In Vivo Performance of Different Scaffolds for Dental Pulp Stem Cells Induced for Odontogenic Differentiation

Total Page:16

File Type:pdf, Size:1020Kb

Load more

ORIGINAL RESEARCH Dentistry In vivo performance of different scaffolds for dental pulp stem cells induced for odontogenic differentiation Cigdem ATALAYIN(a) Abstract: This study was designed to determine the in vivo (a) Huseyin TEZEL performance of three different materials as scaffolds for dental pulp Taner DAGCI(b) Nefise Ulku KARABAY stem cells (DPSC) undergoing induced odontogenic differentiation. YAVASOGLU(c) An odontogenic medium modified by the addition of recombinant (d) Gulperi OKTEM human bone morphogenetic protein 2 was used in the experimental Timur KOSE(e) groups to induce differentiation. Mesenchymal stem cell medium was used in the control groups. DPSC were transplanted onto the backs of (a) Ege University, School of Dentistry, Department of Restorative Dentistry, Izmir, mice via three scaffolds: copolymer of L-lactide and DL-lactide (PLDL), Turkey. copolymer of DL-lactide (PDL) and hydroxyapatite tricalcium phosphate (b) Ege University, School of Medicine, (HA/TCP). The expression levels of dentin sialo-phosphoprotein (DSPP), Department of Physiology, Izmir, Turkey. dentin matrix protein-1 (DMP1), enamelysin/matrix metalloproteinase 20 (c) Ege University, Faculty of Science, (MMP20) and phosphate-regulating gene with homologies to endopeptidases Department of Biology, Izmir, Turkey. on X chromosome (PHEX) were analysed using RT-PCR. The expressions (d) Ege University, School of Medicine, in the experimental groups were compared to those in the control Department of Histology and Embryology, groups. The transcript expressions at 6 and 12 weeks were significantly Izmir, Turkey. different for all scaffolds (p < 0.05), except for the expression of DSPP in (e) Ege University, School of Medicine, the PLDL group with regard to the time variable. Although there was a Department of Biostatistics and Medical decrease in the expression of enamelysin/MMP20 in PLDL and HA/TCP Informatics, Izmir, Turkey. at 12 weeks, all other expressions increased and reached their highest level at 12 weeks. The highest DSPP expression was in the PDL group (p < 0.05). The highest expression of DMP1 was detected in the HA/TCP Declaration of Interests: The authors group (p < 0.05). The highest expression of PHEX was in the PLDL group certify that they have no commercial or associative interest that represents a conflict (p < 0.05). Consequently, PLDL and PDL seemed to be promising scaffold of interest in connection with the manuscript. candidates for odontogenic regeneration at least as HA-TCP, when they were applied with the DPSC induced for odontogenic differentiation. Corresponding Author: Keywords: Dentistry; Regeneration; Dental Pulp. Cigdem Atalayin E-mail: [email protected] Introduction The current dental treatments are unable to restore full biological DOI: 10.1590/1807-3107BOR-2016.vol30.0120 function, including the mechanical properties of the lost or damaged tissue. The ‘regenerative dentistry’ concept of biological tooth repair appears to be a promising alternative for the future of dentistry.1 Although different stem cells, morphogens and scaffolds can be combined to simulate natural odontogenic regeneration, it is crucial to determine which options most Submitted: May 5, 2016 closely replicate the characteristics of human dental tissues. Accepted for publication: Aug 16, 2016 Last revision: Sep 1, 2016 Dental pulp stem cells (DPSC) seem to be the most appropriate cell group for the regenerative approach.2 They have a higher odontogenic Braz. Oral Res. 2016;30(1):e120 1 In vivo performance of different scaffolds for dental pulp stem cells induced for odontogenic differentiation differentiation capacity compared to other cell groups (Research no. 11-5.1/8), and informed consent was due to their content of specific progenitor cells.3 obtained from the patients. A previously reported Odontogenic differentiation of DPSC can be induced isolation and culture method was used.5,13,14 using various factors; for example, dexamethasone has The cells were analysed with flow cytometry using been reported as the main inductive factor in previous a FACSCalibur (BD Biosciences, CA, USA), and the DPSC studies.4,5,6 Bone morphogenetic proteins data were analysed using the Cell Quest software (BD (BMP), known as active components of odontogenic Biosciences, CA, USA) to determine the phenotypic differentiation and tooth development, have been used characteristics. Stem cells that were negative for as a growth factor in an appropriate medium.7,8 This CD34 (hematopoietic progenitor cell antigen; APC) combination of inductive factors has been suggested as and CD45 (leucocyte common antigen/cell marker being more effective in enhancing differentiation.4,9,10 of hematopoietic origin; APC-H) but positive for Hence, it may be useful to investigate different medium CD73 (NTES’-nucleotidase; PE) and CD90 (thymus modifications to create effective combinations of cell antigen/Thy-1/Thy-1.1; FITC) were selected factors for inducing odontogenic differentiation. for this study. The rate of mesenchymal clusters of Scaffolds imitate the conditions in the tissue.11 The differentiation (CD73+CD90) was 98.3%. properties of a scaffold material are important. It must In the control (-) groups, a mesenchymal stem simulate the biological matrix and provide the desired cell medium13 containing an alpha modification of tissue formation.12 Many types of natural and synthetic Eagle’s medium (Gibco Invitrogen, Grand Island, materials have been tested as scaffolds in regenerative USA) supplemented with 15% fetal bovine serum dentistry; nevertheless, there is still a need for new (FBS) (Gibco Invitrogen, Grand Island, USA), 0.1 mM materials and designs. Both ceramics and synthetic L-ascorbic acid phosphate (Sigma-Aldrich, St. Louis, polymers can provide optimal scaffold structures.13 MO, USA), 2 mM L-glutamine (Sigma-Aldrich, St. Louis, Hydroxyapatite tricalcium phosphate (HA-TCP) has MO, USA) and 100 units/ml penicillin/streptomycin been reported to be an appropriate scaffold material (Gibco Invitrogen, Grand Island, USA) was used for DPSC and odontogenic regeneration.6,14,15 Synthetic during the culture period. In the experimental polymers are increasingly in demand as scaffold (+) groups, the medium was modified by adding materials due to their properties of biocompatibility, 0.01 μM dexamethasone sodium phosphate, 1.8 mM biodegradability and the incorporation of bioactive monopotassium phosphate (KH2PO4) and 50 ng/ml molecules.13 Copolymers, including a poly-L/DL recombinant human bone morphogenetic protein lactide that is used in medical applications, may 2 (rhBMP2) (ProSpec-Tany TechnoGene Ltd., Israel) also be an option to consider when devising new to induce odontogenic differentiation.8,13 The cells scaffold materials. were cultured at 37°C in 5% CO2 and the medium The aim of this study was to determine the in vivo was changed every two days. performance of different scaffold materials, i.e., a copolymer of L-lactide and DL-lactide (PLDL), Preparation of scaffolds a copolymer of DL-lactide (PDL) and hydroxyapatite Three different scaffold materials (40 mg) were tricalcium phosphate (HA/TCP) for DPSC induced for used as follows; odontogenic differentiation by medium modification. a. PLDL in a 80/20 molar ratio with an inherent viscosity midpoint of 5.8 dl/g (Purasorb PLDL, Methodology Purac, Holland) b. PDL with an inherent viscosity midpoint of Cell culture 2.0 dl/g. (Purasorb PDL, Purac, Holland) Human impacted third molar teeth (n = 15) that c. HA-TCP ceramic powder (Zimmer, Warsaw, had been surgically extracted were used as the Indiana, USA) cell source. The study protocol was approved by The polymer scaffolds, PLDL and PDL, were the Human Ethical Committee of Ege University dissolved in dioxane before being mixed with the 2 Braz. Oral Res. 2016;30(1):e120 Atalayin C, Tezel H, Dagci T, Karabay Yavasoblu NU, Oktem G, Kose T cells. The cell suspensions, containing ~1x106 DPSC MMP20 reverse: 5’GATTTCGCATAAAGTTGCCCAT cultured to the third passage, were mixed with the PHEX forward: 5’AACTTTGCTGCCTCAATGGGA appropriate scaffold material, and transplantation PHEX reverse: 5’ GTCAATAAAGGCCCAGCGAAC was performed as described below. β-actin forward: 5’ AGCCTCGCCTTTGCCGA β-actin reverse: 5’ CTGGTGCCTGGGGCG Transplantation A total of 0.3 ml of each primer (0.5 mM) was mixed All transplantation procedures were performed with 10.5 ml of LightCycler FastStart DNA Master under sterile conditions and in accordance with the SYBR Green I (Roche, Cat no: 03 003 230 001) for a guidelines approved by the Animal Ethical Committee final volume of 18 ml. The standard cycling conditions of Ege University (Research no. 2010-21). Fifty mg/kg were 95°C for 10 min, followed by 40 cycles of 95°C for Ketamine HCl (Alfamine®), 5 mg/kg Xylazine HCl 15 s, 62°C for 8 s and 72°C for 13 s. The comparative (Alfazyne®) and 1 mg/kg acepromazine maleate Ct method (2–ΔΔCt method) was used to analyse the were intraperitoneally administered to each of the data.16 The expression of genes was normalized using immunocompromised mice. The dorsal surface of each the glucose β-actin gene as a control housekeeping mouse was shaved and cleaned, and one midsagittal gene. The relative changes in the expression levels of incision was made. A mixture of cell suspension and the analysed genes in the experimental group were scaffold (n = 3 for each group) was then placed into a compared to those in the control group. The details pocket that was prepared subcutaneously to the dorsal of the analysis were as follows: surface of each immunocompromised mouse. The Ct: Threshold cycle, HKG: Housekeeping gene pockets and incision lines were closed. The animals (β-actin), GOI: Experimental gene were euthanized with 100 mg/kg thiopental sodium ΔCt(Control): Ct(GOI) – Ct(HKG) at 6 or at 12 weeks; the samples were removed 6 or ΔCt(Experimental): Ct(GOI) – Ct(HKG) 12 weeks, respectively, after the transplantation, and ΔΔCt: ΔCt (Experimental) – ΔCt (Control) the structure of the formed tissues was investigated Fold change: 2 –ΔΔCt using Real Time-Polymerase Chain Reaction (RT-PCR). IBM SPSS (Version 20.0) was used for the statistical analysis.
Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Inhibition of MEPE Cleavage by Phex

    Inhibition of MEPE Cleavage by Phex

    _________________________________________________________________________http://www.paper.edu.cn BBRC Biochemical and Biophysical Research Communications 297 (2002) 38–45 www.academicpress.com Inhibition of MEPE cleavage by Phex Rong Guo,a Peter S.N. Rowe,b Shiguang Liu,a Leigh G. Simpson,a Zhou-Sheng Xiao,a and L. Darryl Quarlesa,* a Department of Medicine, The Center for Bone and Mineral Disorders, Duke University Medical Center, Box 3036, Durham, NC 27710, USA b The University of Texas Health Science Center at San Antonio, Institute for Drug Development, Molecular Therapies, Endocrinology, Texas Research Park, 14960 Omicron Drive, 78245 San Antonio, TX, USA Received 7 August 2002 Abstract X-linked hypophosphatemia (XLH) and the Hyp-mouse disease homolog are caused by inactivating mutations of Phex which results in the local accumulation of an unknown autocrine/paracrine factor in bone that inhibits mineralization of extracellular matrix. In these studies, we evaluated whether the matrix phosphoglycoprotein MEPE, which is increased in calvaria from Hyp mice, is a substrate for Phex. Using recombinant full-length Phex (rPhexWT) produced in Sf9 cells, we failed to observe Phex- dependent hydrolysis of recombinant human MEPE (rMEPE). Rather, we found that rPhex-WT inhibited cleavage of rMEPE by endogenous cathepsin-like enzyme activity present in Sf9 membrane. Sf9 membranes as well as purified cathepsin B cleaved MEPE into two major fragments of 50 and 42 kDa. rPhexWT protein in Sf9 membrane fractions, co-incubation of rPhexWT and cathepsin B, and pre-treatment of Sf9 membranes with leupeptin prevented the hydrolysis of MEPE in vitro. The C-terminal domain of Phex was required for inhibition of MEPE cleavage, since the C-terminal deletion mutant rPhex (1–433) [rPhex30M] failed to inhibit Sf9-dependent metabolism of MEPE.
  • Osteoactivin and Cd44 : a Novel Interaction Regulating Bone Cell Differentiation and Function

    Osteoactivin and Cd44 : a Novel Interaction Regulating Bone Cell Differentiation and Function

    OSTEOACTIVIN AND CD44 : A NOVEL INTERACTION REGULATING BONE CELL DIFFERENTIATION AND FUNCTION A dissertation submitted to Kent State University in partial fulfillment of the requirements for the degree of Doctor of Philosophy by Gregory R. Sondag December 2015 © Copyright All rights reserved Except for previously published materials Dissertation written by Gregory R. Sondag B.S., Edinboro Univeristy of Pennsylvania, Edinboro, PA, USA 2010 M.S., Edinboro Univeristy of Pennsylvania, Edinboro, PA, USA 2011 Approved by Fayez Safadi___________________, Chair, Doctoral Dissertation Committee Walt Horton Jr.___________ ______, Members, Doctoral Dissertation Committee James Hardwick ________________, Werner Geldenhuys _____________, Min-Ho Kim __________________ _, Richard Meindl__________________, Accepted by Ernest Freeman_________________, Director, School of Biomedical Sciences James L. Blank__________________, Dean, College of Arts and Sciences TABLE OF CONTENTS TABLE OF CONTENTS ...................................................................................... III LIST OF FIGURES............................................................................................. VII LIST OF TABLES ............................................................................................ XIII LIST OF ABBREVIATIONS .............................................................................. XIV DEDICATION ..................................................................................................... XV ACKNOWLEDGEMENTS ................................................................................
  • Comparative Transcriptome Analyses Reveal Genes Associated with SARS-Cov-2 Infection of Human Lung Epithelial Cells

    Comparative Transcriptome Analyses Reveal Genes Associated with SARS-Cov-2 Infection of Human Lung Epithelial Cells

    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.24.169268; this version posted June 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Comparative transcriptome analyses reveal genes associated with SARS-CoV-2 infection of human lung epithelial cells Darshan S. Chandrashekar1, *, Upender Manne1,2,#, Sooryanarayana Varambally1,2,3,#* 1Department of Pathology, University of Alabama at Birmingham, Birmingham, AL 2Comprehensive Cancer Center, University of Alabama at Birmingham, Birmingham, AL 3Institute of Informatics, University of Alabama at Birmingham, Birmingham, AL # Share Senior Authorship (UM Email: [email protected]) *Correspondence to: Sooryanarayana Varambally, Ph.D., Molecular and Cellular Pathology, Department of Pathology, Wallace Tumor Institute, 4th floor, 20B, University of Alabama at Birmingham, Birmingham, AL 35233, USA Phone: (205) 996-1654 Email: [email protected] And Darshan S. Chandrashekar Ph.D., Department of Pathology, University of Alabama at Birmingham, Birmingham, AL Email: [email protected] Running Title: SARS-CoV-2 gene signature in infected lung epithelial cells Disclosure of Potential Conflicts of Interest: No potential conflicts of interest were disclosed. Page | 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.06.24.169268; this version posted June 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract: Understanding the molecular mechanism of SARS-CoV-2 infection (the cause of COVID-19) is a scientific priority for 2020. Various research groups are working toward development of vaccines and drugs, and many have published genomic and transcriptomic data related to this viral infection.
  • Soluble Klotho Causes Hypomineralization in Klotho-Deficient Mice

    Soluble Klotho Causes Hypomineralization in Klotho-Deficient Mice

    237 3 Journal of T Minamizaki, Y Konishi sKL causes hypomineralization 237:3 285–300 Endocrinology et al. in kl/kl mice RESEARCH Soluble Klotho causes hypomineralization in Klotho-deficient mice Tomoko Minamizaki1,*, Yukiko Konishi1,2,*, Kaoru Sakurai1,2, Hirotaka Yoshioka1, Jane E Aubin3, Katsuyuki Kozai2 and Yuji Yoshiko1 1Department of Calcified Tissue Biology, School of Dentistry, Hiroshima University Graduate School of Biomedical & Health Sciences, Hiroshima, Japan 2Department of Pediatric Dentistry, School of Dentistry, Hiroshima University Graduate School of Biomedical & Health Sciences, Hiroshima, Japan 3Department of Molecular Genetics, University of Toronto, 1 King’s College Circle, Toronto, Canada Correspondence should be addressed to Y Yoshiko: [email protected] *(T Minamizaki and Y Konishi contributed equally to this work) Abstract The type I transmembrane protein αKlotho (Klotho) serves as a coreceptor for the Key Words phosphaturic hormone fibroblast growth factor 23 (FGF23) in kidney, while a truncated f FGF23 form of Klotho (soluble Klotho, sKL) is thought to exhibit multiple activities, including f Klotho acting as a hormone, but whose mode(s) of action in different organ systems remains to f Phex be fully elucidated. FGF23 is expressed primarily in osteoblasts/osteocytes and aberrantly f kl/kl mice high levels in the circulation acting via signaling through an FGF receptor (FGFR)-Klotho coreceptor complex cause renal phosphate wasting and osteomalacia. We assessed the effects of exogenously added sKL on osteoblasts and bone using Klotho-deficient kl/kl( ) mice and cell and organ cultures. sKL induced FGF23 signaling in bone and exacerbated the hypomineralization without exacerbating the hyperphosphatemia, hypercalcemia and hypervitaminosis D in kl/kl mice.
  • Ultra-Processed Food Targets Bone Quality Via Endochondral Ossification

    Ultra-Processed Food Targets Bone Quality Via Endochondral Ossification

    Bone Research www.nature.com/boneres ARTICLE OPEN Ultra-processed food targets bone quality via endochondral ossification Janna Zaretsky1, Shelley Griess-Fishheimer1, Adi Carmi1, Tamara Travinsky Shmul1, Lior Ofer2, Tali Sinai1, Svetlana Penn1, Ron Shahar2 and Efrat Monsonego-Ornan 1 Ultra-processed foods have known negative implications for health; however, their effect on skeletal development has never been explored. Here, we show that young rats fed ultra-processed food rich in fat and sugar suffer from growth retardation due to lesions in their tibial growth plates. The bone mineral density decreases significantly, and the structural parameters of the bone deteriorate, presenting a sieve-like appearance in the cortices and poor trabecular parameters in long bones and vertebrae. This results in inferior mechanical performance of the entire bone with a high fracture risk. RNA sequence analysis of the growth plates demonstrated an imbalance in extracellular matrix formation and degradation and impairment of proliferation, differentiation and mineralization processes. Our findings highlight, for the first time, the severe impact of consuming ultra-processed foods on the growing skeleton. This pathology extends far beyond that explained by the known metabolic effects, highlighting bone as a new target for studies of modern diets. Bone Research (2021) ;9:14 https://doi.org/10.1038/s41413-020-00127-9 1234567890();,: INTRODUCTION penetration of blood vessels and bone tissue formation by The vertebrate skeleton has evolved as a dynamic system that osteoblasts.1,2,4,6 The EO process is tightly orchestrated by various serves numerous functions, such as protecting internal organs, signaling molecules and transcription factors, including transform- creating attachment sites for muscles to produce locomotion, ing growth factor β/bone morphogenetic protein (BMP), fibroblast providing a reservoir for minerals, and serving as a hematopoietic growth factor (FGF), Wnt, hedgehog, and the transcription factor niche.
  • Effects of PHEX Antisense in Human Osteoblast Cells

    Effects of PHEX Antisense in Human Osteoblast Cells

    J Am Soc Nephrol 13: 394–399, 2002 Effects of PHEX Antisense in Human Osteoblast Cells NENGJEN REMI SHIH, OAK D. JO, and NORIMOTO YANAGAWA Medical and Research Services, Sepulveda Veterans Administration Medical Center, Sepulveda, California; and Department of Medicine, School of Medicine, University of California at Los Angeles, Los Angeles, California. Abstract. X-linked hypophosphatemia (XLH) is an X-linked produced and stably transfected with PHEX-antisense vectors, dominant disorder that is characterized by rachitic bone disease resulting in a decrease in PHEX expression at mRNA and and hypophosphatemia due to renal phosphate transport defect. protein levels. It was found that these antisense-transfected The candidate gene for XLH, PHEX, has recently been iden- cells had impaired mineralization, with a decrease in 45Ca tified and found to share high homology with endopeptidases. incorporation and calcification nodule formation. It was also PHEX is expressed in various tissues, including bones, and the found that the conditioned culture media collected from these available evidence today indicates that bones can release ab- antisense-transfected cells exhibited inhibitory activities on normal humoral factors that affect bone mineralization and 45Ca incorporation by the nontransfected MG-63 cells and 32P proximal tubule phosphate transport in XLH. It was, therefore, uptake by the opossum kidney proximal tubular cells. The hypothesized that the inactivating mutations of PHEX in bone results of the study, therefore, provide strong evidence that may lead to the release of humoral factors and contribute to the supports the link between PHEX mutations and the pathogen- phenotypic expression of the disease. To test this possibility, esis of XLH.
  • Periapical Bone Response to Bacterial Lipopolysaccharide Is Shifted Upon Cyclooxygenase Blockage

    Periapical Bone Response to Bacterial Lipopolysaccharide Is Shifted Upon Cyclooxygenase Blockage

    Original Article http://dx.doi.org/10.1590/1678-7757-2018-0641 Periapical bone response to bacterial lipopolysaccharide is shifted upon cyclooxygenase blockage Abstract Fernanda Regina Objectives: Infection, inflammation and bone resorption are closely related events in apical periodontitis development. Therefore, we sought RIBEIRO-SANTOS1,2 to investigate the role of cyclooxygenase (COX) in osteoclastogenesis Geyson Galo da SILVA1 and bone metabolism signaling in periapical bone tissue after bacterial Igor Bassi Ferreira PETEAN1 lipopolysaccharide (LPS) inoculation into root canals. Methodology: Seventy 1 Maya Fernanda Manfrin ARNEZ two C57BL/6 mice had the root canals of the first molars inoculated with Léa Assed Bezerra da SILVA1 a solution containing LPS from E. coli (1.0 mg/mL) and received selective Lúcia Helena FACCIOLI3 (celecoxib) or non-selective (indomethacin) COX-2 inhibitor. After 7, 14, Francisco Wanderley Garcia 21 and 28 days the animals were euthanized and the tissues removed for total RNA extraction. Evaluation of gene expression was performed by qRT- PAULA-SILVA1,3 PCR. Statistical analysis was performed using analysis of variance (ANOVA) followed by post-tests (α=0.05). Results: LPS induced expression of mRNA for COX-2 (Ptgs2) and PGE2 receptors (Ptger1, Ptger3 and Ptger4), indicating that cyclooxygenase is involved in periapical response to LPS. A signaling that favours bone resorption was observed because Tnfsf11 (RANKL), Vegfa, Ctsk, Mmp9, Cd36, Icam, Vcam1, Nfkb1 and Sox9 were upregulated in response to LPS. Indomethacin and celecoxib differentially modulated expression of osteoclastogenic and other bone metabolism genes: celecoxib downregulated Igf1r, Ctsk, Mmp9, Cd36, Icam1, Nfkb1, Smad3, Sox9, Csf3, Vcam1 and Itga3 whereas indomethacin inhibited Tgfbr1, Igf1r, Ctsk, Mmp9, Sox9, Cd36 and Icam1.
  • Improving the Diagnosis of X-Linked Hypophosphatemia

    Improving the Diagnosis of X-Linked Hypophosphatemia

    AboutOpen | 2021; 8: 29-33 ISSN 2465-2628 | DOI: 10.33393/ao.2021.2235 Rare Diseases ORIGINAL RESEARCH ARTICLE Improving the diagnosis of X-linked hypophosphatemia: recommendations to optimize diagnostic flow and clinician/geneticist cooperation in the Italian clinical practice Emanuele Agolini1, Roberto Chimenz2, Danilo Fintini3, Vito Guarnieri4, Laura Guazzarotti5, Stefano Mora6, Leonardo Salviati7, Giovanna Weber8 1Medical Genetics Laboratory, IRCCS Ospedale Pediatrico Bambino Gesù, Rome - Italy 2Pediatric Nephrology Unit, Azienda Ospedaliera Universitaria G. Martino, Messina - Italy 3Endocrinology Unit, University Pediatric Hospital Department, IRCCS Ospedale Pediatrico Bambino Gesù, Rome - Italy 4Medical Genetics Division, Fondazione IRCCS Casa Sollievo della Sofferenza di San Giovanni Rotondo, Foggia - Italy 5Clinical Pediatric Unit, Azienda Ospedaliera Universitaria di Padova, Padua - Italy 6Pediatric Endocrinology Unit, IRCCS Ospedale San Raffaele, Milan - Italy 7Clinical Genetics Unit, Department of Women and Children’s Health, University of Padova, Padua - Italy 8Vita-Salute San Raffaele University, Department of Pediatrics, IRCCS Ospedale San Raffaele, Milan - Italy ABSTRACT Objective: To provide Italian expert opinion-based practical recommendations to improve the cooperation between clinicians and geneticists in order to optimize diagnostic flow and care of X-linked hypophosphatemia (XLH). Methods: A panel of four geneticists and four clinicians from Italian reference centers for the diagnosis and man- agement of XLH met virtually, first to highlight the critical issues in patient care and then to identify and share proposals to improve the diagnostic and care path of XLH. Results: Critical issues emerged regarding the transfer of adequate clinical information from clinicians to geneti- cists, standardization and clarity of genetic reporting, and adequate interactions between clinicians and geneti- cists during patients’ follow-up.
  • Preview of “Supplement Table S4.Xls”

    Preview of “Supplement Table S4.Xls”

    Annotations for all recurrently lost regions cytoband 1p36.12 3p14.2 3q13.13 q value 0,01352 0,1513 0,085307 residual q value 0,01352 0,1513 0,085307 wide peak boundaries chr1:23457835-23714048 chr3:60396160-60637030 chr3:110456383-110657226 genes in wide peak E2F2 FHIT DPPA4 ID3 DPPA2 TCEA3 DDEFL1 TBC1D19 PI4K2B STIM2 GBA3 KCNIP4 DKFZp761B107 C4orf28 GPR125 FLJ45721 hsa-mir-218-1 CXCL3 GRSF1 HNRPD HTN1 HTN3 IBSP IGFBP7 IGJ IL8 CXCL10 KDR CXCL9 AFF1 MUC7 NKX6-1 PF4 PF4V1 PKD2 POLR2B PPEF2 PPAT PPBP PRKG2 MAPK10 PTPN13 REST CXCL6 CXCL11 CXCL5 SPINK2 SPP1 SRP72 STATH SULT1E1 UGT2B4 UGT2B7 UGT2B10 UGT2B15 UGT2B17 SPARCL1 VDP SLC4A4 HERC3 GENX-3414 CDKL2 TMPRSS11D ABCG2 ADAMTS3 CLOCK CEP135 G3BP2 HNRPDL ENAM FAM13A1 CXCL13 PAICS UGT2B11 HPSE NMU SMR3B NPFFR2 UGT2A1 CCNI hsa-mir-491 hsa-mir-31 4p15.32 4q13.1 4q13.1 (continued) 6q14.1 0,14888 0,17878 0,093693 0,14888 0,17878 0,093693 chr4:17969802-29966659 chr4:55756035-90966136 chr6:76830186-107898353 CCKAR AFM SEC31A AIM1 DHX15 AFP RUFY3 BCKDHB RBPSUH ALB WDFY3 PRDM1 SOD3 AMBN LPHN3 CCNC SLIT2 ANXA3 DKFZP564O0823 CGA SLC34A2 AREG RCHY1 CNR1 PPARGC1A ART3 ANKRD17 EPHA7 KIAA0746 BMP3 BRDG1 GABRR1 ANAPC4 BTC SMR3A GABRR2 SLA/LP CCNG2 ASAHL GRIK2 LGI2 SCARB2 COQ2 HTR1B TBC1D19 CDS1 SULT1B1 HTR1E PI4K2B CENPC1 TMPRSS11E IMPG1 STIM2 CSN1S1 MRPS18C ME1 GBA3 CSN2 COPS4 NT5E KCNIP4 CSN3 HSD17B11 PGM3 DKFZp761B107 DCK HERC5 POU3F2 C4orf28 DMP1 PLAC8 PREP GPR125 DSPP NUDT9 SIM1 FLJ45721 EPHA5 NUP54 ELOVL4 hsa-mir-218-1 EREG UGT2B28 MAP3K7 FGF5 ODAM TPBG GC HERC6 TTK GK2 SDAD1 RNGTT GNRHR UBE1L2 TBX18
  • Supplementary Materials: Molecular Signature of Subtypes of Non- Small Cell Lung Cancer by Large-Scale Transcriptional Profiling

    Supplementary Materials: Molecular Signature of Subtypes of Non- Small Cell Lung Cancer by Large-Scale Transcriptional Profiling

    Cancers 2020 S1 of S18 Supplementary Materials: Molecular Signature of Subtypes of Non- Small Cell Lung Cancer by Large-Scale Transcriptional Profiling: Identification of Key Modules and Genes by Weighted Gene Co- Expression Network Analysis (WGCNA) Magdalena Niemira, Francois Collin, Anna Szalkowska, Agnieszka Bielska, Karolina Chwialkowska, Joanna Reszec, Jacek Niklinski, Miroslaw Kwasniewski and Adam Kretowski Cancers 2020 S2 of S18 A B Figure S1. The top-ranked enriched canonical pathway identified in (A) SCC and (B) ADC using IPA: Eicosanoid signalling pathway. Cancers 2020 S3 of S18 A Cancers 2020 S4 of S18 Figure S2. The second-ranked enriched canonical pathway identified in (A) SCC and (B) ADC using IPA: Agranulocyte adhesion and diapedesis. Cancers 2020 S5 of S18 Figure S3. The top-ranked enriched canonical pathway identified only in lung ADC: MIF regulation of innate immunity. A B Figure S4. Cluster dendograms of the gene clusters of (A) LUAD and (B) LUSC subset from TCGA database. Cancers 2020 S6 of S18 A B C D Figure S5. Protein-protein interaction (PPI) network of genes in the red (A), lightcyan (B), darkorange (C), yellow (D) modules in ADC. The networks were constructed using Cytoscape v. 3.7.2. software. Cancers 2020 S7 of S18 A B Figure S6. Protein-protein interaction (PPI) network of genes in the blue (A) and (B) modules in SCC. The networks were constructed using Cytoscape v. 3.7.2. software. Cancers 2020 S8 of S18 Table S1. Upstream regulator analysis of DEGs in lung SCC predicted by IPA. Upstream Prediction Target
  • Decellularized Porcine Cartilage Scaffold; Validation of Decellularization and Evaluation of Biomarkers of Chondrogenesis

    Decellularized Porcine Cartilage Scaffold; Validation of Decellularization and Evaluation of Biomarkers of Chondrogenesis

    International Journal of Molecular Sciences Article Decellularized Porcine Cartilage Scaffold; Validation of Decellularization and Evaluation of Biomarkers of Chondrogenesis Roxanne N. Stone 1,2, Stephanie M. Frahs 2,3,4, Makenna J. Hardy 2,3,4 , Akina Fujimoto 2,3, Xinzhu Pu 2,3,4, Cynthia Keller-Peck 2,3 and Julia Thom Oxford 2,3,4,5,* 1 Interdisciplinary Studies Program, Boise State University, Boise, ID 83725, USA; [email protected] 2 Biomolecular Research Center, Boise State University, Boise, ID 83725, USA; [email protected] (S.M.F.); [email protected] (M.J.H.); [email protected] (A.F.); [email protected] (X.P.); [email protected] (C.K.-P.) 3 Center of Biomedical Research Excellence in Matrix Biology, Boise State University, Boise, ID 83725, USA 4 Biomolecular Sciences Graduate Programs, Boise State University, Boise, ID 83725, USA 5 Department of Biological Sciences, Boise State University, Boise, ID 83725, USA * Correspondence: [email protected]; Tel.: +01-208-426-2395 Abstract: Osteoarthritis is a major concern in the United States and worldwide. Current non-surgical and surgical approaches alleviate pain but show little evidence of cartilage restoration. Cell-based treatments may hold promise for the regeneration of hyaline cartilage-like tissue at the site of injury or wear. Cell–cell and cell–matrix interactions have been shown to drive cell differentiation pathways. Biomaterials for clinically relevant applications can be generated from decellularized Citation: Stone, R.N.; Frahs, S.M.; porcine auricular cartilage. This material may represent a suitable scaffold on which to seed and Hardy, M.J.; Fujimoto, A.; Pu, X.; Keller-Peck, C.; Oxford, J.T.