US 2014.0171492A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0171492 A1 Di Ruscio et al. (43) Pub. Date: Jun. 19, 2014
(54) CHMERC RNAOLIGONUCLEOTDES AND Related U.S. Application Data USES THEREOF (60) Provisional application No. 61/475,566, filed on Apr. 14, 2011. (75) Inventors: Annalisa Di Ruscio, Brookline, MA (US); Alexander K. Ebralidze, Publication Classification Brookline, MA (US); Daniel G. Tenen, Jamaica Plain, MA (US); Giuseppe (51) Int. C. Leone, Rome (IT) CI2N IS/II3 (2006.01) (52) U.S. C. (73) Assignees: Universita Cattolica del Sacro Cuore, CPC ...... CI2N 15/I 13 (2013.01) Rome (IT): Beth Israel Deaconess USPC ...... 514/44 R:536/24.5:536/25.3; 435/6.11 Medical Center, Inc., Boston, MA (US) (57) ABSTRACT (21) Appl. No.: 14/111,971 The present invention relates to chimeric RNA oligonucle otides that are single-stranded oligonucleotides. These com (22) PCT Fled: Apr. 13, 2012 pounds are capable of targeting particular genes and reducing DNA methyltransferase activity. Accordingly, these com (86) PCT NO.: PCT/US 12/33617 pounds are particularly useful in the treatment of disease S371 (c)(1), associated with aberrant DNA methyltransferase activity, (2), (4) Date: Mar. 6, 2014 Such as cancer or a genetic disorder. Patent Application Publication Jun. 19, 2014 Sheet 1 of 42 US 2014/0171492 A1
Extra-coding C/EBPa a-5 kb transcript =s=>r2.6 kb
Figure 1A
n s N d n s N Cd n N CR 52 S C2Rs 2 & SOR 52 & 5 N1 5 N1 d - N2
Ethidium C/EBPsy C/EBPy k Bromide mRNA r ecRNA Figure 1B
HL-60 HL-60 C/EBPay mRNA CAEBPdecrAS s 3 150 150 - is 125 125 - 5as e 100 1OO as 5 & 75 75 gas 50 50 isg O 25 25 or is o o: N & ŠS NSf a.QS s 992 S QSSS a.s AS C3SS S S Patent Application Publication Jun. 19, 2014 Sheet 2 of 42 US 2014/0171492 A1
Total RNAS 2 C/EBPRNA CAEBPecPRNA 4oose C/EBP eCRNA
Figure 1D Nuclei RNAS
C/EBP mRNA C/EBPecrMA Patent Application Publication Jun. 19, 2014 Sheet 3 of 42 US 2014/0171492 A1
120 CAESP. mRNA 3100 g 80 is 60 40 Ei & 20 O 300 3 250 S. 200 as 150 100 d 6 s so O O 1 2 3. Time after thymidine block release Figure 1F
CAEBPecrNA C/EBPymRNA 5 g 125 125 :: 100 100 75 g is 50 HS 50 is 2 25 O
H-60 +ML-60218 (25 M, 24 h)
Figure 1G
Patent Application Publication Jun. 19, 2014 Sheet 6 of 42 US 2014/0171492 A1
Cell Cycle phase GOG1 S MG2
s E 8 s
d O
S es S o
25 s s Propidium lodide Staining( 1.00) Figure 1K
C/EBP mRNA 200 150 f 100
C/EBPy ecrNA f
Untreated Oh 1h 2h Figure 1L Patent Application Publication Jun. 19, 2014 Sheet 7 of 42 US 2014/0171492 A1
c É g 150 C 125 : OO T is 75 S 50 S A. 2. S5 sh1 Sh2 sh shi ni ni es es Figure 2A
-----...--Lill-ll-...-scrambled ------sh ------sh2 ------sh3 Figure 2B
0. 4
O. 3
O 2
0. 1
O se Sh1 Sh2 sh;3 S Figure 2C Patent Application Publication Jun. 19, 2014 Sheet 8 of 42 US 2014/0171492 A1
HL60 cells U937 cells
Figure 3 Patent Application Publication Jun. 19, 2014 Sheet 9 of 42 US 2014/0171492 A1
5' CCGGGACGCAGGCGGCGUCAGGCcucagogCCAGUGGCGAGGGGCGGCGCGG 3' Figure 4A to: Figure 4B
3 sooooooooooooots,E. 5 Figure 4C
DNA probe RNA probe Figure 4D Patent Application Publication Jun. 19, 2014 Sheet 10 of 42 US 2014/0171492 A1
O O h Cl 8
L
Oli O CEBPa Lucife extra Rase coding probe probe Figure 4E Figure 4F Patent Application Publication Jun. 19, 2014 Sheet 11 of 42 US 2014/0171492 A1
Figure 5A
Undigested Bst i3. i
COBRA analysis Figure 5B Patent Application Publication Jun. 19, 2014 Sheet 12 of 42 US 2014/0171492 A1
High-expressing
--- SCRO Figure 6B
OW-expressing s s M .
Y. O --
Figure 6D Patent Application Publication Jun. 19, 2014 Sheet 13 of 42 US 2014/0171492 A1
Extra-coding C/EBPa transcript =b C/EBPa RWA HR2 CEBP) R1 -l Figure 7A
Region R2 Alignment: Locations vs. Karyotype Alignment: Locations vs. Query
1732 candidates (only first 100 are shown)
Figure 7B Patent Application Publication Jun. 19, 2014 Sheet 14 of 42 US 2014/0171492 A1
Region R1 Alignment: Locations vs. Karyotype
is .
Alignment. Locations vs. Query
at
1 candidate only. Figure 7C
:
R2 R1 Non-specific Specific Figure 7D
Patent Application Publication Jun. 19, 2014 Sheet 21 of 42 US 2014/0171492 A1
C/EBPY eCRNA =0 C/EBP mRNA
R1 sHY | C/EBP | V - can cy Distal promoter CDS 3' UTR Figure 13A
U937 C/EBPy eCRNA C/EBP RNA
Figure 13B Patent Application Publication Jun. 19, 2014 Sheet 22 of 42 US 2014/0171492 A1
Distal promoter (-857 to- 634bp from CEBPa TSS)
Figure 13C
a 5 2 K562
& 4 Sg C/EBPermA C/EBPRNA 5 O re 2 g 33 is5 3 s eS eS as * o Unmethylated (UM) CpGs 8 Methylated (M) CpGs Figure 13D Figure 13E Patent Application Publication Jun. 19, 2014 Sheet 23 of 42 US 2014/0171492 A1
oUnmethylated (UM) CpGs 7. a Methylated (M)CpGs
2.5 yzsz. O S &S is a ; : 1 gSS S3: S S S S : 5 0.8 3. seases. 3 as . . scs. . . k - - - - by is a 0.6 Unmethylated (UM) CpGs ; O-4 e Methylated (M) CpGs E. E. E. : EEER 0.2 SSSSSS ER SES S. 33.3SSS 332:88: is3.2 0 i
S &S 2 - &sé to 5 oUnmethylated (UM) CpGs 3 4 a Methylated (M) CpGs s l 2 32 o i s s g Figure 13F Patent Application Publication Jun. 19, 2014 Sheet 24 of 42 US 2014/0171492 A1
Scale O ! Chr19: 3377000 33780000 so 330000d 3380000 382000d 3383000d 33.4000d 3385000 3386000c. 3367000 E. H== i H HR cEBPA) cEBPG CpG islands ce: is CpG: 291 CpG 96.
Figure 13G Patent Application Publication Jun. 19, 2014 Sheet 25 of 42 US 2014/0171492 A1
si 9 II is v Y 90 O D
S. 8070 URR I 8 E. K562 e 3 HL60 K562 Mock V O KS62AEa I i. l
i N s 3 . f g s g 5 5 as & as a ... i
if UR '. 3 0.30 r 020 s O H60 0.00 K562 Mock ...O.O. K562 Aza g g g g g g g g g g g g g g g 3'Ur Oks -14 kb -S9 kb & 8 a S ; ; ; ; 3 g is (Distal promoter)
cepa) A ', CEBPagene locus CAEBPygene locus Methylation Delta=Average(Methylation UR)-Average:Methylation r1)
Figure 13H-13 Patent Application Publication Jun. 19, 2014 Sheet 26 of 42 US 2014/0171492 A1
to Unitethylated (UM) CpGs osta promoter (-857 to- 834bp from C/EBPa TSS) 8 Methylated (M) CpGs AEP in NA
Mock Aza |-
CeBPY promoter region (-571 bp to -32 bp from CEBPTSS) CEBP: InrnA
UR R R r1
CEBPy promoter region (-571 bp to -312 bp from CAEEPyTSS) CEBP mRNA 2.5
Mock Aza
Mock Aza
Figures 13-13K Patent Application Publication Jun. 19, 2014 Sheet 27 of 42 US 2014/0171492 A1
CAEBPa mRNA
R2 R1 UR l H avaSko CDS 3' UTR Figure 13L
R1 UR CDS 3' UTR CDs 3' UTR Hybridization Undigested Digested with different probes Figure 13M Figure 13N
UR EV R2 R1 Figure 13O Patent Application Publication Jun. 19, 2014 Sheet 28 of 42 US 2014/0171492 A1
TP73 promoter region (214 bp to -59 bp from TP73 TSS) E73 –* $º |-
TP73
irr
->, 3333° Mock Aa o Unmethylated (UM) CpGs a Methylated (M) CpGs
Figure 13P Patent Application Publication Jun. 19, 2014 Sheet 29 of 42 US 2014/0171492 A1
O 10 8 C) Ss 6 T7+DNMT1 .. 6 ; : S5 Y S - X Y X XX 3 4. DNMT1: ; ; &; ; 8. & a S 2 s s O OUnmethylated (UM) CpGs O T7 T7+ DNMT1 O Methylated (M) CpGs DNMT1 Figure 14A
E. COll. C 8er 4 r RNA pol 3. a RNAE. Colipol as iii.; : 595 3 +DNMT1 0-----> --> ------4 al DNMT1 EE ; : S. 1 is . . . . (D5 O oUnmethylated (UM) CpGs O 1 E. Col. E. COlli DNMT1 O Methylated (M) CpGs RNApol RNA pol Figure 14B Patent Application Publication Jun. 19, 2014 Sheet 30 of 42 US 2014/0171492 A1
f Capture biotin labeled DNAs on streptavidin magnetic beads
D NA monar-OHe has he (x10)
M.S S S H CH H CH
C CHCH CH CH Ho Ho H. H. monar-O m)NA Tri Restriction HH3 H HO enzyme digest Check for methylation efficiency himDNAH7 (x10) H. H. He is 40C CHCH, CH, CH, A-O 700c mDNA Hy HSH H
tol. L 2 Position-> of primers- Mixm)NA with 10-fold for COBRA molar excess of not Uncut Bst biotinylated umDNA e umDNA Z(x10) -- CH, CH, CH, CH, DNA - e HSHS... H . S
Figure 14C
Patent Application Publication Jun. 19, 2014 Sheet 32 of 42 US 2014/0171492 A1
3 3 9 5C S. SSR05 umDNA hn NA m)NA D05D06 DO5DO6 DO5/DO6 Figure 15C
Kod of DNMT1-nucleic acid complex
SS
c .9 g
O
O
0.00 0.05 0.10 0.15 DNMT1 (uM) e RNA Ohm)NA O um)NA 0 m)NA Figure 15D Patent Application Publication Jun. 19, 2014 Sheet 33 of 42 US 2014/0171492 A1
f DNMT1 lif 8 s ss U937 e tra SS g as 12 g 9 ge 10 8 a . ; S 4 2 RO5 R04 Y S.5 O IgG DNMT1 " ssR04 Figures 15E-15F Figure 15G
ecrA
DNMT1-RNA precipitate as polyAtall ranscrip
2. - 250 HL-60 cells c 25 HL-60 cells 85. se S 99 2OO 's 20 s S$150 8. a. 15 5 100 g 10 s 2 Sis 50 5 5 Y input DNMT1 PolyA(-) PolyA(+) input Figure 15H Patent Application Publication Jun. 19, 2014 Sheet 34 of 42 US 2014/0171492 A1
N-1 RNA RO1 RO3 57 E"GGCGGCGUCAGGC RNA RO1/R03 57 CCGGGACGCAGGCGGCGTCAGGC 37 5'GGGAGTGGGGAGGGGGGGGGGGG 37 3. GGCCCTGCGTCCGCCGCAGTCCG 5 3 CGCCACCGCTCCCCGCCGCGCC 5 DNA DO1/DO2 DNA DO3/D04 Figure 15
8 DNMT1 3g DNMT1 9 9. DNMT1 achi -C) o Stor É onA 3d'BoSESS poly Fore' 8 compe ico (of 1 2 3 4 5 6 8 3 : S-C E E E 3 8 3
8 U RNA DNA di RNA DNA EC RNA duplex duplex duplex duplex SS RO1/RO3 DO3/DO4 RO1 RO3 DO1 DO2 RO1 Figure 15. Patent Application Publication Jun. 19, 2014 Sheet 35 of 42 US 2014/0171492 A1
Free DNMT1
Figure 15K Figure 15L
DNMT1
RO1 Figure 15M Patent Application Publication Jun. 19, 2014 Sheet 36 of 42 US 2014/0171492 A1
Distal Intergenic Promoter 4.5% N 5.2% Downstream intron 53 O% 22.7% 5'UTR
Figure 16A
s C 9 5 as 53 s S. 3 se 5. ed so - I - DNMT1 DNMT1 DNMT1 DNMT1 unbound bound unbound bound Figure 16B
Gene DNMT1 unbound DNMT1 bound
density (10973 gene loci) (4833 gene loci) N high 3. A=23.04% E=10.45% C=56.64%. G=12.08%
B g - o to s O % s r 9. n N loW H=19.24% D=12.04% o 0.2 0.4 s 0.8 1. 00 0.2 0.4 08 0.8 10 Methylation level Methylation level Figure 16C Patent Application Publication Jun. 19, 2014 Sheet 37 of 42 US 2014/0171492 A1
Expression level (log2) 12.0
acces USP29(1.96) Methylation level
2 RNA-DNMT1 Interaction (# of reads of specific peaks) 2 30 C Z O z Ho Figure 16D
cDNA libraries O.8 O.7 0.6 O.5 O4 O3 O.2 0.1 IgG DNMT1 Figure 16E Patent Application Publication Jun. 19, 2014 Sheet 38 of 42 US 2014/0171492 A1
Analysis flowchart 40857 Refseq transcripts (hg19 - from UCSC)
23250 unique genes (longest Refseq isoform) u-1N 17212 gene loci without 6038 gene loci with DNMT1-RIP peaks DNMT1-RIP peaks (Gene locus definition: 3kb upstream+gene body +3kb downstream) l 10973 gene loci 4833 gene loci covered by RRBS covered by RRBS (Group: (Group: Not DNMT1-bound) DNMT1-bound) Figure 16F Patent Application Publication Jun. 19, 2014 Sheet 39 of 42 US 2014/0171492 A1
Expression level (log2) Expression level (log2) s 12.0 12.0 g CSF3R(456) o 59) 9. g "00 --HHHHH--> e 0.0 CS3R UND Methylation level Mylation level 109% ill.CpG island Ell).J. L. E CpG. island -CSFSR- UND RNA-DNMT1 interaction (ii of reads of specific peaks) 30 RNA-DNMT1 interaction (ii of reads of specific peaks) f l d l, his Hs :“t elk CS3R ? UND Expression level (log2) Expression level (log2) a 120 a 12.0 MAFf(556) EWSR1(666) 'e ------H- 00 ------a EWSRf Methylation level Methylation level g 10%. 100% É.0%RC Lll-l-all or 0% CpG "de-...- s-s-s-s-s-s-s- CpG island Af P ------e EMWSR gNA-DNMT1 Interaction ( of reads of specific peaks) 40 RNA-DNMT1 Interaction (# of reads of specific peaks) le s
al s â to e- MAF... su ---- 2 O will - Expression level (log2) 12.0
u C/EBPE(467) s CEBPE Methylation level
% ------(58.8land p me Figure 16G RNA-DNMT1 interaction (ii of reads of specific peaks) 30 s -e-- - - - 2. To CEBPE Patent Application Publication Jun. 19, 2014 Sheet 40 of 42 US 2014/0171492 A1
Pision20 levelog2) Expression level (log2) 12.0 MYODf(2.8) on —-H WNT3(3.78) Met tion lewel O Mylation love ------U). AN3 OIII Methylation level
O 100% ------. . . . Y.
CpGII island II || | | | | | || || III-- a 30 RNA-NMT1 interaction (it of reads of specific peaks) - MAN: —-s——H- RNA-DNMT1 interaction (if of reads of specific peaks) Yo
expressionlewel (log2} 12-0
fixD3 (223) Expression level (log2} 99T-s:FOXO3 - 120 Methylation lewel s 10%III || III IL. III gd in-1A24) E.s RR 00 NefA --- FOX3 Methylation level
e 100% ------w
S 30 RNA-DNMT1 Interaction (it of reads of specific peaks) 8Y | | | | | || s —i- E0 $G isla a 'o FOXO3 HNFA es st- Exision levelewel (log2)2 S 30 RNA-DNMT1 Interaction (it of reads of specific peaks)
OOGSTM52.37) gas-s-s-s 25 0 Nfa HHHHis GSMS to level Expression level (log2) 3 12.0 O CpG islan 9 HH RASSF102.26) SSS is 0.0 s 30 RNA-DNMT1 interaction (# of reads of specific peaks) Methylation level RASS0
s—-s-s -- g- Y - Y O - - - - Y - ...... Expression level (log2)S5 islanyIII III"- | a 12 on TH s RASSFO
s ST -- h er 2 30 RNA-DNMT1 Interaction (# of reads of specific peaks) SS Methylation level s O
2 RASSAf0 CpG island * is Figure 16H
30 RNA-DNMT1 Interaction it of reads of specific peaks)
s Patent Application Publication Jun. 19, 2014 Sheet 41 of 42 US 2014/0171492 A1
Genomic template Faraway for tRNA were crnA Coding gene 1 from cluster H Chromatin loops (DNMT1-bound, not methylated, low or not expressed) u1 2) Coding gene 2 from clusters D and G - w (DNMT1-bound, methylated, not expressed or expressed") C3) Coding gene 3 from cluster A (not DNMT1-bound, not methylated, expressed)
O4) Coding gene 4 from cluster F
(not DNMT1-bound, not methylated, low or not expressed) O5) Coding gene 5 from clusters E (not DNMT1-bound, methylated, expressed)
* - possible insufficient methylation and/or methylation occurs in not regulatory element(s)
Figure 17 Patent Application Publication Jun. 19, 2014 Sheet 42 of 42 US 2014/0171492 A1
IllllllllllinIIIII
Figure 18 US 2014/0171492 A1 Jun. 19, 2014
CHMERC RNAOLIGONUCLEOTDES AND complex binds to a DNMT to reduce DNA methylation of the USES THEREOF gene. In further embodiments, the synthesized RNA oligo nucleotide is covalently or non-covalently linked to a target CROSS-REFERENCE TO RELATED ing moiety, where the targeting moiety is a polypeptide, APPLICATION polypeptide derivative, or peptidomimetic that is capable of 0001. The present application claims the benefit of U.S. transport across into a particular cell type (e.g., a cell-pen Provisional Application No. 61/475,566, filed Apr. 14, 2011, etrating peptide. Such as a polycationic or an amphipathic the disclosure of which is hereby incorporated by reference in peptide). its entirety. 0008. In some embodiments, the invention features a syn thesized RNA oligonucleotide for reducing DNA methyla BACKGROUND OF THE INVENTION tion of a gene by a DNA methyltransferase (DNMT), where the oligonucleotide consists of a sequence of about 15 to 0002 The invention relates to gene-specific chimeric about 30 nucleotides (e.g., 15-20 nucleotides, 15-25 nucle RNA oligonucleotides and various uses thereof, including otides, 15-30 nucleotides, 15-35 nucleotides, 16-20 nucle methods of treating cancer. otides, 16-25 nucleotides, 16-30 nucleotides, 16-35 nucle 0003 DNA methylation plays a significant role in medi otides, 17-20 nucleotides, 17-25 nucleotides, 17-30 ating gene expression. Less is known about how this epige nucleotides, 17-35 nucleotides, 18-20 nucleotides, 18-25 netic mark is distributed throughout the genome, and in par nucleotides, 18-30 nucleotides, or 18-35 nucleotides) having ticular why DNA methyltransferases (DNMTs), which are at least 80% complementarity (e.g., at least being 85%, 90%, not sequence-specific, "avoid certain CpG islands. The dem 95%, 97%, 99%, and 100% complementarity) to a portion of ethylating agent 5-aza-cytidine and analogs have been used an extra-coding RNA of the gene, and where the synthesized for epigenetic research and received approval by the U.S. RNA binds to the extra-coding RNA to form a complex and Food and Drug Administration for the treatment of all sub the complex binds to a DNMT to reduce DNA methylation of types of myelodysplastic syndrome (MDS). the gene. In further embodiments. In some embodiments, the 0004 Currently, the two most prominent, approved dem invention features a synthesized RNA oligonucleotide for ethylating agents for the treatment of myelodysplastic Syn reducing DNA methylation of a gene by a DNA methyltrans drome are azacitidine (or 5-azacytidine, sold as Vidaza) and ferase (DNMT), where the oligonucleotide consists of a decitabine (or 5-aza-2'-deoxycytidine, sold as Dacogen). sequence of about 15 to about 30 nucleotides (e.g., 15-20 These agents are incorporated into genomic DNA and inhibit nucleotides, 15-25 nucleotides, 15-30 nucleotides, 15-35 DNMT by covalent binding. Cytotoxic effects have been nucleotides, 16-20 nucleotides, 16-25 nucleotides, 16-30 associated with global incorporation of these agents into nucleotides, 16-35 nucleotides, 17-20 nucleotides, 17-25 DNA and, thus, limit their clinical application. Although non nucleotides, 17-30 nucleotides, 17-35 nucleotides, 18-20 nucleoside inhibitors of DNA methylation possess less poten nucleotides, 18-25 nucleotides, 18-30 nucleotides, or 18-35 tial side effects, these inhibitors are generally less efficient nucleotides) having at least 80% complementarity (e.g., at than their nucleoside analogues and still cause global dem least being 85%, 90%, 95%, 97%, 99%, and 100% comple ethylation. Global, non-specific demethylation can lead to mentarity) to an extra-coding RNA of the gene that is increased tumorogenicity because demethylation likely covalently or non-covalently linked to a targeting moiety decreases expression of tumor Suppressor genes as well as (e.g., as described herein). prometastatic genes. 0009. In a second aspect, the invention features a pharma 0005. Therapy of diseases, including various cancers, can ceutical composition including any synthesized RNA oligo be impaired by non-specific demethylating agents. Thus, new nucleotide described herein and a pharmaceutically accept strategies for gene-specific delivery of agents to reduce able excipient. In some embodiments of this aspect, the methylation of DNA are desired. composition further includes a histone deacetylase inhibitor (e.g., a hydroxamic acid, Such as trichostatin A (TSA), Vori SUMMARY OF THE INVENTION nostat (SAHA), belinostat (PXD101), (E)-N-hydroxy-3-4- 0006 We have now developed chimeric RNA oligonucle 2-hydroxyethyl-2-(1H-indol-3-yl)ethylaminomethyl otides (CROs) capable of targeting specific genes and reduc phenylprop-2-enamide (LAQ824), panobinostat (LBH589), ing DNA methylation of a gene by a DNA methyltransferase. suberoylanilide hydroxamic acid (SAHA), oxamflatin, scrip These CROs can be used to treat any condition having aber taid, suberic bishydroxamic acid (SBHA), m-carboxy-cin rant hypermethylation, including cancer. namic acid bishydroxamic acid (CBHA), and pyroxamide); a 0007. In a first aspect, the invention features a synthesized cyclic peptide, Such as trapoxin A, apidicin, TPX-HA, and RNA oligonucleotide for reducing DNA methylation of a depsipeptide (FR901228)); a benzamide, such as entinostat gene by a DNA methyltransferase (DNMT), where the oligo (MS-275), N-acetyldinaline (CI994), and mocetinostat nucleotide includes a sequence of about 15 to about 30 nucle (MGCD0103); an electrophilic ketone, such as trifluorom otides (e.g., 15-20 nucleotides, 15-25 nucleotides, 15-30 ethyl ketones or alpha-ketoamides, see Frey et al., Bioorg. nucleotides, 15-35 nucleotides, 16-20 nucleotides, 16-25 Med. Chem. Lett. 12:3443-3447, 2002, and U.S. Pat. No. nucleotides, 16-30 nucleotides, 16-35 nucleotides, 17-20 6,511.990, incorporated herein by reference); and a fatty acid, nucleotides, 17-25 nucleotides, 17-30 nucleotides, 17-35 Such as valproic acid, arginine butyrate, butyric acid, and nucleotides, 18-20 nucleotides, 18-25 nucleotides, 18-30 phenylbutyrate). nucleotides, or 18-35 nucleotides) having at least 80% 0010. In a third aspect, the invention features a method of complementarity (e.g., at least being 85%, 90%. 95%, 97%, treating or prophylactically treating a Subject having cancer, 99%, and 100% complementarity) to a portion of an extra the method including administering to the Subject any syn coding RNA of the gene, and where the synthesized RNA thesized RNA oligonucleotide described herein or any phar binds to the extra-coding RNA to form a complex and the maceutical composition described herein in an amount Suffi US 2014/0171492 A1 Jun. 19, 2014
cient to treat the cancer. In some embodiments, the cancer is ther embodiment of this aspect, the method includes synthe selected from the group of a myelodysplastic syndrome (e.g., sizing the nucleotide sequence having at least 80% comple refractory anemia, refractory anemia with ringed sidero mentarity. In yet another further embodiment, the method blasts, refractory anemia with excess blasts, refractory ane includes contacting the nucleotide sequence having at least mia with excess blasts intransformation, refractory cytopenia 80% complementarity with one or more extra-coding RNAs with multilineage dysplasia, myelodysplastic syndrome asso and/or DNMTs. In another embodiment, the method includes ciated with an isolated del(5q) chromosome abnormality, and the nucleotide sequence having one or more modified nucle a myeloproliferative neoplasm), leukemia (e.g., acute otides. In any of these embodiments, the method includes myeloid leukemia), head and neck cancer, liver cancer (e.g., reducing DNA methylation of a gene by inactivating and hepatoma and hepatocellular carcinoma), lung cancer (e.g., sequestering a DNMT. In another embodiment, the CROS adenocarcinoma, Small cell lung cancer, and non-small cell contain gene-specific sequences that can be designed having lung cancer), prostate cancer (e.g., adenocarcinoma), skin a sequence that is at least 80% (e.g., at least 85%, 90%. 95%, cancer (e.g., squamous cell carcinoma), retinoblastoma, glio 96%, 97%, 98%, 99% or more) complementary to a region blastoma, breast cancer, thyroid cancer, ovarian cancer, pan spanning the promoter, the coding part of the gene, and/or the creatic cancer, brain cancer, kidney cancer, colon cancer, 3'-downstream part (e.g., -2 kilobases and/or +2 kilobases endometrial cancer, gastric cancer, multiple myeloma, and from the transcriptional start site (TSS) or the transcriptional lymphoma (e.g., T-cell lymphoma). end site (TES) of the genes, respectively). In a further 0011. In a fourth aspect, the invention features a method of embodiment of this aspect, the genes are those contained in treating or prophylactically treatinga Subject having agenetic cluster Cand any described herein. disorder, the method including administering to the Subject 0014. In a seventh aspect, the invention features a method any synthesized RNA oligonucleotide described herein or of diagnosing a subject for treatment with a synthesized RNA any pharmaceutical composition described herein in an oligonucleotide for reducing DNA methylation of a gene by a amount Sufficient to treat the genetic disorder. In some DNA methyltransferase (DNMT), the method including: embodiments, the genetic disorder is an imprinting disorder determining the Subject as having a cancer or a genetic dis (e.g., Beckwith-Wiedemann Syndrome (BWS), Prader-Willi order (e.g., any cancer or disorder described herein) related to Syndrome (PWS), Angelman Syndrome (AS), Albright the gene (e.g., any gene described herein, Such as from cluster hereditary osteodystrophy (AHO), pseudohypoparathyroid C), analyzing the sequence of one or more extra-coding ism type 1 A (PHP-IA), and pseudohypoparathyroidism type RNAs of the gene, identifying an RNA oligonucleotide 1B (PHP-IB)); a disorder associated with loss of imprinting sequence having at least 80% complementarity (e.g., at least (LOI) (e.g., LOI in IGF2/H19 for Wilms tumor); and a repeat being 85%, 90%. 95%, 97%, 99%, and 100% complementa instability disease (e.g., Fragile X syndrome and myotonic rity) to the extra-coding RNA, synthesizing the RNA oligo dystrophy). nucleotide, and administering the RNA oligonucleotide for 0012. In a fifth aspect, the invention features a method of reducing the methylation (e.g., by at least 10% or any per preparing a synthesized RNA oligonucleotide for reducing centage described herein). DNA methylation of a gene by a DNA methyltransferase 0015. In particular embodiments of any of the above (DNMT), the method including preparing a sequence of aspects, the extra-coding RNA is a transcribed RNA corre about 15 to about 30 nucleotides (e.g., 15-20 nucleotides, sponding to a coding region, a non-coding region, or both 15-25 nucleotides, 15-30 nucleotides, 15-35 nucleotides, coding and non-coding regions, or is a fragment thereof. In 16-20 nucleotides, 16-25 nucleotides, 16-30 nucleotides, particular embodiments, the extra-coding RNA is a tran 16-35 nucleotides, 17-20 nucleotides, 17-25 nucleotides, scribed RNA corresponding to a non-coding region or a frag 17-30 nucleotides, 17-35 nucleotides, 18-20 nucleotides, ment of a non-coding region. In other embodiments, the 18-25 nucleotides, 18-30 nucleotides, or 18-35 nucleotides) extra-coding RNA is a transcribed RNA corresponding to having at least 80% complementarity (e.g., at least being both a coding region and a non-coding region or to both a 85%, 90%, 95%, 97%, 99%, and 100% complementarity) to fragment of a coding region and a fragment of a non-coding an extra-coding RNA of the gene. In a further embodiment of region. this aspect, the method further includes incorporating one or 0016. In certain embodiments of any of the above aspects, more modified nucleotides into the sequence of about 15 to the RNA oligonucleotide includes one or more modified about 30 nucleotides. nucleotides selected from 5-azacytidine, 5-aza-5,6-dihydro 0013. In a sixth aspect, the invention features a method of cytosine, 5-aza-2'-deoxycytidine, beta-L-5-azacytidine, identifying a RNA oligonucleotide for reducing DNA methy 2'-deoxy-beta-L-5-azacytidine, 2'-deoxy-N4-2-(4-nitrophe lation of a gene by inactivating a DNA methyltransferase nyl)ethoxycarbonyl-5-azacytidine, 5-fluorocytidine, 1-?3-D- (DNMT), the method including: analyzing the sequence of arabinofuranosil-5-azacytosine, and 1-B-D-ribofuranosyl-2 one or more extra-coding RNAS of the gene; identifying a (1H)-pyrimidinone, and analogs thereof (e.g., analogs having nucleotide sequence having at least 80% complementarity one of the following substitutions for the hydrogen of the (e.g., at least being 85%, 90%. 95%, 97%, 99%, and 100% 4-amino group of the cytosine ring: methyl, ethyl, 9-fluore complementarity) to the extra-coding RNA; and determining nylmethyl, 9-(2-sulfo)fluorenylmethyl, 9-(2,7-dibromo) fluo one or more binding sites between the nucleotide sequence renylmethyl, 17-tetrabenzoa, c.g.ifluorenylmethyl, having at least 80% complementarity with the extra-coding 2-chloro-3-indenylmethyl, benz finden-3-ylmethyl, 2,7-di RNA and/or the DNMT (e.g., by using a RNA electrophoretic tert-9-(10,10-dioxo-10,10,10,10-tetrahydrothioxanthyl)me mobility shift assay), thereby identifying the RNA oligo thyl, 1,1-dioxobenzobthiophene-2-ylmethyl, 2.2.2-trichlo nucleotide for reducing DNA methylation (e.g., by at least roethyl, 2-trimethylsilylethyl 2-phenylethyl, 1-(1- 10% or any percentage described herein). In a further adamantyl)-1-methylethyl, 2-chloroethyl, 1,1-dimethyl-2- embodiment of this aspect, the method includes sequencing haloethyl, 1,1-dimethyl-2,2-dibromethyl, 1,1-dimethyl-2.2, one or more extra-coding RNAS of the gene. In another fur 2-trichloroethyl, 1-methyl-1-(4-biphenylyl)ethyl, 1-(3,5-di US 2014/0171492 A1 Jun. 19, 2014 tert-butylphenyl)-1-methylethyl 2-(2- and 4'-pyridyl)ethyl, selected from a demethylating agent (e.g., 5-azacytidine (aza 2.2-bis(4-nitrophenyl)ethyl, N-(2-pivaloylamino)-1,1-dim citidine), 5-aza-2'-deoxycytidine (decitabine), any cytidine ethylethyl 2-(2-nitrophenyl)dithio)-1-phenylethyl, 2-(N.N- analog described herein, and any other demethylating agent dicyclohexylcarboxamido)ethyl, t-butyl, 1-adamantyl, described herein), a DNA and/or RNA polymerase inhibitor 2-adamantyl, vinyl, allyl, 1-isopropylallyl, cinnamyl, 4-nitro (e.g., cytarabine, fludarabine, gemcitabine, cladribine, and cinnamyl, 3-(3'-pyridyl)prop-2-enyl, 8-quinolyl. N-hydrox clofarabine), a thymidylate synthase inhibitor (e.g., 5-fluo ypiperidinyl, alkyldithio, benzyl, p-methoxybenzyl, p-ni rouracil, floXuridine, capecitabine, tegafur, and carmofur), an trobenzyl, p-bromobenzyl, p-chlorobenzyl, 2,4- immunosuppressant (e.g., azathioprine), an adenosine dichlorobenzyl, 4-methylsulfinylbenzyl, 9-anthrylmethyl, deaminase inhibitor (e.g., pentostatin), a thiopurine (e.g., diphenylmethyl, 2-methylthioethyl, 2-methylsulfonylethyl, thioguanine and mercaptopurine), or a label (e.g., an isotope, 2-p-toluenesulfonyl)ethyl, 2-(1,3-dithianyl)methyl, 4-me Such as a positron emitting isotope; a radioimaging agent or a thylthiophenyl, 2,4-dimethylthiophenyl, 2-phosphonioethyl, radiolabel; a fluorescent label. Such as green fluorescent pro 1-methyl-1-(triphenylphosphonio)ethyl, 1,1-dimethyl-2- tein (GFP), fluorescein, and rhodamine; a nuclear magnetic cyanoethyl 2-dansylethyl, 4-phenylacetoxybenzyl, 4-azido resonance active label; a luminescent label; a chromophore benzyl, 4-azidomethoxybenzyl, m-chloro-p-acyloxybenzyl, label; a chemiluminescence label, Such as luciferase and p-(dihydroxyboryl)benzyl, 5-benzisoxazolylmethyl, 2-(trif B-galactosidase; an enzymatic label. Such as peroxidase and luoroethyl)-6-chromonylmethyl, m-nitrophenyl, 3,5- phosphatase; a reporter molecule. Such as biotin or a hista dimethoxybenzyl, 1-methyl-1-(3,5-dimethoxyphenyl)ethyl, mine tag; and an antibody or an antibody fragment). C.-methylnitropiperonyl, o-nitrophenyl, 3,4-dimethoxy-6-ni 0018. In other embodiments of any of the above aspects, trobenzyl, phenyl(o-nitrophenyl)ethyl, 2-(2-nitrophenyl) the gene is C/EBPa (CCAAT enhancer binding protein ethyl, 6-nitroveratryl, 4-methoxyphenacyl, 3',5'-dimethoxy alpha); SPE (spleen focus forming virus (SFFV) proviral benzoin, t-amyl. S-benzylthio, butynyl, p-cyanobenzyl, integration oncogene spil); RXRA (retinoid X receptor, cyclohexyl, cyclopentyl, cyclopropylmethyl, p-decyloxyben alpha); RARB (retinoic acid receptor, beta); RB1 (retinoblas Zyl. diisopropylmethyl, 2.2-dimethoxycarbonyl vinyl, o-(N. toma 1); CDKN2A (cyclin-dependent kinase inhibitor 2A); N-dimethylcarboxamido)benzyl, 1,1-dimethyl-3-(N,N-dim CDH1 (cadherin 1, type 1, E-cadherin); CDH13 (cadherin 13, ethycarboxamido)propyl. 1,1-dimethylpropynyl, H-cadherin); TIMP3 (TIMP metallopeptidase inhibitor 3); 2-furanylmethyl, 2-iodoethyl, isobomyl, isobutyl, isonicoti VHL (von Hippel-Lindau tumor suppressor); MLH1 (mutL nyl, p-(p'-methoxyphenylazo)benzyl, 1-methylcyclobutyl, homolog 1, colon cancer, nonpolyposis type 2); MGMT 1-methylcyclohexyl, 1-methyl-1-cyclopropylmethyl, 1-me (O-6-methylguanine-DNA methyltransferase); BRCA1 thyl-1-(p-phenylaZophenyl)ethyl, 1-methyl-1-phenylethyl, (breast cancer 1, early onset); GSTP1 (glutathione S-trans 1-methyl-1-(4-pyridyl)ethyl, phenyl, p-(phenylazo)benzyl, ferase pi 1); HLTF (helicase-like transcription factor); 2,4,6-tri-t-butylphenyl, 4-(trimethylammonium)benzyl, 2.4. RASSF1 (Ras association (RalGDS/AF-6) domain family 6-trimethylbenzyl, a urea (e.g., a urea with phenothiazinyl member 1); SOCS1 (suppressor of cytokine signaling 1); (10)-carbonyl, N'-p-toluenesulfonylaminocarbonyl, and ESR1 (estrogen receptor 1); or DAPK1 (death-associated N'-phenylaminothiocarbonyl), and an amide (e.g., forma protein kinase 1). In some embodiments, the gene is C/EBPa mide, acetamide, phenoxyacetamide, trichloroacetamide, tri and the extra-coding RNA of C/EBPa is SEQ ID NO:1 or fluoroacetamide, phenyacetamide, 3-phenylpropamide, pent SEQID NO:8, or a fragment thereof. In other embodiments, 4-enamide, o-nitrophenylacetamide, the gene is SPI1 and the extra-coding RNA of SPI1 is SEQID o-nitrophenoxyacetamide, 3-(o-nitrophenyl)propanamide, NO:2, SEQID NO:3, SEQID NO:4, or SEQID NO:5, or a 2-methyl-2-(o-nitrophenoxy)propanamide, 3-methyl-3-ni fragment thereof. In yet other embodiments, the gene is trobutanamide, o-nitrocinnamide, 3-(4-t-butyl-2,6-dinitro RXRA and the extra-coding RNA of RXRA is SEQID NO:6 phenyl)-2,2-dimethylpropanamide, o-(benzoyloxymethyl) or SEQ ID NO:7, or a fragment thereof. In some embodi benzamide, 2-(t-butyldiphenylsiloxy)methyl)methyl ments, the gene is RARBand the extra-coding RNA of RARB benzamide, 3-(3',6'-dioxo-2',4',5'-trimethylcyclohexa-1',4'- is SEQ ID NO:9, or a fragment thereof. In other embodi diene)-3.3-dimethylpropionamide, o-hydroxy-trans ments, the extra-coding RNA of the gene is the promoter cinnamide, acetoacetamide, p-toluenesulfonamide, and region of the gene. In further embodiments, the extra-coding benzesulfonamide); or those having one of the following RNA is the promoter region of the gene selected from Substitutions for the 4-amino group of the cytosine ring: 4-O- C/EBPa, SPI1, RXRA, and RARB. methoxy and 4-S-methylsulfanyl). In further embodiments, the modified nucleotide is a cytidine analog further conju 0019. In other embodiments of any of the above aspects, gated to a guanosine nucleotide (e.g., 5-aza-2'-deoxycyti the genes are found in cluster C as described herein. Some of dine-phosphodiester linkage-guanosine, 5-aza-2'-deoxycyti those genes belong to particular Gene Ontology (GO) catego dine-phosphodiester linkage-2'-deoxy-guanosine, ries (www.geneontology.org and The Gene Ontology Con guanosine-phosphodiester linkage-5-aza-2'-deoxycytidine, sortium, “Gene ontology: tool for the unification of biology.” or 2'-deoxy-guanosine-phosphodiester linkage-5-aza-2'- Nat. Genet. 25(1):25-29 (2009)). Exemplary non-limiting GO categories include genes related to conversion of one or deoxycytidine). In other embodiments, the RNA oligonucle more primary RNA transcripts into one or more mature RNA otide includes one or more modified nucleotides selected molecules (GO:0006396, RNA processing); genes related to from cytarabine, fludarabine, gemcitabine, cladribine, clo biochemical and morphological phases that occur during Suc farabine, 5-fluorouracil, azathioprine, floXuridine, mercap cessive cell or nuclear replication events (GO: 0007049, cell topurine, thioguanine, pentostatin, and cladribine, oranana cycle), genes related to chemical reactions and pathways log thereof. In yet further embodiments, the modified involving mRNA (GO:0016071, mRNA metabolic process), nucleotide is 5-azacytidine or 5-aza-2'-deoxycytidine. genes related to assembly, arrangement, or disassembly of 0017. In other embodiments of any of the above aspects, chromosomes (GO:0051276, chromosome organization), the RNA oligonucleotide includes a therapeutic agent genes related to splicing and joining primary RNA transcript US 2014/0171492 A1 Jun. 19, 2014 to form mature form of the RNA (GO:0008380, RNA splic described herein). Fragments may include at least 4, 5, 6, 8, ing), and any described herein. 10, 11, 12, 14, 15, 16, 17, 18, 20, 25, 30, 35, 40, 45, or 50 0020. In particular embodiments of any of the above contiguous amino acids or nucleic acids of the full length aspects, the oligonucleotide is not double-stranded. sequence. A fragment may retain at least one of the biological 0021. In some embodiments of any of the above aspects, activities of the full length protein or nucleic acid. the DNMT is selected from the group consisting of DNMT1, 0030. By “inactivating a DNA methyltransferase” is DNMT2, DNMT3a, DNMT3b, and DNMT3L. In further meant a RNA oligonucleotide that reduces the methylating embodiments, the DNMT is DNMT1. activity of DNA methyltransferase by at least 10% (e.g., at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, DEFINITIONS 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or even 99%) 0022. By “chimeric RNA oligonucleotide' or "CRO is compared to a control lacking the RNA oligonucleotide. meant an RNA oligonucleotide capable of reducing the activ 0031. By "modified nucleotide' is meant a nucleotidehav ity of DNA methyltransferase and of selectively or specifi ing a modification to the chemical structure of one or more of cally hybridizing to a target sequence within a gene locus. the base, sugar, and backbone, including the phosphate linker. 0023. By "complementarity” is meant an oligonucleotide 0032. By “reduced DNA methylation” is meant reducing able to form one or more hydrogen bonds with another oli the methylating activity of DNA methyltransferase by at least gonucleotide (e.g., a RNA) by either traditional Watson-Crick 10% (e.g., at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, (e.g. G with C. A with T, or A with U) or other non-traditional 50%, 55%, 60%. 65%, 70%, 75%, 80%, 85%, 90%. 95%, or types (e.g., diaminopurine with T, 5-methyl C with G, 2-thio even 99%), compared to a control lacking the RNA oligo thymidine with A, inosine with C. pseudoisocytosine with G. nucleotide. Non-limiting methods for determining reduced etc.). In reference to the oligonucleotide of the present inven DNA methylation are described herein (e.g., in Example 4). tion, the binding site (or binding energy) for a nucleotide with 0033. By “stringent conditions” is meant conditions under its target or complementary sequence is sufficient to allow the which a RNA oligonucleotide will selectively or specifically relevant function of the nucleotide to proceed, e.g., targeting hybridize to its target sequence (i.e., an extra-coding RNA). of the RNA, binding to DNMT, or triple helix formation. typically in a complex mixture of nucleic acids, but to no Determination of a binding site (or binding energy) for a other sequences. Stringent conditions are sequence-depen nucleotide is well known in the art (see, e.g., Turner et al., dent and length-dependent. Generally, stringent conditions Cold Spring Harbor Symp. Quant. Biol. 52:123-133, 1987: are selected to be about 5° C. to about 25°C. lower than the Frier et al., Proc. Natl. Acad. Sci. USA 83:9373-9377, 1986: thermal melting point (T) for the specific sequence at a and Turner et al., J. Am. Chem. Soc. 109:3783-3785, 1987). A defined ionic strength pH. Stringent conditions may also percent complementarity indicates the percentage of contigu include destabilizing agents, such as formamide. For selec ous residues in a nucleotide that can form hydrogen bonds tive or specific hybridization, a positive signal is at least two (e.g., Watson-Crick base pairing) with a second nucleotide times background, preferably 10 times background hybrid (e.g., being 50%, 55%, 60%. 65%, 70%, 75%, 80%, 85%, ization. Exemplary stringent conditions include: 50% forma 90%. 95%, 97%, 99%, and 100% complementary), option mide, 4xSSC, and 1% SDS, incubating at 42°C.; and 4xSSC, ally determined under stringent conditions. 1% SDS, incubating at 65° C., with wash in 0.2xSSC, and 0024. By “complex binds to a DNA methyltransferase” is 0.1% SDS at 65° C. Hybridization techniques are generally meant an interaction between a CRO-extra-coding RNA described in Nucleic Acid Hybridization, A Practical complex and a DNA methyltransferase with a dissociation Approach (eds. B. D. Hames and S. J. Higgins, IRL Press, constant (Kd) measured in the range of between 0.01 uM to 1985); Tijssen, “Overview of principles of hybridization and 0.10M (e.g., 0.01, 0.02, 0.03, 0.05, 0.08, 0.09, and 0.1 uM). the strategy of nucleic acid assays” in Laboratory Techniques 0025. By “cytidine analog is meanta modified nucleotide in Biochemistry and Molecular Biology: Hybridization with having a cytosine base or a modified cytosine base. Nucleic Probes (ed. P. C. van der Vliet, Elsevier Science 0026. By “demethylating agent” is meant an agent that Publishers B.V., 1993); PCR Protocols, A Guide to Methods leads to decreased methylation of DNA by directly or indi and Applications (eds. M. A. Innis et al., Academic Press. rectly inactivating a DNA methyltransferase. Inc., New York, 1990); Gall and Pardue, Proc. Natl. Acad. 0027. By “DNA methyltransferase” or “DNMT is meant Sci., USA 63:378-383, 1969; and John et al., Nature 223:582 an enzyme that methylates the C-5 carbon of cytosines in 587, 1969. DNA. Exemplary DNMTs include DNMT1, DNMT2, 0034). By “substantially identical” is meant an oligonucle DNMT3a, DNMT3b, and DNMT3L. otide exhibiting at least 30%, 35%, 40%, 45%, 50%, 55%, 0028 By “extra-coding RNA” or “ecRNA' is meant tran 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or even 99% scribed pre-mRNA including both coding and non-coding identity to a reference nucleotide sequence. For polypeptides, regions or only non-coding regions. Extra-coding RNA the length of comparison sequences will generally be at least regions and fragments thereof may include those that can 4 (e.g., at least 5, 6,7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18. form secondary structures with CROs as predicted by RNA 19, 20, 25, 50, or 100) amino acids. For oligonucleotides, the secondary structure prediction programs known in the art length of comparison sequences will generally be at least 5 (e.g., CentroidFold, Mfold, RNAfold, RNAstructure, and nucleotides (e.g.,5,6,7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18. CONTRAfold). Extra-coding RNA regions and fragments 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides). It thereof may also include those that modulate methylation is to be understood herein that gaps may be found between the patterns of genes associated with the extra-coding RNA nucleotide of sequences that are identical or similar to nucle region. In some embodiments, the ecRNA only includes one otides of the original oligonucleotide. The gaps may include or more contiguous, non-coding regions of a gene. no nucleotides or one or more nucleotides that are not iden 0029. By "fragment” is meant a portion of a full-length tical or similar to the original oligonucleotide. Percent iden amino acid or nucleic acid sequence (e.g., any sequence tity may be determined, for example, with an algorithm GAP. US 2014/0171492 A1 Jun. 19, 2014
BESTFIT, or FASTA in the Wisconsin Genetics Software phase border. FACS analysis shows synchronization after the Package Release 7.0, using default gap weights. treatment. FIG. 1L shows the levels of coding and ecRNA 0035. By “subject' is meant a human or non-human ani upon release from double thymidine block. Induction of mal (e.g., a mammal). ecRNA preceded and surpassed expression of C/EBPa 0036 By “treating a disease, disorder, or condition in a mRNA. Subject is meant reducing at least one symptom of the disease, 0040 FIGS. 2A-2C show that down-regulation of C/EBPa disorder, or condition by administrating a conjugate or thera extra-coding RNAs leads to down-regulation of C/EBPa peutic polypeptide to the Subject. mRNA expression and increased methylation of the C/EBPa 0037. By “prophylactically treating a disease, disorder, promoter region. FIG. 2A is a graph showing the effect of or condition in a Subject is meant reducing the frequency of shRNAs that target extra-coding RNAs on the levels of extra occurrence or severity of (e.g., preventing) a disease, disorder coding RNA (left) and of mRNA expression (right). The or condition by administering to the Subject a conjugate or shRNAS are designed against the sequence after the polyA therapeutic polypeptide to the Subject prior to the appearance signal. FIG. 2B is a chart showing the effect of shRNAs that of a disease symptom or symptoms. target extra-coding RNAs on promoter methylation. Methy 0038. Other features and advantages of the invention will lation data from bisulfate sequencing was analyzed with BIO be apparent from the following Detailed Description, the Analyzer Software (Aggregated Representation of Methyla drawings, and the claims. tion Data). The white bars represent methylated states, the black bars represent unmethylated states of each CpG BRIEF DESCRIPTION OF THE DRAWINGS dinucleotide within the sequencing reads, and changes from 0.039 FIGS. 1A-1L show the characterization of an extra black bars (as shown in lane labeled “Scrambled in FIG. 2B) coding RNA of the C/EBPa gene. FIG. 1A is a diagram of to white bars (as shown in lanes labeled “sh 1.” “sh2 and coding (gray arrow) and extra-coding (arrow labeled with "-5 “sh3 in FIG. 2B) indicate increase in methylation states of kb') RNAs. The white rectangle indicates the position of the corresponding CpG dinucleotides. FIG. 2C is a graph show probe used in the RNA electrophoretic mobility shift assays ing quantification of the results shown in FIG.2B. (REMSAs). The black star indicates the C/EBPa mRNA 004.1 FIG. 3 shows immunoprecipitation of C/EBPa probe located in the 3' UTR region, and the white star indi extra-coding RNAs with antibodies against DNA methyl cates the extra-coding probe located after the polyA signal transferase 1 (DNMT1) and with control (IgG). The upper outside the coding sequence. FIG. 1B is a Northern blot panel shows the end-point of RT-PCR, and the bottom panel hybridization analysis of coding RNAs (black star), extra shows graphs having quantitated results from real time qRT coding RNAS (white star), and loading control (EtBr) using PCR. the mRNA probe and extra-coding probe in HL-60, U937, 0042 FIGS. 4A-4F show that DNMT1 binds to folded Jurkat, and K562 cell lines. FIG.1C show graphs for levels of RNAs with high affinity comparable to that of DNA. FIG. 4A coding (left) and extra-coding (right) C/EBPa transcripts in provides an exemplary RNA oligonucleotide corresponding cellular fractions from HL-60 cell lines. FIGS. 1D-1E Show to the 5' end of C/EBPa extra-coding RNA. FIG. 4B provides relative levels of the transcripts in total and nuclear fractions, stem-loop-like folding of the RNA oligonucleotide. FIG. 4C where the ratio between mRNA and ecRNA levels were 30:1 provides an exemplary double-stranded DNA oligonucle and 2:1 in total and nuclear fractions, respectively. FIG. 1F otide corresponding to the 5' sequence of the RNA oligo shows that DRB treatment did not reduce ecRNA levels upon nucleotide. FIG. 4D shows an analysis of a RNA electro release of cells from double thymidine block. FIG.1G shows phoretic mobility shift assay (REMSA) for RNA and DNA. that treatment with the Pol III inhibitor ML-60218 signifi Provided are data for free probes (lanes 1 and 5); probes with cantly reduced levels of ecRNA and Pol III-transcribed 5S DNMT1, without polydIdC (lanes 2 and 6); and probes with rRNA and only moderately affected C/EBPamRNA (P n.s.). DNMT1 having increasing amounts of competitor, polydIdC FIGS. 1C-1G show results of qRT PCR assays. Statistical (lanes 3, 4, 7, and 8). The bottom panel demonstrates unifor analysis performed by paired T-test (*P-0.05: **P<0.01; mity in probe loading. FIG. 4E shows that double-stranded ***P<0.001); and all error bars are meansits.d(n=3). FIG. 1H RNA (dsRNA) molecules bind to DNMT1 and single is a series of Northern blots of non-coding (nc) C/EBPa stranded RNA (ssERNA) of the same primary structure have transcripts performed on nuclear RNA fractions of three dif low to zero capacity for DNMT1. FIG. 4F shows an analysis ferent cell lines (left panel). The two middle panels demon of a REMSA with RNAseT3 digested transcripts correspond strate enrichment of non-coding C/EBPa transcripts in ing to the 5' regions of the C/EBPa extra-coding RNAs and the nuclear polyA(-) fraction; the right panel illustrates the luciferase gene, showing similar binding affinity of DNMT1 extent of polyA(-) fraction purity. FIG. 1 I are results from to dsRNAs from different sources. primer extension experiments performed on total cellular and 0043 FIGS.5A-5B show that transcription interferes with cellular polyA(-) RNAs of HL-60 cell line as described in the DNA methylation using an in vitro assay. FIG. 5A are sche experimental procedures. The AL16 oligonucleotide is matics showing (i) a hemimethylated DNA segment with an located in the coding region of C/EBPa gene. Primer exten integrated 17 promoter; (ii) an in vitro transcription assay sion revealed a ~4 kb band in the polyA(-) fraction, marking using T7 polymerase and nucleotide triphosphates (NTPs): the TSS for non-coding transcript at ~2 kb upstream to the (iii) a parallel in vitro transcription and methylation assay mRNA TSS. FIG. 1J are sequences used for mapping non using T7 polymerase, NTPs, and DNMT1; and (iv) an in vitro coding C/EBPa transcripts by 5', 3 RACE in two cell lines, methylation assay using NTPs and DNMT1. FIG. 5B shows HL-60 and U937. R4, R6, R8, and AL21, A123, AL25 are a combined bisulfite restriction analysis (COBRA) assay of primers used in RACE. Also provided are the 5' and 3' ends of methylation patterns acquired using the assays provided in non-coding and coding transcripts in both cell lines. FIG. 1K FIG. 5A(ii)-(iv). The black arrow indicates the presence of show results from double thymidine block of HL-60 cells. digestion products and shows that DNMT1 activity is present Treatment with thymidine (2.5 mM) arrested the cells in G1/S in the absence of transcription. US 2014/0171492 A1 Jun. 19, 2014
0044 FIGS. 6A-6D show exemplary gene-specific RNA shRNAs on methylation of the C/EBPa promoter using oligonucleotides for reducing DNA methylation. FIG. 6A is a bisulfite sequencing. The lollipop representation is used to schematic showing high-expressing RNAS that sequesters show methylation patterns, where black dots indicate methy DNMT1 and interferes with DNA methylation of the corre lated positions and white dots indicate unmethylated posi sponding region (left). In absence of transcription (right), tions. FIG.13D shows DNA methylation changes as the ratios DNMT1 methylates the targeted region. FIG. 6B is a sche of methylated to unmethylated CpGs in all clones analyzed matic showing a proposed, non-limiting mechanism of per each construct. FIGS. 13E-13K show the results of DNMT1 sequestration by a double-stranded chimeric RNA ecRNA gain-of-function studies in K562 cells, in which oligonucleotide. FIG. 6C is a schematic showing a proposed C/EBPa is methylated and silenced. FIG. 13E shows the non-limiting mechanism of DNMT1 sequestration through effect of ecRNA upregulation on levels of C/EBPa mRNA. forming a double-stranded complex between natural RNA The unrelated region (UR) is a 705 bp fragment located ~45 and a single-stranded chimeric RNA oligonucleotide. FIG. kb downstream to the C/EBPa gene. FIG. 13F shows the 6D depicts a proposed, non-limiting mechanism of DNMT1 effect of ecRNA upregulation on methylation of the C/EBPa sequestration through triplex structure formation (e.g., H locus, where lollipop representations (left) and DNA methy form) between genomic DNA and a single-stranded chimeric lation changes (right) are provided. FIGS. 13G-13 I show RNA oligonucleotide. Aza indicates 5-aza-2'-deoxycytidine comparisons of DNA methylation changes imposed by or an analog thereof. ecRNA overexpression and 5-Aza-CR treatment by Mas 004.5 FIGS. 7A-7D show results from an exemplary SARRAY analysis. FIG. 13G is a diagram showing the posi screen for extra-coding RNA having “target site specificity.” tion of Mass ARRAY target regions: C/EBPa and C/EBPg FIG. 7A depicts the position of two chosen regions within genes; and CpG islands. FIG. 13H is a heatmap representing C/EBPa extra-coding RNA: R1 and R2. BLAST analyses are the methylation level of individual CpGs for overexpression provided for R2 (FIG. 7B) and R1 (FIG. 7C). FIG. 7D is a samples (UR, R1); two untreated control cell lines (K562, Northern blot hybridization analysis of probes corresponding HL-60); and mock 5-Aza-CR-treated cells; below are snap to regions R1 and R2, where total RNAs was extracted from shots of regions corresponding to C/EBPa and C/EBPg genes. cell lines that express C/EBPa (HL-60 and U937 cell lines) FIG. 13I shows methylation changes (Methylation Delta) and from cell lines that do not express C/EBPa (HEK293 and induced by ectopic ecRNA expression that are significant K562 cell lines). only within C/EBPalocus. The region +6 kb includes the R1 0046 FIG.8 provides an exemplary sequence of the 3'-end fragment and was excluded from the statistical analysis. of the C/EBPa extra-coding RNA (SEQID NO:1). FIGS. 13J-13K are comparative analyses of C/EBPa and 0047 FIG. 9 provides exemplary extra-coding RNAs of C/EBPg expression and methylation changes following four different locations of the spleen focus forming virus 5-Aza-CR treatment and ecRNA overexpression in K562 proviral integration oncogene spil (SPI1, Homo sapiens) cells, where lollipop representations (left), DNA methylation gene locus, including bases 47356552-47356358 (SEQ ID changes (middle), and changes in expression levels deter NO:2), 47340202-47339789 (SEQ ID NO:3), 47342950 mined by qRT PCR (right) are provided. FIG. 13L is a dia 47342689 (SEQ ID NO:4), and 473401.98-47339789 (SEQ gram indicating the position of regions of the ecRNA ID NO:5) of Homo sapiens chromosome 11, GRCh37.p2 employed for overexpression (R2 and R1) and unrelated primary reference assembly (NCBI Ref. Seq. NT 009237. regions (UR), and regions of C/EBPa gene analyzed for 18). changes in DNA methylation (CDs and 3'UTR). FIG. 13M is 0048 FIG. 10 provides exemplary extra-coding RNAs of a Northern blot analysis of untransfected K562 and K562 two different locations of the retinoid X receptor alpha stably transfected with constructs R1, UR, and EV (empty (RXRA, Homo sapiens) gene locus, including bases 126630 vector) demonstrating uniformity of overexpression levels of 127130 (SEQID NO:6) and 127305-127805 (SEQID NO:7) R1 and UR constructs. FIG.13N shows the effect of ecRNA of Homo sapiens chromosome 9, GRCh37.p2 primary refer upregulation on methylation of the C/EBPalocus by COBRA ence assembly (NCBI Ref. Seq. NT 019501.13). analysis of the coding and 3' UTR regions of C/EBPa gene. 0049 FIG. 11 provides an exemplary sequence of C/EBPa Blackarrows indicate incompletely digested PCR products of extra-coding RNA (SEQID NO:8). bisulfite converted genomic DNAs isolated from cells stably 0050 FIG. 12 provides an exemplary sequence of retinoic transfected with R1 and UR constructs. FIG. 13O shows the acid receptor beta (RARB, Homo sapiens) extra-coding RNA effect of ecRNA upregulation on levels of C/EBPa mRNA, (SEQ ID NO:9), including bases 25407956-25410445 of where overexpression of R1 led to significant upregulation of Homo sapiens chromosome 3, GRCh37.p2 primary reference ecRNA. FIG. 13P shows comparative analyses of effects of assembly (NCBI Ref. Seq. NT 022517.18). ecRNA upregulation and 5-Aza-CR treatment on TP73 pro 0051 FIGS. 13 A-13P show the loss- and gain-of-function moter methylation and TP73 mRNA expression level, where studies demonstrating that ecRNA maintains C/EBPa expres lollipop representations (left) and DNA methylation changes sion by regulating methylation of the C/EBPa locus. FIG. (right) are provided. For FIGS. 13H-13K and 13P. error bars 13A is a diagram indicating the position of target sequences indicate meansitS.d.; all bisulfite sequenced clones were ana for shRNA constructs (sh 1-3; vertical arrows); the 1057 bp lyzed by Fisher's exact test: Mass ARRAY data were ana fragment derived from the ecRNA employed for overexpres lyzed by paired T-test; and *P<0.05; **P<0.001: ***P<0. sion (R1; double-headed arrow); and regions analyzed for OO1. changes in DNA methylation (distal promoter, coding 0.052 FIGS. 14A-14C are results from experiments show sequence, CDS; and 3'UTR; white double-headed arrows). ing that transcription impedes DNA methylation. FIGS. 14A FIGS. 13B-13D show results of ecKNA loss-of-function, in and 14B show lollipop representations of bisulfite sequenced which C/EBPa is expressed. FIG. 13B shows the effect of clones analyzed by Fisher's exact test (*P-0.05: **P<0.01; ecRNA-targeting shRNAs on C/EBPa transcript levels in ***P<0.001). The right panels show DNA methylation U937 cells. FIG. 13C shows the effect of ecRNA-targeting changes as described in FIG. 13D. The same effect was US 2014/0171492 A1 Jun. 19, 2014 observed with two different RNA polymerases: T7 and FIG. 15L is a gel showing that DNMT1 binding to folded Sigma-Saturated (o70)-Holoenzyme (E. coli RNA poly ssRNA is not affected by the absence of CpG dinucleotides merase). FIG. 14C is a schematic showing the generation of when stem-and-loop-like structure is preserved. FIG. 15M is hemimethylated DNA. (a and b) The region corresponding to an RNA EMSA performed in the presence of increasing con the 5' region of the ecRNA genomic template was amplified centration of spermine, where no significant changes in bind using a forward primer containing the T7 promoter sequence ing were observed. and a biotinylated (arrowhead B) and not-biotinylated reverse 10054 FIGS. 16A-16H show the DNMT1 epitranscrip primers containing a unique BstX1 restriction site (unmethy tome analysis. FIG.16A is a pie chart showing distribution of lated DNA; umlDNA). (c) Biotinylated umlDNA was in vitro specific DNMT1 library peaks. FIG. 16B is a comparison of methylated with M.SssI(NEB). (d) Efficiency of methylation gene expression and methylation levels between DNMT1 was assessed by restriction digestion of the methylated DNA unbound and DNMT1 bound groups (P<0.0001). FIG. 16C (mDNA) with methylation insensitive and sensitive restric shows a DNMT1 Epitranscriptome map, where the cloud tion enzymes MspI and HpaFI, respectively. (e) 10x molar plots representing genes within DNMT1 unbound and bound excess of not biotinylated uml)NA was mixed with biotiny groups were stratified by methylation and expression levels. lated mDNA. The mixture was denatured (100° C.: 5 min FIG. 16D shows examples of genes falling into the C utes), quickly chilled to 70° C., and reannealed by slow chill (C/EBPa) and B (USP29) clusters. Peaks are visualized using ing down to 4°C. (OThe biotinylated DNAs, a ~10:1 mixture SISSRs (Site Identification from Short Sequence Reads) of hmDNAS and mDNAs, were captured with streptavidin (Jothietal. Nucleic Acid Res 36:5221-5231, 2008). FIG.16E magnetic beads. (g) The beads were removed following is a chart showing enrichment of C/EBPaecPNA in a cDNA BstX1 restriction digestion. (h) COBRA analysis was per library made of RNAs that co-immunoprecipitated with anti formed to assess the purity of the himDNA. The primers for hDNMT1 antibody. FIG.16F is a flow chart of RIPseq analy bisulfite converted DNA were designed against the upper sis showing various steps applied for the comparative RIPseq (unmethylated) strand, hence BstU1 I digestion of himDNA and RRBS analyses. FIGS. 16G and 16H are additional and uml)NA should present identical restriction patterns. examples of genes in clusters C and B. Presence of trace amount of BStUI digestion fragments in 0055 FIG. 17 is a non-limiting model of putative long hmDNA lane (marked with asterisk) reflects -<10% of the distance DNMT1 sequestration by ecRNA. Without being mDNA in the mixture (e and f). limited by theory, this model proposes that ecRNA is tran scribed from remote genomic template (located nearby to 0053 FIGS. 15A-15M show that DNMT1 binds to RNA coding genes 1 and 2) and maintain close physical proximity with a greater affinity than to DNA. FIG.15A is a result from with coding genes 3 and 4 by chromatin looping. This an RNA immunoprecipitation (RIP) demonstrating that ecRNA, being identified by RIPseq, will likely be aligned to ecRNA is immunoprecipitated with anti-DNMT1 antibody in the respective "Coding genes 1 and 2 loci' and not to the HL-60 cells. Error bars are meansits.d. FIG.15B is a diagram showing the position and sequences of RNA and dsDNA remote coding genes 3- and 4-corresponding loci. The coding oligonucleotides used in EMSA. Asterisks indicate position gene 5 belongs to cluster E. where its expression may be less of methylated cytosines. uml)NA, hm)NA, and mDNA refer likely to be affected by methylation (as detected by RRBS). to unmethylated, hemimethylated, and methylated DNA 0056 FIG. 18 is a gene ontology (GO) chart of exemplary probes, respectively. FIG. 15C are RNA and DNA EMSA genes within cluster C. Enrichment is shown for the first 20 performed with a fixed concentration of ssRNA and dsDNAS GO's biological process annotations, where enrichment was (1 nM) and increasing concentrations of DNMT1 protein as determined by using Benjamini corrected P-values and -log indicated above the gel. FIG. 15D is a nonlinear regression (P-value) are provided. analysis of bound RNA/DNA vs. DNMT1 concentrations. Error bars indicates.d. from two independent EMSAs. FIG. DETAILED DESCRIPTION 15E shows the secondary structures predicted by RNAfold of 0057 Contrary to traditional views that DNA methylation ssRNA R05 and R04. FIG. 15F is a REMSA showing that affects gene expression, we have discovered that gene expres R04 displays lower DNMT1 affinity compared to R05 (FIG. Sion, i.e., transcription, affects DNA methylation. Our dis 15C, left panel) at the same DNMT1 concentrations. FIG. covery is based on the observation that (i) double-stranded 15G is a graph showing that ecRNA specifically immunopre RNA molecules bind to DNA methyltransferase (DNMT1), cipitates with anti-hDNMT1 antibody in U937 cells. FIG. (ii) single-stranded RNA of the same primary structure have 15H shows the enrichment of non-polyadenylated ecRNA in low to Zero capacity to bind DNMT1, and (iii) DNMT1 is DNMT1-RNA precipitate (PolyA(-)) in HL-60 cells. The inactive during transcription. Based on these observations, schematics outline the tested procedure and the TaqMan we developed single-stranded chimeric RNA oligonucle probe set (black double headed arrow) used to detect both otides (CROs) having the dual ability to inactivate DNA C/EBPatranscripts (polyadenylated CEBPamRNA and non methyltransferase (DNMT) by enhanced binding between an polyadenylated C/EBPa ecRNA). FIG. 15L is a diagram RNA sequence and DNMT and to target a specific gene showing positions and sequences of RNA and DNA oligo during transcription by binding an extra-coding RNA or by nucleotides used in EMSA, where possible stem-loop-like triplex formation with genomic DNA. Though the extra-cod folding within the ecRNA sequence is also shown. dsRNA ing RNA can include both coding and non-coding regions, we oligo represents imperfect duplex between RNA oligo R01 have discovered that non-coding regions of an extra-coding and R03; double-stranded DNA oligo correspond to the RNA may play a functional role in gene expression. sequences of the RNA oligo. FIG. 15J shows RNA and DNA I0058 Without wishing to be limited by theory, we hypoth EMSA performed with increasing amounts of competitors: esize that: (i) cell-type specific transcription is an underlying polydI-dC and dsDNA. FIG. 15K shows secondary structures cause of the diverse methylation patterns; (ii) RNAs as physi of R01 and mutated R01. Both are able to form stem-and cal entities could establish and maintain cell-type specific loop-like structures. Asterisks indicate C to U substitutions. methylation patterns; (iii) modulation of expression levels of US 2014/0171492 A1 Jun. 19, 2014 selected transcripts may change methylation patterns of can be performed at high Stringency conditions (as shown in respective genes and ultimately gene expression; and (iv) the FIGS. 7B-7C) and/or Northern blot hybridization assays can enhanced ability of RNA to bind DNMT1 could be exploited be performed at a lower concentration of sodium chloride in the development of a novel, therapeutic gene-specific dem (e.g., 0.2 MNaCl, 0.1 MNaCl, or 50 mM. NaCl) (as shown in ethylating agent. FIG. 7D). Exemplary gene targets for CROs are provided 0059 Gene-specific CROs can be obtained by including herein. unique genomic sequences with low capacity to form second 0065 Extra-Coding RNA ary structures. When the CRO form a double-stranded duplex 0.066 Extra-coding RNAs (ecRNAs) can include both with their target, i.e., a naturally occurring RNA, the formed coding and non-coding regions of a gene. In particular, the duplex will bind DNMT1 through its observed binding capac CRO includes a sequence that is gene-specific. Exemplary ity to dsRNA. When the gene target is not available, such as genes include: C/EBPa (CCAAT enhancer binding protein when the RNA is not being transcribed, then the lack of alpha, cluster C (GO Accession No.: GO:00 10605), HGNC secondary structure will prevent CROs from non-specifically Accession No.: 1833, NCBI Ref. Nos.: NP 004355.2, binding DNMT1. In this manner, the CROs target specific NM 004364.3); SPI1 (spleen focus forming virus (SFFV) genes and avoid the global demethylating effect observed proviral integration oncogene spil, cluster C (GO:00 10605), with traditional demethylating agents. Non-limiting HGNC:11241, NCBI: NP 001074016.1, NM 001080547. examples of the CRO interacting with transcribed RNA is 1); RXRA (retinoid X receptor, alpha, cluster C (GO: provided in FIGS. 6C and 6D. 0010605), HGNC:10477, NCBI:NP 002948.1, 0060. Furthermore, these chimeric RNA oligonucleotides NM 002957.4); RARB (retinoic acid receptor, beta, HGNC: can be used to deliver additional demethylating agents. For 9865, NCBI:NP 000956.2, NM 000965.3); RB1 (retino example, 5-azacytidine and or 5-aza-2'-deoxycytidine blastoma 1, cluster C (GO:0007049, GO:0051276, covalently bind DNMT1, and these known agents can be GO:0022402, GO:0006325, GO:0000278, GO:0016568, incorporated into CROs to further enhance binding between GO:0010605, and GO:0022403), HGNC:9884, NCBI:NP DNMT and RNA sequences. For example, when the CRO 000312.2, NM 000321.2); CDKN2A (cyclin-dependent includes 5-aza-2'-deoxycytidine and forms a double-stranded kinase inhibitor 2A, HGNC: 1787, NCBI:NP 478102.1, duplex with its gene target, then DNMT1 can bind via the NM 058195.2); CDH1 (cadherin 1, type 1, E-cadherin, secondary structure of the duplex and the 5-aza-modification HGNC:1748, NCBI:BAA88957.1, AB025106.1); CDH13 in cytidine. (cadherin 13, H-cadherin, HGNC:1753, NCBI:NP 001248. 0061 Taken together, these chimeric RNA oligonucle 1, NM 001257.3); TIMP3 (TIMP metallopeptidase inhibi otides can be used to treat various diseases associated with tor 3, HGNC: 11822, NCBI:NP 000353.1, NM 000362.4): aberrant DNMT activity, such as cancer, and to develop a new VHL (von Hippel-Lindau tumor suppressor, HGNC: 12687, field of customized, gene-targeted demethylating therapy. NCBI:NP 000542.1, NM 000551.2); MLH1 (mutL homolog 1, colon cancer, nonpolyposis type 2, HGNC:7127, Chimeric RNA Oligonucleotides NCBI:NP 00024.0.1, NM 000249.3); MGMT (O-6-meth 0062. The chimeric RNA oligonucleotide (CRO) of the ylguanine-DNA methyltransferase, HGNC:7059, NCBI: invention is capable of reducing the activity of DNA methyl NP 002403.2, NM 002412.3); BRCA1 (breast cancer 1, transferase and selectively or specifically hybridizing to a early onset, HGNC:1100, NCBI:NP 00923.1.2, target sequence in a gene and/or to a corresponding extra NM 007300.3); GSTP1 (glutathione S-transferase pil 1, coding RNA. The CRO includes a sequence of about 15 to HGNC:4638, NCBI:NP 000843.1, NM 000852.3); HLTF about 30 nucleotides having percentage complementarity to (helicase-like transcription factor, HGNC: 11099, NCBI: an extra-coding RNA of a gene. The formed duplex (with an NP 620636.1, NM 139048.2); RASSF1 (Ras association extra-coding RNA) and/or triplex (with the respective (RalGDS/AF-6) domain family member 1, HGNC:9882, genomic sequence) will allow for binding to DNMT. This NCBI:NP 733833.1, NM 170715.1); SOCS1 (suppressor binding will result in sequence-specific protection of the of cytokine signaling 1, HGNC: 19383, NCBI:NP 003736. respective genomic sequences from the enzymatic activity of 1, NM 003745.1); ESR1 (estrogen receptor 1, HGNC:3467, DNMT. Accordingly, these chimeric RNA oligonucleotides NCBI:NP 001116214.1, NM 001122742.1); and DAPK1 can be used for treatment (e.g., as an agent for cancer therapy) (death-associated protein kinase 1, HGNC:2674, NCBI:NP or for diagnostic methods or kits (e.g., as a probe for a diag 004929.2, NM 004938.2). Exemplary gene-specific nostic assay). sequences for the CRO include the 3'-end of C/EBPaecKNA 0063. The RNA sequence of the CRO binds DNMT and provided in FIG. 8 (SEQ ID NO: 1) and fragments of the reduces methylating activity. As described herein, DNMT C/EBPaecRNA provided in FIG.11 (SEQIDN0:8); a region strongly interacts with RNA in a manner that is not sequence of SPI1 ecRNA, including the four regions provided in FIG. specific. In particular, DNMT can bind RNA more strongly 9 (SEQID NOS:2-5); a region of RXRA ecRNA, including than DNA with the same primary structure. Optionally, bind the two regions provided in FIG. 10 (SEQID NOs:6-7); and ing between the CRO and DNMT could be further enhanced a region of RARB ecRNA, including fragments of the RARB by including one or more modified nucleotides (e.g., cytidine ecKNA provided in FIG. 12 (SEQID NO:9). or analogs thereof) that covalently bind to DNMT. Exemplary 0067 Based on the various genes described herein (e.g., cytidine analogs are described herein. any described herein, such as those in cluster C), the gene 0064. In addition to binding DNMT, the CRO includes a specific sequences for the CRO can be designed having a sequence to selectively or specifically hybridizing to its target sequence that is at least 80% (e.g., at least 85%, 90%. 95%, sequence, i.e., an extra-coding RNA (ecrNA), of a gene. 96%, 97%, 98%, 99% or more) complementary to a region Binding of the CRO to the ecRNA can be determined by any spanning the promoter, the coding part of the gene, and/or the useful method. Optionally, the methods can be performed 3'-downstream part (e.g., -2 kilobases and/or +2 kilobases under stringent conditions. For example, BLAST searches from the transcriptional start site (TSS) or the transcriptional US 2014/0171492 A1 Jun. 19, 2014
end site (TES) of the genes, respectively). Any useful method tein catabolic process), genes related to chemical reactions can be used to determine such TSS and TES positions, includ and pathways resulting in the breakdown of a protein or ing various databases (e.g., TESS: Transcription Element peptide (GO:00 19941, modification-dependent protein cata Search System, available at www.cbil.upenn.edu/tess/, and bolic process), genes related to chemical reactions and path Transcriptional Regulatory Element Database (TRED), ways resulting in the breakdown of a macromolecule (GO: available at rulai.cshl.edu/cgi-bin/TRED/tred. 0043.632, modification-dependent macromolecule catabolic cgi?process home). Exemplary gene-specific sequences for process), genes related to hydrolysis of a peptide resulting in the CRO include the 3'-end of C/EBPa ecRNA provided in the breakdown of a protein (GO:0051603, proteolysis FIG. 8 (SEQID NO: 1) and fragments of the C/EBPaecRNA involved in cellular protein catabolic process), and genes provided in FIG. 11 (SEQIDN0:8); a region of SPI1 ecRNA, related to cell cycle processes involved in the progression of including the four regions provided in FIG. 9 (SEQID NOs: biochemical and morphological phases that occur during Suc 2-5); a region of RXRA ecRNA, including the two regions cessive cell or nuclear replication events (GO:0022403, cell provided in FIG. 10 (SEQ ID NOS:6-7); and a region of cycle phase), where definitions for such terms and related GO RARB ecRNA, including fragments of the RARB ecRNA accessions numbers are provided on www.geneontology.org provided in FIG. 12 (SEQID NO:9). (AmiGO version 1.8, last accessed Apr. 11, 2012). Further 0068 Also described herein are methods of identifying exemplary non-limiting GO categories include GO:0044257, ecRNAs, as well as CROs that bind to such ecRNAs to form cellular protein catabolic process; GO:0006281, DNA repair; a complex and such complexes that bind DNMT. In some GO:0006974, response to DNA damage stimulus: non-limiting embodiments, the CRO includes a sequence that GO:0006412, translation; GO:0006511, ubiquitin-dependent is gene-specific (e.g., a complementary to a particular gene), protein catabolic process; GO:0033554, cellular response to where the gene is in cluster C, as described herein (e.g., see stress; GO:0046907, intracellular transport; GO:0000375, Example 8). RNA splicing, via transesterification reactions; GO:0000398, 0069. In some embodiments, the genes incluster C belong nuclear mRNA splicing, via spliceosome; GO:0000377, to particular Gene Ontology (GO) categories (www.geneon RNA splicing, via transesterification reactions with bulged tology.org and The Gene Ontology Consortium, "Gene ontol adenosine as nucleophile; GO:0051301, cell division; ogy: tool for the unification of biology.” Nat. Genet. 25(1): GO:0034660, incRNA metabolic process; GO:0000279, M 25-29 (2009)). Exemplary non-limiting GO categories phase; GO:0010558, negative regulation of macromolecule include genes related to conversion of one or more primary biosynthetic process; GO:00 10629, negative regulation of RNA transcripts into one or more mature RNA molecules gene expression; GO:0009890, negative regulation of biosyn (GO:0006396, RNA processing); genes related to biochemi thetic process; GO:0006260, DNA replication; GO:0006350, cal and morphological phases that occur during Successive transcription; GO:0045449, regulation of transcription; cell or nuclear replication events (GO:0007049, cell cycle), GO:0031327, negative regulation of cellular biosynthetic genes related to chemical reactions and pathways involving process; GO:00 10498, proteasomal protein catabolic pro mRNA (GO:0016071, mRNA metabolic process), genes cess; GO:0043 161, proteasomal ubiquitin-dependent protein related to assembly, arrangement, or disassembly of chromo catabolic process; GO:0000280, nuclear division; somes (GO:0051276, chromosome organization), genes GO:0007067, mitosis; GO:004.8285, organelle fission: related to splicing and joining primary RNA transcript to GO:0051726, regulation of cell cycle; GO:0000087, Mphase form mature form of the RNA (GO:0008380, RNA splicing), of mitotic cell cycle; GO:0045934, negative regulation of genes related to cellular breakdown of macromolecules, large nucleobase, nucleoside, nucleotide and nucleic acid meta molecules (e.g., proteins), nucleic acids and carbohydrates bolic process; GO:0043933, macromolecular complex sub (GO:0044265, cellular macromolecule catabolic process), unit organization; and GO:0016481, negative regulation of genes related to cellular metabolic process involving deox transcription. yribonucleic acid (GO:0006259, DNA metabolic process), 0070 Exemplary non-limiting genes in GO Accession No. genes related to conversion of a primary mRNA transcript GO:0006396 (RNA processing) include those having the fol into one or more mature mRNA (GO:0006397, mRNA pro lowing abbreviated name, the full name, the HGNC Acces cessing), genes relate to breakdown of a macromolecule or sion No., and the chromosome location: SCAF1 (SR-related any molecule of high relative molecular mass having multiple CTD-associated factor 1, HGNC:30403, 19q13.3-q13.4): repetition of subunits (GO:0009057, macromolecule cata RALY (RNA binding protein, autoantigenic (hnRNP-associ bolic process), genes related to cellular processes involved in ated with lethal yellow homolog (mouse)), HGNC:15921, the progression of biochemical and morphological events that 2011.21-q11.23): NCBP2 (nuclear cap binding protein sub occur during Successive cell or nuclear replication events unit 2, 20 kDa, HGNC:7659, 3g29): EIF2C2 (eukaryotic (GO:0022402, cell cycle process), genes related to the speci translation initiation factor 2C, 2, HGNC:3263, 8q24); fication, formation, or maintenance of the physical structure CHERP (calcium homeostasis endoplasmic reticulum pro of eukaryotic chromatin (GO:0006325, chromatin organiza tein, HGNC: 16930, 19p 13.1); RPL14 (ribosomal protein tion), genes related to progression through the phases of the L14, HGNC:10305, 3p22-p21.2); RBM3 (RNA binding mitotic cell cycle (GO:0000278, mitotic cell cycle), genes motif (RNP1, RRM) protein 3, HGNC: 9900, Xp11.2); LSM6 related to alteration of DNA, protein, or RNA in chromatin (LSM6 homolog, U6 small nuclear RNA associated (S. cer (GO:0016568, chromatin modification), genes related to pro evisiae), HGNC:17017, 4q31.21); RBM4 (RNA binding cesses that decreases the frequency, rate, or extent of the motif protein 4, HGNC:9901, 11q13); RBM5 (RNA binding chemical reactions and pathways involving macromolecules motif protein 5, HGNC:9902, 3p21.3); SYNCRIP (synap (GO:00 10605, negative regulation of macromolecule meta totagmin binding, cytoplasmic RNA interacting protein, bolic process), genes related to chemical reactions and path HGNC:16918, 6q14-q15); ZNF638 (zinc finger protein 638, ways resulting in the breakdown of a protein either with or HGNC:17894, 2p13.1); SART3 (squamous cell carcinoma without the hydrolysis of peptide bonds (GO:0030163, pro antigen recognized by T cells 3, HGNC:16860, 12q24.11); US 2014/0171492 A1 Jun. 19, 2014
WTAP (Wilms tumor 1 associated protein, HGNC:16846, (heterogeneous nuclear ribonucleoprotein M, HGNC:5046, 6q25-q27); PNN (pinin, desmosome associated protein, 19p13.3-p13.2); DDX46 (DEAD (Asp-Glu-Ala-Asp) box HGNC:9162, 14q21.1); PUS7L (pseudouridylate synthase 7 polypeptide 46, HGNC:18681, 5q31.1); RPS28 (ribosomal homolog (S. cerevisiae)-like, HGNC:25276, 12q12); APP protein S28, HGNC:10418, 19p 13.2); CNOT6L (CCR4 (amyloid beta (A4) precursor protein, HGNC:620, 21q21.2): NOT transcription complex, subunit 6-like, HGNC:18042. DDX23 (DEAD (Asp-Glu-Ala-Asp) box polypeptide 23, 4q13.3); METTL1 (methyltransferase like 1, HGNC:7030, HONC:17347, 12q13.11); DHX38 (DEAH (Asp-Glu-Ala 12q13); HNRNPF (heterogeneous nuclear ribonucleoprotein His) box polypeptide 38, HGNC:1721 1, 16q22); SRRM2 F, HGNC:5039, 10q11.21); PRKRA (protein kinase, inter (serine/arginine repetitive matrix 2, HGNC:16639, 16p13.3); feron-inducible double stranded RNA dependent activator, TARDBP (TAR DNA binding protein, HGNC:11571, 1 p36. HGNC:9438, 2d 31.2); HNRNPD (heterogeneous nuclear 22); INTS6 (integrator complex subunit 6, HGNC:14879, ribonucleoprotein D (AU-rich element RNA binding protein 13q14.3); U2AF1 (U2 small nuclear RNA auxiliary factor 1, 1, 37 kDa), HGNC:5036, 4q21); HNRNPC (heterogeneous HGNC:12453, 21q22.3); LSM5 (LSM5 homolog, U6 small nuclear ribonucleoprotein C (C1/C2), HGNC:5035, 14q11): nuclear RNA associated (S. cerevisiae), HGNC:17162, 7p14. RPL10A (ribosomal protein L10a, HGNC:10299, 6p21.31); 3); LSM4 (LSM4 homolog, U6 small nuclear RNA associ PABPC1 (poly(A) binding protein, cytoplasmic 1, HGNC: ated (S. cerevisiae), HGNC:17259, 19p 13.1); SRRM1 8554, 8q22.2-q23); ARL6IP4 (ADP-ribosylation-like factor (serine/arginine repetitive matrix 1, HGNC:16638, 1p36): 6 interacting protein 4, HGNC:18076, 12q24.31); DDX41 LSM3 (LSM3 homolog, U6 small nuclear RNA associated (DEAD (Asp-Glu-Ala-Asp) box polypeptide 41, HGNC: (S. cerevisiae), HGNC:17874, 3p25.1); PTBP2 (polypyrimi 18674, 5q35.3); RPS24 (ribosomal protein S24, HGNC: dine tract binding protein 2, HGNC:17662, 1 p21.3); TGS1 10411, 10q22); PRPF40A (PRP40 pre-mRNA processing (trimethylguanosine synthase 1, HGNC:17843, 8q11): factor 40 homolog A (S. cerevisiae), HGNC:16463, 2c23.3); RBM10 (RNA binding motif protein 10, HGNC:9896, Xp11. RTCD1 (RTCA) (RNA 3'-terminal phosphate cyclase, 3): IMP4 (IMP4, U3 small nucleolar ribonucleoprotein, HGNC:17981, 1p13.3); MPHOSPH10 (M-phase phosphop homolog (yeast), HGNC:30856, 2d21.1); CCAR1 (cell divi rotein 10 (U3 small nucleolar ribonucleoprotein), HGNC: sion cycle and apoptosis regulator 1, HGNC:24236, 10q22. 7213, 2p13.3); SMAD2 (SMAD family member 2, HGNC: 1); PABPN1 (poly(A) binding protein, nuclear 1, HGNC: 6768, 18q21); RNPS1 (RNA binding protein S1, serine-rich 85.65, 14q11.2); RRP1 (ribosomal RNA processing 1 domain, HGNC:10080, 16p13.3); CASC3 (cancer suscepti homolog (S. cerevisiae), HGNC:18785, 21q22.3); SF3B14 bility candidate 3, HGNC:17040, 17q11-q21.3); INTS10 (in (Splicing Factor 3B, 14-kD subunit, HPRD: 09702, 2pter tegrator complex subunit 10, HGNC:25548, 8p21.3); DDX5 p25.1); EMG1 (EMG 1 nucleolar proteinhomolog (S. cerevi (DEAD (Asp-Glu-Ala-Asp) box helicase 5, HGNC:2746, siae), HGNC:16912, 12p13); PTBP1 (polypyrimidine tract 17q21); U2AF1 L4 (U2 small nuclear RNA auxiliary factor binding protein 1, HGNC:9583, 19p13.3); HNRNPA2B1 1-like 4, HGNC:23020, 19q13.13); RBMX (RNA binding (heterogeneous nuclear ribonucleoprotein A2/B1, HGNC: motif protein, X-linked, HGNC:9910, Xq26); HNRNPA1 5033,7p15); RRP9 (ribosomal RNA processing 9, small sub (heterogeneous nuclear ribonucleoprotein A1, HGNC:5031, unit (SSU) processome component, homolog (yeast), 12q13.1); HNRNPAO (heterogeneous nuclear ribonucleopro HGNC:16829, 3p21.31); HNRNPR (heterogeneous nuclear tein A0, HGNC:5030, 5q31); NOP14 (NOP14 nucleolar pro ribonucleoprotein R, HGNC:5047, 1 p36.12); HNRNPU(het tein homolog (yeast), HGNC:16821, 4p16.3); URM1 (ubiq erogeneous nuclear ribonucleoprotein U (scaffoldattachment uitin related modifier 1, HGNC:28378, 9q34.13); DDX56 factor A), HGNC:5048, 1 q44); RNMTL1 (RNA methyltrans (DEAD (Asp-Glu-Ala-Asp) box helicase 56, HGNC:18.193, ferase like 1, HGNC:18485, 17p13.3); B1CD1 (bicaudal D 7p13); HNRNPH3 (heterogeneous nuclear ribonucleoprotein homolog 1 (Drosophila), HGNC: 1049, 12p11.2-p11.1); H3 (2119), HGNC:5043, 10q22); UPF3B (UPF3 regulator of RSL1D1 (ribosomal L1 domain containing 1, HGNC:24534, nonsense transcripts homolog B (yeast), HGNC:20439, 16p13.13); WDR83 (WD repeat domain 83, HGNC:32672, Xq25-q26); NOLC1 (nucleolar and coiled-body phosphop 19p 13.13); PCF11 (PCFI 1, cleavage and polyadenylation rotein 1, HGNC:15608, 10q24.32); GTF2F1 (general tran factor subunit, homolog (S. cerevisiae), HGNC:30097. scription factor 11F, polypeptide 1, 74 kDa, HGNC:4652, 11 q13); PA2G4 (proliferation-associated 2G4, 38 kDa, 19p13.3); WDR3 (WD repeat domain 3, HGNC: 12755, HGNC:8550, 12q13.2): NOP2 (NOP2 nucleolar protein 1p12); DDX54 (DEAD (Asp-Glu-Ala-Asp) box polypeptide homolog (yeast), HGNC:7867, 12p13); RPS16 (ribosomal 54, HGNC:20084, 12q24.11); HNRNPH1 (heterogeneous protein S16, HGNC:10396, 19q13.1); RPS14 (ribosomal nuclear ribonucleoprotein H1 (H), HGNC:5041, 5q.35.3): protein S14, HGNC:10387, 5q31-q33); SNRPA (small SMC1A (structural maintenance of chromosomes 1A, nuclear ribonucleoprotein polypeptide A, HGNC: 11151, HGNC: 11111, Xp11.22-p11.21): PDCD7 (programmed cell 19q13.1); SNRPG (small nuclear ribonucleoprotein polypep death 7, HGNC:8767, 15q22.2); POP7 (processing of precur tide G, HGNC:11163, 2p13.3); CPSF3L (cleavage and poly sor 7, ribonuclease P/MRP subunit (S. cerevisiae), HGNC: adenylation specific factor 3-like, HGNC:26052, 1 p36.33): 19949, 7q22); PUF60 (poly-U binding splicing factor FIP1L1 (FIP1 like 1 (S. cerevisiae), HGNC:19124, 4q11 60KDa, HGNC:17042, 8q24.3); ADAR (adenosine deami q12); ELAC2 (elaC homolog 2 (E. coli), HGNC:14198, nase, RNA-specific, HGNC:225, 1q21.3); UTP18 (UTP18 17p11.2); PUS1 (pseudouridylate synthase 1, HGNC:15508, Small Subunit (SSU) processome component homolog 12q24); STRAP (serine/threonine kinase receptor associated (yeast), HGNC:24274, 17q21.33); WBP4 (WW domain protein, HGNC:30796, 12p13.1): TRPT1 (tRNA phospho binding protein 4 (formin binding protein 21), HGNC: 12739, transferase 1, HGNC:20316, 11q13); NAA38 (N(alpha)- 13q13.3); HNRPLL (heterogeneous nuclear ribonucleopro acetyltransferase 38, NatC auxiliary subunit, HGNC:20471, tein L-like, HGNC:25127, 2p22); RNGTT (RNA guanylyl 7q31.1-q31.3); ZFC3H1 (zinc finger, C3H1-type containing, transferase and 5'-phosphatase, HGNC:10073, 6q16); DKC1 HGNC:28328, 12q21.1); HNRNPL (heterogeneous nuclear (dyskeratosis congenita 1, dyskerin, HGNC:2890, Xq28); ribonucleoprotein L, HGNC:5045, 19q13.2); HNRNPM DGCR8 (DiGeorge syndrome critical region gene 8, HGNC: US 2014/0171492 A1 Jun. 19, 2014
2847, 22d 11.2); TRMT6 (tRNA methyltransferase 6 HGNC:23797, 19p13.3); POLR2D (polymerase (RNA) II homolog (S. cerevisiae), HGNC:20900, 20p12.3); PCBP1 (DNA directed) polypeptide D, HGNC:9191, 2d21); IVNS 1 (poly(rC) binding protein 1, HGNC:8647, 2p13-p12); ABP (influenza virus NS1A binding protein, HGNC:16951, PCBP2 (poly(rC) binding protein 2, HGNC:8648, 12q13.12 1q25.1-q21.1): POLR2C (polymerase (RNA) II (DNA q13.13); QKI (QKI, KH domain containing, RNA binding, directed) polypeptide C, 33 kDa, HGNC:9189, 16q13-q21): HGNC:21 100, 6q26); TSEN2 (tRNA splicing endonuclease POLR2A (polymerase (RNA) II (DNA directed) polypeptide 2 homolog (S. cerevisiae), HGNC:28422, 3p25.2); FTSJ1 A, 220 kDa, HGNC:9187, 17p13.1); SF3B2 (splicing factor (Fts.J homolog 1 (E. coli), HGNC:13254, Xp11.23): 3b, subunit 2, 145 kDa, HGNC:10769, 11q13); PRPF 19 ZCCHC6 (zinc finger, CCHC domain containing 6, HGNC: (PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. 25817, 9q21): DUS1L (dihydrouridine synthase 1-like (S. cerevisiae), HGNC:17896, 11q12.2); EXOSC10 (exosome cerevisiae), HGNC:30086, 17q25.3); FTSJ3 (Fts.J homolog 3 component 10, HGNC:9138, 1p36.22); PPP2CA (protein (E. coli), HGNC:17136, 17q23); TFIP11 (tuftelin interacting phosphatase 2, catalytic Subunit, alpha isozyme, HGNC: protein 11, HGNC: 17165, 22d 12.1); PPP2R1A (protein 9299, 5q31.1): PRPF8 (PRP8 pre-mRNA processing factor 8 phosphatase 2, regulatory subunit A, alpha, HGNC:9302, homolog (S. cerevisiae), HGNC:17340, 17p13.3); USP39 19q13); EXOSC8 (exosome component 8, HGNC:17035, (ubiquitin specific peptidase 39, HGNC:2007 1, 2p11.2): 13q13.1); ZCCHC11 (zinc finger, CCHC domain containing ADAT2 (adenosine deaminase, tRNA-specific 2, HGNC: 11, HGNC:28981, 1 p32.3); EXOSC4 (exosome component 21172, 6q24.2); SCNM1 (sodium channel modifier 1, 4, HGNC:18189, 8q24.3); SARS (seryl-tRNA synthetase, HGNC:23136, 1q21.3); SNRNP70 (small nuclear ribonucle HGNC:10537, 1 p13.3); SF1 (splicing factor 1, HGNC: oprotein 70 kDa (U1), HGNC: 11150, 19q13.3); NSUN2 12950, 11q13); PRPF3 (PRP3 pre-mRNA processing factor 3 (NOP2/Sun domain family, member 2, HGNC:25994, 5p15. homolog (S. cerevisiae), HGNC:17348, 1q21.1); EXOSC1 32); RBM28 (RNA binding motif protein 28, HGNC:21863, (exosome component 1, HGNC:17286, 10q24); PRPF4 7q32.2); PPWD1 (peptidylprolyl isomerase domain and WD (PRP4 pre-mRNA processing factor 4 homolog (yeast), repeat containing 1, HGNC:28954,5q12.3); TYW1B (tRNA HGNC:17349, 9q31-q33); TTF2 (transcription termination yW synthesizing protein 1 homolog B (S. cerevisiae), HGNC: factor, RNA polymerase II, HGNC:12398, 1 p 13.1); PRPF6 33908, 7q11.23); TXNL4B (thioredoxin-like 4B, HGNC: (PRP6 pre-mRNA processing factor 6 homolog (S. cerevi 26041, 16q22.2): PDCD11 (programmed cell death 11, siae), HGNC:15860, 20d 13.33); TARBP1 (TAR (HIV-1) HGNC:13408, 10q24.32): TRMU (tRNA 5-methylaminom RNA binding protein 1, HGNC: 11568, 1 q42.2); HNRPDL ethyl-2-thiouridylate methyltransferase, HGNC:25481, (heterogeneous nuclear ribonucleoprotein D-like, HGNC: 22q13); RBM23 (RNA binding motif protein 23, HGNC: 5037, 4q21.22); EIF4A3 (eukaryotic translation initiation 20155, 14q11.1); SF3A2 (splicing factor 3a, subunit 2, 66 factor 4A3, HGNC:18683, 17q25.3); PAPD4 (PAP associ kDa, HGNC:10766, 19p13.3-p13.2); SF3A1 (splicing factor ated domain containing 4, HGNC:26776, 5q14.1); ROD1 3a, subunit 1, 120 kDa, HGNC:10765, 22q12.2); SF3A3 (PTBP3) (polypyrimidine tract binding protein 3, HGNC: (splicing factor 3a, subunit 3, 60 kDa, HGNC:10767, 1p): 10253, 9q32); SNRNP200 (small nuclear ribonucleoprotein SLBP (stem-loop binding protein, HGNC:10904, 4p16.3); 200 kDa (U5), HGNC:30859, 2d 11.2); CPSF7 (cleavage and D1 S3 (DIS3 mitotic control homolog (S. cerevisiae), HGNC: polyadenylation specific factor 7, 59 kDa, HGNC:30098, 20604, 13q21.32): HNRNPUL1 (heterogeneous nuclear 11 q12.2); CPSF6 (cleavage and polyadenylation specific fac ribonucleoprotein U-like 1, HGNC:17011, 19q13.31); tor 6, 68 kDa, HGNC: 13871, 12q15); SNRNP40 (small PPP1R8 (protein phosphatase 1, regulatory subunit 8. nuclear ribonucleoprotein 40kDa (U5), HGNC:30857, 1 p35. HGNC:9296, 1 p35.3); SFPQ (splicing factor proline/ 2): THOC4 (ALYREF) (Aly/REF export factor, HGNC: glutamine-rich, HGNC:10774, 1p34.3); LSM10 (LSM10, 19071, 17q25.3); CPSF4 (cleavage and polyadenylation spe U7 small nuclear RNA associated, HGNC: 17562, 1 p34.3): cific factor 4, 30 kDa, HGNC:2327, 7q22); RBM39 (RNA NOP56 (NOP56 ribonucleoproteinhomolog (yeast), HGNC: binding motif protein 39, HGNC:15923, 20d 11.22); CPSF3 15911, 20p13); RBM14 (RNA binding motif protein 14, (cleavage and polyadenylation specific factor 3, 73 kDa, HGNC: 14219, 11q13.2); and TXNL4A (thioredoxin-like HGNC:2326, 2p25.1): THOC3 (THO complex 3, HGNC: 4A, HGNC:30551, 18q23). 19072, 5q35.3); CPSF2 (cleavage and polyadenylation spe 0071. Additional exemplary genes also include those hav cific factor 2, 100kDa, HGNC:2325, 14q31.1); NHP2 (NHP2 ing the following abbreviated names, where the full name, the ribonucleoprotein homolog (yeast), HGNC: 14377, 5q35.3); HGNC Accession No., and the chromosome location can be TRUB2 (TruB pseudouridine (psi) synthase homolog 2 (E. accessed by using any useful database (e.g., HUGO Gene coli), HGNC:17170,9); PRPF38B (PRP38 pre-mRNA pro Nomenclature Committee (HGNC, available at www.gene cessing factor 38 (yeast) domain containing B, HGNC: names.org/hgnc-searches), Human Protein Reference Data 25512, 1p13.3); SSU72 (SSU72 RNA polymerase II CTD base (HPRD, available at www.hprd.org/index html), or the phosphatase homolog (S. cerevisiae), HGNC:25016, 1p36): NCBI Database): GO:0007049, cell cycle (ADCY3, THOC1 (THO complex 1, HGNC:19070, 18p11.32): MRPL41, AURKB, CDC16, WTAP, CD2AP, CTNNB1, POLR2H (polymerase (RNA) II (DNA directed) polypeptide CDCA8, APP, DDX11, INCENP, ILK, VPS4B, CDCA2, H, HGNC:9195, 3q28); POLR2L (polymerase (RNA) II VPS4A, H2AFX, TLK1, TLK2, SUPTSH, CCNA2, CDCA5, (DNA directed) polypeptide L, 7.6 kDa, HGNC:9199, CCAR1, CDCA3, ANAPC1, RAN, LIG1, POLE, SKP2, 11 p.15): POLR2J (polymerase (RNA) II (DNA directed) LIG3, ESPL1, UBR2, LIG4, NCAPD3, DCTN2, NCAPD2, polypeptide J, 13.3 kDa, HGNC:9197, 7q11.2); TRA2B MAPK1, UHRF1, PPP1 CA, RCC2, SPAG5, CNTROB, (transformer 2 beta homolog (Drosophila), HGNC: 10781, TBRG1, MAD2L2, MRE 11A, CDC34, CALR, RCC1, PIN1, 3q26.2-q27); UTP6 (UTP6, small subunit (SSU) processome SAC3D1, NCAPG2, SPIN2B, TCF3, NUDC, SSSCA1, component, homolog (yeast), HGNC:18279, 17q11.2): MLL, MKI67, MAP2K1, PCNT, NUF2, PCNP, CDC20, WBP11 (WW domain binding protein 11, HGNC:16461, CDC26, RAD54L, ATM, NOTCH2, NOLC1, DMTF1, 12p12.3); QTRT1 (cqueuine tRNA-ribosyltransferase 1, UBA3, CHAF1A, CCNT1, GTSE1, CCNE1, SEH1L,
US 2014/0171492 A1 Jun. 19, 2014
TRIP12, BUB3, USP31, UBXN1, STAMBP, LRRC41, CBL, ESPL1, TACC3, PPP1CB, WEE1, NCAPD3, NCAPD2, SPSB2, BIRC6, UBE2Q2, UBE2O1, CCNB1, WSB1, DCTN2, RCC2, TIMELESS, SPAG5, AKAP8, MAD2L2, PSMD14, HSP90B1, GMCL1, PSMD13, CUL4A, TCEB2, DSCC1, MRE 11A, KATNB1, ANAPC11, CDC34, RCC1, TBL1X, and BARD1); GO:0043.632, modification-depen CCNG2, NIPBL, SAC3D1, NCAPG2, FBXO43, CLASP2, dent macromolecule catabolic process (CBX4, MYLIP TCF3, HELLS, NUDC, SSSCA1, TAF1, MAP2K1, MKI67, CDC16, CD2AP, ZNRF2, WWP2, CUL9, RABGEF1, PCNT, NUF2, CDC20, CDC26, RAD54L, ATM, HDAC3, RBCK1, RNF149, RNF34, AUP1, CDCA3, PAN2, CDKN1B, NOLC1, PLK1, ZNF318, SMC1A, ABL1, E2F1, ANAPC1, USP1, UBR4, SKP2, SOCS7, UBR2, UBE2J2, MAD1L1, E2F4, RHOU, GTSE1, AKT1, CCNE1, SEH1 L, PSMA2, MIB1, PSMA1, UHRF1, KDM2A, PIAS4, PSMC3IP RANBP1, DYNC1H1, FANCA, CDC7, ARHGEF2, CCNK, DSN1, CCNF, PAPD7, TPX2, TRIM33, FBXL8, UBR5, PSMA4, FBXL5, ASB1, RNF138, NUSAP1, UBE2I, CDK6, RB1, RAD52, CDK4, CDK2, FBXL4, PIAS2, TNFAIP3, FBXL3, ASB6, RAD23B, KLHDC3, RAD51, CCND1, CCND2, TOP3A, ADAM17, RAD23A, NEDD8, UBA5, ANAPC11, CDC34, PSMA7, HAUS5, CAMK2G, USP9X, ZNF655, NCAPH, NCAPG, UBAC1, PSMB5, ARIH1, PSMB4, ARIH2, UBE2D2, BCL2, NPAT, PAFAH1B1, GFI1, PPP3CA, BUB3, TRIP13, PSMB1, FBXW5, FBXW4, FBXO43, STAMBPL1, NFATC1, BOD1, TXNL4B, PDS5A, ILF3, MIS12, RNF168, TRAF7, RNF167, FBXO9, HECTD1, FBXO7, CDC25A, SMC4, CCNB1, PSMD13, CUL4A, GSPT1, HACE1, PCNP, CDC20, CDC26, ATG3, ATE1, URM1, RNF6, PSMC5, PSMC4, VCP, UBA1, OTUB1, UBA2, SETD8, TXNL4A, and DNM2). UBA3, KIAA0368, UBE2G1, UBE2G2, BAP1, OS9, 0072 The candidate CRO for a particular gene can also be SENP6, FBXL19, FANCL, USP19, LONP1, MGRN1, screened for “target site specificity,” where the chosen frag PSMD1, PSMD2, PSMD3, USP11, NSMCE2, USP10, ment of the extra-coding RNA hybridizes exclusively with PSMD6, PSMD7, USP14, UBE2A, UFDIL, DDB1, HERC5, the targeted genomic site (gene locus) but not to any other HERC4, UBE2I, ERLIN1, HERC3, HERC2, WDR48, genomic site (gene loci). Candidate transcripts can be SENP3, PSME1, UBE2K, PSME2, UBE2M, UBC, DDB2, screened with any useful method. In one example, candidate USP21, KLHL12, SIAH2, USP22, USP24, UBE2S, USP7, sequences of RNA oligonucleotides are assessed by using an CUEDC2, OTUD5, USP3, UBE3B, C10ORF46, USP9X, algorithm with a genomic database (e.g., using a BLAST USP4, EDEM3, C12ORF51, STUB1, EDEM1, MYCBP2, algorithm with the following parameters: -E: 10, -B: 100, UBE2R2, SUMO2, RNF123, SQSTM1, MAP3K1, USP39, filter: dust, -W: 8, -M: 1, N: -1, -Q: 2, and -R: 1). In PPP2CB, USP36, FBXW 11, USP33, TRIP12, BUB3, another example, the candidate sequences are manually USP31, UBXN1, STAMBP, LRRC41, CBL, SPSB2, BIRC6, assessed by Northern blot hybridization, as described in UBE2O2, UBE2O1, CCNB1, WSB1, PSMD14, HSP90B1, Laboratory Techniques in Biochemistry and Molecular Biol GMCL1, PSMD13, CUL4A, TCEB2, TBL1X, and BARD1); ogy: Hybridization with Nucleic Probes (ed. P. C. van der GO:0051603, proteolysis involved in cellular protein cata Vliet, Elsevier Science Publishers B.V., 1993). Optionally, bolic process (IDE, CBX4, MYLIP, CDC16, CD2AP. the genomic database methods and Northern blot hybridiza ZNRF2, WWP2, CUL9, RABGEF1, RBCK1, RNF149, tion methods are performed under stringent conditions. RNF34, AUP1, CDCA3, PAN2, ANAPC1, USP1, RELA, Results from these two exemplary approaches are shown in UBR4, SKP2, SOCS7, UBR2, UBE2J2, PSMA2, MIB1, FIGS. 7A-7D and described herein. PSMA1, UHRF1, KDM2A, PIAS4, TRIM33, FBXL8, 0073. In addition, the candidate CRO for a particular gene UBR5, PSMA4, ASB1, FBXL5, RNF138, FBXL4, PIAS2, can be screened for its ability to bind DNMTs. For example, TNFAIP3, FBXL3, ASB6, RAD23B, RAD23A, NEDD8, acceptable binding includes that which results in an equal or UBA5, ANAPC11, CDC34, PSMA7, UBAC1, PSMB5, higher affinity between the candidate CRO and one or more ARIH1, PSMB4, ARIH2, UBE2D2, PSMB1, FBXW5, DNMTs, as compared to the affinity between a corresponding FBXW4, FBXO43, STAMBPL1, RNF168, TRAF7, DNA oligonucleotide and the one or more DNMTs. Affinity RNF167, FBXO9, HECTD1, FBXO7, HACE1 PCNP, can be assessed by any useful method. Exemplary methods CDC20, CDC26, ATG3, ATE1, URM1, RNF6, PSMC5, include RNA/DNA electrophoretic mobility shift assays PSMC4, VCP, UBA1, OTUB1, UBA2, UBA3, KIAA0368, (such as shown in FIGS. 4D-4F) and measurement of direct UBE2G1, UBE2G2, BAP1, OS9, SENP6, FBXL19, FANCL, quantitative binding of radiolabeled oligonucleotides to USP19, LONP1, MGRN1, PSMD1, PSMD2, PSMD3, DNMTs (e.g., as described in Burgisser, J. Recept. Res. USP11, NSMCE2, USP10, PSMD6, PSMD7, USP14, 4:357-369, 1984). In particular embodiments, the CRO has UBE2A, UFDIL, DDB1, HERC5, HERC4, UBE2I, both target site specificity and the ability to bind DNMTs. ERLIN1, HERC3, HERC2, WDR48, SENP3, PSME1, 0074 Different segments of an ecRNA can be tested to UBE2K, PSME2, UBE2M, UBC, DDB2, USP21, ADAM17, design the SSCRO, including those sequences upstream and KLHL12, SIAH2, USP22, USP24, UBE2S, USP7, downstream of the target gene and those sequences corre CUEDC2, OTUD5, APH1A, USP3, UBE3B, C10ORF46, sponding to coding and intronic sections. When the ecRNA USP9X, USP4, EDEM3, C12ORF51, STUB1, EDEM1, includes a non-coding region, this region can be either MYCBP2, UBE2R2, SUMO2, RNF123, SQSTM1, upstream or downstream of the coding region of a gene. For MAP3K1, USP39, PPP2CB, USP36, FBXW 11, USP33, example, the ecRNA can include a sequence that is down TRIP12, BUB3, USP31, UBXN1, STAMBP, LRRC41, CBL, stream of the polyA addition site of the mRNA or in proximity SPSB2, BIRC6, UBE2O2, UBE2O1, NCSTN, CCNB1, to a promoter of the gene. WSB1, PSMD14, HSP90B1, GMCL1, PSMD13, CUL4A, 0075 ACRO for a particular gene can be identified by any TCEB2, TBL1X, BARD1); and GO:0022403, cell cycle useful method. For example, the method includes one or more phase (ADCY3, PRC1, PKMYT1, RBM7, AURKB, CDC16, steps of identifying an ecRNA for a particular gene, identify CD2AP, CDCA8, APP RAD21, DDX11, INCENP. TAR ing a sequence having percentage complementarity to the DBP, CDCA2, H2AFX, TUBG1, CCNA2, CDCA5, ASPM, ecRNA, and determining one or more binding sites between CDCA3, ANAPC1, RAN, POLE, LIG3, SKP2, UBR2, the sequence having percentage complementarity and a US 2014/0171492 A1 Jun. 19, 2014
DNMT (e.g., DNMT1 or any other described herein), where Solexa sequence adapters containing 5'-methyl-cytosine can the presence of binding indicates that the sequence can reduce be ligated to the ends of size-selected fragments. Adapter the activity of DNMT. Additional optional steps include ligated fragments can be bisulfite-converted, amplified by determining the binding between the sequence of the CRO PCR, and then size-selected and sequenced on the Illumina/ and the RNA or DNA for the gene; determining the methy Solexa 1G Genome Analyzer. Finally, MEA can be per lation status of the target DNA, such as in one or more CpG formed (e.g., using Affymetrix R GeneChip Human Gene 1.0 islands; and determining the expression level of one or more ST arrays) to determine expression levels. genes. Furthermore, any of these steps can be performed for more than one gene and/or in a high-throughput manner. (0079. The efficacy and/or toxicity of CROs can be deter These methods can be implemented by any useful technique, mined by any useful method. Exemplary techniques include e.g., a RNA electrophoretic mobility shift assay (REMSA); in cellular assays performed in HL-60, U937, and/or K562 cell vivo RNA immunoprecipitation (RIP) with ChIP-grade anti lines to determine one or more of changes in methylation bodies against DNA methyltransferase: RNA immunopre within the genomic region corresponding to the CRO, cipitation with RNA deep sequencing (RIP-Seq); 5', 3'-rapid changes in methylation in unrelated sites as a control for an amplification of the cDNA ends (RACE); microarray expres off-target effect, changes in expression level of the particular sion analysis (MEA); reduced representation bisulfite target gene, and changes in expression of unrelated genes as sequencing (RRBS); combined bisulfite restriction analysis a control for an off-target effect. (COBRA) assay; and combinations thereof. 0076 Particular target genes can be identified in any use 0080 Methods of Preparing a Chimeric RNAOligonucle ful manner. For example, ecRNAS corresponding to target otide genes can be down-regulated, and their effect on DNMT I0081. The CRO can be prepared by any useful method. activity can be evaluated. Exemplary methods to down-regu Exemplary methods include chemical synthesis (e.g., using a late ecRNAs include using an RNAi agent, such as siRNA, Solid Support), in vitro transcription, digestion of long dsRNA dsRNA, miRNA, shRNA, or ptgsRNA. After confirming down-regulation of the targeted RNAs, expression levels of by an RNase III family enzyme (e.g. Dicer, RNase III), and the corresponding mRNAs can be measured by qRT-PCR, cell-based siRNA expression using plasmids, viral vectors, or and methylation pattern of the corresponding geneloci can be PCR-derived expression cassette. characterized by bisulfite sequencing. Further studies can I0082 To incorporate modified nucleotides (e.g., cytidine include in vivo transplantation assays. analogs), the corresponding nucleoside can be converted into 0077. In one example, the sequence of ecRNA can be building blocks, which can be incorporated by step-wise determined by RNA immunoprecipitation (RIP) followed by addition to a growing chain of the oligonucleotide sequence. RNA deep sequencing (RIP-Seq). RIP is a technique used to Alternatively, di-, tri-, or tetra-nucleotides having one or more detect the association of individual proteins with specific modified nucleotides can be converted into building blocks RNA molecules in the cellular context. Generally, cultured and incorporated into the oligonucleotide sequence. Exem cells are treated with formaldehyde to generate protein-RNA plary building blocks include cyanoethyl phosphoramidite or crosslinks between interacting molecules. Following immu N-succinimide ester building blocks. Examples of phos noprecipitation of a protein of interest and crosslink reversal, phoramidite building blocks of mono-, di-, tri-, and tetra associated RNAS can be recovered, characterized, and quan nucleotides having one or more cytidine analogs include titated by reverse transcriptase polymerase chain reaction 5'-dimethoxytrityl (O-DMTr)-N4-dimethylformamidine-5,6- (RT-PCR). Then, the immunoprecipitated RNAs will be sub dihydro-5-aza-2'-deoxycytidine, 3'-(2-cyanoethyl)-(N.N- jected to RNA-Seq, as described in Mortazavi et al., Nat. diisopropyl)-phosphoramidite (or 5-aza-5,6-dihydro-dC Methods 5:621-628, 2008, hereby incorporated by reference. CE phosphoramidite); 5'-O-DMTr-2'-deoxy-5-aza-cytidine RNA-Seq is a robust technology for monitoring expression 3'-O-cyanoethyl-N,N-diisopropylphosphoramidite; and a by direct sequencing the RNA molecules in a sample. Briefly, dinucleotide including 5'-O-DMTr-2'-deoxyguanosine-3'-O- this methodology includes fragmentation of RNA to an aver cyanoethyl-N,N-diisopropylphosphoramidite and 5'-O- age length of 200 nucleotides, conversion to cDNA by ran DMTr-2'-deoxy-5-aza-cytidine-3'-O-cyanoethyl-N,N-diiso dom priming, and synthesis of double-stranded cDNA (e.g., propylphosphoramidites. Additional cytidine analogs are using the Just cDNA DoubleStranded cDNA Synthesis Kit described herein, and methods of making corresponding from Agilent Technology). Then, the cDNA is converted into phosphoramidite building blocks are known. a molecular library for sequencing by addition of sequence 0083. The CROs can be used in the form of double adapters for each library (e.g., from Illumina R/Solexa), and stranded chimeric RNA oligonucleotide (dsCRO). As the resulting 50-100 nucleotide reads are mapped onto the described herein, the RNA transcript binds DNMT1 and genome. RNA-Seq can be performed on RNAs immunopre interferes with DNA methylation during transcription (FIG. cipitated by DNMT antibodies, using an IgG isotype antibody 6A, left). In the absence of transcription, DNMT1 is not as a control. RIP-Seq can be performed in multiple human blocked and exerts enzymatic activity (FIG. 6A, right). For and/or murine cell lines that express or do not express a initial assays, dsCROs can be tested to determine its ability to particular gene. sequester DNMT1 (see FIG. 6B). Exemplary dsCROs 0078. In another example, the methylation status of DNA include those having stem loop-like structures. As compared can be determined by RBBS in a high-throughput manner, as to 5-aza-2'-deoxycytidine, these dsCROs will likely be more described in Bock et al., Nat. Biotechnol. 28:1106-1114, active and less toxic. Though these dsCROS lack gene-speci 2010, incorporated herein by reference. Briefly, high-quality ficity, the results will provide preliminary binding data to genomic DNA can be isolated from laboratory and primary DNMT. The following tests can include developing corre cell lines employed for RIP-Seq and digested with the methy sponding single-stranded CROS to determine gene-specific lation-insensitive enzyme MspI. Pre-annealed Illumina R/ demethylating function. US 2014/0171492 A1 Jun. 19, 2014
Modifications to a RNA Oligonucleotide mide, 3-methyl-3-nitrobutanamide, o-nitrocinnamide, 3-(4- t-butyl-2,6-dinitrophenyl)-2,2-dimethylpropanamide, I0084. The chimeric RNA oligonucleotide (CRO) can o-(benzoyloxymethyl)benzamide, 2-(t-butyldiphenylsi optionally include modifications, such as, e.g., to increase loxy)methyl)methylbenzamide, 3-(3',6'-dioxo-2',4',5'-trim binding to a DNMT, increase stability, or increase cellular ethylcyclohexa-1',4'-diene)-3.3-dimethylpropionamide, uptake. In particular, the CRO can include one or more cyti o-hydroxy-trans-cinnamide, acetoacetamide, p-toluene dine analogs to further enhance binding to DNMT. Sulfonamide, and benzesulfonamide); or those having one of I0085 Cytidine Analogs the following substitutions for the 4-amino group of the I0086. The chimeric RNA oligonucleotide of the invention cytosine ring: 4-O-methoxy and 4-S-methylsulfanyl. In some can optionally include one or more modified cytidine nucle embodiments, the cytidine analog is further conjugated to a otides (or cytidine analogs). As described herein, cytidine guanosine nucleotide (e.g. 2'-deoxyguanosine). Such as for analogs are useful in binding, and thus inactivating, DNMT. 5-aza-2'-deoxycytidine-phosphodiester linkage-guanosine, 0087 Exemplary cytidine analogs includes 5-azacytidine 5-aza-2'-deoxycytidine-phosphodiester linkage-2'-deoxy and 5-aza-2'-deoxycytidine and further analogs thereof, guanosine, guanosine-phosphodiester linkage-5-aza-2'- including those having one of the following Substitutions for deoxycytidine, and 2'-deoxy-guanosine-phosphodiester link the hydrogen of the 4-amino group of the cytosine ring: methyl, ethyl, 9-fluorenylmethyl, 9-(2-sulfo)fluorenylm age-5-aza-2'-deoxycytidine. Additional modifications to ethyl, 9-(2,7-dibromo)fluorenylmethyl, 17-tetrabenzoa.c.g. nucleotides are described herein. ifluorenylmethyl, 2-chloro-3-indenylmethyl, benz finden I0088. Further Modifications to the Chimeric RNA Oligo 3-ylmethyl, 2,7-di-tert-9-(10,10-dioxo-10,10,10,10 nucleotide tetrahydrothioxanthyl)methyl, 1,1-dioxobenzobthiophene 0089 Modifications to the CRO include modified nucle 2-ylmethyl, 2.2.2-trichloroethyl, 2-trimethylsilylethyl, otides having one or more modifications to the chemical 2-phenylethyl, 1-(1-adamantyl)-1-methylethyl, 2-chloroet structure of the base, Sugar, and/or backbone, including the hyl, 1,1-dimethyl-2-haloethyl, 1,1-dimethyl-2,2-dibrom phosphodiester linker. ethyl, 1,1-dimethyl-2.2.2-trichlroethyl, 1-methyl-1-(4-bi 0090. Non-limiting modified bases include those having phenylyl)ethyl, 1-(3,5-di-tert-butylphenyl)-1-methylethyl, 4- and/or 5-position pyrimidine modifications, 8-position 2-(2- and 4'-pyridyl)ethyl, 2.2-bis(4-nitrophenyl)ethyl, purine modifications, and modifications at cytosine exocyclic N-(2-pivaloylamino)-1,1-dimethylethyl, 2-(2-nitrophenyl) amines. Additional modified bases refer to nucleotide bases dithiol-1-phenylethyl, 2-(N,N-dicyclohexylcarboxamido) Such as, for example, adenine, guanine, cytosine, thymine, ethyl, t-butyl, 1-adamantyl, 2-adamantyl, vinyl, allyl, 1-iso uracil, Xanthine, inosine, and queuosine that have been modi propylallyl, cinnayl, 4-nitrocinnamyl, 3-(3'-pyridyl)prop-2- fied by the replacement or addition of one or more atoms or enyl, 8-quinolyl, N-hydroxypiperidinyl, alkyldithio, benzyl, groups. Further examples of modified bases include bases p-methoxybenzyl, p-nitrobenzyl, p-bromobenzyl, p-chlo that are alkylated (e.g., as in O- and N-alkylated purines and robenzyl, 2,4-dichlorobenzyl, 4-methylsulfinylbenzyl, 9-an pyrimidines), halogenated, thiolated, aminated, amidated, thrylmethyl, diphenylmethyl, 2-methylthioethyl, 2-methyl addition or removal of an aza group, or acetylated bases, sulfonylethyl 2-p-toluenesulfonyl)ethyl, 2-(1,3-dithianyl) individually or in combination. Exemplary modified bases methyl, 4-methylthiphenyl, 2,4-dimethylthiphenyl, include 5-propynyluridine, 5-propynylcytidine, 6-methylad 2-phosphonioethyl, 1-methyl-1-(triphenylphosphonio)ethyl, enine, 6-methylguanine, N.N.-dimethyladenine, 2-propylad 1,1-dimethyl-2-cyanoethyl 2-dansylethyl, 4-phenylacetoxy enine, 2-propylguanine, 2-aminoadenine, 1-methylinosine, benzyl, 4-azidobenzyl, 4-azidomethoxybenzyl, m-chloro-p- 3-methyluridine, 5-methylcytidine, 5-methyluridine, 5-(2- acyloxybenzyl, p-(dihydroxyboryl)benzyl, 5-benzisox amino)propyl uridine, 5-halocytidine, 5-halouridine, 4-ace azolylmethyl, 2-(trifluoroethyl)-6-chromonylmethyl, tylcytidine, 1-methyladenosine, 2-methyladenosine, 3-meth m-nitrophenyl, 3,5-dimethoxybenzyl, 1-methyl-1-(3.5- ylcytidine, 6-methyluridine, 2-methylguanosine, dimethoxyphenyl)ethyl, alpha.-methylnitropiperonyl, o-ni 7-methylguanosine, 2,2-dimethylguanosine, 5-methylami trophenyl, 3,4-dimethoxy-6-nitrobenzyl, phenyl(o-nitrophe noethyluridine, 5-methyloxyuridine, 7-deazaadenosine, nyl)ethyl, 2-(2-nitrophenyl)ethyl, 6-nitroveratryl, 7-deaZaxanthine, 7-deazaguanine, 6-azouridine, 6-azocyti 4-methoxyphenacyl, 3',5'-dimethoxybenzoin, t-amyl, S-ben dine, 6-azothymidine, 5-methyl-2-thiouridine, 2-thiouridine, Zylthio, butynyl, p-cyanobenzyl, cyclohexyl, cyclopentyl, 4-thiouridine, 2-thiocytidine, dihydrouridine, pseudouridine, cyclopropylmethyl, p-decyloxybenzyl, diisopropylmethyl, queuosine, archaeosine, N6-methyladenosine, 8-oxo-N6 2,2-dimethoxycarbonyl vinyl, o-(N,N-dimethylcarboxa methyladenine, 5-methylcarbonylmethyluridine, uridine mido)henzyl, 1,1-dimethyl-3-(N,N-dimethycarboxamido) 5-oxyacetic acid, pyridine-4-one, pyridine-2-one, diami propyl, 1,1-dimethylpropynyl, 2-furanylmethyl, 2-iodoethyl, nopurine, N4.N4-ethanocytosin, N6.N6-ethano-2,6-diami isobornyl, isobutyl, isonicotinyl, p-(p'-methoxyphenylazo) nopurine, 5-(C3-C6)-alkynyl-cytosine, 5-fluorouracil, 5-bro benzyl, 1-methylcyclobutyl, 1-methylcyclohexyl, 1-methyl mouracil, pseudoisocytosine, 2-hydroxy-5-methyl-4- 1-cyclopropylmethyl, 1-methyl-1-(p-phenylaZophenyl) triazolopyridine, isocytosine, isoguanine, 8-substituted ethyl, 1-methyl-1-phenylethyl, 1-methyl-1-(4-pyridyl)ethyl, adenines and guanines, 5-substituted uracils and thymines, phenyl, p-(phenylazo)benzyl, 2,4,6-tri-t-butylphenyl, 4-(tri azapyrimidines, carboxyhydroxyalkyl nucleotides, carboxy methylammonium)benzyl, 2,4,6-trimethylbenzyl, a urea alkylaminoalkyl nucleotides, alkylcarbonylalkylated nucle (e.g., a urea with phenothiazinyl-(10)-carbonyl, N'-p-tolu otides, and universal bases (e.g., pyrrole, diazole, triazole, enesulfonylaminocarbonyl, and N'-phenylaminothiocarbo pyrene, pyridyloxazole, and pyrenylmethylglycerol deriva nyl), and an amide (e.g., formamide, acetamide, phenoxyac tives, such as 3-nitropyrrole or 5-nitroindole). etamide, trichloroacetamide, trifluoroacetamide, 0091 Exemplary modified sugars include 2-position phenyacetamide, 3-phenylpropamide, pent-4-enamide, o-ni Sugar modifications, in which the 2-OHis replaced by a group trophenylacetamide, o-nitrophenoxyacetamide, 3-(o-nitro such as an H, OR, R, halo (e.g., F), SH, SR, NH, NHR, NR, phenyl)propanamide, 2-methyl-2-(o-nitrophenoxy)propana or CN, wherein R is an alkyl moiety. Modified sugars also US 2014/0171492 A1 Jun. 19, 2014
include, e.g., non-ribose Sugars. Such as mannose, arabinose, and adenosine analogs (e.g., pentostatin, which is an adenos glucopyranose, galactopyranose, 4-thioribose, and other Sug ine deaminase inhibitor, and cladribine, which is a DNA ars, heterocycles, or carbocycles. polymerase inhibitor). 0092. In some embodiments, the CRO includes a phos 0.095 Demethylating Agents phorodiester linkage. Such as via 2'-ribose, as in the natural 0096. The CRO can include one or more demethylating sugar phosphorodiester backbone in RNA. In other embodi agents, including nucleoside-based agent (e.g., a cytidine ments, to enhance the resistance to nuclease degradation in analog). Exemplary demethylating agents include cytidine vivo, the natural phosphorodiester linker —O—P(=O)(O)— analogs, such as 5-azacytidine (or azacitidine), 5-aza-5,6- O—CH2— can be modified to be a phosphorothioate linker dihydrocytosine, 5-aza-2'-deoxycytidine (or decitabine), —O P(=O)(ST)—O—CH2—, a boranophosphate linker, beta-L-5-azacytidine, 2'-deoxy-beta-L-5-azacytidine, or a methylphosphonate linker. Phosphorothiate linkers can 2'-deoxy-N4-2-(4-nitrophenyl)ethoxycarbonyl-5-azacyti be implemented using standard phosphoramidite protocols dine (or N4-NPEOC-5-CdR), 5-fluorocytidine, 1-?3-D-ara and Substituting a bis(O.O-diisopropoxy phosphinothioyl) binofuranosil-5-azacytosine (or fazarabine), and 1-3-D-ribo disulfide (S-tetra) for iodine during the oxidation step (see, furanosyl-2 (1H)-pyrimidinone (or Zebularine); and non e.g., Zon and Stec. “Phosphorothioate Analogues' in Oligo nucleoside analogs, such as derivatives of 4-aminobenzoic nucleotides and Their Analogs. A Practical Approach (ed. F. acid (e.g., procaine), epigallocatechin-3-gallate (EGCG), Eckstein, IRL Press, pp. 87-108, 1991); Zon, High Perfor N-phthalyl-L-tryptophan (or RG108), and (1E,6E)-1.7-bis mance Liquid Chromatography in Biotechnology (ed. W. S. (4-hydroxy-3-methoxyphenyl)-1,6-heptadiene-3,5-dione Hancock, Wiley, New York, Ch. 14, pp. 310-397, 1990); Stec (curcumin). et al., Tetrahed. Lett. 34:5317-5320, 1993: Iyer et al., J. Org. 0097 Labels Chem. 55:4693-4699, 1990). Other exemplary linkers (0098. A label can be linked to the chimeric RNA oligo include phosphorodithioates, phosphotriesters, aminoalky nucleotide to allow for diagnostic and/or therapeutic treat lphosphotriesters, alkyl phosphonates (e.g., 3'-alkylene phos ment. Examples of labels include detectable labels, such as an phonate), chiral phosphonates, phosphinates, phosphorami isotope, a radioimaging agent, a marker, a tracer, a fluorescent dates (e.g., 3'-amino phosphoramidate), label (e.g., rhodamine), and a reporter molecule (e.g., biotin). aminoalkylphosphoramidates, thionophosphoramidates, 0099 Examples of radioimaging agents emitting radiation thionoalkylphosphonates, and thionoalkylphosphotriesters. (detectable radio-labels) that may be suitable are exemplified Other modifications to the backbone include those replacing by indium-111, technitium-99, or low dose iodine-131. the phosphorous atom with short chain alkyl or cycloalkyl Detectable labels, or markers, for use in the present invention internucleoside linkages, mixed heteroatom and alkyl or may be a radiolabel, a fluorescent label, a nuclear magnetic cycloalkyl internucleoside linkages, or one or more short resonance active label, a luminescent label, a chromophore chain heteroatomic or heterocyclic internucleoside linkages label, a positron emitting isotope for PET scanner, a chemi (e.g., morpholinio linkages; siloxane backbones; Sulfide, Sul luminescence label, or an enzymatic label. Fluorescent labels foxide and sulphone backbones; formacetyl and thiofor include but are not limited to, green fluorescent protein macetyl backbones; methylene formacetyl and thiofor (GFP), fluorescein, and rhodamine. Chemiluminescence macetyl backbones; alkene containing backbones; labels include but are not limited to, luciferase and B-galac Sulphamate backbones; methyleneimino and methylenehy tosidase. Enzymatic labels include but are not limited to per drazino backbones; Sulfonate and Sulfonamide backbones; oxidase and phosphatase. A histamine tag may also be a amide backbones; and others having mixed N, O, S and CH detectable label. For example, conjugates may comprise a component parts). carrier moiety and an antibody moiety (antibody or antibody 0093. In other embodiments, the natural sugar phosphoro fragment) and may further comprise a label. The label may be diester backbone can be replaced with a protein nucleotide for example a medical isotope, Such as for example and with (PNA) backbone having repeating N-(2-aminoethyl)-glycine out limitation, technetium-99, iodine-123 and -131, thallium units linked by peptide bonds. Other types of modifications 201, gallium-67, fluorine-18, indium-111, etc. for oligonucleotides designed to be more resistant to nuclease Formation of a Complex with a Carrier degradation are described U.S. Pat. Nos. 6,900,540 and 0100 For delivery to the target gene, the chimeric RNA 6,900.301, incorporated herein by reference. oligonucleotide of the invention can covalently or non-co valently bind a carrier to form a complex. The carrier can be Therapeutic Agents used to alter biodistribution after delivery, to enhance uptake, 0094. The CRO can include any useful therapeutic agent. to increase half-life or stability of the CRO (e.g., improve Any of the therapeutic agents described below may be used in nuclease resistance), and/or to increase targeting to a particu the compounds of the invention. Exemplary therapeutic lar cell or tissue type. agents for use in a CRO are demethylating agents (e.g. cyti 0101 Exemplary carriers include a condensing agent dine analogs, as described herein), DNA and/or RNA poly (e.g., an agent capable of attracting or binding a nucleic acid merase inhibitors (e.g., a synthetic nucleoside that resembles through ionic or electrostatic interactions); a fusogenic agent cytidine, Such as cytarabine for the treatment of acute myelo (e.g., an agent capable of fusing and/or being transported cytic leukemia; fludarabine for the treatment of hematologic through a cell membrane); a protein to target a particular cell malignancies by S-phase specific inhibition of multiple DNA or tissue type (e.g., thyrotropin, melanotropin, lectin, glyco polymerases, including DNA primase and DNA ligase I; protein, Surfactant protein A, or any other protein); a lipid; a gemcitabine; cladribine; and clofarabine); thymidylate Syn lipopolysaccharide; a lipid micelle or a liposome (e.g., thase inhibitors (e.g., 5-fluorouracil (5FU), floxuridine formed from phospholipids, such as phosphotidylcholine, (FUDR), capecitabine, tegafur, and cannoflur); immunosup fatty acids, glycolipids, ceramides, glycerides, cholesterols, pressants (e.g., azathioprine); and other nucleoside analogs, or any combination thereof), a nanoparticle (e.g., silica, lipid, Such as thiopurines (e.g., thioguanine and mercaptopurine) carbohydrate, or other pharmaceutically-acceptable polymer US 2014/0171492 A1 Jun. 19, 2014
nanoparticle); a polyplex formed from cationic polymers and Biol. 18:6457-6473, 1998); CDH1 in breast cancer, gastric an anionic agent (e.g., a CRO), where exemplary' cationic cancer, thyroid cancer, leukemia, and liver cancer (see Graff polymers include polyamines (e.g., polylysine, polyarginine, et al., Cancer Res. 55:5195-5199, 1995); CDH13 in lung polyamidoamine, and polyethylene imine); cholesterol; a cancer, ovarian cancer, and pancreatic cancer (see Toyooka et dendrimer (e.g., a polyamidoamine (PAMAM) dendrimer); a al., Cancer Res.61:4556-4560, 2001); TIMP3 in brain cancer serum protein (e.g., human serum albumin (HSA) or low and kidney cancer (see Bachman et al., Cancer Res. 59:798 density lipoprotein (LDL)); a carbohydrate (e.g., dextran, 802, 1999); VHL in kidney cancer (see Herman et al., Proc. pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic Natl Acad. Sci. USA 91.9700-9704, 1994); MLH in colon acid); a lipid; a synthetic polymer, (e.g., polylysine (PLL), cancer, endometrial cancer, and gastric cancer (see Kane et polyethylenimine, poly-L-aspartic acid, poly-L-glutamic al., Cancer Res. 57:808–811, 1997); MGMT in brain cancer, acid, styrene-maleic acid anhydride copolymer, poly(L-lac colon cancer, lung cancer, and breast cancer (see Qian et al. tide-co-glycolic) copolymer, divinyl ether-maleic anhydride Cancer Res. 57:3672-3677, 1997); BRCA1 in breast cancer copolymer, N-(2-hydroxypropyl)methacrylamide copolymer and ovarian cancer (see Dobrovic et al., Cancer Res. 57:3347 (HMPA), polyethylene glycol (PEG), polyvinyl alcohol 3350, 1997); GSTP1 in prostate cancer, liver cancer, colon (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropy cancer, breast cancer, and kidney cancer (see Lee et al., Proc. lacrylamide polymer, pseudopeptide-polyamine, peptidomi Natl Acad. Sci. USA'91: 11733-11737, 1994); SMARCA3 in metic polyamine, or polyamine); a cationic moiety (e.g., cat colon cancer and gastric cancer (see Moinova et al., Proc. Natl ionic lipid, cationic porphyrin, quaternary salt of a Acad. Sci. USA99:4562-4567, 2002); RASSF1 in lung can polyamine, or alpha helical peptide); a multivalent Sugar cer, liver cancer, and brain cancer (see Dammann et al., Nat. (e.g., multivalent lactose, multivalent galactose, N-acetyl Genet. 25:315-319, 2000); SOCS1 in liver cancer, colon can galactosamine, N-acetyl-glucosamine, multivalent mannose, cer, and multiple myeloma (see Yoshikawa et al., Nat. Genet. or multivalent fucose); a vitamin (e.g., vitamin A, vitamin E, 28:29-35, 2001); ESR1 in colon cancer, breast estrogen vitamin K, vitamin B, folic acid, vitamin B12, riboflavin, receptor-negative cancer, lung cancer, and leukemia (see Issa biotin, or pyridoxal); a cofactor, or a drug to disrupt cellular et al. Nat. Genet. 7:536-540, 1994), DAPK1 in lymphoma cytoskeleton to increase uptake (e.g., taxon, Vincristine, Vin (see Katzenellenbogen et al., Blood 93:4347-4353, 1999). blastine, cytochalasin, nocodazole, japlakinolide, latrunculin Additional cancers include those associated with any gene A, phalloidin, Swinholide A, indanocine, or myoServin). described herein (e.g., a gene in cluster C). 0106 Genetic Disorders Diseases and Conditions 01.07 The CROs of the invention can be used to treat 0102 The CROs of the invention can be used to treat a genetic disorders that arise from aberrant DNA methylation, variety of diseases and conditions involving aberrant DNMT Such as imprinting disorders related to uniparental disomy. activity. In particular, beneficial treatments of cancer and The potency and the gene specificity of the CRO can be used imprinting disorders include use of the CROs to reduce to correctaberrant gain of DNA methylation within a specific DNMT activity in a gene-specific manner. gene locus and/or to restore the normal expression of an (0103 Cancer Therapy imprinted parental allele, as the expressed allele is mutated or 0104. The CROs of the invention may be used to treat any deleted for a particular locus. disease related to aberrant DNMT activity, such as cancer. In 0.108 Exemplary genetic disorders include imprinting particular, the CROs of the invention can be used to treat disorders, such as Beckwith-Wiedemann Syndrome (BWS), cancers having aberrant methylation of specific genes related Prader-Willi Syndrome (PWS), Angelman Syndrome (AS), with cancer progression. Exemplary cancers include those Albright hereditary osteodystrophy (AHO), pseudohypopar related to C/EBPa expression, such as myelodysplastic syn athyroidism type 1 A (PHP-IA), and pseudohypoparathyroid drome (e.g., refractory anemia, refractory anemia with ringed ism type 1B (PHP-IB); disorders associated with loss of sideroblasts, refractory anemia with excess blasts, refractory imprinting (LOI), which is considered the most abundant and anemia with excess blasts in transformation, refractory most precocious alteration in cancer, such as LOI in IGF2/ cytopenia with multilineage dysplasia, myelodysplastic Syn H19 for Wilms tumor; and repeat instability diseases, where drome associated with an isolated del(5q) chromosome the expansion of trinucleotide (TNR) repeats leads to silenc abnormality, and a myeloproliferative neoplasm), leukemia ing of the associated genes, such as in Fragile X syndrome (e.g., acute myeloid leukemia), head and neck cancer, liver and myotonic dystrophy. cancer (e.g., hepatoma and hepatocellular carcinoma), lung cancer (e.g., adenocarcinoma and non-small cell lung can Administration and Dosage cer), prostate cancer (e.g., adenocarcinoma), and skin cancer 0109 The present invention also features pharmaceutical (e.g., squamous cell carcinoma); those related to SPI1. Such compositions that contain a therapeutically effective amount as acute myeloid leukemia, T-cell lymphoma, and chronic of a CRO of the invention. The composition can be formu lymphocytic leukemia-like disease; those related to RXRA, lated for use in a variety of drug delivery systems. One or Such as non-Small cell lung cancer (NSCLC); and those more physiologically acceptable excipients or carriers can related to RARB Such as lung cancer (e.g., Small cell lung also be included in the composition for proper formulation. cancer (SCLC) and non-small cell lung cancer (NSCLC)), Suitable formulations for use in the present invention are head and neck cancer, breast cancer, prostate cancer, glioblas found in Remington's Pharmaceutical Sciences (Mack Pub toma, and leukemia. lishing Company, Philadelphia, Pa., 17th ed., 1985). For a 0105. Other exemplary methylated genes and related can brief review of methods for drug delivery, see, e.g., Langer, cers include RB1 in retinoblastoma (see Stirzaker et al., Can Science 249:1527-1533, 1990. cer Res. 57:2229-2237, 1997); CDKN2A (INK 4A and ARF 0110. The pharmaceutical compositions are intended for transcript) in lung and colon cancer (see Herman et al., Can parenteral, intranasal, topical, oral, or local administration, cer Res. 55:4525-4530, 1995; and Robertson et al., Mol Cell Such as by a transdermal means, for prophylactic and/or US 2014/0171492 A1 Jun. 19, 2014 20 therapeutic treatment. The pharmaceutical compositions can disease or condition is delayed, hindered, or prevented, or the be administered parenterally (e.g., by intravenous, intramus disease or condition symptoms are ameliorated, or the term of cular, or Subcutaneous injection), or by oral ingestion, or by the disease or condition is changed or, for example, is less topical application or intraarticular injection at areas affected severe or recovery is accelerated in an individual. by the vascular or cancer condition. Additional routes of 0113 Amounts effective for this use may depend on the administration include intravascular, intra-arterial, intratu severity of the disease or condition and the weight and general mor, intraperitoneal, intraventricular, intraepidural, as well as state of the Subject, but generally range from about 0.05ug to nasal, ophthalmic, intrascleral, intraorbital, rectal, topical, or about 1000 ug (e.g., 0.5-100 lug) of an equivalent amount of aerosol inhalation administration. Sustained release adminis the agent per dose per Subject. Suitable regimes for initial tration is also specifically included in the invention, by Such administration and booster administrations are typified by an means as depot injections or erodible implants or compo initial administration followed by repeated doses at one or nents. Thus, the invention provides compositions for more hourly, daily, weekly, or monthly intervals by a Subse parenteral administration that include the above mention quent administration. The total effective amount of an agent agents dissolved or Suspended in an acceptable carrier, pref present in the compositions of the invention can be adminis erably an aqueous carrier, e.g., water, buffered water, Saline, tered to a mammal as a single dose, either as a bolus or by PBS, and the like. The compositions may contain pharmaceu infusion over a relatively short period of time, or can be tically acceptable auxiliary Substances as required to approxi administered using a fractionated treatment protocol, in mate physiological conditions, such as pH adjusting and buff which multiple doses are administered over a more prolonged ering agents, tonicity adjusting agents, wetting agents, period of time (e.g., a dose every 4-6 hours, 8-12 hours 14-16 detergents and the like. The invention also provides compo hours, 18-24 hours, every 2-4 days, every 1-2 weeks, and once sitions for oral delivery, which may contain inert ingredients a month). Alternatively, continuous intravenous infusions such as binders or fillers for the formulation of a tablet, a Sufficient to maintain therapeutically effective concentrations capsule, and the like. Furthermore, this invention provides in the blood are contemplated. compositions for local administration, which may contain 0114. The therapeutically effective amount of one or more inert ingredients such as solvents or emulsifiers for the for agents present within the compositions of the invention and mulation of a cream, an ointment, and the like. used in the methods of this invention applied to mammals 0111. These compositions may be sterilized by conven (e.g., humans) can be determined by the ordinarily-skilled tional sterilization techniques, or may be sterile filtered. The artisan with consideration of individual differences in age, resulting aqueous solutions may be packaged for use as is, or weight, and the condition of the mammal. Single or multiple lyophilized, the lyophilized preparation being combined with administrations of the compositions of the invention includ a sterile aqueous carrier prior to administration. The pH of the ing an effective amount can be carried out with dose levels preparations typically will be between 3 and 11, more pref and pattern being selected by the treating physician. The dose erably between 5 and 9 or between 6 and 8, and most prefer and administration schedule can be determined and adjusted ably between 7 and 8, such as 7 to 7.5. The resulting compo based on the severity of the disease or condition in the subject, sitions in Solid form may be packaged in multiple single dose which may be monitored throughout the course of treatment units, each containing a fixed amount of the above-mentioned according to the methods commonly practiced by clinicians agent or agents, such as in a sealed package of tablets or or those described herein. capsules. The composition in Solid form can also be packaged 0115 The compounds of the present invention may be in a container for a flexible quantity, Such as in a squeezable used in combination with either conventional methods of tube designed for a topically applicable cream or ointment. treatment or therapy or may be used separately from conven 0112 The compositions containing an effective amount tional methods of treatment or therapy. can be administered for prophylactic or therapeutic treat 0116. When the compounds of this invention are admin ments. In prophylactic applications, compositions can be istered in combination therapies with other agents, they may administered to a subject with a clinically determined predis be administered sequentially or concurrently to an individual. position or increased Susceptibility to cancer, or any disease Alternatively, pharmaceutical compositions according to the described herein. Compositions of the invention can be present invention may be comprised of a combination of a administered to the Subject (e.g., a human) in an amount compound of the present invention in association with a phar sufficient to delay, reduce, or preferably prevent the onset of maceutically acceptable excipient, as described herein, and clinical disease. In therapeutic applications, compositions are another therapeutic or prophylactic agent known in the art. administered to a subject (e.g., a human) already suffering 0117. In particular, combination therapies include a CRO from disease (e.g., cancer, Such as leukemia or a myelodys and a histone deacetylase (HDAC) inhibitor to further modu plastic syndrome) in an amount Sufficient to cure or at least late transcription of genes, e.g., to promote the transcription partially arrest the symptoms of the condition and its compli of genes previously silenced by hypermethylation and acety cations. An amount adequate to accomplish this purpose is lation of histones. Exemplary HDAC inhibitors include defined as a “therapeutically effective amount, an amount of hydroxamic acids (e.g., trichostatin A (ISA), Vorinostat a compound Sufficient to Substantially improve Some symp (SAHA), belinostat (PXD101), (E)-N-hydroxy-3-4-2-hy tom associated with a disease or a medical condition. For droxyethyl-2-(1H-indol-3-yl)ethylaminomethylphenyl example, in the treatment of a cancer (e.g., those described prop-2-enamide (LAQ824), panobinostat (LBH589), sub herein), an agent or compound that decreases, prevents, croylanilidc hydroxamic acid (SAHA), OXamflatin, Scriptaid, delays, Suppresses, or arrests any symptom of the disease or suberic bishydroxamic acid (SBHA), m-carboxy-cinnamic condition would be therapeutically effective. A therapeuti acid bishydroxamic acid (CBHA), or pyroxamide); cyclic cally effective amount of an agent or compound is not peptides (e.g., trapoxin.A. apidicin, TPX-HA, or depsipeptide required to cure a disease or condition but will provide a (FR901228)); benzamides (e.g., entinostat (MS-275), treatment for a disease or condition such that the onset of the N-acetyldinaline (CI994), or mocetinostat (MGCD0103): US 2014/0171492 A1 Jun. 19, 2014 electrophilic ketones (e.g., trifluoromethyl ketones or alpha (Roche Applied Science). The sequences of various Northern ketoamides, see Frey et al., Bioorg. Med. Chem. Lett. Blotting probes were as follows: 12:3443-3447, 2002, and U.S. Pat. No. 6,511.990, incorpo rated herein by reference); and fatty acids (e.g., valproic acid, arginine butyrate, butyric acid, or phenylbutyrate). C/EBPC. mRNA: (SEQ ID NO: 10) 5 - CCGCTCCTCCACGCCTGTCCTTAGAAAGGGGTGGAAACATAGGGACT EXAMPLES TGGGGCTTGGAACCTAAGGTTGTTCCCCTAGTTCTACATGAAGGTGGAGG
Experimental Methods GTCTCTAGTTCCACGCCTCTCCCACCTCCCTCCGCACACACCCCACCCCA
0118. The experimental methods described herein are GCCTGCTATAGGCTGGGCTTCCCCTTGGGGCGGAACT CACTGCGATGGGG used to obtain the results discussed in the brief description of the figures and the examples described herein, unless other GT CACCAGGTGACCAGTGGGAGCCCCCACCCCGAGTCACACCAGAAAGCT wise noted. AGGTCGTGGGTCAGCTCTGAGGATGTATACCCCTGGTGGGAGAGGGAGAC 0119 Cell culture: All cell lines were obtained from ATCC and grown in glutamine containing medium, at 37° C. in a CTAGAGATCTGGCTGTGGGGC-3'; humidified atmosphere with 5% CO. and 0120 RNA isolation and Northern Blot Analysis: Total ecRNA: RNA isolation, electrophoresis, transfer, and hybridization (SEQ ID NO: 11) were carried out as described in Maniati et al., Molecular s' - GTCACATTTGTAAATAATACAGCATTTTCCCTGGCGGCAATCCTGAC cloning: A Laboratory Manual, Cold Spring Harbor Labora TTTCATGAGCTCTCCATCCATCCTGAGCCCCTCTTACCCTAAGGGGGTGA tory Press, 1982). Cytoplasmic RNA was isolated with the Paris kit (Ambion) according to the manufacturer's recom CTTACTTCCCCCAGGCAAGACAAATAAATAGCAGAGGACAAGGCTCCAAA. mendations. Nuclear RNAs were prepared according to Blo TGGAGTATGTCCAGAGCCTGAAGGCAGTCTCTTGGGGTCAGGGGAGGGGG bel, et al., Science 154:1662-1665, 1966, with minor modifi cations. Briefly, equal amounts of viable cells (~50 million) CTGAAGGGGTTACTGGGCTGAGGCCTTGGCGAGGCTTCTTATCTGCCCCG were washed with ice-cold PBS supplemented with 5 mM vanadyl complex, 1 mM PMSF and resuspended in the ice GGGAGGAGGAGAGGGAGTCCTCTGCCTGAGGGGTAGGCCTGGCTAAGCAG coldlysis buffer: 1x Buffer A (10 mM HEPES-NaOH pH 7.6: CCCTAGGCTCAAGGAGCCCTTTGTGCAGACTTCCTTGCAAATCACCTACA 25 mM KCl; 0.15 mM spermine: 0.5 mM spermidine; 1 mM EDTA; 2 mM Nabutyrate); 1.25 M sucrose; 10% glycerol: 5 GCTGCAGCCCTGGCCACTCACACACACCGCAGCTCCAGATICCAGCAGGA mg/mL BSA: 0.5% NP-40; freshly supplemented with pro CCCTCGGCCAGCAGGAAGAGGCCTCCAGTGGTAGGACCCTCCAACCCTCT tease inhibitors (2 mM leupeptin, add as x400; 2 mM pepsta tin, add as x400; 100 mM benzamidine, add as x400; a pro CCTCTTTCCCTAGACCATGTGGCTACACCCTACC-3 '' . tease inhibitor cocktail (Roche Applied Science, Cat. No. 1836153), 1 tablet with 375 uL HO, add as x100; 100 mM I0121 qRT-PCR: Sybr green reactions were performed PMSF, add as x100); 2 mM vanadyl complex (New England using iQ Sybr Green supermix (Biorad, Hercules, Calif.) Biolabs); and 20 units/mL RNase inhibitor (RNAguard; using the following parameters: 95°C. (10 min.), 40 cycles of Amersham Biosciences). Samples were incubated at 0°C. for 95° C. (15 sec.) and 60° C. (1 min.), and 72° C. (1 min.). ~10 minutes and passed through a Dounce homogenizer. The TaqMan analysis was performed using Hotstart Probe One pelleted nuclei were resuspended in 0.5 ml of lysis buffer and step qRT-PCR master mix (USB) at the following conditions: diluted with 2.25 mL of Dilution Buffer (2.13 mL of “Cush 50° C. (10 min.), 95°C. (2 min.), and then 40 cycles of 95°C. ion' buffer with 0.12 mL of 0.1 g/mL BSA), freshly supple (15 sec.) and 60°C. (60 sec.). qRT PCR primers were located mented with protease inhibitors, overlaid onto 2 mL “cush in the coding region for the mRNA (black double headed ions” (200 mL. “Cushion” buffer consists of 15 mL ddHO: 15 arrow) and after the polyA signal for the ecRNA (white mL 20x Buffer A: 30 mL glycerol; 240 mL 2.5 M Sucrose; double headed arrow) (FIG. 1A). The sequences of primers freshly supplemented with protease inhibitors) into one SW used for TaqMan real time PCR were as follows: human 55 Titube, and centrifuged at 24,400 rpm (60 minutes. 4°C.). C/EBPa: Forward 5'-TCG GTG GACAAG AACAG-3 (SEQ The pelleted nuclei were resuspended in 1 mL Storage buffer ID NO:18), Reverse 5'-GCAGGCGGT CATTG-3' (SEQID (1.75 mL dd H2O: 2 mL glycerol; 0.2 mL 20x Buffer A), NO:19), and Taqman Probe 5'-ACA AGGCCA AGC AGC freshly supplemented with protease inhibitors. Nuclear GC-3' (SEQID NO:20); ecPNA. Forward 5'-GGTTGT CTG RNAs were extracted as described in Maniatis et al., 1982. All TGG GCC AGG TCA-3'(SEQ ID NO:21), Reverse 5'-AGA total, cytoplasmic, and nuclear RNA samples used in this GCT CATGAAAGT CAG GATTG-3' (SEQID NO:22), and study were treated with DNase I (10 U of DNase I per 3 ug of Taqman Probe 5'-AATAAT ACAGCATTTTCC CTG GCG total RNA; 37° C. for one hour; in the presence of RNase G-3'(SEQ ID NO:23); human C/EBPy: Forward: 5'-GGC inhibitor). After DNase I treatment, RNA samples were TAGAGGAGC AGGTAC AT-3' (SEQID NO:24), Reverse: extracted with acidic phenol (pH 4.3) to eliminate any 5'-GCCTGG GTATGG ATA ACACTA-3' (SEQID NO:25), remaining traces of DNA. Polyadenylated and non-polyade and Taqman Probe: 5'-CGACACCACTCATGT CAATGG nylated RNA fractions were selected with the MicroPoly(A) CTG-3' (SEQ ID NO:26); human TP73: ABI Cat. PuristTM purification kit (Ambion). cDNA syntheses were #HsO1060631 m1; 18S rRNA: ABI Cat. #4310893E; and performed with Random Primers (Invitrogen) with Tran human 5S rRNA: ABI Cat. HHs02385257 g1. The sequences scriptor Reverse Transcriptase (Roche Applied Science) of primers used for real-time RT PCR (Sybr) were as follows: according to the manufacturer's recommendation. cDNA was human C/EBPa: Forward: 5'-CCGCTC CTCCAC GCCTGT purified with a High Pure PCR Product Purification Kit CCTTAG-3' (SEQ ID NO:27) and Reverse: 5'-GCC CCA US 2014/0171492 A1 Jun. 19, 2014 22
CAG CCA GAT CTC TAG GTC-3' (SEQ ID NO:28); Plus-70 100000 MWCO column (Millipore). Lentiviral ecRNA: Forward: 5'-TCA TGA GCTCTC CAT CCA TCC transduction was performed in the presence of Hexa TGA-3'(SEQ ID NO:29) and Reverse: 5'-CTG GCCGAG dimethrine bromide (final concentration 8 ug/ml) in the GGT CCT GCTGGAATC-3' (SEQID NO:30); and B-AC human myeloid cell line U937. Puromycin (2 g/ml) was TIN Promega Cat. # G5740. added to the cultures two days after infection. Resistant 0.122 Primer extension and 5'-3' RACE: cDNA from the clones were selected and Screened for down-regulation of the HL-60 cell line was synthesized as described above and run in ecRNA by qRT-PCR. The short hairpins RNAs sequences alkaline condition (Sambrook et al., Molecular Cloning: A were as follows: Laboratory Manual, 3rd ed., (Cold Spring Harbor Laboratory Press, 2001). Southern blot transfer and hybridization with oligo AL16 were performed as previously reported (Sam SC: (SEQ ID NO: 31) brook et al., 2001). The sequences of primers used for 5' 5'-ATCTCGCTTGGGCGAGAGTAA-3 '; RACE were as follows: R4 5'-AGA GGC GCG CTTGCC TACAGGTGA-3' (SEQID NO:12), R6 5'CTC GCC ACT Sh:1: GGC GCT GAG GCCTGA-3' (SEQID NO:13), and R8 5'- (SEQ ID NO: 32) GAG TCT TGG GAG CCC TCAAGT GTC T-3' (SEQ ID 5'-AATAAATAGCAGAGGACAAGG-3 '; NO:14). The sequences of primers used for 3' RACE were as follows: AL21- 5'-GTC ACA TTT GTA AAT AAT ACA (SEQ ID NO: 33) GCA-3' (SEQID NO:15), AL23 5' CCCTGG CGG CAA 5' - CAGGCAAGACAAATAAATAGC-3"; TCC TGA CTT TCA-3' (SEQ ID NO:16), and AL25-5'- and TCA TGAGCT CTC CAT CCA TCC TGA-3' (SEQ ID Sh:3: NO:17).5',3' RACE was performed on two myeloid cell lines (SEQ ID NO: 34) HL-60 and U937 using the Exact STARTTM Eukaryotic 5 - GAAGAGGCCTCCAGTGGTAGG-3 '' . mRNA 5'- & 3'-RACE Kit according to the manufacturers I0127. Up-regulation of ecRNA: The 3' downstream region instructions. of C/EBPa ecRNA and an unrelated genomic region were 0123 Double thymidine block (early S-phase block): cloned into the pBabe retrovirus vector harboring a puromy HL-60 cells were grown overnight to 70-80% confluence, cin selection marker (Addgene plasmid 1764). K562 cells washed twice with 1xPBS, and cultured in DMEM (10% were transfected with the Amaxa Cell Line Nucleofector(R) FCS)+2.5 mM thymidine for 18 h (first block). Thymidine Kit V. Program T-003. Puromycin (2g/ml) was added to the was washed out with 1xPBS, and cells were grown in DMEM (10% FCS). After 8 hours, cells were cultured in presence of cultures two days after transfection. Resistant clones were thymidine for 18 h (second block) and then released as selected and screened for upregulation of ecRNA and the described. Synchrony was monitored by flow cytometry unrelated region (UR) by Northern Blot Analysis. The prim analysis of propidium iodide-stained cells using a LSRII flow ers for amplification of 3' and 5' regions (R1 and R2) and the cytometer (BD Biosciences) at the Harvard Stem Cell Insti Unrelated Region (UR) of ecRNA were as follows: tute/Beth Israel Deaconess Center flow cytometry facility. 0.124 DRB and ML-60218 treatment: After release from R1: double thymidine block, HL-60 cells were treated with 100 (SEO ID NO : 35) uM of 5,6-Dichlorobenzimidazole 1-?3-D-ribofuranoside forward: 5 - ATG TCG GTGTCT TTT TAA AAC CAG -3 (DRB) (Sigma Aldrich) for 1, 2, and 3 hours. HL-60 cells and were treated with 25 M ML-60218 (2-chloro-N5-(5- (SEQ ID NO: 36) chloro-3-methyl-1-benzothiophen-2-yl)-2-methylpyrazol-3- reverse: 5 ' - GCT. AAG CTT CCA GAG TGT AAA AGG -3"; ylbenzenesulfonamide, CalbiochemR) for 24 hours. Total R2: RNA was harvested as described above and expression levels (SEO ID NO : 37) of C/EBPa, ecrNA, and 5S were measured by Taqman qRT forward: 5 - CCC GGC CCC AGA GTT AAG TTT GTC -3 PCR. and 0125 5' AZacytidine (5 Aza-CR) treatment: K562 cells (SEQ ID NO: 38) were cultured in the presence of 10 uM 5AZa-CR (Sigma reverse: 5'- CGG CCC AGCTTT TAT ACC CGG CAG -3"; Aldrich) or 2% 1xPBS (mock treatment). Medium was and refreshed every 48 hours. RNA (for RT-PCR) and genomic UR: DNA (for bisulfite sequencing) were isolated after 7 days of (SEO ID NO. 39) treatment. forward: 5" - TA. TAC AGC CAT GAA. AGA. AAC TTAC -3' 0126 Down-regulation of ecRNA: Three different short and hairpin RNAs targeting the human ecRNA and one scrambled (SEQ ID NO: 40) control were designed according to the Dharmacon Software reverse : " - AGT TTT ACT GTG. GTG TGT TTG TTC - 3 '' . program and cloned into the lentivirus vectorpLKO.1 (Sigma Aldrich), which has a puromycin selection marker. Lentivirus 0128 Bisulfite Treatment, Combined Bisulfite Restriction particles were produced as previously described (Stewart et Analysis Assay (COBRA) and Bisulfite Sequencing: The al., RNA 9:493-501, 2003). HEK293T cells were co-trans methylation profile of the C/EBPa gene locus was performed fected with either empty vector or the plKO-shRNA vector by bisulfite sequencing as previously described. Briefly, 1 Jug and Gag-Pol and Env constructs using LipofectamineTM2000 of genomic DNA was bisulfite converted by using EZ DNA (Invitrogen) according to the manufacturer's recommenda Methylation kit (Zymo Research, Orange, Calif.). The prim tion. Virus containing Supernatants were collected 48 and 72 ers and PCR conditions for bisulfite sequencing and com hours after transfection and concentrated using a Centricon bined bisulfite restriction analysis assay (COBRA) are sum US 2014/0171492 A1 Jun. 19, 2014
marized below. For COBRA, PCR products were purified and mL, 1x Buffer of 10 mM Tris pH 7.4; 10 mM. NaCl: 0.5% incubated with BstUI at 60° C. for 3h. The digested DNA was NP-40, freshly supplemented with protease inhibitors (pro then separated on a 3.5% agarose gel and stained with tease inhibitors cocktail: Roche Applied Science, Cat. No. ethidium bromide. For bisulfite sequencing, PCR products 1836153, 1 tablet with 375 uL HO; add as x100), 1 mM were gel purified (Qiagen) and cloned into the pGEMR-T PMSF, and 2 mM vanadyl complex (NEB)). Cells were incu EasyVector System (Promega). Sequencing results were ana bated at 0°C. for 10-15 minutes and homogenized by Dounce lyzed using BiQ analyzer Software. The sequences of primers (10 strokes pestle A and 40 strokes pestle B). Nuclei were for COBRA and bisulfite sequencing were as follows: recovered by centrifugation at 2,000 rpm for 10 minutes at 4 C/EBPa-1.4 kb region-: forward: 5'-GGT GTTTTT AGT C. Nuclei were resuspended in 3 ml 1x Resuspension Buffer TGT GTTTTTTT-3' (SEQID NO:41) and reverse: 5'-AAA (50 mM HEPES-NaOH, pH 7.4; 10 mM MgCl) supple CCC TAA AAC CCC TTA-3' (SEQ ID NO:42); C/EBPa mented with 1 mM PMSF and 2 mM vanadyl complex. Distal Promoter: forward: 5'-TAGTTTYGTTAGTTT GGG DNase treatment (250U/ml) was performed for 30 minutes at GGGTTT-3' (SEQID NO:43) and reverse: 5'-TCTAATCTC 37°C., and EDTA (final concentration 20 mM) was added to CAA ACT ACC CCTATA-3' (SEQ ID NO:44); C/EBPa halt the reaction. Resuspended nuclei were sonicated once for coding region: forward: 5'-AGGTTA AGGYGGTTGTGG 20s (1 pulse every 3 seconds) at 30% amplitude (Branson GTTTTA-3' (SEQID NO:45) and reverse:5'-CCAACTACT Digital Sonifer, Danbury, Conn.). TAA CTT CAT CCT CCT-3' (SEQ ID NO:46); C/EBPa I0131 Immunoprecipitation: Before preclearing, the 3'UTR: forward: 5'-AGGTTYGTG GTAGGA GGA GGG sample was adjusted to 1% Triton X-100; 0.1% sodium TTT A-3' (SEQ ID NO:47) and reverse: 5'-TAA CCC ACR deoxycholate, 0.01% SDS: 140 mM. NaCl; Protease inhibi ACC TAACTT TCT AAT-3' (SEQ ID NO:48); TP73 pro tors; 2 mM vanadyl complex; and 1 mM PMSF to facilitate moter: forward: 5'-GTG GGY GGTTTY GTY GGGTTT solubilization. In the preclearing step, ~50 ul magnetic beads TGT-3'(SEQ ID NO:49) and reverse: 5'-ACC CCT AAA (Protein A or G Magnetic Beads:#S1425S or HS143OSNEB) CRA ATT ATA TAA A-3' (SEQ ID NO:50); and C/EBPy were added to the sample and incubation was carried out for promoter: 1 h on a rocking platform at 4°C. Beads were removed in a magnetic field. The sample was divided into three aliquots: (i) forward: antibody of interest: DNMT1 antibody (Abeam (SEQ ID NO: 51) eatitab 13537); (ii) preimmune serum: IgG (Sigma Aldrich); 5 - GAA GTG AATTTT TTA. AAA TGA TTT -3' (iii) no antibody, no serum (input). About 5pg antibody or and preimmune serum was added to the respective aliquot and incubation performed on a rocking platform overnight at 4° rewerse : (SEQ ID NO: 52) C. Input was stored at -20° C. after addition of SDS to 2% s" - TTT TGT TTT AGT TTT TTA AGT AGT TGG GA-3 '' . final concentration. On Day II, About 200 ul of Protein A coated Super-paramagnetic beads (enough to bind 8 Lug IgG) 0129 Mass ARRAY: Quantitative DNA methylation were added to the samples and incubated on a rocking plat analysis using the Mass ARRAY technique was performed by form for 1 h at 4°C. Six washes were performed with immu Sequenom, Inc., as previously described (Frommer et al., noprecipitation buffer (150 mM. NaCl; 10 mM Tris-HCl, pH Proc Natl AcadSci USA 89: 1827-1831, 1992). Briefly, 1 ug 7.4; 1 mM EDTA; 1 mM EGTA pH 8.0: 1% Triton X-100: of genomic DNA was converted with sodium bisulfite using 0.5% NP-40 freshly supplemented with 0.2 mM vanadyl the EZ DNA methylation kit (Zymo Research, Orange, complex and 0.2 mM PMSF) in a magnetic field. Proteinase Calif.), FCR amplified, in vitro transcribed, and then cleaved Ktreatment to release DNA/RNA into solution and to reverse by RNase A. The samples were then quantitatively tested for HCHO crosslinking was performed in 200 ul of 100 mM their DNA methylation status using MALDI-TOF mass spec Tris-HCl, pH 7.4; 0.5% SDS for the immunoprecipitated trometry. The samples were desalted and spotted on a 384 samples and in parallel for the input; Proteinase K. 500 ug/ml pad SpectroCHIP (Sequenom) using a Mass ARRAY nano at 56° C. overnight. On Day III, beads were removed in dispenser (Samsung), followed by spectral acquisition on a magnetic field. Phenol (pH 4.3) extraction was performed Mass ARRAY Analyzer Compact MALDI-TOF MS (Seque after addition of NaCl (0.2 M final concentration). EtOH nom). The resultant methylation calls were performed by the precipitation (in the presence of glycogen) was conducted for EpiTyper software v1.0 (Sequenom) to generate quantitative 3 hours at -20°C. The pellet was dissolved in 180 ul H.O. results for each CpG site or an aggregate of multiple CpG heated at 75°C. for 3 minutes, and immediately chilledonice. sites. The methylation levels of aggregated multiple CpGS Samples were treated with DNase I (250 U/ml) in the pres were calculated as the mean of each CpGs methylation value ence of RNase inhibitor 300 U/ml in x1 buffer #2 (NEB) at and presented as percentage. 37° C. for 30 minutes. Phenol (pH 4.3) extraction and EtOH 0130 Nuclear RNA immunoprecipitation (nRIP): nRIP precipitation were repeated. The RNA pellet was dissolved in performed as described by Ebralidze et al. (Science 303:383 50 ul H.O. 387, 2004) with some modifications. Crosslinked nuclei were I0132 Electrophoretic gel mobility shift assays (EMSAs) collected as follows: About 60x10 HL-60 cells were and Kd determination: DNA and RNA oligonucleotides (15 crosslinked with 1% formaldehyde (formaldehyde solution, pmol) were end-labeled with Y-32P ATP (PerkinElmer) and freshly made 50 mM HEPES-KOH: 100 mM NaCl; 1 mM T4 polynucleotide kinase (New England Biolabs). Reactions EDTA: 0.5 mMEGTA; 11% formaldehyde) for 10 minutes at were incubated at 37°C. for 1 hand then passed through G-25 room temperature. Crosslinking was halted by adding /10th spin columns (GE Healthcare) according to the manufactur volume of 2.66 MGlycine, kept for 5 minutes at room tem er's instructions to remove unincorporated radioactivity. perature and 10 minutes on ice. Cell pellets were washed Labeled samples were gel-purified on 10% polyacrylamide twice with ice-cold PBS (freshly supplemented with 1 mM gels. Binding reactions were carried out in 10 uL Volumes in PMSF) and then resuspended in cell lysis buffer (volume=4 the following buffer: 5 mM Tris pH 7.4, 5 mM MgCl, 1 mM US 2014/0171492 A1 Jun. 19, 2014 24
DTT, 3% v/v glycerol, 100 mM NaCl. Various amounts of 200. Then, the genome was divided into course bins (10 Kb) purified DNMT1 protein (BPS Bioscience Inc., 0.021-0.156 and reads were counted for DNMT1 RIP and IgG control in uM) were incubated with 1.1 nM of 32P-labeled dsDNA and each bin. A linear regression was fitted across all non-zero ss/ds RNAs. In the competitive assay, a fixed amount of bins and the slope of the regression was used as a scaling protein and increasing amounts of competitors (dsDNA or factor alpha to normalize the RIP and control. Overlapping poly (dI-dC)) were used. All reactions were assembled on ice reads in the DNMT1 RIP were aggregated into contiguous and then incubated at room temperature. Samples were intervals. Each DNMT1 interval was tested for significance loaded onto 6% native polyacrylamide gels (0.5xTBE) at 4 by comparing the number of reads within the interval the C. for 3 hat 140 V. Gels were dried and exposed to X-ray film number of reads in the same region of the IgG control, mul and a Phosphorimager Screen. Data were analyzed with tiplied by the scaling factor (exact binomial test, P=0.5). ImageOuant Software. For affinity assays, the percent shifted Multiple tests were corrected by Benjamini-Hochberg. species was determined as follows: the migration of the 16,187 intervals (representing the start and end boundaries of labeled DNA in this reaction was defined as Zero percent peaks) were determined to be significantly enriched in the shifted and the ratio of the Phosphorimager counts in the area DNMT1 RIP as compared to the IgG control (P<0.0001; of the lane above this band to the total counts in the lane was q<0.0001). A false discovery rate of 7.5% was determined by defined as background and Subtracted from all other lanes. determining the number of significantly enriched intervals in This band represented total input. Subsequent lanes contain the IgG immunoprecipitate using DNMT1 as a control. Sig ing DNMT1-nucleic acid complexes were treated identically, nificantly enriched DNMT1 intervals have a mean length of and the percentage complex formation was calculated as fol 347 bp and a median of 67 reads per interval. Every peak lows: Input-(free probe for each lane-background/input). represents an interval with a height value: the sum of all All experiments contained a control reaction lacking reads within an interval. All peaks were annotated with DNMT1. The percentage complex formation was plotted as a CEAS28 build on RefSeq hg19. A peak was considered function of DNMT1 concentration using nonlinear regression belonging to a gene if located in the gene body or 3 kb up or analysis using Prism 4.0a. downstream the gene (gene loci). Altogether, 6038 gene loci 0133. In vitro Transcription-Methylation Assay: The in were covered by a least 1 significant RTPSeq peak. vitro transcription-methylation assays were performed on 0.135 Reduced representation bisulfite sequencing hemimethylated DNA (FIG. 14H) in the presence or absence (RRBS): High quality genomic DNA was isolated from the of 5 U of human DNMT1 (New England Biolabs) and 5 U of myeloid cell line HL-60. DNA was digested with Msp1 T7 RNA polymerase (Promega) or 5 U of E. coli RNA poly (NEB), a methylation-insensitive enzyme that cuts CCGG. merase sigma-saturated holoenzyme (Epicentre). Reactions Digested DNA was size selected on a 4% NuSieve 3:1 Aga were performed in DNMT1 buffer according to the manufac rosegel (Lonza). For each sample two slices containing DNA turer's recommendations supplemented with rNTPs and 1.25 fragments of 40-120 bp and 120-220 bp, respectively, were mM MgCl, including the “DNMT1 only” reaction. This excised from the unstained preparative portion of the gel. predetermined concentration of Mg" cations is high enough These two size fractions were kept apart throughout the pro to Sustain activity of RNA polymerases and low enough not to cedure including the final sequencing. Pre-annealed Illumina inhibit DNMT1 activity. The primers for the in vitro tran adaptors containing 5'-methyl-cytosine instead of cytosine scription/methylation assays were as follows: Forward: wereligated to size-selected MspI fragments. Adapter-ligated 5'-GGA AGG GCG ATCGGT GCG GGC CTC-3' (SEQ ID fragments were bisulfite-treated using the EZ DNA Methy NO:53), reverse (biotinylated): 5'-Biotin-CAG CCC TCG lation kit (Zymo Research, Orange, Calif.). The products AGGCCC GAAGCCACC-3' (SEQID NO:54), and reverse were PCR amplified, size selected, and sequenced on the (not-biotinylated): 5'-CAGCCCTCG AGG CCC GAA GCC Illumina GA IIX at a reading length of 36 bp. Sequencing ACC-3' (SEQID NO:55). reads were mapped to the reference genomehg19 using RRB 0134 RNA immunoprecipitation sequencing (RIPseq.): Smap61 allowing 2 mismatches. Reads from replicates were Total RNA immunoprecipitated with DNMT1 antibody merged and processed using a custom computational pipe (Abeam catfiab13537) and IgG (Sigma Aldrich) was pro line. We considered only CpG located in regions with a depth cessed for sequencing as described by Mortazavi et al. with of coverage greater than 3 reads. The B-score of CpG methy some modifications. Double stranded cDNA was synthesized lation in a given position is the ratio of methylated CpGs using the Just clNA Double-Stranded cDNA Synthesis Kit within the total number of CpGs through all reads. Levels of (Agilent Technology, Santa Clara, Calif.) according to the genes methylation is the mean of all CpG B-scores within-2 manufacturers instructions. Illumina sequencing libraries kb from the TSS to the end of first intron; for intronless genes were constructed from these cDNA using a ChIP-Seq sample the entire gene body was considered. Genes with less than 3 preparation kit (cathIP-102-1001, Illumina, San Diego, sequenced CpG in the promoter or less than 3 sequenced CpG Calif.) with minor modifications. Illumina paired-end adap in the first exon-intron were excluded. tor and PCR primers were used to replace the single read 0.136 RNA expression profiling: RNA isolated from adaptor and primers in the kit. Constructed libraries were HL-60 cells was employed for sample amplification and subjected to a final size-selection step on 10% Novex TBE labeling using the Whole Transcriptome assay reagent kits gels (Invitrogen, Carlsbad). DNA fragments of 175-200 bp from Affymetrix. 10 ug of labeled RNA was hybridized on were excised from a SYBR-green-stained gel. DNA was Affymetrix GeneChip Human Gene 1.0 ST array. Hybridiza recovered from the gel and quantified following Illumina’s tion, washing, staining, and scanning were carried out as qPCR quantification protocol. Paired end sequencing of these recommended by the manufacturer. Each hybridization reac libraries was then performed on an Illumina GAIIx to achieve tion was performed in triplicates. Washes and staining were 2x76 bp reads. Paired-End reads were trimmed to 50 bp and performed through the Fluidics Station 400 and the Gene aligned to the reference genome hg19 using BWA59 with the Chip(R) Scanner 3000 (Affymetrix, Santa Clara, Calif., USA) following parameters: bwa aln-o 1-125 -k2; bwa sample -o was used to measure the fluorescence intensity emitted by the US 2014/0171492 A1 Jun. 19, 2014
labeled target. Raw data processing was performed using the existence of ncRNAs within the C/EBPa gene locus and to Affymetrix GeneChip(R) Operating Software (GCOS). assess their functional role in the gene expression. Microarrays were RMA normalized using affy, a R-Biocon 0142. As expected, we observed extensive “extra-coding ductor library. C/EBPa expression was used as a threshold to transcription arising within the C/EBPalocus (FIGS. 1A-1C). define expressing (>log2(4)) and not expressing (>log(4)) Northern blot analysis of total RNA from four leukemic cell genes for the further analysis. lines, probing the region immediately after the C/EBPapoly 0.137 Data integration: We used the RefSeq transcripts adenylation site, revealed the presence of a major band of-5 database built on hg19 (UCSC release) as a genome annota kb in HL-60 and U937, but not in K562 or Jurkat cell lines tion reference for RipSeq, RRBS, and microarray expression (FIGS. 1A-1B). The identified transcript was distinct from the experiments. We selected only the longest transcripts. -2.6 kb signal detected with a C/EBPa coding region probe, Accordingly, the number of 40857 RefSeq, Ids was reduced to and correlated with C/EBPa mRNA expression. These non 23250 transcript Ids. Then, we annotated all RIPSeq peaks polyadenylated transcripts were enriched in the nuclear frac against the gene loci which include exonic, intronic, and UTR tion unlike polyadenylated C/EBPa mRNA (FIGS. 1C, 1H) regions plus 3 kb upstream of the TSS and 3 kb downstream Suggesting that this RNA may have functional roles indepen of the Transcription End Site (TES) regions. We identified dent of protein coding potential. To map the entire length of 6038 gene loci with DNMT1-RIPseq. peaks and 17212 gene these transcripts, we performed primer extension and 5', 3 loci without DNMT1-RIPseq. peaks. Finally, we focused our RACE on total and polyA(-) RNAs isolated from HL-60 and study on gene loci covered by the RRBS. We identified 4833 U937 cells. That allowed us to identify the transcriptional gene loci with DNMT1-RIPseq. peaks and covered by RRBS start site (TSS) of these long ecRNAs, one at -1.4 kb and and 10973 geneloci without DNMT1-RIPseqpeaks and cov another at -0.8 kb upstream of the canonical C/EBPa mRNA ered by RRBS. TSS in HL-60 and U937 cell lines, respectively. Both novel 0138 Gene ontology (GO): GO analysis was performed transcripts terminated at +3.6 kb downstream from the with DAVID. We focused our analysis on biological process C/EBPa TSS (FIGS. 1I, 1J). These transcript(s) are “extra annotations. GO enrichment was scored using the Benjamini coding’ rather than non-coding, since they overlap the single corrected p-value. C/EBPa exon and could potentially encode C/EBPa protein. 0139 Statistical analysis: Methylation changes of clones Theoretically, all regions of these extra-coding RNAs (ecR analyzed by bisulfate sequencing were calculated using the NAs) could potentially bind to DNMTs with high affinity. Fisher's exact test (GraphPad Prism Software Inc.). Methy qRT-PCR analysis confirmed concordant expression mode lation changes assessed by Mass ARRAY were calculated between extra-coding and coding transcripts, in both cellular using paired t-test (GraphPad Prism Software Inc.). The sta and nuclear RNAs (FIGS. 1D-1E). tistical evaluation of DNMT1-RNA interaction versus 0.143 To exclude the possibility that these long transcripts expression and methylation was estimated using the student are unspliced precursors of the intronless C/EBPa gene, we t-test. For both populations: DNMT1-bound group and examined the time course of the RNA synthesis and the RNA DNMT1-unbound group (box-plots: FIG. 15B), we mea polymerase type(s) responsible for the initiation of messen sured the overrepresentation of genes which follow our ger and ecRNA. First, HL-60 cells synchronized by double hypothesis (clusters B and C) against the ones which do not thymidine block (thymidine arrests cells at the GO/G1 phase (clusters A and D) using a 2-sample proportion test. P-values boundary) were analyzed upon release from the block (with fort-test and 2-sample proportion test were calculated by the ~85% of cells entering the G1/S phase: FIG.1K). Induction of R functions (http://www.r-project.org) “t. tcst” and “prop. ecRNA was observed immediately after the block release, at test” respectively. Values of Ps0.05 were considered statisti marked contrast to significantly lower levels of C/EBPa cally significant. The meants.d. of two or more replicates is mRNA at this time point (FIG. 1L). Thus, we stipulated that reported. C/EBPaecRNA synthesis precedes the expression of its over lapping mRNA. Next, synchronized HL-60 cells were ana 0140 Data availability: Microarray expression, RIPseq lyzed after treatment with the RNA polymerase II (Pol II) and RRBS data are available on the gene omnibus database inhibitor DRB at different time points. In the presence of under the accession IDs GSE32153, GSE32162, and DRB, we observed strong down-regulation of mRNA but no GSE32168 respectively. The following examples are decrease in ecRNA expression levels (FIG. 1F), suggesting intended to illustrate, rather than limit the invention. that the ecRNA transcription is mediated by a different RNA polymerase than Pol II. To determine the effect of polymerase Example 1 on ecRNA synthesis, we employed a specific RNA poly merase III (Pol III) inhibitor, ML-60218. Treatment with Characterization of Extra-Coding RNAs of C/EBPa ML-60218 resulted in marked down-regulation of ecRNA, 0141 We hypothesized that non-coding RNAs (ncRNAs) with little effect on C/EBPa mRNA (FIG. 1G). Collectively, may function to regulate gene expression. To further test the these findings identify a novel Pol III-regulated RNA (i.e., universal character of the functionality of ncRNAs, we ecRNA) overlapping the C/EBPa locus and preceding focused on the CCAAT enhancer binding protein alpha C/EBPa mRNA expression in S phase. (C/EBPa) gene locus. C/EBPa is a master regulator in the hematopoietic system, and its expression is crucial during Example 2 granulocytic differentiation. Impaired C/EBPa expression and/or function disrupts granulopoiesis and contributes to Functional Role of ecRNAs on mRNA Expression leukemogenesis, and the presence of C/EBPa mutations is and DNA Methylation for C/EBPa now one of the criteria in the classification of human Acute 0144. We also interrogated the functional role of ecRNAs Myelogenous Leukemia (AML). In consideration of its fun for C/EBPa. Lentiviral shRNA-mediated down-regulation of damental role in hematopoiesis, we decided to investigate the ecRNAs led to significant down-regulation of the mRNA US 2014/0171492 A1 Jun. 19, 2014 26
(FIG. 2A). Furthermore, down-regulation of ecRNAs also DNMT, but unbound single-stranded CROs will not bind affected the methylation status within the C/EBPa locus. (i.e., inactivate) DNMT. In this manner, gene-specific dem When transcription of ecRNAs was reduced by shRNAs, ethylation is obtained. DNA methylation levels within the upstream promoter region 0148 Next, we compared REMSAs with fully folded and were significantly increased (FIGS. 2B-2C). As shown in RNaseT3 digested 250 transcripts corresponding to CG-rich FIG. 2C, down-regulation of C/EBPa ecPNAs resulted in regions of the C/EBPa extra-coding RNA and the luciferase about 67%-92% increased methylation of CpG islands com gene (FIG. 4F). A very similar pattern was obtained for these pared to control with scrambled shRNA. C/EBPa expression two non-homologous sequences, strongly suggesting the can be highly susceptible to methylation control, and hyper non-sequence-specific nature of the interaction between methylation in the CpG island within the upstream promoter DNMT1 and RNA. Thus, the mechanism discovered for region of the C/EBPa gene has been shown in a subclass of C/EBPa, as described herein, could be applicable to other leukemia patients in the absence of other known genetic genes. mutations. Based on these results, CROs can be used to target 0149 Finally, we tested the role of active transcription on ecRNA and decrease methylation of tumor Suppressor genes, DNMT1's ability to methylate DNA. Using in vivo methyla Such as C/EBPa. tion assays, we determined the methylation status of hemi 0145. In order to unveil the mechanistic aspects behind the methylated DNA in the presence or absence of transcription. control of DNA methylation by transcription, we performed FIG. 5A(i)-(iv) shows various in vitro assays to determine the in vivo RNA immunoprecipitation (RNA IP) with ChIP effect of transcription on methylation status, where a parallel grade antibodies against DNA methyltransferase 1 assay including polymerase and DNMT1 can be used to (DNMT1). We repeatedly observed a significant enrichment determine methylation status during transcription (FIG. of C/EBPaecPNAs in the immunoprecipitated RNA fraction 5A(iii)) and another assay including DNMT1 can be used to (FIG. 3). determine methylation status in the absence of transcription 0146 We also observed enrichment of other transcripts (FIG. 5A(iv)). Using combined bisulfite restriction analysis (e.g., extra-coding RNAS found in the PU. 1 gene locus) and (COBRA), methylated sites were converted into restriction immunoprecipitation of other RNAs with DNMT1 antibody. sites that can be digested by BstUI. FIG. 5B shows that Since RNA-DNMT1 binding appears not to be sequence digested products are absent when both DNMT1 and T7 specific, these complexes can be formed not only with polymerase are present, but digested products are present C/EBPa transcripts but with other RNAs as well. Previous only when DNMT1 is present (black arrow). Thus, these data studies have shown that downregulation of PU.1, by deletion demonstrate that DNMT1 enzymatic activity occurs in the of an upstream regulatory element (URE), induced acute absence of transcription and that RNAs can be used to prevent myeloid leukemia, T-cell lymphoma, and chronic lympho or reduce DNA methylation. Based on the experiments cytic leukemia-like disease in a murine model (see Rosen described herein, interactions between ecRNAs and other baueret al., Nat. Genet. 36:624-630, 2004; and Rosenbaueret DNMTs, such as DNMT3a or DNMT3b, can also be tested. al., Nat. Genet. 38:27-37, 2006). Similarly, downregulation Example 4 of PU. 1 has been observed in myeloma cell lines and in a subset of freshly isolated myeloma cells. The 17-kb 5’ Screening for ecRNAs Having Target Site Specificity upstream enhancer (URE) and the promoter region of the PU. 1 gene were highly methylated in human myeloma cell 0150. To obtain transcripts having target site specificity, lines. Both sequences correspond to genomic regions giving we performed genomic database searches and Northern blot rise to different ecRNAs (Ebralidze et al., Genes Dev. hybridization assays for ecRNAs that hybridize exclusively 22:2085-2092, 2008). Following 5-aza-2'-deoxycytidine with the targeted genomic site (gene locus) but not to any treatment, upregulation of PU. 1 expression and correspon other genomic site (gene loci). dent growth arrest of myeloma cells have been observed 0151. Using the BLAST genomic database, we searched (Tatetsu et al., Cancer Res.67:5328-5336, 2007). The dem for potential hybridization sites for regions R1 and R2 within ethylating effect of CROs can be tested by its ability to restore C/EBPaecRNA (FIGS. 1). R1 and R2 were assessed using the PU.1 expression by correcting the aberrant methylation pat following BLAST parameters: -E: 10, -B: 100, filter: dust, tern in the URE and promoter region of myeloma cells. FIG. -W: 8, -M: 1. -N: -1, -Q: 2, and -R: 1). Search results are 9 shows exemplary extra-coding RNAs (SEQ ID NOS:2-5) provided for R2 (FIG. 7B) and R1 (FIG. 7C). Whereas R2 for use in generating CROs that can target SPI1 and reduce hybridized to 1,732 candidates, R1 hybridized to only one. PU.1 methylation. Accordingly, R1 but not R2 will likely bind with target site specificity. Example 3 0152. Using Northern blot hybridization, we manually assessed whether R1 and/or R2 would hybridize exclusively Binding Interactions Between ecRNAs for C/EBPa to one genomic site. As shown in FIG.7D, probes correspond and DNMT ing to regions R1 and R2 were hybridized with total RNAs extracted from cells that express C/EBPa (i.e., HL-60 and 0147 To test the binding ability of DNMT1 to C/EBPa U937 cell lines) and cells that lack C/EBPa (i.e., HEK293 and ecRNAs, we performed RNA electrophoretic mobility shift K562 cell lines). The probe corresponding to R2 provided assays (REMSA). We observed strong binding of DNMT1 to non-specific hybridization to all four cell lines. In contrast, folded RNAs comparable to that of double-stranded DNAS the probe corresponding to R1 provided specific hybridiza with the same primary sequence (FIGS. 4A-4E). Importantly, tion to C/EBPa-expressing cell lines HL-60 and U937. single-stranded RNA of the same primary sequence had 0153. Based on the results of these two methods, region almost undetectable binding to DNMT1 (FIG. 4E). Thus, R1 of C/EBPa would be appropriate for ssCRO design. single-stranded CROs hound to its target sequence will bind Accordingly, these methods could be used to determine other US 2014/0171492 A1 Jun. 19, 2014 27 candidate transcripts having “target site specificity' for a for both treatments (FIGS. 13G-13H). We did not observe targeted genomic site. Such as one or more sites in SPI1 major changes in methylation status outside the C/EBPa (spleen focus forming virus (SFFV) proviral integration locus resulting from ecRNA overexpression (FIG. 13I). oncogene spil), RXRA (retinoid X receptor, alpha), RARB 5-Aza-CR treatment led to the expected increase of C/EBPa (retinoic acid receptor, beta), or any other gene described mRNA levels and reduced levels of DNA methylation of the herein. C/EBPa locus (FIG. 13J). In contrast, increased mRNA expression within the neighboring C/EBPg gene and changes Example 5 in methylation status were achieved only after 5-Aza-CR treatment (FIGS. 13J-13K) and not after R1 overexpression. Functional Studies of the ecRNA Regulating C/EBPa In addition, to rule out off target effects on other chromo Expression Somes, we analyzed the expression and methylation profile of 0154 Further to Example 2 and to examine the functional the TP73 gene promoter, located on chr1p36, methylated and role of the ecRNA in regulation of C/EBPa transcription on not expressed in K562, before and after the two treatments. the C/EBPalocus, we performed RNA interference-mediated We detected expression and methylation changes exclusively loss-of-function and overexpression-mediated gain-of-func after 5-Aza-CR treatment (FIG. 13P). These results demon tion experiments. Efficient knock-down of the ecRNA (~4- strate that this ecRNA inhibits DNA methylation at the fold decrease) achieved by small hairpin (sh) RNAS targeting C/EBPalocus, with no discernible effects on DNA methyla the 3' end of the ecRNA (but not including the C/EBPa tion at other tested loci. mRNA) led to a decrease of C/EBPa mRNA expression of 0157 Collectively, these results confirm the inverse link similar magnitude (FIGS. 13 A-13B), suggesting that ecRNA between ecRNA and C/EBPa methylation, and highlight the may regulate C/EBPa expression. In view of the observations gene-specific, highly localized effect, Supporting a specific that increased methylation of C/EBPa gene promoter cis regulatory role of the ecRNA on C/EBPa expression. sequences has been implicated in leukemia and lung cancer, Accordingly, these experiments can be used to determine the we set out to examine if there was a connection between effect of ecRNAs on the methylation status of other candidate C/EBPa ecRNA and methylation of the C/EBPa locus. We transcripts, as well as to determine what regions of ecRNAS analyzed methylation changes within the distal promoter (lo are most appropriate for CRO design for selectively or spe cated at -0.8-0.6 kb from the C/EBPatranscription start site) cifically targeting any of the genes described herein. by bisulfite sequencing (FIG. 13A). Intriguingly, ecRNA knockdown led to a significant increase in DNA methylation Example 6 levels, compared to the non-targeting control (FIGS. 13C Transcription Interferes with DNMT1 Methylation 13D). of DNA 0155 To investigate whether enforced expression of the ecRNA was sufficient to inhibit methylation, the downstream 0158 To examine whether the act of transcription itself region of the ecRNA (R1) and an unrelated region (UR: could interfere with the ability of DNMT1 to methylate hemi located 45 kb downstream of the gene) were overexpressed in methylated DNA, we performed a combined in vitro tran K562 cells, which express ecKNA and C/EBPamRNA at low scription and DNA methylation assay. A hemimethylated levels (FIGS. 13L-13M). Ectopic expression of the down DNA segment (bottom strand methylated) corresponding to stream region of ecRNA resulted in significant increase in the 5' end of the ecRNA (located at -1.4-0.5 kb from the mRNA expression (FIG. 13E) and concomitant decrease of C/EBPa TSS) was engineered downstream of a T7 RNA DNA methylation in all three tested regions within the polymerase promoter, and DNMT1 methylase activity was C/EBPagene: the distal promoter, the C/EBPa coding region, monitored in the presence and absence of active transcription and the C/EBPa 3' UTR. This effect was specific to the (FIGS.5A, 14C). In the absence of polymerase, there was as ecRNA as we did not observe changes in DNA methylation expected a dramatic increase in DNA methylation of the following overexpression of the unrelated region (UR) (FIG. upper strand mediated by DNMT1 (FIGS.5A, 14A-14B). In 13F, 13N). Ectopic expression of the upstream region R2 of contrast, no changes in methylation were observed in the ecRNA did not affect C/EBPa expression, suggesting a presence of both polymerase and DNMT1 (FIGS. 5A-5B, modular character of the ecRNA (FIG.13O). Indeed, analysis 14B). These findings expand on previous studies that have of the 3' part (R2) demonstrated its unique homology to the shown the ability of RNA to modulate DNMTs enzymatic C/EBPa locus, whereas the 5' region (R1) shared sequence activity in vitro and strongly suggest that RNAS arising from homology with thousands of genomic loci (FIGS. 7A-7D). methylation-sensitive genes and their promoters can regulate Together, these loss- and gain-of-function experiments dem corresponding gene expression by interfering with DNA onstrate that the presence of ecRNA prevents C/EBPalocus methylation. specific DNA methylation. 0156 To assess the specificity of the ecRNA overexpres Example 7 sion, we tested whether the effect was confined to the C/EBPa locus. We compared expression levels with DNA methylation DNMT1 Binds to ecRNA with Greater Affinity than changes resulting from ecKNA overexpression to that to DNA induced by the well-characterized hypomethylating agent 0159. We next sought to investigate the mechanism behind 5'-azacytidine (5-Aza-CR). We applied a high-throughput the observation that the C/EBPa methylation pattern is medi methylation analysis of the C/EBPalocus using both a cus ated by altered ecRNA levels. DNMT1 expression and enzy tomized platform for mass ARRAY technology and direct matic activity peaks during S phase. Intriguingly, increased bisulfite sequencing. Some 100kb spanning both C/EBPa and ecRNA expression also occurs during the S phase. We there the neighboring C/EBPg (C/EBP gamma, HGNC:1837, fore asked whether the presence of ecRNA during the S phase NCBI: NP 001797.1, NM 001806.2) gene were analyzed set the stage for ecRNA interference with DNMT1 activity. US 2014/0171492 A1 Jun. 19, 2014 28
To this aim, we tested the in vivo binding of DNMT1 to 0164. In summary, these findings demonstrate that ecRNA by using RNA Immunoprecipitation (RIP) with an DNMT1 binds folded ecRNA with higher affinity than DNA. anti-DNMT1 antibody. Based on the experiments, regions of the ecRNA in other (0160 We observed ecKNA enrichment (>60-fold in candidate genes described herein, that can interact with HL-60 cells) in DNMT1-RNA precipitates, as compared to DNMT1 and other DNMTs such as DNMT3a or DNMT3b, the IgG control, demonstrating a physical interaction can be predicted based on whether the particular region has a between ecRNA and DNMT1 (FIG. 15A). Similar results propensity to form a stable RNA secondary structure. Further, were obtained in U937 cells (FIG. 15G). Analysis of polyA knowing the effect of RNA secondary structure on RNA (+)/(-) fractions in DNMT1-RNA precipitates revealed DNMT1 complex formation will aid in the design of CROs to enrichment of C/EBPa transcripts in the polyA(-) fraction target particular regions of the ecRNA, such as by testing the (FIG. 15H), suggesting that the major component of C/EBPa secondary structure and binding stability of CRO-ecRNA transcripts in DNMT1-RNA precipitates was ecRNA. Next, complexes. we tested in vitro the ecRNA-DNMT1 interaction by per forming RNA electrophoresis mobility shift assays Example 8 (REMSA) with regions corresponding to the 5' and 3' end of Mapping the DNMT1 Epitranscriptome the ecRNA (ssRNA: R05 and R04) (FIGS. 15B, 15I). 0161 First, to compare DNMT1 binding capacity of mis 0.165. Our observations described above suggested an matched double-stranded (ds:R01/R03) and folded single inverse correlation between RNA-DNMT1 complexes and stranded (ss:R01, R04, and R05) RNAS to dsDNAs (with the the methylation of the C/EBPa locus. Thus, we sought to same primary sequence as the RNA oligonucleotides), we explore whether this phenomenon mirrored a more global performed competitive binding assay. We observed strong mechanism of control of genomic methylation. We applied a binding for both ds- and ssRNA in the presence of poly comparative genome-scale approach to identify and correlate (dI-dC) (non-specific competitor) and dsDNA oligos (spe gene expression, association with DNMT1, and methylation cific competitor) (FIGS. 15J, 15C). status. cDNA libraries made of RNAs that co-immunopre cipitated with anti-DNMT1 antibody (DNMT1 library) and (0162 Second, to investigate whether DNMT1 affinity for IgG (control library) were first assessed for C/EBPaecPNA RNA was dependent on the presence of CpG dinucleotides, enrichment (FIG. 16E) and subsequently analyzed by mas we replaced the cytidine within CpG dinucleotides to uridine sively parallel sequencing. Using 76-base paired-end in the ssRNA oligonucleotide (R01: the substitution being sequencing, we produced a total of 30.25 and 26.95 million neutral with regards to the predicted secondary structures, pair reads for DNMT1 and control libraries, respectively. All according to RNAfold (FIG. 15K). The mutations did not significant DNMT1 peaks were annotated with CEAS build disrupt the RNA-protein complexes (FIG. 15L) unlike what on RefSeqhg19 (a total of 16, 176; P<0.0001; false discovery has previously been shown for DNA. Further, to test if the rate of 7.5%). These peaks were aligned against the hg19 ecRNA-DNMT1 binary complex was a case of trivial charge genome using locations scattered throughout the RefSeq, charge interactions, we performed REMSA in the presence of genome annotation as follows: exonic 48%; intronic 23%; increasing concentrations of spermine, a molecule with four distal intergenic 5%; 5' UTR 9%; 3' UTR 5%; and upstream positive charges at high density. Only a thousand-fold molar promoter and downstream gene (assigned as 3 kb regions excess of spermine began to moderately affect the binding flanking the annotated genes) 10% (FIG. 16A). (FIG. 15M), Suggesting a strong element of structural recog 0166 We focused on the genomic regions encompassing 3 nition indicate that the ecRNA can physically associate with kb upstream and downstream of the annotated genes (gene DNMT1. This interaction is not contingent upon the presence loci') and identified 6,042 gene loci covered by the DNMT1 of CpG dinucleotides, is not charge dependent, and requires library. To assess the linkage between genomic loci giving certain RNA structural components. rise to DNMT1-bound RNAs and the levels of genomic 0163. Further to Example 3, we interrogated whether methylation and expression of the corresponding nearby ecKNA displays higher affinity for DNMT1 than DNA. We genes, we applied a genome-scale methylation screening (re quantitatively compared the DNMT1 binding affinity for duced representation bisulfite sequencing, RRBS) and gene SSRNA capable of forming secondary structures, unmethy expression microarray analysis. DNMT1 library and gene lated DNA (umDNA), hemimethylated DNA (hmDNA), and expression microarray database were aligned with the RRBS fully methylated DNA (mDNA). RNA and DNA oligonucle library. otides at a constant molar concentration were titrated with an (0167. Within 15,794 RRBS-covered loci, 4,897 gene loci increasing range of DNMT1 enzyme concentrations using overlapped with the DNMT1-boudn library, and 10,897 gene EMSA. An initial complex between enzyme and RNA was loci did not (FIG. 16F). Within both groups, DNMT1-bound formed with <0.013 uM DNMT1, whereas DNA began com and not bound, genes were stratified according to expression plexing at >0.026 uM DNMT1 (FIG. 15C). The dissociation and methylation levels (FIG. 16B). We observed that genes constant (Kd) for RNA was 0.045 (+0.004) uM, whereas for belonging to the DNMT1-bound group had significantly DNA was between 0.082 and 0.11 uM (umDNA 0.082 (+0. higher levels of expression than genes belonging to the 03); hmDNA 0.14 (+0.11), and mDNA 0.11 (+0.06) uM)) DNMT1 unbound group. An opposite trend was observed for (FIG. 15D). Remarkably, the DNMT1 complex with RNA methylation levels: genes belonging to the DNMT1-bound was 2-fold stronger compared to uml)NA and 3-fold stronger group had significantly lower levels of methylation than than himDNA and mDNA. Importantly, RNA lacking stem genes belonging to the DNMT1 unbound group. Thus, glo and-loop-like structures (R04: FIG. 15E) did not display the bally, DNMT1-RNA association is negatively correlated with same binding affinity as folded RNA (FIG. 15F), demonstrat gene locus methylation status. Next, we clustered genes ing the effect of RNA secondary structure on RNA-DNMT1 within both groups according to levels of expression and complex formation. methylation (FIG. 16C). We defined genes as “expressed US 2014/0171492 A1 Jun. 19, 2014 29 and “low or not expressed above and below the score of of the DNMT1-bound RNAs identified by RIPseq will align log(4)=2, respectively; and “hypomethylated” and “methy to sites of transcription and the respective local genes, and not lated as genes with mean of all CpG scores below and above to the gene loci where the actual DNMT1-binding event takes 50%, respectively. Interestingly, a predominant number of place (FIG. 17). Interestingly, gene ontology analysis showed genes (i.e., more than 50%) were either in cluster B (i.e., that genes in DNMT1-bound cluster C belong to multiple DNMT1 unbound, methylation above 50%, and low expres families of biological processes Suggesting a general charac sion level below log(4)=2) or in cluster C (i.e., DNMT1 ter of the DNMT1 sequestration throughout the genome (FIG. bound, methylation below 50%, and expression levels above 18). or slightly below log(4)–2). For example, 51.45% in the 0169. In conclusion, we have generated the first DNMT1 unbound group were in cluster B (lower right quad “DNMT1-centered epitranscriptome', a comprehensive map rant of FIG. 16C) and 56.64% in the DNMT1 bound group cross-referencing DNMT1-interacting transcripts to (i) DNA cluster C (mid-lower and upper left quadrants of FIG.16C), in methylation and (ii) gene expression. These data Support the agreement with the proposed hypothesis that these interac notion that RNA transcripts act as a shield sequestering tions prevent DNMT1 dependent DNA methylation. An DNMT1 and thus modulating DNA genomic methylation. attractive feature of the epitranscriptome is its dual applica The data also provide a widerscope for applications of CROS bility: (1) as a tool for basic and clinical oncology and stem to target a variety of DNMT1-interacting RNA transcripts cell research; and (2) as a guide for gene specific therapeutic listed herein. approaches. 0168 Moreover, the numbers of genes inclusters B and C OTHER EMBODIMENTS were significantly higher than numbers of genes inclusters A, 0170 All publications, patent applications, and patents F, E and G, H, D, respectively (P-value-0.0001). Examples of mentioned in this specification are herein incorporated by genes from clusters Band Care presented in FIGS. 16D, 16G, reference. 16H. Grouping of genes inclusters A, F, E, G, H, and D may (0171 Various modifications and variations of the be the results of the technical limitation of RRBS, contingent described method and system of the invention will be appar upon the genomic location of the restriction sites and the ent to those skilled in the art without departing from the scope DNA library size-selection, or these genes may be governed and spirit of the invention. Although the invention has been by yet another mechanism of transcriptional control. Another described in connection with specific desired embodiments, it interesting possibility is that genes in clusters A, F, G, H, and should be understood that the invention as claimed should not D might be under long-distance methylation control. It has be unduly limited to such specific embodiments. Indeed, vari recently been shown that thencRNA HOTTIP can exert regu ous modifications of the described modes for carrying out the latory function on distal genes via chromosomal looping, invention that are obvious to those skilled in the fields of while being anchored to its own site of transcription. Without medicine, pharmacology, or related fields are intended to be wishing to be limited by mechanism, it is possible that some within the scope of the invention.
SEQUENCE LISTING
<16 Os NUMBER OF SEO ID NOS: 74
<21 Os SEQ ID NO 1 &211s LENGTH: 1057 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide
<4 OOs SEQUENCE: 1 atgtcggtgt ctittittaaaa cc agaaagaa gCtact tcca aggttgtctg tdggcc aggt 60 cacatttgta aataatacag catttitc cct gg.cggcaatic ct gactitt.ca tdagct ct co 12O atc catcct g agc.ccct citt accctaagggggtgacttac titcc cc cagg caagacaaat 18O
aaatagcaga ggacaaggct coaaatggag tatgtc.caga gcctgaaggc agtict cittgg 24 O
ggt Cagggga gagggctgaa giggittact.g. gigctgaggcc ttgg.cgaggc titcttatctg 3 OO
cc.ccggggag gaggagaggg agt cct ctgc ctgaggggta ggcctggcta agcagc ccta 360 ggctcaagga gC cctttgttg cagacitt CCt tdaaat cac ct acagctgc agcc ctggcc 42O act cacacac accgcagct C cagattic cag caggaccCt c ggc.ca.gcagg aagaggcctic 48O
cagtgg tagg accotccaac cct ct cotct titcc ctagac catgtggcta caccct accc 54 O ctg.cgaggcc caaggcagc ctgaagagag agaC ccctic C at CC agcc.ct coacacctgc 6 OO
US 2014/0171492 A1 Jun. 19, 2014 36
- Continued
<4 OOs, SEQUENCE: 11 gtcacatttg taaataatac agcatttitcc ctdgcggcaa toctogactitt catgagctict 6 O c catccatcc tdagcc cct c ttaccctaag ggggtgactt act tcc.ccca ggcaaga caa 12 O ataaat agca gaggacaagg Ct c caaatgg agtatgtc.ca gag cctgaag gcagt ct ctt 18O gggg.tcaggg gagggggctg aaggggttac tiggctgagg CCttggcgag gCttctt at C 24 O tgcc.ccgggg aggaggagag ggagt cct ct gcc tagggg taggcctggc taa.gcagcc C 3OO taggct Caag gagcc.ctttgttgcagactitc Cttgcaaatc acctacagct gcagc cctgg 360 C Cact cacac acaccgcagc ticcagattico agcaggaccc ticggc.ca.gca ggalagaggcc 42O tccagtggta ggaccctic ca accct citcct ctitt.ccc tag accatgtggc tacaccctac 48O c 481
<210s, SEQ ID NO 12 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic prlmer
<4 OOs, SEQUENCE: 12 agaggcgc.gc titgcct acag gtga 24
<210s, SEQ ID NO 13 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic prlmer
<4 OOs, SEQUENCE: 13 Ctcgcc actg gcgctgaggc ctga 24
<210s, SEQ ID NO 14 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic prlmer
<4 OOs, SEQUENCE: 14 gagt cttggg agc cct Caag titct 25
<210s, SEQ ID NO 15 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic prlmer
<4 OOs, SEQUENCE: 15 gtcacatttg taaataatac agca 24
<210s, SEQ ID NO 16 &211s LENGTH: 24 &212s. TYPE: DNA US 2014/0171492 A1 Jun. 19, 2014 37
- Continued ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
SEQUENCE: 16 c cct gg.cggc aatcctgact ttca 24
SEO ID NO 17 LENGTH: 24 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
SEQUENCE: 17 t catgagctic ticcatc catc ctda 24
SEQ ID NO 18 LENGTH: 17 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
SEQUENCE: 18 toggtggaca agaacag 17
SEQ ID NO 19 LENGTH: 14 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
SEQUENCE: 19 gCaggcggtc attg 14
SEQ ID NO 2 O LENGTH: 17 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic probe
SEQUENCE: 2O acaaggcc aa gcagogc 17
SEQ ID NO 21 LENGTH: 21 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
SEQUENCE: 21 ggttgtctgt gggcCagg to a 21
SEQ ID NO 22 LENGTH: 23 US 2014/0171492 A1 Jun. 19, 2014 38
- Continued
&212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OOs, SEQUENCE: 22 agagct catgaaagticagga ttg 23
<210s, SEQ ID NO 23 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic probe
<4 OOs, SEQUENCE: 23 aataatacag catttitcc ct gg.cgg 25
<210s, SEQ ID NO 24 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OOs, SEQUENCE: 24 ggctagagga gcaggtacat
<210s, SEQ ID NO 25 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OOs, SEQUENCE: 25 gcctgggt at ggatalacact a 21
<210s, SEQ ID NO 26 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic probe
<4 OOs, SEQUENCE: 26 cgacac cact catgtcaatig gotg 24
<210s, SEQ ID NO 27 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OOs, SEQUENCE: 27 cc.gctic ct co acgc.ctgtcc ttag 24
<210s, SEQ ID NO 28 US 2014/0171492 A1 Jun. 19, 2014 39
- Continued
&211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OOs, SEQUENCE: 28 gcc.ccacago cagat citcta ggit c 24
<210s, SEQ ID NO 29 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OOs, SEQUENCE: 29 t catgagctic ticcatc catc ctda 24
<210s, SEQ ID NO 3 O &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OOs, SEQUENCE: 30
Ctggcc.gagg gtc.ctgctgg aatc 24
<210s, SEQ ID NO 31 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide
<4 OOs, SEQUENCE: 31 atct cqcttg ggcgagagta a 21
<210s, SEQ ID NO 32 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide
<4 OOs, SEQUENCE: 32 aataaatagc agaggacaag g 21
<210s, SEQ ID NO 33 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide
<4 OOs, SEQUENCE: 33
Caggcaagac aaataaatag C 21 US 2014/0171492 A1 Jun. 19, 2014 40
- Continued <210s, SEQ ID NO 34 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide
<4 OOs, SEQUENCE: 34 gaagaggcct C cagtggtag g 21
<210s, SEQ ID NO 35 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OOs, SEQUENCE: 35 atgtcggtgt ctittittaaaa ccag 24
<210s, SEQ ID NO 36 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OOs, SEQUENCE: 36 gctaagct tc cagagtgtaa aagg 24
<210s, SEQ ID NO 37 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OO > SEQUENCE: 37 cc.cggc.ccca gagittaagtt tt C 24
<210s, SEQ ID NO 38 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OOs, SEQUENCE: 38 cggcc.ca.gct tittatacccg gcag 24
<210s, SEQ ID NO 39 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OOs, SEQUENCE: 39 tatacago.ca tdaaagaaac ttac 24 US 2014/0171492 A1 Jun. 19, 2014 41
- Continued
<210s, SEQ ID NO 4 O &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OOs, SEQUENCE: 4 O agttt tactg toggtgtgttt gttc 24
<210s, SEQ ID NO 41 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OOs, SEQUENCE: 41 ggtgtttitta gttgttgttitt titt 23
<210s, SEQ ID NO 42 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OOs, SEQUENCE: 42 aaac Cotaala accocitta 18
<210s, SEQ ID NO 43 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OOs, SEQUENCE: 43 tagtttygtt agtttggggg gttt 24
<210s, SEQ ID NO 44 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OOs, SEQUENCE: 44 totaatct CC aaactaCCCC tata 24
<210s, SEQ ID NO 45 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OOs, SEQUENCE: 45 aggitta aggy ggttgttgggt titta 24 US 2014/0171492 A1 Jun. 19, 2014 42
- Continued
<210s, SEQ ID NO 46 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OOs, SEQUENCE: 46
CCaact actt alactitcatCc toct 24
<210s, SEQ ID NO 47 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OOs, SEQUENCE: 47 aggttygtgg taggaggagg gttta 25
<210s, SEQ ID NO 48 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OOs, SEQUENCE: 48 taaCCCaCra CCtalactt to taat 24
<210s, SEQ ID NO 49 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OOs, SEQUENCE: 49 gtgggyggitt tygtygggitt ttgt 24
<210s, SEQ ID NO 50 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OOs, SEQUENCE: 50 accoctaaac raattatata aa 22
<210s, SEQ ID NO 51 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OOs, SEQUENCE: 51 US 2014/0171492 A1 Jun. 19, 2014 43
- Continued gaagtgaatt ttittaaaatg attt 24
<210s, SEQ ID NO 52 &211s LENGTH: 29 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OOs, SEQUENCE: 52 ttttgttitta gttttittaag tagttggga 29
<210s, SEQ ID NO 53 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OOs, SEQUENCE: 53 ggaagggcga t C9gtgcggg cctic 24
<210s, SEQ ID NO 54 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (1) ... (24) 223 OTHER INFORMATION: 5'-Biotin
<4 OOs, SEQUENCE: 54 Cagc cct cqa ggc.ccgaagc cacc 24
<210s, SEQ ID NO 55 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OO > SEQUENCE: 55 Cagc cct cqa ggc.ccgaagc cacc 24
<210s, SEQ ID NO 56 &211s LENGTH: 4 212. TYPE: PRT <213s ORGANISM: Unknown 22 Os. FEATURE: 223 OTHER INFORMATION: Description of Unknown: "DEAD" box motif peptide sequence
<4 OOs, SEQUENCE: 56 Asp Glu Ala Asp 1.
<210s, SEQ ID NO 57 &211s LENGTH: 4 212. TYPE: PRT <213s ORGANISM: Unknown
US 2014/0171492 A1 Jun. 19, 2014 46
- Continued
<4 OOs, SEQUENCE: 61
23
<210s, SEQ ID NO 62 &211s LENGTH: 22 212. TYPE : RNA <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 62
CugaggcCull gC9aggcull cul 22
<210s, SEQ ID NO 63 &211s LENGTH: 22 212. TYPE : RNA <213> ORGANISM: Homo sapiens
<4 OOs, SEQUENCE: 63 ucacacacac cqcagoucca ga 22
<210s, SEQ ID NO 64 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens <4 OOs, SEQUENCE: 64
Ctgaggcc tt ggcgaggctt ct 22
<210s, SEQ ID NO 65 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (13) . . (13) <223> OTHER INFORMATION: Methylated
<4 OOs, SEQUENCE: 65
Ctgaggcctt ggc gaggctt ct 22
<210s, SEQ ID NO 66 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (13) . . (13) <223> OTHER INFORMATION: Methylated
<4 OOs, SEQUENCE: 66
Ctgaggcctt ggc gaggctt ct 22
<210s, SEQ ID NO 67 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens <4 OO > SEQUENCE: 67
23
<210s, SEQ ID NO 68 &211s LENGTH: 23 212. TYPE : RNA
US 2014/0171492 A1 Jun. 19, 2014 48
What is claimed is: 14. The oligonucleotide of claim 13, wherein said DNMT 1. A synthesized RNA oligonucleotide comprising a is DNMT1. sequence of about 15 to about 30 nucleotides having at least 15. The oligonucleotide of claim 1, wherein said oligo 80% complementarity to a portion of an extra-coding RNA of nucleotide further comprises a therapeutic agent selected a gene, wherein said synthesized RNA binds to said extra from the group consisting of a demethylating agent, a DNA coding RNA to form a complex and said complex binds to a and/or RNA polymerase inhibitor, a thymidylate synthase DNA methyltransferase (DNMT) to reduce DNA methyla inhibitor, an immunosuppressant, an adenosine deaminase tion of said gene. inhibitor, a thiopurine, or a label. 2. The oligonucleotide of claim 1, wherein said portion of 16. The oligonucleotide of claim 15, wherein said thera said extra-coding RNA corresponds to a non-coding region of peutic agent is said demethylating agent selected from the said gene, or a fragment thereof. group consisting of 5-azacytidine and 5-aza-2'-deoxycyti 3. The oligonucleotide of claim 2, wherein said portion of dine, said DNA and/or RNA polymerase inhibitor selected said extra-coding RNA corresponds to a fragment of said from the group consisting of cytarabine, fludarabine, gemcit non-coding region or corresponds to both a coding region and abine, cladribine, and clofarabine; said thymidylate synthase a non-coding region of said gene or to both a fragment of a inhibitor selected from the group consisting of 5-fluorouracil, coding region and a fragment of a non-coding region of said floXuridine, capecitabine, tegafur, and carmofur, said immu gene. nosuppressant that is azathioprine; said adenosine deaminase inhibitor that is pentostatin: said thiopurine selected from the 4. (canceled) group consisting of thioguanine and mercaptopurine; or said 5. The oligonucleotide of claim 1, further comprising one label selected from the group consisting of an isotope, a or more modified nucleotides selected from the group con radioimaging agent or a radiolabel, a fluorescent label, a sisting of 5-azacytidine, 5-aza-5,6-dihydrocytosine, 5-aza-2'- nuclear magnetic resonance active label, a luminescent label, deoxycytidine, beta-L-5-azacytidine,2'-deoxy-beta-L-5-aza a chromophore label, a chemiluminescence label, an enzy cytidine, 2'-deoxy-N4-2-(4-nitrophenyl)ethoxycarbonyl-5- matic label, a reporter molecule, an antibody, and an antibody azacytidine, 5-fluorocytidine, 1-B-D-arabinofuranosil-5- fragment. azacytosine, 1-B-D-ribofuranosyl-2 (1H)-pyrimidinone, 17. A pharmaceutical composition comprising the synthe cytarabine, fludarabine, gemcitabine, cladribine, clofarabine, sized RNA oligonucleotide of claim 1 and a pharmaceutically 5-fluorouracil, azathioprine, floXuridine, mercaptopurine, acceptable excipient. thioguanine, pentostatin, and cladribine, oran analog thereof. 18. The pharmaceutical composition of claim 17, further 6. The oligonucleotide of claim 5, wherein said modified comprising a histone deacetylase inhibitor. nucleotide is 5-azacytidine or 5-aza-2'-deoxycytidine. 19. A method of treating or prophylactically treating a 7. The oligonucleotide of claim 1, wherein said gene is Subject having cancer, said method comprising administering C/EBPa (CCAAT enhancer binding protein alpha); SPI1 to said subject a synthesized RNA oligonucleotide of claim 1 (spleen focus forming virus (SFFV) proviral integration in an amount Sufficient to treat said cancer. oncogene spi1); RXRA (retinoid X receptor, alpha); RARB 20. The method of claim 19, wherein said cancer is selected (retinoic acid receptor, beta); RB1 (retinoblastoma 1); from the group consisting of a myelodysplastic syndrome, CDKN2A (cyclin-dependent kinase inhibitor 2A); CDH1 leukemia, head and neck cancer, liver cancer, lung cancer, (cadherin 1, type 1, E-cadherin); CDH13 (cadherin 13, prostate cancer, skin cancer, retinoblastoma, glioblastoma, H-cadherin); TIMP3 (TIMP metallopeptidase inhibitor 3); breast cancer, thyroid cancer, ovarian cancer, pancreatic can VHL (von Hippel-Lindau tumor suppressor); MLH1 (mutL cer, brain cancer, kidney cancer, colon cancer, endometrial homolog 1, colon cancer, nonpolyposis type 2); MGMT cancer, gastric cancer, multiple myeloma, and lymphoma. (O-6-methylguanine-DNA methyltransferase); BRCA1 21. The method of claim 20, wherein said myelodysplastic (breast cancer 1, early onset); GSTP1 (glutathione S-trans syndrome is selected from the group consisting of refractory ferase pi 1); HLTF (helicase-like transcription factor); anemia, refractory anemia with ringed sideroblasts, refrac RASSF1 (Ras association (RalGDS/AF-6) domain family tory anemia with excess blasts, refractory anemia with excess member 1); SOCS1 (suppressor of cytokine signaling 1); blasts in transformation, refractory cytopenia with multilin ESR1 (estrogen receptor 1); or DAPK1 (death-associated eage dysplasia, myelodysplastic syndrome associated with an protein kinase 1). isolated del(5q) chromosome abnormality, and a myelopro 8. The oligonucleotide of claim 7, wherein said gene is liferative neoplasm. C/EBPa and said extra-coding RNA of C/EBPa is SEQ ID 22. The method of claim 20, wherein said cancer is acute NO:1 or SEQID NO:8, or a fragment thereof; or wherein said myeloid leukemia; or non-Small cell lung cancer or Small cell gene is SPI1 and said extra-coding RNA of SPI1 is SEQID lung cancer, or T-cell lymphoma; or glioblastoma. NO:2, SEQID NO:3, SEQID NO:4, or SEQID NO:5, or a 23-25. (canceled) fragment thereof; or wherein said gene is RXRA and said 26. A method of treating or prophylactically treating a extra-coding RNA of RXRA is SEQ ID NO:6 or SEQ ID Subject having a genetic disorder, said method comprising NO:7, or a fragment thereof; or wherein said gene is RARB administering to said Subject a synthesized RNA oligonucle and said extra-coding RNA of RARB is SEQID NO:9, or a otide of claim 1 in an amount Sufficient to treat said genetic fragment thereof. disorder. 9-11. (canceled) 27. The method of claim 26, wherein said genetic disorder 12. The oligonucleotide of claim 1 wherein said oligo is an imprinting disorder, a disorder associated with loss of nucleotide is not double-stranded. imprinting, a repeat instability disease, Beckwith-Wiede 13. The oligonucleotide of claim 1, wherein said DNMT is mann Syndrome BWS), Prader-Willi Syndrome (PWS), selected from the group consisting of DNMT1, DNMT2, Angelman Syndrome (AS), Albright hereditary osteodystro DNMT3a, DNMT3b, and DNMT3L. phy (AHO), pseudohypoparathyroidism type 1A (PHP-IA), US 2014/0171492 A1 Jun. 19, 2014 49 pseudohypoparathyroidism type 1B (PHP-IB), loss of RNA and/or said DNMT, thereby identifying the RNA oligo imprinting in IGF2/H19 for Wilms tumor, Fragile X syn nucleotide for reducing DNA methylation. drome, or myotonic dystrophy. 39. The method of claim 38, further comprising sequenc 28. (canceled) ing one or more extra-coding RNAS of the gene; or further 29. A method of preparing a synthesized RNA oligonucle comprising synthesizing said nucleotide sequence having at otide for reducing DNA methylation of a gene by a DNA least 80% complementarity; or further comprising contacting methyltransferase (DNMT), said method comprising prepar the nucleotide sequence having at least 80% complementarity ing a sequence of about 15 to about 30 nucleotides having at with one or more extra-coding RNAs and/or DNMTs. least 80% complementarity to an extra-coding RNA of said 40-41. (canceled) gene. 42. The method of claim 38, wherein said extra-coding 30. The method of claim 29, wherein said extra-coding RNA is a transcribed RNA corresponding to a coding region, RNA is a transcribed RNA corresponding to a coding region, anon-coding region, or both coding and non-coding regions, a non-coding region, or both coding and non-coding regions, or fragments thereof. or fragments thereof. 43. The method of claim 38, wherein said nucleotide 31. The method of claim 29, further comprising incorpo sequence having at least 80% complementarity comprises rating one or more modified nucleotides into said sequence of one or more modified nucleotides selected from the group about 15 to about 30 nucleotides, wherein said modified consisting of 5-azacytidine, 5-aza-5,6-dihydrocytosine, nucleotide is selected from the group consisting of 5-azacy 5-aza-2'-deoxycytidine, beta-L-5-azacytidine, 2'-deoxy tidine, 5-aza-5,6-dihydrocytosine, 5-aza-2'-deoxycytidine, beta-L-5-azacytidine, 2'-deoxy-N4-2-(4-nitrophenyl) beta-L-5-azacytidine, 2'-deoxy-beta-L-5-azacytidine, ethoxycarbonyl-5-azacytidine, 5-fluorocytidine, 1-?3-D-ara 2'-deoxy-N4-2-(4-nitrophenyl)ethoxycarbonyl-5-azacyti binofuranosil-5-azacytosine, 1-?3-D-ribofuranosyl-2 (1H)- dine, 5-fluorocytidine, 1-?3-D-arabinofuranosil-5-azacy pyrimidinone, cytarabine, fludarabine, gemcitabine, tosine, 1-B-D-ribofuranosyl-2 (1H)-pyrimidinone, cytara cladribine, clofarabine, 5-fluorouracil, azathioprine, floxuri bine, fludarabine, gemcitabine, cladribine, clofarabine, dine, mercaptopurine, thioguanine, pentostatin, and cladrib 5-fluorouracil, azathioprine, floXuridine, mercaptopurine, ine, or an analog thereof. 44. The method of claim 43, wherein said modified nucle thioguanine, pentostatin, and cladribine, oran analog thereof. otide is 5-azacytidine or 5-aza-2'-deoxycytidine. 32. The method of claim 31, wherein said modified nucle 45. The method of claim 38, wherein said gene is C/EBPa otide is 5-azacytidine or 5-aza-2'-deoxycytidine. (CCAAT enhancer binding protein alpha); SPI1 (spleen focus 33. The method of claim 29, wherein said gene is C/EBPa forming virus (SFFV) proviral integration oncogene spil); (CCAAT enhancer binding protein alpha); SPI1 (spleen focus RXRA (retinoid X receptor, alpha); RARB (retinoic acid forming virus (SFFV) proviral integration oncogene spil); receptor, beta); RB1 (retinoblastoma 1); CDKN2A (cyclin RXRA (retinoid X receptor, alpha); RARB (retinoic acid dependent kinase inhibitor 2A); CDH1 (cadherin 1, type 1, receptor, beta); RB1 (retinoblastoma 1); CDKN2A (cyclin E-cadherin); CDH13 (cadherin 13, H-cadherin); TIMP3 dependent kinase inhibitor 2A); CDH1 (cadherin 1, type 1, (TIMP metallopeptidase inhibitor 3); VHL (von Hippel E-cadherin); CDH13 (cadherin 13, H-cadherin); TIMP3 Lindau tumor Suppressor); MLH1 (mutL homolog 1, colon (TIMP metallopeptidase inhibitor 3); VHL (von Hippel cancer, nonpolyposis type 2); MGMT (O-6-methylguanine Lindau tumor Suppressor); MLH1 (mutt homolog 1, colon DNA methyltransferase); BRCA1 (breast cancer 1, early cancer, nonpolyposis type 2); MGMT (O-6-methylguanine onset); GSTP1 (glutathione S-transferase pi 1); HLTF (heli DNA methyltransferase); BRCA1 (breast cancer 1, early case-like transcription factor); RASSF1 (Ras association onset); GSTP1 (glutathione S-transferase pi 1); HLTF (heli (RalGDS/AF-6) domain family member 1); SOCS1 (Sup case-like transcription factor); RASSF1 (Ras association pressor of cytokine signaling 1); ESR1 (estrogen receptor 1); (RalGDS/AF-6) domain family member 1); SOCS1 (Sup or DAPK1 (death-associated protein kinase 1). pressor of cytokine signaling 1); ESR1 (estrogen receptor 1); 46. The method of claim 45, wherein said gene is C/EBPa or DAPK1 (death-associated protein kinase 1). and said extra-coding RNA of C/EBPa is SEQ ID NO:1 or 34. The method of claim 33, wherein said gene is C/EBPa SEQ ID NO:8, or a fragment thereof; wherein said gene is and said extra-coding RNA of C/EBPa is SEQ ID NO:1 or SPI1 and said extra-coding RNA of SPI1 is SEQ ID NO:2, SEQ ID NO:8, or a fragment thereof; wherein said gene is SEQID NO:3, SEQID NO:4, or SEQID NO:5, or a fragment SPI1 and said extra-coding RNA of SPI1 is SEQ ID NO:2, thereof, wherein said gene is RXRA and said extra-coding SEQID NO:3, SEQID NO:4, or SEQID NO:5, or a fragment RNA of RXRA is SEQ ID NO:6 or SEQ ID NO:7, or a thereof, wherein said gene is RXRA and said extra-coding fragment thereof; or wherein said gene is RARB and said RNA of RXRA is SEQ ID NO:6 or SEQ ID NO:7, or a extra-coding RNA of RARB is SEQID NO:9, or a fragment fragment thereof; or wherein said gene is RARB and said thereof. extra-coding RNA of RARB is SEQID NO:9, or a fragment 47-49. (canceled) thereof. 50. The method of claim 38, wherein said DNMT is 35-37. (canceled) selected from the group consisting of DNMT1, DNMT2, 38. A method of identifying a RNA oligonucleotide for DNMT3a, DNMT3b, and DNMT3L. reducing DNA methylation of a gene by inactivating a DNA 51. The method of claim 50, wherein said DNMT is methyltransferase (DNMT), said method comprising: ana DNMT1. lyzing the sequence of one or more extra-coding RNAS of said 52. The method of claim 38, wherein said determining step gene; identifying a nucleotide sequence having at least 80% includes use of a RNA electrophoretic mobility shift assay. complementarity to said extra-coding RNA; and determining 53. (canceled) one or more binding sites between said nucleotide sequence 54. A method of treating or prophylactically treating a having at least 80% complementarity with said extra-coding Subject having cancer, said method comprising administering US 2014/0171492 A1 Jun. 19, 2014 50 to said Subject a pharmaceutical composition of claim 17 in an amount Sufficient to treat said cancer. 55. A method of treating or prophylactically treating a Subject having a genetic disorder, said method comprising administering to said Subject a pharmaceutical composition of claim 17 in an amount Sufficient to treat said genetic disorder.