DOCSLIB.ORG

Original Article Influence of Variants of the Drosha, Mir499a, and Mir938

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Original Article Influence of Variants of the Drosha, Mir499a, and Mir938 Am J Transl Res 2020;12(12):8216-8224 www.ajtr.org /ISSN:1943-8141/AJTR0121284 Original Article Influence of variants of thedrosha , mir499a, and mir938 genes on susceptibility to acute lymphoblastic leukemia in an admixed population from the brazilian amazon Tatiane Piedade de Souza2, Darlen Cardoso de Carvalho1, Alayde Viera Wanderley1,4, Sweny Marinho Fernandes1,4, Juliana Carla Gomes Rodrigues1, Amanda Cohen-Paes1, Marianne Rodrigues Fernandes1, Fernando Augusto Rodrigues Mello Junior5, Lucas Favacho Pastana1, Lui Wallacy Morikawa Souza Vinagre1, Artur Luiz da Costa Silva3, Paulo Pimentel de Assumpção1, Sidney Santos1,2, André Salim Khayat1, Ney Pereira Carneiro dos Santos1,2 1Research Center of Oncology, Federal University of Pará, Belém, Pará, PA, Brazil; 2Laboratory of Human and Medical Genetics, Institute of Biological Sciences, Belém, Pará, PA, Brazil; 3PTC Laboratory of Biological Engineering-Guamá, Belém, Pará, PA, Brazil; 4Otávio Lobo Children’s Cancer Hospital-HOIOL-Belém, Pará, PA, Brazil; 5Molecular Biology Laboratory of The Ophir Loyola Hospital-HOL-Belém, Pará, PA, Brazil Received August 28, 2020; Accepted October 25, 2020; Epub December 15, 2020; Published December 30, 2020 Abstract: Acute Lymphoblastic Leukemia (ALL) is the most common type of cancer in children. Polymorphisms that alter the normal function of the microRNAs involved in the development of ALL have been widely investigated, although published data on these polymorphisms in admixed populations are scarce. We investigated the role of 10 polymorphisms in the microRNA and protein-coding genes of the microRNA synthesis complex in susceptibility to pediatric B-cell ALL. The study includes 100 pediatric ALL patients and 180 healthy individuals. The statistical analyses were run in SPSS v.25.0. In the case of the microRNA synthesizing genes, a significant pattern was found in only gene, that is, the rs3805500 polymorphism of DROSHA, in which the homozygous mutant (AA) genotype was associated with a threefold increase in the risk of developing ALL when compared to other genotypes (P=0.004, OR=2.913, CI=1.415-5.998). In the microRNA coding genes, the homozygous mutant rs3746444 genotype of the MIR499A gene was associated with a 17-fold increase in the risk of development of ALL (P<0.001, OR=17.797, CI=5.55-57.016). A protective effect against the development of ALL was also observed in the carriers of the wild homozygous rs2505901 genotype in the MIR938 gene. Our findings highlight the potential of these polymorphisms in the genes involving in the coding of microRNAs for the evaluation of the risk of contracting ALL in the population of the Brazilian Amazon region. These findings contribute to a more complete understanding of the complex etiology of ALL. Keywords: Acute lymphoblastic leukemia, microRNAs, single nucleotide polymorphism, susceptibility Introduction carcinogens, as well as chromosomal and molecular alterations [4, 5]. In particular, many Acute Lymphoblastic Leukemia (ALL) is the single nucleotide polymorphisms (SNPs) in key most common type of cancer in children and genes of the regulatory pathways have been adolescents of up to 19 years of age, repre- ascribed a fundamental role in the develop- senting 28% of all malignancies in this age ment of ALL [6]. group and 75% of all cases of leukemia [1-3]. The etiology of ALL is considered to be mul- The investigation of the SNPs found in the tifactorial, involving both environmental and microRNA genes has emerged as a promising genetic factors, which have been investigated new field of genomic research. The principal extensively. These factors include exposure to function of these molecules is to regulate gene Polymorphisms in microRNA genes and the ALL risk expression via post-transcriptional silencing, Selection of the study polymorphisms the cleaving of messenger RNAs (mRNA) or inhibiting the initiation of translation through The SNPs selected for the present study were base pairing between the microRNA and its chosen due to their known association with mRNA target [7]. The presence of SNPs in susceptibility to ALL and different types of microRNA genes or the protein-coding genes cancer, based on the published data. The involved in the synthesis of the microRNAs references of the journal articles used for the may affect their correct functioning, resulting selection of the polymorphisms are listed in in impacts on gene regulation processes [8]. the Table S1 [38-48]. A total of 10 polymor- Despite the important regulatory potential of phisms were selected, seven in microRNA these polymorphisms, few studies have fo- genes and three in the protein-coding genes cused on the influence of the SNPs located in essential to the synthesis of microRNAs: rs- non-coding genomic regions. In addition, evi- 636832 (AGO1), rs10035440 e rs3805500 dence on the occurrence of these polymor- (DROSHA), rs213210 and rs107822 (MIR- phisms in populations with high levels of mis- 219-1), rs2910164 (MIR146a), rs12894467 cegenation, such as that of the Brazilian (MIR300), rs3746444 (MIR499a), rs4919510 Amazon region, is particularly scarce. Given (MIR608), and rs2505901 (MIR938). this, the present study investigated the role of Extraction and quantification of the DNA 10 polymorphisms of the microRNA and microRNA synthesis genes in the susceptibility The DNA was extracted from peripheral blood of pediatric patients from the Brazilian Amazon using a commercial DNA extraction kit (Bio- region to B-cell ALL. pur Mini Spin Plus-250 extraction kit, Biopur, Brazil). The concentration of the genetic mate- Material and methods rial was quantified in a NanoDrop 1000 spec- trophotometer (Scientific Term NanoDrop Patients and controls 1000; NanoDrop Technologies Wilmington, The case group of the present study included DE). 100 patients diagnosed with B-cell ALL by Genotyping of polymorphisms immunophenotyping and/or molecular analy- sis. All these individuals were in treatment The 10 polymorphisms were genotyped by at the Otávio Lobo Hospital in Belém, a refer- allelic discrimination using the TaqMan Open- ence center for the treatment of pediatric can- Array Genotyping technology with a set of 32 cer in the northern region of Brazil. The pa- customized assays, which were run in a tients included in the study were between 1 QuantStudio™ 12K Flex Real-Time PCR sy- and 18 years old. Recurrent patients or those stem (Applied BiosystEM, Life Technologies, with comorbidities were not included in the Carlsbad, USA), according to the manufactur- group. The control group consisted of 180 er’s protocol. This method is based on real- individuals with no diagnosis for B-cell ALL or time Polymerase Chain Reaction (qPCR). The any other type of cancer. None of these indi- quality of the readings of the genotypes and viduals were related to any of the patients in other data were analyzed in the TaqMan the case group, and they were all over the peak Genotyper software. risk age for the development of ALL. Quality control Ethical aspects To ensure an adequate level of accuracy, poly- This study was approved by the Research morphisms were only included in the present Ethics Committee of the Research Center of study if they satisfied three criteria: (i) MAF≥ Oncology of the Federal University of Pará 1%; (ii) genotyping rate ≥80%, and (iii) were in (CAAE number 11433019.5.0000.5634). All Hardy-Weinberg (HWE). The HWE was per- participants (or their legal guardians) signed a formed using the Arlequin software (v.3.5.1.2). term of informed consent authorizing the col- The significance of the HWE test was adjust- lection of samples and data. ed for multiple comparisons by the Bonferroni 8217 Am J Transl Res 2020;12(12):8216-8224 Polymorphisms in microRNA genes and the ALL risk Table 1. Primers used for RT-PCR in the chromosomal USA) with the primers designed specifi- fusion analysis cally for the five fusions mentioned above, Cromossomic Fusion Genes Primer (5’-3’) also following the manufacturer’s in- structions. The primers used for RT-PCR t(1;19)(q23;p13) E2A CTACTCCCCGGATCACTCAA are listed in Table 1. PBX1 AGGCTTCATTCTGTGGCAGT t(4;11)(q21;q23) MLL CGCCCAAGTATCCCTGTAAA Analysis of genomic ancestry AF4 GAGCATGGATGACGTTCCTT t(9;22)(q34;q11) BCR TCGCAGAACTCGCAACAGT The genomic ancestry of the partici- ABL ACACCATTCCCCATTGTGAT pants was analyzed following Santos et t(12;21)(p13;q22) TEL TCTCTCATCGGGAAGACCTG al. (2010) and Ramos et al. (2016), us- ing a set of 61 Ancestry Informative AML1 TGCGGTAGCATTTCTCAGC Markers (AIMs). The individual and glo- del(1)(p32;p32) SIL TCCTACCCTGCAAACAGACC bal proportions of European, Amerindian, TAL1 AGGCGGAGGATCTCATTCTT and African genetic ancestry were esti- mated using STRUCTURE v.2.3.4 [9-11]. Table 2. Demographic parameters for the case (pa- Statistical analyses tients with B-cell ALL) and control groups analyzed in the present study The Chi-square test was applied for the Variable Case (100) Control (180) p-value pairwise comparisons of the categorical Sex (M/F) 60/40 53/127 <0.001a variables between the case and control Age* 5.53 ± 3.991 65.97 ± 16.021 <0.001b groups, while the quantitative variables Genetic ancestry* were compared using Student’s t. The European 0.429 ± 0.133 0.454 ± 0.170 0.189c multivariate analyses considered the sex of the participants and Amerindian African 0.203 ± 0.089 0.241 ± 0.138 0.213c ancestry as confounding variables. The Amerindian 0.361 ± 0.154 0.304 ± 0.149 0.004c Mann-Whitney test was used to com- aChi-square, bStudenta0 t, cMann-Whitney9trU. *Mean ± eStandard Deviation. pare the estimates of genetic ancestry between the groups. All statistical analy- ses were run in SPSS v.25.0 (SPSS, method (P≤0.001), and the HWE values are Chicago, IL, USA), considering a P≤0.05 signifi- shown in the Table S2. As all 10 of the polymor- cance level. phisms selected for the present study satisfied these criteria, they were all included in the Results association analyses (Table S2).
Load more

Recommended publications
  • The Expression of Non-Coding Rnas and Their Target Molecules in Rheumatoid Arthritis
    International Journal of Molecular Sciences Review The Expression of Non-Coding RNAs and Their Target Molecules in Rheumatoid Arthritis: A Molecular Basis for Rheumatoid Pathogenesis and Its Potential Clinical Applications Chang-Youh Tsai 1,*,† , Song-Chou Hsieh 2,†, Chih-Wei Liu 1, Cheng-Hsun Lu 2,3 , Hsien-Tzung Liao 1, Ming-Han Chen 1, Ko-Jen Li 2, Cheng-Han Wu 2,3, Cheih-Yu Shen 2,3 , Yu-Min Kuo 2,3 and Chia-Li Yu 2,* 1 Division of Allergy, Immunology & Rheumatology, Taipei Veterans General Hospital, National Yang-Ming Chiao-Tung University, Taipei 11217, Taiwan; [email protected] (C.-W.L.); [email protected] (H.-T.L.); [email protected] (M.-H.C.) 2 Department of Internal Medicine, National Taiwan University Hospital, National Taiwan University College of Medicine, Taipei 10002, Taiwan; [email protected] (S.-C.H.); [email protected] (C.-H.L.); [email protected] (K.-J.L.); [email protected] (C.-H.W.); [email protected] (C.-Y.S.); [email protected] (Y.-M.K.) 3 Institute of Molecular Medicine, National Taiwan University College of Medicine, Taipei 10002, Taiwan * Correspondence: [email protected] (C.-Y.T.); [email protected] (C.-L.Y.) † The two co-first authors contributed equally in the preparation of the manuscript. Abstract: Rheumatoid arthritis (RA) is a typical autoimmune-mediated rheumatic disease presenting Citation: Tsai, C.-Y.; Hsieh, S.-C.; Liu, C.-W.; Lu, C.-H.; Liao, H.-T.; Chen, as a chronic synovitis in the joint. The chronic synovial inflammation is characterized by hyper- M.-H.; Li, K.-J.; Wu, C.-H.; Shen, C.-Y.; vascularity and extravasation of various immune-related cells to form lymphoid aggregates where an Kuo, Y.-M.; et al.
    [Show full text]
  • Micrornas As New Regulators of Neutrophil Extracellular Trap Formation
    International Journal of Molecular Sciences Review MicroRNAs as New Regulators of Neutrophil Extracellular Trap Formation Sonia Águila † , Ascensión M. de los Reyes-García †, María P. Fernández-Pérez, Laura Reguilón-Gallego, Laura Zapata-Martínez, Inmaculada Ruiz-Lorente, Vicente Vicente , Rocío González-Conejero *,‡ and Constantino Martínez *,‡ Department of Hematology and Medical Oncology, Morales Meseguer University Hospital, Centro Regional de Hemodonación, Universidad de Murcia, IMIB, C/Ronda de Garay S/N, 30003 Murcia, Spain; [email protected] (S.Á.); [email protected] (A.M.d.l.R.-G.); [email protected] (M.P.F.-P.); [email protected] (L.R.-G.); [email protected] (L.Z.-M.); [email protected] (I.R.-L.); [email protected] (V.V.) * Correspondence: [email protected] (R.G.-C.); [email protected] (C.M.); Tel.: +34-968341990 (R.G.-C. & C.M.); Fax: +34-968261914 (R.G.-C. & C.M.) † These authors contributed equally to this work. ‡ These authors shared senior authorship. Abstract: Neutrophil extracellular traps (NETs) are formed after neutrophils expelled their chromatin content in order to primarily capture and eliminate pathogens. However, given their characteristics due in part to DNA and different granular proteins, NETs may induce a procoagulant response linking inflammation and thrombosis. Unraveling NET formation molecular mechanisms as well Citation: Águila, S.; de los as the intracellular elements that regulate them is relevant not only for basic knowledge but also Reyes-García, A.M.; Fernández-Pérez, to design diagnostic and therapeutic tools that may prevent their deleterious effects observed in M.P.; Reguilón-Gallego, L.; several inflammatory pathologies (e.g., cardiovascular and autoimmune diseases, cancer).
    [Show full text]
  • Editorial: Functions of Non-Coding RNA in Innate Immunity
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Frontiers - Publisher Connector EDITORIAL published: 14 December 2015 doi: 10.3389/fimmu.2015.00622 Editorial: Functions of Non-Coding RNA in Innate Immunity Susan Carpenter* Department of Molecular, Cell and Developmental Biology, University of California, Santa Cruz, Santa Cruz, CA, USA Keywords: innate immunity, long non-coding RNAs, miRNAs, inflammation, extracellular RNA Our understanding of the functions that non-coding RNAs play in shaping the immune response is still in its infancy. The breakthroughs in deep sequencing technology have provided us with an unprecedented view of the human genome. The deeper we sequence the more non-coding genes we identify, while the number of protein coding genes remains constant. GENCODE represents the gene set of the ENCODE project and there are currently 15,931 long non-coding RNA (lncRNA) genes, 9,882 small non-coding RNA genes, and 14,477 Pseudogenes cataloged in GENCODE version 231. The contribution of each of these genes to biological processes still remains to be determined. In this research topic, we explore recent data surrounding the functions for microRNA (miRNA) as well as lncRNA within Innate Immunity. Innate immune responses to infection involve the production of pro-inflammatory cytokines such as IL-6 and TNFα in addition to the Type I Interferons (IFNs) that play critical roles in anti-viral immunity. In recent years, there have been huge strides made in understanding the contributions of small RNAs such as miRNA to the Innate Immune processes. More recently, our attention has also been drawn to the growing catalog of lncRNAs.
    [Show full text]
  • Interactome of Mirnas and Transcriptome of Human Umbilical Cord Endothelial Cells Exposed to Short-Term Simulated Microgravity
    www.nature.com/npjmgrav ARTICLE OPEN Interactome of miRNAs and transcriptome of human umbilical cord endothelial cells exposed to short-term simulated microgravity Dharanibalan Kasiviswanathan1,2,4, Rajadurai Chinnasamy Perumal 3,4, Srinivasan Bhuvaneswari1,2, Pavitra Kumar1, ✉ Lakshmikirupa Sundaresan 1,2, Manuel Philip 3, Sajesh Puthenpurackal Krishnankutty3 and Suvro Chatterjee1,2 Adaptation of humans in low gravity conditions is a matter of utmost importance when efforts are on to a gigantic leap in human space expeditions for tourism and formation of space colonies. In this connection, cardiovascular adaptation in low gravity is a critical component of human space exploration. Deep high-throughput sequencing approach allowed us to analyze the miRNA and mRNA expression profiles in human umbilical cord vein endothelial cells (HUVEC), cultured under gravity (G), and stimulated microgravity (MG) achieved with a clinostat. The present study identified totally 1870 miRNAs differentially expressed in HUVEC under MG condition when compared to the cells subjected to unitary G conditions. The functional association of identified miRNAs targeting specific mRNAs revealed that miRNAs, hsa-mir-496, hsa-mir-151a, hsa-miR-296-3p, hsa-mir-148a, hsa-miR-365b-5p, hsa- miR-3687, hsa-mir-454, hsa-miR-155-5p, and hsa-miR-145-5p differentially regulated the genes involved in cell adhesion, angiogenesis, cell cycle, JAK-STAT signaling, MAPK signaling, nitric oxide signaling, VEGF signaling, and wound healing pathways. Further, the q-PCR based experimental studies of upregulated and downregulated miRNA and mRNAs demonstrate that the above 1234567890():,; reported miRNAs influence the cell proliferation and vascular functions of the HUVEC in MG conditions effectively.
    [Show full text]
  • Combined Effects of PVT1 and Mir-146A Single Nucleotide
    Int. J. Biol. Sci. 2018, Vol. 14 1153 Ivyspring International Publisher International Journal of Biological Sciences 2018; 14(10): 1153-1162. doi: 10.7150/ijbs.25420 Research Paper Combined Effects of PVT1 and MiR-146a Single Nucleotide Polymorphism on the Lung Function of Smokers with Chronic Obstructive Pulmonary Disease Sijing Zhou1*, Yi Liu2*, Min Li3, Peipei Wu2, Gengyun Sun2, Guanghe Fei2, Xuan Xu4, Xuexin Zhou5, Luqian Zhou5, Ran Wang2 1. Hefei Prevention and Treatment Center for Occupational Diseases, Hefei 230022, China 2. Department of respiratory and critical care medicine, the first affiliated hospital of Anhui medical university, Hefei 230022, China 3. Department of oncology, the first affiliated hospital of Anhui medical university, Hefei 230022, China 4. Division of Pulmonary/Critical Care Medicine, Cedars sinai Medical Center, Los Angeles 90015, USA 5. The first clinical college of Anhui medical university, Hefei 230032, China *These authors contributed equally to the work. Corresponding author: Ran Wang Ph.D., Department of respiratory and critical care medicine, The first affiliated hospital of Anhui medical university, Hefei, 230022, China. Phone: 86-551-62922913; Fax: 86-551-62922913; E-mail: [email protected] © Ivyspring International Publisher. This is an open access article distributed under the terms of the Creative Commons Attribution (CC BY-NC) license (https://creativecommons.org/licenses/by-nc/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2018.02.07; Accepted: 2018.06.16; Published: 2018.06.23 Abstract Non-coding RNAs play an important role in the pathogenesis of chronic obstructive pulmonary disease (COPD). This study was performed to investigate the role of PVT1 and miR-146a single nucleotide polymorphisms (SNPs) in the lung function of COPD smokers.
    [Show full text]
  • Downloaded from 10X Genomics Datasets Available on Link
    International Journal of Molecular Sciences Article Unravelling the Role of Trophoblastic-Derived Extracellular Vesicles in Regulatory T Cell Differentiation Árpád Ferenc Kovács 1,* ,Nóra Fekete 1, Lilla Turiák 2 , András Ács 2 ,László K˝ohidai 1 , Edit I. Buzás 1,3,4 and Éva Pállinger 1 1 Department of Genetics, Cell- and Immunobiology, Semmelweis University, H-1085 Budapest, Hungary 2 MS Proteomics Research Group, Research Centre for Natural Sciences, Hungarian Academy of Sciences, H-1051 Budapest, Hungary 3 MTA-SE Immune-Proteogenomics Extracellular Vesicle Research Group, H-1085 Budapest, Hungary 4 HCEMM-SE Extracellular Vesicle Research Group, H-1085 Budapest, Hungary * Correspondence: [email protected] Received: 21 June 2019; Accepted: 11 July 2019; Published: 14 July 2019 Abstract: Regulatory T cells (Treg) are mandatory elements in the maintenance of human pregnancy, but their de novo differentiation has not been completely exposed. HSPE1 chaperone expressing trophoblast cells may have a role in it. Trophoblast-derived extracellular vesicles (EVs), either at the feto–maternal interface or in circulation, target CD4+ T cells. We hypothesized that HSPE1-associated trophoblastic cell line (BeWo)-derived EVs are active mediators of Treg cell differentiation. We proved at first that recombinant HSPE1 promote human Treg cell differentiation in vitro. Developing a CRISPR-Cas9 based HSPE1 knockout BeWo cell line we could also demonstrate, that EV-associated HSPE1 induces Treg development. Next-generation sequencing of miRNA cargo of BeWo-EVs characterized the regulatory processes of Treg polarization. By the use of single-cell transcriptomics analysis, seven Treg cell subtypes were distinguished and we demonstrated for the first time that the expression level of HSPE1 was Treg subtype dependent, and CAPG expression is characteristic to memory phenotype of T cells.
    [Show full text]
  • Functional Polymorphisms in Pre-Mir146a and Pre-Mir499 Are
    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 54), pp: 91876-91886 Research Paper Functional polymorphisms in pre-miR146a and pre-miR499 are associated with systemic lupus erythematosus but not with rheumatoid arthritis or Graves’ disease in Mexican patients Isidro Alemán-Ávila1,2, Mayra Jiménez-Morales1, Olga Beltrán-Ramírez1, Rosa Elda Barbosa-Cobos3, Silvia Jiménez-Morales4, Fausto Sánchez-Muñoz5, Guillermo Valencia-Pacheco6, Luis M. Amezcua-Guerra5, Yaneli Juárez-Vicuña5, Dulce Milagro Razo-Blanco Hernández7, María Concepción Aguilera-Cartas8, Ricardo F. López-Villanueva9, Oscar Peralta-Zaragoza10, Carlos Tovilla-Zárate11 and Julian Ramírez-Bello1 1Endocrine and Metabolic Disease Unit Research, Hospital Juarez of Mexico, Mexico City, Mexico 2Superior School of Medicine Postgraduate Program, National Polytechnic Institute, Mexico City, Mexico 3Rheumatology Department, Hospital Juarez of Mexico, Mexico City, Mexico 4Laboratory of Cancer Genomics, National Institute of Genomic Medicine, Mexico City, Mexico 5Immunology Department, National Institute of Cardiology, Mexico City, Mexico 6Hematology Laboratory, Regional Research Center, Autonomous University of Yucatan, Yucatan, Mexico 7Research Direction, Hospital Juarez of Mexico, Mexico City, Mexico 8Endocrinology Department, Hospital Juarez of Mexico, Mexico City, Mexico 9Rheumatology Department, Regional Hospital General (ISSSTE), Health Service Yucatan, Yucatan, Mexico 10 Direction of Chronic Infections and Cancer, Research Center in Infection Diseases, National
    [Show full text]
  • Associations of Mirna Polymorphisms and Expression Levels with Breast Cancer Risk in the Chinese Population
    Associations of miRNA polymorphisms and expression levels with breast cancer risk in the Chinese population P. Qi1, L. Wang2, B. Zhou2, W.J. Yao3, S. Xu1, Y. Zhou1 and Z.B. Xie1 1Department of Head-Neck and Breast Surgery, Xinxiang Central Hospital, Xinxiang, China 2Department of General Surgery, The First Affiliated Hospital of Xinxiang Medical University, Xinxiang, China 3Department of Thoracic Surgery, The First Affiliated Hospital of Xinxiang Medical University, Xinxiang, China Corresponding author: P. Qi E-mail: [email protected] Genet. Mol. Res. 14 (2): 6289-6296 (2015) Received March 3, 2015 Accepted May 14, 2015 Published June 11, 2015 DOI http://dx.doi.org/10.4238/2015.June.11.2 ABSTRACT. Single-nucleotide polymorphisms in microRNAs (miRNAs) may dramatically affect gene expression and subsequently alter individual susceptibility to cancer, and thus has become a research hotspot for many cancer types, including breast cancer. We recruited 321 breast cancer patients and 290 controls in our study. Four established miRNA single-nucleotide polymorphisms (mir-499 rs3746444 A>G; miR-27a rs895819 A>G; miR-196a2 rs11614913 T>C; miR-146a rs2910164 G/C) were detected using Taqman assays. Mature miRNA expression, allele distribution, and the association with clinical features were further analyzed. Our results showed that the miR146a rs2910164 G/C polymorphism was associated with an elevated risk of breast cancer (odds ratio = 1.85, 95% confidence interval = 1.03-3.32; P < 0.05). Compared with the ancestral T allele Genetics and Molecular Research 14 (2): 6289-6296 (2015) ©FUNPEC-RP www.funpecrp.com.br P. Qi et al.
    [Show full text]
  • Role of Microrna (Mirna) and Viroids in Lethal Diseases of Plants and Animals
    ISSN 0006-2979, Biochemistry (Moscow), 2018, Vol. 83, No. 9, pp. 1018-1029. © Pleiades Publishing, Ltd., 2018. Published in Russian in Biokhimiya, 2018, Vol. 83, No. 9, pp. 1283-1298. REVIEW Role of microRNA (miRNA) and Viroids in Lethal Diseases of Plants and Animals. Potential Contribution to Human Neurodegenerative Disorders L. Cong1,2, Y. Zhao1,3, A. I. Pogue4, and W. J. Lukiw1,5,6,a* 1Neuroscience Center, Louisiana State University School of Medicine, Louisiana State University Health Sciences Center, New Orleans LA 70112-2272, USA 2Department of Neurology, Shengjing Hospital, China Medical University, Heping District, Shenyang, Liaoning Province, China 3Department of Anatomy and Cell Biology, Louisiana State University School of Medicine, Louisiana State University Health Sciences Center, New Orleans LA 70112-2272, USA 4Alchem Biotech Research, Toronto ON M5S 1A8, Canada 5Department Neurology, Louisiana State University School of Medicine, New Orleans LA 70112-2272, USA 6Department Ophthalmology, Louisiana State University School of Medicine, New Orleans LA 70112-2272, USA ae-mail: [email protected] Received April 19, 2018 Revision received May 25, 2018 Abstract—Both plants and animals have adopted a common strategy of using ~18-25-nucleotide small non-coding RNAs (sncRNAs), known as microRNAs (miRNAs), to transmit DNA-based epigenetic information. miRNAs (i) shape the total transcriptional output of individual cells; (ii) regulate and fine-tune gene expression profiles of cell clusters, and (iii) modu- late cell phenotype in response to environmental stimuli and stressors. These miRNAs, the smallest known carriers of gene- encoded post-transcriptional regulatory information, not only regulate cellular function in healthy cells but also act as impor- tant mediators in the development of plant and animal diseases.
    [Show full text]
  • MAFB Determines Human Macrophage Anti-Inflammatory
    MAFB Determines Human Macrophage Anti-Inflammatory Polarization: Relevance for the Pathogenic Mechanisms Operating in Multicentric Carpotarsal Osteolysis This information is current as of October 4, 2021. Víctor D. Cuevas, Laura Anta, Rafael Samaniego, Emmanuel Orta-Zavalza, Juan Vladimir de la Rosa, Geneviève Baujat, Ángeles Domínguez-Soto, Paloma Sánchez-Mateos, María M. Escribese, Antonio Castrillo, Valérie Cormier-Daire, Miguel A. Vega and Ángel L. Corbí Downloaded from J Immunol 2017; 198:2070-2081; Prepublished online 16 January 2017; doi: 10.4049/jimmunol.1601667 http://www.jimmunol.org/content/198/5/2070 http://www.jimmunol.org/ Supplementary http://www.jimmunol.org/content/suppl/2017/01/15/jimmunol.160166 Material 7.DCSupplemental References This article cites 69 articles, 22 of which you can access for free at: http://www.jimmunol.org/content/198/5/2070.full#ref-list-1 by guest on October 4, 2021 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2017 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606.
    [Show full text]
  • Accepted Author Manuscript Published in GLIA
    UvA-DARE (Digital Academic Repository) miR147b: A novel key regulator of interleukin 1 beta-mediated inflammation in human astrocytes van Scheppingen, J.; Mills, J.D.; Zimmer, T.S.; Broekaart, D.W.M.; Iori, V.; Bongaarts, A.; Anink, J.J.; Iyer, A.M.; Korotkov, A.; Jansen, F.E.; van Hecke, W.; Spliet, W.G.; van Rijen, P.C.; Baayen, J.C.; Vezzani, A.; van Vliet, E.A.; Aronica, E. DOI 10.1002/glia.23302 Publication date 2018 Document Version Accepted author manuscript Published in GLIA Link to publication Citation for published version (APA): van Scheppingen, J., Mills, J. D., Zimmer, T. S., Broekaart, D. W. M., Iori, V., Bongaarts, A., Anink, J. J., Iyer, A. M., Korotkov, A., Jansen, F. E., van Hecke, W., Spliet, W. G., van Rijen, P. C., Baayen, J. C., Vezzani, A., van Vliet, E. A., & Aronica, E. (2018). miR147b: A novel key regulator of interleukin 1 beta-mediated inflammation in human astrocytes. GLIA, 66(5), 1082- 1097. https://doi.org/10.1002/glia.23302 General rights It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons). Disclaimer/Complaints regulations If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website.
    [Show full text]
  • B-Dependent Induction of Microrna Mir-146, an Inhibitor Targeted to Signaling Proteins of Innate Immune Responses
    NF-␬B-dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses Konstantin D. Taganov*, Mark P. Boldin*, Kuang-Jung Chang, and David Baltimore† Division of Biology, California Institute of Technology, 1200 East California Boulevard, Pasadena, CA 91125 Contributed by David Baltimore, June 23, 2006 Activation of mammalian innate and acquired immune responses TLR signal transduction by interfering with upstream signaling must be tightly regulated by elaborate mechanisms to control their pathways. Several classes of negative regulators of the TLR system onset and termination. MicroRNAs have been implicated as neg- have been described in the past: soluble decoy receptors (sTLR2͞ ative regulators controlling diverse biological processes at the level 4), cell-surface transmembrane receptors (ST2, SIGRR, and of posttranscriptional repression. Expression profiling of 200 mi- TRAILR), and numerous intracellular proteins: IRAK-M, sup- croRNAs in human monocytes revealed that several of them pressor of cytokine signaling 1 (SOCS1), MyD88 short (MyD88s), (miR-146a͞b, miR-132, and miR-155) are endotoxin-responsive inhibitor of NF-␬B(I␬B), and A20 (3). genes. Analysis of miR-146a and miR-146b gene expression un- MicroRNAs (miRNAs) are an evolutionarily conserved class of veiled a pattern of induction in response to a variety of microbial endogenous Ϸ22-nt noncoding RNAs involved in posttranscrip- components and proinflammatory cytokines. By means of pro- tional gene repression (4–6). In animals, miRNAs are processed moter analysis, miR-146a was found to be a NF-␬B-dependent from long primary transcripts [pri-miRNAs (pri-miR)] through an gene. Importantly, miR-146a͞b were predicted to base-pair with Ϸ60-bp hairpin precursor step [pre-miRNAs (pre-miR)] into the ,sequences in the 3؅ UTRs of the TNF receptor-associated factor 6 mature forms by sequential cutting with two RNase III enzymes and IL-1 receptor-associated kinase 1 genes, and we found that Drosha and Dicer (7, 8).
    [Show full text]