JapaneseJapaneseSociety Society ofSystematicZoologyof Systematic Zoology

Species Diversity, 2008, 13, 221-230

A New Phreodrilid Species (Annelida: Clitellata: Phreodrilidae) from Lake Biwa, Japan

Patrick Martiniand Akifumi Ohtaka2

i Freshwater Biology, Rayal Beigian institute of IVcttural Sciences, Rue Vtiutier 29, B-1000 Brussels, Belgriunz E-maig:Patrich.Martin@naturalsciences,be 2Department ofIVicitural Sciences, haculty ofEducation, Hirosaki Uhiver:sdy, 1 Bunltyo-cho, Hirosaki, 036-8560 Jic]pan E-mail: [email protected]

(Received 24 January 2008; Accepted 15 October 2008)

A new species of Phreodrilidae is described flrom Lake Biwa, Japan, using classical morphology and a 658bp long fragment of the mitochondrial cy- "DNA tochrome c oxidase subunit I (COI) gene as a potenttal barcode". Asta- cQpsidrilus ru,uteki sp. nov, is unusual in possessing dorsal bundles each rep- resented by only a single seta, instead of the usual hair and support setae. Among other phreodrilids, this feature has been reported only in IVesodrilus isochaeta Pinder and Brinkhurst, 1997 and insulodrilus butdus Pinder and Brinkhurst, 1997, both described firom Australia. The new species pessesses This is paired spermathecal setae and peeuliar voluminous, pendant penes, the first record of the family in Japan, a circumstance that contradiets the assumed Gondwanan origin of the Phreodrilidae. Because any hypothesis of Asia) a former zoogeographical connection between Japan (or other parts of and Australia is unsupported by any other biogeographical data, it is proba- ble that A. ryuteki was introduced to Japan from the Southern Hemisphere. Conversely, the tubificid Embolocqphalus yanzaguchii (Brinkhurst, 1971) ap- pears to have been introduced into Australia from Japan. Key Words: Clitellata, oligochaetes, Phreodrilidae, AstacQpsidrigus, new

species, Lake Biwa.

Introduction

To date, there are 51 species in the family Phreodrilidae, excluding Tttsmani- aedritus tasmaniaensis Goddard, 1909, a taxon too poorly described to be assigned to any of the current genera. Two subfamilies are distinguished, the Phreodrilinae including Phreodrilus and Antarctodrilus, and the Phreodriloidinae with Phreo- driloides, AstacQpsielritus, insulodrilus, AJesodritus, and Schizodrilus (Brinkhurst 1991; Pinder and Brinkhurst 1997). The global distribution ef the family indicates a Gondwanan origin (Martin et al, 2008), The majority of species occur in the South- Hemisphere: ern Hemisphere, although a few have been recorded in the Northern Morocco (Giani et al. 1995), Sri Lanka (Stephenson 1913), the Arabian Peninsula (Martinez-Ansemil et al. 2002), and Ireland (Gunn et al. 2003). In this context, the find- present new species found in Lake Biwa, Japan, is an especially significant ing, since it faIIs well outside of the biogeographical range predicted by the hypoth-

NII-Electronic Library Service JapaneseJapaneseSociety Society ofSystematicof Systematic Zoology

222 P. Martin and A. Ohtaka

esis of a Gondwanan origin, For this reason, we have decided to publish a descrip- tion of this new species even though only one specimen (one fragment) is available for description, in spite of many unsuccessful attempts to find additional material at the type locality, This decision is additionally justMed by the fact that the new species has quite distinct morphological features that unambiguously characterize it vis-a-vis its congeners.

Material and Methods

The material was collected in Lake Biwa in January, 2001, by means of a dredge during a survey of the aquatic oligochaete fauna (Ohtaka and Nishino 1995, 1999, 2006; Nishino et al. 1999). The collected material was sieved through a net (250,um mesh size) anct preserved in absolute ethanol fbr subsequent DNA analy- sis.

Morphological study The anterior part of the specimen (head and sexual segments) was used fbr classical morphological work. Prior to dissection, this part was removed from ethanol and fixed overnight in the laboratory in 70,Xu neutralised fbrmalin. It was cut along the midsagittal plane and the intestine was partly removed. The frag- ments were stained in alcoholic carmine, dehydrated, cleared in xylene, mounted in Canada balsam, and examined under a Reichert compound microscope with di/e ferential interference contrast. Drawings were made by means of a camera lueida. The specimen has been deposited as the holotype in the Hokkaide University Mu- seum, Sapporo, Japan, with the acronym ZIHU, representing the former Zoological Institute, Hokkaido University. In the description, segments are designated by Roman numerals and septa are indicated by the Arabic numbers of the adjacent segments (e.g., septum 415 lies between segments IV and V).

DNA extraction, PCR amplification, and sequencing DNA was extracted from the posterior part of the specimen using QIAgen DNA Mini Kit according to the manufacturer's protocol for animal tissue. A 658bp re- gion of the COI gene was amplified using 10ul DNA extract, The primers HC02198 (5'-TAAACTTCAGGGTGACCAAAAAATCA-3') and LCO1490 (5'-GGTCAACAAAT CATAAAGATATTGG-3r) (Folmer et al. 1994) were used in quantities ef 2.5"1, with 2.5"1 dNTP,, 2.5"I buffer, O,26ul Taq DNA polymerase (5Upt1-i), and 4.74"1 steril- ized water. The samples were subjected to 30 cycles of 60s at 940C, 60s at 510C, and 90 s at 72eC, with an additional initial step of 5 min denaturation at 94eC, and a final step of 5min extension at 720C. The PCR product was purified using the GEXTM PCR DNA and Gel Band Purincation Kit (Amersham Biosciences) according to the manufacturer's protocol. The sample was prepared for sequencing reaction with the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems). The sequenc- mg reactlon mixture included 3ul DNA, 2 ready reaction mix, × se- purified ,ul 1 pt15 quencing buffer, 2 pt1 of 2"M primer, and 2 "1 sterilized water. Sequencing-PCR was carried out in both directions using the primers Iisted above, with 25 cycles of 10s at 960C, 5s at 50eC, and 4min at 600C, with an initial step of 60s denaturation at 96oC. Automatic sequencing was perfbrmed on an ABI310 Genetic Analyser (Ap-

NII-Electronic Library Service JapaneseJapaneseSociety Society ofSystematicof Systematic Zoology

New phreodrilid species from Lake Biwa 223

plied Biosystems), The sequence was deposited in EMBL under accession number FM163436,

Taxonomy

AstacQpsidrilus r vuteki sp. nov. (Fig, 1)

Holotype. ZIHU-3261, slide Ol.036.02, sexually mature specimen, incomplete (first 21 segments), Type Iocality. Northern basin off Hayasaki (35023'N, 136007'E), Lake Biwa, Japan, 29 January 2001, in the profundal zone of the lake at 90 m depth (see NishinQ

et al. 1999). "ryuteki", "dragon Etymology. A literally a fiute", is a Japanese transverse flute used in gagaku, the Shinto traditional orchestra associated with the imperial court and ceremonies. The sound of the ryuteki is said to represent the dragons that ascend into the skies between the heavenly lights and the people of the earth, The name, a noun in apposition, is used allegorically, and is meant to represent a dragon (Astacopsidrilus rly"teki sp, nov.) calling to its closest Gondwanan relatives (the Australasian Phreodrilidae) across the Pacific Ocean. Deseription. Length 3,1mm, 21 segments (incomplete specimen with length to male pore 1.55mm). Width at XII (clitellum) O.35mm. Prostomium rounded. Clitel- lum extending over XII-XIII (Fig. IC). Ventral setae from II, two per bundle, 96-126 um long, about 6"m thiek, becom- ing slightly longer from II to following segments, sigmoid with nodulus on upper third of shaft, bifid with reduced upper teeth (Fig. IA, vs), Ventral setae absent in XII. Two modified genital, spermathecal setae per bundle in XIII; one of these elon- inconspicuous gate, 129"m long, 3.8um thick, and straight with bent ental tip, nodulus slightly distal to middle of shaft, and hollow distal tip, seta prqecting from enlarged, glandular setal sac (Fig. IB, ss); other seta shorter, 60um long, 2.3um thick, and differentiated into a simple rod mostly contained within the sac lengest (Fig. IA, sps). Large, discrete glandular cells associated with ental end of spermathecal setae and musculature (Fig. IB, gc). G!andular setal sacs opening into spermathecal vestibulae near spermathecal pores. Dorsal setae from III, one seta (exceptionally twoabne a replacement seta?) representing each bundle, similar in shape to ventral setae but slightly smaller, 70-108,um long, 6"m thick (Fig. IA, ds). Neither hair setae nor support setae pres- ent. Male and sperrnathecal pores paired (Fig. IB, mp, spp), opening roughly in of XII, same plane slightly medial of ventral seta] line; male pores on posterior part spermathecal pores on anterier margin of XIII. Eversible dorsal pad of pharynx well developed in II to IV, oesophagus in V-IX, suddenly widening te intestine in X. One pair of testes in XI. Male ducts paired. Prestate glands absent, Sperm funnels small, located in ventral part of 11!12 (Fig. IB, sfi. Vasa deferentia thin, about 10um wide and roughly ef same width along whole length, anterio-ventrally coiled in part of XII, extending dorsally to join atria near union with penes (Fig. IB, vd, u). Atria tubular, convoluted, confined to

NII-Electronic Library Service JapaneseJapaneseSociety Society ofSystematicZoologyof Systematic Zoology

224 P. Martin and A. Ohtaka

co

raQen

vnco>acoaaco s

¢ y-E8aEacagts

anQut F-.--=---=--L

E gg 8

NN .JV (

Fig. 1, Astacopsidritus ro,uteki sp, nov., holotype (ZIHU-3261), A, Somatic and spermathecal setae; B, right lateral view of genitalia in segments XII-XIV (the sperm funnel suggested with dashed lines was removed from this part during dissection and only seen in the left part of the dissected fragment; the location of the female funnel is uncertain); C, external view of an- terior segments with schematie drawing of genitalia (right side of dissected holotype). Abbre- viations: a, atrium; ds, dorsal seta; ff, female funnel; gc, glandular cells; 1, lumen; m, muscle tissue; mp, male pore; p, pendant penis; ps, penis sac; s, sperm; st sperm funnel; spa, sper- mathecal ampulla; spd, spermathecal duct; spp, spermathecal pore; sps, spermathecai setae; spv, spermatheeal vestibule; ss, setal sac; sw, swelling; u, union of vas deferens and atrium; vd, vas deferens; vs, ventral seta.

NII-Electronic Library Service JapaneseJapaneseSociety Society ofSystematicof Systematic Zoology

New phreodrilid species flrom Lake Biwa 225

XII, about 1075 ptm long, 48um wide, with distinct lurnen, not ciliated (Fig. IB, a), Voluminous pendant penes present within penis sacs (Fig. IB, p, ps), Ejaculatory ducts asymmetrically situated inside penes, running close to posterior side of lat- ter, facing septum 12/13, lined on this side with single layer of cells similar in ap- pearance to that of penis sacs; anterior face of penes (that opposite septum 11/12) thickened, made of transversely stretched cells. Cuticular penis sheaths absent. Spermathecal vestibules (Fig. IB, spv) tall with narrow lumen, giving rise to spermathecal ducts with ectal swellings (Fig. IB, spd), and with dorsal muscular attachments to body wall (Fig. IB, m). Pear-shaped spermathecal ampullae (Fig. IB, spa) restricted to XIV or extending into XV. Sperm as a loose mass in ampullae. One pair of ovaries in XII, Female funnels inconspicuous, probably opening into spermathecal vestibules (Fig. IB, ff), COI sequence. EMBL accession number: FM163436 (see Appendix). Taxonomic remarks. The ventral spermathecal pores place this species in the subfamily Phreodriloidinae Brinkhurst, 1991, and the tall spermathecal vestibules incorporating the female pores are characteristic of the genus AstacQp- sidritus (Pinder and Brinkhurst 1997; Pinder and Erseus 2000). The female funnel of this new species is inconspicuous and its exact location is uncertain. The deep spermathecal vestibules with muscular connections to the dorsal body wall permit the placement of this species within Astacopsidrilus with some confidence. The ob- servation that the tall spermathecal vestibules, associated with ectal swe}lings of the spermathecal duets, are very similar in A, T:yuteki and A. edwardi Pinder, 2003 gives additional support to this conclusion, although lateral muscular attachments to the body wall are absent, or at Ieast net noticeable, in A. nyuteki but present in A. edwardi, and the swellings of the spermathecal ducts are posterior to the muscu- lar connections (cfi Pinder 2003), Astacqpsidrilus rlyuteki is unique in having each dorsal bundle represented by only a single seta, while Iacking the usual hair and support setae. This character state is rare in the Phreodrilidae and was previously known only in IVesodrilus isochaeta Pinder and Brinkhurst, 1997 and insulodrilas b(fidus Pinder and Brinkhurst, 1997, both members of the Phreodriloidinae (see Pinder and Brinkhurst 1997). Although clearly a different species than A, ryuteki, L bijidus has, in addition to the single setae, similar paired spermathecal setae (one longer, hollow-tipped, and protruding into the base of spermathecal vestibuie, the other shorter, apparently not hollow-tipped, and not protruding from the setal sac; Pin- der and Brinkhurst 1997: 492), The spermathecal ducts of t bijidus were illustrated with ectal swellings as well, but no muscular connections to the dorsal body wall were mentioned and the vestibules are short. Female ducts were not observed, making the assignment of this species to insalodrilus not firmly justified, aecord- ing to the current (Pinder and Brinkhurst 1997) diagnoses of the genera AstacQp- sicirilus and insutodrilus. lf future scrutiny of new material of A. ]1),uteki demon- strates that the female funnels do not open into the spermathecal vestibules, L bi- j7dus sheuld be regarded as the closest previously described species to A. r:yuteki. Astacqpsidrilus species are only distinguished from insulodrilus by the degree of development of the ectal spermatheca! duct and the position of the female pores. The latter is partly dependant on the fbrmer (Pinder, pers. com,), and taxa that are defined by degrees of development of a character along a continuurn should be re- garded with suspicion, In the future, it might be that these genera are put in syn-

NII-Electronic Library Service JapaneseJapaneseSociety Society ofSystematicof Systematic Zoology

226 P. Martin and A. Ohtaka

onymy, Among the twelve previously described species of the genus Astacopsidrilas, modified spermathecal setae are only known from four, A. beckettae Pinder and Brinkhurst, 1997, A. edwardi, A. ostiensis Pinder and Erseus, 2000, and A. plamaseta (Brinkhurst and Fulton, 1979). Astacopsidrilus beckettae has single sper- mathecal setae (Pinder and Brinkhurst 1997); all others, including A. Tu,uteki, have paired spermatheeal setae, In A. plumctseta, the hollow-tipped setae are very long (up to three times as long as the somatic setae; Pinder and Brinkhurst 1997) while they are of about the same size as the somatic setae in the other three species. The spermathecal setae of A. r:1;uteki look very similar to those of A. ostiensts (cf Pinder and Erseus 2000, fig. 1). Although well-developed penes are diagnostic of the genus, the penes are peculiar in A. Tlyutehi, not only in their volume but alse in their cell structure and the asymmetrical loeation of the ejaculatory ducts inside them. The COI gene fragment of A, Jlyuteki i's here provided with the aim of using it "barcode" as a marker for the species (Hebert et al. 2003). Erseus and Kvist (2007) have recently demonstrated this gene's usefulness for the secure identifieation of four northwest European species of the marine tubificid genus Tubij7coides. This suggests its suitability as the basis for an identification system for oligochaete species. No COI sequence is available fbr any phreodrilid so far; however, the first hundred most similar sequences identified during a BLAST search (Basic Local Alignment Search Tool; Altschul et al. 1997) correspond to oligochaetes, without exception. This virtually excludes the possibility that the DNA sequence obtained for A. nyuteki actually results firQm contamination. Geographical distribution and habitat. To date, A. r vuteki is only known from its type locality, a profundal habitat in Lake Biwa at 90m depth with muddy sediment and bottom temperatures quite constant throughout the year, 7-80C. The faunal community there is dominated by Tubijlex tubCfex (MUIIer, 1774), Limnodrilus prqfLindicola (Verril1, 1871), Branchiura sowerbyi Beddard, 1892, and Teneridrilus mastix (Brinkhurst, 1979), with some naidids occasienally present, Specaria josinae (Vejdovsky, 1883), Vojdovsityella simplex Liang, 1958, and U?zcinais uncinata (ersted, 1842) (Nishino et al. 1999).

Discussion

The Japanese archipelago in the Northern Hemisphere is far from Australia or New Zealand in the Southern Hemisphere, and the latter countries belong to difL ferent fireshwater zoogeographical regions (Timm 1980). Although the global distri- bution of the Phreodrilidae indicates a Gondwanan origin, there is evidence of more recent dispersal (Pinder 2001). It is now clear that at Ieast some Asian and Tibetan terrains were portions of Gondwana (Crawford 1974; Audley-Charles 1984; Bayly 1992). Those Gondwanan fragments did not involve Japan, but there might have been occasional migration thereto after the formation of the Asian Iandmass. Although the hypothesis of some type of former zoogeographical connection between Japan (or other parts of Asia) and Australia cannot be rejected, it is more probable that A. ilyuteki was in- troduced reeently from the Southern Hemisphere. With the intensification in world-wide trade, opportunities for both intended

NII-Electronic Library Service JapaneseJapaneseSociety Society ofSystematicof Systematic Zoology

New phreodrilid species from Lake Biwa 227

and unintended introductions of invertebrates have dramatically increased in re- cent decades. The Ecological Society of Japan (2002) listed alien animals and plants in Japan and suggested that many alien species remain unrecorded. An intertidal mussel, Xenostrobus securis (Lamarck, l819), originally distributed in Australia and New Zealand, was first recorded from a brackish lake and some bays in Japan in the 1970s, and later became widespread along the central and southern Japanese coasts (Kimura 2002). An Australian temnocephalidan, illemnosewellia minor (Haswell, 1888), was recorded in Japan in 1985, taken from an alien crayfish, Cherax tenuimanus (Smith, 1912) that was introduced from Western Australia in rearing ponds at Ibusuki, Kagoshima Prefecture, in Kyushu, southern Japan (Tamura et al. I985). Blakemore et at. (2006) suspected that of the 80 or so terrestrial earthworms recorded so far in Japan, approximately 50% are alien species that most 1ikely have been introduced inadvertently by human activities. Conversely, a tubificid oligochaete, Embolocaphalus yamaguchii (Brinkhurst, 1971), which first was recorded only flrrom Lake Biwa under the name Petoscolex sp. by Yamaguchi (1953) (Ohtaka 1994), but not long ago was also collected from several otiher locali- ties in the Japanese main island of Honshu (Ohtaka, unpublished), was recently recerded from South Australia (Pinder and McEvoy 2002). This distribution is ex- ceptional within the Australian tubificid fauna because other tubificids found in Australia are either endemic or cosmopolitan (Pinder and McEvoy 2002), The pop- ulation of E. yamaguchti in Australia is thus suspected to have been introduced there, possibly along with omamental plants or fish, because there is a Japanese garden in the catchment of the Australian locality of this species (Pinder, pers, com.), Pinder and Brinkhurst (1997) discussed possible mechanisms of dispersal in the Phreodrilidae such as rafting, drifting, transport by birds, or even storms, The recent discovery of an unidentifiable phreedrilid firom Europe (Ireland) caused Gunn et al, (2003) to consider the importation of worms with fish or macrophytes as the source. The fact that certain species of Astacospidrilus are leech-like ecto- commensals on freshwater crayfish (Euastactts) is of special concern in this re- spect, although such species have very broad segrnents, and thus are different firom A, r:vuteki as well as other phreodrilids (Pinder and Brinkhurst 1997). Intro- ductions of non-commensal phreodrilids via importation of crayfish cannot be ex- cluded as they may have been caught up in mud and sediment when the crayfish were collected. Several species of Australian and New Zealand crayfishes are avail- able in Japan in pet shops or via the internet, but established populations of these have never been recorded to date in Japan. To cenclude, it is probable that A. iJ,uteki was introduced firom the Southern Hemisphere, giving rise to a population more or less established in Lake Biwa, al- though no evidence conclusively demonstrating this is available.

Acknowledgements

We are gratefu1 to Adrian Pinder (Department of Environment and Conserva- tion, Western Australia) fbr sharing his thoughts about Gondwana-Asia, and the Australian E. yamcrguchii as a possible introduced species, and for linguistic im- prevements; to Machiko Nishino (Lake Biwa Environmental Research Institute,

NII-Electronic Library Service JapaneseJapaneseSociety Society ofSystematicof Systematic Zoology

228 P. Martin and A, Ohtaka

Japan) for her assistance during the fieldwork; to Claudine Devries-Duchene who inked the figures; to Ali Ait Boughrous for processing the DNA material; and to two anonymous referees for valuable comments on the manuscript. This work was

financially supported by the Lake Biwa Environmental Research Institute, and by

a Grant-in-Aid for Scientific Research from the Japan Society fbr the Promotion of Science (19570079) to A, O.

Appendix COI sequence ofAstacQpsidrilus i:yuteki (EMBL accession number: FM163436)

ANCACTTTATATTATCTTTGGTTTATGAGCCGGTATAGNAGGTACTGGAACTAGC- CTTCTCATTCGACTCGAACTAGCTCAACCTGGATCATTCCTTGGTAGAGATCAACTCTA- CAATACCCTAGTAACCGCCCATGCATTTCTAATAATCTTCTTTATAGTAATAC- CAATCTTCATTGGAGGATTTGGAAACTGACTTATTCCCTTAATACTAGGGGCTCCC- GATATAGCCTTTCCTCGTCTCAATAACCTGAGATTTTGACTTCTTCCCCCCTCACT- TATTCTCCTAGTATCCTCCGCGGCCGTAGAAAAAGGTGCTGGAACTGGATGAACAGTT- TATCCTCCACTCGCAGGAAATCTAGCTCATTCAGGACCATCAGTAGACCTAG- CAATCTTCTCGCTACATTTAGCAGGAGCAGCATCTATTCTTGGTGCTATTAATT'rCATCA- CAACAGTAATCAATATGCGTTGAAAAGGTATACGCTTAGAACGAATTCCTCTATTTG- TATGAGCTGTTATTATTACAGTTGTTCTACTCCTTCTTACTCTTCCTGTTCTAGCCGGT- GCCATTACCATACTTCTAACGGACCGAAATCTAAACACTTCATTCTTTGATCCAGCCG- GAGGTGGAGACCCTGTCCTATATCAACATCTATTC

References

Altschul, S. F., Madden, T. L., Schalier, A. A., Zhang, J., Zhang, Z., Miller, W, and Lipman, D. J, 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search pro- grammes. Nucleie Acids Research 25: 3389-3402. Audley-Charles, M. G. 1984. Cold Gondwana, warm Tethys and the Tibetan Lhasa block, Na-

ture 310: 465-466. Bayly, I. A, E, 1992, 11he IVbn-marine C?ntrqpagidae (CtrpqpodaJ Calanoidq) of the V-lortd. Guides to the ldentijication of the Mtcroinvertebrates of the bontinental Waters of the TVbrld, A]b. 2. SPB Academic Publishing, The Hague, 30 pp. Blakemore, R. J., Ito, M. Y. and Kalleko, N, 2006, Alien earthworms in the Asia/Pacifie region

with a checklist of speeies and the first reeords of Eukerria saltensis (Oligochaeta: Oe- nerodrilidae) and Eiseniella terraedra (Lumbrieidae) from Japan, and Pontoscolex corethrurus (Glossoscolecidae) firom Okinawa. Pp. 173-181. in: Koikem E, Clout, M, N,, Kawamichi, M., De Poorter, M, and Iwatsuki, K. (Eds) Assessment and Control ofBiologi- cal invasion Risks, IUCN, Gland, Switzerland. Brinkhurst, R. O. 1991. A phylogenetic analysis of the Phreodrilidae (Annelida, Oligochaeta), with a description of a new species, Canadian Journal of Zoology 69: 2031-2040. Cra"[fbrd, A, R. 1974. A greater Gondwanaland. Seience 184: 1179-1181. Ecological Society of Japan (Ed.) 2002. Handbook ofAtien Species in Jlrrpan, Chljin Shokan, Tokyo, 390 pp, [In Japanese]

Erseus, C. and Kvist, S. 2007. COI variation in Scandinavian marine speeies of Tubijicoides (Annelida: Clitellata: Tubificidae). Journal of the Marine Biological Association of the United Kingdom 87: 1121-1126.

NII-Electronic Library Service JapaneseJapaneseSociety Society ofSystematicof Systematic Zoology

New phreodrilid species from Lake Biwa 229

Fohmer, O., Black, M., Hoeh, R., Lutz, R, A, and Vrljenhoek, R. 1994. DNA primers for amplifi- cation for mitochondrial cytochrome c oxidase subunit 1 from diverse metazoan inverte- brates. Molecular Marine Biology and Biotechnology 3: 294-299.

Giani, N., Martin, P. and Juget, J. 1995. A new species of Phreodrilidae (Oligochaeta), Asta- cQpsidriltts naceri sp, nov,, from Morocco (North Africa), with notes on the biogeography of the family. Canadian Journal of Zoology 73: 2375-2381. Gunn, R. J. M., Pinder, A, M. and Walker, B. M. 2003. Phreodrilidae (Annelida: Oligochaeta), a family new to Europe. Irish Naturalists' Journal 27: 315-317. Hebert, P. D, N., Cywinska, A,, Ball, S. L. and deWaard, J. R. 2003. Biological identifications through DNA barcodes. Proceedings of the Royal Society of London, Series B 270i 313-321. Kimura, T. 2002. Xenostrobus securts. P. 188, in: Ecological Soeiety of Japan (Ed.) lldndbooh of Alien Species in lapan. Chijin Shokan, Tokyo. [In Japanese] Martin, P., Martinez-Ansemil, E., Pinder, A,, Timm, T. and WetzeL M. J. 2008. Global diver- sity of oligochaetous clitellates ("Oligoehaeta"; Clitellata) in fireshwater. Hydrobiologia

595: 117-127. Martinez-Ansemil, E,, Giani, N. and Sambugar, B. 2ee2. 01igochaetes firom underground wa- ters of Oman with descriptions of twe new species of Phreodrilidae (Oligochaeta): Antarctodrilus arabicus n. sp. and Phreodrilus stocki n, sp, Contributions to Zoology 71: 147-158. Nishino, M., Ohtaka, A, and Narita, T, 1999. Studies on the aquatic oligochaete fauna in Lake Biwa, central Japan. III. Distribution of respective taxa within the lake, Japanese Jour- nal of Limnology 60: 539-558. Ohtaka, A. 1994, Redescription of EmboJocephatus yamaguchii (Brinkhurst, 1971) eomb. nov. (OIigochaeta, Tubificidae), Proceedings of the Japanese Society of Systematic Zoology 52i 34-42. Ohtaka, A. and Nishino, M. 1995. Studies on the aquatic oligochaete fauna in Lake Biwa, cen- tral Japan. I, Checklist and taxonomic Temarks, Japanese Journal of Limnology 56: 167-182. Ohtaka, A, and Nishino, M. 1999. Studies on the aquatic oligochaete fauna in Lake Biwa, cen- tral Japan. II. Records and taxonomic remarks on nine species. Hydrobiologia 406: 33-47. Ohtaka, A. and Nishino, M. 2006, Studies on the aquatic oligochaete fauna in Lake Biwa, cen- tral Japan. IV. Faunal characteristics in the attached lakes (naiko). LimnologrT 7: 129-142, Plnder, A, M. 2001. Notes on the diversity and distribution of Australian Naididae and Phreo- drilidae (Oligochaeta: Annelida). Hydrobiologia 463: 49-64. Pinder, A. M. 2003. New species and records of the Phreodrilidae (Annelida: Clitellata> from Western Australia. Records of the Western Australian Museum 21: 307-313. Pinder, A. M. and Brinkhurst, R. O, 1997. Review of the Phreodrilidae (Annelida: Oligochaeta:

Tubificida) of Australia, Invertebrate Taxonomy 11: 443-523. Pinder, A, M, and Erseus, C, 2000. New Phreodrilidae (Annelida: Clitellata) firom Tasmanian estuaries. Papers and Proceedings of the Royal Society of Tasmania 134: 29-33, Pinder, A. M. and McEvoy, P. K. 2002. Enzbolocephatus yamaguchii (Brinkhurst, 1971) (Clitel- lata: Tubificidae) from South Australian streams. Records of the South Australian Mu- seum 35: 139--145. Stephenson, J. 1913. 0n a collection of Oligochaeta, rnainly from Ceylon, Spolia Zeylanica 8: 251-276. Tamura, S,, Oki, I., Kawakatsu, M,, Ninagawa, M,, Matsusato, T, and Suzuki H. 1985. A note on an introduced species of DL4gesia tigrina (Girard, 1850), found in eulture ponds of Aus- tralian crayfish in Kagoshima Prefeeture, Japan, Bulletin of Fuji Women's Col!ege 23:

NII-Electronic Library Service JapaneseJapaneseSociety Society ofSystematicof Systematic Zoology

230 P. Martin and A, Ohtaka

133-137.

Timrn, T. 1980. Distribution of aquatic Oligochaeta, Pp, 55-77. in: Brinkhurst, R, O, and Cook, D. G. (Eds) Aquatic Oligochaete Biolngy. Plenum, New York. Yamaguchi, H. 1953, Studies on the aquatic Oligochaeta of Japan VI. A systematic report, with some remarks on the classification and phylogeny of the Oligoehaeta. Journal of the Faculty of Seience, Hokkaido University, Series VI, Zoelogy 11: 277-343,

NII-Electronic Library Service