C in a humidified chamber. After washing three times with PBS, sections were incubated with secondary antibody (CF568 Donkey Anti-Mouse IgG (H + L) (Biotium, Fremont, CA, USA) that was highly cross-adsorbed, and diluted 1:750 in blocking buffer) for 2 h, washed three times with PBS, and incubated with 2 µg/mL DAPI (Nacalai Tesque) for 20 min at room temperature in a dark, humidified chamber. After removing excess buffer, the sections were encapsulated in SlowFade™ Diamond Antifade Mountant (Thermo Fisher Scientific).

4.6. Confocal Laser-Scanning Microscopy Images were taken by using a confocal laser-scanning microscope (Leica 408 TCS SP8, Leica Microsystems, Wetzlar, Germany). GFP was excited at 488 nm and the light emitted was captured at 500 to 530 nm. CF568 was excited at 552 nm, and the light emitted was captured at 580 to 610 nm. DAPI and Aniline Blue were excited at 405 nm, and the light emitted was captured at 430 to 480 nm. Images were analyzed using Leica Application Suite X (Leica Microsystems).

Supplementary Materials: The following are available online at www.mdpi.com/2223-7747/6/4/60/s1, Table S1: DNA sequences of PaNEN1, PaNEN4, and PaNAC45 cDNAs. Acknowledgments: We thank Joseph Hershenhorn (Volcani Center, Israel) for providing us with P. aegyptiaca seeds, Shmuel Wolf (The Hebrew University of Jerusalem, Israel) for the AtSUC2pro::GFP tomato seeds, and the National BioResource Project Tomato (AMED, Japan) for providing us with ‘Micro-Tom’ seeds (accession number: TOMJPF00001). We also thank Junpei Takano and Akira Yoshinari (Osaka Prefecture University) for the confocal laser-scanning microscopy. This study was partly supported by the Scientific Research in Innovative Areas project “The Plant Cell Wall as an Information Processing System” (MEXT, Japan) to KA (grant No. 15H01237), and by the Grant-in-Aid for Scientific Research (B) to KA (grant No. 16H04875). Author Contributions: M.E. performed the experiments, analyzed the data, and wrote the paper; K.A. conceived and designed the experiments, analyzed the data, and wrote the paper. Conflicts of Interest: The authors declare no conflict of interest.

Abbreviations

BR brassinosteroid CC companion cell CHER1 CHOLINE TRANSPORTER-LIKE 1 DAPI 40,6-diamidino-2-phenylindole PBS phosphate-buffered saline qPCR quantitative polymerase chain reaction SE sieve element SEL size exclusion limit SUC2 SUCROSE-PROTON SYMPORTER 2

References

1. Parker, C. Observations on the current status of Orobanche and Striga problems worldwide. Pest Manag. Sci. 2009, 65, 453–459. [CrossRef][PubMed] 2. Fernández-Aparicio, M.; Reboud, X.; Gibot-Leclerc, S. Broomrape weeds. Underground mechanisms of parasitism and associated strategies for their control: A review. Front. Plant Sci. 2016, 7, 135. [CrossRef] [PubMed] 3. Dörr, I. How Striga parasitizes its host: A TEM and SEM study. Ann. Bot. 1997, 79, 463–472. [CrossRef] 4. Bar-Nun, N.; Sachs, T.; Mayer, A.M. A role for IAA in the infection of Arabidopsis thaliana by Orobanche aegyptiaca. Ann. Bot. 2008, 101, 261–265. [CrossRef][PubMed] Plants 2017, 6, 60 11 of 12

5. Truscott, F.H. On the regeneration of new shoots from isolated dodder haustoria. Am. J. Bot. 1958, 45, 169–177. [CrossRef] 6. Dörr, I. Sieve elements in haustoria of parasitic angiosperms. In Sieve Elements: Comparative Structure, Induction and Development; Behnke, H.-D., Sjolund, R.D., Eds.; Springer: Berlin, Germany, 1990; pp. 239–256. 7. Haupt, S.; Oparka, K.J.; Sauer, N.; Neumann, S. Macromolecular trafficking between Nicotiana tabacum and the holoparasite Cuscuta reflexa. J. Exp. Bot. 2001, 52, 173–177. [CrossRef][PubMed] 8. Birschwilks, M.; Haupt, S.; Hofius, D.; Neumann, S. Transfer of phloem-mobile substances from the host plants to the holoparasite Cuscuta sp. J. Exp. Bot. 2006, 57, 911–921. [CrossRef][PubMed] 9. Péron, T.; Candat, A.; Montiel, G.; Veronesi, C.; Macherel, D.; Delavault, P.; Simier, P. New insights into phloem unloading and expression of sucrose transporters in vegetative sinks of the parasitic plant Phelipanche ramosa L. (Pomel). Front. Plant Sci. 2016, 7, 2048. [CrossRef][PubMed] 10. Aly, R.; Hamamouch, N.; Abu-Nassar, J.; Wolf, S.; Joel, D.M.; Eizenberg, H.; Kaisler, E.; Cramer, C.; Gal-On, A.; Westwood, J.H. Movement of protein and macromolecules between host plants and the parasitic weed Phelipanche aegyptiaca Pers. Plant Cell Rep. 2011, 30, 2233–2241. [CrossRef][PubMed] 11. Spallek, T.; Melnyk, C.W.; Wakatake, T.; Zhang, J.; Sakamoto, Y.; Kiba, T.; Yoshida, S.; Matsunaga, S.; Sakakibara, H.; Shirasu, K. Interspecies hormonal control of host root morphology by parasitic plants. Proc. Natl. Acad. Sci. USA 2017, 114, 5283–5288. [CrossRef][PubMed] 12. Furuta, K.M.; Yadav, S.R.; Lehesranta, S.; Belevich, I.; Miyashima, S.; Heo, J.O.; Vatén, A.; Lindgren, O.; De Rybel, B.; Van Isterdael, G.; et al. Plant development. Arabidopsis NAC45/86 direct sieve element morphogenesis culminating in enucleation. Science 2014, 345, 933–937. [CrossRef][PubMed] 13. Stadler, R.; Wright, K.M.; Lauterbach, C.; Amon, G.; Gahrtz, M.; Feuerstein, A.; Oparka, K.J.; Sauer, N. Expression of GFP-fusions in Arabidopsis companion cells reveals non-specific protein trafficking into sieve elements and identifies a novel post-phloem domain in roots. Plant J. 2005, 41, 319–331. [CrossRef][PubMed] 14. Imlau, A.; Truernit, E.; Sauer, N. Cell-to-cell and long-distance trafficking of the green fluorescent protein in the phloem and symplastic unloading of the protein into sink tissues. Plant Cell 1999, 11, 309–322. [CrossRef] [PubMed] 15. Esau, K. Development and structure of the phloem tissue. II. Bot. Rev. 1950, 16, 67–114. [CrossRef] 16. Evert, R.F. Esau’s Plant Anatomy: Meristems, Cells and Tissues of the Plant Body: Their Structure, Function and Development, 3rd ed.; Wiley: Hoboken, NJ, USA, 2006; pp. 357–405. 17. Wallner, E.S.; López-Salmerón, V.; Belevich, I.; Poschet, G.; Jung, I.; Grünwald, K.; Sevilem, I.; Jokitalo, E.; Hell, R.; Helariutta, Y.; et al. Strigolactone- and karrikin-independent SMXL proteins are central regulators of phloem formation. Curr. Biol. 2017, 27, 1241–1247. [CrossRef][PubMed] 18. Bonke, M.; Thitamadee, S.; Mähönen, A.P.; Hauser, M.T.; Helariutta, Y. APL regulates vascular tissue identity in Arabidopsis. Nature 2003, 426, 181–186. [CrossRef][PubMed] 19. Xie, B.; Hong, Z. Unplugging the callose plug from sieve pores. Plant Signal. Behav. 2011, 6, 491–493. [CrossRef][PubMed] 20. Kondo, Y.; Nurani, A.M.; Saito, C.; Ichihashi, Y.; Saito, M.; Yamazaki, K.; Mitsuda, N.; Ohme-Takagi, M.; Fukuda, H. Vascular cell induction culture system using Arabidopsis leaves (VISUAL) reveals the sequential differentiation of sieve element-like cells. Plant Cell 2016, 28, 1250–1262. [CrossRef][PubMed] 21. Heo, J.O.; Blob, B.; Helariutta, Y. Differentiation of conductive cells: A matter of life and death. Curr. Opin. Plant Biol. 2017, 35, 23–29. [CrossRef][PubMed] 22. Kang, Y.H.; Breda, A.; Hardtke, C.S. Brassinosteroid signaling directs formative cell divisions and protophloem differentiation in Arabidopsis root meristems. Development 2017, 144, 272–280. [CrossRef] [PubMed] 23. Anne, P.; Azzopardi, M.; Gissot, L.; Beaubiat, S.; Hématy, K.; Palauqui, J.C. OCTOPUS negatively regulates BIN2 to control phloem differentiation in Arabidopsis thaliana. Curr. Biol. 2015, 25, 2584–2590. [CrossRef] [PubMed] 24. Truernit, E.; Bauby, H.; Belcram, K.; Barthélémy, J.; Palauqui, J.C. OCTOPUS, a polarly localised membrane-associated protein, regulates phloem differentiation entry in Arabidopsis thaliana. Development 2012, 139, 1306–1315. [CrossRef][PubMed] 25. Ruiz Sola, M.A.; Coiro, M.; Crivelli, S.; Zeeman, S.C.; Schmidt Kjølner Hansen, S.; Truernit, E. OCTOPUS-LIKE 2, a novel player in Arabidopsis root and vascular development, reveals a key role for OCTOPUS family genes in root metaphloem sieve tube differentiation. New Phytol. 2017, 216, 1191–1204. [CrossRef][PubMed] Plants 2017, 6, 60 12 of 12

26. Enari, M.; Sakahira, H.; Yokoyama, H.; Okawa, K.; Iwamatsu, A.; Nagata, S. A caspase-activated DNase that degrades DNA during apoptosis, and its inhibitor ICAD. Nature 1998, 391, 43–50. [CrossRef][PubMed] 27. Woo, E.J.; Kim, Y.G.; Kim, M.S.; Han, W.D.; Shin, S.; Robinson, H.; Park, S.Y.; Oh, B.H. Structural mechanism for inactivation and activation of CAD/DFF40 in the apoptotic pathway. Mol. Cell 2004, 14, 531–539. [CrossRef] 28. Dettmer, J.; Ursache, R.; Campilho, A.; Miyashima, S.; Belevich, I.; O’Regan, S.; Mullendore, D.L.; Yadav, S.R.; Lanz, C.; Beverina, L.; et al. CHOLINE TRANSPORTER-LIKE1 is required for sieve plate development to mediate long-distance cell-to-cell communication. Nat. Commun. 2014, 5, 4276. [CrossRef][PubMed] 29. Wang, L.; Yu, J.; Li, D.; Zhang, X. Sinbase: An integrated database to study genomics, genetics and comparative genomics in Sesamum indicum. Plant Cell Physiol. 2015, 56, e2. [CrossRef][PubMed] 30. Altschul, S.F.; Madden, T.L.; Schaffer, A.A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D.J. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 1997, 25, 3389–3402. [CrossRef][PubMed] 31. González-Verdejo, C.I.; Die, J.V.; Nadal, S.; Jiménez-Marín, A.; Moreno, M.T.; Román, B. Selection of housekeeping genes for normalization by real-time RT-PCR: Analysis of Or-MYB1 gene expression in Orobanche ramosa development. Anal. Biochem. 2008, 379, 176–181. [CrossRef][PubMed] 32. Fernández-Aparicio, M.; Huang, K.; Wafula, E.K.; Honaas, L.A.; Wickett, N.J.; Timko, M.P.; Depamphilis, C.W.; Yoder, J.I.; Westwood, J.H. Application of qRT-PCR and RNA-Seq analysis for the identiﬁcation of housekeeping genes useful for normalization of gene expression values during Striga hermonthica development. Mol. Biol. Rep. 2013, 40, 3395–3407. [CrossRef][PubMed] 33. Hozumi, A.; Bera, S.; Fujiwara, D.; Obayashi, T.; Yokoyama, R.; Nishitani, K.; Aoki, K. Arabinogalactan proteins accumulate in the cell walls of searching hyphae of the stem parasitic plants, Cuscuta campestris and Cuscuta japonica. Plant Cell Physiol. 2017, 58, 1868–1877. [CrossRef][PubMed] 34. Ruzin, S.E. Sectioning and mounting. In Plant Microtechnique and Microscopy; Oxford University Press: Oxford, UK, 1999; pp. 73–85.

© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).