Meleagris Gallopavo

INVESTIGATING TURKEY (MELEAGRIS GALLOPA VO) DOMESTICATION IN THE SOUTHWEST UNITED STATES THROUGH ANCIENT DNA ANALYSIS by

Camilla Speller MA, Simon Fraser University 2005 BA, University of Calgary 1999

DISSERTATION SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF

DOCTOR OF PHILOSOPHY

In the Department of Archaeology

© Camilla Speller 2009

SIMON FRASER UNIVERSITY

Fall 2009

All rights reserved. This work may not be reproduced in whole or in part, by photocopy or other means, without permission of the author. APPROVAL

Name: Camilla Speller Degree: Ph.D Title of Thesis: Investigating Turkey (Me/eagris gallopavo) Domestication in the Southwest United States through Ancient DNA Analysis

Examining Committee:

Chair: Ross Jamieson Associate Professor, Archaeology

Dongya Yang Senior Supervisor Associate Professor, Archaeology

Jon Driver Supervisor Professor, Archaeology

John Welch Internal Examiner Associate Professor, Archaeology

Dennis O'Rourke External Examiner Professor, Anthropology, University of Utah

Date Defended/Approved: (j c±ob'W q 2009

ii SI j\H) N H~ AS E HUN IV E HSIT Y THINKING OF THE WORLD

DECLARATION OF PARTIAL COPYRIGHT LICENCE

The author, whose copyright is declared on the title page of this work, has granted to Simon Fraser University the right to lend this thesis, project or extended essay to users of the Simon Fraser University Library, and to make partial or single copies only for such users or in response to a request from the library of any other university, or other educational institution, on its own behalf or for one of its users.

The author has further agreed that permission for multiple copying of this work for scholarly purposes may be granted by either the author or the Dean of Graduate Studies.

It is understood that copying or publication of this work for financial gain shall not be allowed without the author's written permission.

While licensing SFU to permit the above uses, the author retains copyright in the thesis, project or extended essays, including the right to change the work for subsequent purposes, including editing and publishing the work in whole or in part, and licensing other parties as the author may desire.

Permission for public performance, or limited permission for private scholarly use, of any multimedia materials forming part of this work, may have been granted by the author. This information may be found on the separately catalogued multimedia material and in the signed Partial Copyright Licence.

No Digital Copy for SFU Library collection: By special permission ofthe Dean of Graduate Studies, the author is exempted from granting permission to Simon Fraser University Library to keep or make a digital copy for use in its circulating collection (currently available to the public at the "Institutional Repository" link of the SFU Library website). It is agreed that the author may change this decision at any time, by providing SFU Library with a signed Partial Copyright Licence in standard form.

The original Partial Copyright Licence attesting to these terms, and signed by this author, may be found in the original bound copy of this work, retained in the Simon Fraser University Archive.

Simon Fraser University Library Burnaby, BC, Canada

Partial Copyright Licence_PDF Exemption 2007 ABSTRACT

As one of the New World's few animal domesticates, the turkey (Me/eagris gallopavo) represented an important resource for the Ancestral Puebloans of the Southwest United States. Despite the rich database of Southwest archaeology, several questions concerning the domestication and use of turkeys remain unanswered, including the geographic origin of turkey domestication, the pre-contact flock management and breeding practices, and the changing roles of wild and domestic turkeys through time. In order to address these outstanding issues, this study applied ancient DNA analysis to 193 archaeological turkey bones, from 43 archaeological sites ranging in time from AD600 to AD1880. The authenticity of the ancient DNA data was secured through multiple criteria, including: the use of dedicated ancient DNA facilities; the inclusions of blank extracts and peR negative controls; and repeat extractions and amplifications.

Mitochondrial DNA analysis of the archaeological remains revealed a strong genetic bottleneck within the pre-contact Southwest turkey population, reflective of human selection and breeding. The genetic differences between the Southwest turkeys and modern commercially­ raised turkeys point to two geographically distinct turkey domestication events in North America: one involving M. g. silvestris and/or intermedia with a subsequent trade of domestic stocks into the Southwest proper, and the other involving M. g. gallopavo in south-central Mexico. The broad distribution of a genetically uniform stock throughout the Southwest suggests that turkeys were traded within and between cultural traditions, and that a single lineage of turkey was used for ritual purposes, feather production, and for food.

While the archaeological and genetic evidence point to the intensification of domestic turkey husbandry through time, the recovery of M. g. merriami haplotypes in the archaeological remains indicates that some local birds were exploited in conjunction with the imported domestic lineage. In addition to hunted wild birds, the osteological and genetic data point to the incorporation of wild individuals into domestic flocks, and/or hybridization of wild toms and domestic hens. This study, integrating genetic, osteometric and archaeological data offers an exclusive snapshot into the complexities of the domestication process, and the dynamic human­ animal interactions of the past.

Keywords: Ancient DNA analysis, Domestication, Me/eagris gallopavo, Ancestral Puebloans

iii ACKNOWLEDGEMENTS

Many thanks go out to my supervisory committee, Dr. Dongya Yang and Dr. Jonathan Driver for providing guidance throughout this research. Special thanks go to my senior supervisor, Dr. Yang, for his exceptional support and mentorship, not only for this project, but throughout my studies at SFU. This study was supported by a Wenner­ Gren Foundation Dissertation Fieldwork Grant (2008), a Canada Graduate Scholarship from the Social Science and Humanities Research Council of Canada (SSHRC) as well as Yang's grant from the SSHRC. Thanks also to Dr. Dennis O'Rourke of the University of Utah, and to Dr. John Welch for serving on my Examining Committee, and for their helpful comments on my dissertation. I would also like to recognize the assistance of Andrew Barton, Shaw Badenhorst and Tyr Fothergill for their assistance in osteological analysis, and in particular the aid of Dr. Robert Muir in conducting the inter-observer replicability tests. I am also grateful to Ursula Arndt, Krista McGrath, and Sarah Padilla for technical assistance in the SFU ancient DNA laboratory, and for discussion on the DNA results. I would also like to acknowledge the academic support I received from so many of the Department of Archaeology faculty, in particular Drs. Dana Lepofsky, David Burley and Mark Skinner. Thanks also to the SFU Department of Archaeology staff, Merrill Farmer, Chris Papaianni, Laura Nielson, and Shannon Wood for all their patience and cooperation over the last few years.

I am indebted to the many individuals who helped me access the archaeological bones samples for analysis. Special thanks go to Dr. R. Garvin, Dr. J. Kelley, Dr. B. Vierra, and Dr. Cathy Cameron who provided turkey bones from their archaeological research projects. My gratitude goes out to all the members of the National Park Service who assisted with the research permits and accessing the archaeological collections. Special thanks to out to Gary Brown of Aztec Ruin; Keith Lyons and Scott Travis of Canyon De Chelly National Monument; Stephen Fettig of Bandelier National Monument; Brian Carey and Carrie Dennett of Chiricahua National Monument and Fort Bowie National Historic Site; Jim Kendrick and Fred Moosman of EI Morro and EI Malpais National Monuments; Steve Riley of Gila Cliff Dwellings National Monument; Heather Young and Kathy Billings of Pecos National Historical Park; Ellen Brennan, Brian

iv Culpepper and James Dryer of Navajo National Monument; Tobin Roop, Derek Toms, and Mariah Robertson of Salinas Pueblo Missions National Monument; Duane Hubbard of Tonto National Monument; Jeremy Moss of Tumacacori National Historical Park; as well as to Michele Girard and Larry Ludwig.

I would also like to acknowledge Arthur Vokes, Courtney Fischrup, Mark Cattanach, and Mike Jacobs of the Arizona State Museum and Elaine Hughes of the Museum of Northern Arizona for their aid in accessing archaeological turkey bone collections. My thanks also to Jamie Merewether, Robin Lyle and the staff at Crow Canyon Archaeological Center, and to Susan Thomas, Tracy Murphy and the other Anasazi Heritage Center staff members for providing many sample for DNA analysis. Finally, I would like thank Kim Beckwith and Stephanie Rodeffer for their aid in accessing the samples from the Western Archeological and Conservation Center. I am especially indebted to Kim Beckwith, who spent many hours organizing the research permits and collections; I am so grateful for her patience and encouragement throughout the project. A warm thank you also to Monty and Adele Clement of Valley Creek Farm, Victoria, BC, who provided many of the modern turkey samples analyzed in this project.

My appreciation also goes out to Dr. Brian Kemp, Dr. Bill Lipe, Cara Monroe and Scott Wyatt of Washington State University for their constructive comments and discussion on the results of this project. I am also beholden to my family, my fellow graduate students, and my friends, both at SFU and abroad, for all their encouragement throughout my graduate studies. Thank you!

v TABLE OF CONTENTS

Approval ii Abstract iii Acknowledgements iv Table of Contents vi List of Figures x List of Tables xiii Chapter 1: Introduction 1 Objectives 2 Chapter 2: Background 4 Animal Domestication 4 Concepts of Domestication 5 Domestication Defined 5 Human Intentionality 6 Domestication as 'Developmental Phenomenon' 7 Wild versus Domestic 7 Pre-requisites for Domestication 8 Identifying Domestication in the Archaeological Record 9 Morphological Markers 10 Non-morphological Markers 14 Turkey Domestication in the Pre-contact Southwest.. 16 The Turkey (Meleagris gallopavo) 19 Models for Turkey Domestication 23 Change in Turkey Use Over Time 38 Domestication and DNA analysis 39 Organellar DNA 39 Number and Geographic Origin(s) of Domestication Events 40 Ancient DNA and Turkey Domestication 41 Chapter Summary 42 Chapter 3: Materials and Methods 44 Archaeological Turkey Samples 44 Osteological Analysis 47 Bone Preparation, Decontamination and Extraction 47 PCR Set-up and Amplification 49 D-Ioop Amplification 49

vi Cytochrome b Amplification 50 Additional Amplifications 51 Sex Identification 51 Modern Turkey Samples 53 Modern D-Ioop Amplification 54 Modern Turkey Sex Identification 54 Sequence Analysis 56 Haplotype Assignation 56 Phylogenetic and Network Analysis 57 Contamination Controls 57 Lab Protocols 58 Repeat Extractions and Amplifications 58 Chapter Summary 59 Chapter 4: Results and Authentication 61 PCR Amplification 61 Direct Sequencing 66 D-Ioop Haplotypes 68 Cytochrome b Haplotypes 69 Sex Identification of Ancient Turkey Samples 70 Genetic Sex and Morphological Size 75 Sex Identification of Modern Samples 76 Authenticity of Ancient DNA Results 79 Physically Isolated Work Area 80 PCR Control Amplifications 81 Molecular Behaviour 81 Quantitation and Biochemical Preservation 82 Reproducibility and Independent Replication 83 Cloning 84 Associated Remains 84 Phylogenetic Sense 84 Sex Identification Results 85 Chapter Summary 86 Chapter 5: Geographic Origin 87 Mesoamerican Domestic Turkey 87 Modern Commercial Varieties 88 Southwest Domestic Turkey 89 Local Domestication Model 91 Phylogeographic Analysis 93 Research Questions 94 Materials and Methods 95 Phylogenetic Analysis 95 Median-Joining Networks 95 Results 96 Mitochondrial Haplogroups 96 Phylogenetic Relationships 98

vii Discussion 100 Identifying the Domestic Lineage 100 Merriam's Turkeys 102 Geographic Origins 103 Number of Domestication Events 107 Chapter Summary 108 Chapter 6: Flock Management Practices 109 Animal Breeding 109 Small Indian Domesticate 110 Large Indian Domesticate 110 Single Population Model 111 Stock Enhancement 114 Research Questions 115 Materials and Methods 116 Osteometric Analysis 116 Regression Analysis 117 Sex Identification 117 Haplotype Analysis and Distribution 117 Results 118 Inter-and Intra-observer Error 118 Regression Analysis 118 Osteometric Analysis 120 Haplotype Distribution 127 Discussion 130 SID and LID Breeds 130 Single Domestic Lineage with Trade 132 Stock Enhancement 134 Chapter Summary 137 Chapter 7: The Changing Roles of Turkeys 138 Ritual Use of Turkey 138 Change through Time 140 Wild versus Domestic 142 Research Questions 143 Sand Canyon Pueblo 143 Methods and Materials 146 Regional Analysis 146 Site-Specific Analysis 147 Results 152 Regional analysis 152 Site-Specific Analysis 154 Discussion 157 Regional Analysis 157 Regional Sex Distribution 159 Site-Specific Analysis 160 Chapter Summary 163

viii Chapter 8: Conclusions 164 Research Summary 164 Implications 167 Reference List 169 Appendices 193 Appendix A: Archaeological Sample and Provenience Information 194 Appendix B: Measurements of Gran Quivira Humeri. 200 Appendix C: PCR Amplification Results 202 Appendix D: Miscoding Lesions in Ancient Sequences 212 Appendix E: D-Ioop Haplotype Multiple Alignment 214 Appendix F: Comparison of Genetic Sex and Morphological Size 216 Appendix G: Inter- and Intra-Observer Replicability 222 Appendix H: Measurements of Humeri Included in Osteometric Analyses 224

ix LIST OF FIGURES

Figure 1 Original range of the wild turkey subspecies in North America (based on Schorger 1966) 22 Figure 2 Detailed map showing the locations of sites within the Northern San Juan and Dolores area (adapted with permission of the Crow Canyon Archaeological Center © 1999) 44 Figure 3 Map showing the locations of archaeological sites from which turkey samples were obtained (adapted with permission of the Crow Canyon Archaeological Center © 1999, see Figure 2 for sites in southwest Colorado) 46 Figure 4 Examples of typical turkey samples used for DNA extraction .48 Figure 5 Relative positions of the overlapping primer sets used to amplify the 598bp D-Ioop fragment (arrows are used only to denote the length of the amplicon, sequencing was conduced from both directions) 49 Figure 6 Electrophoresis gel image of 342bp PCR amplified D-Ioop fragments 61 Figure 7 Multiple alignment of obtained cytb sequences and M. gallopavo GenBank isolate EF153719 (dots indicate identical base pair to the reference) 70 Figure 8 Electrophoresis gel of co-amplified DNA extracts with cytb and Pst! primers 70 Figure 9 Electrophoresis gel of co-amplified turkey DNA extracts using D-Ioop primers TK-F315/TK-R670 and Pst! primers, demonstrating a high failure rate 71 Figure 10 Electrophoresis gel showing the final mtW co-amplification ratio 72 Figure 11 Electrophoresis gels displaying the mtW amplification results for the modern turkey samples (upper bands represent cytb fragments, while lower bands represent Pstl fragments); BK and Neg indicate the blank extract and negative control, 100bp indicates 100 base pair ladder (Invitrogen, Carslbad, CA) 77 Figure 12 Electrophoresis gel displaying the amplification of the HINTW gene fragment for modern turkey samples; BK and Neg indicate the blank extract and negative control, 100bp indicates 100 base pair ladder (Invitrogen, Carslbad, CA) 77 Figure 13 Repeat amplifications of MTU1 using HINTW and mtW technqiues 79

x Figure 14 Overlapping sequences required to obtain a reliable consensus sequence for TU135 (arrows indicate sequencing direction for each of the amplicons) 82 Figure 15 Diagram of McKusick's 'introduction' model for Southwest domestic turkeys 90 Figure 16 Diagram of Breitburg's 'local domestication' model for Southwest domestic turkeys 92 Figure 17 Median-joining network of obtained modern and ancient D-Ioop haplotypes 96 Figure 18 Median-joining network displaying the relationships between the obtained D-Ioop sequences and available wild turkey reference sequences 97 Figure 19 Phylogenetic tree displaying the relationships between obtained haplotypes and modern wild turkey subspecies, with ocellated turkey as the outgroup 98 Figure 20 Phylogenetic tree displaying the relationships between obtained cytb haplotypes and available M. gallopavo GenBank reference sequences 100 Figure 21 Bivariate plot displaying the strong correlation between greatest proximal breath and greatest length for the 40 complete adult turkey humeri 118 Figure 22 Bivariate plot displaying the strong correlation between greatest distal breath and greatest length for the 40 complete adult turkey humeri 119 Figure 23 Frequency distribution of GL measurements of complete adult turkey humeri of molecularly determined sex 121 Figure 24 Frequency distribution of Gran Quivira humeri greatest lengths 122 Figure 25 Frequency distribution of humeral greatest lengths of the Gran Quivira and H1 adult birds 123 Figure 26 Bivariate plot of humeral greatest proximal breadth by greatest length of the two haplogroups 125 Figure 27 Bivariate plot of H1 and H2 distal tibiotarsi greatest distal breadth by greatest distal depth 126 Figure 28 Geographic locations of archaeological sites where H1 turkey were recovered (adapted with permission of the Crow Canyon Archaeological Center © 1999) 127 Figure 29 Geographic locations of archaeological sites where H2 turkey were recovered (adapted with permission of the Crow Canyon Archaeological Center © 1999) 128 Figure 30 Geographic locations of archaeological sites where rare H1 haplotypes were recovered (adapted with permission of the Crow Canyon Archaeological Center © 1999) 129

xi Figure 31 Plan map of Sand Canyon Pueblo displaying the architectural blocks and excavated areas (adapted with permission of the Crow Canyon Archaeological Center © 2004) 144 Figure 32 Plan maps displaying the structures and excavated portions of the four architectural blocks at Sand Canyon Pueblo (adapted with permission of the Crow Canyon Archaeological Center © 2004) 148 Figure 33 Frequencies of H1 and H2 haplotypes through time 152 Figure 34 Relative proportion of H1 to H2 types through time 153 Figure 35 Graphs displaying the frequency of male and female turkeys through time 154 Figure 36 Distribution of male and female turkeys among Sand Canyon architectural blocks 156 Figure 37 Distribution of male and female turkeys from different depositional contexts at Sand Canyon Pueblo 157 Figure 38 Diagram of the revised 'introduction' model for Southwest domestic turkey 165

xii LIST OF TABLES

Table 1 Archaeological sites from which turkey samples were obtained 45 Table 2 PCR primers used to amplify turkey overlapping D-Ioop fragments .49 Table 3 PCR primers used to amplify turkey cytb fragment 50 Table 4 Generic 'bird' cytb primers 51 Table 5 Pstl PCR Primers used to amplify turkey W-chromosome fragments 52 Table 6 Modern turkey DNA proveniences and morphological sex 53 Table 7 Wand Z chromosome HINT gene primers 56 Table 8 Archaeological bone samples that underwent repeat extraction and/or repeat amplification 59 Table 9 Final overlapping D-Ioop sequences lengths and mtDNA haplotypes obtained for ancient and modern turkey samples 62 Table 10 PCR amplification and sequencing results using 'Bird Cytb' primers 66 Table 11 Polymorphic sites defining each haplotype 68 Table 12 Missing or ambiguous data for the 20 'tentative' haplotypes 69 Table 13 Final sex identifications of tested archaeological turkey samples 72 Table 14 Frequency and proportion of failed mtW samples in each morphological size category 76 Table 15 Provenience and sex identification results for modern turkey samples 78 Table16 McKusick's (1986b) GL of humeri for each turkey populations 120 Table 17 GL mean measurements for H1 and Gran Quivira humeri 123 Table 18 Haplotype frequencies at Gran Quivira and other Southwest sites 124 Table 19 Measurements and standard scores of H2 humeri samples 126 Table 20 Provenience and context of Sand Canyon turkey bones 149 Table 21 Frequency of turkey haplogroups through time 152 Table 22 Frequency of turkey haplogroups and sexes through time 153 Table 23 Haplotypes and sex identifications of Sand Canyon turkey samples 155 Table 24 Distribution of male and female turkeys among Sand Canyon architectural blocks 156 Table 25 Distribution of turkey sexes from different depositional contexts at Sand Canyon Pueblo 157

xiii CHAPTER 1: INTRODUCTION

Animal domestication revolutionized the life-ways of formative peoples, their relationship with their environment, and their technological and social development. In order to more fully understand North America's indigenous cultures, it would be remiss to overlook one of the continent's few animal domesticates: the turkey. While the turkey has served as a cultural staple in North America from pre-history to current history, archaeological investigations into turkey domestication have proven inconclusive for various reasons. This study uses a new archaeological approach, that of ancient DNA analysis, to explore the origins and use of domestic turkeys in North America, specifically in the Southwest United States.

This study of pre-contact turkey use focuses on the 'four-corners' region of the Southwest United States (northern Arizona and New Mexico, southwest Colorado and southern Utah). This area, occupied by the Ancestral Puebloans (also known as the Anasazi) yields archaeological evidence of turkeys as valuable spiritual and secular resources, beginning in New Mexico around 100BC-AD500 and intensifying through time until the Ancestral Puebloans migrated out of the area around AD1 000-1300 (Breitburg 1993). Turkey bones and feathers are recovered in a variety of archaeological contexts, indicating that they were used not only for food, textile and tool sources, but for ritual purposes as well. The presence of turkey feathers on prayer sticks and the recovery of intact desiccated turkeys, suggests they were spiritually important, and used as sacrificial animals (Hill 2000; Schorger 1966). Despite the extensive archaeological investigations within the Southwest over the last century, several major questions about the Ancestral Puebloans and their relationship with the turkey remain unanswered. Debates persist as to the origin of the domestic turkey in North America: whether it was introduced from Mexico along with other plant cultigens such as corn and beans (McKusick 1986b); or rather if turkeys were locally domesticated by Anasazi-Mogollon groups (Breitburg 1988, 1993). Furthermore, we still know very little about the process of turkey breeding, or even the principal motivations for turkey husbandry, i.e., whether it was for economic or ritual purposes, and how these motivations may have changed over time. 1 Questions surrounding the origin and use of Southwest domestic turkey stocks have been inadequately addressed due to a lack of effective osteological criteria. Although turkey bones, feathers, and feather artifacts are often excellently preserved in Southwest archaeological sites, visual examination or measurements alone have not been able to confidently and consistently distinguish between wild and domestic turkeys, or among presumed breeds of domestic turkeys (Munro 1994; Senior and Pierce 1989). For example, since the earliest turkey remains in the Southwest cannot be accurately identified as either Mexican domesticates or wild North American turkeys (based on osteological grounds), the origin of turkey domestication could not be suitably addressed. Moreover, the criteria developed to distinguish possible turkey breeds (McKusick 1986b) are even more difficult to apply when the turkey skeletons are incomplete, broken, or belong to juvenile birds, as is often the case in archaeological sites. Most importantly, visual or metric examination of ancient bones and feathers alone cannot distinguish between traits resulting from selective turkey breeding by the Ancestral Puebloans, and those characteristics that reflect the natural variation in a population, sexual dimorphism, or other environmental factors (Clutton-Brock 1999; Senior and Pierce 1989). Ancient DNA analysis, which goes beyond visual and metric examinations, may offer a more precise and accurate technique for differentiating wild and domestic turkey remains, identifying breeding populations, and tracking their changes through time.

Objectives

By providing an added level of detail to current debates, ancient DNA analysis can open fresh avenues for archaeological investigations. Even more importantly, information gleaned using genetic analyses allows archaeologists to pose altogether new questions. This study applied ancient DNA techniques to archaeological turkey remains to address three research objectives: 1) to determine the geographic origin(s) of four-corners domestic turkey stocks; 2) to investigate the flock management practices of the Ancestral Puebloans as they pertain to turkey breeding; and 3) to examine the roles of turkeys in Ancestral Puebloan culture, and how they changed through time.

This thesis has a somewhat unconventional format. Chapter 2: Background, reviews and evaluates the literature pertaining to animal domestication, as well as the pre-contact occupation of the Southwest United States, with a focus on the Ancestral

2 Puebloans and their use of turkeys. Chapter 3: Materials and Methods, describes the archaeological turkey samples included in the study, and the overall methods for DNA extraction, amplification and sequencing. Chapter 4: Results and Authentication, reviews the results of DNA extraction, amplification and sequencing, and provides a discussion on the authenticity of the DNA sequences. The subsequent three chapters, Chapter 7: Geographic Origins, Chapter 8: Flock Management Practices, and Chapter 9: The Changing Roles of Turkeys, explore each of the three research objectives in detail. These chapters contain the background information, specific methods, results, and discussion pertaining to each of the respective research objectives. Finally, the conclusions of the study are presented in Chapter 8.

3 CHAPTER 2: BACKGROUND

Archaeologists have long been fascinated with the process and motivations behind animals domestication. Animal domestication represents a revolution in the lives of pre-historic peoples, their relationship with their environment, and their technological and social development. As one of the few animal domesticates in the New World, it seems surprising that the turkey has not received more attention. Though some ethnographic studies have explored indigenous turkey use (Gnabasik 1981; Poplin 1992), Native North American achievements in the area of animal domestication have generally been overlooked, and it is distressing to read in a relatively recent peer­ reviewed journal "there is little doubt that the real domestication of the turkeys was first accomplished in Europe" (Brant 1998:366).

This chapter begins by exploring the concept of domestication, and the types of direct and indirect archaeological evidence which can contribute to a better understanding of this dynamic process. Next, the chapter reviews pre-contact turkey use in the Southwest, with a focus on the origins of the domestic turkey, how turkey breeding was accomplished, and changes in its principal use through time (a more thorough discussion of Southwest prehistory may be found in Cordell (1997) or Kanter (2004)). The chapter concludes with an exploration of how ancient DNA analysis may contribute to animal domestication studies in general, and to Southwest turkey domestication in particular.

Animal Domestication

Questions revolving around plant and animal domestication and the origins of agriculture and pastoralism, have been a focus of archaeology and biology for generations. Much research has focused on understanding the animal domestication process (Hemmer 1990; Price 2002; Zeuner 1963), and tracking its origins in the archaeological record (Clutton-Brock 1981; Hyams 1972; Zeder et a/. 2006a).

4 Concepts of Domestication

Despite extensive research on animal domestication, archaeologists and biologists have found it difficult to explain and define this elusive process. In general, domestication is a dynamic process that takes place over successive generations whereby tamed animals are cut off from wild populations and slowly assimilated into human societies (Glutton-Brock 1999:29). In Glutton-Brock's view (1992, 1999), this process incorporates both biological and cultural influences: the biological processes are evolutionary ones, where the founding group adapts over successive generations to its new human-influenced environment. The biological processes are similar to natural selection, and incorporate concepts like founder effect, bottlenecks, as well as some intentional or unintentional 'artificial' human selection. The cultural processes, on the other hand, deal with the new concepts of animal ownership. In addition to changes in human culture, Glutton-Brock (1999:31-32) maintains that animals themselves also experience 'culture' change (if animal 'culture' is defined as a way of life imposed over successive generations of a animal society by its elders). During the domestication process, humans manipulate the social environment of their domestic animals, causing significant shifts in their learned behaviour patterns.

Domestication Defined

Myriad definitions of domestication can be found in the literature, usually focusing on either the biological or cultural aspects of domestication. In archaeological literature, the most commonly cited definitions of domestication (primarily from the early 1980 and 90s) have a strong anthropogenic focus (Glutton-Brock 1999; Ducos 1978; Hemmer 1990). These definitions focus on the capture and taming of animals by humans, their separation from the wild population, and their reliance on humans for their maintenance. Using this approach, domestication is often defined as a point when a particular threshold was met in the human-animal relationship. Some definitions focus on a biological threshold - controlled breeding for example, as in "the capture and taming by man of animals of a species with particular behavioural characteristics, their removal from their natural living area and breeding community and their maintenance under controlled breeding conditions for mutual benefits (Bokonyi 1989:22). Similarly, Glutton­ Brock (1999:32) defines a domestic animal as one "that has been bred in captivity for the

5 purposes of economic profit to a human community that maintains complete mastery over its breeding, organization of territory, and food supply".

Others definitions examine a cultural or social threshold, as in: "domestication exists when (and only when) living animals are integrated as objects into the socio­ economic organization of the human groups, in the sense that, while living, those animals are objects for ownership, inheritance, exchange, trade, etc., as are the other objects (or persons) with which human groups have something to do" (Ducos 1978:54).

Human Intentionality

These definitions, however, view animals as being essentially passive in the establishment of domestication (O'Connor 1997: 150), with an imbalanced share in the symbiotic relationship. Ducos (1989:29) states this explicitly - "domestication is not a natural state - it exists because humans (and not animals) wished it". Others, like Morey (1994) take a less anthropocentric view of domestication, and approach domestication strictly as an evolutionary process, without considering any human intentionality. In this view, changes in animal diet, behaviour, morphology, physiology and behaviour are the result of a new selective niche, the domestic association with human beings, rather than due to any conscious selection or rational decision making on the part of human beings (Morey 1994:336). Although it is possible that humans intentionally began the domestication process, it is not necessary to presume that they did. Using this evolutionary framework, the concept of domestication is open to organisms other than humans (such as the relationship between ants and aphids).

More recent explanations stress the notion that both species benefit from the process: animals increase their reproductive fitness and range, while humans gain a more predictable resource base (leder 2006b). leder's (2006b: 106) careful evaluation of previous definitions has provided perhaps the most appropriate view of domestication, as a "continuum of increasing human intervention ranging from predation to genetic engineering in which there are varying degrees of investment in altering an animal's natural behaviour (its movement, breeding schedule, or population structure) to suit human needs". Intentionality, and the deliberate dominant role taken by humans to pursue the domestication relationship is what separates domestication from other forms of mutualism, or commensalisms (leder 2006b: 107). Over time, this cumulative process renders both parties more and more interdependent.

6 Domestication as 'Developmental Phenomenon'

These aforementioned definitions rightly emphasize the evolutionary nature of domestication. Nevertheless, they omit one important factor in the domestication process - the experiential process. Domestication is both a long-term and short-term process. Over the long-tem, domestication involves adaptation to a captive environment through genetic change over generations. Nevertheless, the process also incorporates environmental stimulation and experiences that occur during an animal's lifetime. In this way, one can think of domestication as both an evolutionary process and a developmental phenomenon (Price 2002:10). The domestication process includes important developmental factors, like socialization, that occur anew in each captively­ bred generation. The process of socialization (often referred to as imprinting) occurs in most domestic species in the first few days or weeks of life, and helps stabilize hierarchical bonds of later adult life (Hess 1968). Imprinting determines the character of social behaviour and mate selection in adult life, and particularly in birds, is an important factor in rendering them more tame and adapting them to new types of food or habitat (Sossinka 1982:380). In birds, the critical period for imprinting, lies within the first 32 hours of hatching (Hess 1968:225), and is an important species recognition tool that will affect mating preference in adult life - females will often only mate with the species or subspecies with which they were reared (Brown 1975:628).

Wild versus Domestic

If defining domestication is a challenging task, then so too is setting a threshold between 'wild' and 'domestic'. At what point does a group of animals become fully domesticated? Since human-animal relationships can include a range of intensities, ranging from selective hunting, taming, and capture, to intentional and selective breeding, is this dichotomy between wild and domestic a valid or useful concept? Pinpointing an exact time and place that animals become 'domestic' is simplistic. Considering that domestication is a cumulative process, rather than an instantaneous event, it is perhaps more fruitful to describe the amount of investment in the relationship by both human and animal partners (Zeder 2006b; Zeder ef al. 2006b). Research can examine the intensity of the domestication relationship by evaluating genetic or morphological modifications taking place in the animal populations, beginning with founder effects and new selective pressures, followed by characteristic morphological

7 changes (Zeder et a/. 2006b). Studies may also examine how the animals are incorporated in the social structure of a community, and the social implications of animal ownership (Ducos 1978; Ducos 1989; Ingold 1996). Using species-specific case studies, examining the middle ground between hunting and husbanding will help to understand how the domestication process might have unfolded. Most importantly, it is imperative to recognize that the domestication process does not follow the same developmental trajectory in all cases, but will vary based on the species' biological and behavioural characteristics, as well as the human cultural contexts (Zeder et al. 2006b:139).

Following upon Zeder's view, the approach taken in this paper does not adhere to one particular definition for domestication, or domestic animals. Rather, this research seeks to elucidate the complex interrelationship between humans and animals, and document the nature and degree of human exploitation and control of animals. By broadening the perspective beyond merely identifying the use of domestic animals, one may explore how the nature and intensity of these relationships change over time and space, and explore the constantly fluctuating boundaries of domestication.

Pre-requisites for Domestication

Not all wild animals can be domesticated, rather, they must evince certain exaptations, developmental plasticities, and social behavioural patterns that are compatible with humans. In order to adapt to their new human society, they must be a social animal, with a hierarchical dominance behavioural pattern (Glutton-Brock 1999:9) (although the domestic cat may be an exception to this rule). Some favourable traits for domestication include "gregariousness, non-aggressive behaviour, promiscuous sexual behaviour, readily breed in captivity, precocious young, readily tamed, ease in handling, limited sensitivity to environmental change, limited agility, wide environmental tolerance and generalized feeding behaviours" (Price 2002:23-24). Additionally, the animals must be able to breed in captive, crowded and unnatural conditions. Young animals must be able to survive away from their mother, and must be able to adapt to new environments and feeding behaviours (Glutton-Brock 1999:9). A wide home range and a short flight distance are also important criteria for domestication (Glutton-Brock 1992:80). All of these characteristics reflect animal species that are placid and gregarious, easy to tend

8 in a flock or herd, and willing to be directed in their movements (in other words, without fixed migration patterns as in gazelle or reindeer) (Clutton-Brock 1999:9, 18-19).

A smaller brain size may also be a useful exaptation for domestication. Hemmer (1990:114) notes that where brain size varies geographically within a wild species, the smallest-brained populations were those to be initially domesticated - this pattern is visible in domestic dogs, cats, sheep and goats.

In terms of domesticated birds, some additional considerations for domestication include specialized food requirements, breeding periodicity, imprintability and social structure (Sossinka 1982). The first domesticated bird species were often seed or grass eaters, since the earliest captured animals would need to be able to forage on their own, or be able to survive on stored human food (e.g. grains or seeds). Breeding conditions are another important consideration as early captive populations may not succeed if they were primarily photoperiodic species, sensitive to light cues for breeding. Instead, most domesticated birds have been from subtropical or arid areas, where breeding cues are less environmentally or geographically cued (Sossinka 1982:379).

There are also certain human cultural factors that will affect which animal species are domesticated. First, humans must have a need or desire that can be fulfilled by protecting and breeding a particular animals (Price 2002:21), such as animals for food, transportation, beasts of burden, sacrificial offerings or other ritual purposes. Furthermore, human communities must also possess the technology or lifestyle patterns to accommodate domestic animals. For example, human groups must have a sufficient subsistence base and appropriate mobility patterns that allow for the care and provisioning of domestic animals.

Identifying Domestication in the Archaeological Record

There are many lines of evidence that can be used to explore the domestication process, or identify the use of domestic animals in the archaeological record. The most prevalent method is zooarchaeology, or the identification and analysis of animal remains retrieved from archaeological excavations. Zooarchaeological evidence for animals undergoing domestication focuses on changes in a species' natural behaviours, and can be roughly divided into morphological and non-morphological markers, including characteristic osteological changes, and shifts in a species' demography, abundance or geographic distribution. 9 •

Morphological Markers

Morphological markers of domestication are predominantly those that reflect a selective response for reduced wariness and aggression. Hemmer (1990) argues that animals display a constellation of behavioural, physiological and morphological changes associated with reduced aggression, and a decline in "environmental appreciation" as they become dependent on humans. These changes are linked to more 'juvenile' or 'paedomorphic' behavioural traits including greater gregariousness, less wariness, and greater playfulness. The behavioural traits are also linked to characteristic morphological changes including earlier onset of sexual maturity, more frequent receptivity, smaller brain size, shortened snout, tooth-size and tooth number reduction, smaller bodies, pie-bald coats, lop ears, decrease in sexual dimorphism. Although a suite of biological and morphological changes accompanies the domestication process, many will not be visible in the archaeological record. For archaeologists, the most useful morphological indicators of domestication are changes in overall body size, facial structure and dental morphology.

There are a number of factors that affect timing and type of morphological changes in domestic animals, and these depend on the biology of the species and the nature of their interaction with humans. Some changes may be reflected only in certain elements and dimensions, and may 'kick-in' at different times in the domestication process (Zeder 2006a). Moreover, several causal factors may result in the same type of morphological changes.

Identifying these morphological markers within the initial phases of domestication can prove challenging, since selection would operate more strongly on behavioural attributes, rather than morphological ones. While some of the aforementioned morphological traits may appear within the first few generations of the domestication process (Trut et al. 2009), for many animal species, morphological changes may not be useful for tracking the initial stages of domestication, as they may not have had time to take effect (Meadows 1989:85). The initial 'proto-domesticate' population may not differ significantly from their fully wild brethren morphologically, but rather will show less aggressive behaviour, be more tolerant of penning, with weak alarm systems, etc. (Zeder 2006b: 109).

10 Reduction in Body Size

Until quite recently, overall body size reduction was the most commonly used domestication marker (Zeder 2006a:172). Body size reduction is related to several aspects domestication, including the intentional or unintentional selection for tamer animals, the elimination or reduction of a sexually-selective advantage for breeding success (especially for males), or an adaptive response to poor diets, or the lack of night time feeding (Zeder 2006a). As size reduction may be purely the result of inferior nutrition, lack of food diversity, low-quality forage, restricted mobility and parasitic infection, this morphological change may be reflected within a few generations (Meadows 1989:85-86). However, there are several disadvantages to using body size as the sole marker for domestication, since body size is dependent on sex, age, and environment, and can be confounded by the movement of a new domestic breed into an area. Furthermore, a similar decrease in size can be seen in wild animals towards the end of the Pleistocene, caused by either environmental and climatic factors, or their confinement to marginal areas by encroaching human settlements (Meadows 1989:87). Most importantly, a demographic shift in the domestic population (often reflecting the selective culling of young males) may be misinterpreted as an overall change in size, especially if the adult population is mainly composed of females (Zeder 2006c; Zeder and Hesse 2000).

Reduction in Skull Size

Almost all domestic animals have experienced a reduction in skull size in relation to body size compared to their wild progenitor (Clutton-Brock 1999:36-37). The skull reduction is accompanied by a relative decrease in cranial capacity and brain size as well. Other morphological changes in the cranial region include a shortening of the jaws and facial region. Tooth size reduction and tooth crowding usually accompanies the reduction in jaw size, and has been used to identify domestication in dogs and pigs (Morey 1992).

Though these cranial changes can be useful for documenting domestication in dogs and pigs, they are not observed to the same extent in goats and sheep, and may reflect the nature of initial contact between humans and different animal species. For examples, omnivores like dogs and pigs may have been drawn to the refuse of human settlements, and morphological changes such as snout shortening and tooth crowding

11 may reflect the proximity (and subsequent human exploitation) of less wary individuals (Morey 1992). One must be cautious when interpreting these cranial changes, since similar alterations in skull shape have been reported in commensal species like rats and sparrows (Hemmer 1990).

Relaxed Competition

Morphological changes associated with direct human control over breeding will usually occur later in the domestication process and can reflect relaxed selection for traits associated with mate competition, e.g. large overall size in males. Another common example is the increased variation of horn size and shape observed in domestic caprids and bovids compared to wild populations (Clutton-Brock 1999). One drawback to this domestication marker is that there not always a clear understanding of the range of variation in horn size and type occurring in wild populations, and of the number of generations needed to produce observable changes (Meadows 1989:89). Although, hard tissues such as horns tend to preserve well in the archaeological record, morphological changes in shape or size may be difficult to recognize in juvenile or fragmentary remains which dominate some archaeological assemblages.

Morphological changes may also occur when animals move into new environments, either through random genetic drift, or through deliberate selection for adaptations to the new territory (Zeder 2006b: 109). Later, deliberate selective breeding for certain physiological traits, such as coat colour, meat or milk quality, or size, may also be reflected morphologically (Zeder et al. 2006b:141).

Plastic Responses

In addition to the morphological traits influenced by underlying genetic and behavioural changes, there are also non-genetic responses that occur as a result of human-animal relationships. These plastic or 'ecophenotypic' responses reflect non­ genetic characteristics acquired within an individual's lifetime as a response to diet, lifestyle or environment, and may be observed as bone or tooth pathologies, diseases, or chemical changes in bones and teeth, and are often good markers of early herd or flock management practices (Zeder 2006b: 11 0).

Pathologies that arise from animal husbandry practices include tethering injuries to the lower legs, or bit-wear on teeth (Reitz and Wing 1999:302). For example, Outram

12 and colleagues' (2009) study of horse remains associates with the Eneolithic Botai culture of Kazakhstan found bit-wear on the mesial surface of the lower second premolars, suggesting that some horses were bridled, and perhaps ridden. Although this pathology is a useful indicator in cultural contexts where metal bits were employed, it is not certain to what extent soft hemp or leather bits would produce this characteristic tooth wear (Olsen 2006:255).

Mature animals used as beasts-of-burden may also display stress-related diseases like arthritis and bone spurs (Reitz and Wing 1999:297-299). Castration was a popular practice for producing powerful draft animals like oxen. In addition to rendering the animals more placid, castration may also produce identifiable morphological changes, usually resulting in males that are fatter than non-castrated males, with longer, more slender limbs and horns (Reitz and Wing 1999:302). These morphological changes, however, appear in oxen only if castration occurs early in the bull's development (i.e. a few weeks after birth) (Armitage and Clutton-Brock 1976).

Other pathologies may reflect the poor living conditions of the confined animal. Overcrowding in unsanitary conditions may produce localized stresses or epidemic sweeps of disease. For examples, the dramatic increase in the frequency of linear enamel hypoplasia in Sus scrofa molars during the Neolithic in Europe, has been attributed to pig domestication: overcrowded conditions, disrupted feeding patterns, and inbreeding may have all led to higher frequencies of these pathological conditions compared to wild boar populations (Dobney ef al. 2004). Penning and crowding may also produce bone fractures, and healed fractures on limb bones may indicate human protection, as animals with serious injuries are subject to higher predation rates, while captive individuals are more likely to survive long enough to heal the fracture (Gilbert ef al. 1996:11).

Provisioning

Isotopic analysis of archaeological faunal remains has also been used to examine the nature of human-animal relationships. This approach is based on the assumption that wild and captive animals will have significantly different diets, since the former forages in the wild, while the latter may be provisioned by humans. Some recent studies have used C13 and N15 isotopes to examine the diet of potential domestic animal populations. A study by Guan ef al. (2007) noted a significant difference in the 5N 15

13 values of domestic pigs and wild boars recovered from an archaeological site in Jilin province, China, suggesting that domestic pigs had enriched nitrogen values through the consumption of human waste and leftovers. Similarly, Rawlings' (2006) investigation of carbon and nitrogen isotope from archaeological turkey bones recovered from Shield Pueblo, Colorado suggested that turkeys were consuming a diet principally composed of maize, with limited ingestion of insects and other protein sources. The results suggests that the turkeys at the site were provisioned, subject to confinement with limited foraging (Rawlings 2006:166-172).

Although these plastic responses may be useful for examining past human­ animal relationships, they should be interpreted with caution, since these characteristics may not appear in all species, and can also be the result of environmental or cultural factors unrelated to domestication (Zeder 2006a). Pathological changes will occur in wild as well as domestic animals, and climatic and environmental factors may affect the diet of wild animals in unpredictable ways. Therefore, this type of non-specific evidence is best used in conjunction with other archaeological or genetic evidence.

Non-morphological Markers

In addition to morphological or osteological domestication markers, a suite of evidence associated with the human management or control of animals may also be used to examine domestication. Moreover, these demographic changes may more precisely demarcate the beginning of the domestication process since they often precede any genetically based morphological change (Zeder 2006a).

Demographic Profiling

Demographic profiling was one of the first non-morphological markers applied in 1950s and 60s, and was based on the assumption that age and sex profiles of hunted animals will differ from those harvested by owners interested in promoting the long-term growth of herds. However, how well do these theoretical assumptions parallel the reality of early hunting or herding strategies? Critics of this model question if there is even a 'natural' population structure common to all wild herds, and whether hunters would kill a representative samples of these populations (Collier and White 1976). There is also the concern of whether human owners would uniformly follow expected patterns for prolonged female survivorship. For example, animal stocks managed for beasts of

14 burden, or wool production would exhibit vastly different demographic profiles than stocks valued for milk or meat (Reitz and Wing 1999:297).

Even if these theoretical assumptions could be relied upon, there are many methodological challenges associated with demographic modelling. In order to assess and develop these demographic profiles, the animal population's age and sex composition must be determined. It has been very difficult to construct separate harvest profiles for young males and females due to the lack of standardization in securing long­ bone fusion rates and dental eruption and wear patterns for age identification, in addition to the difficulty in sexing (often immature) faunal remains (Zeder 2006c). Accidental deaths, diseases and socio-economic vagaries may also affect the slaughter pattern in unexpected ways (Reitz and Wing 1999:297). The "social reasons for killing animals may override economic reasons not to kill then, and disease and injury can leave the herder with no choice at all" (Meadows 1989:83). The presence of mixed economic goals (e.g. meat, milk, security) and the fragmentary nature of many zooarchaeological remains may further confound the profiles.

In order to be effective, demographic profiling arguments require solid modern data on the demography and behaviour of the wild taxa and detailed species-specific harvest profiles under various hunting and herding strategies. These studies also require accurate ageing and sexing criteria and large (preferably regional), carefully collected assemblages of animal bones (Meadows 1989).

Zoogeography and Abundance

Archaeological evidence concerning the distribution and abundance of a presumed domesticate may also be used as evidence for the domestication process. One of the most reliable indicators of domestic animals (or captive animals undergoing selection) is the appearance of the species outside their presumed natural range, as it indicates the human-mediated movement or herding of captive animals (Meadows 1989:84-85). This indicator, however, requires knowledge of a species' pre-historic range (which may have changed considerably over the last 10,000 years, after millennia of human hunting and encroachment). Zoogeographic distributions are most accurate when they are based on distributions of Late Pleistocene and very Early Holocene assemblages that pre-date the domestication event (Zeder 2006a).

15 Zoogeographic patterning is most problematic for species like pig or horse, which have a broad natural distribution, located throughout Europe, the Near East and Asia. In these cases, the analyses require a thorough faunal collection with comparative specimens of both wild and domestic animals from various regions (Meadows 1989:85).

Besides geographic distribution, an increase in the overall abundance of a potential domestic species may also demarcate the initial stages of domestication. However, intensified hunting of the same animal species may also produce a similar zooarchaeological assemblage, so abundance data should be interpreted with caution if it takes place within the species natural habitat (Zeder 2006a:176).

Other Evidence for Human Control

Along with the many morphological and non-morphological markers, several other types of archaeological evidence may also provide indirect evidence for human control or exploitations. Remnants of corrals or animal pens may preserve in the archaeological record, in addition to animal dung or hoof prints, offering evidence for the penning of animals within or near human habitations (Zeder et al. 2006b).

Artifacts (milk churns and bits), art (early drawing, paintings, designs on ceramics and reliefs of domestic animals) (Clutton-Brock 1999), and chemical analysis of organic residues from ancient vessels (Outram et al. 2009), may also provide added detail about animal-human relationships. Historical sources, such as the documentation of plants in inscriptions, tablets, manuscripts, and books, and linguistic comparisons may also provide additional information about domestication events (Zohary and Hopf 2000). However, one must be cautious about applying these criteria, since artifacts and artistic representations may be open to multiple interpretations, especially in the initial phases of domestication, and should only be used as a line of support for other domestication arguments (Meadows 1989:82).

Turkey Domestication in the Pre-contact Southwest

In recent years, there has been a strong focus on documenting domestication in a variety of animal species, and understanding how multiple lines of evidence can be combined to provide an in-depth and species-specific history for each domestic species. Turkey domestication in Mesoamerica and the Southwest United States has received some attention, focusing mainly on the zooarchaeological evidence for the spread and 16 exploitation of the domestic birds (Breitburg 1988; McKusick 1986b; Munro 2006). Although turkey has served as a cultural and nutritional staple in North America from antiquity to the present day, many of these zooarchaeological investigations into turkey domestication are inconclusive, especially regarding the geographic origin(s) of the domestic birds, the number of domestic breeds, and how humans bred and made use of the domestic stocks. The following section will explore the archaeological evidence for the use of domestic turkey stocks within the Southwest United States, with a focus on the Ancestral Puebloans, the culture most closely associated with the domestic turkey.

The Ancestral Puebloans

Along with the Hohokam and the Mogollon, the Ancestral Puebloans are one of the three major archaeological traditions in the Southwest. The term Ancestral Puebloan is used here to denote the ancestors of modern Pueblo people who occupied the Colorado Plateau. The Ancestral Puebloan homeland extends into central New Mexico to the east and southern Nevada on the west, with the southern boundary often demarcated by the Colorado and Little Colorado rivers in Arizona and the Rio Puerco to the Rio Grande in New Mexico (Cordell 1997). The southern range of their territory encompasses portions of the Basin and Range. To the south lie the territories of the Mogollon and Hohokam. The term Mogollon here denotes the people occupying upland southern Arizona and southwestern New Mexico between AD200-1000, after which they are known more frequently as Mogollon Pueblo (Lekson 2009; Reid 1989:21-22). Hohokam refers to the people occupying the Sonoran desert south of the Mogollon Rim from approximately AD300-1400 (Fish 1989; Kantner 2004).

Although the Ancestral Puebloan people as a whole shared many cultural and economic similarities, stylistic differences occurred throughout the region. Archaeologists often distinguish among various subregions within the greater four-corners, based primarily on ceramic technology and styles, and architectural forms; these sub-regions include the Virgin, Kayenta, Tusayan, De Chelly, Northern San Juan and Rio Grande peoples (Cordell 1997).

The Ancestral Puebloans were subsistence horticulturalists and the chief exploiters of turkeys in the Southwest. Though the domestic turkey does not seem to have been used by the Hohokam, archaeological evidence suggests they did hunt wild turkey (Schorger 1966). It is not completely clear whether the Mogollon husbanded

17 domesticated turkey, but since turkey bones are not common in Mogollon sites, it seems clear they did not exploit the turkey to the extent of the Ancestral Puebloans (Reed 1951).

The Ancestral Puebloan culture first becomes recognizable in the Southwest around 100BC, though occupation of the area seems to have begun at the end of the last glacial episode of the Pleistocene, around 11 ,OOOBP, by groups commonly referred to as Paleolndians. These hunter-gatherers were highly mobile, occupying camps for only a short time, and therefore leaving only ephemeral traces in the archaeological record (Cordell 1997). The best known sites are large-game kill or processing sites where diagnostic stone points have been recovered, while camp sites or other activity areas are less common, and more difficult to date. Well known Paleolndian sites dating between 11 ,000-7000BP include the types sites of Clovis and Folsom, New Mexico, along with early occupations of Ventana Cave, and Sulphur Spring in Arizona (Cordell 1997). The Clovis assemblages from processing and kill sites suggest that these Paleolndians were highly mobile hunter-gatherers, who were focused on the hunt of mammoth, and other large game (e.g. bison, horse, camels, cervids, antelopes), though smaller game and plants were also exploited (Cordell 1997). Until around 9000 BP, the climate had been slowly becoming drier and warmer, greatly expanding the grasslands and increasing the habitat for bison. However, after this time, the warming drying climate pushed the grasslands, and bison, northward, and the Paleolndians turned their focus toward elk, deer, and bighorn sheep, as well as a more generalized hunting and gathering way of life.

The adoption of grinding tools in the early Archaic period, ca. 5000 BC suggests a stronger focus on plant foods, though hunting of both large and small game, and a mobile reliance on locally available resources remained the predominant subsistence pattern (Kantner 2004:54-56). Squash and maize were introduced into the Southwest from Mesoamerica during the late Archaic period, (Kantner 2004:57-58). While the earliest archaeological evidence for corn cultivation in Mexico occurs in the Guila Naquitz Cave in Oaxaca valley (6250BP) (Piperno and Flannery 2001) and San Marcos Cave in the Tehuacan Valley (5500BP) (Long et al. 1989), the arrival of corn and squash into the Southwest seems to occurs several millennia later, around 3500BP (Tagg 1996; Wills 1988). Isotopic, botanical, and dietary analyses, coupled with archaeological evidence of irrigation canals, suggest that maize cultivation was adopted in the

18 Southwest between ca. 1500-1000 BC (Damp et al. 2002; Matson and Chisholm 1991), though because of the relative abundance of regional natural resources, it seems that cultivars did not dominate the diet, but rather augmented it (Wills 1995).

An increase in agricultural production marks the end of the Archaic period and beginning of Basketmaker times around 100 BC, and is associated with a dramatic increase in the construction of substantial dwelling and more extensive midden formations (Wills et al. 1994:308). This shift towards more sedentary adaptations and agricultural intensification allowed for the creation of surpluses to maintain human occupation year round in an arid environment with a generally low carrying capacity. During the Basketmaker periods of occupation (100BC-AD750) on the Plateau, the Ancestral Pueblo buffered periods of low precipitation by exploiting diverse environmental landscapes, and exploiting seasonal wild resources in addition to cultivated resources.

As population increased, and the Ancestral Pueblo approached the carry­ capacity of their localities, seasonal or generational mobility became a difficult strategy to maintain. While this mobile and land-extensive strategy continued on the peripheries of the four-corners, during the later Pueblo periods (AD1 000-1300) the majority of the Ancestral Pueblo responded by turning towards larger aggregated communities with complex village organizations and intensified agricultural production (Varien 1999b). Intercommunity exchange also became an important strategy when precipitation varied between regions, and when the options for community or household migration decreased. The later Pueblo periods also demonstrate a decreasing trend in large game hunting, and an increased reliance on small game hunting and garden trapping (Muir and Driver 2002b).

In the late 13th century, when a combination of drought, disease, and conflict made it difficult to sustain these large aggregated communities in the Mesa Verde, the Ancestral Pueblo migrated into the Rio Grande and neighbouring areas. The presence of large village sites, focused on agricultural rather than wild resources, continues until the arrival of the Spanish in the 16th century.

The Turkey (Me/eagris gallopavo)

The turkey was present in the New World in some form or another long before the Ancestral Puebloans, and they had a no less rich and interesting history in the 19 Southwest. Turkeys are part of the order Galliformes, which includes chickens, guineas, peafowls and other terrestrial birds. Within the family Meleagrididae, there is only one living genus - Meleagris - which contains the two living species of turkey: Meleagris gal/apava, the North American turkey, and M. acel/afa, the ocellated turkey of the Yucatan (previously known as Agriacharis acel/afa). The two birds of this genus are characterized by their relatively large-size, naked, carunculated heads, and broad and square-ended body feathers (Aldrich 1967b: 17)

The turkey is descended from a pheasant-like ancestor which entered and evolved in the New World during the Pliocene or late Tertiary period (Aldrich 1967a; Steadman 1980:4). By the Pleistocene, several distinct paleospecies of turkeys are present in North America, including M. anfiqua, M. alfa, M. fridens, M. progenes, M. crassipes, M. califarnica, and M. gal/apava. While the first four of the aforementioned fossil species are known by only a few rare elements (Schorger 1966:62-64) (and are not confident species designations), the later three are far more prevalent and seem to share a common ancestor (Steadman 1980). The modern turkey's closely related cousin, the ocellated turkey (M. acel/afa) seems to have evolved in the early Holocene, when an ancestral population of Meleagrids became segregated in the Yucatan (Steadman 1980:154).

While M. califarnica was isolated in California, M. gal/apava was present throughout the eastern United States and Mexico prior to human arrival in the late Pleistocene (Steadman 1980). Although turkey populations reached the Arizona/New Mexico and Mexico border, (apparently) no M. gal/apava remains are found in pre­ Holocene deposits in the Southwest proper (Rea 1980).

Instead, the Pleistocene Southwest was occupied by M. crassipes. This species was widespread, ranging from Nuevo Leon, Mexico to the Grand Canyon, Al, with the earliest radiocarbon dates around 25,000BP and persisting until around 3300-6600BP when it appears to go extinct (Rea 1980). According to Rea (1980:211), this small turkey with long legs and slight sexual dimorphism, bears little similarity to contemporary Meleagrididae, such as M. gal/apava and M. acel/afa, and seems to represent a now extinct side branch in turkey evolution. M. crassipes does not occur in the same deposits as M. gal/apava, which in the late Pleistocene and early Holocene seem to be restricted to Southern New Mexico, Northern Sonora and the south-central and Gulf portions of Texas. Further north, M. gal/apava seems to appear only into contexts associated with

20 semi-sedentary horticulturalists (Rea 1980:211-215), suggesting that the niche left by M. crassipes was not immediately filled by M. gallopavo populations.

Wild Turkey Subspecies

Today, the Southwest is occupied by the Merriam's wild turkey subspecies (Me/eagris gallopavo merriam/). Found within the montane-woodland area of the western US, their range extends from east-central Arizona along the Mogollon Rim to central Arizona and north to the Grand Canyon, generally paralleling the ponderosa pine (Pinus ponderosa) belt of Arizona (Scott and Boeker 1977). Merriam's is one of five wild turkey sub-species presently living in North America: M. g. si/vestris (the Eastern wild turkey) inhabits roughly the eastern half of the US, chiefly within the eastern deciduous forest and oak-savannah habitats, extending north to Ontario, south to the Gulf coast, and west to east-central Oklahoma and Missouri (Aldrich 1967b:30-31). M. g. osceola (the Florida wild turkey) resides in the southern half of Florida, in the southeastern evergreen and tropical areas of peninsular Florida (Aldrich 1967b:35). M. g. intermedia (Rio Grande wild turkey) ranges over the south central plains and north-eastern Mexico with permanent residence along the stream-bordering woods and scrub of the southern Great Plains. Their range extends southward to southern Texas and the Gulf coast of Tamaulipas. M. g. mexicana (Gould's wild turkey) occupies the pine and pine-oak forests of southern Arizona and New Mexico, north-western Mexico ("ranging from the Rio Grande through eastern Coahuila down the Sierra Madre Oriental and the Gulf Coastal Plain to Guanajuato" (Schorger 1966:48) (Figure 1) .A sixth subspecies, M. g. gallopavo (South Mexican wild turkey), which occupied southern Mexico, observed only sporadically before the 1970's, is now rumoured to be extinct (Dickson 1992; Eaton 1992). M. g. gallopavo original range likely included the areas between Puerto Vallarta and Acapulco on the Pacific coast, and east to Tuxpan and Veracruz on the Gulf of Mexico (Mallia 1998).

21 _ M. g. silvestris (Eastern) Mg. osceola (Florida) _ M g. intermedia (Rio Grande) _ Mg. merriami(Merriam's) _ M g. mexicana (Gould's) _ M g. galloavo (S. Mexican)

Figure 1 Original range of the wild turkey subspecies in North America (based on Schorger 1966)

Of the five extant subspecies, Gould's is the largest, and Florida the smallest, with Merriam's, Eastern and Rio Grande subspecies falling intermediately between the two (Stangel ef al. 1992). The wild subspecies can be generally recognized based on plumage and body proportions (Dickson 1992). The Eastern variety has metallic copper­ coloured body feathers, with dark brown tipped tail feathers, differentiating it from the iridescent green and red tint of the Florida species. Gould's distinctive blue-green colouration and white tipped tail feathers, as well as its longer legs, larger feet and larger centre tail feathers set it apart from its neighbours. Rio Grande turkeys are a pale copper with yellow tipped tail and rump feathers, and disproportionately long legs, while Merriam's turkey is characterized by its white rump and darker body displaying blue, purple and bronze reflections. The phenotype variation between (or even within) subspecies is likely a result of adaptations to local environmental conditions. For example, the subspecies occupying higher latitudes tend to be larger than those in warmer climates (following Bergman's rule), and Eastern wild turkeys living in moist

22 deciduous forest are more darkly plumed than those living in the drier areas of the Midwest (Gloger's rule) (Aldrich 1967b:44; Eaton 1992; Pelham and Dickson 1992)

It is still not certain which of these five (or six) subspecies first entered into a relationship with the Ancestral Puebloans. Many texts have avidly perpetuated the notion the domestic turkey was descended from the South Mexican turkey, M. g. gallopavo, the domestic turkey of Mesoamerica (Kennamer et al. 1992; Leopold 1944). Others have claimed a separate domestication in either the eastern coastal Mexico/Oklahoma region (involving the Eastern wild turkey, M. g. silvestris) (McKusick 2001) or within the Southwest proper (involving the local Merriam's wild turkey, M. g. merriam; (Amsden 1949; Breitburg 1988). Still others have mistakenly listed the closely related Mexican ocellated turkey as the presumed wild ancestor (Shriver 1987).

Whatever the subspecies, the earliest evidence of turkey in the Southwest appears Puebloans appears ca. 100 BC to AD 500 based on the recovery of whole desiccated turkey, some turkey bones, and turkey feathers from Tularosa Cave, NM, Grand Gulch UT, Durango CO, and Canyon del Muerto, AZ (McKusick 1986b). It is not known whether these remains constitute fully domesticated turkeys, or merely captured animals (Schorger 1966), but it is certain that the turkey was taking its place in the lives of the Ancestral Puebloans.

Models for Turkey Domestication

Unlike many other animals living in the New World, turkeys have many attributes that make them well suited for domestication. Turkeys live in large hierarchical flocks; they have a strong parent-young bonding; they are prolific breeders and they are omnivorous and adaptable to a range of environments (Breitburg 1993; Eaton 1992). Most importantly, they have low reactivity levels to humans, they can reproduce in captivity outside of their normal geographic range, and they have the capacity to imprint at young age. These last three qualities are imperative for a successful, perpetual relationship with humans (Sossinka 1982).

However, turkey are also irascible, pugnacious, arrogant, stupid, belligerent, cantankerous bullies, noisy, and defiant - all popular terms used to describe the personality of the turkey. They are also unsanitary, and when kept for long periods in a village, their droppings can spread diseases like Salmonella and Shigella (Walker

23 1985:153). When considering these latter issues one becomes curious about the initial motivations for turkey domestication in the Southwest.

Two hypotheses have been put forward for the advent of turkey domestication in the Southwest: the 'introduction' model and the local domestication model. McKusick (1980, 1986b) has advocated that Southwest turkeys were first domesticated in eastern coastal Mexico and introduced into the Southwest by the Upper Sonoran Agricultural Complex, along with other plant cultigens such as corn and beans. Based on examinations of mummified birds recovered from early archaeological sites, she suggests that the first bird introduced and exploited by the Ancestral Puebloans was a gracile, hump-backed, darkly plumed species, the Tularosa turkey, which McKusick also terms the Small Indian Domesticate (SID). McKusick proposes that the desire for feathers, either for spiritual or economic reasons would have driven the adoption of the domestic turkey. In her view, trade in turkey products would have begun first with feathers, followed by trade of live birds. The turkey predates the trade of other birds and feathers from Mexico, namely young tropical macaws and parrots, which seems to have begun around AD1000, reaching impressive levels at the Chihuahuan site of Casas Grande after AD1200 (Creel and McKusick 1994; Hargrave 1970b:53). The introduction of the SID corresponds to the first evidence for feather robes and blankets, and strong evidence of turkey product utilization in the SW is only found after the "establishment of a firm agricultural base capable of providing a surplus of food adequate to support domestic fowl" (McKusick 1983:171). McKusick's introduction hypothesis is supported by the fact that the earliest evidence for turkey use in the Southwest corresponds with evidence for domestication. There is little or no archaeological evidence for the exploitation of wild birds prior to presence of SIDs, suggesting that domesticated stocks, or at least controlled/tamed animals were introduced into the region (Munro 2006).

McKusick also defines a second larger domesticate breed, the Large Indian domesticate (LID) which she suggests is of Eastern origin. The LID appears in Ancestral Puebloan sites during Basketmaker III times, (as early as AD500 at Mesa Verde, CO and Tse-ta'a in Canyon de Chelley) and in some areas quickly replaced the SID. McKusick suggests this replacement may represent a population replacement of the late Basketmaker cultures with early Pueblo peoples from outside of the four-corners region. McKusick also advocates that feral populations of this larger turkey breed is the

24 predecessor of the Merriam's Wild Turkey, a premise first proposed by Hargrave (1970a:25).

More recently, an alternative hypothesis has been offered: one of local Southwest domestication by the Ancestral Puebloan-Mogollon groups with a later introduction into Mesoamerica. Breitburg (1988, 1993) proposes that the original impetus for domestication would have been a drive to possess live birds for spiritual reasons. Ethnographically, turkey has been considered a symbolic representation of rain, earth and fertility (Tyler 1991:81). The spiritual importance and socio-religious value surrounding the capture of live birds would have provided the original impetus for domestication. He points out that not only do the earliest Mexican turkey remains date from around the same time periods as in the Southwest, the archaeological evidence for domestication at Tularosa Cave, NM (including pens and eggshell) is much more convincing than any other domestication evidence from Mexico. In Breitburg's model, the original source of domestic birds would have been from wild turkeys around the four­ corners region, following the original proposal by both Amsden (1949) and Schorger (1966). He conducted an in-depth statistical analysis of the measurements of turkeys remains in the Southwest using principal component analysis, multivariate discriminant analysis and univariate tests. The results of his study indicated that the Southwest domestic turkeys are dissimilar to wild and prehistoric Mexican turkey remains, indicating that Mesoamerican breeds were not the progenitors of the Southwest domestic turkey. His osteometric study was not able to distinguish McKusick's domestic breeds, and his results indicated very little size and shape difference between the archaeological Southwest turkey populations and modern populations of Merriam's wild turkey.

Evidence of Turkey Use through Time

Whatever the original motivation or subspecies progenitor for the first exploited turkeys, it was not long before they had gained an important place in the Ancestral Puebloan culture. Their presence in the archaeological record begins around 100 BC and continues to gain in importance throughout the duration of Ancestral Puebloan occupation of the Southwest. As the Ancestral Puebloan population expands in the region, so too does the prevalence of the turkey.

25 Basketmaker" (100 BC-AD500) The Ancestral Puebloan culture first becomes recognizable in the four-corners region of the Southwest during the Basketmaker II phase. Ancestral Puebloan subsistence during this period was characterized by limited hunting and gathering along with horticulture of maize and squash, with the introduction of the bean around AD400. Isotopic analysis of human remains in southeast Utah indicate that at least some regions were highly dependent on maize (Chisholm and Matson 1994; Matson and Chisholm 1991). The shift from nomadic hunting and gathering to limited agriculture may have been spurred on by increased aridity, decreased ground water levels and decreased moisture during the Archaic period, leading to a decline in available wild plant resources (Cordell and Gumerman 1989; Plog 1997). The Ancestral Puebloans' semi-sedentary, bi-seasonal mobility is supported by some permanent villages composed of semi­ subterranean pithouse clusters, as well as open-air temporary camps and rock shelter sites (Gumerman and Dean 1989; Rohn 1989). Large game hunting (using the atlatl) was still a major focus of subsistence. Woven nets, bags and baskets were used as containers; ceramic were not used during this time.

Signs of turkey use also appear in Basketmaker II contexts, in the form of feather blankets (from Grand Gulch, UT, Durango CO, and Canyon del Muerto, AZ (Morris 1939), the bones of four small turkeys from Tularosa Cave, NM (Martin et aJ. 1952), and one desiccated bird, also from Canyon del Muerto. Some feather trimmings were recovered from a human burial in Woodchuck Cave, in the Tsegi area and 77 adult turkey feathers were uncovered in Sand Dune Cave, UT (Hargrave 1970a:16-17). Hargrave notes that the lack of associated turkey bone at the latter two sites suggests the feathers may have been traded into the site. Alternatively, the feathers may also belong to local wild birds (Munro 2006). Reliable proof of domestication, in the form of turkey droppings, loose feathers, shell fragments, and turkey pens, is not observed during the Basketmaker II phase (Hargrave 1970a:16). At Turkey Pen Ruins, however, the recovery of turkey coprolites within Basketmaker II contexts, suggests that individual turkeys may have been held captive at the site, while copious amounts of corn pollen in at least two of the turkey coprolites implies that turkeys may have been provisioned with maize (Aasen 1984). Similarly, the complete mummified turkey recovered from Tularosa Cave had legumes in the dung clinging to the body, and complete corn kernels in the crop (Schorger 1961). This coprolite and dietary evidence suggests that the Ancestral Puebloans may have captured and provisioned small populations of turkeys, and/or that 26 previously domesticated (or at least controlled) turkeys were introduced into the Southwest during Basketmaker II times (Munro 2006).

Basketmaker III (AD500-750) Basketmaker III witnessed an increased emphasis on agriculture, with continued reliance on large-game hunting, though now with the bow and arrow (Gumerman and Dean 1989). Pithouses remain the most common permanent dwellings type, and the presence of ceramic vessels, stone mauls, trough metates, and storage pits associated with the pithouses indicates that the Ancestral Puebloan lifestyle became more sedentary (Cordell 1984). Small hamlets ranging from 1-12 dwellings are the most popular site type, though some larger villages are also present. During this period there is also some evidence of sizeable, non-residential pithouses, with large central firepits, which were likely used as public gathering places or ceremonial buildings (Kantner 2004:63); these central pithouses may represent a prototype of ceremonial kivas (Rohn 1989). Archaeological evidence for fences surrounding some larger pithouse structures begins during the late Basketmaker III phase, paired with limited evidence for the differential distribution of exotic items, may represent the beginnings of status differentiation within or among Ancestral Puebloan groups (Damp and Kotyk 2000).

Basketmaker III sites yielded a higher prevalence of turkey remains compared to the previous period, though turkey use is still rather limited compared to later periods. There is more evidence of turkey domestication in the form of turkey pens, eggshells, and desiccated turkeys (McKusick 1986b), and a wider geographic distribution (i.e. present in Arizona, New Mexico, Utah and Colorado). Apparently, turkey remains and evidence of pens seems to be most prevalent in areas with no wild turkey populations (Hargrave 1939). Turkeys first begin to appear in Canyon de Chelly sites during this period, though the lack of turkey remains in refuse areas suggests that turkeys were not being eaten (Breitburg 1993; McKusick 1986b). Rather turkeys seem to be used primarily for their feathers, or ritually interred as complete animals. Sites such as Knobby Knee, Twin Tree and Badger House in Colorado, all have evidence for turkey burials beneath pithouse floors (Munro 2006). Antelope House, in particular, begins to take its place as an important location for turkey husbandry and feather production (McKusick 1986a:142). Turkey bones and feathers, including 'pied' feathers (a white-splotched colour mutation) first appear at Antelope House during Basketmaker III periods, and increase in frequency through time at this site. Beginning during this time period, turkey

27 feathers become important for the manufacture of feather wrapped cordage, woven into robes or blankets (McKusick 1986b; Schorger 1966). fragments of such feather-wrapped cords are found in several Basketmaker III contexts at Grand Gulch sites, as well as at the Twin Tree site and Badger House (McKusick 1986b; Munro 2006).

Pueblo I (AD750-900) Pueblo I marks the beginning of a new architectural style among the Ancestral Puebloans. There is a shift out of pithouses and into 'pueblos' or flat-roofed, above­ ground dwellings, made from jacal (wattle-and-daub) and later, during the 10th century, from sandstone masonry (Kidder 1927), though the western Ancestral Puebloans on the Colorado plateau retain slab-lined pithouses (Gumerman and Dean 1989). The dwellings are often associated with kivas, specially constructed circular or key-shaped ceremonial chambers, storage units, and midden - all together forming an extended family residence termed a 'Unit Pueblo' (Cordell 1997:281; Prudden 1903). The shift to above­ ground clustered pueblos may be related both to the need for surplus maize storage areas, as well the development of strong matrilineal kin-structures in the face of unpredictable precipitation and declining agricultural conditions (Kantner 2004:69-72).

As during Basketmaker times, agriculture is still the main subsistence focus and a new cultigen, cotton, is introduced (Cordell 1997). A new variety of early flowering maize Maiz de Ocho, also becomes more widespread during this time. In addition to larger kernels that were easier to grind, this variety allowed the Ancestral Puebloans to cultivate crops at higher (and therefore moister) altitudes (Kantner 2004:67).

There is strong evidence for steady population increase during this period, as well as an expansion of village settlements (Wills et al. 1994). Although this move to more permanent above-ground architecture with significant storage areas seems to reinforce a strong reliance on agriculture and a more sedentary Iifeway, most of the habitation sites were occupied for around one to two generations (perhaps 30 years or so) (Wills et al. 1994). The short occupation spans and the frequent abandonment of residences can be attributed to the continued strategy of movement as a response to environmental changes and local resources depression. As local resources such as wild animals, or wood for fuel and construction, were slowly depleted, settlements would shift to occupy new, more bountiful areas. Reciprocal exchange of resources within or between communities may also have continued as an important tactic for buffering minor climatic variations between neighbouring regions, as greater local and regional 28 exchange is seen through the trade of marine shells and artifacts, exotic lithic material, and trade in pottery (San Juan redware).

This period also marks the first strong evidence for the use of domestic turkey stocks, and is likely related to the ability to store larger quantities of surplus maize (Breitburg 1993). There is evidence for turkey production in the form of feathers, textiles (robes and blankets), and tools (awls, etc.) and turkey exploitation increases from 1% to 20% in some areas (Breitburg 1993:157). Turkey droppings at Mancos Canyon (Munro 1994:96), turkey eggshells at Black Mesa, and Antelope House, AZ (McKusick 1986b:7), denotes turkey husbandry at the sites. Ritual interment of birds is still practiced: an adult male turkey, wrapped, was placed over a hearth at Barker Arroyo, NM (Hill 2000), and complete turkey carcasses are buried within several San Juan region sites (Muir and Driver 2002b:174). Grand Gulch, UT displayed a formal burial of a probable pet turkey (whose femur had been broken and subsequently healed), as well as turkey petroglyphs (Schorger 1966). Inter-site turkey trade is supported by strong osteological affinities between the birds throughout the Southwest (Breitburg 1988).

Pueblo II (AD900-1150) The two most significant changes in Pueblo II are the emergence of larger and relatively sedentary communities in various parts of the Southwest, including Chaco Canyon, the Mesa Verde and the Mimbres valley, as well as intensified cultivation techniques and water control technologies (Wills et al. 1994). These two changes mark the beginning of a growing tendency towards agricultural strategies that focus on the intensive local land-use, rather than the mobile extensive land-use strategies seen in previous periods. These new strategies are likely related to variation in climate and precipitation and the continuing growth in population, and result in changes in architectural styles, settlement size and location, subsistence strategies and community organization and exchange networks.

Pueblo II is characterized by an expansion of small Ancestral Puebloan villages all over the landscape. The stable environment, with relatively good rainfall, along with water management practices may have spurred on this population growth (Cordell and Gumerman 1989). Not only are there more sites (especially in the western region) but more habitation rooms per site, sometimes in two-story dwellings. In addition to an increase in the number of kivas, large kivas and tower kivas, specialized subterranean milling rooms also start to become popular, especially in the San Juan and Mesa Verde

29 regions (Rohn 1989). The spread of villages may have placed pressure on the large wild game, as there is a shift in emphasis from deer and antelope to small game like rabbit, gophers and birds (Gumerman and Dean 1989; Plog 1997).

The development of the Chaco Canyon phenomenon in San Juan Basin also occurs during this period. Great Houses, such as Pueblo Bonito, were constructed several stories high from sandstone masonry, with sometimes more than 100 units. The large planned towns, likely built by organized labour, were linked to each other and associated villages by an extensive road system. There is still a strong pattern of intercommunity interaction seen throughout the entire Ancestral Puebloan area through the trade of lithic materials and ceramics, though more localized traditions of architecture and decorated ceramic patterns begin to be displayed.

During Pueblo II the domestic turkey spread throughout the four-corners region, possibly spurred on by favourable environmental conditions which increased the carrying capacity of the region (Breitburg 1993). The density of bird populations increases and there is more evidence of ritual interment, feathered textiles, turkey pens, turkey dung accumulations, eggshell fragments and modified bones (Breitburg 1993:157-158). Gizzard stones, the stone chips that turkeys ingest to aid in the crushing of seeds and other hard foods, also begin to appear in Pueblo II sites. Over time, these stones become smoothed by mechanical friction and the acidic environment of the gizzard, and are eventually expelled (Schorger 1966:95-96). The recovery of smoothed chert and chalcedony debitage produced during stone tool manufacture (by humans) provide excellent support for the presence of turkeys within human sites (Munro 2006). There is also more evidence that the turkey is being used for food as well as for artifact manufacture. In the San Juan region, turkeys are routinely found in domestic middens, suggesting they were butchered and consumed (Muir and Driver 2002b:174). Turkey bone awls, unworked bone, eggshell, as well as interments of headless female turkey are all first observed at Chaco Canyon during this period (McKusick 1986b:8). Excavation at Pueblo Bonito recovered egg shells, turkey bone awls, beads, feather robes and blankets, in addition to unworked bone in refuse midden deposits (Badenhorst 2008: 134, 143; Judd 1954:66,71,73,107,141-2). Tseh So, also in Chaco Canyon, contained decapitated female turkey interments in kivas (Brand et al. 1937; Hill 2000: 101, 106). Further evidence of ritual turkey use is seen in turkey carcass interments in two Colorado sites (Mancos Canyon, Mug House) and one site in New

30 Mexico (Barker Arroyo), all associated with pit structures or kivas (Hill 2000). Additionally, Pueblo II deposits at Tularosa Cave, Chaco Canyon and Canyon de Chelly all had multitudes of desiccated turkeys and turkey shanks buried in caves and crevices (McKusick 1986b:11). Bradley Beacham and Durand's (2007) embryo development study of eggshells from Salmon Ruin, suggest that while fewer turkey eggs were being hatched before AD11 00, there is solid evidence for hatched eggshells and purposeful turkey breeding towards the end of the Pueblo II occupation.

Pueblo III (AD1150-1300) Pueblo III represents the peak of Ancestral Puebloan occupation in the area, culminating in the rapid depopulation of the four-corners region around AD1300. The period is characterized by population aggregation from small, highly dispersed settlements into large aggregated villages located in canyons, near canyon heads, or in clusters of cliff dwellings (in the case of Mesa Verde proper) (Lipe 1995). This period was characterized by less predictable rainfall patterns than previously, and by AD1200 in the Mesa Verde region, settlements had moved away from arable land on the mesa tops, and instead conglomerated into large villages of more than 500 structures. Varien (1999b) suggests that this move to large aggregated communities reflects a change in land tenure systems, from one of usufruct in the previous periods, to one of heritable property rights.

There is a decreasing trend in large game hunting, and instead an increased reliance on small game hunting and garden trapping (Muir and Driver 2002b). Towards the end of the 13th century, the four-corners was almost completely depopulated, representing a move of around 10,000 people out of the region within a quarter of a century, likely moving into the neighbouring Upper Rio Grande, Hopi Mesa, Acoma and Zuni areas (Varien 1999b). The eventual depopulation of the area is likely related to the marked decline in hydrological conditions (Cordell and Gumerman 1989) and the major drought in 1275-1300 (Cordell and Gumerman 1989), though the issues of high population density and intersite hostilities cannot be ignored.

In the four-corners region, turkey husbandry reaches its maximum level in the Pueblo III period (Breitburg 1993). Evidence for turkey enclosures, usually recognized by deep deposits of turkey dung as seen at Chaplin Mesa (Hargrave 1965a) and Mug House (Rohn 1971 :60) and accumulations of gizzard stones, (Munro 1994; Rohn 1971) are also more common. Turkey dung was recovered throughout sites, suggesting that

31 turkeys were foraging around the village as well as being enclosed in pens. Turkeys were an integral part of life at many sites, and both domestic and wild turkeys were exploited (indicated by butchered bones of both types) (McKusick 1986b). By this period, Antelope House, in Canyon de Chelly, reaches its peak as a centre for turkey feather production. Over 11,000 loose feathers, as well as feather cordage (feathers twinned into a vegetal core, often used to make robes or blankets), feather artifacts, and eggshell (concentrated mainly within Pueblo III contexts) testify to the importance of turkey products as raw materials (McKusick 1986a:147). The turkey feathers at the site include three colour aberrations due to partial albinism: the pied mutation, which first appeared within the Basketmaker III period, as well as the erythristic (red phase) and silver (black-tipped white phase) mutations. These mutations are also found in Pueblo III contexts at Step House, Long House and Mug House, Keet Seel, Inscription House, and Gila Cliff Dwellings (McKusick 1986a).

The importance of turkeys as a protein source is obvious; disarticulated bones, often displaying charring and butchery marks, are scattered throughout refuse deposits at several sites, including Mug House (Rohn 1971:104) and Pueblo de Arroyo (Judd 1959:62, 126) as well as in many Northern San Juan sites. The Pueblo III midden deposits at Sand Canyon Pueblo (Muir 1999), Shield's pueblo (Rawlings 2006) and Albert Porter (Badenhorst 2008) are dominated by turkey remains. This pattern is seen throughout the four corners region. Lagomorphs and turkeys appear to be the most important food resource during this period, with a corresponding decrease in the relative frequency of artiodactyls (Badenhorst 2008; Driver 2002; Muir and Driver 2002b). Driver (2002) proposes that these regional trends indicate that by Pueblo III, the growing human population was focusing on domestic turkey for meat, since settlement expansion, habitat disruption and over-hunting may have reduced the local availability of artiodactyls. Hunting may have been largely confined to circumscribed areas, explaining the variability in the proportion of local taxa like jackrabbit and cottontails.

The abundant turkey remains in Pueblo III sites indicated that turkeys were raised in large flocks. Badenhorst (2008:81-82) estimates that between 60-600 turkeys may have been raised and consumed each year at Albert Porter. Considering the amount surplus of maize required to provision and feed large turkey flocks (estimated at 5049-56483 kg per year), Badenhorst (2008:83) suggests that turkeys may have also been fed leftovers, old or spoiled maize, or may have consumed other maize products,

32 such as human fecal matter containing undigested maize (Driver in Badenhorst 2008:83).

In addition to being an important food source, turkey bone (usually the ulna, radius, tibiotarsus or tarsometatarsus) was also an important raw material source. Turkey bones were used to fashion items such as awls, tubular bead, needles, reamers, spatulas, scrapers, whistles, hairpins and bone tubes in the La Plata district (Morris 1939:120-122), Mug House (Rohn 1971:106, 229), Chaco Canyon (Judd 1959; Schorger 1966:37), Grasshopper Pueblo (Olsen 1979), Wetherhill Mesa (Hargrave 1965b) and Chaplin Mesa (Hargrave 1965a).

In addition to the turkey's secular role, there is still some evidence of ritual interment: for example, a young defleshed turkey skeleton was found buried in a kiva at Mug House (Rohn 1971 :79), and up to five possible turkey burials may be present at Shield's Pueblo (Rawlings 2006:125). However, some sites show a decrease in the amount of ritual activity associated with turkey. In the San Juan region, ceremonial structures contained the remains of several wild birds with ethnographic spiritual connotations among the Pueblo, but contained lower than average amounts of turkey bone compared to other areas of the site (Muir and Driver 2002a, b), perhaps suggesting a decline in the spiritual importance of the bird.

Pueblo IV (AD1300-1625) The Pueblo IV period was one of almost continual change, with new developments in terms of religion and ritual, settlement areas and layouts, and community organization. Following the migration at the end of the 13th century, the majority of the populations shifted in a southwesterly direction, from the Colorado Plateau towards the Basin and Range area, with large settlements building up in the area just east of the Rio Grande, at Pecos and Las Humanas. This period is characterized by a general decrease in population size throughout the Southwest, with greater clustering into large communities (Lekson 2009). Most of the region's population lived in large sites, usually either inward facing towns, with large central plazas, or towns with a honeycomb or massed room layout (LeBlanc 1999). Except for within the Hopi area, most sites had far fewer kivas relative to living spaces, and some sites have no kivas or exhibit rectangular kivas incorporated into roomblocks (Cordell 1994). Many archaeologists have interpreted the creation of these large highly integrated settlements with enclosed plazas as a reflection of changing community organization within the 33 period (Adams 1991; Bernardini 1998; Potter 2000). While prior to AD1275, roofed and unroofed great kivas were the focus of most communal ritual activity, during the Pueblo IV period, the central plazas became the centres of community life.

Although turkey stocks drastically declined in the four-corners proper, due to the migration of their human caretakers, turkey husbandry shifts to the pueblos of the northern Rio Grande and the Santa Fe river valleys, with turkeys used for food, feathers and ritual purposes. At the site of Arroyo Hondo near Santa Fe, NM, over three thousand turkey or large bird (likely turkey) bones were recovered, in addition to eggshells, unhatched poults, turkey pens and dung, all demonstrating the importance of turkey at the site. Despite the prevalence of unworked bone, bone tools and turkey feather blankets, there was no indication that turkeys were used for ceremonial purposes (Lang and Noble 1978). In other Pueblo IV sites, such as those in the EI Morro valley, turkey remains are found in great abundance within central plaza deposits, suggesting that turkeys may have been the meat of choice at community feasting event (Potter 2000).

Conversely, at Homol'ovi III, along the Middle Colorado River, only 11 individual M. gallopavo bone elements were scattered throughout the site, in addition to three articulated adult turkeys, 14 poults and seven unbroken eggs suggesting a very small flock, not suitable for a dependable meat or raw material source (Senior and Pierce 1989). Additionally, the seemingly intentional burial of two male turkeys may reflect the ritual importance of the birds. Turkeys were also recovered from Pueblo IV contexts at Pindi Pueblo (in addition to turkey pens, dung and eggshells), Pueblo Encierro, Alfred Herrara, as well as the Largo, Las Madres and San Marcos Pueblos of the Galisto Basin, although it is not clear whether the birds were used primarily for food or feathers (Breitburg 1988:28; Lang and Harris 1984). The role and importance of turkeys seems have varied widely between Pueblo IV sites, based on a variety of factors, including foraging potentials, quantities of surplus corn, the importance of feather robes, and the availability of meat resources other than turkey (Lang and Harris 1984:100) .

While the Large Indian Domesticate (LID) seems to be most prominent within northern New Mexico (Lang and Harris 1984:99), further south at the Tompiro Pueblos, breeding of the Small Indian Domesticate (SID) reaches its peak in the Pueblo IV period. Gizzard stones, eggshells, and over 900 SID turkey remains were recovered from Mound 7 at Gran Quivira, and SID remains were recovered at the nearby Pardo and Tabira pueblos as well (McKusick 1981). As two-thirds of the turkey population is adult

34 (over two years old), with little evidence of burning or butchery, McKusick surmises that the Gran Quivira population was bred predominantly for feathers (McKusick 1981 :52).

It is also during Pueblo IV that particularly large turkey individuals are recovered from archaeological sites in the Point of Pines region of central Arizona, within the Mogollon Pueblo culture area. Many turkeys from both the Point of Pines Pueblo and Grasshopper Pueblo are significantly larger than typical LID specimens, and larger still than modern M. g. merriami comparative material (Olsen 1990:47). It has been hypothesized that these large turkey may represent a second domestication of Merriam's wild turkey individuals, or the introduction of wild turkey genes into LID populations in that region (McKusick 1974:276).

The Ancestral Puebloan world opened greatly between 1300 and 1600 with the emergence and arrival of several new groups, including the trading centre of Casas Grande, the arrival of the Athapascans, and finally, the arrival of the Spanish. All of these changes greatly affected the overall population size, the social organization and interactions of the Pueblo peoples (Lekson 2009). These social changes in turn influenced the importance of turkey husbandry, eventually resulting in dramatic decline of indigenous turkey husbandry.

Between the years of AD1250 to 1500, the city of Casas Grande (also known as Paquime), in Chihuahua, Mexico, was one of the largest settlements in the Southwest (Lekson 1999). Massive multi-story habitation rooms formed the core of the city, while public and ceremonial areas were found outside the core, and included T-shaped ballcourts (one small one containing subfloor burials), platform and effigy mounds, as well as reservoirs, wells and slab covered drains. As Mesoamerican trade items, such as copper bells, turquoise, macaws and parrots, and shells were traded through Casas Grande to other southwest sites, the site has often been described as a mercantile centre (Lekson 1999). Eggshells, feather, bird skeletons, and pens, are also prevalent, intimating that Casas Grande also acted as a breeding centre for turkeys as well as macaws (Bradley 1992b; Minnis 1988). Although the majority of the turkeys were of the LID variety, some SID individuals and some very large individuals (similar to those found at Point of Pines area of central Arizona), were also present (McKusick 1974:275). The turkeys at the site were likely used for trade, as well as for rituals and sacrifice; many turkeys, both males and females, were apparently decapitated prior to interment either with humans, under room floors, or under plaza floors (McKusick 1974:273).

35 In addition to Mesoamerican influences, the arrival of Athabaskan speaking Apache and Navajo groups around AD1500 also affected relations throughout the Southwest. The Apache and Navajo began occupying the land between and around Pueblo villages (first as hunter-gatherers, and in the case of the Navajo, later as agriculturalists and pastoralists), altering the traditional pattern of interaction among the Pueblos (Cordell 1997). The lifestyle of the Pueblos continued to change with the arrival of the Spanish, beginning in 1539 with the visit of Fransisco Vasquez de Coronado, a Spanish explorer and military commander, to the Zuni, Acoma, Hopi, and Rio Grande Pueblos. Spanish missionaries and explorers recount the presence of large turkey stocks at many of the New Mexico Pueblos, including the Zuni pueblos, Queres pueblos, Pecos Pueblos, and the Tano Pueblos of the Galisto Valley (see Schorger 1966:36-40)

As Spanish colonists trickled into the region, they pushed the Pueblo peoples out of arable land on the river valleys and into the plains and mountains. As the Rio Grande region contained very little in terms of material wealth, the main impact of colonialism was affected through the Catholic Church's desire to convert Pueblo souls, and through the Spanish requirement for labour (repartimiento) and tribute (encomienda) (Cordell 1997). Epidemic diseases also had devastating effects, and may have decimated up to 75% of the Pueblo populations within the first 100 years of contact (Upham 1982:39). The Pueblo people responded by abandoning their small villages and forming larger defensible settlements. In 1680, spurred on by the oppression of their religion and attempts to convert them to Christianity, the Pueblo people pushed the Spanish out of the area for the next 12 years (Cordell 1994). Although the relations between Navajo and Pueblos grew closer around the time of the revolt, relations between the Spanish, Pueblos, Apache and Navajo remained uneasy and occasionally violent until the seizure of New Mexico by the United States between 1846-1848, and until settlements were reached with the Navajo in 1863, and with the Apache in the 1880s (Amsden 1949).

These intense changes in the lifestyle of the Ancestral Puebloans had drastic effects on the success of indigenous turkey stocks. The Spanish introduced new domestic plants and animals into the region, including wheat, barley and fruit trees, along with fowl, sheep, goat, pig, cattle, donkey, horse and mule (Tarcan 2005). Over time, these new cultigens and animals were adopted; sheep in particular became the dominant domestic herd, and an important source of meat and wool. Based on her faunal analysis at the Middle Village of Zuni Pueblo, Tarcan (2005) suggests that these

36 larger-bodied domesticates would have been preferred over the smaller indigenous turkey, since the total energy requirements for husbandry are not dissimilar, and sheep provided economic advantages over turkeys. The chicken was also introduced in the 1600s, and its adoption as a domestic fowl may have contributed to the decline of turkey husbandry. Based on the available historic documents, domestic chickens seem to have been introduced by at least 1631, it became more widely adopted in Arizona around the late 1600s, and was popular in both Arizona and New Mexico by the 1770s (Schroeder 1968). At Pueblo sites, the chickens seem to have been adopted primarily for meat, eggs, or for sale, rather than for feathers (Schroeder 1968).

Turkey husbandry declined throughout the historic period. McKusick claims that the SID populations disappeared with the fall of Gran Quivira Pueblo in 1672, while the LID persisted for another 25 years, until the last turkey stocks were recorded in New Mexico in 1723 (McKusick 1986b:11). She cites Schroeder's Birds and Feathers in Documents Relating to Indians ofthe Southwest, pg. 102-103 to support the total extinction of the Southwest stocks, though his exact wording is:

"Fray Juan de Torquemada in 1723 published a work on the Indians that included the Southwest. He noted that the natives along the Rio Grande raised (1) many turkeys (gallinas de la tierra) and made robes from their feathers. They also offered (2) plumes to coarse rocks that they had build up (wishing shrines)" (Schroeder 1968:102-1 03).

This is the last mention that Schroeder makes regarding indigenous turkey husbandry until the Early American Period (1800s), when he notes turkeys and turkey feather use by the Zuni, Acoma, Laguna, Zia, Santa Ana, San Felipe, Cochiti, Jemez. Schorger also notes a drastic decline in domestic turkey in the 19th century, though wild turkey populations appeared to be prolific (Schorger 1966:24). Between 1723 and the 1800s, it is not clear if Pueblo people continued to raise turkeys, and whether the Southwest breed persisted into modern times. Colonists may also have imported modern breeds of domestic turkeys from the Eastern seaboard, which may have replaced or interbred with the indigenous breed. The use of both chickens and turkeys after AD1500 is difficult to assess since many Spanish documents were destroyed during the Pueblo Revolt of the late 1600's, and those documents that do exist often lump all small or lesser livestock under the term "ganado menor" (Schroeder 1968).

37 Change in Turkey Use Over Time

Despite the many disputes concerning the origin and motivation for turkey domestication, most Southwest archaeologists agree there was a shift in the focus of turkey domestication over time. Reed (1951) was the first to propose that turkeys were kept and raised for feathers or ritual purposes prior to around AD900, but became a principal food source during Pueblo 1/ times. Turkey bones are relatively scarce during the Basketmaker phases, but become more plentiful in the refuse deposits of later Pueblo sites. McKusick (1986b) notes the importance of feather products prior to the Pueblo 1/ phase, both for use in feather blankets and robes, as well as for ritual purposes.

However, around Pueblo II, the evidence for predominant feather and ritual use seems to be replaced by the turkey's clear value as a subsistence item. Breitburg emphasizes the ritual nature of the bird during its initial domestication, but presumes the need for food, by-products, or trade items would have eventually balanced the secular need for the turkey against the spiritual one (Breitburg 1993:171). Population growth, dispersion and aggregation, fluctuating environmental conditions and pressure on wild animal resources would have encouraged the Ancestral Puebloans to adopt turkey as an important food source during Pueblo II and III.

Finally, we are brought to the role of wild turkeys within the lives of the Ancestral Puebloans. Some evidence indicates that although turkeys were domesticated, wild turkeys were still hunted and utilized (McKusick 1980, 1986b). McKusick proposes that wild turkeys were caught and eaten during the Basketmaker periods when the domesticates were used primarily for feathers or ritual purposes (McKusick 1986b). Was there a distinction between the uses of the wild and domestic birds in terms of food and ritual? Were these distinctions perpetuated once the domestic bird became an important food source?

One may perhaps feel that a review of Southwest domestic turkey use leaves more questions than answers. Where did the Southwest domestic turkey come from? Which is the ancestral subspecies for the domestic bird? How many breeds were present in the Southwest? How were the turkeys bred? Were there differences in the use of male and female birds, or wild and domestic birds, in terms of food and rituals? Based on the lack of osteological criteria to separate males and female, wild individuals and domestic breeds, many of these questions could not be addressed. Genetic 38 analyses, however, have made significant contributions to the study of animals domestication, and may offer a new tool to explore these outstanding issues.

Domestication and DNA analysis

Both modern and ancient DNA analyses have been extremely useful for understanding the domestication process. Genetic analyses of domestication focus on the biological processes of domestication, such as genetic drift, founder effect, inbreeding, and selection. While some modern DNA studies have concentrated on identifying the actual genes involved in domestication, others have focused their attention on organelle DNA (mitochondrial and chloroplast DNA).

Organellar DNA

The majority of genetic analyses have sought to elucidate domestication through the examination of organellar DNA, such as chloroplast DNA in plants, and mitochondrial DNA (mtDNA) in animals (Bradley and Magee 2006). These genomes are particularly useful for studying domestication, as the mutation rate is higher than in nuclear DNA. Considering the relatively shallow time depth of domestication (usually less than 10,000 years), a relatively rapid mutation rate is required to identify difference between wild and domestic populations (Bradley and Magee 2006). Another advantage of mtDNA is that it is present in much higher copy number per cell than nuclear DNA - this is of particular benefit to analyses on archaeological materials, where the DNA may be significantly degraded. While the haploid nature of mtDNA allows the identification and analysis of maternal lineages (Beja-Pereira et al. 2006; Chen et al. 2005; McGahern et al. 2006; Meadows et al. 2007), V-chromosome analysis can identify and examine male lineages (in mammals) (Lindgren et al. 2004; Meadows et al. 2006). Non-coding loci, such as microsatellite markers, have also been used to examine breed histories and relatedness (Cronin et al. 2006; Qu et al. 2006; Simonsen et al. 1998; Smith et al. 2005). Since microsatellites are found on the nuclear genome, these studies are usually limited to modern samples, though researchers have attempted microsatellite studies on ancient remains with some success (Edwards et al. 2003).

Rather than attempting to identify the actual genes that underlie phenotypic change, non-coding or organellar DNA analyses attempt to identify the genetic signature of founder effects, population bottlenecks and restricted breeding groups, that usually

39 accompany the domestication process (Bar-Gal et al. 2002a; Beja-Pereira et at. 2006; Dobney and Larson 2006; Vila et at. 1999). These analyses typically begin by analyzing the range of variation present in modern and/or ancient wild lineages and identifying any secondary effects of population isolation within modern and/or domestic species. By comparing the phylogeographic relationships between genetic haplotypes of domestic animal and wild populations in the same region, one may identify the wild progenitor species of domestic groups, identify the number and geographic origin of domestication events, and track the dispersal of domesticates into new territories (Dobney and Larson 2006).

While most examinations of domestication have been conducted on modern domestic populations and their presumed wild counterparts, the results of these studies may be biased by generations of selective breeding, hybridization, population movements, and heritage breed extirpations. Additionally, many presumed wild progenitors (e.g. the aurochs) may be extinct, or locally extirpated within the presumed domestication region (e.g. Chinese water buffalo (Yang et at. 2008). Ancient DNA analysis of archaeological material has been used more frequently over the last few decades to document domestication histories and the movement of domestic populations across the world.

Number and Geographic Origin(s) of Domestication Events

DNA analyses of domestic animal have suggested that multiple domestication centres are the norm, rather than the exception (Zeder et al. 2006a). Recent studies of bovine mtDNA analysis have suggesting a third domestication event in Africa, in addition to those proposed for the Near East and Europe (Bradley and Magee 2006; Troy et at. 2001). Larson et a/.'s (2005) extensive mtDNA analysis of Sus species across the globe yielded evidence for at least six different wild boar domestication events scattered throughout the Old World. Goat (Bar-Gal et at. 2002b; Sardina et at. 2006) and sheep (Meadows et at. 2007) analyses, too, have suggested multiple events for each species, with the primary origin in the Fertile Crescent.

However, one must be cautious in interpreting these data, since genetic evidence for the appearance of new 'wild types' in domestic contexts does not automatically denote a distinct domestication event. For example, wild animals incorporated into domestic populations may appear to represent an separate domestication event if the

40 founding domestic population is small, and its genetic signature is subsumed by the wild recruits (Larson et al. 2007). Alternatively, the inclusion of wild males into domestic flocks may be completely masked if mtDNA is analyzed, exclusive of V-chromosome markers.

Ancient DNA and Turkey Domestication

Ancient DNA analysis of archaeological remains should hold the key to many outstanding questions regarding pre-contact turkey use in the Southwest United States. Ancient DNA analysis of early turkey remains may reveal which of the modern wild subspecies represents the wild ancestor(s) to domestic stocks. We may finally be able to resolve if Merriam's wild turkey was already a distinct subspecies at the turn of the first millennium, or whether it is in fact a feral descendent of domesticated birds.

However, more than just phylogentic questions can be answered with molecular analysis. DNA analysis of archaeological remains will be able to shed light on the flock management practices of the Ancestral Puebloans as they pertain to breeding. Genetic analysis should be able to identify if a single original domesticated flock dispersed throughout the region, or whether the Ancestral Puebloans domesticated wild turkeys at different times and in different areas. Ancient DNA analysis may be able to determine if there is a genetic difference between specimens categorized as LID, SID or hybrids, or whether observed differences are the result of environmental plasticity andlor natural variation. DNA may also be able to identify some specific breeding patterns, for examples, whether the Ancestral Puebloans were enhancing their flocks through the trade of birds between sites, or by incorporating wild birds into their stocks.

Finally, DNA analysis may also elucidate the different roles turkeys may have played in Ancestral Puebloan culture. It may be possible to identify if wild and domestic turkeys, or distinct domestic breeds were used for different purposes, specifically for food, textiles or ritual sacrifice. By examining turkeys from different sites and time periods, it may be possible to examine how the use of turkeys may have changed over time. There seems to be consensus that turkeys shifted from being principally a feather source to an important food item as Southwest populations rose dramatically during the Pueblo II and III phases. When turkey production reaches its peak of intensity around AD1000-1300 is there evidence that a particular breed (one used specifically for food or ritual) was husbanded more intensively than others?

41 Using DNA for sex identification may be able to identify any difference in the use of male and female turkeys, while also helping to clarify osteological criteria for sex discrimination. Although some osteometric criteria have been proposed to discriminate between the sexes, there can be overlap between categories - for example between the large female wild birds, and small male domestic birds, as well as between male and female birds of the LID and SID breeds. Genetic analyses of the archaeological remains may help to clarify and validate these proposed osteological criteria. Armed with new information and a fresh perspective, ancient DNA analysis can allow us to explore the issue of turkey domestication in the Southwest in more depth than has ever been possible.

Chapter Summary

Domestication can be explained as a dynamic process that takes place over successive generations whereby tamed animals are cut off from wild populations and slowly assimilated into human societies. This process incorporated both biological influences (e.g. founder effect, bottlenecks, artificial human selection) and cultural influences (concepts of animal ownership, changes in animal social relations and hierarchies). There are many lines of evidence that can be used to identify the process of animal domestication, and the use of domestic animals in the archaeological record. These include morphological markers, such as reduction in body and skull size, variation in horn size and shape, and pathologies, as well as non-morphological markers, such as shifts in a population's demography, abundance or geographic distribution.

Many of these markers have been used to examine turkey domestication and use within the Southwest United States. This region displays archaeological evidence of turkeys as valuable spiritual and secular resources for the Ancestral Puebloans, beginning in New Mexico around 100BC-AD500 and intensifying steadily through time until around AD1400. The arrival of the Spanish drastically altered the traditionallifeways of the Ancestral Puebloans, and brought new domesticates to the area. By the 1700s, the indigenous turkey had become extinct. Archaeological evidence indicates that turkeys were used for both spiritual and secular purposes, with a significant shift in their exploitation around Pueblo II (AD900), when turkeys change from being predominantly a ritual animal and source of feathers, to being an important food item.

42 Despite the rich archaeological database for the region, several issues concerning the Southwest domestic turkey remains unresolved. The application of ancient DNA analysis to archaeological remains may hold the key to addressing questions concerning the geographic origin, the number of domestication events, and the wild progenitor of the Southwest domestic turkey. Additionally, ancient DNA analysis may also contribute to debates concerning the number of domestic breeds, and the validity of current osteological criteria for differentiating male, female, wild and domestic individuals.

43 CHAPTER 3: MATERIALS AND METHODS

This chapter reviews the overall materials and methods for DNA extraction, amplification and sequencing, as well as the methods for the development of the new sex identification technique. Methods and materials particular to each of the three research objectives will be covered in more detail in Chapters 5,6 and 7, respectively.

Archaeological Turkey Samples

One hundred and ninety-three archaeological turkey bone samples underwent ancient DNA extraction and analysis. The samples were obtained from 43 sites, ranging in time from late Basketmaker II to historic times. The majority of the samples were from the northern portion of the Ancestral Puebloan region, within the Northern San Juan and Dolores areas (Figure 2, Table 1)

UTAH COLORADO ,.i 11 j e, ? S ~ (, 17

l Montezuma valley l~ U,.j 13 16 I' 14 I{ .oJ"

... ~= o 5 """.... ~ 9"L 'p ::

Figure 2 Detailed map showing the locations of sites within the Northern San Juan and Dolores area (adapted with permission of the Crow Canyon Archaeological Center © 1999)

44 Table 1 Archaeological sites from which turkey samples were obtained

Number # of tested Archaeological Site Occupation Dates (AD) on Map samples 1 Grass Mesa 600-920 1 2 LeMoc Shelter 720-900 1 3 Hamlet de la alia 780-920 1 4 Aldea Sierritas 720-800 2 5 McPhee Villaqe 820-980 4 6 Masa Neqra Pueblo 860-980 1 7 Hanging Rock 720-880 2 8 House Creek Village 800-920 1 9 Escalante Pueblo 1075-1250 2 10 Shields Pueblo 1020-1300 13 11 Hedley Ruin 1000-1300 6 12 Mockinqbird Mesa 5MT13795) 700-1100 1 12 Mockinqbird Mesa 5MT948) 900-1350 6 12 Mockingbird Mesa 5MT3217) 1150-1300 2 12 Mockingbird Mesa 5MT1602) 1150-1300 9 13 Sand Canyon Pueblo 1250-1280 32 14 Stanton's Site 1230-1270 5 15 Castle Rock Pueblo 1250-1300 5 16 Ida Jean Site 1050-1150 2 17 Albert Porter 900-1300 8 18 Bluff Great House 900-1300 7 19 Comb Wash 1150-1250 5 20 Los Alamos (LA12587) 1275-1325 3 20 Los Alamos (LA4618) 1275-1325 5 21 Alamo Canyon, Bandelier NM 1150-1180 1 21 Rainbow House, Bandelier NM 1400-1600 4 22 Pueblo Bonito, Chaco Canyon 900-1150 7 23 Aztec Ruin 1105-1300 5 24 Atsinna, EI Morro 1280-1380 5 25 Antelope House, Canyon de Chelly 700-1300 2 26 Tsa-ta'a, Canyon de Chelly 700-1300 3 27 Keet Seel 1250-1300 5 28 Turkev Cave 445-1300 1 29 Point of Pines 1200-1400 5 30 Grasshopper Pueblo 1300-1400 5 31 South Pueblo, Pecos 1300-1846 2 31 Forked Lightning, Pecos 1300-1846 2 32 Gran Quivira, Salinas Pueblo Mission 1300-1672 5 33 Gila Cliff Dwellinq 1270-1290 3 34 Tonto Upper Ruin 1300-1400 3 35 Tumacacori National Monument 1691-1850 1 36 Fort Bowie 1862-1894 3 37 Calderon Site 820-1296 7

Additional samples were obtained from sites throughout the greater Southwest and Northern Mexico (Figure 3, Table 1). Appendix A presents the detailed sample and provenience information for each of the archaeological turkey bones.

45 COLORADO

, 32 i, i, , __1--' TEW3A

N • Casas Grandes A

o 150 I , 3fO KIlometers 37 0 1'f 200• ""---~---~Miles

Figure 3 Map showing the locations of archaeological sites from which turkey samples were obtained (adapted with permission of the Crow Canyon Archaeological Center © 1999, see Figure 2 for sites in southwest Colorado)

Due to the destructive and costly nature of ancient DNA analysis, as well as the overall paucity of turkey remains from some Ancestral Puebloan sites, most sites were represented by one to five remains. One exception was the site of Sand Canyon Pueblo, where 32 turkey remains were sampled for a site-specific analysis.

In order to reduce the likelihood of sampling from the same turkey individual, when possible the same bone element and side were selected, or samples were selected from different archaeological contexts. Humeri were preferentially selected over

46 other elements, since McKusick's Southwest Indian Turkey: Prehistory and comparative osteology (1986) indicated that size and character differences existed between males, female, LID, SID and wild turkey humeri. The analysis of one particular element would also allow for sufficiently large collections to make meaningful osteometric comparisons among turkey types. However, if no humeri were available from a particular site, other elements were selected, with preference given to long bones.

Osteological Analysis

Morphological species identifications were conducted for all samples to ensure they were consistent with M. gallopavo (Gilbert et a/. 1996). Many shaft fragments or small samples could not be confidently identified as M. gallopavo. If the samples were consistent with overall size and morphology of M. gallopavo, they were included in the DNA analysis. Samples were photographed and measured according to criteria provided in Von den Driesh (1976). All bone measurements are listed in Appendix A. As a first step in sex identification, tarsometarsi were examined for the presence of a spur (or spur scar), indicating a probably male individual (Gilbert et a/. 1996).

The majority of the samples from this study were not previously identified as either LID or SID turkeys. However, most of the samples were obtained from the four­ corners region, an area where the LID supposedly predominated (McKusick 1986b). The only sizable collection of SID remains was recovered from Gran Quivira, at Salina Pueblo Missions National Monument in New Mexico. Although permission was sought to apply ancient DNA techniques to 15-20 samples from this site, only five samples were approved for destructive analysis (TU1041, TU1049, TU1052, TU1053, TU1054). Considering the small number of samples approved for DNA analysis, osteological measurements were taken on an additional 23 turkey humeri from the Gran Quivira collection to characterize the size difference between these SID and other turkey populations in the region. Measurements of these supplementary Gran Quivira humeri are listed in Appendix B.

Bone Preparation, Decontamination and Extraction

The archaeological turkey bone samples were processed in the dedicated ancient DNA laboratory in the Department of Archaeology at Simon Fraser University, using a modified silica spin protocol (Yang et a/. 2004; Yang et a/. 1998). Two samples, 47 weighing between 0.3-2.0g, were cut from each turkey bone. Samples were cut with a hacksaw, equipped with a fresh blade (first cleaned with bleach) for each separate bone. Examples of cut turkey bone samples are provided in Figure 4.

Figure 4 Examples of typical turkey samples used for DNA extraction

Samples were chemically decontaminated to remove dirt and surface contamination: samples were first immersed in 100% commercial bleach for seven minutes, then rinsed in distilled water, followed by immersion in 1N HCI for 0.5 min, immersion in 1N NaOH for 0.5 min, before being rinsed twice in distilled water. Decontaminated samples were UV irradiated for 30 min on two sides before being crushed into power using a vice.

The bone powder was added to 3-5ml of lysis buffer (0.5M EDTA pH8, 0.2-0.5% SDS, 0.5 mg/ml proteinase K) and incubated overnight in a rotating hybridization oven at 50°C. After centrifugation, 3-4ml of lysis was concentrated in a 10,000 NMWL or 30,000 NMWL Amicon® Ultra-4 Centrifugal Filter Unit (Millipore, Billerica, MA, USA), and purified using a QIAquick PCR Purification Kit or QIAquick Nucleotide Removal Kit column (QIAGEN, Hilden, Germany), with 1OOIJI eluted from the column for subsequent PCR amplification.

48 peR Set-up and Amplification

D-Ioop Amplification

Based on available GenBank M. gallopavo reference sequences, several overlapping primer sets were designed to amplify a maximum of 598 bp from the hypervariable control region (D-Ioop) of the turkey mtDNA genome (Table 2, Figure 5). This locus was selected for analysis as: 1) mtDNA is present in higher copy numbers than nuclear DNA, making it easier to recover from degraded archaeological remains; 2) the mtDNA D-Ioop is non-coding with a high mutation rate, making it ideal for studies of closely related populations (Cann et al. 1984); and 3) this locus was the focus of a recent comprehensive genetic survey of modern North American wild turkey populations (Mock et al. 2002), allowing the genetic data recovered from this project to be comparable to a large modern sample.

Table 2 peR primers used to amplify turkey overlapping D-Ioop fragments Primer Position Sequence (5' to 3') TK-F2 15482-15505 AATTTATTCCCGCTTGGATAAGCC TK-F90 15573-15593 ACY CCC CTA TTG AGT GTA CCC TK-F143 15624-15650 GCATAATCGTGCATACATTTATATACC TK-F224 15704-15729 GTAGACGGACATAACAACCTTTACCCC TK-F315 15759-15782 ACATGCCAATGACATTAACTCCTTC TK-F411 15829-15854 TGGTTACAGGACATACCTCTAAATCT TK-R156 15613-15636 TGCACGATTATGCATAGTATACCC TK-R261 15718-15741 AGGGAGRAATGGGGTAAAGGTTGT TK-R405 15801-15824 TGTATATGGTCTCTTGRGGGTTGG TK-R567 15962-15981 GGGAAAGAATGGGCCTGAAG TK-R670 16058-16083 CAGATGACTTCGTGAAAAGTGAGGAG Note: F and R in the primer name denotes forward and reverse primers, respectively. Position number is based on M. gallopavo isolate EF153719 mtDNA genome.

F143-R407

F90-R261 F315-R670

F2-R261 F31S-R567

F2 -R407

F2-R156 F224-R407 F41l-R670

I I I I I 50 100 150 200 250 300 350 400 450 500 550

Figure 5 Relative positions of the overlapping primer sets used to amplify the 598bp D-Ioop fragment (arrows are used only to denote the length of the amplicon, sequencing was conduced from both directions)

49 All ancient DNA PCR amplifications were conducted in a Mastercycler Personal (Eppendorf, Hamburg, Germany) in a 30-50 IJL reaction volume containing 50 mM KCI and 10 mM Tris-HCI, 2.5 mM MgCI2, 0.2 mM dNTP, 1.5 mg/mL BSA, 0.31JM each primer, 3-5 IJL DNA sample and 2.25-3.75U AmpliTaq Gold™ or AmpliTaq Gold™ LD (Applied Biosystems). Initial PCR reactions were prepared using the longest primer sets (i.e. TK-F2/TK-R405, TK-F315ITK-R670) to test for overall DNA preservation. Samples which failed to amplify using the long primer sets were re-amplified using shorter primer sets.

The conditions of PCR amplification were as follows: the initial denaturing took place at 95°C for 1;2min, followed by 60 cycles at 95°C for 30 sec, 50°C or 52°C for 30 sec, 70°C for 40 sec followed by a final 7 min extension at 72°C. Five IJL of PCR product were separated by electrophoresis on 2% agarose gel and visualized using SYBR-Green on a Dark Reader Box. PCR products were purified using Qiagen's MinElute PCR Purification Kit ™ (QIAGEN, Hilden, Germany), and were sequenced using both forward and reverse primers at the Central Facility of the Institute for Molecular Biology and Biotechnology Laboratory at McMaster University (using an ABI 3100), or at Macrogen Ltd., Seoul, Korea (ABI 3730XL).

Cytochrome b Amplification

A second mtDNA primer set was designed to amplify a 176bp fragment of the turkey cytochrome b (cytb) gene (Table 3). The cytb gene is a protein-coding DNA sequence, and therefore more conserved than the D-Ioop, making it very useful for assessing relationships between regionally or temporally distinct populations. The cytb PCR reactions, amplifications and PCR product purification occurred using the same methods and conditions listed above. Although some of the samples were sequenced using the forward or reverse PCR primers, the majority of the amplified samples were sequences using a specially designed sequencing primer (Table 3).

Table 3 peR primers used to amplify turkey cytb fragment

Primer Position Seauence (5' to 3') TK-F215 13885-13908 GAAACGTACAATACGGTTGACTCC TK-R391 14038-14060 TACAAAGGCTGTTGCTATGAGGG TK-F228S 13898-13917 CGGTTGACTCCTCCATAACC Note: F and R denote forward and reverse primers, respectively, while S denotes the sequencing primer. Position number is based on Meleagris gallopavo GenBank isolate EF153719 mtDNA genome.

50 Additional Amplifications

Samples that failed to amplify using any of the turkey D-Ioop primer sets, or the cytb primers were subsequently amplified with more generic 'bird' primer sets. Two primer sets composed of two forward primers and a common reverse primer (Table 4) were designed to amplify a cytb gene fragment either 102bp or 219bp in length. The primers were particularly designed to amplify cytb fragments from turkeys, chicken (Gallus gallus), Canada goose (Branta canadensis), prairie-chicken and grouse (Tympanuchus and Bonasa sp.). These birds can be recovered in Southwest archaeological sites, and due to some morphological similarities with turkeys, fragmentary remains of these bird species could be mistaken for turkey. Considering that the D-Ioop primers were designed to bind specifically to turkey, these additional primer sets were designed to ensure that D-Ioop PCR failure was not due to errors in morphological species identification.

Table 4 Generic 'bird' cytb primers Primer Position Sequence (5' to 3') GA-F407 14077-14098 GRGGRCAAATATCATTYTGAGG GA-F524 14194-14213 CCCTYACYCGATTCTTCGCC GA-R627 14276-14296 GGRTTGTTTGAGCCYGATTCG Note: F and R in the primer name denotes forward and reverse primers, respectively. Position number is based on Meleagris gallopavo isolate EF153719 mtDNA genome.

Sex Identification

A new sex identification technique was developed for this research based on the amplification of a female-specific W-chromosome fragment. Since nuclear DNA is present in low quantities in ancient remains, the primers were designed to target a highly repetitive element within the female-specific W-chromosome which should theoretically offer more numerous amplification templates than single copy non-repetitive nuclear loci. Turkey W-chromosome primers were designed to amplify 144bp of a published 400bp female-specific bent-repetitive DNA sequence (Table 5).

51 Table 5 Pstl peR Primers used to amplify turkey W-chromosome fragments Primer Position Sequence (5' to 3') TK-F176-W 176-198 CCAGAAATACCAATTATCTCCGC TK-R320-W 298-319 CGATAAAACTGGCATTTCCTGG Note: F and R in the primer name denotes forward and reverse primers, respectively. Position number is based on Meleagris gallopavo GenBank isolate X17583 for female-specific 0.4 kb Pstl repetitive unit.

Saitoh et al. 's (1989:253) study of highly repetitive regions of the turkey W­ chromosome indicated that this Pstl unit is repeated approximately 10,000 times within the diploid genome of the female turkey, and absent within the male turkey genome. These Pst! primers were included in a co-amplification reaction with D-Ioop primers F315/R567, which acted as an internal positive control. This new co-amplification technique was given the abbreviation mtW. Co-amplifications were designed to preferentially amplify the W-chromosome: 1) the W-chromosome fragment (144bp) was designed to be shorter than the D-Ioop fragment (222bp); and 2) the primers were added to the co-amplification reaction in a ratio of 10: 1. This ratio allowed for the W­ chromosome to be preferentially amplified when present, but still contained adequate amounts of D-Ioop primer to act as an internal positive control.

PCR co-amplifications were conducted in a Mastercycler Personal (Eppendorf, Hamburg, Germany) in a 30 IJL reaction volume containing 50 mM KCI and 10 mM Tris­ HCI, 2.5 mM MgCI2, 0.2 mM dNTP, 1.5 mg/mL BSA, 0.61JM each W-chromosome primer, 0.061JM each D-Ioop primer, 3 IJL DNA sample and 2.25-3.75 U AmpliTaq Gold™ LD (Applied Biosystems). Five IJL of PCR product were separated by electrophoresis on 2% agarose gel and visualized using SYBR-Green on a Dark Reader Box.

Sex identities were assigned to individual samples based on visual analysis of the electrophoresis gel results: the amplification of the W-chromosome fragment (with or without a D-Ioop amplification) indicated a female bird; the sole amplification of the D­ loop positive control indicated a male bird; failed amplification of both fragments indicated a PCR amplification failure. Samples identified as male in initial reactions were re-amplified to ensure that W-chromosome amplification failure was not responsible for a false positive result.

Turkeys are sexually dimorphic birds, with the male being larger than the female. The genetic sex identifications obtained through the mtW analyses were compared to the morphological size of long bone elements to test the reliability of the genetic sex 52 identification. Genetic sex and morphological size were compared through scatter plots or histograms for all humeri, tibiotarsi and tarsometatarsi when the complete elements, or at least one complete distal or proximal end were present. Only elements from fully mature individuals (i.e. elements that displayed complete ossification and epiphyseal fusion) were included in the comparison of morphological size and sex.

Modern Turkey Samples

Twenty-seven modern turkey samples were also DNA analyzed (Table 6). Seven samples were obtained from turkey necks purchased at "Save-on-Foods", Burnaby, BC, and 20 turkey phalanges were collected from recently slaughtered birds at Valley Creek Farm, Victoria, BC.

Table 6 Modern turkey DNA proveniences and morphological sex LablD Provenience Element MorDholoaical Sex MTU1 Suoermarket Neck N/A MTU2 Suoermarket Neck N/A MTU3 Suoermarket Neck N/A MTU4 Suoermarket Neck N/A MTU5 Suoermarket Neck N/A MTU6 Supermarket Neck N/A MTU7 Suoermarket Neck N/A MTU10 Valley Creek Farm Phalanx Male MTU11 Valley Creek Farm Phalanx Male MTU12 Valley Creek Farm Phalanx Male MTU13 Valley Creek Farm Phalanx Male MTU14 Valley Creek Farm Phalanx Male MTU15 Valley Creek Farm Phalanx Female MTU16 Valley Creek Farm Phalanx Female MTU17 Valley Creek Farm Phalanx Female MTU18 ValleY Creek Farm Phalanx Female MTU19 Valley Creek Farm Phalanx Female MTU20 ValleY Creek Farm Phalanx Female MTU21 ValleY Creek Farm Phalanx Female MTU22 Valley Creek Farm Phalanx Female MTU23 Valley Creek Farm Phalanx Female MTU24 ValleY Creek Farm Phalanx Female MTU25 ValleY Creek Farm Phalanx Male MTU26 ValleY Creek Farm Phalanx Male MTU27 ValleY Creek Farm Phalanx Male MTU28 Valley Creek Farm Phalanx Male MTU29 Valley Creek Farm Phalanx Male

53 Modern D-Ioop Amplification

The complete 598bp D-Ioop fragment was amplified using the longest possible primer set (F2/R670). All modern samples were amplified using the longest possible primer set (F2/R670) to ensure the efficacy of the DNA extraction. Only 10 of the samples were sequenced however, since commercially-raised turkeys generally display relatively low levels of genetic diversity (Smith ef al. 2005; Ye ef al. 1998), and the obtained sequences matched those obtained from GenBank. Three of the modern turkeys were amplified using cytb primers (F215/R391) and sequenced using the forward sequencing primer TK-F228S.

Modern DNA PCR amplifications were conducted in a Mastercycler Personal (Eppendorf, Hamburg, Germany) in a 25-30 IJL reaction volume containing 50 mM KCI and 10 mM Tris-HCI, 2.5 mM MgCI2, 0.2 mM dNTP, 1.5 mg/mL BSA, 0.31JM each primer, 1.0-2.5 IJL DNA sample and 1.25U AmpliTaq Gold™ or AmpliTaq Gold™ LD (Applied Biosystems). The conditions of PCR amplification were as follows: the initial denaturing took place at 95°C for 1~min, followed by 30-40 cycles at 95°C for 30 sec, 52°C for 30 sec, 70°C for 4psec followed by a final 7 min extension at 72°C. Five IJL of PCR product were separated by electrophoresis on 2% agarose gel and visualized using SYBR-Green on a Dark Reader Box. PCR products were purified using Qiagen's

M MinElute PCR Purification KitT , and sent to the Macrogen Ltd. sequencing facility in Seoul, Korea for sequencing on an ABI 3100.

Modern Turkey Sex Identification

The modern turkey samples were sex identified using a number of techniques. First, the modern turkey samples underwent genetic sex identification using the same mtW technique as the ancient samples. In order to validate the mtW results, the modern turkeys were subsequently tested with previously published bird or turkey sex identification primers, as well as an additional primer set targeting single-copy W­ chromosome gene fragments.

Like the ancient samples, the modern turkeys were first co-amplified with Pst1 primers and D-Ioop primers (F315/R567) at a ratio of 10: 1. PCR amplifications were conducted for 30 cycles in a Mastercycler Personal (Eppendorf, Hamburg, Germany) in

54 a 25 IJL reaction volume containing 50 mM KCI and 10 mM Tris-HCI, 2.5 mM MgCI2, 0.2 mM dNTP, 1.5 mg/mL BSA, 0.61JM each W-chromosome primer, 0.061JM each D-Ioop primer, 1.0-1.5 IJL DNA sample and 1.25 U AmpliTaq Gold™ LD (Applied Biosystems). Five IJL of PCR product were separated by electrophoresis on 2% agarose gel and visualized using SYBR-Green on a Dark Reader Box. Sex identities were assigned based on visual analysis of the electrophoresis gels: the amplification of both the Pst1 and D-Ioop fragment indicated female; the sole amplification of the D-Ioop positive control indicated a male bird; failed amplification of both fragments indicated a PCR amplification failure.

Next, the modern samples underwent PCR using primer sets designed for the genetic sex identification of birds (and specifically turkey). Primer set P8 (5'­ CTCCCAAGGATGAGRAAYTG-3') and P2 (5'-TCTGCATCGCTAAATCCTTT-3') were designed by Griffiths et al. (1998) as a molecular technique to sex most bird species. These primers amplify conserved chromo-helicase-DNA-binding (CHD) genes located on the avian sex chromosomes. The single primer set would amplify homologous sections of both CHD-W (located on the W-chromosome) and CHD-Z (located on the Z­ chromosome) genes, whose intron length tends to differ. Sex is identified via visualization of an electrophoresis gel - in females, the primers would amplify the CHD­ W gene located on the W chromosome, as well as the CHD-Z located on the Z chromosome producing two gel bands differing in length, while in males, the primer set would amplify on the CHD-Z gene producing one gel band. Primers were added to a 25ul PCR reaction with chemical concentrations as listed above. PCR occurred using varying cycle numbers (30-50) and annealing temperatures (46-52°C).

Samples were also amplified using two published primer sets designed to amplify W-specific fragments on both the chicken and turkey genomes (Granevitze et al. 2007). Turkey samples underwent PCR with primer set HUR0418F (5'- TGGCATCTGCAGAAAATGAA-3') and HUR0418R (5'-CAGAC-AATGCACTTCTCCCA­ 3') and primer set HUR0421F (5'-CTCCATTTTCTTA-GTTTGTTAGCAC-3') and HUR0421 R (5'AACCTGAAGAAGCAACAGCC-3'), designed to amplify fragments 557bp and 450bp in length, respectively. Primers were added to a 25ul PCR reaction with chemical concentrations as listed above. PCR occurred using varying cycle numbers (30-40) and annealing temperatures (46-56°C).

55 Due to difficulties in amplifying nuclear DNA using published primer sets P2/P8, HUR0418F/R, HUR0421 FIR, a new primer set was designed based on turkey W­ chromosome HINT gene sequences obtained from GenBank. Primers TKW-F268 and TKW-R482 were designed to amplify 196bp of the female-specific HINTW gene (based on GenBank isolate AY713488) (Backstrom et al. 2005) (Table 7). These primers were included in simplex PCR reactions; the amplification for the HINTW fragment should indicate female birds, while amplification failure should indicated male birds.

Table 7 Wand Z chromosome HINT gene primers Primer Seauence (5' to 3') TKW-F286 AAG CGA TGC TCA TTT CTG G TKW-R482 TCC GAC CTG CTC AAA ACC Note: F and R in the primer name denotes forward and reverse primers, respectively.

HINTW primers were added to a 25ul PCR reaction with chemical concentrations as listed above. Final PCR conditions were set at 45 cycles, with an annealing temperature of 52°C. Three successfully amplified samples were sequenced using forward and reverse primers to ensure that the targeted HINTW gene fragment was being amplified.

Sequence Analysis

The obtained ancient and modern DNA sequences were BLAST-compared through GenBank to determine if they would match Meleagris sequences, and to ensure that they did not match with any other unexpected species or sequences. The electropherograms were first truncated to remove primer sequences. Sequences were visually examined and base pair ambiguities were identified using ChromasPro software (www.technelysium.com.au). Multiple sequences from the same bone sample were compiled into consensus sequences using ChromasPro.

Haplotype Assignation

The complete consensus D-Ioop sequence for each sample was truncated to 438bp (position 15567-16004, based on complete mtDNA genome of GenBank specimen EF153719) to make them comparable to Mock et al. (2002) wild turkey 56 subspecies data. D-Ioop haplotypes were assigned to samples based on multiple alignments and phylogenetic analyses. 'Confident' haplotypes were assigned only after repeat amplification and sequencing of polymorphic areas confirmed that mutation sites were not the result of DNA post-mortem degradation and damage. Criteria for assigning a 'confident' haplotypes were as follows: 1) if the total 438bp fragment was obtained; and 2) if repeat sequencing could confirm all polymorphic areas as either 'authentic' mutations, post-mortem damage, and/or sequencing errors. If a sequence was incomplete, or displayed one or more unresolved base pair ambiguities, a tentative haplotype was assigned. Tentative haplotypes were assigned if: 1) at least 300 of the 441 bp were obtained; 2) the obtained sequence covered polymorphic regions required for haplotype identification; and 3) base pair ambiguities were not located on known polymorphic sites. Samples with sequences that did not meet the 'confident' or 'tentative' criteria were not assigned haplotypes.

Phylogenetic and Network Analysis

The 181 obtained truncated D-Ioop haplotypes were combined with 276 Meleagris GenBank entries to generate a combined D-Ioop data set of 457 individuals. For the cytb data, the 39 obtained sequences were combined with seven available GenBank sequences to produce a combined data set of 46 individuals. Multiple alignments of the haplotypes sequences and published Meleagris mtDNA reference sequences were conducted using ClustalW (Thompson et a/. 1994) through BioEdit (Hall 1999). Phylogenetic analysis was conducted using MEGA 3.1 software (Kumar et a/. 2004), and median-joining networks were created using Network (v. 4.1.1.2) (Bandelt et a/. 1999).

Contamination Controls

The issue of contamination is of vital concern in ancient DNA analyses, since the degraded nature of ancient DNA means that even miniscule amounts of modern DNA can overwhelm ancient templates during PCR amplification (Richards et a/. 1995). The ancient DNA extraction and amplification was conducted using the most rigorous protocols and procedures to reduce the risk of contamination.

57 Lab Protocols

Comprehensive controls were taken during every step of the extraction and amplification procedure to reduce the risk of contamination. Protective clothing, such as masks, disposable gloves, and Tyvek™ suits with hoods and shoe covers, was worn during bone decontamination, extraction and PCR set-up procedures. Sample preparation, extraction and PCR set-up took place in a positive pressure laboratory, equipped with UV sources for workspace irradiation. Disposable aerosol-resistant plugged pipette tips were used to avoid contamination between samples via communal solutions. Multiple blank extractions and negative controls were run in conjunction with the turkey samples to identify systematic contamination.

The DNA extraction lab and the PCR lab at Simon Fraser University are located in separate buildings, with separate ventilation systems, and all equipment, including pipettes, apparatuses, solutions, cameras, etc., is dedicated to either the DNA extraction or PCR laboratories. Steps were taken to prevent the introduction of modern DNA into the ancient DNA processing areas, and no modern turkey DNA has ever been extracted or set up for amplification within the ancient DNA laboratory space.

Repeat Extractions and Amplifications

In order to ensure that the results were replicable, at least 20% of the successfully sequenced samples underwent either repeat extraction or repeat amplification. Table 8 lists the 20 samples that underwent a repeat extraction, and the 25 samples that underwent repeat PCR amplifications.

In most cases, the repeat extractions or amplifications took place at least 6 months after the initial extraction. All samples which displayed rare or unique haplotypes were re-extracted or re-amplified. Ten additional repeat PCR samples were selected using an online random number generator (http://www.random.org/) to ensure that some of the repeated samples were truly randomly selected.

58 Table 8 Archaeological bone samples that underwent repeat extraction and/or repeat amplification.

Re-extracted Initial Repeat Re-Amplified Initial Repeat Samples Extraction Extraction Sample PCR PCR TU12 14-Jun-06 3-AuQ-OB TU14 AUQ-06 Oct-OB TU33 14-Jun-06 17-Nov-OB TU15* Aua-06 Mar-09 TU44 14-Jun-06 17-Nov-OB TU20 Aua-06 Nov-OB TU127 29-May-07 17-Nov-OB TU21 Aua-06 Oct-OB TU131 29-MaY-07 17-Nov-OB TU36* Apr-07 Mar-09 TU135 29-May-07 30-Jul-07 TU41* Apr-07 Mar-09 TU1003 15-Jan-OB 17-Nov-OB TU4B Jul-06 Oct-OB TU1004 29-Apr-OB 17-Nov-OB TU65* Mar-OB Mar-09 TU1017 25-Nov-07 1B-Dec-07 TU73* Sep-07 Mar-09 TU1034 16-Nov-07 15-Jan-OB TU75* Apr-07 Mar-09 TU1049 16-Nov-07 17-Nov-OB TUB2* Oct-06 Mar-09 TU1053 16-Nov-07 17-Nov-OB TU93 Apr-07 Oct-OB TU1054 16-Nov-07 17-Nov-OB TU107 Nov-07 Oct-OB TU1055 25-Nov-07 1B-Dec-07 TU115* Jul-06 Mar-09 TU1059 16-Nov-07 1B-Dec-07 TU119 Jun-07 Oct-07 TU1061 25-Nov-07 1B-Dec-07 TU121 Jun-07 Oct-OB TU1063 16-Nov-07 17-Nov-OB TU123 Jun-07 Oct-07 TU1066 29-Apr-OB 17-Nov-OB TU125 Jun-07 Oct-07 TU1091 29-Apr-OB 17-Nov-OB TU126 Jun-07 Oct-07 TU1101 16-Nov-07 17-Nov-OB TU141 Apr-OB Oct-OB TU152 Nov-OB Mar-09 TU1019 May-OB Oct-OB TU1020* May-OB Mar-09 TU1041 Nov-07 Oct-OB TU1064* May-OB Mar-09 Note: "Randomly selected sample using on-line random number generator

Chapter Summary

Ancient DNA extraction and analysis were applied to 193 archaeological turkey bones, obtained from 43 archaeological sites, as well as from 27 modern commercially­ raised turkey samples. All archaeological bones samples were photographed and measured, before being processed in the dedicated ancient DNA laboratory in the Department of Archaeology at Simon Fraser University, using a modified silica spin protocol. Two turkey mtDNA fragments were targeted: 1) a 598bp D-Ioop fragment; and 2) a 176bp cytb fragment. D-Ioop sequences were then truncated to 438bp and confident and tentative D-Ioop haplotypes were assigned for positively amplified samples. Successfully amplified samples were sex identified through the co-amplification of a female-specific W-specific chromosome fragment and D-Ioop fragment (mtW).

59 Comprehensive controls were taken during every step of the extraction and amplification procedure to reduce the risk of contamination, including: the use of protective clothing; a positive pressure laboratory; and dedicated lab materials and reagents. Multiple blank extractions and negative controls were included at every step of the analysis, and more than 20% of the successfully sequenced samples underwent either repeat extraction or repeat amplification to identify contamination in the ancient DNA extraction and amplification processes.

60 CHAPTER 4: RESULTS AND AUTHENTICATION

This chapter reviews the overall results of the ancient DNA amplification, sequencing and haplotype analysis. Since ancient DNA results must be proven authentic before they can be used to address research questions, the second portion of this chapter evaluates the evidence supporting the authenticity of these data. More detailed results of phylogenetic and osteometric analyses relating to the three specific research objectives are presented in chapters 5, 6 and 7, respectively. peR Amplification

Amplifications of at least one D-Ioop fragment were observed for 175 of the 193 samples, an amplification success rate of 90.7%. Appendix C presents the PCR amplification results for all samples and primer sets. One hundred and fourty-five samples yielded long amplicons of 324bp or 342bp when amplified with primer sets TK­ F2/TK-R405 or TK-F315/TK-R670, respectively, demonstrating the excellent DNA preservation within the majority of the samples. Figure 6 shows an electrophoresis gel of some positively amplified samples yielding long DNA fragments.

100bp TU5G TU57 TUG5 TUG7 TUG8 TUG9 TU7G TU79 TU80 TU83 BK1 BK2 • -=- =- ...... ~ c;;;;;:;::;a. -=- ~ =-- l~ c:=. -='~ ~ ------

Figure 6 Electrophoresis gel image of 342bp PCR amplified D-Ioop fragments using primers TK-F315/TK-R670Note: TU# indicates individual turkey remains, BK is for blank extractions, and 100bp for 100 base pair ladder (Invitrogen, Carslbad, CA). The short bands at the bottom of the gel are primer-dimers, the product of non-specific binding between primers during PCR amplification

61 The complete 438bp targeted D-Ioop fragment (produced by overlapping primer systems) was obtained for 155 samples, while at least 250bp (in some cases, also produced by overlapping primer systems) were obtained for 172 samples. Table 9 summarizes the D-Ioop sequence lengths obtained for all samples. Slight differences in sequence lengths are principally the result of differences in sequencing quality and sequencing direction.

Table 9 Final overlapping D-Ioop sequences lengths and mtDNA haplotypes obtained for ancient and modern turkey samples D-Ioop D-Ioop Fragment D-Ioop Cyt b LablD Start Position End Position Lenath Haplotype Haplotype TU1 15531 16058 527 aHao1 TU2 15507 16058 551 aHao2 Cvt2 TU3 15531 16058 527 aHao1 TU4 15531 16058 527 aHao1 Cvt1 TU5 15507 16058 551 aHao1 TU6 15531 16058 527 aHao1 TU7 15507 16014 507 aHao1 TU8 15507 16034 527 aHao1 Cvt1 TU9 - - - NA NA TU10 - - - NA TU11 15507 16036 529 aHao1 TU12 15507 16021 514 aHao2 Cvt2 TU13 15531 16005 474 aHao1 TU14 15531 16058 527 aHao2 TU15 15531 16017 486 aHao1 TU16 15507 16011 504 aHao1 TU17 15507 16005 498 aHao1 TU18 15531 16045 514 aHao2 Cvt2 TU19 15531 16005 474 aHao1 Cvt1 TU20 15531 16024 493 aHao1 TU21 15507 16058 551 aHao2c Cvt2 TU22 15531 16014 483 aHao1 TU23 15750 15800 50 IS TU24 15531 16005 474 aHao1 TU25 15531 16008 477 aHao1 TU26 15507 16008 501 aHao1 TU27 15531 15960 429 aHao1 TU28 15531 16045 514 aHao1* TU29 15531 16011 480 aHao1 TU30 15562 16011 449 aHao1 TU31 15507 16011 504 aHao1 Cvt1 TU32 15531 16011 480 aHao1 TU33 15531 16005 474 aHao1 Cvt1 TU34 15543 16020 477 aHao1 TU35 15531 15960 429 aHao1* TU36 15531 16026 495 aHao1 TU37 15537 16025 488 aHao1 TU38 15534 16029 495 aHao1 TU39 15531 16021 490 aHao1 Cvt1 TU40 15531 16021 490 aHao1 TU41 15531 16021 490 aHao1 Cvt1

62 D-Ioop D-Ioop Fragment D-Ioop Cyt b LablD Start Position End Position Lenath Haplotype Haplotype TU42 15531 16038 507 aHao1 TU43 15531 16016 485 aHao1 TU44 15531 16036 505 aHao2* Cvt2 TU45 15531 16016 485 aHao1 TU46 15531 15960 429 aHao1* TU47 15531 16038 507 aHao1 TU48 15507 16058 551 aHao2 Cvt2 TU49 - - - NA NA TU50 15531 15960 429 aHao1* TU51 15531 16031 500 aHao1 TU52 15531 16016 485 aHao1 TU53 15531 16038 507 aHao1 TU54 15531 16011 480 aHao1 TU55 15531 16021 490 aHao1 TU56 15531 16016 485 aHao1 TU57 15531 16021 490 aHao1 TU58 15531 16016 485 aHao1 Cvt1 TU59 15531 16021 490 aHao1 TU60 15651 16027 376 aHao1* NA TU61 - - - NA TU62 - - - NA TU63 15531 16029 498 aHao1 TU64 15531 16021 490 aHao1 TU65 15531 16017 486 aHao1 TU66 15531 16011 480 aHao1 NA TU67 15531 16021 490 aHao1 TU68 15531 16020 489 aHao1 TU69 15531 16005 474 aHao1 TU70 15531 16016 485 aHao1 TU71 15531 16046 515 aHao1 TUn 15531 16017 486 aHao1 TU73 15531 16031 500 aHao1 TU74 15531 16021 490 aHao1 TU75 15531 16031 500 aHao1 Cvt1 TU76 15531 16025 494 aHao1 TU77 15531 16021 490 aHao1 TU78 15531 16009 478 aHao1 TU79 15858 16022 164 IS TU80 15531 16025 494 aHao1 TU81 15531 16021 490 aHao1 TU82 15543 16027 484 aHao1 TU83 15531 16025 494 aHao1 TU84 15531 16021 490 aHao1 TU85 15531 16016 485 aHao1 TU86 15539 16045 506 aHao1 TU87 - - NA NA TU88 15507 16017 510 aHao1 TU89 15531 16009 478 aHao1 Cvt1 TU90 15531 16014 483 aHao1 TU91 15531 16024 493 aHao1 TU92 15531 16008 477 aHao1 TU93 15507 16058 551 aHao1a Cvt1 TU94 15531 16028 497 aHao1 Cvt1 TU95 15531 15787 256 IS NA TU96 15531 16011 480 aHao1 TU97 15531 15960 429 aHao1* TU101 15531 16031 500 aHao1 63 D-Ioop D-Ioop Fragment D-Ioop Cyt b LablD Start Position End Position Lenath Haplotype Haplotype TU102 15531 16031 500 aHao1 TU105 15531 16026 495 aHao1 TU106 15531 16021 490 aHao1 TU107 15531 16021 490 aHao1 TU111 15531 15960 429 aHao1* TU112 15531 16016 485 aHao1 TU113 15534 16016 482 aHao1 TU114 15531 16035 504 aHao1 TU115 15507 16024 517 aHao1 TU116 15531 16022 491 aHao1 TU117 15531 16032 501 aHao1 TU119 15507 16058 551 aHao1 TU120 15531 16009 478 aHao1 TU121 15507 16011 504 aHao1 TU123 15507 16058 551 aHao1 TU124 15531 16058 527 aHao1 TU125 15507 16058 551 aHao1 TU126 15507 16058 551 aHao1 TU127 15531 16058 527 aHao1 Cvt1 TU128 15508 16014 506 aHao1 TU129 - - - NA NA TU130 15508 16021 513 aHao1 TU131 15531 16058 527 aHao1 Cvt1 TU132 15531 15960 429 aHao1* TU133 15531 16000 469 aHao1* TU134 15531 15960 429 aHao1* TU135 15508 16058 550 aHao2e Cvt2 TU136 - - NA TU137 15531 16027 496 aHao1 TU138 15531 16026 495 aHao1 TU139 15531 16039 508 aHao1 TU140 15531 16021 490 aHao1 TU141 15508 16058 550 aHao2 Cvt2 TU142 - - - NA TU147 - -- NA TU148 - - - NA TU149 - - - NA TU150 - - - NA TU151 - - - NA TU152 15531 16058 527 aHao2e TU1001 - - - NA NA TU1003 15531 16038 507 aHao1 Cvt1 TU1004 15531 16035 504 aHao1a Cvt1 TU1009 15507 16058 551 aHao1 TU1010 15531 16014 483 aHao1 TU1015 - - - NA NA TU1017 15507 16045 538 aHao2 Cvt2 TU1018 - - - NA TU1019 15507 16058 551 aHao2c Cvt2 TU1020 15531 16021 490 aHao1 TU1022 15531 16021 490 aHao1 Cvt1 TU1026 15531 15960 429 aHao1* TU1033 15531 16008 477 aHao1 Cvt1 TU1034 15531 16031 500 aHao1 TU1036 - - - NA NA TU1037 15531 16016 485 aHao1 TU1038 15531 15800 269 aHao1*

64 O-Ioop O-Ioop Fragment O-Ioop Cyt b Lab 10 Start Position End Position Lenath Haplotvpe Haplotype TU1039 15507 16021 514 aHao1 TU1041 15507 16058 551 aHao2 Cvt2 TU1049 15531 16036 505 aHao1 TU1052 15531 16021 490 aHao1 TU1053 15531 16036 505 aHao1a Cvt1 TU1054 15531 16044 513 aHao1b Cvt1 TU1055 15507 16058 551 mHao2 Cvt1 TU1057 15531 16028 497 mHao2 Cvt1 TU1059 15531 15960 429 mHao2 TU1061 15531 16037 506 aHao2b NA TU1062 15531 16021 490 aHao1 TU1063 15507 16037 530 aHao2 Cvt2 TU1064 15531 16045 514 aHao1* TU1066 15531 16009 478 aHao1c Cvt1 TU1067 15531 16027 496 aHao1 TU1069 15531 16021 490 aHao1 TU1070 15531 16041 510 aHao1 TU1072 15531 16036 505 aHao1 TU1078 15531 16028 497 aHao1 TU1079 15507 16016 509 aHao1 TU1083 15531 16038 507 aHao1 TU1084 15705 15960 255 aHao1* TU1086 15507 16041 534 aHao1 TU1091 15531 16021 490 aHao1d Cvt1 TU1093 15531 16031 500 aHao1 TU1096 15531 16028 497 aHao1 TU1097 15531 16021 490 aHao1 TU1098 15531 16020 489 aHao1 TU1101 15531 16038 507 aHao2c Cvt2 TU1102 15507 16045 538 aHao1 Cvt1 TU1103 15507 16044 537 aHao1 TU1104 15507 15960 453 aHao1* TU1105 15507 16045 538 aHao1* TU1106 15531 16058 527 aHao2 NA TU1108 15531 15960 429 aHao2d* NA TU1109 15794 15960 166 IS NA TU1111 15531 15960 429 aHao2* Cvt2 TU1112 15531 15960 429 aHao2d* NA MTU1 15531 16058 527 mHao2 MTU2 15531 16058 527 mHao1 Cvt1 MTU3 15531 16058 527 mHao1 MTU4 15531 16058 527 mHao1 MTU5 15531 16058 527 mHao1 MTU6 15531 16058 527 mHao1 Cvt1 MTU7 15531 16058 527 mHao2 Cvt1 MTU10 15531 16058 527 mHao2 MTU11 15531 16058 527 mHao1 MTU28 15531 16058 527 mHao2 Note: Start and End positions based on M. gallopavo GenBank reference EF153719 * indicates 'tentative' haplotype, NA denotes a failed samples ('no amplification'), while IS indicates insufficient sequence for haplotype assignment.

Of the 54 ancient samples amplified using cytb primers TK-F215/R391, 39 were successfully amplified and sequenced (PCR amplifications for each sample are listed in

65 Appendix C, results summarized in Table 9). Three modern turkey samples were also amplified and sequenced using cytb primers (Table 9).

Eighteen ancient turkey remains did not yield any turkey mtDNA (either using D­ loop or cytb primers) despite multiple PCR set-ups. Eight of these samples were amplified using two more generic bird cytb primer sets: GA-F407/GA-R627 designed to amplify a 220bp fragment, and GA-F524/GA-R627 designed to amplify a 102bp fragment. These particular samples were re-tested as they either represented fragmentary remains that could not be confidently identified as turkey, or from bone elements that were either significantly larger (e.g. TU87) or smaller (e.g.TU129) than expected for typical M. gallopavo remains. The results of the PCR amplification and species identifications can be found in Table 10; BLAST searches and multiple alignments of successfully sequenced samples indicated that four samples were M. gallopavo, one of the samples (TU87) was from a Canada goose.

Table 10 PCR amplification and sequencing results using 'Bird Cytb' primers

Lab 10 220bp fraa 102bp fraa Species 10 TU49 X ./ M. gallopavo TU61 ./ ./ M. qallopavo TU62 X X - TU?9 ./ ./ M. gallopavo TUB? X ./ B. canadensis TU129 X X - TU1001 X X - TU1015 X ./ M. gallopavo Note: X indicates failed PCR amplification, ./ indicates successful PCR amplification and sequencing.

Direct Sequencing

Most samples that produced strong D-loop or cytb amplifications returned generally clear sequencing results (Appendix C). Strong primer-dimers (the products of non-specific binding between primers during PCR amplification) were occasionally seen on the electrophoresis gels (see Figure 6). In some cases, primer-dimers could not always be completely removed through the PCR product purification process, and 'messy' areas at the beginning of the sequence electropherograms were sometimes observed. These 'messy' beginnings rarely affected the haplotype identification of the

66 samples, since sequences were truncated from around 550bp to 438bp. Samples that produced ambiguous sequences due to poor sequencing quality, or either excessively weak or strong signal strengths were re-sequenced in order to achieve clearer results.

Some DNA template damage was also observed as sequence miscoding and base modifications. Hydrolysis and oxidation are two major processes which damage DNA templates over time, and may results in strand breaks, or base modifications (Eglinton and Logan 1991; Lindahl 1993). During hydrolysis, the N-gycosyl bond between the base and sugar breaks down in the presence of water, resulting in deaminization of bases and in depurination of deoxyribose-adenine or deoxyribose­ guanine bonds (Hoss et al. 1996; Lindahl 1993). Oxidation distorts the helix through the interaction of free radicals and ionizing radiation with the DNA, which can result in modified bases, cross-links, and the modification of pyrimidines (C and T) to hydantoins (Gilbert et al. 2003; Lindahl 1993). Although most DNA damage will impede PCR enzymatic activity (Hoss et al. 1996), some damage may not hinder PCR, but merely produce miscoding lesions. The most common base modifications arising from deamination of cytosine to urasil (thyamine's analogue), or the deamination of adenine to hypoxanthine (guanine's analogue), resulting in A ---+G (type 1) or C ---+T (type 2) transitions (Gilbert et a/. 2003; Hansen et a/. 2001). However, because either of the complementary DNA strands can be sequences, these transitions can be reflected in two ways. Type 1 damage may be reflected as an A ---+G transition, or as a T---+C transition if the complementary strand is sequenced. Similarly, type 2 damage may be observed as either a C ---+T or a G ---+A transition.

Appendix D displays the base pair positions and ambiguities associated with miscoding lesions in the ancient sequences. Ninety-four of the 96 miscodings were 'type 2' transitions (C ---+T,G ---+A), and only two mixed peaks resulting from 'type l' damage (T---+C) were observed. This ratio of 'type 2' to 'type l' damage is consistent with that found in other ancient DNA studies (Gilbert et a/. 2007; Paabo et a/. 2004). Just over 60% of the damage occurred within the first 200bp of the D-Ioop, an area particularly rich in repetitive strings of Ts and Cs. Samples displaying probable miscodings were re­ amplified and re-sequenced at least once to ensure that the base modifications were damage-induced rather than authentic polymorphic areas.

67 D-Ioop Haplotypes

Twelve haplotypes were identified within the ancient and modern samples; Table 11 summarizes the polymorphic sites that define each haplotype, while Appendix E presents the complete multiple alignments of the 12 D-Ioop haplotypes.

Table 11 Polymorphic sites defining each haplotype

II) II) .... en CD II) II) N C") co "Ilt II) C") en #of .... N ...... co C") II) co en 0 N "Ilt II) en Haplotype II) CD CD CD CD ...... co co co en en II) II) II) II) II) II) II) II) II) II) II) II) II) II) samples ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ (n=) EF153719 CC T CC TT CC T A C T C - aHap1 C C C 142 aHap1a T C C C 3 aHap1b C C C C 1 aHap1c T C C C 1 aHap1d T C C C 1 aHap2 T C T TT C T C 12 aHap2b T C T TT T C 1 aHap2c T C T T C C 3 aHap2d T C T T CG C ? 2 aHap2e C T T C CT 2 mHap1 6 mHap2 C 7

Haplotypes were assigned for 171 of the 175 successfully amplified archaeological samples and all 10 of the sequenced modern samples (Table 9). Only four samples failed to produce replicable sequences of sufficient length to assign a haplotype. Confident haplotypes were assigned for 161 of the 181 samples, while tentative haplotypes were assigned for the remaining 20 samples. Table 12 defines the ambiguities or missing data for each of the tentatively assigned samples. Most 'tentative' haplotypes were the results of PCR failure for either primer set TK-F90/TK­ R261 or TK-F411-R670. Failure of the former primer set resulted in missing data for positions 15613-15650, while failure of the latter resulted in missing data for 15961­ 16004, the last 44bp of the D-Ioop fragment.

The majority of the archaeological samples were represented by a single haplotype: aHap1 was found in 142 of the ancient samples, representing 83% of the successfully amplified archaeological samples. The next most common type was aHap2, found in 12 ancient samples (7%). The remaining ancient haplotypes were represented 68 by one to three samples each. All of the 10 modern turkey samples were assigned to one of two haplotypes (mHap1 and mHap2), which was either identical or differed by one base pair from the M. gallopavo GenBank EF153719 reference sequence. Three ancient sequences (TU1055, TU1057 and TU1059) also matched the modern haplotype mHap2.

Table 12 Missing or ambiguous data for the 20 'tentative' haplotypes

Missing LablD Missing Data Positions bp ambiguities base pairs TU28 15613-15650 37 15980 -N TU35 15613-15650, 15961-16004 81 TU44 15613-15650 37 15979 -N TU46 15613-15650, 15961-16004 81 TU50 15613-15650 37 TU60 15567-15651 84 TU97 15960-16004 44 TU111 15960-16004 44 TU132 15960-16004 44 TU133 16001-16004 3 TU134 15613-15650,15961-16004 81 TU1026 15613-15650,15961-16004 81 TU1038 15613-15650 37 TU1064 15800-16004 204 TU1084 15960-16004 44 TU1104 15613-15650, 15961-16004 81 TU1105 15613-15650 37 15591 -Y TU1108 15960-16004 44 TU1111 15779-15793, 15961-16004 58 15782 - y TU1112 15960-16004 44 15844-Y, 15868-Y

Cytochrome b Haplotypes

Only two haplotypes were identified within the obtained cytb sequences, Cyt1 and Cyt2, respectively. The cytb sequences were generally clear, and displayed very few ambiguous base pairs or miscoding lesions. All successfully amplified samples were assigned 'confident' cytb haplotypes. Table 9 summarizes the cytb haplotypes for the 39 successfully amplified samples, and Figure 7 presents a multiple alignment of the two cytb haplotypes with M. gallopavo GenBank reference sequence EF153719. The two haplotypes are differentiated by two polymorphic sites (position 13938 and 14015).

69 Further phylogenetic analyses of the D-Ioop and cytb haplotypes, and their relationship to modern wild turkey populations are presented in Chapter 5.

13940 13950 13960 13970 13980 I II II II II I EF153719 TTC TTCTTCATCT GCATCTTCCT ACACATTGGA CGCGGCCTAT ATTATGG Cyt1 Cyt2 T

13990 14000 14010 14020 14030 I I I II II I I I EF153719 TTC GTACCTATAT AAAGAAACCT GAAATACAGG AGTAGTCTTA CTTCTCA Cyt1 Cyt2 C

Figure 7 Multiple alignment of obtained cytb sequences and M. gallopavo GenBank isolate EF153719 (dots indicate identical base pair to the reference).

Sex Identification of Ancient Turkey Samples

All samples with successfully assigned haplotypes underwent genetic sex identification. Various combinations of mtDNA primers and the Pstl W chromosome primers were tested in order to achieve a relatively even co-amplification. The method was originally tested using cytb and Pstl primers, however the similarity in amplicon length of the two fragments (176bp vs 144bp) made it difficult to preferentially amplify the Pstl fragment, resulting in weak Pstl bands, in spite of the high mtDNA to W primer ratios (Figure 8).

TU1 TU3 TU4 TU5 TU7 TU8 TU12 TU13 TU14

_I" .. ~ ---

Figure 8 Electrophoresis gel of co-amplified DNA extracts with cytb and Pst! primers (upper bands represent cytb fragments, while lower bands represent Pst! fragments); blank and negative controls were included in amplification, but run a separate portion ofthe gel; 100bp indicated the 100 base pair ladder (Invitrogen, Carslbad, CA)

70 The co-amplification was also attempted with longer D-Ioop fragments (TK­ F315/TK-R670), which resulted in a 45% amplification failure, or the amplification of either the D-Ioop or the Pstl fragments, but rarely both fragments (Figure 9).

100bp TU34 TU36 TU37 TU38 TU39 TU40 TU41 TU42

. • - .. ,; -- -

Figure 9 Electrophoresis gel of co-amplified turkey DNA extracts using D-Ioop primers TK-F315/TK-R670 and Pstl primers, demonstrating a high failure rate and uneven co-amplification (upper bands represent cytb fragments, while lower bands represent Pst! fragments); blank and negative controls were included in amplification but run a separate portion of the gel; 100bp indicated the 100 base pair ladder (Invitrogen, Carslbad, CA)

The most successful co-amplification was achieved with D-Ioop primers TK­ F315/R567 (producing a 222bp amplicon) in combination with the Pstl primers. Using a primer ratio of 1: 10 of D-Ioop to Pstl, a relatively even co-amplification was achieved for most female samples, though well-preserved samples tended to have a stronger Pstl amplifications, while more degraded DNA samples tended to have stronger D-Ioop amplification (Figure 10). This primer combination and concentration was used for the bulk of the extracts.

Based on initial and repeat sex identification tests, sex was assigned to 146 of 171 tested samples, representing a success rate of 85% for the tested samples, and 75.6% of the total 193 samples. Table 13 presents the assigned sex for each of the ancient turkey samples. Of the 146 successful samples, 60 samples (41 %) were identified as female and 86 samples (59%) as male.

71 100bp TU141 TU152 TU1004 TU1009 TU1010 TU1019 TU1020 TU1022 BK j r__~ , ,- r- ...... _'*~--_.:: ...--; a:..-..:-~ (" ,(:' -... -_.--

-~ .... _....------

Figure 10 Electrophoresis gel showing the final mtW co-amplification ratio (1 :10 of D-Ioop to Pstl primers); upper bands represent cytb fragments, while lower bands represent Pstl fragments); the short band at the very bottom of the gel are primer-dimers; 100bp indicated the 100 base pair ladder

Table 13 Final sex identifications of tested archaeological turkey samples

Lab 10 Haplotype Initial 10 Repeat 10 Final Sex TU1 aHap1 Female Female Female TU2 aHap2 Male Male Male TU3 aHap1 Female Female Female TU4 aHap1 Female Female Female TU5 aHap1 Female Female Female TU6 aHap1 Female Female Female TU7 aHap1 Male Male Male TU8 aHap1 Female Female Female TU11 aHap1 NA - NA TU12 aHap2 Male Male Male TU13 aHap1 Male Male Male TU14 aHap2 Male Male Male TU15 aHap1 Male Male Male TU16 aHap1 Male Male Male TU17 aHap1 Male Male Male TU18 aHap2 NA - NA TU19 aHap1 Female Female Female TU20 aHap1 Male Male Male TU21 aHap2c Male Male Male TU22 aHap1 Male Male Male TU24 aHap1 Female Female Female TU25 aHap1 Male Male Male TU26 aHap1 Male Male Male TU27 aHap1 Male Male Male TU28 aHap1 NA - NA TU29 aHap1 Male Male Male TU30 aHap1 Male Male Male TU31 aHap1 Female - Female TU32 aHap1 Male Male Male TU33 aHap1 NA - NA TU34 aHap1 Female Female Female TU35 aHap1 NA - NA TU36 aHap1 Male Male Male TU37 aHap1 Male Male Male

72 Lab 10 Haplotype Initial 10 Repeat 10 Final Sex TU38 aHap1 Male Male Male TU39 aHap1 Female - Female TU40 aHap1 Male Male Male TU41 aHap1 Male Male Male TU42 aHap1 Male Male Male TU43 aHap1 NA - NA TU44 aHap2 Male NA NA TU45 aHap1 Male Male Male TU46 aHap1 Male Male Male TU47 aHap1 Male Male NA TU48 aHap2 Female - Female TU50 aHap1 NA NA NA TU51 aHap1 Female - Female TU52 aHap1 Female - Female TU53 aHap1 Male Male Male TU54 aHap1 Female - Female TU55 aHap1 Male Male Male TU56 aHap1 Male Male Male TU57 aHap1 Female - Female TU58 aHap1 Male Male Male TU59 aHap1 NA - NA TU60 aHap1 NA - NA TU63 aHap1 Female - Female TU64 aHap1 NA - NA TU65 aHap1 Male Male Male TU66 aHap1 Male Male Male TU67 aHap1 Male Male Male TU68 aHap1 Female Female Female TU69 aHap1 Female - Female TU70 aHap1 Male Male Male TU71 aHap1 Male Male Male TU72 aHap1 Female - Female TU73 aHap1 Female? Female Female TU74 aHap1 Male Male Male TU75 aHap1 Female - Female TU76 aHap1 Female Female Female TU77 aHap1 Male Male Male TU78 aHap1 Female - Female TU80 aHap1 Male Male Male TU81 aHap1 Female - Female TU82 aHap1 Female - Female TU83 aHap1 Male Male Male TU84 aHap1 Male? Male Male TU85 aHap1 Male Male Male TU86 aHap1 Female - Female TU88 aHap1 Male Male Male TU89 aHap1 Male Male Male TU90 aHap1 Female - Female TU91 aHap1 Male Male Male TU92 aHap1 Female - Female TU93 aHap1a Male Male Male TU94 aHap1 Male Male Male TU96 aHap1 Female - Female TU97 aHap1 NA - NA TU101 aHap1 Male Male Male 73 Lab 10 Haplotvpe Initial 10 Repeat 10 Final Sex TU102 aHap1 NA - NA TU105 aHap1 Female - Female TU106 aHap1 Male Male Male TU107 aHap1 Male Male Male TU111 aHap1 Male Male Male TU112 aHap1 Female - Female TU113 aHap1 Male Male Male TU114 aHap1 Male Male Male TU115 aHap1 Female Female Female TU116 aHap1 Male Male Male TU117 aHap1 Male Male Male TU119 aHap1 Female - Female TU120 aHap1 Male Male Male TU121 aHap1 Female - Female TU123 aHap1 Male Male Male TU124 aHap1 Male Male Male TU125 aHap1 Female Female Female TU126 aHap1 Female - Female TU127 aHap1 Male Male Male TU128 aHap1 Male Male Male TU130 aHap1 Male Male Male TU131 aHap1 Female - Female TU132 aHap1 Female - Female TU133 aHap1 Female - Female TU134 aHap1 Female - Female TU135 aHap2e Male Male Male TU137 aHap1 Male Male Male TU138 aHap1 Female - Female TU139 aHap1 Female - Female TU140 aHap1 Female -- Female TU141 aHap2 Male Male Male TU152 aHap2e Male Male Male TU1003 aHap1 Female - Female TU1004 aHap1a Male Male Male TU1009 aHap1 Male Male Male TU1010 aHap1 Female Female Female TU1017 aHap2 Male Male Male TU1019 aHap2c Female Female Female TU1020 aHap1 Female - Female TU1022 aHap1 Female - Female TU1026 aHap1 Male Male Male TU1033 aHap1 Male Male Male TU1034 aHap1 Female - Female TU1037 aHap1 Male Male Male TU1038 aHap1 NA - NA TU1039 aHap1 Male Male Male TU1041 aHap2 Male Male Male TU1049 aHap1 Female - Female TU1052 aHap1 Male Male Male TU1053 aHap1a Male Male Male TU1054 aHap1b Female Female Female TU1055 mHap2 Female - Female TU1057 mHap2 Male Male Male TU1059 mHap2 NA - NA TU1061 aHap2b Male Male Male 74 Lab 10 Haplotype Initial 10 Repeat 10 Final Sex TU1062 aHap1 Male Male Male TU1063 aHap2 Male Male Male TU1064 aHap1 Male Female Female TU1066 aHap1c Male Male Male TU1067 aHap1 Male Male Male TU1069 aHap1 Female - Female TU1070 aHap1 Male Male Male TU1072 aHap1 Male Male Male TU1078 aHap1 Male Male Male TU1079 aHap1 Male Male Male TU1083 aHap1 Male Male Male TU1084 aHap1 NA NA NA TU1086 aHap1 Male Male Male TU1091 aHap1d Female - Female TU1093 aHap1 Male Male Male TU1096 aHap1 Female - Female TU1097 aHap1 Female - Female TU1098 aHap1 Male Male Male TU1101 aHap3 Male Male Male TU1102 aHap1 NA - NA TU1103 aHap1 Male Male Male TU1104 aHap1 Female - Female TU1105 aHap1 Male? Male Male TU1106 aHap2 Male Male Male TU1108 aHap2d NA - NA TU1111 aHap2 Female Female Female TU1112 aHap2d NA - NA Note: NA indicates 'No amplification', ? indicates an ambiguous sex ID based on visual examination of the electrophoresis gel results.

Genetic Sex and Morphological Size

The obtained genetic sex was compared to the morphological size of the bone samples using available measurements for all adult long bone fragments. Due to the highly fragmented nature of the archaeological samples, morphological sex could not be determined using published criteria (such as Kooliath 1975 in Gilbert et al. 1996 or Wakeling et al. 1997), since they are based on the greatest length of the complete element. Additionally, these criteria are based on extant wild turkey populations, and may not be comparable to the ancient Southwest domestic population. Instead, genetic sex results were compared to the relative size of the available long bone elements (tarsometatarsi, tibiotarsi, and humeri), using several dimensions.

Appendix F presented the bivariate plots and frequency distributions comparing genetic sex and morphological size. The genetic sex identified using the mtW technique corresponded with the morphological size of the elements in all cases, with relatively smaller elements identified as female and larger elements identified as male. Since no

75 overlap occurred between the measurements of the largest females and the smallest males (for any element), characterizing the elements as males or females based on their morphological size was very straightforward.

Table 14 demonstrates that the success rate for mtW amplification was generally equal for both sexes. There were 25 cases where the mtW technique failed, but a tentative sex could be assigned based on element size (Appendix F). Thirteen of the failed mtW cases were morphologically consistent with females and 12 failed mtW cases were consistent with male. The mtW success rates for each sex were calculated based on the number of failed and successful mtW samples in each morphological sex category, resulting in 74% and 81% for males and females respectively. These relatively even success rates demonstrate that the mtW technique is not biased towards the preferential amplification of either sex.

Table 14 Frequency and proportion of failed mtW samples in each morphological size category Morphologically Female Morphologically Male Total n= % of Females n= % of Males n= mtWsuccess 40 74.1 50 80.6 90 mtWfail 13 24.5 12 19.4 25 Total 53 100.0 62 100.0 115

Sex Identification of Modern Samples

The 27 modern commercially-raised turkey samples underwent a variety of sex identification techniques. The 20 turkey samples obtained from Valley Creek farms (MTU10-MTU29) were morphologically identified as males or females prior to the birds' slaughter (the sex of the six samples obtained from grocery store meat, MTU1-MTU7, could not be determined morphologically). All 27 modern turkey samples then underwent the same genetic sex identification technique as the ancient extracts, i.e. samples were co-amplified using D-Ioop (TK-F315/R567) and Pstl primers, in various ratios, until an even co-amplification could be achieved. The final primers concentrations of D-Ioop to Pstl primers were the same as for the ancient samples (1: 10), Figure 11. These mtW sex identifications were confirmed using the HINTW primer sets (Figure 12). The amplification of the HINTW fragment should indicate female birds, while the absence of visible amplification should indicate male birds.

76 100 MTU MTU MTU MTU MTU MTU MTU BK Neg bp 1 2 3 4 5 6 7 cont cont ...... -----.-----...... ~~~---- ...... ~ ...... - - -- - ... 100 MTU MTU MTU MTU MTU MTU MTU MTU MTU MTU MTU bp 10 11 12 13 14 15 16 17 18 19 20 - - - - - ~ - ""-- :....:.-. .:..;-;.. - --- .... _---.

MTU MTU MTU MTU MTU MTU MTU MTU MTU BK Neg 21 22 23 24 25 26 27 28 29 cont cont s_s.~aeeeEE: ------­_.- -- Figure 11 Electrophoresis gels displaying the mtW amplification results for the modern turkey samples (upper bands represent cytb fragments, while lower bands represent Pstl fragments); BK and Neg indicate the blank extract and negative control, 100bp indicates 100 base pair ladder (Invitrogen, Carslbad, CA).

100 MTU MTU MTU MTU MTU MTU MTU MTU MTU MTU MTU MTU MTU MTU bp 1 2 3 4 5 6 7 10 11 12 13 14 15 16 ?!""

_..~ •--...... - - - .... - - ""...

100 MTU MTU MTU MTU MTU MTU MTU MTU MTU MTU MTU MTU MTU BK Neg bp 17 18 19 20 21 22 23 24 25 26 27 28 29 cont coni ------Figure 12 Electrophoresis gel displaying the amplification of the HINTW gene fragment for modern turkey samples; BK and Neg indicate the blank extract and negative control, 100bp indicates 100 base pair ladder (Invitrogen, Carslbad, CA).

77 Table 15 compares the morphological and genetic sex identification results for all three genetic tests, as conducted for all 27 modern samples. In all but two cases, the morphological and genetic sexing yielded consistent results.

Table 15 Provenience and sex identification results for modern turkey samples Morphological Final LablD Provenience mtWSex HINTW Sex SexlD MTU1 Supermarket Unknown Female Male Female MTU2 Supermarket Unknown Female Female Female MTU3 Supermarket Unknown Female Female Female MTU4 Supermarket Unknown Female Female Female MTU5 Supermarket Unknown Female Female Female MTU6 Supermarket Unknown Female Female Female MTU7 Supermarket Unknown Female Female Female MTU10 Valley Creek Farms Male Male Male Male MTU11 Valley Creek Farms Male Male Male Male MTU12 Valley Creek Farms Male Male Male Male MTU13 Valley Creek Farms Male Male Male Male MTU14 Valley Creek Farms Male Male Male Male MTU15 Valley Creek Farms Female Female Female Female MTU16 Valley Creek Farms Female Female Female Female MTU17 Valley Creek Farms Female Female Female Female MTU18 Valley Creek Farms Female Male Male Male MTU19 Valley Creek Farms Female Female Female Female MTU20 Valley Creek Farms Female Female Female Female MTU21 Valley Creek Farms Female Female Female Female MTU22 Valley Creek Farms Female Female Female Female MTU23 Valley Creek Farms Female Female Female Female MTU24 Valley Creek Farms Female Female Female Female MTU25 Valley Creek Farms Male Male Male Male MTU26 Valley Creek Farms Male Male Male Male MTU27 Valley Creek Farms Male Male Male Male MTU28 Valley Creek Farms Male Male Male Male MTU29 Valley Creek Farms Male Male Male Male

MTU1 was identified as female using the mtW technique, and male with the HINTW technique. Since MTU1 was obtained from a supermarket, no morphogical sex identification was possible. Repeat PCR amplifications using both the mtW and HINTW confirmed the bird was female (Figure 13). The amplification failure of the HINTW fragment in the initial amplification may have been due to either allele drop out or a technical error during PCR set-up.

78 100bp MTU1 MTU1 MTU1 MTU2 BK Neg 100bp MTU1 MTU1 MTU1 MTU2 BK Neg .. _:.. .4Iil:i:It ...... &.;..'- ,...... - ..;. -, ...... -- I- - -- - HINTW re-amplification mtW re-amplification

Figure 13 Repeat amplifications of MTU1 using HINTW and mtW technqiues. MTU2 was included as a PCR positive control in both cases. BK and Neg indicate the blank extract and negative control, 100bp indicates 100 base pair ladder (Invitrogen, Carslbad, CA).

The second sex identification ambiguity occurred with sample MTU18. MTU18 was morphologically identified as female, though both genetic sex identification techniques pointed to male. This discrepancy is likely due to a morphological misidentification, as secondary sexual characteristics, such as snood development can vary between individuals.

Authenticity of Ancient DNA Results

Ancient DNA results must be proven authentic before they can be used to address research questions, and several publications have outlined the protocols required to ensure authenticity (Cooper and Poinar 2000; Paabo et al. 2004; Poinar 2003). Poinar's (2003) publication outlines 10 criteria which can be used to test the authenticity of ancient and forensic DNA. These criteria are: 1) physically isolated work area, such as the separation of the pre-PCR and post-PCR work spaces, and the use of ancient DNA dedicated equipment including clothing, equipment and reagents; 2) peR control amplifications, including blank extractions and negative controls run along side the ancient samples; 3) appropriate molecular behaviour, i.e. there should be an inverse relationship between amplification efficiency and amplification length, as fragments longer than approximately 500bp are not expected to amplify effectively in ancient samples (Paabo et al. 1989); 4) quantitation of DNA copy number should be assessed using Real-time PCR or a competitive PCR assay; 5) reproducibility of results from the same and different extracts of a specimen; 6) cloning the amplified products to test the ratio of authentic to exogenous DNA, and identify damage induced modifications; 7)

79 independent replication of samples extraction, amplification and sequencing within another dedicated laboratory; 8) biochemical preservation, such as assessing the total amount, composition, and diagenetic change in proteins or other residues; 9) analysis of associated remains, such as other faunal remains recovered from similar contexts to test for comparably preserved DNA; and 10) phylogenetic sense, phylogenetic analysis of ancient or extinct species should demonstrate an affiliation with modern related species.

While Poinar's criteria provide a useful guide for examining authenticity, strict adherence to these criteria can never guarantee the absence of false positive results. Common sense and multiple lines of evidence including archaeological, osteological, ethnographic, and statistical evidence should always be used to rigorously test the robusticity of the ancient DNA results. Many of the aforementioned criteria, as well as other osteological and archaeological lines of evidence were used to ensure that the DNA results in this study were authentic.

The degradation and damage to ancient DNA means that even minuscule amounts of modern DNA can exceed the targeted DNA during PCR (Richards et al. 1995); therefore, comprehensive contamination controls were taken during every step of the extraction and amplification procedure. Starting with the project's design stage, all primers were carefully scrutinized to ensure that they would not bind with human DNA, in order to false positive PCR amplification. Since DNA from common commercial 'food' species can be omnipresent in the environment (Leonard et al. 2007), the turkey D-Ioop and cyt b primers were also designed to avoid binding to chicken DNA. Additionally, to prevent modern reference DNA samples themselves or their PCR products from contaminating ancient DNA samples, the bulk of the modern samples was collected, extracted and amplified after the extraction and sequencing of all archaeological sample (Yang and Speller 2006).

Physically Isolated Work Area

Archaeological samples were processed within a lab dedicated to ancient DNA analysis - no modern DNA is processed in this lab. Sample preparation, extraction and PCR set-up took place in a positive pressure laboratory, equipped with UV sources for decontamination. Disposable aerosol-resistant pipette tips were used to avoid contamination between samples via communal solutions and buffers. Protective clothing,

80 including masks, disposable gloves, and Tyvek™ suits with hoods and shoe covers, was worn during bone decontamination, extraction and PCR set-up procedures.

The Pre-PCR lab and Post-PCR labs are located in separate buildings, with separate ventilation systems, and same-day travel between the PCR lab and the Pre­ PCR lab is generally prohibited. All equipment, including pipettes, apparatuses, solutions, cameras, etc. are dedicated to either the Pre-PCR or PCR laboratories.

Most of the archaeological turkey bone samples examined in this study had been stored in close contact with other archaeological turkey bones, and may have been exposed to modern reference samples during morphological comparison. Sample cross­ contamination with both ancient and modern remains was therefore a possibility. A rigorous chemical decontamination control was applied to counteract possible surface contamination, including immersion in sodium hypochlorite, hydrochloric acid and sodium hydroxide. Decontamination with bleach has been recommended by several ancient DNA publications (Dissing et al. 2008; Kemp and Smith 2005; Malmstrom et at. 2007), and Watt's (2005) study indicated that immersion of the bone in a 100% commercial bleach solution for seven minutes should be sufficient to remove surface contaminants, while ensuring the survival of endogenous DNA within the bone.

PCR Control Amplifications

The extensive contamination controls undertaken in this study seem to have been successful at eliminating any systematic contamination as no turkey mtDNA peR amplification was observed in non-turkey bone samples (e.g. TU87, a Canada goose bone), blank extracts or PCR negative controls (though primer-dimers were sometimes observed).

Molecular Behaviour

The amplifications followed the molecular patterns expected for ancient DNA, i.e. the samples displayed an inverse relationship between amplification efficiency and amplification length. Though at least one amplicon of over 300bp was obtained for most samples (75%), more than half of the samples that failed using longer primer systems were often successful using shorter primer sets.

81 The overall DNA preservation in the samples also followed expected patterns based on age and geographic location of the archaeological sites. All samples were obtained from sites dating within the last 1500 years, and well within the limitations for ancient DNA preservation (Paabo ef al. 2004). Samples recovered from cooler climatic regions (i.e. higher elevations, and/or higher latitude sites) exhibited greater DNA preservation than samples obtained from desert sites. For example, 26 of the 32 samples from Sand Canyon Pueblo, located on the Colorado Plateau between 1500­ 2100m, were easily amplified using only the two long primer sets. In contrast, of the seven samples obtained from the Calderon Site in Chihuahua's Sonoran desert, only two could be amplified. Moreover, 16 separate PCR amplifications were performed to obtain a reliable consensus sequence for one of the two successful samples (TU 135 ­ Figure 14).

TU135• -0077 -TK-R407 TUl3 5x-E18 7 -TK-F14 3

TU135bx-E18 7 -TK-R4 05

TU135 -E189 -TK-F2

TU13 SB-D133 -TK-F2

TU135 -0084 -TK-F2 TU13 Sb-E186 -TK-F31S

TU13SD76--TK-F2 TU135x-E190 -TK-R6 70

TU135B-D13 3 -TK-R407 TU135Bx-D134 -TK-F31S

TR13 5 -E189 -TK-R405 TU135 -E186 -TK-R56 7

TU135 -0084 -TK-R407 TR13 5x-E190 -TK-F315

560

Figure 14 Overlapping sequences required to obtain a reliable consensus sequence for TU135 (arrows indicate sequencing direction for each of the amplicons)

Quantitation and Biochemical Preservation

Due to the excellent DNA preservation observed in the bulk of the archaeological samples, DNA quantitation through either Real-time PCR or competitive PCR was not undertaken. Quantifying DNA copy number is undoubtedly an important step when working with ancient human or hominid samples, especially in samples with starting template <1000 copies, since modern human contamination may be a significant issue (Paabo ef al. 2004). However, adequate template appeared to be present in the archaeological turkey Oudging by the amplification success rate) and no other lines of

82 evidence, including blank and negative controls, or the sequences themselves indicated the likelihood of contamination from modern sources.

Other tests of biochemical preservation, such amino acid racemization (Poinar et al. 1996), or flash pyrolysis with GC and MS (Poinar and Stankiewicz 1999) were not conducted for similar reasons. Although total amount and composition of amino acids, or other organic compounds may act as a useful proxy for DNA preservation in bones, they are more useful as a screening method for ancient DNA feasibility in very old or precious samples (Paabo et al. 2004). However, the bulk of the samples demonstrated good morphological preservation, and considering the relatively recent age of the samples, other biochemical preservation tests were considered superfluous.

Reproducibility and Independent Replication

Bone samples and DNA extracts should be re-extracted or re-amplified in order to detect contamination of any individual sample, and to identify miscoding lesions or sequencing errors (Paabo et al. 2004). In order to ensure that the results were replicable, more than 20% of the successfully sequenced samples underwent either repeat extractions or repeat amplifications. In all cases, the replicated results were consistent with the initial analysis. Some damage-induced modifications were observed within some re-amplified samples, which may be expected in DNA extracts that are re­ amplified up to two or three years after initial extraction.

None of the bone samples extracted in this study was replicated in another independent ancient DNA facility, as independent replication is usually only warranted "when a novel and unexpected result of great consequence is obtained" (Paabo et al. 2004:658). However, a separate ancient DNA project conducted by Scott Wyatt, Dr. Brian Kemp, and colleagues at Washington State University amplified turkey mtDNA sequences from 29 archaeological turkey coprolites recovered from the Turkey Pen on Arizona's Black Mesa (Speller et al. in prep; Wyatt et al. 2009). Three of the haplotypes recovered at the Washington State University laboratory were not only identical to those recovered in this study (aHap1, aHap2 and aHap2c), but their relative frequency within the whole sample was similar as well. The match of turkey mtDNA haplotypes in two different laboratories, using different primer sets, and different archaeological samples is significant evidence to support the authenticity of this study's ancient turkey sequences.

83 Cloning

Cloning amplified products can test the ratio of authentic to exogenous DNA and identify damage induced modifications (Paabo et al. 2004). Cloning was not undertaken in this study, as repeated amplifications and sequencing were capable of identifying and resolving damage-induced ambiguities. The most common form of miscoding was 'type 2' C-T transitions, which were easily resolved with repeat amplification and sequencing, and did not interfere significantly with haplotype assignment.

Associated Remains

Due to the sheer number of sites and geographic regions, this study did not analyze additional associated archaeological material to test for the overall DNA preservation at each site. However, the levels of DNA preservation exhibited in this study are comparable to those obtained from other Southwest ancient DNA studies. For example, Yang et al.'s (2005) study of archaeological rabbit remains from the Pueblo II site of Stix and Leaves Pueblo (5MT11555) in Montezuma County, CO region yielded a 100% success rate from 20 samples. Approximately 85% of tested archaeological human samples from Grand Gulch/Canyon de Muerto yielded mtDNA in O'Rourke et al.'s (1996) study, while Carlyle et al.'s (2000) study of human remains from Canyon del Muerto and the Grand Gulch and Colorado River areas yielded a slightly lower success rate of 68%.

Phylogenetic Sense

BLAST searches and phylogenetic analysis indicated that the recovered archaeological sequences matched identically or very closely with reference M. gallopavo sequences. Although five of the 11 ancient haplotypes (aHap1 a, aHap1 b, aHap1 c, aHap1 d, aHap2d) did not have identical matches in GenBank, they differed from known haplotypes by only one base pair, respectively, and fall well within the expected variation of M. gallopavo subspecies. Of the six ancient haplotypes that did display matches in GenBank, only one was consistent with modern commercially-raised turkey mtDNA haplotypes (mHap2). Although a match with commercially-raised turkey sequences may indicate contamination with modern turkey DNA, the three archaeological samples (TU1055, TU1057, TU1059) displaying this modern haplotype were recovered from the late 19th century site of Fort Bowie, where modern varieties of

84 turkeys, chicken and ducks were known to have been raised (Herskovitz 1978), thus recovery of a modern haplotype within these samples is expected. Additionally, these three samples underwent either repeat extraction or amplification (Table 8 & 9), and consistently produced the same mHap2 haplotype.

Sex Identification Results

This research included the development of a new sex identification technique, mtW co-amplification, designed to amplify highly-repetitive fragments of nuclear sex chromosome DNA. The technique's accuracy and effectiveness may be demonstrated through a number of observations. First, for the 20 modern turkey samples were morphological sex could be determined, the mtW technique was able to confirm the sex identity for 19 of the 20 birds. Though the mtW results failed to match the morphological sex for one of the birds, further testing indicated that the initial morphological identification was likely incorrect. Second, for all 27 modern samples, the mtW technique produced identical sex identification results as the more traditional technique which relied on the simplex amplification of the HINTW gene fragment.

In 100% of cases where the mtW technique was applied to measured archaeological elements, the mtW sex identity matched the predicted sex based on element size. This result indicates that the co-amplification primer ratio was effective in amplifying both the W-chromosome and mtDNA fragment when they were present in sufficient quantities, but suitably balanced to avoid the preferential amplification of mtDNA alone. One potential issue when targeting a sex-specific marker like the W­ chromosome is a false positive result due to allele drop-out (Schmidt et al. 2003). This is a particular issue in ancient DNA analysis, where nuclear DNA is seriously degraded. In females, the successful amplification of the mtDNA fragment, but an amplification failure of the W-chromosome fragment would lead to a false-positive male identification. The perfect match between the morphological and genetic sex identities among the 90 measured samples testifies to the remarkable accuracy of the method. The success of the technique, supported by both modern samples and the measured archaeological elements, adds confidence in the authenticity of the mtW results when applied to fragmentary or juvenile archaeological remains where tentative morphological sex can not be determined.

85 The high sex identification success rate (75.6%) in ancient remains demonstrates the sensitivity of the techniques and the efficacy of targeting highly repetitive nuclear DNA fragments. Moreover, the equivalent success rate for the mtW technique exhibited by males and females indicates that the technique is not biased towards the preferential identification of one sex over the other. The technique's effectiveness highlights the immense potential for developing and applying similar highly-repetitive sex-chromosome techniques to other archaeological fauna.

Chapter Summary

Ancient DNA was extracted, amplified and sequenced from 175 of the 193 archaeological turkey bones, and 10 modern commercially-raised turkey samples. Overall, the archaeological samples displayed excellent DNA preservation, and an amplification success rate of over 90%. D-Ioop haplotypes were assigned for 171 archaeological samples and 10 modern samples, while cyb haplotypes were obtained for 39 archaeological samples and 3 modern samples. Twelve D-Ioop haplotypes and two cytb haplotypes were identified within the ancient and modern samples, all of which were identical or closely related to M. gallopavo reference sequences observed in GenBank. Using a newly developed mtW co-amplification technique, sex was assigned to 146 of the archaeological samples. The accuracy and sensitivity of the mtW technique can be demonstrated through the correspondence between obtained genetic sex and morphological size, and the high sex identification success rate (over 70%) for the ancient samples. The DNA extraction and analysis followed strict contamination controls, and a review of published criteria points to the robusticity of the obtained data and the authenticity of the ancient DNA results.

The carefully scrutinized ancient DNA can now be applied to the three research questions posed above, the first of which relates to the geographic origins of the Southwest domestic turkey stocks.

86 CHAPTER 5: GEOGRAPHIC ORIGIN

The geographic origin(s) of North American domestic turkey is a controversial issue and multiple wild progenitors and geographic locations have been proposed for domestic turkeys in both Mesoamerica and the Southwest. While it is accepted that at least one domestication event occurred in Mesoamerica with the wild South Mexican domestic turkey (M. g. gallopavo) as its wild progenitor (Crawford 1992), there has been much controversy surrounding the geographic origin of domestic stocks in the Southwest United States. The most extensive review of turkey domestication was conducted by Schorger (1966) in The wild turkey: Its history and domestication. Schorger proposed two separate domestication events for turkeys: one in Mesoamerica and one in the Southwest, using both archaeological and historic data to support his assertion. Other have proposed a single Mexican domestication event, with subsequent dispersal into the Southwest (Leopold 1944), or two separate domestication centres in both eastern coastal Mexico and Oklahoma (McKusick 2001).

This chapter explores the first of the proposed research objectives: to determine the geographic origin of the Southwest domestic bird, the number of domestication events, and possible wild progenitor populations. Following a review and evaluation of the current hypotheses for the geographic origin of Mesoamerican and Southwest domestic turkeys, this chapter will argue that rather than supporting a local domestication model, the ancient DNA data point to the import of previously domesticated stocks into the Southwest United States around 2000 years ago, from an areas east/southwest of the region.

Mesoamerican Domestic Turkey

Few sources in English have reviewed the archaeological evidence of domestic turkey use in Mesoamerica. However, the earliest reported turkey archaeological remains in Mesoamerica seem to be from Tlatilco, on the Central Plateau of the Basin of Mexico, dated between 800-400BC (Alvarez 1976 in Breitburg 1988:32) though their wild or domestic status is not clear. Flannery's (1967: 155) study of prehistoric vertebrate fauna at Tehuacan valley noted the use of turkey beginning around AD180 and 87 intensifying through time until the time of Conquest when they constitute around 10% of the animals consumed in the valley. The turkeys appear to be domestic rather than wild, since the Tehuacan valley is likely outside range of wild M. g. gal/opavo, but Flannery (1967: 175) does not propose a possible origin for the birds. It is commonly assumed that subspecies progenitor for the Mesoamerican domestic bird was the South Mexican turkey (M. g. gal/opavo) (Crawford 1984:325)

From historical accounts, it is clear that turkeys were raised in large numbers at many Mexican sites for both food and tribute to local leaders. Around AD1430, the lord of Texcoco, Netzahualcoyotzin, is recorded to have required a tribute of 100 turkeys daily (Ixtlilxochitl 1840 in Schorger 1966:10). Schorger (1966:8) notes that the spread of turkeys from Mexico into the Yucatan and further south, may have occurred just prior to the arrival of the Spanish, since few or no common turkey bones are found in Yucatan archaeological sites. Instead, large quantities of ocellated turkey (Meleagris ocel/afa) bones are recovered from Mayan sites. Turkeys were widely distributed around Mexico and within Central America as far south as Costa Rica by Columbian times, however, they were not introduced to the Caribbean until early in the 16th century. Turkey seemed to be present in Peru just prior to the arrival of the Spanish, reaching Ecuador only around AD1587, and Chile around AD1650 (Crawford 1992).

Modern Commercial Varieties

The commercially-raised turkeys found in North American farms and supermarkets today are thought to be descended from the Mesoamerican domestic turkey. Turkey were transported from Mexico to Europe in the early 16th century, where they quickly spread across the continent. The earliest Spanish records list the arrival of turkeys in AD1511-12 (Crawford 1992). Present in Italy by 1520, France by 1538, England by 1541 and Sweden by 1556, they multiplied rapidly, and were being raised on farms by the turn of the 17th century (Schorger 1966). Over the following centuries, several varieties of turkey were developed in Europe, including the Norfolk Black, Cambridgeshire Bronze, White Austrian, Buff, Blue and Ronquieres (Marsden and Martin 1946:22; Myrick 1902).

In the 18th century, these European turkey breeds were imported onto the United States Atlantic seaboard - by this point "only a puny representative of the wild bird" (Schorger 1966:3). The European breeds were much smaller than the local wild turkeys.

88 Although some attempts were made to domesticate the Eastern wild turkey, they failed apparently due to the wildness of the birds (Crawford 1984:331). Hybridizations between the European domesticates and the wild turkeys was widespread however, with heterosis producing much larger and more vigorous animals. These hybrid varieties eventually become the forerunner to the Narragansett, Slate and Bronze turkeys of today (Marsden and Martin 1946:22-23). The American Bronze (named after the bronze plumage inherited from its wild parent) quickly replaced the introduced domesticate, in America, Europe, as well as in Mexico (Crawford 1992).

Southwest Domestic Turkey

In contrast to the simplified view of Mesoamerican turkey domestication, the origin of Southwest turkey domestication is fraught with hearsay and speculation, rendering a most confusing review of the literature. Indeed, almost all wild turkey subspecies have been proposed as its possible wild progenitor. Two major hypotheses have been put forward for origin of Southwest domestic turkeys: the 'introduction' model and the local domestication model. Charmion McKusick (1980; 1986; 2001) has always advocated that turkeys were first domesticated elsewhere and introduced into the Southwest in domesticated form (Figure 15). The first bird introduced and exploited by the Ancestral Puebloans was a gracile, hump-backed, darkly plumed species, the Tularosa turkey, which McKusick also terms the Small Indian Domesticate (SID). The bird was definitely present on the Black Mesa by the Lolomai Phase (AD1 00-300), but may have entered the region as early as 200BC (McKusick 2001 :17). Following Gloger's rule, the SID's dark plumage suggests an adaptation to a moist lowland environment, as darker melanic feathers seem to confer resistance to bacterial degradation prevalent in hot humid environments (Burtt and Ichida 2004; Eaton 1992). McKusick presumes the SID may have originated from the coastal region extending from eastern Mexico to southwestern Texas (McKusick 2001 :46), and would have been transported by humans into the Southwest via the Pecos River drainage, moving from southern New Mexico to Tularosa Cave, and northward into the four-corners.

89 1500AD-Present

1000-1500AD LID

M. g. merriami 500-1000AD (Southwest)

LID (Southwest) 0-500 AD t ...... ···················································(oi

Figure 15 Diagram of McKusick's 'introduction' model for Southwest domestic turkeys

Based on the analysis of mummified archaeological remains, Schorger (1961, 1970) had originally given this bird the subspecies designation M. g. tularosa. Schorger's taxonomic distinction of the Tularosa turkey was based primarily on plumage: it had a uniquely densely feathered neck around the base of the skull, unlike the sparse head and neck feathering of the wild forms. The tibiotarsi were also found to be distinctly shorter than Merriam's wild turkey. Considering that size and colouration can vary with environmental conditions, these criteria are not usually adequate for defining a new subspecies. Subsequently, McKusick (2001: 111), observing the bird's osteological similarity to the Eastern wild turkey, and noting the lack of any wild populations of M. g. tularosa, revised the subspecies designation to M. g. silvestris (tularosa). This designation was further supported by comparison with a small, short-shanked, hump­ backed M. g. silvestris skeleton obtained from Mississippi (McKusick 2001: 113). Based on character differences, McKusick (1986) asserts that M. g. gallopavo, M. g. mexicana and M. g. intermedia bear no relationship to the SID, and are not present in Southwest archaeological sites.

McKusick also defines a second larger domesticate breed, the Large Indian domesticate (LID), which arrives in the Southwest AD500 (Figure 15). By Pueblo II times, the LID is the dominant breed in the Southwest, and McKusick (2001 :125) 90 suggests these birds would have arrived with the Plains Woodland groups from Oklahoma.

Merriam's Wild Turkey as Feral Domesticate

The lack of paleontological or archaeological wild turkey remains in the Southwest prior to 300BC had lead several researchers to assume that no local wild turkeys were present in the region prior to the arrival of the imported domestic bird (Hargrave 1965a; Rea 1980). Since the earliest evidence for turkey use in Southwest sites seemed to correspond directly with the earliest evidence of domestication, modern Merriam's wild turkey populations were thought to be the feral descendents of the imported domestic turkeys (Hargrave 1965a:158; 1970a:25). McKusick (2001 :5) supports this view and suggests Merriam's populations would have become naturalized by the AD600s. In this second 'introduction' scenario, both the LID and the naturalized Merriam's populations would be given the subspecies designation M. g. merriami, even though the original wild progenitor of the LID would have been M. g. silvestris, the Eastern Wild turkey.

Local Domestication Model

More recently, an alternative hypothesis has been offered: one of local Southwest domestication by the Ancestral Puebloan-Mogollon groups. In Emmanuel Breitburg's (1988, 1993) model, the original source of domestic birds would have been from wild turkeys around the four-corners region (Figure 16). He points out that not only do the earliest Mexican turkey remains date from around the same time periods as in the Southwest, the early archaeological evidence for domestication at Tularosa Cave, dating to as early as 200BC (including pens and eggshell) is much more convincing than any other domestication evidence from Mexico.

Breitburg conducted an in-depth statistical analysis of the measurements of turkeys remains in the Southwest using principal component analysis, multivariate discriminant analysis and univariate tests. The results of his study demonstrated very little size and shape difference between Southwest domestic turkey, Merriam's wild turkey and the Eastern subspecies.

91 1500AD-Present

1000-1500AD

500-1000AD

0-500 AD

Domestic 500 BC-AD 0 (Southwest)

Pre-500 BC M. g. merriami (Southwest)

Figure 16 Diagram of Breitburg's 'local domestication' model for Southwest domestic turkeys

Breitburg also disagrees with the notion that Merriam's populations were descended from the domestic imported bird. He notes that current populations of domestic turkeys cannot survive well in the wild (Ligon 1946), and that feral populations of the LID would not have been prone to form viable populations of wild turkeys. Biologist Harley Shaw (2002), also raises concerns over the "Indian Transplant Hypothesis" for the origin of Merriam's turkey in the Southwest. Like Brietburg, Shaw questions whether feral turkeys would have survived in the mountainous environments of the Southwest, considering that transplants of domesticated, or pen-raised wild birds have almost always failed (Kennamer et al. 1992); only transplants of wild birds have prospered. Shaw notes that the Colorado Plateau and Mogollon Rim would have provided suitable turkey habitat (ponderosa pine forests) around 8,000 years ago. Merriam's birds may have entered the area in the early mid-holocene, but failed to spread quickly across the dry pinyon-juniper, sagebrush, and grassland flats separating forested areas, due to a lack of water availability. Unfortunately, a dearth of knowledge concerning the history of various mid-Holocene rivers, makes it difficult to speculate on possible entry corridors (or the timing) for wild turkey migration into the Southwest.

92 As of yet, neither the 'introduction' model nor the local domestication model could be confirmed, mostly due to the scarcity of Holocene turkey remains in both Southwest and Mesoamerican deposits. Munro (2006) notes that many of the earliest Southwest turkey remains were recovered from sites with multiple occupations, and in most cases, were excavated in the early 20th century, which adds uncertainty to the dates of the available specimens. In addition to ambiguous archaeological evidence, the osteological analyses of both archaeological and modern turkey populations have also been inconclusive. A recent study of modern wild turkey populations investigated weight, size, and spur length differences between subspecies (Stangel et al. 1992). The results demonstrated no statistical difference between any of five current subspecies of wild turkey: yes, there were mean size difference between the subspecies, but they were minor when compared to variation within subspecies. If modern turkey subspecies cannot be separated based on skeletal morphology, then perhaps metric analysis of archaeological remains is not the answer to distinguishing populations. Instead, genetic characterization of the wild and domestic populations may hold the key to identifying subspecies and wild progenitors.

Phylogeographic Analysis

Phylogeography is the study of principles and processes that govern the geographic distribution of genetic lineages especially within and among closely related species. Phylogeography typically focuses on mtDNA since this non-recombinant, maternally-inherited marker contains non-coding regions with rapid mutation and extensive intraspecific polymorphisms (Avise 2000). Numerous projects have applied phylogeographic principles to locate the origin and population source of domestication events (Dobney and Larson 2006; Zeder et al. 2006b). By comparing the genetic relationships between archaeological and/or modern domestic animal and wild populations in the same or surrounding region, one may identify the geographic origin, number of domestication events, and wild progenitors of domestic lineages.

Despite the potential of molecular and phylogeographic techniques, there are a number of challenges facing the pylogeographical study of wild and domestic turkeys. Current North American wild turkey populations have experienced significant translocation throughout almost all of their historic ranges. During the 19th and early 20th century, habitat loss and over-hunting pushed wild turkeys to the brink of extinction

93 in much of their original range. By the 1920s, turkey populations had disappeared from 18 of the 39 states with historic populations (Bromley 2001). The 1950s witnessed their expansion through the efforts of the National Wild Turkey Federation, a foundation dedicated to conserving both wild turkeys and the hunting tradition. Using profits from hunting permits, turkey populations were translocated to locally extirpated areas using a variety of stocking systems. Turkey populations skyrocketed from around 30,000 birds to 5.6 million birds within the United States alone, with turkeys accessible for hunting in every state but Alaska (Bromley 2001). Turkey populations were even translocated to the Pacific Northwest and Hawaii, far outside their original range. Hence, identifying the pre-contact and pre-translocation subspecies distribution is now extremely difficult. Moreover, the bottleneck resulting from the severe population decline, followed by translocations of replacement stocks may have had serious effects on the genetic diversity both within and between populations (Latch and Rhodes 2005).

Sizable genetic studies have recently been conducted on current wild turkey populations in North America (Mock et al. 2004; Mock et al. 2002; Szalanski et al. 2000). The Eastern subspecies was most affected by habitat destruction and repopulation efforts, and displays the greatest amount of genetic diversity and the least amount of phylogeographic consensus. Merriam's wild turkey, on the other hand, which resides in the intermountain region between 1,800-3,6001 m, has been less affected by transplantation and interbreeding, as there has been little success stocking the region with domestic and Eastern strains not suitably adapted to the rugged environment (Ligon 1946). Despite the historical changes in the subspecies' ranges, a general phylogeographic pattern can still be identified in modern wild turkey populations, and most subspecies still group within major phylogeographic clades, although hybrid subspecies occur on bordering territories.

Research Questions

This research sought to answer the following questions: Can ancient DNA analysis identify the genetic signature of the domestic bird? If so, was the turkey introduced into the region or was it domesticated locally by Ancestral Puebloan groups? How many turkey domestication events took place in pre-contact North America? The following section summarizes the methods used to address these research questions.

94 Materials and Methods

The 181 confident and tentative haplotypes obtained from the 10 modern samples and 171 archaeological samples were included in the haplogroup and phylogeographic analysis. The obtained sequences were combined with the 276 available Me/eagris GenBank entries to generate a combined data set of 457 individuals.

Phylogenetic Analysis

The phylogenetic trees were composed using Mega3 software (Kumar et al. 2004) using the neighbour-joining (NJ) algorithm, which produces phylogenetic trees constructed under the principles of minimum evolution (ME). The ME methods uses distance measures to correct multiple possible mutations at the same sites; final trees are based on the minimum amount of evolutionary change (i.e. the smallest value of the sum of all branches) (Saitou and Nei 1987). Unlike other ME methods, the NJ algorithm minimizes the sum of branch lengths at each stage of clustering of 'operational taxonomic units' (also known as neighbours), producing reliable trees more efficiently than other distance-based methods. As the NJ method does not assume a constant rate of evolution, it produces an unrooted tree, which may be rooted through the addition of an outgroup.

NJ trees were composed using the 12 D-Ioop haplotypes obtained in this study, and GenBank Meleagris reference sequences. In order to simplify the phylogenetic analysis, duplicate sequences from each turkey subspecies were eliminated; only 66 original reference sequences from GenBank were included in analysis. NJ trees were also composed using the obtained cytb sequences and the seven available M. gallopavo reference sequences from GenBank. Since individuals with the same D-Ioop haplotype consistently demonstrated the same cytb haplotype, the NJ tree included the cytb haplotypes associated with each of the 12 D-Ioop haplotypes, rather than all 39 obtained sequences. All NJ trees in this analysis were calculated using the Kimura 2-parameter, with 2000 replications as a bootstrapping test of phylogeny.

Median-Joining Networks

Network analyses are designed to reconstruct phylogenetic networks and trees, infer ancestral types and inferred types, evolutionary branchings and variants, and to estimate dating (Bandelt et al. 1999). This analysis works best on non-recombinant bio­ 95 molecules, such as mtDNA, Y-STRs, virus DNA, and some non-recombinant autosomal DNA. The software is designed to reconstruct all possible maximum parsimony trees (i.e. the shortest and least complex phylogenetic trees), demonstrating multiple possible links between taxa. Median-joining (MJ) algorithms were used, since they allow for multi­ state and missing data. Graphically, the size of each tree node represents the frequency of any given haplotype with larger nodes represented by more individuals. Median­ joining networks were composed using Network (v.4.1.1.2) incorporating the 181 obtained sequences and all available GenBank M. gallopavo D-Ioop reference sequences.

Results

Mitochondrial Haplogroups

Median-joining network analysis of the 12 obtained D-Ioop haplotypes revealed three haplogroups (Figure 17): those samples which clustered around aHap1 (haplogroup H1), those that clustered around aHap2 (haplogroup H2), and a third cluster including all modern samples and three archaeological samples (haplogroup H3).

H1

H2 aHap2e D SW archaeological samples D Modern domestic turkey samples

Figure 17 Median-joining network of obtained modern and ancient D-Ioop haplotypes. Node sizes are proportional to haplotype frequencies in the dataset. Lines between nodes represent a single nucleotide change, except where perpendicular hashes represent single changes.

96 The relationship of these haplogroups to extant wild turkey populations can be seen in the median-joining network of Figure 18. As wild M. g. gallopavo populations are supposedly extinct, there are no sequences available from this subspecies, and its relationship to extant subspecies cannot yet be ascertained. GenBank reference sequences from modern domestic turkey (classified only to the species level as M. gallopavo) are shown in pink to demonstrate the relationship between the modern domesticate and the wild subspecies.

H3

H1

_ M. g. silvestris (Eastern) o M. g. osceola (Florida) _ M. g. intermedia (Rio Grande) M. g. merriami (Merriam's) H2 o M. g. mexicana (Gould's) M. gallopavo (Domestic) o Modern domestic turkey samples o SW archaeological samples

Figure 18 Median-joining network displaying the relationships between the obtained D­ loop sequences and available wild turkey reference sequences. Solid colours represent modern wild turkey haplotypes obtained from Genbank; 'M. gallopavo (domestic)' refers to modern domestic turkey haplotypes obtained from GenBank (identified only to the species level), which are clustered around mHap1. The grey areas represent the haplotypes obtained from the archaeological samples, while the white areas indicate the haplotypes obtained from modern commercially-raised turkey samples extracted in this study.

97 Phylogenetic Relationships

Figure 19 displays a phylogenetic tree composed of the 12 obtained haplotypes along with 66 original subspecies haplotypes obtained from GenBank, with ocellated turkey (M. acel/ata) included as the outgroup.

seES1 Silvestris AF172957 FAA15 Osceola AF486931 ESW2 Silvestris AF486904 EBW9 Silvestris AF486884 EOM5 Silvestris AF486898 RKC251ntermedia AF487089 FTL1 Osceola AF486951 FTL9 Osceola AF486959 CM10 Merrlami AF172948 MeS9 merriami AF486994 EWV3 Silvestris AF486915 FTL6 Osceola AF486956 EWV5 Silvestris AF486917 RKC30 Intermedia AF487094 AEU7 Silvestris AF172960 SCES2 Silvestris AF172958 TEB Silvestris AF172953 ESW1 Silvestris AF4B6902 EOM8 Silvestris AF486900 EWV6 Silvestris AF486918 ROW9 Intermedia AF487069 EWV10 Silvestris AF486912 TES Silvestris AF172954 EBW2 Silvestris AF486877 EWV9 Silvestris AF486920 FTL30sceolaAF486953 .aHAP1 Easlem, Florida and Rio Grande wild turkey .aHAP1b MRM2 Merriami AF486997 .aHAP1a ••HAP1d .aHAP1c SOE1 Silvestris AF172947 ROW7 Intermedia AF487067 RNL3 Intermedia AF487111 EWW8 Silvestris AF486929 REN3 Intermedia AF487077 /),.mHAP2 REN22 Intermedia AF487074 M gallopavo AJ297180 M gallopavo EF153719 4mHAP1 M gallopavoAF172952 FAA23 Osceola AF486938 ESW3 Silvestris AF486905 ECL4 Silvestris AF486888 EWW2 Silvestris AF486923 Eel6 Silvestris AF486890 EWW3 Silvestris AF486924 RGH2 Intermedia AF487081 FBC15 Osceola AF486944 RDW11 Intermedia AF487059 RKW3 Intermedia AF487103 FBe7 Osceola AF486949 Intermedia AF172962 RDW13 Intermedia AF487061 eaHAP2e RDW10 Intermedia AF487058 RTC3 Intermedla AF487117 GCS10 Mexicana AF486967 MSL14 Merriami AF487010 SOE7 Silvestris AF172961 eaHAP2c eaHAP2d MWM14 Merriami AF487042 RTC4lntermedia AF487118 eMS Merriami AF172964 52 MWM2 Merriami AF487048 MCS1 merriami AF486985 MRM4 merrlami AF486999 Merriam's wild turkey e.HAP2b MSP13 merriami AF487029 MSM4 merriami AF487025 MWM9 merriami AF487057 MCS6 merrlaml AF486991 MSL9 merriami AF487019 eaHAP2 GNS15 Mexicana AF486960 L.. Meleagris ocellata AF487120

o------t 0.005 Figure 19 Phylogenetic tree displaying the relationships between obtained haplotypes and modern wild turkey subspecies, with ocellated turkey as the outgroup. The numbers at the nodes indicate those bootstrap values above 50% after 2000 replications. Squares represent H1 haplotypes, circles represent H2 haplotypes, and triangles represent H3 haplotypes.

98 When examining the network and phylogenetic tree, haplogroup H1 (containing five haplotypes), was phylogenetically most closely related to the M. g. silvestris and M. g. intermedia subspecies. The network analysis demonstrates that the five H1 haplotypes form a separate node, whose nearest neighbours lie within the central Eastern/Rio Grande wild turkey node. The most common H1 haploype, aHap1, had an exact match with an atypical Merriam's wild turkey haplotype (appearing as the red 'slice' in the aHap1 node of Figure 18). This haplotype is rare in modern Merriam's populations, and was encountered in only three of 110 tested Merriam's individuals (see Discussion for more detail).

The second haplogroup (H2), contained six haplotypes, five of which clearly fall within the range of wild M. g. merriami populations. The most common H2 haplotype, aHap2, found in 12 archaeological turkey bones, is also the most common Merriam's haplotype in contemporary wild populations, found in 43 of 110 tested individuals (Figure 18). Ancient haplotype aHap2c also has an identical match with modern Merriam's individuals, though this type is less common, occurring in two of 110 tested individuals (Figure 18). Haplotype aHap2e was recovered from two archaeological samples from Chihuahua, Mexico, which lies south of the current M. g. merriami territory, and within the natural range of the Gould's wild turkey subspecies. This haplotype shows an exact march with the most common M. g. mexicana haplotype (Figure 18, 19).

The third haplogroup (H3) contained all of the modern commercial turkey and the three archaeological samples from the historic site of Fort Bowie. Group H3 contained two haplotypes (mHap1 and mHap2), which differ from each other at only one polymorphic site. The H3 sequences are closely related to other modern commercially­ raised turkey haplotypes obtained from GenBank (depicted in pink, Figure 18), as well as some Rio Grande wild turkey types.

Phylogenetic analysis of the cytb fragment supported a distinction between H2, and the other two haplogroups (Figure 20). As expected from a conserved gene fragment, the cytb haplotypes displayed far less variation than the D-loop haplotypes. The cytb tree displayed only two clades, one composed of all H1 and H3 haplotypes, as well as all available GenBank M. gallopavo cytb sequences. The other clade was composed of all ancient H2 haplotypes (except aHap2d - no cytb fragment could be amplified from either of the two aHap2d turkey bone samples).

99 Q

Meleagris gallopavo AJ401084 Meleagris gallopavo AY157979 Meleagris gallopavo DQ512920 Meleagris gallopavo L08381 Meleagris gallopavo DQ512919 Meleagris gallopavo EF153719 ..._63.. Meleagris gallopavo AF230182 Cyt1 • aHap1 • aHap1a .aHap1b • aHap1c • aHap1d amHap1 amHap2 .aHap2 ] ....--1. aHap2b Cyt2 63 • aHap2c .aHap2e ...------Gallus gallus AY235571

0.02 Figure 20 Phylogenetic tree displaying the relationships between obtained cytb haplotypes and available M. gallopavo GenBank reference sequences with chicken (Gallus gallus) as the outgroup. The numbers at the nodes indicate those bootstrap values above 50% after 2000 replications. Squares represent H1 haplotypes, circles represent H2 haplotypes, and triangles represent H3 haplotypes.

Discussion

Identifying the Domestic Lineage

The first question this analysis sought to answer was whether ancient DNA could identify the genetic signature of the Southwest domestic turkey. Of the three haplogroups recovered from the ancient remains, haplogroup H1 seems to display the genetic signature of a domestic bird. This group included the bulk of the archaeological samples (87%), and displayed a remarkable genetic uniformity, with 142 samples sharing one identical haplotype (aHap1). Considering the high mitochondrial genetic diversity present in modern wild turkey populations (Mock ef al. 2002), the uniformity of the H1 group points to a severe genetic bottleneck and breeding isolation likely associated with the domestication process (Bradley and Magee 2006). Archaeologically, the evidence for turkey husbandry, in the form of turkey pens, eggshells, increased

100 turkey remains, and gizzard stones are found in conjunction with H1 samples (McKusick 1986b; Muir and Driver 2002b; Munro 1994). The evidence for a severe genetic bottleneck, in combination with archaeological evidence for turkey domestication, suggests that aHap1 represents the predominant domestic turkey haplotype. Moreover, group H1 is evolutionarily most closely related to the Eastern and Rio Grande subspecies, which are not currently found in the four-corners region. If a previously domesticated stock was imported into the region, the genetic diversity may have been further restricted through a founder effect. The overall uniformity of the H1 clade suggests that only a single domestic mitochondrial lineage was present in the region (see Chapter 6 for more discussion of turkey breeding).

The other two clades (H2 and H3) have a lesser presence in the Southwest archaeological record. Haplogroup H3, made up primarily of modern commercially raised turkeys, seems to represent the modern-day signature of the Mesoamerican domestic turkeys. The H3 group contains only three archaeological samples, all recovered from the historic site of Fort Bowie in southern Arizona. This site was occupied in the late 19th century, well after the presumed extinction of the Southwest domestic turkey. Modern varieties of chicken, duck and turkey, imported from Eastern North America were raised at the site (Herskovitz 1978), which explains the presence of the 'modern' haplotype mHap2 in the three analyzed turkey remains. The lack of H3 haplotypes in the rest of the pre-contact archaeological collection suggests that neither Mesoamerican nor modern turkey breeds had a significant impact on the population structure of the Southwest domestic breed.

Approximately 12% of the archaeological samples were closely related to Merriam's (and Gould's) wild turkey types (H2), the local wild subspecies of the Southwest and Northern Mexico. The H2 birds have a low but persistent presence throughout all time periods, pointing to the fact that local turkeys were indeed exploited in conjunction with the imported domestic bird. Almost all the H2 samples were recovered from archaeological sites located near ponderosa pine forest, within natural habitat of Merriam's wild turkey (see Chapter 6 for further discussion). The two H2 samples which match the Gould's wild turkey (aHap2e) were recovered within the northern portion of Gould's natural range. It is difficult to determine if these H2 individuals represent hunted or captured wild birds, a less common domestic 'breed', or hybrids between domestic birds and wild individuals (see more discussion in Chapter 6).

101 However, what is apparent is that the frequency of H2 birds in the archaeological record remains low, indicating that these local birds (or at least local hens) did not playa major role in the turkey domestication process despite their local availability.

Merriam's Turkeys

The presence of the H2 types in the archaeological population strongly supports the long-term presence of Merriam's wild turkey types in the Southwest. The DNA data demonstrate a clear distinction between the local Merriam's type and the imported domestic bird, refuting the hypothesis of a naturalized feral population. The cytb data, in particular, demonstrate a clear division between local southwest turkey types (as represented by Merriam's and Gould's types), and all other non-local turkeys (including the imported H1 group, and the H3 Mesoamerican birds). Although the cytb data are limited, they do suggest a long-standing separation between Southwest birds and other neighbouring subspecies, supporting Shaw's (2002) suggestion that Merriam's wild turkey have been present in the Southwest since at least 8000BP, when suitable turkey habitat became available on the Colorado Plateau and Mogollon Rim.

In fact, local turkey populations may have been present in the Southwest as early as 25,000BP. During the late Pleistocene, the Southwest was occupied by M. crassipes, a now extinct meleagrid, represented by only a few paleontological samples. Although this bird has been given a separate species designation (Rea 1980), it bears osteological similarities to M. ga/lopavo and may represent the ancestor to Holocene M. g. merriami and mexicana populations (Dr. E. Corona-M., personal communication, 2009). Outside the southwest, late Pleistocene and early Holocene M. ga/lopavo deposits are found in Northern Sonora and the south-central and Gulf portions of Texas (Rea 1980); these M. ga/lopavo populations likely represent the ancestors of the neighbouring Rio Grande and South Mexican subspecies. Ancient DNA analysis of additional late Pleistocene and early Holocene Meleagris samples from both within and outside the Southwest would help elucidate the natural history and evolution of the subspecies.

While refuting a naturalized feral population, the data do support the occasional introgression of domestic birds into wild stocks. Some of today's Merriam's wild turkeys carry the predominant H1 haplotype, making them phylogenetically distinct from the rest of their subspecies (Figure 18). When input into a GenBank BLAST search, haplotype

102 aHap1 shares an identical match with three Merriam's wild turkey individuals (GenBank accessions AF487032 (MSP16); AF487049 (MWM20); and AF486997 (MRM2). These birds are likely the descendents of escaped domestic hens which subsequently interbred with wild populations. After countless generations of interbreeding with wild populations, these individuals now share the Merriam's phenotype, but carry the mitochondrial signature of the ancestral domestic lineage. These 'aHap1' Merriam's turkeys make up only a small percentage of the overall wild population, suggesting that past gene flow between the wild and domestic birds was somewhat limited. This introgression of a few feral domestic turkeys into local wild populations may have occurred at any time since the initial phases of domestication, but very likely occurred during the migration of the four-corners around AD1300, when turkey flocks might have been abandoned to fend for themselves (Rea 1980).

Geographic Origins

The ancient DNA data suggest that the H1 domestic turkey lineage is distinct from the primary Merriam's clade, suggesting that indigenous wild birds (M. g. merriaml) were not the progenitors of these Southwest domestic flocks. Instead, the genetic data support the introduction of previously domesticated stocks into the region, from a progenitor population genetically similar to present-day M. g. silvestris and/or intermedia. Pinpointing the exact geographic origin of these domestic stocks, however, is extremely difficult. Phylogenetically, the H1 birds group most closely with Eastern (M. g. silvestris) and Rio Grande (M. g. intermedia) wild turkeys. Interestingly, the H1 haplotypes have no identical matches among contemporary individuals of those two subspecies. This result is not improbable, considering the amount of genetic diversity lost over the last centuries and effects of sampling random individuals within modern populations.

Identifying an unambiguous wild subspecies progenitor for the domestic birds as either M. g. silverstris or intermedia is not possible based on the mtDNA data alone. Although these two subspecies can usually be differentiated phenotypically, they do not form distinct phylogenetic clades (Figure 18, 19). The lack of strong phylogeographic patterning is in part a result of drastic changes in the numbers and habitats of North American wild turkey over the last century, followed by the trap-and transplant programs of the 1950s. Due to its large geographic range, the Eastern subspecies was most affected by habitat destruction and repopulation efforts (Kennamer et al. 1992), and

103 shares many common haplotypes with the neighbouring Florida wild turkey and the Rio Grande turkey.

The Rio Grande turkey shows even less phylogenetic consensus, showing a close relationship with the neighbouring Gould's wild turkey (Mg. mexicana), and sharing common haplotypes with Merriam's wild turkey, and the Eastern wild turkey. The Rio Grande subspecies also shares a common haplotype with the modern domestic turkeys (Figure 18), suggesting interbreeding or close common ancestry with neighbouring M g. gallopavo within the southern portion of its range.

While it is likely that the H1 turkeys originated from an area east/southeast of the Southwest United States (within the historic range of the Eastern and Rio Grande wild turkey), these two subspecies occupy an enormous geographic range. Currently, the Eastern wild turkey is found throughout Eastern North America, as well as the oak­ hickory forests of the mid-west (Lewis 1992; Wunz and Pack 1992), while the Rio Grande wild turkey, currently ranges from northern Vera Cruz, and the Tamaulipas through Texas, Oklahoma and into southern Kansas (Beasom and Wilson 1992) (Figure 1).

If one were to speculate on a possible origin for the H1 birds, Northeastern Mexico, around the Tamaulipas area, may represent a possible origin for these Southwest turkey stocks. Highland caves around Ocampo in Northeastern Mexico provide early evidence for the cultivation of bottle gourd, squash and maize by 2500 BC (Smith 1997). Unlike the contemporaneous low-density forager groups that occupied much of western Oklahoma and western and southern Texas (Perttula 2004), Northeastern Mexico was populated by sedentary agricultural communities by 1500 BC (Adams 2005:40). Cultures in this region also display stronger cultural similarities and trade links with the Southwest than do agricultural groups in the Eastern U.S. or Plains (Mathien and McGuire 1986). Moreover, historic accounts can confirm the presence of Rio Grande wild turkey in this region (Leopold 1948), while there is some uncertainty to the distribution of M g. intermedia in the region between the Northeastern Mexico Southwest proper (Reed 1951).

While maize and squash agriculture seems to have moved into the Southwest from central Mexico via northwestern Mexico (ca. 2100 BC) (Hard et at. 2006; Kohler et at. 2008), the conspicuous lack of turkey remains in Early Agricultural sites of northwestern Mexico, southern Arizona and New Mexico, indicates that turkeys likely did 104 not enter the Southwest via this same route (Munro 2006). Instead, the trade of turkey stocks into the Southwest may have been routed through the Trans-Pecos area of Texas (extending south between the Rio Grande to the west and the Pecos river to the east). This area also shares many cultural similarities with groups in New Mexico. For example, the Trans-Pecos groups displayed a somewhat sedentary lifestyle as early as the late archaic period. Semi-sedentary sites, like Keystone Dam (located on a terrace of the Rio Grande valley in EI Paso), begin to appear as early as the Middle Archaic (4000BC-1200BC), and the adoption of cultigens like maize and squash occurs ca. 1500-1000BC (Miller and Kenmotsu 2004), though these cultigens likely only augmented a diet composed primarily of wild plant species (Mallouf 2005). Sites such as Todsen Shelter and Organ Mountain rockshelters have preserved many perishable items such as maize and curcurbita remains, digging sticks, cordage and feathers (Miller and Kenmotsu 2004). Though there is little evidence for turkey use in the Late Archaic (Anderson 1993; Dawson 1993; Wimberly and Eidenbach 1981), faunal preservation in exposed sites within the Basin and Range can be extremely poor. However, some evidence of bird use can be seen throughout the Late Archaic, with some eggshells (species unknown) recovered from Keystone Dam (Miller and Kenmotsu 2004), and over 200 feathers (species unknown) recovered from Fresnal Shelter further north in New Mexico (Tagg 1996).

The archaeological evidence points to the introduction of previously domesticated turkeys into the Southwest between 200BC and AD500, with the first evidence of turkey appearing in Tularosa Cave, NM. It is around this period, spanning the Late Archaic and Early Formative period that trade and contact increases between Trans-Pecos and Mogollon groups in western New Mexico, as seen in shared textile characteristics in both regions, as well as geochemical sourcing studies on obsidian artifacts (Miller and Kenmotsu 2004).

Additionally, the phenotype of early domestic birds themselves, as displayed by whole mummified turkeys recovered from Tularosa cave, NM, and Canyon del Muerto, AZ (Schorger 1970), may support a coastal region as a possible domestication center. The earliest domestic turkeys are small, gracile, and darkly-plumed. In contrast to the white rump, and/or white-tipped tail feathers that characterize the wild turkeys found in the arid higher altitudes of the Southwest, following Gloger's rule, the phenotype of the

105 first imported domestic birds may reflect an adaptation to moist lowland environments such as those around the Gulf of Mexico (Eaton 1992).

Though the archaeological and phylogeographic evidence point to a in introduction of domestic turkeys into the Southwest, Brietburg's local domestication model cannot be definitively rejected. Currently, Eastern/Rio Grande wild turkeys range only near the eastern peripheries of the Southwest states. However, there is no reliable data concerning the prehistoric distribution of these subspecies. If the ranges of Eastern or Rio Grande turkeys extended farther west in the past, populations with relatively high frequencies of H1 haplotypes may have been available for domestication somewhere within the Southwest. The rare presence of the most common H1 haplotype (aHap1) in contemporary Merriam's turkey populations lends (weak) support to this local domestication model, with Merriam's birds as the wild progenitor subspecies. For this hypothesis to be accepted, however, the original Southwest turkey progenitor populations (Merriam's wild turkeys) would have to be polyphyletic, containing both H1 and H2 haplotypes. The resulting bottleneck and founder effect of domestication, followed by conscious or unconscious selection and breeding could eventually have resulted in a domestic flock primarily composed of H1 types. This scenario, however, is contested by the presence of the rarer ancient H1 haplotypes (aHap1 a-d) that are not currently found in Merriam's populations. Instead, these haplotypes are more closely related to the M. g. si/vestris/intermedia populations, further reinforcing a non-local progenitor subspecies for the H1 birds.

Investigating the geographic origin of the Southwest domestic lineage may initially require a more thorough analysis of genetic variability within modern populations of Eastern, Rio Grande and Merriam's wild turkey, in addition to further ancient DNA analysis of archaeological and historic turkey samples, both from the Southwest, and neighbouring regions. Identifying the H1 haplotypes within modern populations would help guide additional archaeological investigations and ancient DNA testing on historic and archaeological turkey remains to refine the pre-contact phylogeographic pattern. A few alleged M. gallopavo remains have been identified in Archaic (pre-agricultural) sites within the Southwest and neighbouring regions (Rea 1980) ; ancient DNA analysis of these isolated finds may be key in tracking the introduction of the H1 turkeys into the Southwest.

106 Number of Domestication Events

Based on the overall genetic uniformity of the H1 group, it seems that only a single domestic lineage was being exploited in the Southwest (see Chapter 6 for more discussion). However, there seems to be a clear distinction between the Southwest domestic turkey (H 1) and the Mesoamerican domestic turkey (H3), suggesting two North American domestication events involving two different wild turkey subspecies. Despite the limited genetic data available for M. g. gallopavo, the H3 group seems to be distinct from the other wild turkey subspecies, with some common types shared with the Rio Grande wild turkey (Figure 18, 19). Unlike the H1 group, the H3 group does not share any common haplotypes with the Eastern Wild turkey, supporting the domestication of M. g. gallopavo populations in Southern Mexico, far outside the natural range of M. g. silvestris, but bordering the natural habitat of M. g intermedia.

While it is likely that the cultural concepts and knowledge concerning bird capture and 'domestication' were exchanged throughout southwestern North America, the genetic signatures of the Southwest and Mesoamerican domestic turkeys seems to reflect two geographically distinct progenitor populations, one involving M. g. silvestris and/or intermedia, with subsequent trade into the Southwest proper, and the other with M. g. gallopavo in south central Mexico. No M. g. gallopavo sequences were recovered in the pre-contact Southwest archaeological samples, suggesting that pre-contact Mesoamerican turkey breeds were not imported into the Southwest in significant numbers.

However, it should be noted that the D-Ioop haplotypes of the two 'breeds' differ at only two or three polymorphic sites, and both haplogroups share a common cytb haplotype, indicating a fairly recent common ancestry. There may have been significant gene flow in the past between M. g. silvestris, M. g. intermedia and M. g. gallopavo, especially around the Mexican Gulf coast region, and hybrids would be expected where bordering subspecies encountered one another. The amount of interbreeding between the pre-contact wild populations is difficult to assess, as wild populations of M. g. gallopavo have been extirpated, and thus no sizable comparative data are available to represent the genetic diversity of this subspecies in the past. Without a clearer understanding of the range of variation present in both pre-contact wild and domestic M. g. gallopavo populations, the mtDNA data alone cannot definitively rule out a single

107 common geographic origin for both the Southwest and Mesoamerican 'breeds' followed by founder effects and genetic drift as the turkey spread throughout the two regions.

Chapter Summary

This chapter examined the origin of Southwest domestic turkey stocks. While it is accepted that turkey were domesticated in Mesoamerica, from wild South Mexican wild turkey stocks (M. g. gallopavo), two major hypotheses have been put forward for the origin of Southwest domestic turkeys: the 'introduction' model and the local domestication model. In order to address the geographic origin of Southwest domestic turkey stocks, and the number of turkey domestication events, the 181 D-loop sequences, and 39 cytb sequences obtained in this study were phylogeographically compared to modern wild turkey populations. The 12 obtained D-Ioop haplotypes cluster into three groups. Group H1, representing 87% of the archaeological samples, is most closely related to modern Eastern and Rio Grande wild turkey populations. Group H2, representing around 12% of the archaeological samples, is most closely related to local Southwest Merriam's and Gould's wild turkey populations. Group H3 containing all modern commercially-raised turkey samples as well as three post-contact archaeological samples, shares a close affinity to other modern domestic turkey sequences, as well as some Rio Grande Turkey types.

The strong genetic bottleneck displayed in group H1, in combination with the archaeological data, suggest that previously domesticated birds were imported into the Southwest ca. 100BC-AD500. The identification of H2 types in the archaeological remains supports the long-term presence of Merriam's wild turkey in the Southwest, though their low frequency indicates that local wild hens did not playa significant role in the domestication process. The presence of a distinct H3 clade, found primarily in modern domestic turkey, is consistent with a distinct domestication event in Mesoamerica, involVing M. g. gallopavo. The absence of H3 haplotypes in the pre­ contact archaeological samples suggests that Mesoamerican turkey breeds were not imported into the Southwest in significant number before historic times, when modern varieties of domestic turkeys were imported from Eastern North America.

108 CHAPTER 6: FLOCK MANAGEMENT PRACTICES

The flock management and turkey breeding practices of the Ancestral Puebloans have been contentious issues. Debates regarding the number of domestic breeds, and the appropriateness of categories such as Small and Large Indian Domesticate, and hybrids have persisted for the last three decades. Moreover, many questions have been raised concerning intentional breeding and stock enhancement.

Due to the lack of validated osteological criteria to differentiate among presumed breeds, male and female turkeys, and wild and domestic birds, many of these issues could not be adequately addressed. Ancient DNA analysis, which can characterize the genetic make-up of archaeological populations, provides a new tool for exploring past breeding practices. This chapter reviews the hypotheses pertaining to the flock management practices of the Ancestral Puebloans, and discusses the osteological and genetic techniques this study used to explore pre-contact turkey breeding. The results of the analysis point to intensive breeding of a single uniform ancestral lineage, with some evidence for the inclusion of some wild individuals into domestic stocks.

Animal Breeding

Today's domestic animals are represented by countless breeds or varieties, intentionally selected for their meat, milk, traction or fur, hide and wool. However, identifying the origin and degree of human intentionality in the breeding of domestic animals in the past can be extremely difficult. Once a domestic population has been established, the conscious selection for certain behavioural or physical traits may result in a particular breed: "a group of animals that has been selected by humans to possess a uniform appearance that is inheritable and distinguishes it from other groups of animals within the same species" (Clutton-Brock 1999:40). These phenotypic traits are usually not associated with animal survival or fitness, but are usually desired for economic reasons - such as enhanced meat, fiber or milk production (Zeder 2006b: 109) as well as aesthetic, or ritual reasons. Pictographs indicate that distinct breeds of cattle, dogs and sheep were present by at least 2000BC in the Babylonian and Egyptian

109 empires; while, in Europe, Roman period written records discuss the efforts made to improve cattle stocks (Clutton-Brock 1999:40). Tracing the origins of these breeds in the archaeological record can be extremely challenging, not only because of the poor preservation and the fragmented state of many remains, but because many of the selected characters relating to temperament, behaviour, or outward appearance are not reflected osteologically.

Small Indian Domesticate

As noted in the previous chapter, Charmion McKusick (1980, 1986b) had proposed two distinct pre-contact breeds of turkeys in the Southwest: the Small Indian Domesticate (SID) and the Large Indian Domesticate (LID). In her model, the early breed of SIDs, would have been used predominantly for feathers, and ritual or sacrificial purposes, rather than as a food source. The introduction of the SID corresponds to the first evidence for feather robes and blankets, and McKusick (1983: 171) notes that strong evidence for turkeys and feathers in the SW is only found after the "establishment of a firm agricultural base capable of providing a surplus of food adequate to support domestic fowl". She postulates that the SID persisted in small numbers throughout the Southwest, becoming more prevalent around the Tompiro Pueblos after AD1275. Husbandry of the SID birds declined in the 1600s, and disappeared with the fall of Gran Quivira in AD1672.

Large Indian Domesticate

Though McKusick considers the SID the first breed in the Southwest, she suggests it was quickly replaced by a larger breed around AD500. The Large Indian domesticate (LID) supposedly arrived in the Southwest during Basketmaker III times, and by Pueblo II became the dominant breed in the Southwest (McKusick 2001 :93). McKusick (2001: 125) suggested that the LID breed was introduced by Plains Woodland groups from Oklahoma, who moved into the region during the late Basketmaker periods. While the LID was larger than the SID, it was still smaller than the Merriam's wild turkey population, which represented the largest form of turkey in the Southwest (McKusick 1986b).

Based on her analysis of preserved feathers, McKusick (2001 :94) asserts there were three aberrant LID colour variations: Silver Phase, Pied, and Erythristic, all three of

110 which were the result of partial albinism. The Silver Phase turkeys were cool grey to white with black-tipped body feathers, produced by the loss of metallic brown and non­ metallic buffy brown pigmentation; the Pied turkeys had glossy white primary and secondary wing and body feathers, with black splotches, and banded white tail feathers; while the Erythristic (or smoky) birds lacked black melanin, and had pale grey bodies, white, grey-barred wings, and a grey and cream tipped tail. These aberrantly coloured feathers are very rare, and thus the frequency of these colour mutants in the domestic population is unknown.

In "Southwest Birds of Sacrifice", McKusick argues that the two breeds were used for different sacrificial purposes, and were kept "genetically pure" through selective breeding for 1200 years (McKusick 2001 :3). She claims the breeds were traded throughout the region and breeds designated for sacrifice by a given group were not normally eaten. Based on her extensive measurements and analysis of turkey remains throughout the Southwest, McKusick (1986b) provided a series of osteological criteria, including discrete traits and measurement by which the SID, LID and Merriam's wild turkey could be distinguished. These include characters of the coracoid, scapula, humerus, femur, tibiotarsus, maximum lengths of the longbones, and occasional pathologies.

Single Population Model

McKusick's breed distinctions have been called into question by a number of researchers (Breitburg 1988; Munro 1994; Olsen 1990; Senior and Pierce 1989). Emanuel Breitburg (1988) was the first to conduct an in-depth statistical analysis of Southwest turkey skeletal remains, using principal component analysis, multivariate discriminant analysis and univariate tests. His results noted little size and shape difference among all pre-contact domestic turkeys, Merriam's wild turkey and the Eastern sub-species, suggesting that osteological size or characters were not sufficient for differentiating different 'breeds', and that the SID and LID were likely part of the same domestic population.

In 2001, McKusick provided a reply to Breitburg's morphometric model. She critiqued his computer-modelling method by noting that he failed to include overall size and axial rotation measurements for the tibiotarsus and pelvis, which reveals the most conspicuous differences between the SID and LID. His computer modelling also did not

111 take into account character differences, which can be fundamental for separating taxa. McKusick (2001: 112) defends her position by noting that the exclusion of these important variables skewed the output of the model: "No computer program, no matter how well designed, is a substitute for intellectual honesty and scientific rigor".

Breitburg's work, however, has been supported by a number of other researchers who found great difficulty in applying McKusick's criteria for separating the domestic breeds (Munro 1994; Olsen 1990). In Munro's (1994) study of turkey bones in the Sand Canyon locality, she was not able to recognize any of McKusick's diagnostic characters. Munro noted some minimal and inconsistent variation among individuals, but could not identify either the LID or SID characteristics (pg. 85-86). In addition to the discrete osteological traits, Munro's study also included an examination of overall turkey size. Although her measurements (confined to turkey tarsometatarsi) found variation in the greatest length of the elements, the differences seemed to reflect sexual dimorphism rather than multiple turkey breeds.

Likewise, Olsen (1990:47) noted that the adult turkeys from Grasshopper Pueblo displayed a size continuum, ranging from specimens much smaller than Merriam's wild turkey, to those far greater than any available wild specimen. If size is the only criteria used to separate wild and domestic birds, then where does one set the cut-off point for separating the groups? Though McKusick's analysis of the Grasshopper specimens had identified both domestic and wild (M. g. merriam/) birds, Olsen's (1990:47) subsequent study led him to the conclusion that "such a fine characterization of the material is not justified". However, in contrast to McKusick and other zooarchaeologists, Olsen assumed that the larger end of the size of the continuum represented domestic, rather than wild birds, which may explain why his results differed from the previous analysis.

Senior and Pierce (1989) also had problems applying the criteria for breed determination in their analysis of turkey remains from the Homol'ovi III site. They found that some turkey remains displayed both LID and SID characteristics within a single skeleton, possibly indicating a domestic hybrid.

As early as the1960s, Schorger cautioned that there was no definite difference between Merriam's wild turkey and smaller Tularosa subspecies found in archaeological remains. "It is impossible, when only individual bones of the turkey are found, to determine if they belonged to the wild or domesticated bird" (Schorger 1966:24), cautioning that turkeys pens and dung were the best evidence for the presence of the 112 domestic bird. Olsen too noted that current turkey subspecies designations are based predominantly on geographic distribution, plumage, and behaviour, rather than on osteological differences.

Schorger (1961) was the first to consider that the small size of the Tularosa turkeys in archaeological sites was a product of confinement. Likewise, the stance of both Munro and Senior and Pierce, is that the differences observed between turkey populations may merely reflect natural variation, life history and environmental variables. Turkeys, like other animals, conform to their environments in predictable ways: mass is generally increased in colder climates, colour darkens in more humid climates, and tarsal length decreases with temperature (i.e. Bergman's rule, Gloger's rule and Allen's rule respectively) (Eaton 1992:3). Domesticates' plumage may also darken if they are reared indoors, since they are not exposed to effects of UV radiation (Sossinka 1982:381). Additionally, relative increases or decreases in overall body size may result either from intentional breeding, or impoverished diets, or inferior living conditions (Sossinka 1982; Zeder 2006a).

The only large collection of SID birds comes from Gran Quivira, a Pueblo IV site in northern New Mexico. Breitburg suggests that the small size of the SID at the site may be the result of isolation which prevented gene flow between the domestic and wild population, which were further exacerbated by environmental or nutritional pressures. The SID's small body size may also reflect a phenotypic response to stressful environmental conditions, overcrowding, a lack of water or suitable nutrition. Senior and Pierce (1989:255-256) relate three examples of the SID appearance in Casas Grandes, Arroyo Hondo and Gran Quivira all coinciding with times of climatic stress and low precipitation. Environmental plasticity and/or natural variation would also explain the prevalence of LID and SID 'hybrids' within the archaeological record.

While McKusick (1986b:24) defends her stance, she has been the first to remark that many of the breeds' diagnostic characters are difficult to recognize, and may not be obvious to all observers. However, not only are the characters somewhat subjective, they have also been constructed using archaeological populations only. Since both the putative SID and LID breeds are likely extinct, these criteria could not be validated on living populations. Ancient DNA analysis, which can characterize the genetic structure of the presumed SID and LID breeds, offers a new tool for validating the breed criteria.

113 Stock Enhancement

In addition to the number of Southwest domestic breeds, several other questions have been raised about indigenous turkey husbandry, especially revolving around intentional selection and stock enhancement. Breitburg noted that there were strong biological affinities among domestic birds throughout the Southwest. This type of uniformity may be a reflection of population inbreeding, which can be both inadvertent or deliberate. During the first stages of domestication, inbreeding may be purely the result of a small founder population. Later, deliberate inbreeding and selection may occur to fix a particular trait for economic, cultural and aesthetic reasons (Clutton-Brock 1992). The uniformity of birds throughout the Southwest may additionally suggest the trade of birds between sites. The exchange of domestic birds between sites would counteract the effects of regional genetic drifts, maintaining a uniform population over a large region.

While inbreeding may be desired to standardize a phenotype, continuous inbreeding over many generations may lead to inbreeding depression, a "reduction in overall fitness brought about by the expression of deleterious genes previously masked by dominant genes at the same or different locus" (Price 2002:31). Inbreeding depression can result in increased juvenile mortality, and reduced reproduction and longevity - effects which may be more pronounced when animals are maintained under suboptimal conditions. Introducing genes from a new population and thus increasing the overall genetic diversity can counteract the effects of inbreeding. Heterosis usually results in increased size and vigour, and can take place very rapidly with the introduction of new genes (Price 2002). In many animal species, an individual's overall level of genetic variability or heterozygosity, may also affect growth rates and body size, heterozygotes may grow faster, and attain a larger body sizes than homozygous individuals (Allendorf and Leary 1986).

Ancient DNA studies of other domestic animals have pointed to the hybridization of domestic stocks and local wild populations (Larson et al. 2007; Vila et at. 2003), and a number of researchers have raised the possibility that wild turkeys and domestic flocks were interbreeding in the past (McKusick 1986b; Schorger 1966). It is often difficult, however, to assess any human intentionality behind this hybridization. For example, wild males may fertilize domestic females when the two populations are residing in adjoining territory, without the intent of the human owners. At the other end of the 'intentionality' spectrum, the Ancestral Puebloans may also have been placing stolen wild turkey eggs

114 under brooding hens, capturing young wild turkeys or confining wild toms until they had fertilized the domestic females (Schorger 1961: 139). Hybridization between domestic and wild turkeys in modern times has produced much larger and vigorous birds (Marsden and Martin 1946:22-23), and hybridizations in the past may have been encouraged to enhance the size or hardiness of domestic flocks.

Ethnographic and historic evidence support the deliberate capture of wild birds. There is ample evidence for the capture and rearing of many types of wild birds throughout the greater Southwest. The Zuni and the Hopi would capture and raise eagles, while the Mohave, Cucapa and the Havasupai raised both hawk and eagle nestlings for feathers, releasing the birds when they were full grown (Rea 2007:52). Oral histories and ethnographies record how vultures, eagles, hawks, macaws, and turkeys were raised among the Northern Pima. Golden eagles and Red-tailed hawk nestlings were taken from eyries, caged until feathers could be harvested once or twice, and then released (Rea 2007:54-56).

Historically, wild turkeys were captured and used in Northern Mexico as well. In the Sonora area, Pfefferkorn noted that although guajalote [wild turkey] were raised, they would die in captivity unless hatched with a brood hen (Schroeder 1968:104). In Chihuahua, the Tarahumara also would occasionally capture local Gould's wild turkeys:

The turkey (siwl) in a domesticated state is not often seen among the Tarahumaras. However, plenty of turkeys are found wild in the sierra and brought home by the Indians. They are fed and carefully raised until they become quite tame and do not try to run away. It is not even necessary to clip their wings... At night the turkeys sleep on the tops of houses or in nearby trees. If the Indians come across the eggs of a turkey, they often put them under a sitting hen (Bennett and Zingg 1935:23).

Archaeologically, the hybridization of wild and domestic turkeys may be supported by observations of some unusually large domestic populations, such as those found in the Point of Pines region of Central Arizona. McKusick suggested that these large domestic turkeys may represent a 're-domestication' of Merriam's wild turkeys, or the influx of wild genes into the domestic population (McKusick 1974:276).

Research Questions

This analysis hoped to address such questions as: Can DNA confirm or refute the proposed breed designations of SID and LID? Was a single original domesticated

115 l

flock dispersed throughout the region, or did the Ancestral Puebloans domesticate wild turkeys at different times and in different areas? Were several turkey breeds present at each site? Were the Ancestral Puebloans enhancing their flocks by incorporating wild birds into stock? Or through the trade of birds between sites?

Materials and Methods

The research strategy began with osteometric analysis of the bones as a first step in distinguishing SID, LID, wild, and male and female turkeys. Since many of the samples were fragmented, regression analysis was conducted to derive greatest length measurements from proximal or distal fragments, so the data would be applicable to McKusick's breed and sex criteria. Finally, metric variation was evaluated in terms of haplotype variation, and genetic sex identifications obtained through ancient DNA analysis.

Osteometric Analysis

All archaeological turkey long bone elements were measured according to von den Dreisch (1976) and compared to McKusick's (1986) osteological criteria to differentiate LID and SID prior to ancient DNA analysis. The osteological analysis for this objective was confined only to those 171 archaeological turkey bones from which D­ loop haplotypes could be obtained. Additionally, the bulk of the osteological analysis was limited to the most prevalent element, the humerus. Analysis focused on the greatest length (GL), the greatest proximal breadth (Bp) and the greatest distal breadth (Bd) of the humerus.

The archaeological samples included 126 humeri, 47 of which were complete elements (40 adults and seven immature individuals). An additional 40 humeri had intact proximal or distal ends, which were incorporated into regression analyses to estimate the greatest length. This study only included measurements from adult birds (over two years of age), when skeletal growth was complete. Adult bones displayed complete ossification of cartilaginous areas of bone, especially at the epiphyseal ends of the long bones (Gilbert et al. 1996). Measurements taken on 23 complete humeri from Gran Quivira (which were not analyzed using ancient DNA techniques) were also included in the osteological analysis.

116 This study included intra and inter-observer error calculations to test the replicability of the von den Driesch measurements. A total of 43 measurements (on 15 separate elements), were taken by an independent zooarchaeologist (Dr. Rober Muir) and repeated by the author. Measurements on the same 15 elements were repeated by the author after a two week period to test intra-observer replicability.

Regression Analysis

The majority of the turkey skeletal elements collected for DNA analysis were fragmented, and thus could not be compared to published osteological criteria for breed or sex identification (Kooliath 1975 in Gilbert et al. 1996; McKusick 1986b; Wakeling et al. 1997), which are based on an element's greatest length. Therefore, two simple linear regression formulae were calculated to estimate greatest length based on greatest distal or proximal breadth measurements. Using SPSS (v.17.0), regression formulae were calculated by first plotting the measurements of the 40 complete adult turkey humeri (20 females, 15 male, 5 unknown) on a scatter graph, plotting a simple regression line, and calculating a regression formulae for GL from either the Bp or Bd.

Sex Identification

The genetic sex of the archaeological turkey bones obtained through mtW co­ amplification were used to confirm morphological criteria for sex estimation, as well as to examine flock management practices. Measurements of bones of known sex were used to provide male and female size ranges that could be applied to sample of unknown sex (e.g. Gran Quivira humeri).

Haplotype Analysis and Distribution

The D-Ioop haplotypes obtained through ancient DNA analysis were assessed in two ways. First, descriptive statistics were used to examine the relationship between haplotypes and bone element size. Second, the haplotypes' regional distribution was assessed to examine the geographic relationships of the types throughout the Southwest and to determine if they formed patterns that would indicate the presence of genetically isolated breeds.

117 Results

Inter-and Intra-observer Error

The inter-observer and intra-observer test measurements are reported in Appendix G. The maximum inter-observer difference was 2mm (1.3% of total measurement) and the maximum percentage error 3.9%. Average inter-observer error rates were 0.5mm, or 1% of total measurement.

The maximum intra-observer difference was 1.6mm (3.7% of total measurement) and the maximum percentage error 4.1 %. Average intra-observer error rates were O.4mm, or 0.8% of total measurement.

Regression Analysis

All 40 complete adult humeri were included in the regression analysis. Figure 21 displays a bivariate plot of greatest proximal breadth by greatest length. The humeri displayed an R2 value of 0.936, demonstrating a strong positive correlation between greatest proximal breadth (Bp) and greatest length (GL).

160.0 Sex ID o Female D Male X Not amplified 150.0 "'" Fit line for Total

140.0- I :::;- 1300 C)

120.0-

110.0- R2 Linear =0.936

25 30 35 40 45 Bp (nm) Figure 21 Bivariate plot displaying the strong correlation between greatest proximal breath and greatest length for the 40 complete adult turkey humeri 118 A simple linear regression formula of Y'= 3.08x+20.35 was calculated to predict GL from Bp. A similar formula was calculated to predict GL from the greatest distal breadth, resulting in an R2 value of 0.924 (Figure 22), and the formula of Y'= 4.274x+11.793.

160.0- Sex ID o Female D Male X Not amplified 150.0- ~~~~~ Fit line for Total

140.0- I ::i' 130.0- C)

120.0

110.0- R2 Linear = 0.924

100.V~--I'------'I------'-I----"--I---r-I----' 22.5 25.0 27.5 30.0 32.5 Bd (mm)

Figure 22 Bivariate plot displaying the strong correlation between greatest distal breath and greatest length for the 40 complete adult turkey humeri

These regression formulae were used to predict GL from proximal and distal humeri fragments. Appendix H presents the measurements for 76 adult humeri incorporated into subsequent analyses, with the predicted GL values presented in bold type.

119 Osteometric Analysis

'Breed' Designations

Although the osteometric analysis attempted to distinguish LID and SID based on the McKusick's (1986) diagnostic criteria, none of the samples could be definitively assigned to either category based on visual or metric analyses of the bones. While McKusick provides osteometric criteria for LID and SID, based on the greatest length of the long bones, (e.g. Table 16), there is significant overlap in the measurement ranges assigned to SID, LID and Merriam's wild turkeys for each sex.

Table1G McKusick's (198Gb) GL of humeri for each turkey populations Population Male (mm) Female (mm) LID 137.7-153.0 108.2-129.9 SID 125.9-146.0 99.6-120.7 Merriam's - 128.3-129.9 Note: The ranges provided are minimum and maximum measurements based on all archaeological populations listed in McKusick (1986b).

Due to the degree of overlap within McKusick's criteria, the turkey humeri could not be confidently assigned to any population based on actual or predicted humeri greatest length measurements. Of the 37 female samples with actual or predicted greatest length measurements, none fell within the Merrim's range, 36 fell within the LID range, and 26 within the SID range (Appendix H). For the males, 36 of 39 samples fell within the LID range, and 30 of 39 fell within the SID range.

Sex Identification

While there was great difficulty in assigning presumptive breed designations, the osteometric analysis demonstrated marked sexual dimorphism between male and female individuals. A frequency distribution of GL measurements from 35 complete adult turkeys of molecularly determined sex demonstrates the clear division between the sexes (Figure 23); no overlap occurs between the largest female and the smallest male. Based on these measurements, tentative sex identities were assigned to those samples that failed the mtW test. Humeri >130mm in length were assigned as male, and humeri <130mm were assigned as female (Appendix H).

120 Sex ID DFemale ~Male

Ferrale lIt1ean =118.188 Std. Dev. =4.6038 N =20 Ivlale lIt1ean =144.06 ~ Std. Dev. =3.6957 N=15 ~ 6. :::s C" ...CIl LL.

4.

2.

100.0 110.0 120.0 130.0 140.0 150.0 160.0 GL(mm)

Figure 23 Frequency distribution of GL measurements of complete adult turkey humeri of molecularly determined sex

A similar frequency distribution was produced using the GL measurements from the Gran Quivira (SID) turkey humeri which had not undergone ancient DNA analysis. The same bi-modal distribution with no overlap, was observed in these samples (Figure 24). The Gran Quivira samples were assigned tentative sex identities based on the same measurement criteria, i.e. GL >130mm =male, GL<130mm =female (Appendix B).

121 6.0

~ c ~ 4.0 tT ...CD LL

2.0

.0....L..---.--- 100.0 110.0 120.0 130.0 140.0 150.0 GL(mm) Figure 24 Frequency distribution of Gran Quivira humeri greatest lengths

As discussed in Chapter 5, the H1 haplogroup seems to represent the genetic signature of the domestic bird, while the H2 group may include wild, captured or domestic individuals. In order to compare the osteological differences between the presumed SID breed at Gran Quivira, and McKusick's presumed LID found elsewhere in the southwest, a comparison was made between the GL of the Gran Quivira collection (SID) and the H1 turkeys. While not all of the H1 samples could not be confirmed as LID based on McKusick's osteometric criteria, all the H1 samples post-date the arrival of the LID into the Southwest (i.e. post AD500), and the majority of the samples are from archaeological sites where McKusick (1986b) identified the presence of LID birds.

Figure 25 demonstrates there is indeed a size difference between the presumed SID at Gran Quivira, and the H1 turkeys. The Gran Quivira individuals fall at the lower end of the size range for both the male and female birds, and there is a 10mm difference between the mean lengths of the two groups.

122 H1 25. o ~ GQ

H1 Mean= 131.1 20.0 N=68 GQ Mean=121.2 N=26 ~ ; 15.0 ::::l tT ~ U.

5.

.01....1.---.....-- 100.0 110.0 120.0 130.0 140.0 150.0 GL(mm)

Figure 25 Frequency distribution of humeral greatest lengths of the Gran Quivira and H1 adult birds

When the mean length of the males and females are considered separately, the Gran Quivira humeri are significantly smaller than the H1 humeri in both sexes (Table 17). Among the males, the H1 mean GL exceeds that of the SID by 3.4mm, with at-test demonstrating a significant difference between males of the two groups (p=.024). This difference is more marked among the females of both groups, where the mean GL of the H1 females exceed the SID females by 5.96mm (p

Table 17 GL mean measurements for H1 and Gran Quivira humeri

Type N= Mean Std. Deviation Std. Error Mean H1 33 143.3 3.78 0.66 Males GQ 8 139.9 2.98 1.05 H1 27 118.8 2.86 0.55 Females GQ 18 112.9 3.86 0.91

123 The osteometric analyses demonstrate that there is a significant size difference between the Gran Quivira population and the domestic turkeys found elsewhere in the Southwest. The ancient DNA analysis haplotypes, however, are not strongly linked to the osteological differences. Table 18 displays the frequency of H1 haplotypes found at Gran Quivira compared to sites elsewhere in the Southwest.

Table 18 Haplotype frequencies at Gran Quivira and other Southwest sites aHap1 aHap1a aHap1b aHap1c aHap1d H1 140 2 0 1 1 GQ 2 1 1 0 0

While the sample size at Gran Quivira is extremely small, two of three haplotypes found at the site (aHap1 and aHap1 a) are also found at other sites in the Southwest. The most common H1 haplotype at other sites (aHap1) is also the most common at Gran Quivira. Only one Gran Quivira haplotype is unique to the site (aHap1 b).

A closer examination of haplotype and the bone size reflects little correspondence between the two variables. The smallest Gran Quivira humeri, TU1049, is significantly smaller than all female humeri, falling more than three standard deviations from the mean, but sharing the aHap1 haplotype with most other domestic birds. TU1054, carrying the unique aHap1c is of average size, falling between the means of both the H1 and GQ female groups (GL=115.4mm).

While there are no marked correspondences between haplotype and size among the H1 haplogroups, there are visible differences in the size of some H2 birds. The bivariate plot of Figure 26 clearly displays the large size of some H2 humeri.

124 Haplogroup 165.0- TU1041 OH1 TU1108 '0 DH2 160.0- '.0 ~ 155.0- TU1101

o 150.0- o

145.0

I 140.0- -135.0- ...J C> 130.0 TU1111 '.0 125.0- TU1112 <9 o fi...'-.o <9 120.0 o ~o o ~c9 o 0 115.0- o 00 110.0-

0 105.0-

II II 28.00 30.00 32.00 34.00 36.00 38.00 40.00 42.00 44.00 46.00 Bp(mm)

Figure 26 Bivariate plot of humeral greatest proximal breadth by greatest length of the two haplogroups

Of the seven H2 samples where humeral measurements were possible, five of the samples are at the large end of the male or female continuum. McKusick's criteria had proposed a humeral GL range of 127. 5-129.9mm for female Merriam's turkeys, but no size range for wild male humeri. However, McKusick noted the maximum length for the male LID was 151-153mm, and theoretically, male Merriam's birds should exceed these measurements. Four of the seven H2 types fall into the size range proposed for Merriam's turkeys, while the other three fall into the typical range for LID birds (Table 19). The standard scores suggest that these four individuals are indeed significantly larger than the rest of the male and female population, respectively.

The tibiotarsus was the only other element with sufficient measurements for a comparison between haplogroup and size (note: while there were also 15 complete tarsometatarsi, none of them was identified as H2). Figure 27 displays a bivariate plot of distal measurements obtained from 15 tibiotarsi from the H1 and H2 groups. Of the four H2 individuals, only TU 135 falls in the largest end of the size continuum. TU 135 was

125 obtained from the Calderon site in Chihuahua, and is consistent both in haplotype and size to the Gould's wild turkey subspecies. The three other H2 individuals are consistent with the size of the H1 turkeys.

Table 19 Measurements and standard scores of H2 humeri samples LablD GL (mm) Haplotype Sex z-score* TU2 142.0 aHap2 Male -0.39 TU44 138.3 aHap2* NAiM -1.03 TU1041 160.5 aHap2 Male 2.82 TU1101 158.0 aHap2c Male 2.39 TU1108 159.3 aHap2d* NA/M 2.61 TU1111 127.8 aHap2* Female 2.23 TU1112 122.9 aHap2d* NAIF 1.01 Note: *z-scores calculated for separately for the male and female populations, respectively, NAIF = No amplification of mtW, but morphologically female, NAIM = No amplification of mtW, but morphologically male

Haplogroup OH1 TU4qjU135 22.00- DH2 o

TlJ65 TU1009 0 20.00- TU1063 TU1061 0 0

TU47 I 0 -'t' TU46 C 18.00- 0

TU48T1J63 16.00- TU520 0 o TU51 o TU96 00 TU500 TU1010

14.00 I I I I I I 14.0 16.0 18.0 20.0 22.0 24.0 Bd (mm) Figure 27 Bivariate plot of H1 and H2 distal tibiotarsi greatest distal breadth by greatest distal depth

126 Haplotype Distribution

The geographic distribution of the haplogroups was also considered to assess their spatial relationship to wild turkey populations. Figures# 28 and 29 display the locations of archaeological sites where the H1 and H2 types were recovered, while Figure 30 displays the archaeological sites where the rare H1 haplotypes (aHap1a-d) were recovered.

COLORADO

,i i i i i, i, .. _.--

CHIHUAHUA

o Sites with Hl Turkey Types • Casas Grandes II _ Merriam's Historic Distribution 11 N Gould's Historic Distribution

0, 150, 3C(J Kilometers 0 100 200 1 , , , Miles

Figure 28 Geographic locations of archaeological sites where H1 turkey were recovered (adapted with permission of the Crow Canyon Archaeological Center © 1999)

127 The H1 turkeys have a wide distribution, and were recovered from archaeological sites in all four states. The H1 turkeys are recovered from sites both within, and outside of the known range of Merriam's wild turkeys.

COLORADO

,i , l i \ i ._.j

X Sites with H2 Turkey Types • Casas Grandes It _ Merriam's Historic Distribution 1:1 N Gould's Historic Distribution

0 150 I I 3IfJ Kilometers A X 0, 100, 200, Miles

Figure 29 Geographic locations of archaeological sites where H2 turkey were recovered (adapted with permission of the Crow Canyon Archaeological Center © 1999)

In contrast almost all H2 types are found within or nearby the historic range of Merriam's (and Gould's) wild turkey. The only exception is samples is the H2 individuals recovered at Chaco Canyon, in northeastern New Mexico. The rare H1 haplotypes,

128 aHap1 a-d are not distributed throughout Southwest sites, but are clustered within northwestern New Mexico.

COLORADO

i I I i, i i, i -_.--,

CHIHUAHUA

a,b,c,d Sites with rare HI Turkey Types ! _ Merrtam's Histortc Distribution 11 _ Gould's Historic Distribution N

0 ,,150 31/0 Kilometers A 0, 1~0 200• Miles

Figure 30 Geographic locations of archaeological sites where rare H1 haplotypes were recovered (adapted with permission of the Crow Canyon Archaeological Center © 1999)

129 Discussion

SID and LID Breeds

The first question this analysis hoped to address was whether DNA could confirm or refute the proposed breed designations of SID and LID. According to McKusick's theory, the SID and LID were derived from two geographically distinct M. g. silvestris populations, the first from north-eastern Mexico (or southeast Texas) and the second from the Oklahoma region. Considering the genetic variation that occurs in wild turkey populations, these two domestic breeds should display different haplotypes or haplotype frequencies, based on McKusick's proposed separate domestication histories for the two groups. While the osteological data examined in this study supported the notion that Gran Quivira turkeys were indeed significantly smaller than the domestic lineage found elsewhere in the Southwest, the ancient DNA data could not confirm that they formed a mitochondrially distinct lineage.

The Gran Quivira turkeys do display some haplotype differences when compared to the rest of the Southwest turkeys. Four D-Ioop haplotypes were identified within the five samples from Gran Quivira. Two samples were aHap1, a haplotype shared with the majority of the other Southwest turkey samples. One sample was aHap1 a, a haplotype shared with turkeys from Los Alamos and Bandelier, and one sample had a unique H1 haplotype, aHap1 b. The fifth sample was significantly larger than typical Gran Quivira humeri, and displayed a H2 haplotype (aHap2). With a GL of 160mm, TU1041 was the largest humerus in the entire ancient DNA sample, far larger that the size criteria proposed for male LID. Likely, this H2 individual represent a wild turkey obtained though hunting or capture, rather than a member of the domestic flock.

Obviously, the DNA analysis of four turkeys is not sufficient to characterize the entire pre-contact turkey population at Gran Quivira. However, the obtained haplotypes can offer some insight into make-up of the Gran Quivira stocks. The presence of aHap1 types at the site suggests that at least some of the Gran Quivira birds were derived from the same ancestral lineage as the domestic turkeys elsewhere in the Southwest. Additionally, the shared aHap1 a haplotype with turkeys at Los Alamos and Bandelier also points to genetic relationships with 'LID' turkeys at nearby sites. These shared haplotypes suggest that the SID and LID breeds were not kept genetically 'pure', as

130 McKusick hypothesizes, but that the Gran Quivira turkeys had genetic input from the domestic lineage found throughout the rest of the Southwest (and vice-versa).

The Gran Quivira flocks, however, date to the Pueblo IV period, nearly 1000 years after the presumed introduction of SID into the Southwest. It is possible that the original 'SID' breed had a distinct haplotype signature, but that interbreeding with other H1 turkeys diluted or eliminated this signature over time. An alternative explanation is also possible, namely that the rare haplotypes found at Gran Quivira (and other Pueblo IV sites like Los Alamos and Bandelier), are later introductions into the Southwest domestic turkey populations, possibly originating from Cases Grande in Chihuahua (see more discussion below).

The earliest sample obtained in the study dates to late Basketmaker III, (after the introduction of the LID), and no early confirmed SID samples could be obtained for analysis. Since very few SID turkeys have been recovered from Basketmaker II or III sites, it is difficult to obtain permission for destructive testing on these rare bone samples. However, some ancient DNA analysis has been conducted on archaeological turkey coprolites recovered from Turkey Pen, on Arizona's Black Mesa, dating to Basketmaker II (ca. 200 BC- AD 450), and the earliest period of domestication (Speller et al. in prep; Wyatt et al. 2009). Pollen analysis conducted on two turkey coprolites at the site noted that they contained copious amounts of corn pollen, suggesting that some birds were being provisioned, or had access to corn (Aasen 1984). As the turkey coprolites were recovered from a midden within the living area of the site, they seem to represent domestic or at least captured birds (Matson 1991; Matson and Chisholm 1991). Since the archaeological contexts predate the arrival of the LID, these samples should represent SID coprolites. DNA analysis of the coprolites revealed the aHap1 signature, matching the domestic lineage found throughout the rest of the Southwest (Speller et al. in prep). No other H1 haplotypes were observed in the 19 coprolites, (though two H2 signatures were also observed), suggesting a genetic continuity between the earliest turkeys imported into the region and later populations.

Considering the genetic similarity of both the Turkey Pen coprolites and the Gran Quivira birds to other Southwest populations, the DNA data cannot confirm a distinct breed designation for the SID. Instead, following Senior and Pierce and others, the small size of the Gran Quivira birds is more attributable to environmental variables than intentional selection and breeding. The major difference between the presumed SID and

131 the LID birds is overall size. The plumage colour does not seem to differ between the two 'breeds', which would be expected if a population was selectively bred for a desired phenotype. McKusick's osteological analysis, however, of the Gran Quivira birds did provide some evidence that the birds suffered from poor living conditions. Compared to other Southwest archaeological domestic turkeys, her data indicated a higher mortality rate for poults and immature turkeys (12.5% and 16.9% respectively), and a high incidence of pathologies, such as warping of the tibiotarsus and tarsometatrsus shafts in a rachitic manner, along with evidence of perosis in the tarsometatarsus proximal articular head (McKusick 1981 :51). These pathologies are quite likely the results of sunlight deprivation (as pens were located behind the cliff dwellings, next to the cliff wall, or in unused hallways or enclosed rooms) and nutritional deficiencies resulting from a predominantly maize diet.

Further ancient DNA analysis of 20-30 samples from Gran Quivira would present an excellent opportunity to more fully characterize these smaller birds. Since it is clear that osteological size differences exist between the Gran Quivira birds, and other Southwest domestic turkeys, the DNA testing could be accomplished on fragmented archaeological remains, thus reducing the destructive nature of the ancient DNA technique. Other 'SID' bone samples, preferably from the earliest time periods of domestication (such as Tularosa Cave and Tsehatso) should be tested to ascertain if the Gran Quivira stock is truly descended from the first domestic turkeys in the Southwest, or whether they represent a population with admixture from later sites within or outside the Southwest.

Single Domestic Lineage with Trade

The data retrieved in this study point strongly to the presence of only a single turkey population found throughout the Southwest. Rather than supporting the hypothesis of two separate breeds imported from different geographic origins, the uniformity of the turkey stocks suggests that only a single domestic lineage was imported into the region.

The distribution of the H1 types also has strong implications for the exchange of turkey stocks throughout the Southwest. Breitburg's (1988) biometric study of Southwest turkey populations was the first to suggest that turkeys were traded between sites, based on the metric uniformity of turkeys throughout the region. The uniformity of the

132 genetic data recovered in this study supports Breiburg's assertion. The same turkey stocks, as represented by aHap1 haplotype, seem to be present from the earliest periods of domestication, until the decline of turkey stocks in the 1700s. The H1 types are distributed over several hundred square kilometres, from Tonto National Monument in Southern Arizona, to Pecos Pueblo in east-central New Mexico, and north to San Juan region of Colorado, incorporating the territories of several cultural traditions including the Ancestral Puebloans, Hohokam and Mogollon. The ubiquitous presence of a single type suggests that the domestic stocks were traded between sites, and between cultural territories. This hypothesis is supported by the presence of unusual or rare haplotypes between contemporaneous and neighbouring archaeological sites. For examples, aHap1 a is found in three turkey individuals, one at Rainbow House, one at LA12587, and the last at Gran Quivira. Rainbow House and LA12587 are both located near Bandelier National Monument, and are roughly contemporaneous sites, while Gran Quivira lies farther to the south, and dates about 50 years later in time.

What is the significance, however, of the other uncommon H1 types found within the domestic lineage? These rarer types (aHap1a-d) are found in the later time periods (Pili and PIV) and are confined to north and central New Mexico. There are at least three explanations that could account for the presence of these types in the domestic population, including random mutations, secondary introductions, and founder effects.

First, these types may be most easily explained as the result of genetic variability and random mutation that occurs over time in any population. The occurrence of these types in the later time periods may point to the accumulation of genetic mutations over time.

The second hypothesis might suggest the introduction of other Eastern/Rio Grande turkey types or breeds after AD1150, potentially from the Oklahoma region, or from further south at Cases Grande. The exchange of corn for bison meat between the Pueblo and Plains groups has been noted in the PIV period (Spielmann 1991). The introduction of wild turkey from further east could account for the presence of these new types. Alternatively, they may represent turkeys traded in from Casas Grande, in Chihuahua, as both turkeys and macaws were bred and traded into the Southwest from this large Mexican site. The Casas Grandes site contains birds which McKusick (1974) identified as both LID and SID, as well as some wild turkey types. It is difficult to track the trade of turkeys from Cases Grande into the Southwest, since both areas are raising

133 morphologically similar birds. The peak of macaw trade from Casas Grande into the Southwest takes place between AD1150-1400 and could act as a proxy for turkey trade from the south. Interestingly, this time period coincides with the presence of the 'rare' H1 haplotypes in northern New Mexico, and trade of turkeys from Casas Grande may account for the presence of these rare haplotype both at Gran Quivira, and other nearby sites.

Finally, the presence of these types within New Mexico, and not within the Northern San Juan and Arizona populations may reveal bottleneck and founder effects associated with the arrival of the domestic lineage into the Southwest. Although we cannot pinpoint the geographic origin of the first Southwest turkey stocks, it is likely that it lies to the southeast of the region, within the natural habitat of the Rio Grande or Eastern Wild turkey. If the domestic stocks moved into the region on a northwest cline, genetic diversity should be highest in the southeast of the region, and slowly declining with the founder effect of each progressive move east and north.

Unfortunately, the data from this study cannot adequately confirm or refute any of the three possible hypotheses (i.e. random mutation, secondary introductions, or founder effects) to account for the presence of the four rare H1 haplotypes. To further test these three hypotheses, DNA analysis should be conducted on Pueblo I and II samples from New Mexico, as well as on archaeological turkey remains from the Plains, and Casas Grande 'LID and SID' birds.

Stock Enhancement

Although it seems that only one domestic stock was present throughout the Southwest, there are at least two lineages of birds identified in the archaeological remains - the H1 group and the H2 group. Despite a clear focus on the exploitation of domestic birds, approximately 12% of the archaeological samples were identified H2, genetically similar to the Merriam's wild turkey. The presence of these types (albeit limited), demonstrates that local turkeys were indeed exploited in conjunction with the imported domestic bird.

It is impossible to ascertain whether each H2 individual represents a 'wild' or 'domestic' bird, or falls within a range of human-animal relationships that lie between those two extremes. The geographic, archaeological, osteological, and ethnographic

134 data can give some indication that in addition to acting as hunted animals, wild turkeys may have been captured and incorporated into the domestic stocks.

Most of the H2 samples were recovered from sites in close proximity to Juniper sagebrush and ponderosa pine forests, the natural habitat of wild turkeys. With the exception of Chaco Canyon, in northwestern New Mexico, all the H2 birds are recovered from sites that fall within the Merriam's historic distribution range. Their local availability may suggest that these individuals represent hunted or live-captured wild birds, rather than members of the domestic lineage. Even the Pueblo II large regional centre of Chaco Canyon has ample archaeological evidence for the use and/or trade of many mountainous region flora and fauna, such as pine timber, red fox, elk, deer, black bear and grizzly bear, likely imported from the nearby Chuska Mountains (Badenhorst 2008: 108); the presence of a hunted wild turkey at the site would not be unexpected. The extremely large size of some H2 elements also supports the concept of hunted wild birds. These individuals fall within the size range expected for Merriam's wild turkeys, and are larger than the rest of the H1 domestic lineage.

On the other hand, there is ample support for the capture of wild turkeys, or the intentional or unintentional hybridization between wild and domestic animals. As mentioned previously, the coprolite analysis from Turkey Pen, AZ, revealed the presence of H2 individuals (Wyatt et al. 2009). The recovery of the coprolites from an excavated turkey enclosure, in addition to the discovery of corn pollen within the coprolites themselves (Aasen 1984), indicates that local birds were likely confined and provisioned along with the H1 domestic stock.

Additionally, although some H2 individuals are significantly larger than the rest of the population, other H2 individuals are the same size, or even smaller than the average H1 birds. While a certain amount of variation is expected within the size of wild populations, the osteological similarity between some H2 birds and the general H1 population (for examples, H2 birds at Headley Ruin, or at Mockingbird Mesa), may represent the genetic signature of wild birds that had been incorporated into domestic stocks. Although the offspring of first or second-generation hybrids may be slightly larger than other domestic turkeys, successive generations of these hybrid offspring should display size similarities with the rest of the population.

Since offspring of small domesticates and wild turkeys are known to produce larger and more vigorous hybrids (Marsden and Martin 1946), the occasional 135 l

hybridization, either intentional or unintentional, may account for size difference between turkey populations within the Southwest. The turkeys in the Grasshopper and Point of Pines region represent some of the largest domestic turkeys in the Southwest. The genetic data from this study support the notion that these populations represent hybrid birds, since both the aHap1, and multiple H2 signatures were observed in the remains from this region.

Most importantly, this type of breed enhancement may account for apparent size difference between the earliest 'SID' birds, and the later 'LID' birds. Rather than representing two distinct breeds, the increase in size over time may instead represent the intentional or unintentional enhancement of relatively inbred domestic stocks with new wild genes. The influx of additional genetic diversity from wild birds into domestic stocks may have resulted in an overall increase in the body size of the Southwest domestic turkeys. This hypothesis is consistent with genetic studies of modern wild turkeys, where more genetically variable turkeys weighed more than less genetically variable individuals of the same age (Stangel et al. 1992:23). Considering that pre­ contact turkeys display strong mitochondrial uniformity through time, hybrid offspring likely resulted from wild males fertilizing domestic hens. The offspring of wild males and domestic hens will carry the domestic mitochondrial signature of the mother - the input from the wild male will not be recognized through mtDNA analysis.

Both turkey behaviour and biology, and ethnographic data support this type of 'one-way' hybdridization. Captured wild females may have difficulty breeding in captivity due to factors such as imprinting and photoperiodicity. In many species, once mature female birds have bred in the wild, they will imprint on distinct environmental conditions for breeding, and will not reproduce in captivity. For example, in wild geese, successful capture and breeding of wild females can only occur if they are caught as juveniles, and mated with mature males (Bottema 1989:37). Additionally, photoperiodicity may playa role in breeding success. Birds that are adapted to certain environments will have specific breeding cues, such as rainfall patterns or day lengths, and these breeding patterns may not be adaptive in new environments, such as dark turkey pens (Lofts and Murton 1968). Captured males on the other hand, may show less inhibition when breeding, and may have been preferred for capture over females.

Ethnographic data lend weight to the 'one-way' hybridization theory. Among the Mountain Pima of Sonora today, Gould's wild turkey gobblers often intermingle with

136 domestic hens. The wild toms feed, breed, and live among the domestic birds for months at a time, typically leaving for the surrounding oak woodlands in spring to breed with wild females (Nabhan 1987). Not only do the Mountain Pima domestic turkeys exhibit diverse plumage when compared to other domestic turkey stocks, they are also vigorous animals, withstanding temperatures ranging from below freezing to over 1DDoF. If the first domestic birds were indeed introduced from lowland areas around the Mexican Gulf Coast, the introduction of local wild genes may have been essential in breeding a domestic bird that could withstand the climatic extremes of the Southwest.

Chapter Summary

This chapter investigated the flock management practices of the Ancestral Puebloans, examining such issues as the number of domestic breeds, trade of birds between sites, and the incorporation of wild birds into domestic flocks. The results of the osteometric and ancient DNA analyses suggested that a single lineage of domestic turkeys was intensively bred throughout the Southwest. While a significant size difference was observed between the majority of the domestic turkey samples, and the proposed 'SID' birds recovered from Gran Quivira, ancient DNA analysis could not confirm a distinct breed designation for the SID turkeys. Rather, the DNA and archaeological data suggest that the size difference observed between the Gran Quivira and other domestic birds reflects a phenotypic response to different environmental or living conditions, rather than intentional selective breeding for a particular trait or phenotype.

The uniformity of the genetic data indicates that the same domestic lineage was present throughout the four Southwest states, ranging in time from the earliest periods of domestication until late Pueblo IV periods. The geographic distribution of the turkey haplotypes suggests that domestic birds were being traded between sites. The osteological, genetic and ethnographic data also support the incorporation of local wild turkeys into domestic flocks, either through unintentional hybridization between wild toms and domestic hens, or through the intentional collection wild turkey eggs or poults. The introgression of wild genes into domestic flocks may be responsible for the observed size difference between early 'SID' and later 'LID', and may have been essential for developing a domestic flock capable of surviving in the climatic extremes characteristic of the Southwest.

137 CHAPTER 7: THE CHANGING ROLES OF TURKEYS

Archaeological, historic and ethnographic evidence all point to the secular and spiritual importance of turkeys in both Ancestral Puebloan and modern Pueblo culture. While archaeological evidence supports the birds' importance as a food item and a raw material source for artifacts and feather textiles, the historic and ethnographic literature highlight the turkeys' importance as a symbolic and ritual animal. There has been much controversy surrounding the principal use of turkeys, and the changing role and importance that different 'breeds', populations, or sexes of turkeys may have played through time (Munro 2006).

This chapter explores the third research objective, to examine the role of turkeys in Ancestral Puebloan culture. This chapter will explore varying hypotheses and evidence concerning the use of turkey through time, distinctions in the use of wild versus domestic turkeys, and male and female birds. The results, both of the regional DNA analyses, as well as the in-depth, site specific research at Sand Canyon, a Pueblo III site on the Colorado Plateau, seem to indicate that the Ancestral Puebloans focus on one lineage of domestic turkeys, for both ritual and economic purposes, with few marked differences in the uses of different populations or sexes of turkeys.

Ritual Use of Turkey

Historically and ethnographically, turkey feathers have been an important economic and ritual item. Birds of all types playa pivotal role in various aspects of Pueblo community life, and feathers especially are used as symbolic markers both to community members as well as to gods and abstract spirit forces.

"Even such mundane tasks as building a room or planting a field require the presentation of feathers from particular birds, while in the rituals that support religious ceremonialism birds and their feathers become counters that keep a complex symbol system in order" (Tyler 1991 :xi)

The turkey is symbolic of the earth (to which the bird is bound) as well as the rain, through its association with the rainmaking spirits of the dead (Tyler 1991:10, 88). Bird feathers, placed on altars and prayer sticks, are used to communicate with the spirit 138 world. Though feathers of certain bird species are specific to each ceremony, turkey feathers are used ubiquitously, and are regarded as the 'clothes' of the prayer-stick (Tyler 1991 :3, 79). Today, mortuary offerings in the form of turkey feathers are given to clothe the dead (Tyler 1991 :85), demonstrating continuity with pre-contact periods when human burials are found wrapped in turkey feather blankets or with feather grave goods (Breitburg 1993; Hargrave 1970a). Archaeological evidence for prayer-sticks (Judd 1954:262; Rohn 1971), and 'feather boxes' (ceramic containers assumed to hold feathers for ceremonial purposes) are also noted in Southwest sites (Judd 1959:18, 161; Morris 1939:180).

Other archaeological evidence indicating the turkey's ritual importance may be the interment of whole birds, often associated with kivas or human burials (Hill 2000). Some of the earliest evidence for turkey sacrifice may come from Canyon del Muerto, where an apparently 'beheaded' turkey was recovered from contexts dating to around AD250 (McKusick 1986b:11); this type of interment continues throughout the Southwest into Pueblo IV times (Munro 2006). There is ample archaeological evidence for both complete desiccated turkeys and turkey shanks and feet being interred (McKusick 1986b).

Different breeds of turkeys may also have filled different ritual roles. In her 2001 book, McKusick proposes that the SID would have been adopted and bred specifically as a sacrifice for Tlaloc, the Mesoamerican god of gentle rain. McKusick (2001 :44-46) suggests that young SIDs would have been decapitated, and their blood used as an offering to Tlaloc in order to increase rainfall for crops, paralleling the use of Mesoamerican turkey sacrifices depicted in the Dresden Codex. She points to examples of headless turkey remains, and deliberate neck and head sacrifices in the archaeological record, including a SID mummy from Basketmaker II contexts at Canyon de Muerto, 300 desiccated turkey carcasses from Basketmaker III levels at Tseahatso, Canyon de Muerto, and the 121 headless turkey sacrifices at Casas Grande several centuries later (McKusick 2001 :45). McKusick (2001) proposes that females may have been preferentially sacrificed since they mature earlier than males, and their glossy black feathering with white margins (mimicking the black and white face colouration of the masked Tlaloc), would have been desired for sacrifice in late October and November for the Aztec ceremony of Tepeilhuilt, honouring Tlaloc.

139 McKusick also outlines special roles for the LID breed as well, as sacrifices associated with the Tezcatlipoca cult. Tezcatlipoca, the Toltec sorcerer/war god representing war, sacrifice, and witchcraft, was often portrayed in turkey costume. Skin­ covered turkey legs with claws are a common Mesoamerican symbol for the deity, thought to represent Tezcatlipoca's foot, severed in his battle with the Earth Monster. McKusick (2001 :92-94) proposes that desiccated male turkey legs recovered from Southwest archaeological sites between AD11 00 to 1277, represent evidence of the Tezcatlipoca cult. These include foot offerings recovered from dark crevices or rock shelters at Tularosa Cave (ca. 1000), at Chaco Canyon (ca. mid-11 OOs), Antelope House (prior to 1277) and upper Tonto Ruin (post-1400).

Although McKusick has outlined several theories concerning the ritual use of these alleged breeds, her hypotheses are extensively rooted in Mesoamerican religion and ritual. Although common religious themes are documented between the two regions (Schaafsma 1999), much of the shared religious iconography emerges or intensifies in the late 13th century, with the development of the Kachina cult in the Hopi, Zuni and Rio Grande areas (Adams 1991), or in the proposed 'Southwestern Regional Cult', around east-central Arizona (Crown 1994). There is only weak archaeological evidence for common rituals and images prior to AD1300 that might support McKusick's hypotheses. Additionally, not all turkey burials necessarily reflect ritual activities or offerings. Instead, some intact turkey remains may merely reflect the disposal of birds that died of sickness or old age, or individuals not consumed as food (Munro 2006). Moreover, turkey 'decapitation' may merely reflect an expedient slaughtering method, rather than overt symbolic or ritual behaviour.

Change through Time

Although turkeys playa strong role as a source of feathers and symbolism, the archaeological evidence points to a shift in the use of turkeys through time. While feather use and ritual interment seem to be more frequent in the Basketmaker and early Pueblo periods, turkeys seem to become a principal food source during Pueblo II times. Munro's (1994) investigation into turkey production in the Sand Canyon locality persuaded her that the intensification of agriculture, increase in population density and reduction of other game in the region led the Ancestral Puebloans to increase turkey production in Mesa Verde region to provide an additional dependable food source.

140 The intensification of turkey husbandry during times of population expansion, would not only have buffered against subsistence stress, but would have also provided an important source of animal protein. Dwindling wild animal resources (and the reduction of available animal protein) during the population expansion of Pueblo III could have lead to human health issues. Evidence of anemia, in the form of porotic hyperostosis, is seen throughout Arizona and New Mexico sites, from Basketmaker II through to Pueblo V time periods, and "iron-deficiency anemia caused by over-reliance on maize has been suggested as the main factor responsible for the porotic hyperostosis of Southwest Indians" (Walker 1985: 146). The value of turkey as a protein source is backed up by the increasing use of turkey and decreasing use of artiodactyls in San Juan region sites from Pueblo II to Pueblo III, coinciding with the peak of human populations in the region (Muir and Driver 2002b).

There has long been controversy surrounding the use of turkey as food for the Pueblo people. Spanish accounts as well as ethnographic surveys have noted that several groups consider eating turkey taboo (Kennamer et a/. 1992; Lange 1951; Schorger 1966). McKusick (2001: 125) claims in the past, only the LID turkey would have been eaten, and only infrequently eaten in the Mesa Verde region after AD960. Instead, she believes that most turkeys were considered too valuable for food and were kept predominantly for feathers for twined robes, or for ritual.

Archaeologically, charred remains and unworked disarticulated bone scattered in Post-Pueblo II refuse pits both along with other mammal bones and trash provide substantial proof that turkeys were used as food, especially in the four-corners proper (Hargrave 1965b; Lang and Noble 1978). Butchery marks indicative of wing, and drumstick disarticulation, removal of wing tips and lower legs, removal of the neck, as well as split and damaged longbone ends indicate that bones were pulled apart, dismembered, gnawed, and bitten off (Hargrave 1965b).

The presence and frequency of butchery marks, however, have been contentious issues. Butchery marks are especially common on the distal end of the tibiotarsus, perhaps caused by removing the meatless lower leg and foot from the meaty drumstick. McKusick (1981,2001) claims, that rather than supporting turkeys as a food source, tibiotarsi and tarsometatarsi cut-marks indicate the removal of the drumstick and shank bone as an offering to Tezcatlipoca. Interestingly, Munro (1994: 109), Badenhorst (2008:53, 55) and Rawlings (2006:94, 99) all recorded that less than 10% of the turkey

141 bones in Northern San Juan Pueblo III sites displayed burning or butchery marks, despite the turkey's clear importance as a food sources during this period. Dirrigl (2001 a) noted the same low frequency of butchery marks in study of turkey remains in Northeastern archaeological sites, where turkeys were consumed, and Corona-M. (1997) too found few cultural modifications in domestic fowl remains from a Colonial period Mesoamerican site. These studies suggest that it is not appropriate to rely solely on cut-marks or burning to assess the importance of turkeys for consumption over other of raw material uses. Rather, the abundance of turkey remains, and their depositional contexts, either in domestic middens, or as fully articulated interred skeletons may be the most useful indicators for the principal function of turkeys within individual archaeological sites (Muir and Driver 2002a).

Wild versus Domestic

Although there is a demonstrable shift in domestic turkey use over time, the role of hunted wild birds is still unclear. McKusick (1986b) proposed that wild turkeys were caught and eaten during the Basketmaker periods when the domesticates were used primarily for feathers or ritual purposes. Was there a distinction between the uses of the wild and domestic birds in terms of food and ritual? Were these distinctions perpetuated once the domestic bird became an important food source? As early as 1951, Lange questioned...

"Is there a chance that domesticated turkeys were used exclusively for non-dietary functions, by at least some tribes? Is there a possibility that such a [food] restriction, if proved could have applied to only the domesticated turkey and not the wild turkey?" (pp. 208).

For example, in the 1620s, Zarate Salmeron noted that the Zuni Indians raised many turkeys for feather blankets, but hunted the wild turkeys for food (Schroeder 1968: 101). Historically kivas at Jemez had paintings of turkeys on the walls, as well as a hunting scene where turkeys were being shot in the trees. Even the Navajo decorated their war bonnets with eagle or wild turkey feathers, and also ate wild turkey (Schroeder 1968). Although wild turkeys were eaten in the historic period, how were they used in the past? As domestic turkeys became more prevalent during later Pueblo periods, were wild turkey still exploited to the same extent?

142 Research Questions

This research sought to explore a variety of questions, including: Can DNA analysis indicate whether wild and domestic turkeys, or different turkey breeds were used for different purposes? Were specific breeds used for food, textiles or ritual sacrifice? Was there a distinction in the use of wild versus domestic turkey or between different sexes of turkey? Moreover, how might the use of turkeys changed over time? When turkey production reaches its peak of intensity around AD1 000-1300 is there evidence that a particular breed (one used specifically for food or ritual) was husbanded more intensively than others?

This research objective included a broad-scale regional analysis, as well as a site-specific component examining one particular archaeological site (Sand Canyon Pueblo) where turkeys were heavily exploited. While the latter two research questions posed above may be addressed through a regional analysis of the distribution of turkey haplotypes through time and space, many of the former questions are difficult to address on a regional scale, due to differences both within and between cultural traditions and ecological zones. Confounding variables such as community size and location, agricultural production, environmental carrying capacity, etc., will also playa role in turkey exploitation. Moreover, the limited sampling strategy enforced by the costly and destructive nature of ancient DNA analysis curbs the number of DNA samples that can be selected from various archaeological contexts when spread over such an extensive regional and temporal scale. Therefore, this research also included a more focused, site­ specific component to examine the use of turkeys within one community, Sand Canyon Pueblo.

Sand Canyon Pueblo

The site of Sand Canyon Pueblo is located in the centre of the Northern San Juan Region, within the Colorado Plateau. Occupied from the 1240s until the last years of the13th century, this Pueblo III site is a large aggregated community, which would have been occupied by around 400-600 individuals (Kuckelman 2007a). The Crow Canyon Archaeological Center has pursued archaeological inquiry into the Sand Canyon locality since 1983, and their research goals have focused on the social, cultural and environmental changes that took place during the PIli period, culminating in the migration of Ancestral Puebloans out of the region around AD1300.

143 The Pueblo is located around 2073m elevation, at the head of a small canyon which bisects the site into east and west portions (Figure 31). The site is surrounded by a masonry wall, bordering the site on its eastern, northern, western and southwestern borders, which encloses most of the ca. 420 rooms, 90 kivas (in addition to a great kiva), 14 towers, an enclosed kiva, and aD-shaped bi-wall structure, as well as a small spring. Most of the "public architectural" structures, such as the great kiva, plaza, and D-shaped structure are located on the western side of the site. The excavations at Sand Canyon divided the site in the 16 architectural blocks, which included contiguous architectural structures and features, and were usually composed of multiple kiva suites or of a public building and associated structures (in the case of the Great Kiva, or D-shaped Block 1500). Kiva suites are defined as "a single, ordinary- or clan-size kiva and all the buildings, outdoor spaces, and refuse inferred to have been directly associated with it" (Bradley 1992a:82).

KEY

Excavated area Kiva Possible kiva Site-enclosing wall (inferred) -.( - Walls Approximate extent of rubble _. _. - Architectural block boundary Drainage

N T

10 20 30 Meters

i. j/ ;! -

l1DO· .... ·~·.:.:-.-~· ..::.-I.L:::·//·-·1400-·_·.... e2001 by Crow Canyon Archaeological Center All rights reserved Figure 31 Plan map of Sand Canyon Pueblo displaying the architectural blocks and excavated areas (adapted with permission of the Crow Canyon Archaeological Center © 2004)

The faunal assemblages from Sand Canyon Pueblo and other nearby sites have been extensively analyzed (Driver et al. 1999; Muir and Driver 2002b; Munro 1994). Muir's (1999, 2007) intensive study of the Sand Canyon faunal assemblage characterized the use of animals at the site and their spatial patterning throughout the 144 structures. His study indicated that approximately two-thirds of the assemblage was composed of mammals, one third composed of birds (mainly turkey), as well as a few less common taxa of amphibian, reptile, and gastropods. The mammals (representing around 64% of the assemblage) were dominated by lagomorphs, mainly cottontails, making up approximately 42%, followed by small rodent remains at 34% (such as mice, voles, woodrats, and gophers), approximately 10% artiodactyls (e.g. mule deer, pronghorn, and bighorn sheep), and a few wild and domestic carnivore remains (Muir 1999:46). The second most common class of animals was birds, representing around 34% of the assemblage. Turkeys (Meleagris gallopavo) and "Large birds" (likely turkeys) constituted close to 93% of the bird remains, reflecting the importance of this taxon (Muir 1999:46). Other birds included quail and grouse, ravens, American kestrel, hawks, turkey vultures and Great Horned Owls.

Muir's (1999, 2007) study examined the spatial patterning of the faunal remains within different architectural blocks and depositional contexts to examine distinctions within or between structures. Spatial analysis of the various animal species suggested that their distribution was patterned rather than random. Non-food species, such as birds of prey and carnivores, were rarely found in midden deposits, and were more frequently found in all other deposit types at the site. While lagomorphs were recovered throughout the site, the deposition of artiodactyls and Galliformes was concentrated in certain areas and room blocks.

Artiodactyls were found primarily in kivas and towers within Blocks 100,1000, and 200. Block 100 and 1000 (and possibly 200) contained D-shaped towers, and a high predominance of artiodactyls were found within the roof-fall deposits of the towers, and far fewer on the surface deposits. The greater quantity of artiodactyls remains within the D-shaped tower blocks has been interpreted as reflecting the communal hunting and feasting activities associated with those structures, perhaps serving as hunting or war­ society houses or offices (Kuckelman 2007a). Interestingly, Block 1000 also contained American kestrel (Falco sparverius) and Lynx spp. individuals, perhaps reflecting the hunting activities of this block (Muir 2007).

Galliformes in general were broadly distributed throughout the site, except within the D-shaped tower blocks (100,200, 1000) or in the D-shaped block (1500). These structures contained fewer "large bird" remains, and no deposits were dominated by these taxa. In contrast to the Galliformes, other bird taxa were found in higher quantities

145 in non-midden contexts, and especially concentrated in the D-shaped block. The ethnographic use of wild bird feathers in rituals, specifically in the manufacture of masks, prayer sticks, and prayer bundles (Gnabasik 1981; Tyler 1991), may account for the greater presence of these taxa within a public or ritual structure.

Galliformes dominated the midden and outdoor deposits throughout the site (though other "food" taxa, like lagomorphs were also present). The distribution and quantity of Galliformes (and lagomorphs) within domestic refuse deposits indicated they were used equally by all inhabitants, and points to their value as a commonplace food item.

The quantity and distribution of species at the site suggests that turkey would have been the primary meat source at the site, supplemented by lagomorphs. Though artiodactyls were also a significant part of the diet, these larger species may have been associated with ritual procurement and consumption. The distribution of artiodactyl elements throughout the site also suggested that there was little difference in terms of access to high-quality portions, though some households or structures may have accessed greater quantities of large game.

The expectations of this research were that "hunting" focused areas, such as Block 200, and Block 1000 would contain hunted wild turkey in addition to domestic birds. Block 1500, the D-shaped structure, would contain a higher quantity of turkeys used for ritual purposes; ritual 'birds' may include wild turkey, or female birds (following McKusick's hypothesis). Conversely, the standard living rooms and suits, such as Block 1200, would reflect a higher proportion of domestic turkeys (potentially displaying an even sex ratio if turkeys are being exploited for both meat and feathers).

Methods and Materials

Regional Analysis

The regional analysis (concentrating on the four-corners) was conducted to examine the distribution of haplotypes through time, especially focusing on the transition between the PI and PII periods at AD900. Since precise provenience information and depositional contexts could not be obtained for the majority of the samples, this analysis could not examine the spatial distribution of haplotypes within each site. The regional

146 analysis was restricted to examining the broad patterns in turkey exploitation through time.

Samples from 32 of the 43 sites were included in the regional analysis. The six sites located outside of the Ancestral Puebloan culture area were excluded from in the analysis. Since the Mogollon and Mimbres cultures did not use domestic turkey to the same extent as the Ancestral Puebloans (Munro 2006), or necessarily for the same purposes, the inclusion of sites like Grasshopper Pueblo, Point of Pines and Gila Cliff Ruin could potentially mask some regional or cultural patterns specific to the Ancestral Puebloans. Samples from five sites which could not be dated to a precise occupational period (i.e. a particular cultural phase) were also excluded from the analysis. For example, samples from Antelope House and Tsa-ta'a, in Canyon de Chelly, were not included as they could not be dated specifically to any of the five centuries of occupation. For sites where the occupation period spanned two cultural phases, sites were designated as the phase in which the majority of the site occupation took place. The 32 turkey samples from Sand Canyon Pueblo were also not included in the regional overview, since its large sample would overwhelm the Pueblo III group.

Site-Specific Analysis

To examine the distribution of haplotypes and sexes within a site-specific context, 32 turkey remains were analyzed from the site of Sand Canyon Pueblo. The samples were recovered from 13 different contexts within four structures which included two D-shaped tower blocks (Blocks 200 and 1000), one typical residential unit block (block 1200), and one "public architectural block", the D-shaped block (1500). Figure 32 displays a map of the four blocks, while Table 20 lists the sample contexts.

147 Figure 32 Plan maps displaying the structures and excavated portions of the four architectural blocks at Sand Canyon Pueblo (adapted with permission of the Crow Canyon Archaeological Center © 2004)

148 ,f Sand C rkev b Lab 10 PO FS Struct. TvDe Structure Structure OescriDtion Context TU55 163 18 Non-structure 209 Multiple study unit types Wall fall fill, secondary refuse, cultural deposit TU56 163 29 Non-structure 209 Multiple study unit types Wall fall fill, secondarY refuse, cultural deoosit TU57 184 6 Non-structure 209 Multiple study unit types Fill below wall fall, secondarY refuse, cultural deposit TU58 184 11 Non-structure 209 Multiple study unit types Fill below wall fall, secondary refuse, cultural deposit TU59 184 81 Non-structure 209 Multiple study unit types Fill below wall fall, secondary refuse, cultural deposit TU60 201 9 Structure 208 Aboveqround kiva Wall fall fill, collaosed structure TU61 211 51 Structure 208 Aboveqround kiva Roof fall fill, collapsed structure TU62 212 29 Structure 208 Abovearound kiva Surface contact, with fill, cultural deposit TU63 215 49 Structure 208 Aboveqround kiva Roof fall fill, collaosed structure, with de facto refuse TU64 263 9 Structure 1222 Kiva corner room Construction deposit TU65 271 3 Structure 208 Aboveqround kiva Roof fall fill, collapsed structure, with de facto refuse TU66 347 96 Non-structure 1214 Midden Wall fall fill, secondary refuse, cultural deoosit TU67 357 27 Non-structure 1214 Midden Wall fall fill, secondarY refuse, cultural deposit TU68 359 49 Non-structure 1214 Midden Wall fall fill, secondary refuse, cultural deposit TU69 359 49 Non-structure 1214 Midden Wall fall fill, secondarY refuse, cultural deoosit .t:o. TU70 359 90 Non-structure 1214 Midden Wall fall fill, secondarY refuse, cultural deoosit

.. _--- Architectural Block 200

Block 200 is located along the north-western portion of the site, with the western border of the block abutting the site enclosing wall. This block is considered a 'kiva­ dominated' block (with fewer than four rooms per kiva) (Bradley 1992a), though representing living structures and suites, since the rooms do not exhibit other indicators of special functions or activities (Kuckelman 2007b). The block contained aD-shaped tower, six kivas and associated rooms. The kivas themselves would likely be used for some domestic activities, as well as household level rituals. One of the kiva suites and two adjacent open areas were excavated. The turkeys included in this study were recovered from the above-ground kiva (Structure 208), and one extramural surface (Non-Structure 209). Structure 208 was a circular tower, that seems to have been remodeled into an above-ground kiva, and was associated with six other probable storage rooms. Non-Structure 209 contains the excavated portion of an extramural surface, which seems to have collapsed over a refuse midden associated with a permanent habitation or the kiva, since it contains varied artifacts, as well as ash deposits.

Architectural Block 1000

Block 1000 is considered a 'standard' living block (with five to 16 rooms per kiva), but like Block 100, and possibly Block 200, excavated structures included a two-story 0­ shaped tower, in addition to an above-ground kiva, two kiva corner rooms (likely for storage), two courtyards, two surface living structures, a surface storage room, and three additional structures whose use could not be determined. The block is located in the northeast portion of the site, and the north and eastern borders of the block are delimited by the site enclosing wall. Turkeys in this study were obtained from four areas: Structure 1004, a typical above-ground kiva; Stucture 1006, a small surface room, likely used for storage, and later as a refuse deposit; Non-Structure 1009, a refuse deposit, later covered with debris from the collapse of a two-story tower; and Structure 1012, a kiva, of an unknown type, but consistent with other Pueblo III kivas at the site.

Architectural Block 1200

Block 1200 represents another 'standard' residential block. The block was constructed on the bedrock rim, on a bluff overlooking the site; steep slopes surround

150 the block on its north, west and south side, while the enclosing wall borders the east side. Fifteen of the structures were excavated, including a circular tower, one above­ ground circular kiva, three kiva corner rooms for storage, one living room, five storage rooms, a mealing room, a courtyard, and a few structures whose use could not be determined. Turkey bones in this study were obtained from two structures: Structure 1214, a midden within Structure 1204 (a room of unknown use); and Structure 1222, a kiva corner room, accessed through a tunnel from the kiva, likely use for storage - an inference made from the small size of the room.

Architectural Block 1500

Block 1500 is a distinctive block, composed of two ordinary sized kivas surrounding by a large D-shaped bi-walled structure made up of multiple arc-shaped surface rooms. The block is centrally located within the pueblo, and seems to have been carefully designed and constructed (Kuckelman et a/. 2007). Although this block is made up of two kiva suites, the block was likely a center for ritual or specialized activities, and seems to represent 'public architecture', defined as "non-residential structures that play a role in the social and ceremonial integration of communities or societies" (Bradley and Lipe 1990:1 in Kuckelman 2007b). Along with the Great Kiva (Block 800), the D-shaped building was likely used as a communal area for ritual or non-residential purposes. Portions of at least 12 rooms were excavated, including the western kiva, bi-wall rooms, and some exterior areas immediately outside the kiva. Turkeys in this study were obtained from five different areas. Non-Structure 1500 is an area located outside, but adjacent to, the D-shaped building, just inside the central Plaza. Such open areas between blocks were probably used for a variety of outdoor activities, gatherings or events, in addition to acting as a refuse deposit area. Structure 1507 represents a bi-wall room. Considering the low height of the room «1 m), the space is an assumed storage room. Few artifacts were found on the floor surface, though secondary refuse was deposited, along with some construction material. Structures 1508 and 1509 are two more bi-wall rooms, with some secondary refuse deposited, while Structure 1519 is a storage room located in the lower part of a two-story building.

151 Results

Regional analysis

The regional analysis compared the frequency of H1 and H2 haplotypes through time. The results of the regional analysis demonstrated that the frequency of H1 turkey types exceeded H2 types in all times periods. Table 21 and Figure 33 compare the frequency of H1 and H2 types between the Pueblo I-IV time periods.

Table 21 Frequency of turkey haplogroups through time Haplogro PI (AD700-900) PII (AD900-1150) Pili (AD1150-1300) PIV (AD1300- H1 7 (58.3%) 13 (92.9%) 55 (96.5%) 21 (87.5%) H2 5 (41.7%) 1(7.1%) 2 (3.5%) 3 (12.5%)

60,------,

50 ------

:[ 40 gJ C. E :x 30 +------'0... .cCI> E :i 20 +----

10 +------

o PI (700-900AD) PII (900-1150AD) Pili (1150-1300AD) PIV (1300-1500AD) Figure 33 Frequencies of H1 and H2 haplotypes through time

Both the frequency and proportion of H1 types increases dramatically from the Pueblo I to the Pueblo III period. While the total number of H2 types remains fairly constant between periods, the proportion of H2 to H1 decreases from just over 41 % in

152 Pueblo I to only 3.5% in Pueblo III, with a slight increase to 12.5% in the Pueblo IV (Figure 34). 100.0 -- .. r 90.0 -..... 800 f------/ ------

.~ 70.0 e------/

~ 600 / ~ ... • I--H1 0 -e-H2 c: 50.0 0 'E 0a. 40.0 ... 2 D. .~ 30.0 20.0 "'" ~ 100 ~- "'" .. -..-- 00 PI (700-900AD) PI!"'"(900-1150AD) Pili (1150-1300AD)----PIV (1300-1500AD)

Figure 34 Relative proportion of Hi to H2 types through time

The dramatic increase in the number of H1 types over H2 types supported by a chi-squared analysis of haplogroups, (chi-square with Yates' correction for continuity= 11.79, p=O.008), indicating a significant difference in the exploitation of these two types over these time periods.

Table 22 and Figure 35 compare the frequency of males and females of each haplogroup through time.

Table 22 Frequency of turkey haplogroups and sexes through time

PI (AD700-900) PII (AD900-1150) Pili (AD1150-1300) PIV (AD1300-1500) n= 8 sites n=5 sites n=12 sites n=7 sites Haplogroup M F NA Total M F NA Total M F NA Total M F NA Total H1 6 1 0 7 7 6 0 13 24 24 7 55 14 7 0 21 H2 3 0 2 5 1 0 0 1 1 1 0 2 3 0 0 3 Total: 12 14 57 24 Note: M=Male, F=Female, NA=No Amplification for sex ID.

153 C~N. It) __• 0 - E.~ F =~ ii: ...

I ~ 00 ~~ FFJ~ _ It) _ •••• n:::

Co ~ -0< F -0 Q.cn

o 5 10 15 20 25 Number of Samples (n=)

Figure 35 Graphs displaying the frequency of male and female turkeys through time

Within haplogroups, the number of male birds exceeds the number of female birds in three of the four time periods. In Pueblo III, the time period with the largest sample, there are equal numbers of males and females of both haplogroups. While the small size of the H2 group makes it difficult to analyze, analysis of the H1 group suggests the differences in the number of males and females over time is not significant (Yates' chi-square = 2.484, p= 0.478).

Site-Specific Analysis

Haplotypes were obtained for 29 of the 32 samples (91 %) from Sand Canyon Pueblo, all of which displayed the predominant H1 haplotype, aHap1 (Table 23). Thus, the uniformity of the Sand Canyon sample made it impossible to examine possible differences in the distribution and role of H1 versus H2 turkeys.

Sex identification were obtained for 26 samples (81%), displaying a fairly even sex distribution of 14 males and 12 females. Table 23 presents the results of the haplotype and sex identification for each of the Sand Canyon samples.

154 Table 23 Haplotypes and sex identifications of Sand Canyon turkey samples LablD Block Structure Context Hap Sex Age TU55 200 209 Other aHap1 M Immature TU56 200 209 Other aHap1 M Adult TU57 200 209 Other aHap1 F Adult TU58 200 209 Other aHap1 M Adult TU59 200 209 Other aHap1 NA Adult TU60 200 208 Kiva aHap1 NA Adult TU61 200 208 Kiva NA NA Adult TU62 200 208 Kiva NA NA Immature TU63 200 208 Kiva aHap1 F Adult TU64 1200 1222 Kiva aHap1 NA Adult TU65 200 208 Kiva aHap1 M Adult TU66 1200 1214 Midden aHap1 M Adult TU67 1200 1214 Midden aHap1 M Adult TU68 1200 1214 Midden aHap1 F Immature TU69 1200 1214 Midden aHap1 F Adult TU70 1200 1214 Midden aHap1 M Adult TU71 1200 1214 Midden aHap1 M Adult TU72 1000 1004 Kiva aHap1 F Adult TU73 1000 1006 Other aHap1 F Adult TU74 1000 1009 Other aHap1 M Adult TU75 1500 1500 Other aHap1 F Adult TU76 1500 1500 Other aHap1 F Adult TUn 1500 1508 Other aHap1 M Adult TU78 1500 1508 Other aHap1 F Adult TU79 1500 1507 Other ID NA Adult TU80 1500 1507 Other aHap1 M Adult TU81 1500 1500 Other aHap1 F Adult TU82 1500 1519 Other aHap1 F Adult TU83 1500 1519 Other aHap1 M Adult TU84 1500 1519 Other aHap1 M Adult TU85 1500 1509 Other aHap1 M Adult TU86 1000 1012 Kiva aHap1 F Adult Note: M=Male, F=Female, NA=No amplification, ID=lnsufficient data to assign haplotype.

Table 24 and Figure 36 compare the distribution of male and female turkeys among the four architectural blocks. Block 1500 displayed even numbers of males and females, Blocks 200 and 1200 contained more males than females, with the opposite pattern visible in Block 1000. These difference in the distribution of males and females between structures, however, are not significant (Yates' chi-square= 0.533, p=0.911).

155 Table 24 Distribution of male and female turkeys among Sand Canyon architectural blocks Block Males Females NA Total 200 4 2 4 10 1000 1 3 0 4 1200 4 2 1 7 1500 5 5 1 11 Total 14 12 6 32

6-,------~Male III Female D Not Amplified

200 1000 1200 1500 Architectural Block

Figure 36 Distribution of male and female turkeys among Sand Canyon architectural blocks

Due to the sheer number of depositional contexts and structures, samples were grouped into three different depositional contexts: Kivas (including Kiva structures and Kiva corner rooms); Middens; and Other (usually wall or roof fall deposits). Table 25 and Figure 37 display the distribution of male and female birds among these three contexts. Again, although differences exist in the number of males and females in Kiva, Midden and Other depositional contexts, they are not significant (Yates' chi-square=0.482, p=O.786).

156 Table 25 Distribution of turkey sexes from different depositional contexts at Sand Canyon Pueblo Context Male Female NA Total Kiva 1 3 3 7 Midden 4 2 0 6 Other 9 7 3 19 Total 14 12 6 32

10 -r------, I!WMaie "Female 9 El Not Amplified

8

II 7 .s :« 6 Q. E :: 5 '0... 1: 4 E ::l Z 3

2

Kiva Midden Other Depositional Context

Figure 37 Distribution of male and female turkeys from different depositional contexts at Sand Canyon Pueblo

Discussion

Regional Analysis

As discussed in the previous chapters, generally only a single lineage of domestic turkeys seems to have been exploited within the Ancestral Puebloan territory. The same domestic turkey lineage, as represented by the aHap1 type, is present in all time periods, and there is no strong genetic or morphological evidence to support the presence of two distinct breeds. The same turkey lineage is present both before and

157 after AD900, suggesting that the domestic lineage initially used primarily for feathers and ritual purposes in Pueblo I was also used as a food source in subsequent periods.

There are relative differences in the exploitation of the domestic lineage (H1 types) as compared to the H2 types. If the H2 types do represent local wild birds procured through hunting or capture, there seems to be a strong trend for the decreasing importance of the wild birds through time. While H2 types make up more than 40% of the samples in Pueblo I, their relative proportion drops dramatically in the subsequent periods, constituting less than 10% of the sample. The growing proportion of H1 turkeys in the Pueblo II and III time periods corresponds with archaeological evidence for the intensification of turkey husbandry over time. Archaeologically, the total abundance of turkeys increases throughout Pueblo II and III, along with the frequency of turkey pens, eggshells, gizzard stones, and turkey coprolites (Breitburg 1988, 1993).

The relative increase in H1 types seen in this study also supports the zooarchaeological evidence for changes in Ancestral Puebloan subsistence strategies over time. There is a decreasing trend in large game hunting from Pueblo I to Pueblo II, and instead an increased reliance on small game hunting and garden trapping (Muir and Driver 2002b). Within the central Mesa Verde, expanding human populations and their aggregation into larger communities would have taxed the surrounding environment, increasing competition for land, water and faunal resources (Varien 2006). Driver (2002) proposed that settlement expansion, habitat disruption and over-hunting may have reduced the local availability of artiodactyl populations, and hunting may have been largely confined to circumscribed areas. These same environmental conditions may also have affected wild turkey hunting in a similar fashion. Although it is unlikely that Ancestral Puebloan hunting had a significant impact on the overall numbers of wild turkey in the four-corners, the decreasing proportion of H2 turkey types in the Pueblo II and III period may reflect the growing distance of communities from suitable wild turkey habitat. Moreover, the prolific and easily accessible domestic turkeys may have made it unnecessary or undesirable to hunt further and further afield for wild turkeys.

There appears to be a slight re-bound in the exploitation of local/ wild turkeys in the Pueblo IV period, when the relative proportion of H2 types reaches 12.5%. These later communities are all located south of the four-corners, within the Rio Grande or Gallisto Basin areas. Compared to the Mesa Verde region, the Rio Grande had reliable summer rainfall patterns, more abundant timber and fertile soil, as well as an abundance

158 of wild game, such as deer and water fowl, and wild plants (Cameron 1995). The increase in H2 types in the Pueblo IV period may indicate the greater availability or proximity of wild turkeys compared to earlier time periods.

Regional Sex Distribution

An examination of male and female turkey frequencies through time also points to another notable pattern, i.e. higher frequency in almost all time periods of males (n=59) compared to females (39). The relatively small sample size (98 samples distribution over almost 1000 years) makes it difficult to assess the import of this apparent difference. Demonstrable differences in the exploitation of one sex over the other through time may point to flock management practices designed for particular products, i.e. feathers or meat. However, in this particular study, the larger number of males may be due to differential preservation of male and female bones and sampling bias, rather than true differences in the exploitation of males versus females.

In addition to myriad taphonomic factors which affect bone survival and recovery, bone mineral density plays a role in the survivorship of turkey skeletal elements and portions, with denser and larger bones possessing a greater potential for survival (Dirrigl 2001 a; Grayson 1979). Since turkeys are sexually dimorphic, male turkey bones are generally larger and more robust than female bones, therefore possessing a greater potential for survival in the archaeological record. Furthermore, the completeness of an element, and the retention of key diagnostic features, will affect its identifiability to the species level (Dirrigl 2001 b). Therefore, sampling bias may also contribute to higher percentage of males, if less fragmented elements are preferentially selected.

Additionally, this study's overall sampling technique included some judgmental choice based on size. As one of the main objectives of the DNA study was to validate osteological criteria for breed and sex, sampling was performed to include elements from a range of sizes, and extremely large elements were included when available. Since wild male turkey bones fall within the largest size class, they may have been arbitrarily selected more often than wild females, which would fall within the average size range. This type of sampling bias may explain the strong predominance of H2 males (n=15) over H2 females (n=4) in the entire sample. While a chi-square test would indicate this difference is significant (chi-square=6.368, p=0.011), the small number of individuals in the H2 group makes it difficult to assess whether this sex ratio disparity is due to

159 sampling bias, or real differences in the exploitation of wild birds, perhaps reflecting a human preference for gobblers over hens, due to their large size, more iridescent plumage, or other cultural factors.

The small sample sizes imposed by the costly and destructive nature of ancient DNA analysis make it difficult to make fine-grained investigations into the exploitation of wild and domestic turkey, or different turkey sexes, especially when working with an extensive geographic and temporal framework. Considering that the faunal remains from any given site may number in the hundred or thousands, enthusiastically interpreting patterns of turkey exploitation based on a sample of 100 bones could be seen as somewhat naive. The major strength of ancient DNA analysis lies instead in its precision and accuracy in identifying the species, population or sex of skeletal remains. While ancient DNA analysis cannot (and should not) be applied to all archaeological remains, its forte lies in the development and validation of osteological criteria that can be used on larger zooarchaeological collections.

While the information obtained from this regional overview may not provide precise information regarding the exact proportion of wild versus domestic turkeys, or male versus female turkey in each time period, it can point to some important trends that warrant further investigation. Future studies should investigate whether the decline of locall'wild' turkey exploitation through time is related to the proximity or availability of suitable habitat, or perhaps due to other cultural or economic factors. Additionally, the temporal changes in flock management practices as they may relate to husbandry primarily for food or feathers deserve more refined analysis. Armed with more accurate osteological criteria for determining population and sex, zooarchaeologists may examine these trends using larger sample sets and more accurate provenience data.

Site-Specific Analysis

The haplotype and sex identification analyses at Sand Canyon Pueblo were conducted to investigate whether there were any differences in the use of wild and domestic turkeys; and, male and female turkeys in terms of ritual or food use.

The ancient DNA results suggest the exploitation of a predominantly domestic population at the Pueblo, with little or no use of wild turkeys, despite the proximity of wild turkey habitat on the Colorado Plateau. Domestic turkeys were found in all structures, and contexts, including middens, kivas and public architecture areas, suggesting that 160 domestic birds were used for multiple purposes, including ritual, food, and feathers. The ancient DNA sample represents only 2% of the total turkey population at the site, and therefore it cannot completely discount the use of wild turkeys. The analysis, does, however, suggests that wild turkeys were much less important than the domestic lineage as source of either food or feathers.

Male and female turkeys are present in nearly equal numbers within the sample. This even sex ratio is supported by Munro's osteological analysis of turkeys in the Sand Canyon locality. Based on her analysis of 673 tibiotarsi, she found that females represented 44% of the adult populations, and males represented 56% (Munro 1994:115). Badenhorst's (2008:77) analysis of tarsometatarsi at Albert Porter Pueblo also found equal numbers of toms and hens, suggesting little or no differences in the treatments of sexes in terms of meat and/or secondary products.

It might be argued that demographic profiles of birds raised exclusively for meat should display a higher number of young adult males and older adult females, while flocks maintained for feathers, should display even numbers of male and female adult birds. If meat is the principal role of the animal, males should be culled as soon as they reach maturity, since it is most energy efficient to butcher an animal when it reaches adult size, rather than maintaining it after adulthood when its overall growth slows dramatically (Greenfield et a/. 1988). Females, on the other hand, may be maintained as breeding stock, or potentially for their eggs, which could be used for food, glue or paint ingredients (McKusick 1986b:14). Maintaining a stock for their feathers should demonstrate a more even sex ratio of young and old adults, since the birds of both sexes produce feathers. Adult gobblers (both in the wild and domesticated forms) tend to produce more iridescent, lustrous, and richly coloured plumage than hens (Babcock 1902; Ligon 1946). Thus, adult males may have been maintained for their rich plumage, while adult females may have been maintained for both their feathers, and as breeding stock.

The ancient DNA study was not designed to include a demographic analysis, and thus cannot suitably address this particular question. While Munro's analysis incorporated age analysis, she did not distinguish between young and old adults. Her results found that the bulk of the population, 94%, were adult (2 years +), while only 5% were immature (3 month-2years), and less than 1% were 3 months or younger (1994: 115). Though the fragile and cartilaginous bones of younger individuals are more

161 susceptible to destructive taphonomic processes, this ratio still suggests a strong focus on fully adult birds. It is most likely, that rather than focusing purely on turkeys for meat or feathers, a mixed strategy was taking place: birds sacrificed for their feathers would have been eaten, while birds killed for food would have been plucked.

This study was unable to demonstrate any strong patterning in the distribution of males and females at Sand Canyon Pueblo either among different architectural blocks, or depositional contexts. Although a higher proportion of females was found in kiva contexts, and more males in midden contexts, these differences are not statistically significant.

The lack of demonstrable sex patterning is likely due to a variety of factors that include both sampling issues, as well as pre-depositional behaviour. Muir's research demonstrated patterning in the spatial distribution of taxa within and between structures and depositional contexts. The strength of Muir's study lies in its large sample size, which included nearly 11,000 identified specimens, from over 75 taxa, representing a data set several magnitudes larger than this study. The general patterns and trends exhibited through the analysis of multiple animal families can be examined far more confidently than with a single species. Moreover, the samples analyzed using ancient DNA represented only 2% of the total M. gallopavo samples recovered from the site, which will drastically affect the interpretive power of the study.

The recovery context of the turkey bones from Sand Canyon Pueblo also affected the success of the study. Most of the bones were from secondary refuse deposits, wall fill, or roof fall; only one bone (TU86) was recovered from a floor surface feature. Though the Pueblo seems to have been finally abandoned just before AD1300, many of the structures or rooms had been vacated during the site's occupation. These vacant structures often acted as deposit areas for trash or architectural or building debris. The turkey remains recovered from these, and other fill secondary deposits, are dissociated from their original context, making it difficult to interpret any human behavioural patterns associated with the original use of the bird.

In addition to the lack of surface contexts, there are not always sufficient data to link ritual or secular contexts to specific behaviours. For example, though kivas are understood to be used for household level rituals, they are also used as general gathering spaces, and seem to show evidence for other domestic activities (Kuckelman et al. 2007). Since the kiva is not an exclusively ritual space, not all activities associated 162 with kivas can be considered strictly ritual, making it difficult to interpret the role or use of turkeys in kiva contexts, either as sources or food, feathers, or ritual objects.

The limited results obtained in this analysis point to some considerations for future studies of this kind. First, an attempt to uncover patterns among structures might be more effective using faunal remains from surface contexts, rather than from secondary deposits. Second, structures and deposits with known activity areas (i.e. domestic space, kiva floors, towers), rather than rooms with unknown use, or fill deposits, are more likely to provide an understanding of differences in the use of certain birds. Finally, in order to be most effective, all ancient DNA projects should also include a substantial osteometric component, to pick samples most judiciously for ancient DNA analysis.

Chapter Summary

Archaeological, historic and ethnographic evidence all point to the turkey's importance as a food item, a raw material source for artifacts and feather textiles, and a symbolic and ritual animal. This chapter explored various hypotheses and evidence concerning the use of turkey through time, distinctions in the use of wild versus domestic turkeys, and male and female birds. This research included both a regional analysis of wild and domestic turkeys through time, as well as a more focused, site-specific component to examine the use of turkeys at Sand Canyon Pueblo. The results of the regional analysis displayed a strong trend for the increased importance of domestic turkeys (H1) compared to local/wild birds (H2) over time. While local/wild H2 types made up more than 40% of the samples in Pueblo I, their relative proportion drops dramatically in the subsequent Pueblo II and III periods, likely reflecting the intensive husbandry of domestic turkeys, and possibly the lack of suitable wild turkey habitat near large aggregated communities in the four-corners. The results of the site-specific analysis at Sand Canyon pueblo demonstrated a near exclusive focus on domestic turkeys. Male and female birds were present in essentially equal numbers at the site. Although no strong patterning was observed in the distribution of male and female turkeys among any of the four architectural blocks, or depositional contexts, this result is likely due to issues surrounding site transformation processes and sample selection for ancient DNA analysis.

163 CHAPTER 8: CONCLUSIONS

Research Summary

While the turkey has served as a cultural staple in North America from antiquity to the present day, archaeological investigations into pre-contact turkey domestication have proven inconclusive for various reasons. This study applied ancient DNA analysis to archaeological turkey bones to explore the origins and process of wild turkey domestication in North America, specifically in the Southwest United States. The three objectives of my study were: 1) to determine the geographic origins of the four-corner's domestic turkey stocks; 2) to investigate turkey breeding and domestic flock management practices; and 3) to explore the role of turkeys in Ancestral Puebloan culture.

Ancient DNA techniques were applied to 193 archaeological turkey bones, obtained from 43 archaeological sites, as well as from 27 modern commercially-raised turkey samples. In addition to mtDNA D-Ioop and cytb analysis, the study also included a new sex identification technique (mtW) designed to co-amplify fragments of turkey mtDNA and highly-repetitive areas on the W-chromosome.

Overall, DNA was well preserved in the archaeological samples with a success rate of over 90% for mtDNA amplification. Three distinct mitochondrial clades were identified in the sample: haplogroup H1, containing the majority of the Southwest samples (87% of successfully haplotyped samples), demonstrated an affinity to modern populations of Eastern or Rio Grande wild turkey (M. g. silvestris and M. g. intermedia); group H2, representing around 12% of the haplotyped samples, contained sequences identical or closely related to Merriam's wild turkey (M. g. merriamt), the local wild turkey of the Southwest, while group H3 contained all modern commercially-raised turkey samples as well as three post-contact archaeological samples, sharing a close affinity to other modern domestic (M. g. gallopavo) turkeys.

It is concluded that group H1 displays the genetic signature of the Southwest pre-contact domestic turkey. The genetic uniformity of the H1 group points to a severe

164 genetic bottleneck and breeding isolation associated with the domestication process, while the archaeological evidence for turkey husbandry, in the form of turkey pens, eggshells, increased turkey remains, and gizzard stones is found in conjunction with H1 samples. Rather than validating the domestication of local wild turkeys, phylogeography analysis of the H1 group suggests that previously domesticated turkeys were imported into the Southwest, from an area to the east/southeast of the Southwest United States (within the historic range of the Eastern and Rio Grande wild turkey) (Figure 38). The identification of local wild turkey types in the archaeological remains, however, supports the long-term presence of Merriam's wild turkey in the Southwest, though their low frequency indicates that Merriam's hens did not playa significant role in the domestication process. The presence of a distinct H3 clade, found primarily in modern domestic turkey, is consistent with a distinct domestication event in south-central Mexico, involving M. g. gallopavo. The absence of H3 haplotypes in the pre-contact archaeological samples suggests that Mesoamerican turkey breeds were not imported into the Southwest in significant number before historic times, when modern varieties of domestic turkeys (originally derived from Mesoamerican breeds) were imported from Eastern North America.

1500AD-Present , ...... r·· · ···· .. ·.. ·· · ..

1000-1500AD I ! Introgression ...... •...... ••..•...... 1, . :,...... ,

500-1000AD I '.

...... ········i··················i ' t , •••••••••••••••••••••••••••••••••••••••••••••••••• , 0-500 AD , , ' ...... : ~ . . , ., Domestic , 500 BC-AD 0 (Southwest) ,. ·······························t······················ .

Pre-500 BC M. g. intermedia/silvestris M. g. merriami (Origin unknown) (Southwest)

Figure 38 Diagram of the revised 'introduction' model for Southwest domestic turkey

165 The uniformity of the mitochondrial data indicates that the same domestic lineage was present throughout the four Southwest states, ranging in time from the earliest periods of domestication until late Pueblo IV periods. The geographic distribution of the turkey haplotypes indicates that domestic birds were being traded between sites. Based on the uniformity of obtained mtDNA haplotypes, ancient DNA analysis could not confirm distinct breed designations for Small Indian Domesticate (SID) and Large Indian Domesticate (LID). Rather, the DNA and archaeological data suggest that size differences observed between turkey populations may reflect a phenotypic response to different environmental conditions, or the introgression of wild genes into domestic populations. In addition to the hunting of wild birds, the osteological, genetic and ethnographic data point to occasional hybridizations between wild toms and domestic hens. Intentional or unintentional stock enhancement through heterosis may account for the size difference between the early 'SID' and later 'LID' populations.

The dominance of a single domestic turkey mitochondrial lineage throughout all time periods indicates that the same turkeys which were exploited principally for their feathers or ritual purposes prior to Pueblo II, were intensively husbanded for food in subsequent periods. Shifts in the relative frequency of H1 and H2 haplotypes through time demonstrates the increased importance of domestic turkeys compared to wild birds in later time periods. This trend supports the intensification of turkey husbandry in the Pueblo II and III periods as a response to declining artiodactyl populations, and intense competition for local resources. The results of the site-specific analysis at Sand Canyon Pueblo demonstrated a near exclusive focus on domestic turkeys, rather than wild turkeys, raised for meat rather than secondary products. No strong patterning was observed in the distribution of male and female turkeys among any of the four architectural blocks, or depositional contexts, indicating that male and female birds were not used for dramatically different economic or ritual purposes.

This study also included the development of a new sex identification technique, focused on the co-amplification of mtDNA and highly-repetitive fragments of sex-specific chromosomes. The successful recovery of nuclear DNA, and a 74% success rate for sex identification indicates the fantastic potential for applying a similar technique to other archaeological faunal remains. Accurate sex identification on fragmentary or juvenile faunal remains will not only help to reconstruct precise demographic profiles of past animal populations, but to develop and validate osteological criteria for sex identification.

166 Implications

The results of this research have implications for the study of Ancestral Puebloan culture, our understanding of Mesoamerican cultural development and interaction, and knowledge concerning animal domestication in general. First, the perseverance of a single Southwest domestic lineage for over a millennium reveals the economic and spiritual importance of the turkey in the Ancestral Puebloan culture. The domestic lineage was maintained and propagated from Basketmaker 1/ to Pueblo IV, despite significant shifts in mobility, settlement and subsistence patterns. The Ancestral Puebloans sustained small stocks of domestic turkeys through the Basketmaker 1/ to Pueblo I period, when seasonal or generational mobility was the norm (Varien 1999b). In the later Pueblo periods, the Ancestral Puebloan generated and provisioned greater turkey stocks despite dramatic climatic fluctuations, social instability, and territorial relocation. The profound value of the domestic turkey in Ancestral Puebloan culture is further indicated by the continuity of this lineage despite the presence of locally available wild turkey. Considering that turkeys are still being raised by Pueblo people today, future research should examine whether this mitochondrial lineage persists in the modern Pueblo domestic turkey stocks, potentially providing a new source of genetic diversity for modern commercial turkey strains. Additionally, using the mtDNA and mtWanalysis techniques developed in study, future archaeological research can delve more deeply into understanding the flock management practices and turkey breeding by the Ancestral Pueblo in the past.

This research also provides insights into broader North American cultural developments and interactions, and provides new directions for future investigations. The results of the study point to a hitherto unknown animal domestication centre in North America. Future archaeological and ancient DNA research seek evidence for early bird use in areas surrounding the Southwest and Mesoamerica and characterize the genetic signature of any early turkey remains. Moreover, ancient DNA should also be applied to archaeological turkey remains from Mesoamerica, to more fully understand the relationship between the Mesoamerica and Southwest domestic turkey breeds, and compare how the domestication process unfolded in both regions. Moreover, further archaeological research into trade and interaction between Mesoamerica and the Southwest may provide valuable insight into when and how the domestic turkey was introduced into the Southwest.

167 As one of the few New World animal domesticates, the turkey provides a case study through which to examine North American animal domestication in general. The study of Old World animal domestication has indicated that multiple domestication events seem to be the norm. Multiple domestication centres have been identified for species such cattle, pig, sheep, and donkeys (Bruford et al. 2003), and this study supports a similar multi-centre model for the New World. The detailed information gleaned in this ancient DNA project provides a thorough case study through which to compare the timing and nature of other New World animal domestication events, such as for llama, guinea pig and muscovy duck.

Domestication is a complex process, with human-animal interactions that may range from hunting, capture, taming, to intensive husbandry and selective breeding. This study, incorporating archaeological, genetic, osteometric and phylogeographic data, demonstrates the complexity of animal domestication histories, and the sophistication of animal husbandry and breeding in North America. Using a large scale sample, covering a wide geographic region and multiple time periods, this study has provided a snapshot into the domestication process, and exposed nuances that could not be detected previously, including the genetic characterization of an indigenous domestic breed.

168 REFERENCE LIST

Aasen, D. K. 1984 Pollen, macrofossil and charcoal analyses of Basketmaker coprolites from Turkey Pen Ruin, Cedar Mesa, Utah. MA thesis, Washington State University.

Adams, E. C. 1991 The origin and development ofthe Pueblo Katsina cult. University of Arizona Press, Tucson.

Adams, R. E. W. 2005 Prehistoric Mesoamerica. Third ed. University of Oklahoma Press, Norman.

Aldrich, J. W. 1967a Chapter 1: Historical Background. In The wild turkey and its management, edited by O. H. Hewitt, pp. 3-16. The Wildlife Society, Washington, D.C.

1967b Chapter 2: Taxonomy, distribution and present status. In The wild turkey and its management, edited by O. H. Hewitt, pp. 17-44. The Wildlife Society, Washington, D.C.

Allendorf, F. W. and R. F. Leary 1986 Heterozygosity and fitness in natural populations of animals. In Conservation biology: The science ofscarcity and diversity, edited by M. E. Soule, pp. 57-76. Sinauer Associates, Inc., Sunderland, Massachusetts.

Amsden, C. A. 1949 Prehistoric Southwesterners from Basketmaker to Pueblo. Southwest Museum, Los Angeles.

Anderson, K., G. J. Fenner, D. P. Morris, G. A. Teague and C. R. McKusick 1986 The archaeology of Gila Cliff Dwelling, Publication in Anthpology 36. Western Archaeological and Conservation Center, Tucson, AZ.

Anderson, S. 1993 Archaic period land use in the Southern Tularosa Basin, New Mexico. In Preliminary investigations ofthe Archaic in the region ofLas Cruces, New Mexico. Historic and Cultural Report no. 9, edited by R. S. McNeish, pp. 48-67. Cultural Resources Management Branch, Director of Environment, United States Army Air Defence Artillery Center, Fort Bliss, Texas.

Armitage, P. L. and J. Clutton-Brock 1976 A system for classification and description of the horn cores of cattle from archaeological sites. Journal ofArchaeological Science 3(4):329-348. 169 Avise, J. C. 2000 Phylogeography: The history and formation ofspecies. Harvard University Press, Cambridge, Mass.

Babcock, H. S. 1902 The bronze turkey. In Turkeys and how to grow them, edited by H. Myrick, pp. 16-18. Orange Judd Company, New York.

Backstrom, N., H. Ceplitis, S. Berlin and H. Ellegren 2005 Gene conversion drives the evolution of HINTW, an ampliconic gene on the female-specific avian W chromosome. Molecular Biology and Evolution 22(10): 1992-1999.

Badenhorst, S. 2008 The zooarchaeology of great house sites in the San Juan Basin ofthe American Southwest. PhD Thesis, Simon Fraser University.

Bandelier, A F. 1976 Historical introduction to studies among the sedentary Indians of New Mexico and report on the ruins ofthe Pueblo of Pecos. Kraus Reprint Co., Milwood, NY.

Bandelt, H.-J., P. Forster and A Roehl 1999 Median-joining networks for inferring intraspecific phylogenies. Molecular Biology and Evolution 16:37-48.

Bar-Gal, G. K., H. Khalaily, O. Mader, P. Ducos and L. Kolska-Horwitz 2002a Ancient DNA evidence for the transition from wild to domestic status in Neolithic goats: a case study from the site of Abu Gosh, Israel. Ancient Biomolecules 4:9-17.

Bar-Gal, G. K., P. Smith, E. Tchernov, C. Greenblatt, P. Ducos, A Gardeisen and L. Kolska-Horwitz 2002b Genetic evidence for the origin of the agrimi goat (Capra aegagrus cretica). Journal ofZoology 256:369-377.

Beasom, S. L. and D. Wilson 1992 Rio Grande turkey. In The wild turkey: Biology and management, edited by J. G. Dickson, pp. 306-330. Stackpole Books, Harrisburg, PA

Beja-Pereira, A, D. Caramelli, C. Lalueza-Fox, C. Vernesi, N. Ferrand, A Casoli, F. Goyache, L. J. Royo, S. Conti, M. Lari, A Martini, L. Ouragh, A Magid, A Atash, A Zsolnai, P. Boscato, C. Triantaphylidis, K. Ploumi, L. Sineo, F. Mallegni, P. Taberlet, G. Erhardt, L. Sampietro, J. Bertranpetit, G. Barbujani, G. Luikart and G. Bertorelle 2006 The origin of European cattle: Evidence from modern and ancient DNA PNAS 103(21):8113-8118.

Bennett, W. C. and R. M. Zingg 1935 The Tarahumara: An Indian Tribe ofNorthern Mexico, Chicago.

170 Bernardini, W. 1998 Conflict, migration, and the social environment: Interpreting architectural change in early and late Pueblo IV aggregations. In Migration and reorganization: The Pueblo IV period in the American Southwest. Arizona State University Anthropological Research PaperNo. 51, edited by K. A. Spielmann, pp. 91-114. Arizona State University, Tempe.

Bokonyi, S. 1989 Definitions of animal domestication. In The walking larder: Patterns of domestication, pastoralism, and predation, edited by J. Clutton-Brock, pp. 22-27. Unwin Hyman, London.

Bottema, S. 1989 Some observations on modern domestication processes. In The walking larder: Patterns ofdomestication, pastoralism, and predation, edited by J. Clutton-Brock, pp. 31-45. Unwin Hyman, London.

Bradley, B. A. 1992a Excavations at Sand Canyon Pueblo. In The Sand Canyon Archaeological Project: A Progress Report, Occasional Papers, no. 2., edited by W. Lipe, pp. 79-97. Crow Canyon Archaeological Center, Cortez, Colorado.

Bradley Beacham, E. and S. R. Durand 2007 Eggshell and the archaeological record: new insights into turkey husbandry in the American Southwest. Journal ofArchaeological Science 34(10): 1621.

Bradley, D. G. and D. A. Magee 2006 Genetics and origins of domestic cattle. In Documenting domestication: New genetic and archaeological paradigms, edited by M. A. Zeder, D. G. Bradley, E. Emshwiller and B. D. Smith, pp. 317-328. University of California Press, Berkeley, CA.

Bradley, R. J. 1992b Marine shell exchange in Northwestern Mexico and the Southwest. In The American Southwest and Mesoamerica: Systems ofprehistoric exchange, edited by J. E. Ericson and T. G. Baugh, pp. 121-151. Plenum Press, New York.

Brand, D. D., F. M. Hawley and F. C. Hibben 1937 Tseh So, a small house ruin, Chaco Canyon. New Mexico Anthropological Series 2(2):1-174.

Brant, A. W. 1998 A brief history of the turkey. World Poultry Science Journal 54(4):365-373.

Breitburg, E. 1988 Prehistoric New World turkey domestication: Origins, developments, and consequences. PhD thesis, Southern Illinois University.

1993 The evolution of turkey domestication in the greater Southwest and Mesoamerica. In Culture and Contact: Charles C. Di Peso's Gran Chichimeca, 171 edited by A. I. Woosley and J. C. Ravesloot, pp. 153-172. The University of New Mexico Press, Albuquerque, NM.

Breternitz, D. A. 1969 Archaeological investigations in Turkey Cave (NA2520) Navajo National Monument, 1963. Northern Arizona Society of Science and Art, Inc., Flagstaff, AZ.

Bromley, P. 1. 2001 Lessons from the wild turkey. Biologist 48(6):292.

Brown, J. L. 1975 The evolution ofbehavior. W.W. Norton & Company, Inc., New York.

Bruford, M. W., D. G. Bradley and G. Luikart 2003 DNA markers reveal the complexity of livestock domestication. Nature Reviews Genetics 4(11 ):900-91 O.

Burtt, E. H. J. and J. M. Ichida 2004 Gloger's rule, feather-degrading bacteria, and color variation among song sparrows. The Condor 106(3):681-686.

Cameron, C. M. 1995 Migration and the movement of Southwestern peoples. Journal of Anthropological Archaeology 14(2):104-124.

2009 Chaco and after in the Northern San Juan: Excavations at the Bluff Great House. The University of Arizona Press, Tucson, AZ.

Cann, R. L., W. M. Brown and A. C. Wilson 1984 Polymorphic sites and the mechanism of evolution in human mitochondrial DNA. Genetics 106(3):479-499.

Carlyle, S. W., R. L. Parr, M. G. Hayes and D. H. O'Rourke 2000 Context of maternal lineages in the greater Southwest. American Journal ofPhysical Anthropology 113(1 ):85-1 01.

Caywood, L. (editor) 1962 Archeological studies at Tonto National Monument, Arizona. Southwestern Monuments Association, Globe, AZ.

Chen, S. Y., Y. H. Su, S. F. Wu, 1. Sha and Y. P. Zhang 2005 Mitochondrial diversity and phylogeographic structure of Chinese domestic goats. Molecular Phylogenetics and Evolution 37(3):804-814.

Chisholm, B. and R. G. Matson 1994 Carbon and nitrogen isotopic evidence on Basketmaker /I diets at Cedar Mesa, Utah. Kiva 60(2):239-255.

172 Clutton-Brock, J. 1981 Domestication animals from early times. British Museum (Natural History), London.

1992 The process of domestication. Mammal Review 22(2):79-85.

1999 A natural history ofdomesticated mammals. Second ed. Cambridge University Press, Cambridge, UK.

Collier, S. and J. P. White 1976 Get them young? Age and sex inferences on animal domestication in archaeology. American Antiquity 41 (1): 96-102.

Cooper, A. and H. N. Poinar 2000 Ancient DNA: Do it right or not at ALL. Science 289(5482):1139-1139.

Cordell, L. S. 1984 Prehistory ofthe Southwest. Academic Press Inc., Orlando, FL.

1994 Ancient Pueblo Peoples. St. Remy Press and the Smithsonian Institute, Montreal.

1997 Archaeology ofthe Southwest. Second ed. Academic Press Inc., San Diego.

Cordell, L. S. and G. J. Gumerman 1989 Cultural interaction in the prehistoric Southwest. In Dynamics of Southwest prehistory, edited by L. S. Cordell and G. J. Gumerman, pp. 1-18. Smithsonian Institution Press, Washington, D.C.

Corona-M., E. 1997 Avian resources at a Mexican site at the time of the Spanish Conquest. International Journal of Osteoarchaeology 7(4):321-325.

Crawford, R. D. 1984 Turkey. In Evolution ofdomesticated animals, edited by I. L. Mason, pp. 325-334. Longman Group Ltd., London.

1992 Introduction to Europe and the diffusion of domesticated turkeys from the Americas. Archivos de zootecnia. 41(154):307-314.

Creel, D. and C. R. McKusick 1994 Prehistoric macaws and parrots in the Mimbres Area, New Mexico. American Antiquity 59(3):510-524.

Cronin, M. A., M. D. MacNeil and J. C. Patton 2006 Mitochondrial DNA and microsatellite DNA variation in domestic reindeer (Rangifer tarandus tarandus) and relationships with wild caribou (Rangifer tarandus granti, Rangifer tarandus groentandicus, and Rangifer tarandus caribou). Journal ofHeredity 97(5):525-530.

173 Crown, P. L. 1994 Ceramics and ideology: Salado polychrome pottery. University of New Mexico Press, Albuquerque.

Damp, J. and E. M. Kotyk 2000 Socioeconomic organization of a Late Basketmaker community in the Mexican Springs area, Southern Chuska Mountains, New Mexico. In Foundations ofAnasazi Culture: The Basketmaker-Pueblo transition, edited by P. F. Reed and E. A. Morris. The University of Utah Press, Salt Lake City, UT.

Damp, J. E., S. A. Hall and S. J. Smith 2002 Early irrigation on the Colorado Plateau near Zuni Pueblo, New Mexico. American Antiquity 67(4):665-676.

Dawson, P. 1993 Faunal remains from Todsen Cave. In Preliminary investigations ofthe Archaic in the region ofLas Cruces, New Mexico. Historic and Cultural Report no. 9, edited by R. S. McNeish, pp. 68-104. Cultural Resouces Management Branch, Director of Environment, United States Army Air Defence Artillery Center, Fort Bliss, Texas.

Dean, J. S. 2006 Subsistence stress and food storage at Kiet Siel, Northeastern Arizona. In Environmental change and human adaptation in the ancient American Southwest, edited by D. E. Doyel and J. S. Dean, pp. 160-179. The University of Utah Press, Salt Lake City.

Dickson, J. G. (editor) 1992 The wild turkey: Biology and management. Stackpole Books, Harrisburg, PA.

Dirrigl, F. J. 2001 a Bone mineral density of wild turkey (Meleagris gallopavo) skeletal elements and its effect on differential survivorship. Journal ofArchaeological Science 28(8):817-832.

2001 b Differential identifiability between chosen North American gallinaceous skeletons and the effect of differential survivorship. Acta zoologica cracoviensia 45:357-367.

Dissing, J., M. A. Kristinsdottir and C. Friis 2008 On the elimination of extraneous DNA in fossil human teeth with hypochlorite. Journal ofArchaeological Science 35(6):1445-1452.

Dobney, K., A. Ervynck, U. Albarella and P. Rowley-Conwy 2004 The chronology and frequency of a stress marker (linear enamel hypoplasia) in recent and archaeological populations of Sus scrofa in north-west Europe, and the effects of early domestication. Journal ofZoology 264:197-208.

174 Dobney, K. and G. Larson 2006 Genetics and animal domestication: new windows on an elusive process. Journal ofZoology 269(2):261-271.

Driver, J. C. 2002 Faunal variation and change in the Northern San Juan region. In Seeking the center place: archaeology and ancient communities in the Mesa Verde region, edited by M. D. Varien and R. H. Wilshusen, pp. 143-160. The University of Utah Press, Salt Lake City.

Driver, J. C. and S. Badenhorst 2006 Preliminary report on Comb Wash fauna. Simon Fraser University.

Driver, J. C., M. J. Brand, L. Lester and N. D. Munro 1999 Faunal Studies. In The Sand Canyon Archaeological Project: Site Testing [HTML Title], edited by M. Varien, Chapter 18. Available: http://www.crowcanyon.org/sitetesting. Date of use: 20 April 2009.

Ducos, P. 1978 Domestication defined and methodological approaches to its recognition in faunal assemblages. In Approaches to faunal analysis in the Middle East, edited by R. H. Meadow and M. A. Zeder, pp. 53-56. Peabody Museum Bulletins NO.2. Peabody Museum, Cambridge.

1989 Defining domestication: a clarification. In The walking larder: Patterns of domestication, pastoralism, and predation, edited by J. Clutton-Brock, pp. 28-30. Unwin Hyman, London.

Duff, A. I. and S. C. Ryan 2001 The Shields Pueblo research project, annual report, 2000 Fieldwork. [HTML Title]. Available: http://www.crowcanyon.org/shieldspueblo2000. Date of use: 05 April 2009.

Eaton, S. W. 1992 Wild turkey. The Birds ofNorth America 1(22):1-27.

Edwards, C. J., J. Connellan, P. F. Wallace, S. D. E. Park, F. M. McCormick, I. Olsaker, E. Eythorsdottir, D. E. MacHugh, J. F. Bailey and D. G. Bradley 2003 Feasibility and utility of microsatellite markers in archaeological cattle remains from a Viking Age settlement in Dublin. Animal Genetics 34(6):410-416.

Eglinton, G. and G. Logan 1991 Molecular preservation. Philosophical Transactions ofthe Royal Society of London Series B-Biological Sciences 333(1268):315-327.

Fetterman, J. and L. Honeycutt 1987 The Mockingbird Mesa Survey, Southwestern Colorado. Cultural Resource Series no. 22. Bureau of Land Management, Denver.

175 Fish, P. R 1989 The Hohokam. In Dynamics of Southwest prehistory, edited by L. S. Cordell and G. Gumerman, pp. 19-64. Smithsonian Institution Press, Washington, D.C..

Flannery, K. V. 1967 Vertebrate fauna and hunting practices. In Prehistory ofthe Tehuacan Valley, Vol 1: Environment and subsistence, edited by D. S. Byers, pp. 132-177. University of Texas Press, Austin.

Gifford, J. C. 1980 Archaeological explorations in caves of the Point of Pines region Arizona. Anthropological Papers ofthe University ofArizona no. 36.

Gilbert, B. M., L. D. Martin and H. G. Savage 1996 Avian osteology. Missouri Archaeological Society, Inc., Columbia.

Gilbert, M. T. P., J. Binladen, W. Miller, C. Wiuf, E. Willerslev, H. Poinar, J. E. Carlson, J. H. Leebens-Mack and S. C. Schuster 2007 Recharacterization of ancient DNA miscoding lesions: Insights in the era of sequencing-by-synthesis. Nucleic Acids Research 1(1): 1-1 O.

Gilbert, M. T. P., A. J. Hansen, E. Willerslev, L. Rudbeck, I. Barnes, N. Lynnerup and A. Cooper 2003 Characterization of genetic miscoding lesions caused by postmortem damage. American Journal of Human Genetics 72(1 ):48-61.

Gnabasik, V. 1981 Faunal utilization by the Pueblo Indians. Unpublished MA thesis, Eastern New Mexico University.

Granevitze, Z., S. Blum, H. Cheng, A. Vignal, M. Morisson, G. Ben-Ari, L. David, M. W. Feldman, S. Weigend and J. Hillel 2007 Female-specific DNA sequences in the chicken genome. Journal of Heredity 98(3):238-242.

Grayson, D. K. 1979 On the quantification of vertebrate archaeofaunas. In Advances of archaeological method and theory, edited by M. B. Schiffer, pp. 199-237. vol. 2. Academic Press, Inc., New York, NY.

Greenfield, H. J., J. Chapman, A. T. Clason, A. S. Gilbert, B. Hesse and S. Milisauskas 1988 The origins of milk and wool production in the Old World: a zooarchaeological perspective from the Central Balkans [and Comments]. Current Anthropology 29(4):573-593.

Griffiths, R, M. C. Double, K. Orr and R J. G. Dawson 1998 A DNA test to sex most birds. Molecular Ecology 7(8):1071-1075.

Guan, L., Y. Hu, Z. Tang, Y. Yang, C. Dong, Y. Cui and C. Wang

176 2007 Stable isotope analysis on Sus bones from the Wanfabozi site, Tonghua, Jilin. Chinese Science Bulletin 52(24):3393-3396.

Gumerman, G. J. and J. S. Dean 1989 Prehistoric cooperation and competition in the western Anasazi area. In Dynamics of Southwest prehistory, edited by L. S. Cordell and G. J. Gumerman, pp. 99-148. Smithsonian Institution press, Washington, D.C.

Hall, T. A. 1999 BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41 :95-98.

Hallasi, J. A. 1979 Archaeological excavations at the Escalante site, Dolores, Colorado, 1975 and 1976. Part II, Cultural Resource Series NO.7. Colorado State Office, Bureau of Land Management.

Hansen, A. J., E. Willerslev, C. Wiuf, T. Mourier and P. Arctander 2001 Statistical evidence for miscoding lesions in ancient DNA templates.. Molecular Biology and Evolution 18:262-265.

Hard, R. J., A. C. MacWilliams, J. R. Roney, K. R. Adams and W. L. Merrill 2006 Early agriculture in Chihuahua, Mexico. In Histories of Maize: Multidisciplinary Approaches to the Prehistory, Linguistics, Biogeography, Domestication and Evolution ofMaize, edited by J. E. Staller, R. H. Tykot and B. F. Benz. Elsevier, Amsterdam.

Hargrave, L. L. 1939 Bird bones from abandoned Indian dwellings in Arizona and Utah. Condor 41:206-210.

1965a Archaeological bird bones from Chapin Mesa. American Antiquity 31 (2): 156-160.

1965b Turkey bones from Wetherill Mesa. American Antiquity 31(2):161-166.

1970a Feathers from Sand Dune Cave: a Basketmaker cave near Navajo Mountain, Utah. Museum ofNorthern Arizona Technical Series 9: 1-52.

1970b Mexican macaws: Comparative osteology and survey ofremains from the Southwest. Anthropological papers of the University of Arizona, No. 20. The University of Arizona press, Tucson.

Hayes, A. C. (editor) 1981 Contributions to Gran Quivira Archaeology, Gran Quivira National Monument, New Mexico. National Park Service, U.S. Dept. of Interior, Washington.

Hemmer, H. 1990 Domestication: the decline ofenvironmental appreciation. Translated by N. Beckhaus. Cambridge University Press, Cambridge. 177 Herskovitz, R. M. 1978 Fort Bowie material culture. Anthropological Papers of the University of Arizona no. 31.

Hess, E H. 1968 Imprinting and the "critical period" concept. In Roots ofbehaviour: Genetics, instinct, and socialization in animal behaviour, edited by E. L. Bliss, pp. 254-263. Hafner Publishing Company, New York.

Hill, E. 2000 The contextual analysis of animal interments and ritual practice in Southwestern North America. Kiva 65(4):361-385.

Hoss, M., P. Jaruga, T. H. Zastawny, M. Dizdaroglu and S. Paabo 1996 DNA damage and DNA sequence retrieval from ancient tissues. Nucleic Acids Research 24(7): 1304-1307.

Hyams, E 1972 Animals in the service ofman: 10,000 years of domestication. J.M. Dent & Sons, Ltd., London.

Ingold, T. 1996 Growing plants and raising animals: An anthropological perspective on domestication. In The origins and spread ofagriculture and pastoralism in Eurasia, edited by D. Harris, pp. 12-24. Smithsonian Institution Press, Washington, D.C.

Judd, N. 1954 The material culture of Pueblo Bonito. Smithsonian Institute, Washington, D.C.

1959 Pueblo del Arroyo, Chaco Canyon, New Mexico. Smithsonian Institute, Washington, D.C.

Kantner, J. 2004 Ancient Puebloan Southwest. Cambridge University Press, Cambridge.

Kemp, B. M. and D. G. Smith 2005 Use of bleach to eliminate contaminating DNA from the surface of bones and teeth. Forensic Science International 154(1):53-61.

Kennamer, J. E, M. Kennamer and R. Brenneman 1992 History. In The wild turkey: Biology and management, edited by J. G. Dickson, pp. 6-17. Stackpole Books, Harrisburg, PA.

Kidder, A. V. 1927 Southwestern archaeological conference. Science 66(1716):489-491.

178 Kleidon, J. H. 1999 Castle Rock Pueblo. In The Sand Canyon archaeological project: site testing, edited by M. Varien. Crow Canyon Archaeological Center, Cortez, Colorado.

Kohler, T. A (editor) 2004 Archaeology ofBandelier National Monument: Village formation on the Pajarito Plateau, New Mexico. University of New Mexico Press, Albuquerque, NM.

Kohler, T. A, M. P. Glaude, J.-P. Bocquet-Appel and B. M. Kemp 2008 The Neolithic demographic transition in the U.S. Southwest. American Antiquity 73(4):645-669.

Kuckelman, K. (editor) 2007a The archaeology of Sand Canyon Pueblo: Intensive excavations at a late­ thirteenth-century village in southwestern Colorado [HTML Tit/e), Available: http://www.crowcanyon.org/sandcanyon. Date of use: 20 April 2009.

2007b Summary and conclusions. In The archaeology of Sand Canyon Pueblo: Intensive excavations at a late-thirteenth-century village in southwestern Colorado [HTML Title), edited by K. Kuckelman, Available: http://www.crowcanyon.org/sandcanyon. Date of use: 20 April 2009.

Kuckelman, K., B. A Bradley, M. J. Churchill and J. H. Kleidon 2007 A descriptive and interpretive summary of excavations, by architectural block. In The archaeology of Sand Canyon Pueblo: Intensive excavations at a late-thirteenth-century village in southwestern Colorado [HTML Tit/e), edited by K. Kuckelman, Available: http://www.crowcanyon.org/sandcanyon. Date of use: 20 April 2009.

Kumar, S., K. Tamura and M. Nei 2004 MEGA3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Briefings in Bioinformatics 5: 150-163.

Lang, R. W. and A H. Harris 1984 The faunal remains from Arroyo Hondo Pueblo, New Mexico Arroyo Hondo Archaeological series Volume 5. School of American Research press, Santa Fe, NM.

Lang, R. W. and A H. Noble 1978 More than gold and silver: The turkey at Arroyo Hondo. In Exploration, pp. 3-5. School of American Research press, Santa Fe.

Lange, C. H. 1951 Notes on the use of turkeys by Pueblo Indians. EI Palacio 57:204-209.

Larson, G., U. Albarella, K. Dobney, P. Rowley-Conwy, J. Schibler, A Tresset, J.-D. Vigne, C. J. Edwards, A Schlumbaum, A Dinu, A Balar;sescu, G. Dolman, A Tagliacozzo, N. Manaseryan, P. Miracle, L. Van Wijngaarden-Bakker, M. Masseti, D. G. Bradley and A Cooper 179 2007 Ancient DNA, pig domestication, and the spread of the Neolithic into Europe. Proceedings ofthe National Academy of Sciences 104(39):15276­ 15281.

Larson, G., K. Dobney, U. Albarella, M. Y. Fang, E. Matisoo-Smith, J. Robins, S. Lowden, H. Finlayson, T. Brand, E. Willerslev, P. Rowley-Conwy, L. Andersson and A Cooper 2005 Worldwide phylogeography of wild boar reveals multiple centers of pig domestication. Science 307(5715):1618-1621.

Latch, E. K. and O. E. Rhodes, Jr. 2005 The effects of gene flow and population isolation on the genetic structure of reintroduced wild turkey populations: Are genetic signatures of source populations retained? Conservation Genetics 6(6):981-997.

LeBlanc, S. A 1999 Prehistoric warfare in the American Southwest. The University of Utah Press, Salt Lake City.

Lekson, S. H. 1999 The Chaco meridian: Centers ofpolitical power in the ancient Southwest. AltaMira Press, Walnut Creek, Califonia.

2009 A history ofthe Ancient Southwest. A School for Advanced Research Press, Santa Fe, NM.

Leonard, J. A, O. Shanks, M. Hofreiter, E. Kreuz, L. Hodges, W. Ream, R. K. Wayne and R. C. Fleischer 2007 Animal DNA in PCR reagents plagues ancient DNA research. Journal of Archaeological Science 34(9):1361-1366.

Leopold, A S. 1944 The nature of heritable wildness in turkeys. Condor46:133-197.

1948 The wild turkeys of Mexico. Transactions ofthe North American Wildlife Conference: 393-400.

Lewis, J. B. 1992 The Eastern turkey in mid-western oak-hickory forests. In The wild turkey: Biology and management, edited by J. G. Dickson, pp. 286-305. Stackpole Books, Harrisburg, PA

Ligon, J. D. 1946 History and management ofMerriam's wild turkey. University of New Mexico Publications in Biology NO.1. The University of New Mexico Press, Albuquerque.

Lindahl, T. 1993 Instability and decay of the primary structure of DNA Nature 362(6422):709-715.

180 Lindgren, G., N. Backstrom, J. Swinburne, L. Hellborg, A Einarsson, K. Sandberg, G. Cothran, C. Vila, M. Binns and H. Ellegren 2004 Limited number of patrilines in horse domestication. Nature Genetics 36(4): 335-336.

Lipe, W. 1995 The depopulation of the Northern San Juan: Conditions in the turbulent 1200s. Journal ofAnthropological Archaeology 14:143-169.

Lister, R. H. and F. C. Lister 1987 Aztec Ruins on the Animas. University of New Mexico Press, Albuquerque.

Lofts, B. and R. K. Murton 1968 Photoperiodic and physiological adaptations regulating avian breeding cycles and their ecological significance. Journal ofZoology 155:327-394.

Long, A, B. F. Benz, D. J. Donahue, A J. T. Jull and L. J. Toolin 1989 1st direct AMS dates on early maize from Tehuacan, Mexico. Radiocarbon 31(3):1035-1040.

Longacre, W. A, S. J. Holbrook and M. W. Graves (editors) 1982 Multidisciplinary research at Grasshopper Pueblo Arizona. The University of Arizona Press, Tucson, AZ.

Mallia, J. G. 1998 Indigenous domestic turkeys of Oaxaca and Quintana Roo, Mexico. Animal Genetic Resources Information 28:69-78.

Mallouf, R. J. 2005 Late Archaic foragers of Eastern Trans-Pecos Texas and the Big Bend. In The Late Archaic across the Borderlands, edited by B. J. Vierra, pp. 219-246. The University of Texas Press, Austin.

Malmstrom, H., E. M. Svensson, M. T. P. Gilbert, E. Willerslev, A Gotherstrom and G. Holmlund 2007 More on contamination: The use of asymmetric molecular behaviour to identify authentic ancient human DNA Molecular Biology and Evolution 24(4):998-1004.

Marsden, S. J. and J. H. Martin 1946 Turkey Management. 4 ed. The Interstate, Danville, IL.

Martin, P. S., J. B. Rinaldo, E. Bluhm, H. C. Cutler and R. Grange Jr. 1952 Mogollon culture continuity and change. Fieldiana Anthropology 40.

Mathien, F. J. and R. H. McGuire (editors) 1986 Ripples in the Chichimec Sea: New Considerations of Southwestern Mesoamerican Interactions. Southern Illinois University Press, Carbondale.

181 Matson, R. G. 1991 The origins of Southwestern agriculture. University of Arizona Press, Tucson.

Matson, R. G. and B. Chisholm 1991 Basketmaker II subsistence: Carbon isotopes and other dietary indicators from Cedar Mesa, Utah. American Antiquity 56(3):444-459.

McGahern, A. M., C. J. Edwards, M. A. Bower, A. Heffernan, S. D. E. Park, P. O. Brophy, D. G. Bradley, D. E. MacHugh and E. W. Hill 2006 Mitochondrial DNA sequence diversity in extant Irish horse populations and in ancient horses. Animal Genetics 37(5):498-502.

McKusick, C. R. 1974 The Casas Grande Avian Report. In Casas Grande: A fallen trading center ofthe Gran Chichimeca, edited by C. C. Di Peso, J. B. Rinaldo and G. J. Fenner, pp. 273-307. vol. 8. The Amerind Foundation, Dragoon.

1980 Three groups of turkeys from Southwestern archaeological sites. Contrib. Sci. Nat. Hist. Mus. Los Angeles Co. 330:225-235.

1981 The faunal remains of Las Humanas. In Contributions to Gran Quivira Archaeology, Gran Quivira National Monument, New Mexico, edited by A. C. Hayes, pp. 39-65. Publications in Archeology. National Park Service, U.S. Dept. of Interior, Washington.

1983 Avian Remains [Pratt Cave Studies.]. Artifact 21(1):171-182.

1986a The avian remains. In Archaeological investigations at Antelope House, edited by D. P. Morris, pp. 142-159. National Park Service, U.S. Department of the Interior, Washington, D.C.

1986b Southwest Indian turkey: Prehistory and comparative osteology. Southwest Bird Laboratory, Globe, AZ.

2001 Southwest birds ofsacrifice. The Arizona Archaeologist, Number 31. Arizona Archaeological Society, Tucson.

Meadows, J. R. S., I. Cemal, O. Karaca, E. Gootwine and J. W. Kijas 2007 Five ovine mitochondrial lineages identified from sheep breeds of the Near East. Genetics 175(3):1371-1379.

Meadows, J. R. S., O. Hanotte, C. Drogemuller, J. Calvo, R. Godfrey, D. Coltman, J. F. Maddox, N. Marzanov, J. Kantanen and J. W. Kijas 2006 Globally dispersed Y chromosomal haplotypes in wild and domestic sheep. Animal Genetics 37(5):444-453.

Meadows, R. H. 1989 Osteologial evidence for the process of animal domestication. In The walking larder: Patterns ofdomestication, pastoralism, and predation, edited by J. Clutton-Brock, pp. 80-90. Unwin Hyman, London. 182 Miller, M. R. and N. A. Kenmotsu 2004 Prehistory of the Jornada Mogollon and Eastern Trans-Pecos Regions of West Texas. In The Prehistory of Texas, edited by 1. K. Perttula, pp. 205-295. Texas A&M University Press, College Station.

Minnis, P. E. 1988 Four examples of specialized production at Casas Grande, Northwestern Chihuahua. Kiva 53:181-193.

Mock, K. E., E. K. Latch and O. E. Rhodes 2004 Assessing losses of genetic diversity due to translocation: long-term case histories in Merriam's turkey (Meleagris gallopavo merriam/). Conservation Genetics 5(5):631-645.

Mock, K. E., 1. C. Theimer, O. E. Rhodes, D. L. Greenberg and P. Keim 2002 Genetic variation across the historical range of the wild turkey (Meleagris gallopavo). Molecular Ecology 11 (4):643-657.

Morey, D. F. 1992 Size, shape and development in the evolution of the domestic dog. Journal ofArchaeological Science 19(2):181-204.

1994 The early evolution of the domestic dog. American Scientist 82(4):336­ 347.

Morris, D. P. (editor) 1986 Archaeological investigations at Antelope House. National Park Service, U.S. Department of the Interior, Washington, D.C.

Morris, E. H. 1939 Archaeological studies in the La Plata district, Southwestern Colorado and Northwestern New Mexico. Carnegie Institution of Washington, Washington, D.C.

Muir, R. J. 1999 Zooarchaeology of Sand Canyon Pueblo, Colorado. PhD Thesis, Simon Fraser University.

2007 Faunal remains. In The archaeology of Sand Canyon Pueblo: Intensive excavations at a late-thirteenth-century village in Southwestern Colorado [HTML Title), edited by K. Kuckelman, Available: http://www.crowcanyon.org/sandcanyon. Date of use: 20 April 2009.

Muir, R. J. and J. C. Driver 2002a Identifying ritual use of animals in the northern American Southwest. In Behaviour behind bones, 9th ICAZ Conference Durham, edited by S. O'Day, W. Van Neer and A. Ervynck, pp. 128-143. Oxbow Books, Oxford.

2002b Scale of analysis and zooarchaeological interpretation: Pueblo III faunal variation in the northern San Juan region. Journal ofAnthropological Archaeology 21 :165-199. 183 Munro, N. D. 1994 An investigation ofAnasazi turkey production in southwestern Colorado. MA Thesis, Simon Fraser University.

2006 The role of turkey in the Southwest. In Handbook of North American Indians, Vol. 3, Environment, origins and populations, edited by W. C. Sturtevant, pp. 463-469. Smithsonian Institution, Washington.

Myrick, H. (editor) 1902 Turkeys and how to grow them. Orange Judd Company, New York.

Nabhan, G. P. 1987 Ethnobiology and conservation: Valuing diversity. Environment Southwest 519:28-31.

O'Connor, T. 1997 Working at relationships: Another look at animal domestication. Antiquity 71 :149-56.

O'Rourke, D. H., S. W. Carlyle and R. L. Parr 1996 Ancient DNA: Methods, progress, and perspectives. American Journal of Human Biology 8(5):557-571.

Olsen, J. W. 1990 Vertebrate faunal remains from Grasshopper Pueblo, Arizona. Anthropological Papers, Museum ofAnthropology, University of Michigan no. 83.

Olsen, S. 2006 Early horse domestication on the Eurasian steppes. In Documenting domestication: New genetic and archaeological paradigms, edited by M. A. Zeder, D. G. Bradley, E. Emshwiller and B. D. Smith, pp. 245-272. University of California Press, Berkeley, CA.

Olsen, S. J. 1979 A study of bone artifacts from Grasshopper Pubelo, AZ P: 14: 1. Kiva 44(4):341-373.

Ortman, S. G., D. M. Glowacki, M. J. Churchill and K. Kuckelman 2000 Pattern and variation in northern San Juan village histories. Kiva 66(1): 123-146.

Outram, A. K., N. A. Stear, R. Bendrey, S. Olsen, A. Kasparov, V. Zaibert, N. Thorpe and R. P. Evershed 2009 The earliest horse harnessing and milking. Science 323(5919):1332­ 1335.

Paabo, S., H. Poinar, D. Serre, V. Jaenicke-Despres, J. Hebler, N. Rohland, M. Kuch, J. Krause, L. Vigilant and M. Hofreiter 2004 Genetic analyses from ancient DNA. Annual Review of Genetics 38:645­ 79.

184 Pelham, P. H. and J. G. Dickson 1992 Physical characteristics. In The wild turkey: Biology and management, edited by J. G. Dickson, pp. 32-45. Stackpole Books, Harrisburg, PA.

Perttula, T. K. 2004 An introduction to Texas prehistoric archaeology. In The Prehistory of Texas, edited by T. K. Perttula, pp. 5-14. Texas A&M University Press, College Station.

Pickens, B. (editor) 1993 The missions ofnorthern Sonora: A 1935 field documentation. The University of Arizona Press, Tucson, AZ.

Piperno, D. R. and K. V. Flannery 2001 The earliest archaeological maize (Zea mays L.) from highland Mexico: New accelerator mass spectrometry dates and their implications. Proceedings of the National Academy of Sciences 98(4):2101-2103.

Plog, S. 1997 Ancient peoples ofthe American Southwest. Thames and Hudson, New York, N.Y.

Poinar, H. N. 2003 The top 10 list: criteria of authenticity for DNA from ancient and forensic samples. International Congress Series 1239:575-579.

Poinar, H. N., M. Hoss, J. L. Bada and S. Paabo 1996 Amino acid racemization and the preservation of ancient DNA. Science 272(5263):864-866.

Poinar, H. N. and B. A. Stankiewicz 1999 Protein preservation and DNA retrieval from ancient tissues. Proceedings ofthe National Academy of Sciences ofthe United States ofAmerica 96(15):8426-8431.

Poplin, F. (editor) 1992 Le Dindon: Ethn0200technie no. 49. Societe d'Ethnozootechnie, Paris.

Potter, J. M. 2000 Pots, parties, and politics: Communal feasting in the American Southwest. American Antiquity 65(3):471-492.

Powers, R. P., W. B. Gillespie and S. H. Lekson 1986 The outlier sUNey: a regional view of settlement in the San Juan Basin. Division of Cultural Resources, National Park Service, Department of the Interior, Albuquerque, NM.

Price, E. O. 2002 Animal domestication and behaviour. CABI Publishing, New York.

185 Prudden,1. M. 1903 The prehistoric ruins of the San Juan watershed of Utah, Arizona, Colorado, and New Mexico. American Anthropologist 5:224-228.

Qu, L. J., X. Y. Li, G. F. Xu, K. W. Chen, H. J. Yang, L. C. Zhang, G. Q. Wu, Z. C. Hou, G. Y. Xu and N. Yang 2006 Evaluation of genetic diversity in Chinese indigenous chicken breeds using microsatellite markers. Science in China Series C-Life Sciences 49(4):332­ 341.

Rawlings, 1. A. 2006 Faunal analysis and meat procurement: Reconstructing the sexual division oflabour at Shields Pueblo, Colorado. PhD, Simon Fraser University.

Rea, A. M. 1980 Late Pleistocene and Holocene turkeys in the Southwest. In Papers in Avian Paleontology honoring Hildegard Howard, Contributions in Science, number 330, edited by J. K. E. Campbell, pp. 209-224. Natural History Museum of Los Angeles County.

2007 Wings in the desert: A folk ornithology ofthe Nothern Pimans. The University of Arizona Press, Tucson, AZ.

Reed,EK. 1951 Turkeys in Southwest archaeology. EI Palacio 58(7):195-205.

Reid, J. J. 1989 A Grasshopper perspective on the Mogollon of the Arizona Mountains. In Dynamics of Southwest prehistory, edited by L. S. Cordell and G. Gumerman, pp. 65-98. Smithsonian Institution Press, Washington, D.C..

Reitz, E J. and E S. Wing 1999 Zooarchaeology. Cambridge Manuals in Archaeology. Cambridge University Press, Cambridge, UK.

Richards, M. B., B. C. Sykes and R. E M. Hedges 1995 Authenticating DNA extracted from ancient skeletal remains. Journal of Archaeological Science 22(2) :291-299.

Robinson, C. K., G. 1. Gross and D. A. Breternitz 1986 Overview of the Dolores Archaeological Program. In Dolores archaeological program: Final synthetic report, edited by D. A. Breternitz, C. K. Robinson and G. 1. Gross, pp. 3-45. United States Department of the Interior, Bureau of Reclamation, Engineering and Research Center, Denver, CO.

Rohn, A. H. 1971 Mug House, Mesa Verde National Park, Colorado. Archaeological Research Series NO.7-D. National Park Service, U.S. Department of the Interior, Washington, D.C.

186 1989 Northern San Juan prehistory. In Dynamics of Southwest prehistory, edited by L. S. Cordell and G. J. Gumerman, pp. 149-177. Smithsonian Institution Press, Washington, D.C.

Ryan, S. C. 2004 Albert Porter Pueblo (Site 5MT123), Montezuma County, Colorado: Annual Report, 2004 Field Season. [HTML Title]. Available: http://www.crowcanyon.org/albertporter2004. Date of use: 29 April 2009.

Saitoh, H., M. Harata and S. Mizuno 1989 Presence of female-specific bent-repetitive DNA-sequences in the genomes of turkey and pheasant and their interactions with W-protein of chicken. Chromosoma 98(4):250-258.

Saitou, N. and M. Nei 1987 The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Bioi Evo/4(4):406-425.

Sardina, M. 1., M. Ballester, J. Marmi, R. Finocchiaro, J. van Kaam, B. Portolano and J. M. Folch 2006 Phylogenetic analysis of Sicilian goats reveals a new mtDNA lineage. Animal Genetics 37(4):376-378.

Schaafsma, P. 1999 Tlalocs, Kachinas, sacred bundles, and related symbolism in the Southwest and Mesoamerica. In The Casas Grande world, edited by C. F. Schaafsma and C. L. Riley, pp. 164-192. The University of Utah Press, Salt Lake City.

Schmidt, D., S. Hummel and B. Herrmann 2003 Brief communication: Multiplex XIY-PCR improves sex identification in aDNA analysis. American Journal ofPhysical Anthropology 121 (4): 337-341.

Schorger, A. W. 1961 An ancient pueblo turkey. Auk 78:133-144.

1966 The wild turkey: Its history and domestication. University of Oklahoma Press, Norman.

1970 A new subspecies of Meleagris gallopavo. Auk 87:168-170.

Schroeder, A. H. 1968 Birds and feathers in documents relating to Indians of the Southwest. In Collected papers in honor of Lyndon Lane Hargrave, Papers ofthe Archaelogical Society ofNew Mexico, No.1, edited by A. H. Schroeder. Museum of New Mexico Press, Santa Fe.

Scott, V. E. and E. L. Boeker 1977 Responses of Merriam's turkey to pinyon-juniper control. Journal of Range Management 30(3):220-223.

187 Senior, L. M. and L. J. Pierce 1989 Turkeys and domestications in the Southwest: Implications from Homol'ovi III. Kiva 54(3):245-259.

Shaw, H. G. 2002 Merriam's turkey prehistory: A biologist's perspective. In Culture and environment in the American Southwest: Essays in honor ofRobert C. Euler, edited by D. A. Phillips Jr. and J. Ware, pp. 69-78. SWCA Anthropological Research Paper Number 8. SWCA Environmental Consultants, Phoenix, AZ.

Shriver, P. R. 1987 The wild turkey. Ohio Archaeologist 1:26-28.

Simonsen, B. T., H. R. Siegismund and P. Arctander 1998 Population structure of African buffalo inferred from mtDNA sequences and microsatellite loci: High variation but low differentiation. Molecular Ecology 7:225-237.

Smith, B. D. 1997 Reconsidering the Ocampo Caves and the era of incipient cultivation in Mesoamerica. Latin American Antiquity 8(4):342-383.

Smith, E. J., T. Y. Geng, E. Long, F. W. Pierson, D. P. Sponenberg, C. Larson and R. Gogal 2005 Molecular analysis of the relatedness of five domesticated turkey strains. Biochemical Genetics 43(1-2):35-47.

Sossinka, R. 1982 Domestication in birds. Avian Biology 5:373-403.

Speller, C. F., B. M. Kemp, S. Wyatt, C. Monroe, W. Lipe, U. Arndt and D. Y. Yang in prep Complex history for turkey domestication in pre-contact North America.

Spielmann, K. A. (editor) 1991 Farmers, hunters, and colonists: Interaction between the Southwest and the southern Plains. University of Arizona Press, Tucson.

Stangel, P. W., P. L. Leberg and J. I. Smith 1992 Systematics and population genetics. In The wild turkey: Biology and management, edited by J. G. Dickson, pp. 18-31. Stackpole Books, Harrisburg, PA.

Steadman, D. W. 1980 A review of the osteology and paleontology of turkeys (Aves: Meleagridinae). In Papers in Avian Paleontology honoring Hildegard Howard, Contributions in Science, number 330, edited by J. K. E. Campbell. Natural History Museum of Los Angeles County.

Steen, C. R. 1966 Tse-ta'a: excavations at Tse-ta'a, Canyon de Chelly National Monument, Arizona. US National Park Service, Washington. 188 Stewart, J. D., J. H. Kelley, A. C. MacWilliams and P. J. Reimer 2005 The Viejo period of Chihuahua culture in Northwestern Mexico. Latin American Antiquity 16(2): 192.

Szalanski, A. L., K. Church, D. Oates, R. Bischof and T. O. Powers 2000 Mitochondrial DNA variation within and among wild turkey (Meleagris gallopavo) subspecies. Transactions ofthe Nebraska Academy of Science 26:47-53.

Tagg, M. D. 1996 Early cultigens from Fresnal Shelter, southeastern New Mexico. American Antiquity 61 (2):311-324.

Tarcan, C. G. 2005 Counting sheep: fauna, contact and colonialism at Zuni Pueblo, New Mexico, A.D. 1300-1900. PhD thesis, Simon Fraser University.

Thompson, J. D., D. G. Higgins and T. J. Gibson 1994 CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22:4673-4680.

Troy, C. S., D. E. MacHugh, J. F. Bailey, D. A. Magee, R. T. Loftus, P. Cunningham, A. T. Chamberlain, B. C. Sykes and D. G. Bradley 2001 Genetic evidence for Near-Eastern origins of European cattle. Nature 410(6832): 1088-1 091.

Trut, L., I. Oskina and A. Kharlamova 2009 Animal evolution during domestication: the domesticated fox as a model. BioEssays 31 (3):349-360.

Tyler, H. A. 1991 Pueblo birds and myth. Northland Publishing Co., Flagstaff, AZ.

Upham, S. 1982 Polities and power: An economic and political history ofthe western Pueblo. Academic Press, New York.

Varien, M. 1999a Stanton's Site. In The Sand Canyon archaeological project: Site testing, edited by M. Varien. Crow Canyon Archaeological Center, Cortez, Colorado.

Varien, M. D. 1999b Sedentism and mobility in a social landscape: Mesa Verde and beyond. University of Arizona Press, Tucson.

2006 Turbulent times in the Mesa Verde world. In The Mesa Verde world: Explorations in Ancestral Pueblo archaeology, edited by D. G. Noble, pp. 39-47. School of American Research Press, Santa Fe, N.M.

189 Vierra, B. J. and K. M. Schmidt (editors) 2008a The land conveyance and transfer data recovery project: 7000 years of land use on the Pajarito Plateau. Cultural Resources Report No. 273. Volume 1: Baseline Study. Ecology and Air Quality Group, Los Alamos National Laboratory, Los Alamos, NM.

2008b The land conveyance and transfer data recovery project: 7000 years of land use on the Pajarito Plateau. Cultural Resources Report No. 273. Volume 4: Research Design. Ecology and Air Quality Group, Los Alamos National Laboratory, Los Alamos, NM.

Vila, C., J. E. Maldonado and R. K. Wayne 1999 Phylogenetic relationships, evolution, and genetic diversity of the domestic dog. Journal ofHeredity 90(1):71-77.

Vila, C., C. Walker, A. K. Sundqvist, O. Flagstad, Z. Andersone, A. Casulli, I. Kojola, H. Valdmann, J. Halverson and H. Ellegren 2003 Combined use of maternal, paternal and bi-parental genetic markers for the identification of wolf-dog hybrids. Heredity 90(1):17-24.

Von den Driesch, A. 1976 A guide to the measurement of animal bones from archaeological sites. Peabody Museum Bulletin 1: 1-137.

Wakeling, B. F., F. E. Phillips and R. Engel-Wilson 1997 Age and gender differences in Merriam's turkey tarsometatarsus measurements. Wildlife Society Bulletin 25(3):706-708.

Walker, P. L. 1985 Anemia among prehistoric Indians of the American Southwest. In Health and disease in the prehistoric Southwest, edited by C. F. Merbs and R. J. Miller. Arizona State University, Anthropological Research Papers No. 34.

Watson, P. J., S. A. LeBlanc and C. L. Redman 1980 Aspects of Zuni prehistory: Preliminary report on excavations and survey in the EI Morro valley of New Mexico. Journal ofField Archaeology 7(2):218.

Watt, K. 2005 Decontamination techniques in ancient DNA analysis. MA Thesis, Simon Fraser University.

Wills, W. H. 1988 Early prehistoric agriculture in the American Southwest. School of American Research Press, Santa Fe.

1995 Archaic foraging and the beginning of food production in the American Southwest. In Last hunters, first farmers: New perspectives on the prehistoric transition to agriculture, edited by D. T. Price and A. B. Gebauer, pp. 215-242. School of American Research Press, Santa Fe, NM.

190 Wills, W. H., P. L. Crown, J. S. Dean and C. G. Langton 1994 Complex adaptive systems and Southwest prehistory. In Understanding complexity in the prehistoric Southwest, edited by G. Gumerman and M. Gell­ Mann, pp. 297-339. SFI Studies in the Sciences of Complexity. Addison-Wesley, Reading, MA.

Wimberly, M. L. and P. L. Eidenbach 1981 Preliminary analysis of faunal remains from Fresnal Shelter: Evidence of differential butchering practices during the Archaic. The Artifact 19(3-4):21-40.

Wunz, G. A. and J. C. Pack 1992 Eastern turkey in eastern oak-hickory and northern hardwood forests. In The wild turkey: Biology and management, edited by J. G. Dickson, pp. 232-286. Stackpole Books, Harrisburg, PA.

Wyatt, S., B. M. Kemp, C. Monroe and W. D. Lipe 2009 Domestic turkeys in the American Southwest: Imported birds or an independent domestication event? In Society for American Archaeology, 74th annual meeting, Atlanta, Georgia.

Yang, D. Y., A. Cannon and S. R. Saunders 2004 DNA species identification of archaeological salmon bone from the Pacific Northwest Coast of North America. Journal ofArchaeological Science 31 (5):619­ 631.

Yang, D. Y., B. Eng, J. S. Waye, J. C. Dudar and S. R. Saunders 1998 Improved DNA extraction from ancient bones using silica-based spin columns. American Journal ofPhysical Anthropology 105:539-543.

Yang, D. Y., L. Liu, X. Chen and C. F. Speller 2008 Wild or domesticated: DNA analysis of ancient water buffalo remains from north China. Journal ofArchaeological Science 35(10):2778-2785.

Yang, D. Y. and C. F. Speller 2006 Technical tips for obtaining reliable DNA identification of historic human remains. Technical Briefs in Historical Archaeology 1: 11-16.

Yang, D. Y., J. R. Woiderski and J. C. Driver 2005 DNA analysis of archaeological rabbit remains from the American Southwest. Journal ofArchaeological Science 32(4):567-578.

Ye, X., J. lhu, S. G. Velleman and K. E. Nestor 1998 Genetic diversity of commercial turkey primary breeding lines as estimated by DNA fingerprinting. Poultry Science 77:802-807. leder, M. A. 2006a Archaeological approaches to documenting animal domestication. In Documenting domestication: New genetic and archaeological paradigms, edited by M. A. leder, D. G. Bradley, E. Emshwiller and B. D. Smith, pp. 171-180. University of California Press, Berkeley, CA.

191 2006b Central questions in the domestication of plants and animals. Evolutionary Anthropology: Issues, News, and Reviews 15(3):105-117.

2006c A critical assessment of markers of initial domestication in goats (Capra hircus). In Documenting Domestication: New Genetic and Archaeological Paradigms, edited by M. A leder, D. G. Bradley, E. Emshwiller and B. D. Smith, pp. 181-208. University of California Press, Berkey, CA leder, M. A, D. G. Bradley, E. Emshwiller and B. D. Smith 2006a Documenting domestication: Bringing together plants, animals, archaeology and genetics. In Documenting domestication: New genetic and archaeological paradigms, edited by M. A leder, D. G. Bradley, E. Emshwiller and B. D. Smith, pp. 1-14. University of California Press, Berkeley, CA leder, M. A, E. Emshwiller, B. D. Smith and D. G. Bradley 2006b Documenting domestication: The intersection of genetics and archaeology. Trends in Genetics 22(3): 139-155. leder, M. A and B. Hesse 2000 The initial domestication of Goats (Capra hircus) in the lagros Mountains 10,000 Years Ago. Science 287(5461):2254-2257. leuner, R. E. 1963 A history ofdomesticated animals. Harper & Row, Publishers, Inc., New York. lohary, D. and M. Hopf 2000 Domestication ofplants in the Old World: The origin and spread of cultivated plants in West Asia, Europe and the Nile Valley. Third ed. Oxford University Press, Oxford.

192 APPENDICES

193 Appendix A: Archaeological Sample and Provenience Information

194 Table A1 Archaeological sample and provenience information

Lab Date GL Bp Dip Bd Dd SC Site # Site Name Element Side Portion Comments Provenience information Reference 10 IIAD) (mm) ICmm) ICmm) Cmm\ ICmm) Cmm) TU1 42SA22760 Hedley Ruin 1000-1300 Humerus Left Complete 119.4 31.1 - 24.4 - - PO 284, FS 37 I(Ortman et a/. 2000) TU2 42SA22760 Hedley Ruin 1000-1300 Humerus Right Complete 142.0 38.3 - 29.0 - 14.1 PO 351, FS 5 I(Ortman et a/. 2000) TU3 42SA22760 Hedley Ruin 1000-1300 Humerus Left Proximal - 31.9 - - - - PO 127, FS 53 I(Ortman et a/. 2000)

TU4 42SA22760 Hedley Ruin 1000-1300 Humerus Left Complete 118.3 31.8 - 25.0 - 12.3 PO 284, FS 38 I (Ortman et a/. 2000) 32.7 --- TU5 42SA22760 Hedley Ruin 1000-1300 Humerus Left Proximal - - PO 284, FS 38 I (Ortman et al. 2000)

TU6 42SA22760 Hedley Ruin 1000-1300 Humerus Left Complete 117.8 32.4 - 25.5 - 12.6 PO 284, FS 38 I (Ortman et al. 2000) TU7 42SA24756 Comb Wash 1150-1250 Humerus Right Proximal - 40.0 ---- FS 253, Stratum 5 (Driver and Badenhorst 2006) TU8 42SA24756 Comb Wash 1150-1250 Humerus Left Complete 121.8 30.8 - 24.5 - 13.1 FS 149. Mixed wall fall (Driver and Badenhorst 2006) TU9 42SA24756 Comb Wash 1150-1250 Humerus Left Complete 120.0 29.5 - 24.5 - 12.4 FS 205, Level 3 (Driver and Badenhorst 2006) TU10 42SA24756 Comb Wash 1150-1250 Humerus Right Proximal - 38.1 - - - - Burned FS 135, Level 6 (Driver and Badenhorst 2006) TU11 42SA24756 Comb Wash 1150-1250 Humerus Left Distal + shaft - -- 23.8 - 11.6 FS 184, Level 3 (Driver and Badenhorst 2006) TU12 5MT23 Grass Mesa 600-920 Femur Left Complete 134.5 31.6 - 27.9 20.9 12.8 6258 cat 6 (Robinson et al. 1986) TU13 5MT2854 Aldea Sierritas 720-800 Humerus Left Complete 137.4 32.0 - 26.4 - 13.3 Immature, part of burial? PITSTR2, Fea9, Surf 6,717-02-8, I(Robinson et a/. 1986) TU14 5MT2854 Aldea Sierritas 720-800 Humerus Right Complete 103.8 25.5 - 21.2 - 10.6 Immature PS 3, Seg 2, 609-02-9, I(Robinson et al. 1986) TU15 5MT2151 LeMoc Shelter 720-900 Humerus Right Shaft - --- - 16.4 75-02-21 I(Robinson et a/. 1986)

TU16 5MT4650 Hanging Rock 720-880 Ulna - Shaft ------PITSTR 2, FS 024-048, Strat 2,125-02-20 I (Robinson et a/. 1986)

TU17 5MT4650 Hanging Rock 720-880 Phalanx - Complete 18.8 8.5 - 6.5 - 4.7 PS2, 026-048, Level 10, 129-02-18 I (Robinson et a/. 1986)

TU18 5MT2181 Hamlet de la Olla 780-920 Coracoid Left Proximal ------2182-15054-cat 9 I (Robinson et al. 1986) TU19 5MT2320 House Creek village 800-920 Carpometacarpus Left Complete 62.5 17.4 - 10.5 - - 513 (Robinson et a/. 1986) TU20 5MT4475 McPhee Village 820-980 Humerus Left Proximal + Shaft 40.9 -- - -- Healed fracture Nonstr4, Seg 1, Level 2, 785-02-14, (Robinson et al. 1986) TU21 5MT4475 McPhee Village 820-980 Femur Left Proximal - 35.1 -- -- P55, FEA 27, Lev 1,1078-02-17 (Robinson et a/. 1986) TU22 5MT4475 McPhee Village 820-980 Humerus Right Distal ------PS 4, Seg 6, Str 4, 935-02-24, feature 249 (Robinson et a/. 1986) TU23 5MT4477 Masa Negra Pueblo 860-980 Humerus Left Proximal ------Partial Skeleton 514-02-001, Surstr 13, Fea 11 (Robinson et a/. 1986) TU24 5MT4126 Ida Jean Site 1050-1150 Humerus Left Proximal - 32.3 -- - 13.1 Kiva B, NW, Lower Fill (Powers et a/. 1986) TU25 5MT4126 Ida Jean Site 1050-1150 Humerus Left Proximal - 38.6 -- -- Kiva C, Ventilator I(Powers et a/. 1986) TU26 5MT2149 Escalante Pueblo 1075-1250 Humerus Left Distal - -- 30.9 - - Kiva A, FS 25, Ventilator I(Hallasi 1979) TU27 5MT2149 Escalante Pueblo 1075-1250 Humerus - Shaft ------Healed fracture Kiva A, FS 25, Ventilator I(Hallasi 1979)

TU28 5MT948 Mockingbird Mesa/CANM 900-1350 Humerus Left Complete 119.5 32.7 - 26.1 - 13.1 PO 2322 I (Fetterman and Honevcutt 1987)

TU29 5MT948 Mockingbird Mesa/CANM 900-1350 Humerus Left Proximal + Shaft - 38.7 -- - 14.6 PO 2322 I (Fetterman and Honeycutt 1987)

TU30 5MT948 Mockingbird Mesa/CANM 900-1350 Humerus Left Shaft - --- - 15.9 PO 2322 I (Fetterman and Honeycutt 1987) TU31 5MT948 Mockingbird Mesa/CANM 900-1350 Humerus Left Shaft - --- - 12.5 PO 2322 (Fetterman and Honeycutt 1987) TU32 5MT948 Mockingbird Mesa/CANM 900-1350 Humerus Left Proximal - 38.0 -- - - PO 2322 (Fetterman and Honeycutt 1987) TU33 5MT948 Mockingbird Mesa/CANM 900-1350 Humerus Left Proximal - 31.8 - - -- PO 2322 (Fetterman and Honeycutt 1987) TU34 5MT10508 Stanton's Site 1230-1270 Humerus Left Complete 119.5 32.5 - 25.4 - 13.4 PO 48, FS12 (Varien 1999a) TU35 5MT10508 Stanton's Site 1230-1270 Humerus Left Shaft ------PD51, FS6 (Varien 1999a) TU36 5MT10508 Stanton's Site 1230-1270 Humerus Right Shaft ------PO 52, FS 1 (Varien 1999a) TU37 5MT10508 Stanton's Site 1230-1270 Humerus Right Distal - -- 32.2 - 15.0 PO 62, FS 18 I(Varien 1999a) TU38 5MT10508 Stanton's Site 1230-1270 Humerus Right Distal - - - 32.2 - 15.5 PO 155, FS 7 I(Varien 1999a) TU39 5MT1825 Castle Rock 1250-1300 Humerus Left Shaft - --- - 12.5 PO 57, FS 30 I(Kleidon 1999) TU40 5MT1825 Castle Rock 1250-1300 Humerus Right Proximal' - 39.5 - - - 15.0 PO 143, FS 8, PL10 I(Kleidon 1999)

TU41 5MT1825 Castle Rock 1250-1300 Humerus Left Shaft - - -- - 15.4 PO 247, FS 4 I (Kleidon 1999)

TU42 5MT1825 Castle Rock 1250-1300 Humerus Right Proximal - 39.5 -- -- PD441, FS 1 I (Kleidon 1999) TU43 5MT1825 Castle Rock 1250-1300 Humerus Right Shaft - -- - - 11.9 PO 1140, FS 45 .(Kleidon 1999)

195 Lab Date GL Bp Dip Bd Dd SC Site # Site Name Element Side Portion Comments Provenience information 10 (AD) (mm) I(mm) (mm) I(mm) (mm) I(mm) Reference TU44 5MT13795 Mockingbird Mesa/CANM 700-1100 Humerus Left Proximal - 38.3 14.7 Complete skeleton PD 535, Pithouse B -- - I (Fetterman and Honeycutt 1987) TU45 5MT1602 Mockingbird Mesa/CANM 1150-1300 Tibiotarsus Left Complete 231.0 42.2 22.4 21.8 13.0 PD427 (Fetterman and Honeycutt 1987) TU46 5MT1602 Mockingbird Mesa/CANM 1150-1300 Tibiotarsus Left Distal - - - 20.8 17.9 11.8 PD427 (Fetterman and Honeycutt 1987) TU47 5MT1602 Mockingbird Mesa/CANM 1150-1300 Tibiotarsus Left Distal -- - 20.2 18.7 11.6 PD427 (Fetterman and Honeycutt 1987) TU48 5MT1602 Mockingbird Mesa/CANM 1150-1300 Tibiotarsus Left Distal -- - 17.0 15.9 9.7 PD427 (Fetterman and Honeycutt 1987) TU49 5MT1602 Mockingbird Mesa/CANM 1150-1300 Tibiotarsus Left Distal -- - 16.3 15.5 9.4 PD427 (Fetterman and Honeycutt 1987) TU50 5MT1602 Mockingbird Mesa/CANM 1150-1300 Tibiotarsus Left Distal -- - 15.9 14.7 9.6 PD427 (Fetterman and Honeycutt 1987) TU51 5MT1602 Mockingbird Mesa/CANM 1150-1300 Tibiotarsus Left Distal -- - 15.9 15.1 9.3 PD427 (Fetterman and Honeycutt 1987) TU52 5MT1602 Mockingbird Mesa/CANM 1150-1300 Tibiotarsus Left Distal --- 16.1 15.7 - PD427 (Fetterman and Honeycutt 1987) TU53 5MT3217 . Mockingbird Mesa/CANM 1150-1300 Humerus Right Proximal - 40.5 -- - - PD 154 (Fetterman and Honeycutt 1987) TU54 5MT3217 Mockingbird Mesa/CANM 1150-1300 Humerus Right Shaft ------PD 154 (Kuckelman 2007a) TU55 5MT765 Sand Canyon 1250-1280 Humerus Left Shaft ---- 12.7 Immature PD 163, FS 18 (Kuckelman 2007a) TU56 5MT765 Sand Canyon 1250-1280 Humerus Left Shaft ------PD 163, FS 29 (Kuckelman 2007a) TU57 5MT765 Sand Canyon 1250-1280 Humerus Right Shaft ---- - 12.6 PD 184, FS 6 (Kuckelman 2007a) TU58 5MT765 Sand Canyon 1250-1280 Humerus Left Shaft --- -- 13.5 PD 184, FS 11 (Kuckelman 2007a) TU59 5MT765 Sand Canyon 1250-1280 Humerus Left Distal +shaft --- 30.9 - 14.6 PD 184, FS 81 (Kuckelman 2007a) TU60 5MT765 Sand Canyon 1250-1280 Cervical vert - Complete 38.6 --- - - PD 201, FS 9 (Kuckelman 2007a) TU61 5MT765 Sand Canyon 1250-1280 Tibiotarsus Right Distal +shaft --- 20.4 20.8 - Shaft damaged PD 211, FS 51, PL1 (Kuckelman 2007a) TU62 5MT765 Sand Canyon 1250-1280 Tibiotarsus Left Distal +shaft --- 19.1 16.4 12.8 Immature PD 212, FS 29, PL15 (Kuckelman 2007a) TU63 5MT765 Sand Canyon 1250-1280 Tibiotarsus Right Distal +shaft --- 17.8 15.9 10.2 PD 215, FS 49, PL44 (Kuckelman 2007a) TU64 5MT765 Sand Canyon 1250-1280 Humerus Left Distal --- -- 12.6 Damaged PD 263, FS 9 (Kuckelman 2007a) TU65 5MT765 Sand Canyon 1250-1280 Tibiotarsus Left Distal --- 20.7 20.2 12.8 PF 271, FS 3, (Kuckelman 2007a) TU66 5MT765 Sand Canyon 1250-1280 Humerus Right Shaft ----- 14.0 Complete skeleton PD 347, FS 96, PL4 (Kuckelman 2007a) TU67 5MT765 Sand Canyon 1250-1280 Humerus Left Shaft -- - -- 13.2 PD 357, FS 27 (Kuckelman 2007a) TU68 5MT765 Sand Canyon 1250-1280 Tarsometatarsus Left Complete 88.8 15.1 - 16.9 - 5.5 Immature PD 359, FS 49 (Kuckelman 2007a) TU69 5MT765 Sand Canyon 1250-1280 Humerus Right Distal --- 25.1 - - PD 359, FS 49 (Kuckelman 2007a) Damaged Tuberculum (Kuckelman 2007a) TU70 5MT765 Sand Canyon 1250-1280 Humerus Right Proximal - -- PD 359, FS 90 - -- laterale TU71 5MT765 Sand Canyon 1250-1280 Humerus Right Shaft ------PD 359, FS 199 (Kuckelman 2007a) TU72 5MT765 Sand Canyon 1250-1280 Humerus Right Shaft --- -- 12.5 PD 583, FS 6 (Kuckelman 2007a) TU73 5MT765 Sand Canyon 1250-1280 Humerus Right Shaft --- -- 12.6 PD 604, FS 4 (Kuckelman 2007a) TU74 5MT765 . Sand Canyon 1250-1280 Humerus Left Shaft --- -- 13.8 PF 793, FS 37 (Kuckelman 2007a) TU75 5MT765 . Sand Canyon 1250-1280 Humerus Right Shaft -- -- - 11.8 PD 1037, FS 13 (Kuckelman 2007a) TU76 5MT765 Sand Canyon 1250-1280 Humerus Left Shaft -- --- 12.3 PD 1070, FS 13 (Kuckelman 2007a) Damaged tuberculum (Kuckelman 2007a) TU77 5MT765 ' Sand Canyon 1250-1280 Humerus Left Complete 144.8 -- 16.0 PD 1072, FS 51 -- medial and distal portion TU78 5MT765 Sand Canyon 1250-1280 Humerus Right Distal --- 24.3 - - PD 1072, FS 51 (Kuckelman 2007a) TU79 5MT765 Sand Canyon 1250-1280 Humerus Right Shaft ---- - 14.5 PD 1076, FS 4 (Kuckelman 2007a) TU80 5MT765 Sand Canyon 1250-1280 Humerus Left Shaft --- -- 11.6 PD 1076, FS 4 (Kuckelman 2007a) TU81 5MT765 Sand Canyon 1250-1280 Humerus Right Distal +shaft --- 24.8 - 12.7 PD1124, FS 1 (Kuckelman 2007a) Damaged tuberculum (Kuckelman 2007a) TU82 5MT765 Sand Canyon 1250-1280 Humerus Left Complete 120.3 12.7 PD 1257, FS 40 ---- medial TU83 5MT765 Sand Canyon 1250-1280 Humerus Right Shaft --- -- 11.0 PD 1257, FS 40 (Kuckelman 2007a) TU84 5MT765 Sand Canyon 1250-1280 Humerus Right Shaft , ----- 15.8 PD 1257, FS 40 (Kuckelman 2007a) Damaged tuberculum (Kuckelman 2007a) TU85 5MT765 Sand Canyon 1250-1280 Humerus Left Proximal + shaft 39.4 -- 15.1 PD 1396, FS 33 - - medial TU86 5MT765 Sand Canyon 1250-1280 Humerus Right Shaft --- - - 11.6 PD 1442, PFS 8 (Kuckelman 2007a) TU87 LA12587 Los Alamos 1275-1325 Humerus Right Shaft - -- -- 12.8 Branta Canadensis? FS 1892 I(Vierra and Schmidt 2008b)

196 Lab Date GL Bp Dip Bd Dd SC Site # Site Name Element Side Portion Comments Provenience information 10 ICAD) ICmm) Cmm) Cmm) ICmm) (mm) ICmm) Reference TU88 LA4618 Los Alamos 1275-1325 Humerus Left Complete 143.2 40.9 - 30.7 - 14.5 AN720, Area L (Vierra and Schmidt 2008b) TU89 LA4618 Los Alamos 1275-1325 Humerus Left Complete - 37.8 - 29.6 - 14.4 In 2 pieces AN765 (Vierra and Schmidt 2008b) TU90 LA4618 Los Alamos 1275-1325 Humerus Left Complete 118.2 32.6 - 25.9 - 12.7 AN709 (Vierra and Schmidt 2008b) TU91 LA4618 Los Alamos 1275-1325 Humerus Left Proximal - 37.2 - - - - AN775 (Vierra and Schmidt 2008b) TU92 LA4618 Los Alamos 1275-1325 Humerus Right Complete 112.9 30.2 - 23.9 - 11.7 AN730 (Vierra and Schmidt 2008b) TU93 LA12587 Los Alamos 1275-1325 Tarsometatarsus Right Complete 145.4 21.9 - 21.5 - 8.6 No Spur FS 4193 (Vierra and Schmidt 2008b) TU94 LA12587 Los Alamos 1275-1325 Tarsometatarsus Left Shaft - - - - - 9.4 Spur FS 5132 (Vierra and Schmidt 2008b) Femur Left Proximal P55, FEA27, Lev 1, 1078-02-17 TU95 5MT4475 McPhee Village 820-980 ------I (Robinson et a/. 1986) Left Distal - 14.7 PD427 TU96 5MT1602 Mockingbird Mesa/CANM 1150-1300 Tibiotarsus - - 16.2 - I (Fetterman and Honeycutt 1987) 121.6 34.2 12.7 TU97 5MT3807 Sheilds Pueblo 1150-1250 Humerus Left Complete - 26.6 - PD 2009, FS 2, Lev A I (Duff and Ryan 2001) TU101 5MT3807 Sheilds Pueblo 1150-1250 Humerus Left Proximal - 40.8 --- - PD 2009, FS 2, Lev B (Duff and Ryan 2001) TU102 5MT3807 Sheilds Pueblo 1020-1300 Humerus Left Complete 117.2 31.0 -- - 11.8 Damaged distal portion PD 1199, FS 78 (Duff and Ryan 2001) TU105 . 5MT3807 Sheilds Pueblo 1150-1250 Humerus Left Proximal ------PD 1762, FS 56, Lev A (Duff and Ryan 2001) TU106 5MT3807 Sheilds Pueblo 1020-1300 Humerus Left Complete 138.5 37.9 - 28.9 - 15.2 PD 1976, FS 57 (Duff and Ryan 2001) TU107 5MT3807 Sheilds Pueblo 1020-1060 Humerus Left Complete 34.9 8.0 - 6.6 - 3.2 Immature PD 2094, FS 18, Lev A (Duff and Ryan 2001) TU111 5MT3807 Sheilds Pueblo 1150-1250 Humerus Left Proximal - 20.5 - -- - Immature PD 1762, FS 56, Lev C (Duff and Ryan 2001) TU112 5MT3807 Sheilds Pueblo 1020-1300 Humerus Left Complete 116.1 33.4 - 25.7 - 12.4 PD 628, FS 41 (Duff and Ryan 2001) TU113 5MT3807 Sheilds Pueblo 1020-1300 Humerus Left Complete 145.8 41.0 - 31.6 - 15.7 PD 1068, FS 2 (Duff and Ryan 2001) TU114 5MT3807 Sheilds Pueblo 1020-1300 Humerus Left Complete 145.4 41.4 - 32.1 - 15.6 PD 1763, FS 47 (Duff and Ryan 2001) TU115 5MT3807 Sheilds Pueblo 1150-1250 Humerus Left Proximal - 34.1 - -- - PD 1762, FS 56, Lev B (Duff and Ryan 2001) TU116 5MT3807 Sheilds Pueblo 1020-1060 Humerus Left Complete 51.5 11.0 - 9.4 - 4.6 Immature PD 2094, FS 18, Lev B (Duff and Ryan 2001) TU117 5MT3807 Sheilds Pueblo 1020-1060 Humerus Left Complete 49.0 10.5 - 9.1 - 4.3 Immature PD 2095, FS 26 (Duff and Ryan 2001)

TU119 42SA22674 Bluff Great House 900-1150 Vertebrae - Complete ------FS3715, Lev 3, Test Unit 71A I (Cameron 2009) TU120 42SA22674 Bluff Great House 900-1150 Phalange - Complete ------FS3715, Lev 3, Test Unit 71A (Cameron 2009) TU121 42SA22674 Bluff Great House 900-1150 Tibiotarsus - Shaft ------Very small fragment FS 4310, Lev 8, Unit 75AB (Cameron 2009) TU123 42SA22674 Bluff Great House 1150-1300 Humerus Right Complete 144 39.7 - 30 - 15.35 FS 3703, Lev 2, Test Unit 71, 71 B (Cameron 2009) TU124 42SA22674 Bluff Great House 1150-1300 Humerus Right Complete 144.7 40.3 - 29.6 - 15.5 FS 3703, Lev 2, Test Unit 71, 71 B (Cameron 2009) TU125 42SA22674 Bluff Great House 1150-1300 Humerus Right Complete 122.2 34.4 - 26.5 - 13.3 FS 4442, Lev 13, Test Unit 72ABCD (Cameron 2009) TU126 42SA22674 Bluff Great House 1150-1300 Humerus Right Complete 122.5 32.6 - 25 - 13.5 FS 3703, Lev 2, Test Unit 71, 71 B (Cameron 2009) TU127 5MT123 Albert Porter 900-1150 Tarsometatarsus Right Complete 135.5 22.4 - 21.9 - 7.8 Broken Spur PD, 1954, FS 2, NST 200, #1748 (Ryan 2004) TU128 5MT123 Albert Porter 1150-1300 Tarsometatarsus Left Complete 161 25.6 - 23.9 - 10.1 Spur PD 2006, FS 78, NST100, #16226 (Rvan 2004) TU129 5MT123 Albert Porter 900-1150 Tarsometatarsus Left Complete 114.6 18.5 - 17.1 - 6.2 No Spur PD 1952, FS 7, NST200, #1744 I(Rvan 2004) TU130 5MT123 Albert Porter 1150-1300 Tarsometatarsus Left Complete 149.6 23 - 22.3 - 8.8 Broken Spur PD 354, FS 12, Kiva113, #8221 I(Ryan 2004) TU131 5MT123 Albert Porter 1150-1300 Tarsometatarsus Left Complete 121.8 17.6 - 18.4 - 7.6 Broken Spur PD 2008, FS 83, NST100, #16863 I(Ryan 2004)

TU132 5MT123 Albert Porter 1150-1300 Tarsometatarsus Right Complete 121.3 18.98 - 19.1 - 7.3 No Spur PD 2006, FS 78, NST100, #16227 I (Ryan 2004)

TU133 5MT123 Albert Porter 1150-1300 Tarsometatarsus Left Complete 127.5 19.85 - 19.9 - 7.61 No Spur PD 1705, FS 6, Kiva803, #13789 I (Ryan 2004)

TU134 5MT123 Albert Porter 1150-1300 Tarsometatarsus Right Complete 129.4 20.4 - 20 - 7.83 No Spur PD 1761, FS 8, NST100, #13536 I (Ryan 2004)

TU135 CH-254 Calder6n Site 1034-1296 Tibiotarsus Right Distal - - - 23.2 21.96 12.2 Unit 39, Level 3, 173N, 208E I (Stewart et a/. 2005) TU136 29SJ387 Pueblo Bonito 900-1150 Tibiotarsus Right Distal ------Damaged FS 557, Box 2-12,(5104), West Mound I(Judd 1954) TU137 29SJ387 Pueblo Bonito 900-1150 Ulna Left Proximal ------FS 399, Box 2-8, Level 9, 4 91 N, 562E, East Mound (Judd 1954) TU138 29SJ387 Pueblo Bonito 900-1150 Tarsometatarsus Left Proximal ------FS 2666, Box 1-4, (#1101), East Mound (Judd 1954) TU139 29SJ387 Pueblo Bonito 900-1150 Tarsometatarsus Right Distal ------FS 2939Box 1-2, (#1023), East Mound (Judd 1954) TU140 29SJ387 Pueblo Bonito 900-1150 Tibiotarsus - Distal ------Very small fragment FS 2819, Box 1-4, (#1023), West Mound (Judd 1954) TU141 29SJ387 Pueblo Bonito 900-1150 Tarsometatarsus - Distal ------Very small fragment FS 2819, Box 1-4, (#1023), West Mound I(Judd 1954) TU142 29SJ387 Pueblo Bonito 900-1150 Tarsometatarsus Left Distal ------FS 2736, Box 1-4, (#1240), West Mound I(Judd 1954) TU147 CH-254 Calder6n Site 820-1296 Femur Left Proximal - -- - - 13.2 Immature Unit 54, Lev 3 I(Stewart et al. 2005) 197 Lab Date GL Bp Dip Bd Dd SC Site # Site Name Element Side Portion Comments Provenience information 10 (AD) (mm) (mm) I(mm) (mm) I(mm) (mm) Reference - 19.7 TU148 CH-254 Calder6n Site 820-1296 Tibiotarsus Left Distal - - 20.9 - Unit 54, Lev 3 (Stewart et a/. 2005) - TU149 CH-254 Calder6n Site 820-1296 Humerus Left Distal - - 32.5 -- Unit 54, Lev 3 (Stewart et a/. 2005) TU150 CH-254 Calder6n Site 820-1296 Tarsometatarsus Left Distal - - - 25.1 - - Unit 54, Lev 3 (Stewart et a/. 2005) TU151 CH-254 Calder6n Site 820-1296 Tarsometatarsus Left Proximal - 23.3 - - - - Unit 54, Lev 3 I(Stewart et a/. 2005) TU152 CH-254 Calder6n Site 820-1296 Scapula Right Lateral ------Damaged Unit 64, Lev 3 I(Stewart et a/. 2005\ TU1001 NA2520 Turkey Cave 475-1300 Sternum - - - - - NAVA3073, Site ACC 328, WACC ACC 369 '(Breternitz 1969) Complete 117.7 - - TU1003 LA12121 Alamo Canyon 1150-1180 Humerus Left - 27.2 12.2 Damaged Crista Lateralis Rm 2, Fill, FS1037, SWRO ACC 26, BAND19082 I(Vierra and Schmidt 2008a) TU1004 LA217 Rainbow House Distal - 30.1 - 1400-1600 Humerus Left - - - #3255a & b, SQN8E1, BKG, 6-12", BAND 3865 I (Kohler 2004) TU1009 LA217 Rainbow House 1400-1600 Tibiotarsus Right Complete 220.0 - 37.1 20.7 20.2 9.7 Rm 43, 10-16-50, Bones, Bag 9, BAND 3802 I(Kohler 2004) TU1010 LA217 Rainbow House 1400-1600 Tibiotarsus Right Complete 165.0 - 29.5 16.9 14.5 8.1 Rm 43, 10-16-50, Bones, Bag 9, BAND 3802 (Kohler 2004) TU1015 LA217 Rainbow House 1400-1600 Humerus Left Proximal ------Damaged Crista Lateralis Prov #5860, Rm 11, Floor Fill, BAND3738, ACC 120 (Kohler 2004) TU1017 Gila Cliff Dwelling 1270-1290 Scapula Right Shaft - 29.33' - - - - Rm 30, Cave V (Y-11), GILC 1390, ACC 4, WACC 479 I(Anderson et a/. 1986) TU1018 Gila Cliff Dwelling 1270-1290 - - Shaft ------Small mammal? Rm 31, Cave V (Y4-166), GILC 1389, ACC 4, WACC 479 I(Anderson et a/. 1986\ TU1019 Gila Cliff Dwelling 1270-1290 Radius Right Distal - - - 12.2 - - Immature Rm 23, Cave IV, Y-4-235, GILC1394, ACC 4, WACC 479 I(Anderson et a/. 1986) TU1020 Tsa-ta'a, Canyon de Chelly 700-1300 Humerus Right Complete 117.6 32.4 - 25.3 - 12.0 CACH 4574, ACC 24, WACC 194, STR 57, Lev 3 I(Steen 1966) TU1022 Tsa-ta'a, Canyon de Chelly 700-1300 Humerus Right Complete 113.1 30.7 - 23.8 - 10.8 Epiphyses recently fused CACH 4567, ACC 24, WACC 194, STR 54, Lev 4 I(Steen 1966) TU1026 Tsa-ta'a, Canyon de Chelly 700-1300 Humerus Right Proximal - 41.2 - - - 13.3 Immature CACH 4564, ACC 24, WACC 194, STR 46, Lev 4 I(Steen 1966) CACH39961, ACC 68, WACC 80, Rm 21, Prov 338, AO-CC TU1033 Antelope House 700-1300 Humerus Right Proximal - 39.6 - - - - , 448 I(Morris 1986) CACH39972, ACC 68, WACC 80, Rm 21, Prov 346, AO- TU1034 Antelope House 700-1300 Humerus Left Proximal - 32.0 - - - - CC456 I(Morris 1986) TU1036 Tumacacori National Mon. 1691-1850 Tarsometatarsus Right Complete 171.0 25.4 - 26.1 - 9.7 TUMA2386, ACC 2, WACC 62, Rm 29 I(Pickens 1993) TU1037 U:8:48 Upper RUin, Tonto 1300-1400 Tarsometatarsus Right Distal - - 22.2 - - Spur Scar? TONT2345, ACC 9, WACC 536, Rm A, T2.496 I(Caywood 1962\ TU1038 U:8:48 Upper RUin, Tonto 1300-1400 Tarsometatarsus Left Complete 155.0 23.0 - 23.7 - 9.1 TONT2345, ACC 9, WACC 536, Rm A, T18 I(Cavwood 1962) TU1039 U:8:48 Upper RUin, Tonto 1300-1400 Tarsometatarsus Left Complete 163.0 23.3 - 24.7 - 9.4 Spur TONT2345, ACC 9, WACC 536, Rm A, T10 I(Caywood 1962) TU1041 Gran Quivira 1300-1672 Humerus Right Proximal - 45.5 - - - - SAPU7718, ACC 37, WACC 97, Rm138, FS 7458, I(Hayes 1981) TU1049 Gran Quivira 1300-1672 Humerus Left Complete 105.8 28.3 - 22.0 - 10.5 SAPU7718, ACC 37, WACC 97, Rm 58, Subfloor, FS 4422 I(Hayes 1981) TU1052 Gran Quivira 1300-1672 Humerus Right Complete 125.7 33.8 - 25.2 - 11.1 Immature SAPU7649, ACC 37, WACC 97, Rm 116, Subfloor, FS7137 I(Hayes 1981) TU1053 Gran Quivira 1300-1672 Humerus Right Complete 136.6 38.6 - 29.3 - 13.6 SAPU7529, ACC 37, WACC 97, Rm 14,Fill, FS 1208 I(Hayes 1981) TU1054 Gran Quivira 1300-1672 Humerus Left Complete 115.4 31.4 - 25.2 - 12.2 SAPU7534, ACC 37, WACC 97, Rm 19, SUbfloor, FS 2186 I(Hayes 1981) TU1055 Fort Bowie 1862-1894 Humerus Left Shaft - - - - - 11.6 FOB07700, ACC 2, WACC 59, Trench 3, Unit 77 (Herskovitz 1978) TU1057 Fort Bowie 1862-1894 Tibiotarsus Left Shaft ------FOB07714, ACC 2, WACC 59, Trench 4, Unit HH (Herskovitz 1978) TU1059 Fort Bowie 1862-1894 Tibiotarsus Left Distal - - - 16.3 15.1 - FOB07705, ACC 2, WACC 59, Trench 3, Unit 112 (Herskovitz 1978) TU1061 S. Pueblo, Pecos 1300-1846 Tibiotarsus Left Distal - -- 21.0 19.6 - PEC017919, ACC 45, WACC 699, FS27, Unit A-19, Lev 1 (Bandelier 1976)

TU1062 S. Pueblo, Pecos 1300-1846 Tarsometatarsus Right Shaft - - -- 10.7 Spur PEC017664, ACC 45, WACC 699, FS18, Unit A11, Lev 2 I (Bandelier 1976)

TU1063 Forked Lightning, Pecos 1300-1846 Tibiotarsus Left Distal - -- 22.9 19.8 - PECO 2254, AC 86, WACC 587 I(Bandelier 1976)

TU1064 Forked Lightning, Pecos 1300-1846 Femur Right Distal - -- 23.0 17.8 - PEC02252, AC 86, WACC 587 I(Bandelier 1976) TU1066 LA99 EI Morro 1280-1380 Humerus Left Proximal - 38.8 - - - 13.5 ELM01263, ACC 25, WACC 31, Main Plaza, Test 1 (T2.236) (Watson et a/. 1980\ TU1067 LA99 EI Morro 1280-1380 Humerus Left Complete 145.5 39.1 - 30.4 - 14.5 ELM01264, ACC 25, WACC 31, Main Plaza, Test 1 (T2.216) (Watson et a/. 1980\

TU1069 LA99 EI Morro 1280-1380 Humerus Right Complete 118.3 32.0 - 25.5 - 12.2 ELMO 1268, ACC 25, WACC 31, Main Plaza, Test 1 (T2.306) I(Watson et a/. 1980) TU1070 LA99 EI Morro 1280-1380 Humerus Left Complete 143.3 39.4 - 30.6 - 14.1 ELMO 1269, ACC 25, WACC 31, Main Plaza, Test 1 (T2.407) (Watson et a/. 1980) TU1072 LA99 EI Morro 1280-1380 Humerus Left Proximal - 31.5 - - - - Immature ELMO 1247, ACC 25, WACC 31, Main Plaza, Test 1 (T2.179) (Watson et a/. 1980\ TU1078 Keet Seel 1250-1300 Humerus Left Complete 143.0 38.0 - 29.4 - 14.0 Incorrectly ID'd as R. hum NAVA 7329, ACC 554, A0118, Box 28 (Dean 2006) TU1079 Keet SeeI 1250-1300 Tarsometatarsus Right Complete 153.5 24.1 - 25.2 - 9.8 NAVA 7339, ACC 554, A089, Box 28 I(Dean 2006) TU1083 Keet Seel 1250-1300 Humerus Right Complete 141.3 38.2 - 29.4 - 13.8 NAVA 7356, ACC 554, A0115, Box 23 I(Dean 2006) TU1084 Keet Seel 1250-1300 Tarsometatarsus Right Complete 137.3 21.3 - 22.1 - 8.0 NAVA 7350, ACC 554, A095, Box 23 I(Dean 2006) TU1086 Keet Seel 1250-1300 Tarsometatarsus Left Complete 146.9 23.6 - 24.0 - 9.2 No Spur NAVA 7370, ACC 554, A0110, Box 23 I(Dean 2006) 198 Bd Dd SC Lab Date GL Bp Dip Comments Provenience information Reference Site # Site Name Element Side Portion I(mm) Cmm) ID I(AD} I(mm) Imm) (mm) ICmm) 24.8 11.8 AZRU4820, ACC 78, Trash Mound, Cat #4820 TU1091 Aztec Ruin 1105-1300 Humerus Right Complete 120.8 32.5 - - I(Lister and Lister 1987) 30.7 15.0 AZRU4814, ACC 78, Cat4814, Trash Mound, Sec C-O, L III TU1093 Aztec Ruin 1105-1300 Humerus Right Complete 148.0 39.2 - - I(Lister and Lister 1987) 24.2 11.1 Complete skeleton ARZU4733, ACC 79, WACC 631, West Ruin, Rm 57, TU1096 Aztec Ruin 1105-1300 Humerus Left Complete 114.3 30.7 - - I(Lister and Lister 1987) 25.4 12.7 AZRU4755, ACC 41, WACC 631, Hubbard Mound, Pit 4 TU1097 Aztec Ruin 1105-1300 Humerus Right Complete 121.9 32.5 - - I (Lister and Lister 1987) - 27.1 - 12.9 Immature AZRU4755, ACC 41, WACC 631, Hubbard Mound, Pit 4 TU1098 Aztec Ruin 1105-1300 Humerus Right Complete 136.8 35.0 I(Lister and Lister 1987) - Prov 42, 04052-04066 TU1101 W:10:50 Point of Pines Pueblo 1200-1400 Humerus Right Proximal - 44.7 - - - I(Gifford 1980\ - - - Prov 42, 04052-04066 TU1102 W:10:50 Point of Pines Pueblo 1200-1400 Humerus Right Proximal - 34.3 - I(Gifford 1980\ - 34.0 15.4 Prov 6, Trench L5N, Test 2, Lev 2,04010, TU1103 W:10:50 Point of Pines Pueblo 1200-1400 Humerus Right Complete 148.9 42.8 - I(Gifford 1980\ 25.7 - 12.5 Prov 31, Broadside 2, 04067-70 TU1104 W:10:50 Point of Pines Pueblo 1200-1400 Humerus Right Complete 120.1 33.1 - I(Gifford 1980\ 33.5 - 16.5 Prov 154, 04044-51 TU1105 W:10:50 Point of Pines Pueblo 1200-1400 Humerus Right Complete 150.7 42.8 - I(Gifford 1980\ - 13.4 Immature Rm 27 (1-507) 0128 SE 2.40, SFL1, Box 64, 02750 TU1106 P:14:1 Grasshopper Pueblo 1300-1400 Humerus Right Proximal - 33.4 - - I(Lonaacre et al. 1982) - 17.1 10'd as Merriams turkey Rm 13, Lev 2-4, I-56, Box 60, 02824 TU1108 P:14:1 Grasshopper Pueblo 1300-1400 Humerus Right Proximal - 45.1 - - I (Lonaacre et a/. 1982) 24.9 - 11.6 Great Kiva, Central Feature, Floor, Box 60, 1-82, 02797 TU1109 P:14:1 Grasshopper Pueblo 1300-1400 Humerus Right Complete 115.7 31.5 - (Lonaacre et al. 1982) 27.7 - 13.3 Rm 22 SEQ, Lev 7, 1-89, Box 55, 02845 TU1111 P:14:1 Grasshopper Pueblo 1300-1400 Humerus Right Complete 127.8 35.7 - (Lonaacre et al. 1982) - Rm 13, Lev 18 (0-120cm) I-56, Box 54,02710 TU1112 P:14:1 Grasshopper Pueblo 1300-1400 Humerus Right Proximal - 33.3 - -- (Lonaacre et al. 1982) Note: * DiG - greatest cranial diagonal width

199 Appendix B: Measurements of Gran Quivira Humeri

200 Table B1: Gran Quivira humeri measurements

Lab 10 Element Side GL(mm) Bp(mm) Bd (mm) Haplotype Sex GQ1 Humerus Right 115.2 30.3 24.5 NA F* GQ2 Humerus Right 137.7 38.1 - NA M* GQ3 Humerus Right 141.0 38.7 - NA M* GQ4 Humerus Left 111.3 28.5 22.6 NA F* GQ5 Humerus Right 137.8 38.8 28.6 NA M* GQ6 Humerus Right 116.9 32.1 24.3 NA F* GQ7 Humerus Right 117.4 31.1 23.2 NA F* GQ8 Humerus Left 105.8 28.3 22 NA F* GQ9 Humerus Right 109.5 30.8 23.6 NA F* GQ10 Humerus Right 110.0 29.8 22.8 NA F* GQ11 Humerus Right 115.1 30.3 24.3 NA F* GQ12 Humerus Right 137.7 38.1 - NA M* GQ13 Humerus Left 142.6 39.2 30.3 NA M* GQ14 Humerus Left 113.6 30.0 23.6 NA F* GQ15 Humerus Left 118.1 32.5 24.2 NA F* GQ16 Humerus Right 140.7 36.5 28.8 NA M* GQ17 Humerus Right 117.7 31.7 24.2 NA F* GQ18 Humerus Right 145.2 - 30.7 NA M* GQ19 Humerus Right 109.1 30.3 23.1 NA F* GQ20 Humerus Left 112.2 28.1 22.7 NA F* GQ21 Humerus Left 114.9 31.4 23.9 NA F* GQ22 Humerus Right 110.3 28.9 22.5 NA F* GQ23 Humerus Left 113.7 31.3 25.3 NA F* TU1049 Humerus Left 105.8 28.3 22 aHap1 F TU1054 Humerus Left 115.4 31.4 25.2 aHap1 b F TU1052* Humerus Right 125.7 34.0 25.2 aHap1 M TU1053 Humerus Right 136.6 38.6 29.3 aHap1a M TU1041 Humerus Right - 45.5 - aHap2 M

* indicates tentatively identified sex based on GL measurement, )I( indicates immature individual

201 Appendix C: PCR Amplification Results

202 Table C1 D-Ioop PCR amplifications for archaeological turkey samples

Lab 10 Primer F2/R407 (R405) Primer F315/R670 Primer F2/R261 Primer F224/R407 (R405) Primer F315/R567 Primer F411/R670 Primer F2/R156 Primer F90/R261 Primer F143/R407 (R405) PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P TU1 C118 ./ 7/24/2006 ./ F2 B067 ./ 6/16/2006 ./ F2 B063 ./ 6/16/2006 ./ F224 B065 ./ 6/16/2006 ./ F315 B064 ./ 6/16/2006 ./ F411 C128 ./ E203 ./ 12/15/2008 ./ R567 TU2 C118 X B067 ./ 6/1612006 ./ F2 B063 ./ 6/16/2006 ./ F224 B065 ./ 6/16/2006 ./ F315 B064 ./ 6/16/2006 ./ F411 C119 ./ 7/24/2006 ./ F2 E203 ./ 12/15/2008 ./ R567 7/2412006 ./ R407 0047 ./ 5/17/2007 ./ R407 TU3 0051 ./ 6/22/2007 ./ F2 0053 ./ 6/22/2007 M R670 B067 ./ 6/16/2006 ./ F2 B063 ./ 6/16/2006 ./ F224 B065 ./ 6/1 R/200R ./ F315 BOR4 ./ 6/1 R/2006 ./ F411 E045 ./ 3/5/2008 ./ R407 E203 ./ 12115/2008 ./ R567 TU4 0052 ./ 6/2212007 ./ F24 B067 X B063 X B065 ./ 6/16/2006 ./ F315 B064 ./ 6/16/2006 ./ F411 E032 ./ 2/27/2008 ./ F2 E043 ./ 2/27/2008 ./ F90 E045 ./ 3/512008 ./ F143 E203 ./ 12/15/2008 ./ R567 3/5/2008 ./ R567 TU5 0065 ./ R/22/2007 ./ F2 B067 ./ 6/16/2006 ./ F2 B063 ./ 6/16/2006 ./ F224 B065 ./ 6/16/2006 ./ F315 BOR4 ./ 6/16/2006 ./ F411 E045 ./ 3/512008 ./ R407 0065 ./ 6/22/2007 ./ R407 E203 ./ 12/15/2008 ./ R567 0066 ./ 6/2212007 ./ F2 TU6· B067 ./ 6/16/2006 ./ F2 B063 ./ 6/16/2006 ./ F224 B065 ./ 6/16/2006 of' F315 B064 ./ 6/16/2006 ./ F411 E045 of' 3/512008 M R407 E203 of' 12115/2008 ./ R567 3/5/2008 of' F143 TU7 C118 X C081 ./ 6/20/2006 of' R261 C067 of' 6/512006 of' F224 C062 of' 6/5/2006 ./ F315 COR8 ./ 6/5/2006 ./ R670 G074 ./ 4/101?009 of' F143 0047 ./ 5/17/2007 of' F2 C085 of' 6/20/2006 ./ F24 E203 of' 12/15/2008 ./ R567 TUB C119 of' 7/2412007 ./ F2 C081 ./ 6/20/2006 C067 of' 6/512006 of' F224 C062 of' 6/5/200R of' F~15 COR8 ./ 6/5/200R ./ RR70 C085 ./ 6/20/2006 ./ R261 E203 of' 12/15/2008 of' R567 TU9 C081 X C067 X C062 X C068 X TR9 C101 X TU10 C081 X C067 X C062 X C068 X TR10 C101 X TU11 0066 of' R/22/2007 ./ F2 C081 X C067 ./ 6/512006 of' F224 C062 of' 6/5/2006 of' F315 :068 of' 6/5/2006 of' R67C E045 ./ 3/5/2008 of' F143 C085 ./ 6/20/2008 of' R261 C101 of' 7/512006 of' R407 G073 ./ 4/10/2009 of' R567 of' 3/5/2008 of' R407 TU12 C118 ./ 7/24/2006 ./ F2 C113 X C115 ./ C105 of' 7/512006 ./ F224 C120 ./ 0066 ./ 6/22/2007 of' R407 C121 ./ 8/312006 ./ R670 TR12 E171 ./ 9/24/2008 ./ F2 E172 ./ 9/24/2008 ./ R670 9/24/2008 ./ R405 TU13 C118 ./ 7/24/2006 ./ F2 C121 ./ RI::l/2006 of' RR70 C115 ./ C101 ./ 7/5/2006 ./ R407 C120 of' TU14 c 118 ./ 7/24/2006 ./ F2 C121 of' 8/312006 M R670 115 ./ 101 ./ 7/5/2006 of' R407 C120 ./ E189 ./ 10/28/2008 M F2 E190 of' 10/28/2008 of' F315 10/28/2008 of' R670 TU15 C118 ./ 7/2412006 of' F2 C121 of' 8/312006 of' R670 C115 ./ C105 ./ 7/5/2006 of' F224 C120 of' G067 of' 4/10/2009 of' F2 G068 of' 4/10/2009 of' R670 TU16 C11R of' 7/24/2006 of' F2 ( 121 of' 8/312006 of' R670 115 ./ 101 ./ 7/5/2006 of' R407 C120 of' 0065 of' 6/22/2007 of' F2 0066 ./ 6/22/2007 of' F2 6/22/2007 of' R407 TU17 C119 X C121 ./ 8/312006 ./ R670 C115 ./ 7/26/2006 ./ F2 C101 of' 7/512006 ./ R407 C120 ./ 0047 ./ 5/17/2007 M F2 0066 ./ 6/22/2007 M R407 TU1B ( 11Q X C121 X C115 X C105 ./ 7/512006 of' F224 C12C ./ E032 of' 2/27/2008 E04~ X E045 X 0047 X C120 ./ 8/312006 M R670 G071 X TR1B E194 X E195 X E198 ./ 11/26/2008 X F2 E200 ./ 11/26/2008 ./ R567 E201 of' 11/26/2008 M R670 G071 of' 4/1012009 ./ R261 E199 ./ 11/26/2008 of' F143 11/26/2008 of' R567 TU19 C119 X C121 ./ Rn/2006 ./ R670 ('115 of' 7/2R/2006 ./ F2 C101 ./ 7/512006 ./ R407 C120 of' 0047 ./ 5/17/2007 ./ F2 TU20 C119 X C121 ./ 8/312006 of' R670 C115 of' 7/26/2006 of' F2 C101 ./ 7/512006 of' R407 C120 ./ E194 of' 11/26/2009 ./ F2 E195 ./ 11/26/2009 ./ R670 TU21 C118 X C121 of' 8/3/2006 of' R670 C115 ./ 7/26/2006 of' F2 C105 ./ 7/512006 ./ F224 C120 ./ C119 X ~ , 0047 of' 5/17/2007 of' F2 ~ E189 of' 10/28/2008 of' F2 E190 ./ 10/28/2008 of' F315 ./ 10/28/2008 M R405 TU22 C118 X C122 ./ 8/3/2006 ./ R670 C117 of' 7/12/2006 of' F2 C105 ./ 7/512006 of' F224 0047 ./ 5/17/2007 M F2 C115 X

203 >

Lab 10 Primer F2/R407 (R405) Primer F315/R670 Primer F2/R261 Primer F224/R407 R405) Primer F315/R567 Primer F411/R670 Primer F2/R156 Primer F90/R261 Primer F143/R407 (R405) PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P

TU23 C119 X C122 X R670 C115 X C105 v' 7/5/2006 v' F224 E186 X G065 X E032 X E043 X E045 X 0047 X 0053 X C117 X E203 v' 15/12/2008 X R567 E205 X E187 X E204 X E206 X TU24 C119 X C122 v' 8/3/2006 v' R67° C115 v' 7/26/2006 v' F2 C101 v' 7/5/2006 v' R407 0047 v' 5/17/2007 v' F2 TU25 C119 X C113 X C115 v' 7/26/2006 v' F2 C105 v' 7/5/2006 v' F224 E045 v' 3/5/2008 M F143 0052 X C122 v' 8/3/2006 v' R670 3/5/2008 v' R407 TU26 C119 v' 7/24/2007 v' F2 C113 v' C115 v' C105 v' 7/5/2006 v' F224 C120 v' 0066 v' 6/22/2007 v' R407 C121 v' 8/3/2006 v' R670 TU27 0101 X 10/31/2007 0102 X 0104 X 10105 v' 10/31/2007 v' F224 0109 v' 10/31/2007 v' R567 G065 X D118 X 0119 X 0120 v' 11/14/2007 v' R407 0108 X 0105 v' 10/31/2007 X R407 E205 v' 12/15/2008 v' F2 G071 v' 4/10/2009 v' R261 E206 v' 12/15/2008 v' R405 TU28 C118 X C122 X C115 X C105 v' 7/5/2006 v' F224 E186 v' 10/14/2008 v' R567 G065 v' 4/14/2009 v' R670 E032 v' 2/27/2008 v' F2 E043 X E045 v' 3/5/2008 v' F143 0047 X C113 X C117 X G071 X 3/5/2008 v' R407 0052 X TU29 C118 X C122 v' 8/3/2006 v' R670 Ie 115 v' 7/26/2006 v' F2 IC101 v' 7/5/2006 v' R407 G073 v' 4/10/2009 v' F315 E032 v' 2/?7/2008 v' F2 E043 X 0047 v' 5/17/2007 v' F2 • 0052 X TU30 C119 v' 7/24/2007 M F2 C113 X C115 v' C105 v' 7/5/2006 v' F224 C120 v' C121 v' 8/3/2006 v' R670 TU31 C119 v' 7/24/2007 v' F2 C121 v' 8/3/2006 v' R670 C115 v' C101 X C120 v' C119 v' 7/24/2007 v' R407 0047 v' 5/17/2007 v' F2

TU32 C118 X C122 v' 8/3/2006 v' R670 C115 v' 7/26/2006 v' F2 C101 v' 7/5/2006 v' R407 0047 v' 5/17/2007 v' F2

TU33 ( 11R X (122 X ("'117 v' 7/12/2006 v' F2 IC105 v' 7/5/2006 v' F224 IG073 v' 4/10/2009 v' R567 G070 v' 4/10/2009 v' F2 C119 X 0053 v' 6/1/2007 M R670 0052 X TR33 E194 X E195 v' 11/26/2008 v' R670 E198 v' 11/26/2008 v' F2 E200 v' 11/26/2008 v' R567 E201 v' 11/26/2008 v' F411 G070 v' 4/10/2009 v' F2 E199 v' 11/26/2008 v' F143 G073 v' 4/10/2009 v' F315 11/26/2008 v' R405 TU34 00~4 v' 4/25/2007 M F2 0035 v' 4/25/2007 v' R670 TU35 0034 X 0035 X 0045 X In046 v' 4/25/2007 v' R407 E186 v' 10/14/?008 v' R567 1(,;065 X E032 v' 2/27/2008 v' F2 E043 X E045 v' 3/5/200R v' F143 0044 X G071 X 3/5/2008 v' R405 TU36 0034 v' 4/25/2007 v' F2 0035 v' 4/25/2007 v' R670 G067 v' 4/10/2009 v' F2 G068 v' 4/10/2009 v' R670 7 v' F2 nO'! v' 4/ 107 v' ;7 I TTU3'I D~14I;1 4 v' 2t (7 v' v' v' ;7 G_ 17 v' fr±; v' 7 TU40 C12B v' 10/18720)6 F2 v' C132 v' 1 /1 /2~ R67 ,('129 v' TU41 00~4 v' 4/25/2007 M F2 0035 v' 4/25/2007 v' R670 G067 v' 4/10/2009 v' F2 G068 v' 4/10/2009 v' R670 TU42 C128 v' 10/18/2006 F2 v' C132 v' 10/18/2006 v' R670 C129 v' 0121 v' 11/27/2007 F2 M 0122 X TU43 0043 X 0043 X E204 v' 12/15/200R v' F2 n046 v' 4/?5/2007 v' R407 E032 X E043 X E045 v' 3/512008 v' F14~ 0052 X 0053 X E205 v' 12/15/2008 v' F2 v' R407 0044 X 0035 v' 4/25/2007 v' R670 TU44 C118 X C121 X C117 X 105 v' 7/5/2006 v' F224 C120 v' 7/5/2006 v' R567 G065 v' 4/14/2009 v' R670 E032 v' 2/27/2008 F2 E043 X E045 X C119 X C122 X E204 X G071 X E206 X 0047 X G074 v' 4/10/2009 v' F143 4/10/2009 v' R405 TR44 E194 X E195 X E198 X E200 X E201 X G071 X E198 X E204 X G065 X E206 X TU45 C118 X C121 v' 8/3/2006 v' R670 C117 v' 7/12/2006 v' F2 C114 v' 7/5/2006 v' F224 0047 v' 5/17/2007 v' F2 ~C TU46 C119 X C121 X 117 X IC114 v' 7/5/2006 v' F224 E186 v' 10/14/2008 v' R567 G065 X E032 v' 2/27/2008 v' F2 E043 X E045 v' 3/5/2008 v' F143 0047 X C122 X G071 X 3/5/2008 v' R407 0053 X G074 X TU47 C119 X C117 v' 7/12/2006 v' F2 C114 v' 7/5/2006 M F224 E186 v' 10/14/2008 v' R567 G065 v' 4/14/2009 v' R670 E045 v' 3/5/2008 v' R407 E187 v' 10/14/2009 v' F143 204 Lab ID Primer F2/R407 (R405) Primer F315/R670 Primer F2/R261 Primer F224/R407 R405) Primer F315/R567 Primer F411/R670 Primer F2/R156 Primer F90/R261 Primer F143/R407 (R405f PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P peR A Seq Q P TU48 C118 ./ 7/24/2006 ./ F2 C121 ./ 8/312006 ./ R670 C117 ./ 7/12/2006 ./ F2 C114 ./ 7/512006 ./ F224 C120 ./ D066 ./ 6/22/2007 M R407 E190 ./ 10/28/2008 ./ F315 E189 ./ 10/28/2008 ./ R405 TU49 C122 X C117 X C114 X TU50 C119 X (122 X C117 X C114 ./ 7/512006 ./ F224 E186 X E032 ./ 2/27/2008 ./ F2 E043 X E045 ./ 3/512008 ./ R407 D047 X E203 ./ 12/15/2008 ./ F315 G065 X G071 X TU51 C119 ./ 7/2412006 ./ F2 C121 ./ 17 ./ F2 r.114 ./ ./IF??4 r.1?0 ./ TU52 C118 X C122 ./ 8/3/2006 ./ R670 C117 X C114 ./ 7/5/2006 ./ F224 E032 ./ 2/27/2008 E043 ./ 2/27/2008 ./ F90 E045 ./ 3/512008 ./ D047 X G071 ./ 4/10/2009 ./ R261 TU53 C119 ./ 7/24/2006 ./ F2 C121 ./ 8/312006 X R670 C117 ./ 7/12/2006 ./ F2 C105 ./ 7/512006 ./ F224 E186 ./ 10/14/2008 ./ R567 G065 ./ 4/14/2009 ./ R670 TU54 D052 ./ 6/112007 ./ F24 C121 ./ 8/3/2006 ./ R670 117 ./ 7/12/2006 ./ F2 C105 ./ 7/512006 M F224 C120 ./ C119 ./ 7/24/2006 ./ F2 TU55 D034 ./ 4/25/2007 ./ F2 D035 ./ 4/25/2007 ./ R670 TU56 E054 ./ 3/13/2008 ./ F2 E055 ./ ./ 'Rf>7n TU57 E054 ./ 3/13/2008 ./ F2 E055 ./ 3/13/2008 ./ R670

TU58 D034 ./ 4/25/2007 ./ F2 D035 ./ 4/25/2007 ./ R670 TU59 D034 X D035 ./ 4/25/2007 ./ R670 D045 X D046 X E032 X E043 X E045 ./ 3/5/200R ./ R407 D052 X E204 ./ 12/15/2008 ./ F2 E205 ./ G074 ./ 4/1012009 ./ F143 D044 X TU60 D133 X D134 X D136 X D138 X E032 X E043 X D137 X D162 X D164 X D163 X E204 X E206 X TR60 D151 X D152 X E003 X G070 X G071 X E004 X E189 X E190 ./ 10/28/2008 ./ R670 E204 X E045 X E206 ./ 12/15/2008 ./ F143 ./ 12/15/2008 ./ R407 TU61 E026 X E026 X D136 X E189 X E190 X TU62 D133 X D134 X D162 X D138 X E032 X E043 X D137 X D163 X TR62 D151 X D152 X E003 X D164 X E004 X E045 X TU63 EO?6 ./ 2/1512008 ./ F2 E026 ./ L, :">/. UUll ./ R670 TU64 D133 X D134 ./ 12/5/2007 X F:'l15 D136 ./ 12/11/2007 ./ F2 D138 X G065 X E032 ./ 2/2712008 E043 X D137 ./ 12/11/2007 ./ F143 D134 ./ 12/512007 X R670 TR64 D151 X G065 ./ 4/14/2009 ./ R670 E032 ./ 1/912008 ./ F2 D152 ./ 9/1/2007 ./ R670 TU65 E054 ./ 3/13/2008 ./ F2 E055 ./ 3/13/2008 ./ R670 G067 ./ 4/10/2009 ./ F2 G068 ./ 4/10/2009 ./ R670 TU66 r.1?R ./ ./ F2 C1:'l? ./ ./ IR67C TU67 E054 ./ 3/13/2008 ./ F2 E055 ./ 3/13/2008 ./ R670 TU68 E054 ./ 3/13/2008 ./ F2 E055 ./ 3/13/2008 ./ R670 TU69 E054 ./ 3/13/2008 ./ n"" ./ R670 TU70 D034 ./ 4/25/2007 ./ F2 D035 ./ 4/25/2007 ./ R670 E065 ./ 4/21/2008 ./ F2 TU71 E065 ./ 4/21/2008 ./ F2 E203 ./ 12/15/?008 ./ F315 G065 ./ 4/1412009 ./ R670 E066 ./ 4/21/2008 ./ R407 TU72 EOf>5 ./ 4/21/2008 ./ F2 E203 ./ 12/1 ./ 4114/2009 ./ R670 EOfl6 ./ 4/21/2008 M R407 TU73 D133 X D134 X D136 X D138 ./ 12/11/2007 ./ R315 D137 X D138 ./ 12/11/2007 ./ R567 TR73 D151 ./ 9/1/2007 ./ F2 D152 ./ 9/1/2007 ./ R670 G067 ./ 4/10/2009 ./ F2 G068 ./ 4/10/2009 ./ R670 TU74 DO:'l4 ./ 4/25/2007 ./ F2 D035 ./ 4/25/2007 ./ R670 TU75 D034 ./ 4/25/2007 ./ F2 D035 ./ 4/25/2007 ./ Rfl70 G067 ./ 4/10/2009 ./ F2 G068 ./ ./ R670 TU76 ~ ./ RI ;70 TU77 C ./ 10/1 ./ ~ ./ RI ;70 ~. TU78 ~F Fi iii?l15/2008 ./ R 70 TU79 E054 X E055 X G065 ./ 4/14/2009 ./ R670 T,,"n ./ F2 E055 ./ ./ R670 TU81 E026 ./ 2/15/2008 ./ F2 E027 ./ 2/15/2008 ./ R670 TU82 C128 ./ 10/18/2006 M F2 C132 ./ 10/18/2006 ./ R670 205 Lab 10 Primer F2/R407 (R405) Primer F315/R670 Primer F2/R261 Primer F224/R407 R405) Primer F315/R567 Primer F411/R670 Primer F2/R156 Primer F90/R261 Primer F143/R407 (R405) PCR A Seq Q P PCR A Seq Q P peR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P G067 ./ 4/10/2009 ./ F2 G068 ./ 4/10/2009 ./ R670 TU83 E054 ./ 3/13/2008 ./ F2 E055 ./ 3/13/2008 ./ R670 TU84 E026 ./ 2/15/2008 M F2 E027 ./ 2/15/2008 ./ R670 r,r70 ./ 4/10/2009 ./ F2 TU85 0034 ./ 4/25/2007 ./ F2 0035 ./ 4/25/2007 ./ R67( TU86 EOR~ ./ 4/21/?008 ./ F2 E203 ./ 12/15/2008 ./ F31~ r,065 ./ 4/14/2009 ./ R670 EORn ./ 4/21/200fl ./ R407 TU87 0034 X 0035 X 0045 X 0046 X 0044 X TU88 C128 ./ 10/18/2006 ./ F2 C132 ./ 10/18/2006 ./ R670 0047 ./ 5/17/2007 ./ R407 TU89 0034 ./ 4/25/2007 ./ F2 0035 ./ 4/25/2007 ./ R670 TU90 ( 128 ./ 10/18/2006 ./ F2 C132 ./ 10/18/2006 ./ R670 TU91 0034 X 0035 X 0045 X 0046 ./ 4/25/2007 ./ R407 E186 ./ 10/14/2008 ./ R567 G065 ./ 4/14/2009 ./ R670 E032 ./ 2/27/2008 ./ F2 E043 X E045 ./ 3/~/200fl ./ F143 0052 X 0053 X E204 ./ 15/12/2008 ./ F2 G070 ./ 4/10/2009 ./ F2 3/5/2008 ./ R407 0044 X G070 ./ 4/10/2009 ./ F2 TU92 0034 ./ 4/25/2007 ./ F2 0035 ./ 4/25/2007 ./ R670 TU93 0034 ./ 4/25/2007 ./ F2 0035 ./ 4/25/2007 ./ R670 E189 ./ 10/28/2008 ./ R405 E190 ./ 10/28/2008 ./ F315 TU94 0034 ./ 4/2~/?007 ./ F2 0035 ./ 4/25/2007 ./ R670 TU95 C119 X C122 X C117 X C101 ./ 7/5/2006 ./ R407 E186 X E032 ./ 2/27/2008 ./ F2 E043 X E045 X 0047 X 0053 X E204 X E203 ./ 12/15/2008 ./ E205 ./ 12/15/2008 ./ F2 E187 X TU96 C118 ./ 7/24/2006 ./ F2 C121 X C117 ./ 7/12/2006 ./ F2 C114 ./ 7/5/2006 ./ F224 C120 ./ C122 ./ 8/3/2006 ./ R670 TU97 OOfl4 X 0108 X 0109 ./ 10/31/2007 ./ R567 G065 X E012 ./ 2/27/2008 ./ F2 E043 X 0137 ./ 12/11/2007 ./ F143 0136 X 0138 X G071 ./ 4/10/2009 ./ R261 0137 ./ 12/11/2007 ./ R407 TU101 C128 ./ 10/18/2006 ./ F2 C132 ./ 10/18/2006 ./ R670 ~??A TU102 C11f:l ./ ~4/: III ./ F2 C121 ./ 8/3/2006 ./ R670 C117 ./ 7/12/2006 ./ F2 C114 ./ 7/5/2006 ./ r120 ./ TU105 E171 ./ 24/9/2008 ./ F2 E172 ./ 24/9/2008 ./ R670 TU106 C128 ./ 10/1 fl/2006 ./ F2 C132 ./ 10/18/2006 ./ R670

TU107 0121 ./ 11/27/2007 M F2 0122 ./ 11/27/2007 ./ R670 E189 ./ 10/28/2008 ./ F2 E190 ./ 10/28/2008 ./ R670 TU111 0084 X 0108 X 0109 X G065 X E205 ./ 12/15/2008 ./ F2 G071 ./ 4/10/2009 ./ R261 0137 ./ 12/11/2007 ./ F143 0136 X 0138 X 0137 ./ 12/11/2007 ./ R407 E186 ./ 10/14/2008 ./ R567 TU112 C1?R ./ ./ F2 C132 ./ 1 ./ IRR70 TU113 0034 ./ 4/25/2007 ./ F2 0035 ./ 4/25/2007 ./ R670 TU114 0084 ./ 8/8/2007 ./ F2 E186 ./ 10/14/2008 ./ R567 G065 ./ 4/14/2009 ./ R67( TU115 C118 X C122 ./ 8/3/2006 ./ R670 C117 ./ 7/12/2006 ./ F2 C114 ./ 7/5/2006 M F224 C120 ./ E045 ./ 3/5/2008 ./ R407 0052 X 0084 ./ 8/8/2007 ./ F2 G067 ./ 4/10/2009 ./ F2 G068 ./ 4/10/2009 ./ R670 TU116 C11fl ./ 7/24/2006 ./ F2 C121 ./ 8/3/2006 ./ R670 Ir117 ./ 7/12/2006 ./ F2 C114 ./ 7/5/2006 ./ F224 TU117 E171 ./ 24/9/2008 ./ F2 E172 ./ 24/9/2008 ./ R670 TU119 0051 ./ 6/1/2007 ./ F2 0053 ./ 6/1/2007 ./ R670 0101 ./ 10/31/2005 ./ R407 0102 ./ 10/31/2005 ./ F315 TU120 00~1 X 0053 ./ 5/31/2007 M R670 0105 ./ 10/31/2007 ./ F224 IG065 ./ 4/14/2009 ./ R670 0076 X 0102 X 0077 ./ 7/15/2007 ./ R407 0101 X 0084 ./ 8/8/2007 ./ F2 TU121 0051 X 5/31/2007 0053 ./ 5/31/2007 X R670 0104 ./ 10/31/2007 ./ R261 0105 ./ 10/31/2007 ./ F224 G065 ./ 4/14/2009 ./ R670 0076 ./ 7/15/2007 ./ F2 0102 ./ 10/31/2005 M R670 0077 ./ 7/15/2007 ./ R407 0101 X E189 ./ 10/28/2008 ./ E190 ./ 10/28/2008 ./ F315 10/28/2008 ./ R670 TU123 0051 ./ 6/1/2007 ./ F2 0053 ./ 6/1/2007 ./ R670 0101 ./ 10/31/2007 ./ R407 0102 ./ 10/31/2005 ./ F315 TU124 0051 ./ 6/1/2007 ./ F2 0053 ./ 6/1/2007 ./ R670 0101 ./ 10/31/2005 X R407 0102 ./ 10/31/2005 ./ F315 TU125 0051 ./ 6/1/2007 ./ F2 0053 ./ 6/1/2007 ./ R670 0101 ./ 10/31/2005 ./ R407 0102 ./ 10/31/2005 ./ F315 TU126 0051 ./ 6/1/2007 ./ F2 0053 ./ 6/1/2007 ./ R670 206 -

Lab 10 Primer F2/R407 (R405) Primer F315/R670 Primer F2/R261 Primer F224/R407 R405) Primer F315/R567 Primer F411/R670 Primer F2/R156 Primer F90/R261 Primer F143/R407 (R405) PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P 0101 .,/ 10/31/2007 .,/ R407 0102 .,/ 10/31/2005 .,/ F315 TU127 0068 X 0069 X 0076 X 0077 .,/ 7/15/2007 .,/ R407 0101 .,/ 10/31/2007 .,/ F2 0102 .,/ 10/31/2005 .,/ R670 E189 .,/ 10/28/2008 .,/ R405 E190 .,/ 10/28/2008 .,/ F315 TR127 E194 .,/ 11/26/2008 .,/ E195 .,/ 11/26/2008 .,/ R670 TU128 0068 X 0069 .,/ 6/5/2007 .,/ R670 0076 X 0102 X 0077 .,/ 7/15/2007 .,/ R407 0101 .,/ 10/31/2007 .,/ F2 0084 .,/ 8/8/2007 .,/ F2 0084 .,/ 8/8/2007 .,/ R407 TU129 0068 X 006~ X 0077 X E032 X E043 X E04n X 0076 X 0101 X 0102 X TU130 0068 X 0069 X 0077 .,/ 7/15/2007 .,/ R407 E187 .,/ 10/14/2009 .,/ F143 0076 .,/ 7/15/2007 .,/ F2 0084 .,/ 8/812007 .,/ R407 TR13Q. 0084 .,/ 8/8/2007 .,/ F2 0102 .,/ 10/31/2005 .,/ R670 0101 .,/ 10/31/2007 .,/ F2 TU131 0068 X 0069 .,/ 6/5/2007 X R670 0076 X 0077 .,/ 7/15/2007 .,/ R407 0101 X 0102 .,/ 10/31/2007 .,/ R670 0104 .,/ 10/31/2005 .,/ F2 0105 .,/ 10/31/2007 .,/ R407 E189 .,/ 10/28/2008 .,/ F2 E190 .,/ 10/28/2008 .,/ R670

TR131 E194 .,/ 11/26/2008 .,/ E195 .,/ 11/26/2008 .,/ R670 TU132 0068 X 0069 X 0105 .,/ 10/31/2005 .,/ F224 E186 .,/ 10/14/2008 .,/ R567 G065 X E032 .,/ 2/27/2008 .,/ F2 E043 X E046 .,/ 3/512008 .,/ F143 0076 X 0077 .,/ 7/15/2007 .,/ R407 G071 X 3/512008 .,/ R407 0101 X 0102 X

TU133 0068 X 0069 .,/ 6/5/2007 .,/ R670 0077 .,/ 7/15/2007 .,/ R407 0076 .,/ 7/15/2007 .,/ F2 0101 .,/ 10/31/2007 .,/ F2 0102 X

TU134 0068 X 0069 X 0105 .,/ 101::l1/2005 .,/ R407 E186 .,/ 10/14/2008 .,/ R567 G065 X E032 .,/ 2/27/2008 .,/ F2 E043 X E046 .,/ 3/512008 .,/ F143 0076 X 0077 .,/ 7/15/2007 .,/ R407 3/512008 .,/ R407 TU135 00n8 X 0069 X 0077 .,/ 7/15/2007 .,/ R407 E186 .,/ 10/14/2008 .,/IR567 E187 .,/ 10/14/200~ .,/ F143 0076 .,/ 7/15/2007 .,/ F2 E190 .,/ 10/28/2008 .,/ R670 0084 .,/ 8/812007 .,/ F2 0084 .,/ 8/8/2007 .,/ R407 E189 .,/ 10/28/2008 .,/ F2 TR135 E189 .,/ 10/28/2008 .,/ R407 E190 .,/ 10/28/2008 M F315 E186 .,/ 10/14/2008 .,/ F315 0133 .,/ 12/512007 .,/ F2 0134 .,/ 12/5/2007 .,/ F315 0133 .,/ 12/5/2007 .,/ R407 0134 .,/ 12/5/2007 X R670 TU136 E065 .,/ 4/21/2008 X F2 0064 X E203 .,/ 12/15/2008 X R567 G065 X E084 X .,/ 4/2112008 X R407 E081 X E083 X E206 X E080 X TU137 EOn!> .,/ 4/21/2008 X F2 0064 .,/ 4/21/2008 .,/ F224 E080 .,/ 5/12/2008 .,/ F2 E081 .,/ 5/12/2008 .,/ R670 TU138 E065 X E066 .,/ 4/21/2008 .,/ F143 E080 .,/ 5/12/2008 .,/ F2 E081 .,/ 5/12/2008 .,/ R670 4/21/2008 X R407 TU139 E065 .,/ 4/21/2008 .,/ F2 E081 X IF?03 .,/ "/11- 0 E066 .,/ 4/21/2008 X R407 E080 X TU140 E065 .,/ 4/21/2008 .,/ F2 0064 .,/ 4/21/2008 .,/ F224 E066 .,/ 4/21/2008 X R407 E080 .,/ 5/12/2008 .,/ F2 E081 .,/ 5/12/2008 .,/ R670 TU141 E065 X E066 .,/ 4/21/2008 .,/ R407 E080 .,/ 5/12/2008 .,/ F2 E081 .,/ 5/12/2008 .,/ R670 E189 .,/ 10/28/2008 .,/ F2 E190 .,/ 10/28/2008 .,/ F315 ~ , 10/28/2008 .,/ R405 TU142 E065 X 0064 X E06fi X

TU147 E194 X E195 X E198 X E200 X E201 X E198 X

207 Lab 10 Primer F2/R407 (R405) Primer F315/R670 Primer F2/R261 Primer F224/R407 R405) Primer F315/R567 Primer F411/R670 Primer F2/R156 Primer F90/R261 Primer F143/R407 (R405) PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P TU148 E194 X E195 X E198 X E200 X E201 X E198 X

TU149 E194 X E195 X E198 X E200 X E201 X E198 X

TU150 E194 X E195 X E198 X E200 X E201 X E198 X

TU151 E194 X E195 X E198 X E200 X E201 X E198 X

TU152 E194 ./ 11/26/2008 ./ F2 E195 ./ 11/26/2008 ./ R670 G043 ./ 3/12/2009 ./ F2 G044 ./ 3/12/2009 ./ R670 TU1001 E08D X E081 X E083 X E084 X TU1003 E012 X E013 ./ 1/30/2008 ./ R67C E018 X G073 ./ 4/10/2009 ./ R567 G066 ./ ED33 X E044 ./ 2/27/2008 ./ F90 E019 X E026 X E027 X 2/27/2008 ./ F224 E046 ./ 3/5/2008 ./ F143 3/5/2008 ./ R407 TR1003 E194 ./ 11/26/2008 ./ F2 E195 ./ 11/26/2008 ./ R670 G073 ./ 4/10/2009 ./ F315 G066 ./ TU1004 E080 ./ 5/12/2008 ./ F2 E081 ./ 5/12/2008 ./ R670 TR1004 E194 X E195 ./ 11/26/2008 ./ R670 E198 ./ 11/26/2008 ./ F2 E200 ./ 11/26/2008 ./ R567 E201 ./ E199 ./ 11/26/2008 ./ F143 11/26/2008 ./ R407 TU1009 0121 ./ 11/27/2007 ./ F2 0122 ./ 11/27/2007 X R670 0128 ./ 11/27/2007 ./ R567 0139 ./ 12/11/2007 ./ R407 0140 ./ 12/11/2007 ./ F315 E012 ./ 1/30/2008 ./ R407 TU1010 0121 ./ 11/27/2007 ./ F2 0122 ./ 11/27/2007 ./ Rfl70 10128 ./ 11/27/2007 ./ R567 TU1015 E012 X E013 X E018 X E033 X E044 X E019 X TU1017 0133 X 0134 X Onfl ./ 12/11/2007 ./ F2 0138 X G065 ./ 4/14/2009 ./ R670 G071 X 0137 ./ 12/11/2007 ./ F143 0136 ./ 12/11/2007 ./ R261 G066 ./ G074 ./ 4/10/2009 ./ R405 TR1017 0151 X 0152 X 0164 ./ 1/9/2008 ./ R567 G065 X 0164 ./ 1/9/2008 ./ F315 G066 X TU1018 E080 X E081 X E083 X E084 X TU1019 E080 ./ 5/12/2008 ./ F2 E081 ./ fi/12/2008 ./ R670 E189 ./ 10/28/2008 ./ R405 E190 ./ 10/28/2008 ./ F315 10/28/2008 ./ R670 TU1020 E080 ./ 5/12/2008 ./ F2 E081 ./ 5/12/2008 ./ R670 G073 ./ 4/10/2009 ./ F315 G067 ./ 4/10/2009 ./ F2 G068 X 4/10/2009 ./ R567 TU1022 0121 ./ 11/27/2007 ./ F2 0122 ./ 11/27/2007 ./ R670 TU1026 0121 X 0122 X 0126 X 0128 ./ 11/27/2007 ./ Rfifl7 1(:;065 X E033 ./ 2/27/2008 ./ F2 E044 X 0127 X E186 ./ 10/14/2008 X R567 G071 X E046 X E223 ./ 1/15/2008 ./ R567 E187 ./ 10/14/2009 ./ F143 1/15/2008 ./ F315 10/14/2009 ./ R407 TU1033 0121 X 0122 ./ 11/27/2007 ./ R670 0126 X E223 ./ 1/15/2008 ./ R567 E033 ./ 2/27/2008 ./ F2 E044 ./ 2/27/2008 ./ F90 0127 ./ 11/27/2007 ./ F143 1/15/2008 ./ F315 G071 ./ 4/10/2009 ./ R261 0127 ./ 11/27/2007 ./ R407 G002 1/15/2008 ./ R567 TU1034 0121 X 0122 X 0126 X 0128 ./ 11/27/2007 ./ R567 0127 ./ 11/27/2007 ./ R407 TR1034 E012 ./ 1/30/2008 ./ F2 E013 ./ 1/30/2008 ./ R670 E018 X E019 ./ 1/30/2008 ./ F143 E019 ./ 1/30/2008 ./ R407 TU1036 0133 X 0134 X 0136 X 0138 X E033 X E044 X 0137 X E046 X TR1036 0151 X 0152 X 0162 X 0164 X 0163 X E003 X E004 X E046 X TU1037 E012 ./ 1/30/2008 ./ F2 E013 ./ 1/30/2008 ./ R670 TU1038 0133 X 0134 X 0136 X 0138 X G065 X E044 X 0137 X E186 X E203 X TR1038 0151 X 0152 X 0162 X G069 X 0164 X G065 X E033 ./ 2/27/2008 ./ F2 G071 X 0163 X E003 X E203 X E187 ./ 10/14/2009 ./ F143 G069 X G073 X 10/14/2009 ./ R407 E004 X E046 X TU1039 E080 X E081 ./ 5/12/2008 ./ R67D E083 ./ 5/5/2008 ./ F2 G069 ./ 4/10/2009 ./ F224 E223 ./ 1/15/2008 ./ Rfifl7 E084 X E083 ./ 5/5/2008 ./ R261 4/10/2009 ./ R405 1/15/2008 ./ F315 E187 X G069 ./ 4/10/2009 ./ F224 G002 ./ 1/15/2008 ./ R567 E206 ./ 12/15/2008 X F143 4/10/2009 ./ R405 G074 ./ 4/10/2009 ./ R405 208 Lab 10 Primer F2/R407 (R405) Primer F315/R670 Primer F2/R261 Primer F224/R407 (R405) Primer F315/R567 Primer F411/R670 Primer F2/R156 Primer F90/R261 Primer F143/R407 (R405) PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P G074 ./ 4/10/2009 ./ F143 TU1041 0121 ./ 11/27/2007 ./ F2 0122 X 0128 ./ 11/27/2007 ./ R567 E189 ./ 10/28/2008 ./ R405 E190 ./ 10/28/2008 ./ F315 TU1049 0121 X 0122 X 0126 X 0128 ./ 11/27/2007 ./ R567 E033 ./ 2/2712008 ./ E044 ./ 2/27/2008 ./ F90 0127 ./ 11/27/2007 ./ R407 11/27/2007 ./ F143 TR1049 E194 ./ 11/26/2008 ./ F2 E195 ./ 11/26/2008 ./ R670 TU1052 E012 ./ 1/3012008 ./ F2 E013 ./ 1/30/2008 ./ R670 TU1053 0121 ./ 11/27/2007 M F2 0122 X 0128 ./ 11/27/2007 ./ R567 0128 ./ 11/27/2007 ./ F315 TR1053 E194 ./ 11/26/2008 ./ F2 E195 ./ 11/26/2008 ./ R670 TU1054 0121 ./ 11/27/2007 ./ F2 0122 ./ 11/27/2007 ./ RR70 1r,074 ./ 4/1012009 ./ F143 TR1054 E194 ./ 11/26/2008 ./ E195 ./ 11/26/2008 ./ G074 ./ 4/1012009 ./ F143 TU1055 0133 X 0134 X 0136 X 0138 X G070 X G071 X 0137 X 0151 ./ 9/112007 ./ F2 0152 ./ 9/1/2007 ./ R670 G074 X TR1055 0151 X 0152 X G070 ./ 4/10/2009 ./ F2 G071 ./ 4/10/2009 ./ R261 0163 ./ 9/112007 ./ F143 E189 ./ 10/28/2008 ./ F2 E190 ./ 10/28/2008 ./ R670 G074 ./ 4/10/2009 ./ R405 10/28/2008 ./ R405 10/28/2008 ./ F315 TU10S7 E012 ./ 1/30/2008 ./ F2 E013 ./ 1/30/2008 ./ R670 TU1059 0121 X 0122 X 0126 X 0128 ./ 11/27/2007 ./ R567 G065 X E033 X E044 X 0127 X E204 ./ 12/15/2008 ./ F2 0128 ./ 11/27/2007 ./ F315 E205 X E206 ./ 12/15/2008 ./ F143 12/15/2008 M R407 TR1059 0151 X 0152 X 0162 X 0164 X G065 X 0163 X E204 X E205 ./ 12/15/2008 ./ F2 E004 X E204 X E046 X TU1061 0133 X 0134 X 0136 X 0138 X G065 X 0137 ./ 12/11/2007 ./ F143 E189 X E190 X E203 X 0137 ./ 12/11/2007 ./ R407 TR1061 0151 ./ 9/1/2007 ./ F2 0152 ./ 9/1/2007 ./ R670 E203 ./ 12/15/2008 ./ F315 G065 ./ 4/1412009 ./ R670 12/15/2008 ./ R567 TU1062 E012 ./ 1/3012008 ./ F2 E011 ./ 1/30/2008 ./ R670 TU1063 0121 X 0122 X 0126 ./ 11/27/2007 ./ F2 0128 X G065 ./ 4/1412009 ./ R670 0127 ./ 11/27/2007 ./ F143 0126 ./ 11/27/2007 ./ R261 E203 ./ 12/15/2008 ./ F315 0127 ./ 11/27/2007 ./ R407 E223 ./ 1/1512008 ./ F315 1/15/2008 ./ R567 TR1063 E194 X E195 X E198 X E200 X E201 X E199 ./ 11/26/2008 X F143 E203 ./ 12/15/2008 ./ G06" ./ 4/1412009 ./ R670 E223 ./ 1/15/2008 ./ F315 1/15/2008 ./ R567 TU1064 E080 X E081 ./ 5/1212008 ./ R670 E083 ./ 5/5/2008 ./ F2 E084 ./ 5/5/2008 ./ F143 G067 ./ 4/10/2009 ./ F2 G068 ./ 4/10/2009 ./ R670 E084 ./ 5/512008 ./ R405 TU1066 E080 ./ 5/12/2008 ./ F2 E081 ./ 5/12/2008 ./ R670 TR1066 E194 X E195 X E198 X E200 ./ 11/26/2008 ./ R567 E201 ./ 11/26/2008 ./ R670 E199 ./ 11/26/2008 ./ F143 TU1067 E012 ./ 1/3012008 ./ F2 E013 ./ 1/30/?OOR ./ RR70 TU1069 0121 ./ 11/27/2007 ./ F2 0122 ./ 11/27/2007 ./ R670 TU1070 0121 X 0122 X 0126 X 0128 ./ 11/27/2007 ./ R567 G065 ./ 4/1412009 ./ R670 E033 ./ 2/27/2008 ./ F2 E044 ./ 2/27/2008 ./ F90 0127 X E186 ./ 10/14/2008 ./ R567 G071 ./ 4/1012009 ./ R261 E187 ./ 10/14/2009 ./ F143 TU1072 E080 X E081 ./ 5/1212008 ./ R670 E083 ./ 5/512008 ./ F2 E084 ./ 5/5/2008 ./ F143 E189 X E190 ./ 10/28/2008 ./ R670 E084 ./ 5/512008 ./ R405 TU1078 On9 ./ 12111/2007 ./ F2 0140 ./ 12/11/2007 ./ R670 TU1079 0101 X 0102 ./ 10/31/2007 ./ R670 0104 ./ 10/31/2007 ./ F2 0105 ./ 10/31/2007 ./ F224 0109 ./ 10/31/2007 ./ R567 0118 ./ 11/14/2007 ./ R156 0119 ./ 11/14/2007 ./ R261 0120 ./ 11/14/2007 ./ R407 0104 ./ 10/31/2007 ./ R261 0105 ./ 10/31/2007 X R407 0108 ./ 10/31/2007 ./ F2 TU1083 0121 ./ 11/27/2007 ./ F2 0122 X 0128 X IG065 ./ 4/1412009 ./ R670 E186 ./ 10/14/2008 ./ R567 TU1084 0101 X 0102 X 0104 X 0105 ./ 10/31/2007 ./ F224 0109 ./ 10/31/2007 ./ R567 G065 X 0118 X 0119 X 0120 X E204 X 0105 ./ 10/31/2007 ./ R407 E033 X E044 X E046 X E205 X E187 X ~ , TU1086 0101 X 0102 X 0104 X 0105 ./ 10/31/2007 ./ F224 0109 ./ 10/31/2007 ./ R567 G065 ./ 4/1412009 ./ R670 0118 ./ 11/14/2007 ./ R156 0119 ./ 11/14/2007 ./ R261 0120 ./ 11/14/2007 ./ R407 0105 ./ 10/31/2007 ./ R407 0118 ./ 11/14/2007 ./ F2 TU1091 E080 ./ 5/1212008 ./ F2 E081 ./ 5/12/2008 ./ R670 G074 ./ 4/10/2009 ./ R405 TR1091 E194 ./ 11/26/2008 ./ E195 X E200 ./ 11/26/2008 ./ R567 E201 ./ 11/26/2008 X R670 G074 ./ 4/1012009 ./ R405 TU1093 0139 ./ 12/11/2007 ./ F2 0140 ./ 1?/111?007 ./ R670 TU1096 0139 ./ 12/11/2007 ./ F2 0140 ./ 12/11/2007 ./ R670 209 &

Lab 10 Primer F2/R407 (R405) Primer F315/R670 Primer F2/R261 Primer F224/R407 R405) Primer F315/R567 Primer F411/R670 Primer F2/R156 Primer F90/R261 Primer F143/R407 (R405) PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P PCR A Seq Q P TU1097 E012 X E013 .,/ 1/30/2008 .,/ R670 E018 X E033 .,/ 2/27/2008 .,/ F2 E044 .,/ 2/27/2008 .,/ F90 E019 .,/ 1/30/2008 .,/ F143 E026 X G071 .,/ 4/10/2009 .,/ R261 E019 .,/ 1/30/2008 .,/ R407 TU1098 E012 .,/ 1/30/2008 .,/ F2 E013 .,/ 1/30/2008 .,/ R670

TU1101 0121 .,/ 11/27/2007 .,/ F2 0122 X 0128 .,/ 11/27/2007 .,/ F315 G074 .,/ 4/10/2009 .,/ R405 0128 .,/ 11/27/2007 .,/ R567 TR1101 E194 .,/ 11/26/2008 .,/ F2 E195 .,/ 11/26/2008 .,/ R670 G074 .,/ 4/10/2009 .,/ F143 TU1102 0121 X 0122 X 0126 .,/ 11/27/2007 .,/ F2 0128 X G065 .,/ 4/14/2009 .,/ R670 0127 .,/ 11/27/2007 .,/ F143 0126 .,/ 11/27/2007 .,/ R261 E186 .,/ 10/14/2008 .,/ R567 G066 X 0127 .,/ 11/27/2007 .,/ R407 10/14/2008 .,/ F315 TU1103 01::\3 .,/ 12/5/2007 X F2 0134 X 0136 .,/ 12/11/2007 .,/ F2 0138 .,/ 12/11/2007 .,/ R567 G065 .,/ 4/14/2009 .,/ R670 0137 .,/ 12/11/2007 .,/ F143 0133 .,/ 12/5/2007 X R407 0134 X 0136 .,/ 12/11/2007 .,/ R261 G066 X TR1103 0151 X 0152 X 0164 X TU1104 0101 X 0102 X 0104 X 0105 .,/ 10/31/2007 .,/ F224 0109 .,/ 10/31/2007 .,/ R567 G066 X 0118 .,/ 11/14/2007 M R156 0119 X 0120 .,/ 11/14/2007 .,/ R407 0105 .,/ 10/31/2007 .,/ R407 G066 X 0118 .,/ 11/14/2007 .,/ F2 G071 X E046 .,/ 3/5/2008 .,/ R407 TU1105 0101 Ix 0102 X 0104 X 0105 .,/ 10/31/2007 .,/ F224 0109 .,/ 10/31/2007 M R567 G066 .,/ 4/14/2009 .,/ R670 0118 .,/ 11/14/2007 .,/ R1511 0119 X 0120 X 0105 .,/ 10/31/2007 .,/ R407 G066 X 0118 .,/ 11/14/2007 .,/ F2 G071 X E046 .,/ 3/5/2008 .,/ R407 TU1106 0133 Ix 0134 X 0136 X 0138 X E033 .,/ 2/27/200R .,/ F2 E044 X 01'17 .,/ 12/1112007 .,/ F143 E186 X G071 X 0137 .,/ 12/1112007 .,/ R407 TR1106 0151 X 0152 X 0162 X 0164 X G071 .,/ 4/10/2009 .,/ R261 E004 .,/ 1/16/2008 .,/ F143 E189 X E190 .,/ 10/28/2008 .,/ F315 E003 X E004 .,/ 1/16/2008 .,/ R407 10/28/2008 .,/ R670 TU1108 0101 X 0102 X 0104 X 0105 .,/ 10/31/2007 .,/ F224 E1811 .,/ 10/14/2008 .,/ G066 X 0118 X 0119 X 0120 X 0105 .,/ 10/31/2007 .,/ R407 E203 X G066 X E033 .,/ 2/27/2008 .,/ F2 E044 X E046 .,/ 3/5/2008 .,/ F143 G071 .,/ 4/10/2009 .,/ R261 3/5/2008 .,/ R407 TU1109 0101 X 0102 X 0104 X E033 .,/ 2/27/2008 .,/ E044 X 0120 X TR1109 0151 X 0152 X 0162 X 0164 .,/ 1/9/2008 .,/ R567 0163 X E003 X 0164 .,/ 1/9/2008 .,/ F315 E033 X E044 X E004 X TU1111 0121 X 0122 X 0126 X 0128 .,/ 11/27/2007 .,/ F315 G066 X E033 .,/ 2/27/2008 .,/ E044 X 0127 .,/ 11/27/2007 .,/ R407 0128 .,/ 11/27/2007 .,/ R567 G066 X G071 .,/ 4/10/2009 .,/ R261 TU1112 0121 X 0122 X 0126 X G069 .,/ 4/10/2009 .,/ F224 0128 ? 11/27/2007 ? R567 G066 X E033 X E044 X 0127 X 4/10/2009 .,/ R405 E203 X G066 X E205 .,/ 12/15/2008 .,/ F2 E046 X G073 X 12/15/2008 .,/ R156 G074 X TR1112 0151 X 0152 X 0162 X G069 .,/ 4/10/2009 .,/ F224 0164 .,/ 1/9/2008 .,/ R567 G066 X 0163 X E003 X 4/10/2009 .,/ R405 0164 .,/ 1/9/2008 .,/ F315 G066 X E033 X E044 .,/ 2/27/2008 .,/ F90 E004 X E203 X E205 .,/ 12/15/2008 .,/ F2 G074 X G073 X E046 X

A=PCR amplification, Q=sequencing quality, P= sequencing primer, M= messy or unclear sequence

210 Table C2 Cytb PCR amplifications for archaeological turkey samples Lab Lab Primer F215/R391 Primer F215/R391 Code Code PCR A Seq Q P PCR A Seq Q P TU2 0117 ,/ 14-Nov-07 ,/ F215 TU1001 E191 X TU4 E188 ,/ 28-0ct-08 ,/ F228 TU1003 E191 ,/ 13-Nov-08 ,/ F228 TU8 E188 ,/ 28-0ct-08 ,/ F228 TU1004 E191 ,/ 13-Nov-08 ,/ F228 TU9 E191 X TU1015 E191 X TU12 0117 ,/ 14-Nov-07 ,/ R391 TR1017 E191 ,/ 13-Nov-08 ,/ F228 TR12 E188 ,/ 28-0ct-08 ,/ F228 TU1019 E191 ,/ 13-Nov-08 ,/ F228 TU14 0117 X TU1022 E183 ,/ 28-0ct-08 ,/ F215 TU18 E191 ,/ 13-Nov-08 ,/ F228 TU1026 E191 X TU19 E188 ,/ 28-0ct-08 ,/ F215 TU1033 E192 ,/ 13-Nov-08 ,/ F228 TU21 E188 ,/ 28-0ct-08 ,/ F228 TR1036 E191 X TU31 0117 ,/ 14-Nov-07 ,/ F215 TU1041 E192 ,/ 13-Nov-08 ,/ F228 TU33 E191 ,/ 13-Nov-08 ,/ F228 TU1053 E192 ,/ 13-Nov-08 ,/ F228 TU39 0117 ,/ 14-Nov-07 ,/ R391 TU1054 E192 ,/ 13-Nov-08 ,/ F228 TU41 E191 ,/ 13-Nov-08 ,/ F228 TU1054 E183 ,/ 28-0ct-08 ,/ F228 TU44 E191 ,/ 13-Nov-08 ,/ F228 TR1055 E192 ,/ 13-Nov-08 ,/ F228 TU48 0117 ,/ 14-Nov-07 ,/ F215 TU1057 E192 ,/ 13-Nov-08 ,/ F228 TU49 E191 X TU1059 G042 ,/ 12-Mar-09 ,/ F215 TU58 0117 ,/ 14-Nov-07 ,/ R391 TR1059 E192 X TR60 E191 ,/ 13-Nov-08 X F228 TR1059 G042 X TU66 E191 X TU1061 E192 X TU75 0117 ,/ 14-Nov-07 ,/ F215 TU1061 G043 X TU87 E191 X TR1061 G042 ,/ 12-Mar-09 ,/ F215 TU89 0117 ,/ 14-Nov-07 ,/ R391 TU1063 E192 ,/ 13-Nov-08 ,/ F228 TU93 E191 ,/ 13-Nov-08 ,/ F228 TU1066 E192 ,/ 13-Nov-08 ,/ F228 TU94 0117 ,/ 14-Nov-07 ,/ F215 TU1091 E192 ,/ 13-Nov-08 ,/ F228 TU95 E191 X TU1101 E192 ,/ 13-Nov-08 ,/ F228 TU127 0117 ,/ 14-Nov-07 ,/ R391 TU1102 E192 ,/ 13-Nov-08 ,/ F228 TU127 E191 ,/ 13-Nov-08 ,/ F228 TR1106 E192 X TU129 E191 X TR1106 G043 X TU131 E191 ,/ 13-Nov-08 ,/ F228 TU1108 E192 X TU135 0117 ,/ 15-Nov-08 ,/ F215 TU1108 G043 X TU135 0117 ,/ 15-Nov-08 ,/ R391 TR1109 E192 X TU141 E191 ,/ 13-Nov-08 ,/ F228 TU1111 E192 ,/ 13-Nov-08 ,/ F228 TR143 E191 X TU1112 G043 X TU152 G042 ,/ 12-Mar-09 ,/ F215 TR1112 E192 X TR1112 G043 X A=PCR amplification, Q=sequencing quality, P= sequencing primer

211 Appendix D: Miscoding Lesions in Ancient Sequences

212 OJ -I 0 -I -I -I -I -I -I -I -I -I -I -I -I -I -I -I -I -I -I -I -I -I -I -I -I -I -I -I -I -I -I -I -I -I -I m II) c c c c c c c cccccccccccccccccccc c c c c c c C "'T1 c: ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ c..> c..> c..> I'V I'V I'V ~ -...j ~ C'" 0 ~ ~ ~ ~ 0 0 0 0 0 0 c..> c..> I'V I'V I'V I'V 01 ~ 01 ...... m 01 .... I'V CO m c..> ~ ~ 0 c..> Dl..., I'V ~ 01 c..> -...j .... 01 -...j :j C Dl

214 15570 15580 15590 15600 15610 15620 15630 15640 15650 15660 15670 I I I II II • • • 0 I.. 0 • I I I I I I I I I I I I I I EF153719 AACC TAACCCCCCT ATTGAGTGTA CCCCCCCTTT CCCCCCCAGG GGGGGTATAC TATGCATAAT CGTGCATACA TTTATATACC ACATACATTA TGGTAACGGT ACTATA aHAP1 aHAP1a aHPA1b aHAP1c ·T. aHAP1d

aHAP2 oT 0

aHAP2b oT 0 aHAP2c oT aHAP2d oT . aHAP2e mHAP1 mHAP2

15680 15690 15700 15710 15720 15730 15740 15750 15760 15770 15780 I I I I I I I I I I I II II I I I I II I EF153719 TACT ATATACGTAC TAAACCCATT ATATGTAGAC GGACATAACA ACCTTTACCC CATTTCTCCC TAATGACTAC TCCATGAAAC ATCCAATGAC ATTAACTCCT TCCTAC

aHAP1 oC 0

aHAP1a oT . ·C 0

aHPA1b ·C 0 .C 0 aHAP1c oC.

aHAP1d o T 0 oC 0 aHAP2 C.T oT aHAP2b CoT oT aHAP2c CoT aHAP2d C.T aHAP2e C.T mHAP1 mHAP2

15790 15800 15810 15820 15830 15840 15850 15860 15870 15880 15890 I II I I I I I I II II II II II II I EF153719 CCCC AACATCCATA CCAACCCTCA AGAGACCATA TACATGAATG GTTACAGGAC ATACCTCTAA ATCTTACTGT ACTTACCCCA TTTGGTTATG CTCGACGTAC C AG ATG

aHAP1 oC 0

aHAP1a .C 0

aHPA1b oC 0

aHAP1c oC 0

aHAP1d oC 0

aHAP2 oT . o C 0 oT 0

aHAP2b oT . ·T 0

aHAP2c oT . oC 0

aHAP2d .T 0 oC 0 oG. aHAP2e oT . oC. mHAP1 mHAP2

15900 15910 15920 15930 15940 15950 15960 15970 15980 15990 16000 I I I I I II I I II II II II II II EF153719 GAT T TATTGATCGT ACACCTCACG AGAGATCACC AACCCCTGCC TATAATGTAC TCTATGACTA GCTTCAGGCC CATTCTTTCC CCCTACACCC CTCGCCCTCC TTGC

aHAP1 ·C 0 aHAP1a · C. aHPA1b oC.

aHAP1c oC 0

aHAP1d oC 0

aHAP2 ·C 0 aHAP2b · C. aHAP2c · C. aHAP2d oC. ?????????? ?????????? ?????????? ?????????????? aHAP2e · C. oT . mHAP1 mHAP2 · C.

Figure E1 Multiple alignment of the amplified D-Ioop haplotypes.with M. gallopavo EF153719 as the reference sequence. The dots indicate identical base pair to the reference and the question marks represent missing data.

215 Appendix F: Comparison of Genetic Sex and Morphological Size

216 Genetic Sex 10

180.0- o Female DMaie XNA x 170.0-

0 0 160.0- x e- O E 150.0- 0 -...J 0 C) 0

140.0- x 0

130.0- 0 0

0 0 120.0-

x

110.0 I I I I I 17.5 20.0 22.5 25.0 27.5 Bd (mm)

Figure F1 Scatterplot displaying the correspondence between genetic sex and available tarsometatarsus dimensions (maximal distal breadth by greatest length)

217 Genetic Sex 10 Female 22.00- o o DMaie o XNA

x o 20.00- o

I x -"C C 18.00- 0

16.00- 0 0 0 x Ox xO 0

14.00 I I I I I I 14.0 16.0 18.0 20.0 22.0 24.0 Bd (mm)

Figure F2 Scatterplot displaying the correspondence between genetic sex and available tibiotarsus dimensions (maximal distal breadth by distal depth)

218 Figure F3 Scatterplot displaying the correspondence between genetic sex and available humeri dimensions (maximal distal breadth by greatest length)

219 Genetic Sex 10 Female 20. o ~Male DNA

15.

~ c: G) :::l C" ~ 10.0 LL

5.0

28.0 30.0 32.0 34.0 36.0 38.0 40.0 42.0 44.0 46.0 48.0 Bp (mm)

Figure F4 Histogram displaying the correspondence between genetic sex and humeri greatest proximal width measurements

220 Genetic Sex 10 DFemale 12.0 ~Male DNA

>. 8. U C Ql ~ tT ~ 6.0 LL

22.5 25.0 27.5 30.0 32.5 35.0 Bd (mm)

Figure F5 Histogram displaying the correspondence between genetic sex and humeri greatest distal width measurements

221 Appendix G: Inter- and Intra-Observer Replicability

222 Table G1 Interobserver and Intraobserver replicability results

Specimen CS1 CS2 RM INTER INTRA CS1 CS2 RM INTER INTRA CS1 CS2 RM INTER INTRA CS1 CS2 RM INTER INTRA Humerus GL GL GL (mm) % (mm) % Bp Bp BD (mm) % (mm) % Bd Bd Bd (mm) % (mm) % (mm) % (mm) % 20143R 155.0 155.0 153.5 1.5 1.0 0.0 0.0 42.0 42.7 43.3 1.3 3.1 0.7 1.7 33.8 33.7 32.9 0.9 2.7 0.1 0.3 20143L 155.0 155.0 153.0 2.0 1.3 0.0 0.0 42.8 42.4 42.9 0.1 0.2 1.6 3.7 33.8 33.8 32.7 1.1 3.3 0.0 0.0 T360R 137.0 136.5 136.5 0.5 0.4 0.5 0.4 41.7 41.4 42.5 0.8 1.9 0.3 0.7 31.5 31.6 31.1 0.4 1.3 0.1 0.3 T360L 137.4 136.5 136.5 0.9 0.7 0.9 0.7 41.3 41.2 41.6 0.3 0.7 0.1 0.2 31.6 31.8 31.5 0.1 0.3 0.2 0.6 Coracoid GL GL GL (mm) % (mm) % Bb Bb Bb (mm) % (mm) % 20143R 111.4 111.3 110.0 1.4 1.3 0.1 0.1 31.5 31.5 30.9 0.6 2.1 0.0 0.0 20143L 112.3 111.9 112.0 0.3 0.3 0.4 0.4 31.5 31.5 31.5 0.0 0.0 0.0 0.0 T360R 97.1 96.8 96.0 1.1 1.1 0.3 0.3 28.5 28.6 28.6 0.1 0.4 0.1 0.4 T360L 96.8 96.5 96.0 0.8 0.8 0.3 0.3 29.1 29.1 29.2 0.1 0.3 0.0 0.0 Femur GL GL GL (mm) % (mm) % Bp Bp BD (mm) % (mm) % Bd Bd Bd (mm) % (mm) % Dd Dd Dd (mm) % (mm) % 20143R 145.0 144.0 144.0 1.0 0.7 1.0 0.7 33.8 35.2 34.9 1.1 3.3 1.4 4.1 30.1 30.4 30.3 0.2 0.7 0.3 1.0 23.1 23.5 24.0 0.9 3.9 0.4 1.7 20143L 145.1 144.0 144.5 0.6 0.4 1.1 0.8 34.1 35.2 34.8 0.7 2.1 1.1 3.2 29.9 30.4 30.1 0.2 0.7 0.5 1.7 23.6 23.8 23.9 0.3 1.3 0.2 0.8 T360R 126.5 126.0 126.5 0.0 0.0 0.5 0.4 34.8 34.7 35.0 0.2 0.6 0.1 0.3 30.3 30.2 30.4 0.1 0.3 0.1 0.3 22.6 22.3 22.7 0.1 0.4 0.3 1.3 Tibiotarsus GL GL GL (mm) % (mm) % DiD DiD DiD (mm) % (mm) % Bd Bd Bd (mm) % (mm) % Dd Dd Dd (mm) % (mm) % 20143L 243.0 242.0 241.5 1.5 0.6 1.0 0.4 41.3 42.3 41.3 0.0 0.0 1.0 2.4 22.2 22.3 22.3 0.1 0.5 0.1 0.5 22.1 22.5 21.9 0.2 0.9 0.4 1.8 T360R 198.5 197.5 198.0 0.5 0.3 1.0 0.5 36.8 36.9 36.8 0.0 0.0 0.1 0.3 22.8 23.0 23.1 0.3 1.3 0.2 0.9 22.6 22.6 22.7 0.1 0.4 0.0 0.0 Tarsometarsus GL GL GL (mm) % (mm) % Bp BD BD (mm) % (mm) % Bd Bd Bd (mm) % (mm) % Left 167.0 167.0 167.0 0.0 0.0 0.0 0.0 24.5 24.2 23.9 0.6 2.4 0.3 1.2 25.3 25.7 25.3 0.0 0.0 0.4 1.6

Note: Bp - Maximum proximal breadth (mm); Bd - Maximam distal width (mm); Dip - Maximum Diagonal of the proximal end (mm); Dd - Distal Depth (mm); Bb - Maximum Basal breadth (mm)

223 Appendix H: Measurements of Humeri Included in Osteometric Analyses

224 Table H1 Measurements of humeri included in osteometric analyses

Genetic GL (mm) Bp(mm) Bd (mm) Haplotype LablD Side Sex z-score TU1 Left 119.4 31.1 24.4 aHap1 Female 0.14 TU2 Right 142.0 38.3 29.0 aHap2 Male -0.39 TU3 Left 118.6 31.9 - aHap1 Female -0.06 TU4 Left 118.3 31.8 25.0 aHap1 Female -0.13 TU5 Left 121.1 32.7 - aHap1 Female 0.56 TU6 Left 117.8 32.4 25.5 aHap1 Female -0.27 TU7 Right 143.6 40.0 - aHap1 Male -0.12 TU8 Left 121.8 30.8 24.5 aHap1 Female 0.74 TU9 Left 120.0 29.5 24.5 NA NAIF TU10 Right 137.7 38.1 - NA NAiM TU11 Left 113.5 - 23.8 aHap1 NAIF -1.32 TU20 Left 146.3 40.9 - aHap1 Male 0.36 TU24 Left 119.8 32.3 - aHap1 Female 0.25 TU25 Left 139.2 38.6 - aHap1 Male -0.87 TU26 Left 143.9 - 30.9 aHap1 Male -0.07 TU28 Left 119.5 32.7 26.1 aHap1* NAIF 0.16 TU29 Left 139.5 38.7 - aHap1 Male -0.82 TU32 Left 137.4 38.0 - aHap1 Male -1.19 TU33 Left 118.3 31.8 - aHap1 NAIF -0.14 TU34 Left 119.5 32.5 25.4 aHap1 Female 0.16 TU37 Right 149.4 - 32.2 aHap1 Male 0.90 TU38 Right 149.4 - 32.2 aHap1 Male 0.90 TU40 Right 142.0 39.5 - aHap1 Male -0.39 TU42 Right 142.0 39.5 - aHap1 Male -0.39 TU44 Left 138.3 38.3 - aHap2* NAiM -1.03 TU53 Right 144.9 40.5 - aHap1 Male 0.12 TU59 Left 143.9 - 30.9 aHap1 NAiM -0.07 TU69 Right 119.1 - 25.1 aHap1 Female 0.06 Tun Left 144.8 - - aHap1 Male 0.10 TU78 Right 115.7 - 24.3 aHap1 Female -0.79 TU81 Right 117.8 - 24.8 aHap1 Female -0.26 TU82 Left 120.3 - - aHap1 Female 0.36 TU85 Left 141.7 39.4 - aHap1 Male -0.44 TU88 Left 143.2 40.9 30.7 aHap1 Male -0.18 TU89 Left 136.8 37.8 29.6 aHap1 Male -1.30 TU90 Left 118.2 32.6 25.9 aHap1 Female -0.16 TU91 Left 134.9 37.2 - aHap1 Male -1.62 TU92 Right 112.9 30.2 23.9 aHap1 Female -1.48 TU97 Left 121.6 34.2 12.7 aHap1* NAIF 0.69 TU101 Left 146.0 40.8 - aHap1 Male 0.31 TU102 Left 117.2 31.0 - aHap1 NAIF -0.41 TU106 Left 138.5 37.9 28.9 aHap1 Male -1.00 TU112 Left 116.1 33.4 25.7 aHap1 Female -0.68 TU113 Left 145.8 41.0 31.6 aHap1 Male 0.27 TU114 Left 145.4 41.4 32.1 aHap1 Male 0.20

225 Genetic Lab 10 Side GL (mm) Bp(mm) Bd (mm) Haplotype z-score Sex TU115 Left 125.4 34.1 - aHap1 Female 1.63 TU123 Right 144.0 39.7 30.0 aHap1 Male -0.04 TU124 Right 144.7 40.3 29.6 aHap1 Male 0.08 TU125 Right 122.2 34.4 26.5 aHap1 Female 0.84 TU126 Right 122.5 32.6 25.0 aHap1 Female 0.91 TU149 Left 150.7 - 32.5 NA NAIM TU1003 Left 117.7 - 27.2 aHap1 Female -0.28 TU1004 Left 140.4 - 30.1 aHap1a Male -0.66 TU1020 Right 117.6 32.4 25.3 aHap1 Female -0.31 TU1022 Right 113.1 30.7 23.8 aHap1 Female -1.43 TU1033 Right 142.3 39.6 - aHap1 Male -0.33 TU1034 Left 118.9 32.0 - aHap1 Female 0.02 TU1041 Right 160.5 45.5 - aHap2 Male 2.82 TU1049 Left 105.8 28.3 22.0 aHap1 Female -3.24 TU1053 Right 136.6 38.6 29.3 aHap1a Male -1.33 TU1054 Left 115.4 31.4 25.2 aHap1b Female -0.86 TU1066 Left 139.9 38.8 - aHap1c Male -0.76 TU1067 Left 145.5 39.1 30.4 aHap1 Male 0.22 TU1069 Right 118.3 32.0 25.5 aHap1 Female -0.13 TU1070 Left 143.3 39.4 30.6 aHap1 Male -0.16 TU1072 Left 117.4 31.5 - aHap1 Male TU1078 Left 143.0 38.0 29.4 aHap1 Male -0.22 TU1083 Right 141.3 38.2 29.4 aHap1 Male -0.51 TU1091 Right 120.8 32.5 24.8 aHap1d Female 0.49 TU1093 Right 148.0 39.2 30.7 aHap1 Male 0.65 TU1096 Left 114.3 30.7 24.2 aHap1 Female -1.13 TU1097 Right 121.9 32.5 25.4 aHap1 Female 0.76 TU1101 Right 158.0 44.7 - aHap2c Male 2.39 TU1102 Right 126.0 34.3 - aHap1* NAIF 1.78 TU1103 Right 148.9 42.8 34.0 aHap1 Male 0.81 TU1104 Right 120.1 33.1 25.7 aHap1* Female 0.31 TU1105 Right 150.7 42.8 33.5 aHap1* Male 1.12 TU1108 Right 159.3 45.1 - aHap2d* NAIM 2.61 TU1109 Right 115.7 31.5 24.9 ID NAIF TU1111 Right 127.8 35.7 27.7 aHap2* Female 2.23 TU1112 Right 122.9 33.3 - aHap2d* NAIF 1.01

Note: NAIF = No amplification of mtW, but morphologically identified as female based on GL; NAIM = No amplification of mtW, but morphologically identified as male based on GL; Bold numbers indicate predicted GL based on regression formulae.

226