Mutation Screening in Patients with Isolated Cytochrome C Oxidase Deﬁciency

0031-3998/03/5302-0224 PEDIATRIC RESEARCH Vol. 53, No. 2, 2003 Copyright © 2003 International Pediatric Research Foundation, Inc. Printed in U.S.A. Mutation Screening in Patients With Isolated Cytochrome c Oxidase Deficiency SABRINA SACCONI, LEONARDO SALVIATI, CAROLYN M. SUE, SARA SHANSKE, MERCY M. DAVIDSON, EDUARDO BONILLA, ALI B. NAINI, DARRYL C. DE VIVO, AND SALVATORE DIMAURO Department of Neurology [S.Sa., L.S., C.M.S., S.Sh., M.M.D., E.B., A.B.N., D.C.D.V., S.D.], Columbia University College of Physicians and Surgeons, New York, New York 10032, U.S.A.; Department of Neurology [S. Sa.], University of Modena, Via Del Pozzo 71, 44100, Modena, Italy; and Center for Rare Diseases, Department of Pediatrics [L.S.], University of Padova, Via Giustiniani 3, 35128, Padova, Italy ABSTRACT Cytochrome c oxidase (COX) deficiency has been associated mutations in a patient with Leigh syndrome and one novel SCO2 with a variety of clinical conditions and can be due to mutations in mutation in a patient with hypertrophic cardiomyopathy. These data nuclear or mitochondrial genes. Despite recent progress in our show that heterogeneous clinical phenotypes are associated with understanding of the molecular bases of COX deficiency, the ge- COX deficiency, that mutations in mtDNA COX genes are rare, and netic defect remains elusive in many cases. We performed mutation that mutations in additional genes remain to be identified. (Pediatr screening in 30 patients with biochemical evidence of isolated COX Res 53: 224–230, 2003) deficiency and heterogeneous clinical phenotypes. Sixteen patients had various forms of encephalomyopathy, and six of these had the neuroradiological features of Leigh syndrome. Four patients had Abbreviations encephalohepatopathy, six had hypertrophic cardiomyopathy, and COX, cytochrome c oxidase (EC 1.9.3.1) four had other phenotypes. We studied the three mtDNA genes mtDNA, mitochondrial DNA encoding COX subunits, the 22 mtDNA tRNA genes, and seven nDNA, nuclear DNA COX assembly genes: SCO1, SCO2, SURF1, COX10, COX11, SSCP, single strand conformational polymorphism COX15, and COX17. We report two novel pathogenic SURF1 LS, Leigh syndrome Cytochrome c oxidase (COX), complex IV of the mitochondrial different polypeptides, and the delivery and insertion of the pros- respiratory chain (EC 1.9.3.1), catalyzes the transfer of reducing thetic groups into the holoenzyme. In theory, COX deficiency equivalents from cytochrome c to molecular oxygen and utilizes may result from mutations in structural subunits of the enzyme or the energy generated by this reaction to pump protons across the in ancillary proteins required for its assembly (2). mitochondrial inner membrane. COX, active as a dimer, com- To date, pathogenic mutations have been described in the three prises 13 subunits, two heme groups (a and a3), three copper ions mtDNA genes and in four COX assembly genes, SCO1 (3), SCO2 (two in the CuA site and one in CuB site), a zinc ion, and a (4), COX10 (5), and SURF1 (6, 7). These result in a variety of magnesium ion (1). The biogenesis of COX requires the interplay clinical phenotypes. However, in some patients with isolated of two genomes. Mitochondrial DNA (mtDNA) encodes the three COX deficiency, the molecular defects remain elusive. larger subunits (COX I, COX II, and COX III) that compose the In a series of 30 patients with COX deficiency and unknown catalytic core of the enzyme and contain the prosthetic groups. molecular causes, we screened for mutations in the three mtDNA Nuclear DNA (nDNA) encodes the 10 smaller COX subunits, COX genes, the 22 mtDNA tRNA genes, the four nDNA COX- which have regulatory and structural functions, and several acces- assembly genes already associated with disease in humans (SURF1, sory proteins, which control the folding and maturation of the SCO1, SCO2, and COX10), and three candidate COX-assembly genes (COX11, COX15, and COX17). The yield was meager: one Received April 2, 2002; accepted October 11, 2002. patient had two novel mutations in SURF1, and one had a novel Correspondence: Salvatore DiMauro, M.D., 4-420 College of Physicians and Surgeons, mutation in SCO2 associated with the common E140 K mutation. 630 West 168th St, New York, NY 10032, U.S.A.; e-mail [email protected] This work was supported by National Institutes of Health Grants PO1HD32062 and NS11766 and by a grant from the Muscular Dystrophy Association. L.S. is supported by METHODS grant 439b from Telethon Italia and by a scholarship from the University of Padova. S.Sa. and L.S. contributed equally to this work. We studied 30 patients with isolated COX deficiency [COX DOI: 10.1203/01.PDR.0000048100.91730.6A activity in muscle (referred to citrate synthase) below 33% of the 224 MUTATION SCREENING IN COX DEFICIENCY 225 normal mean; other respiratory chain enzyme activities within The entire coding region of SCO1, SCO2, COX10, COX11, normal ranges]. Table 1 lists clinical and biochemical features. It COX15, and COX17 was amplified as summarized in Table 2. should be noted that four patients with typical Leigh syndrome SURF1 (7); mtDNA tRNA genes (12); and COX I, COX II, and (LS) had already been screened for SURF1 and SCO2 mutations COX III were amplified as described (13). and found negative by Sue et al. (8). They were included in this Mutation screening was performed by direct sequencing of study to be screened for other gene defects. Biopsies were ob- SURF1, SCO2, COX I, COX II, COX III, and mtDNA tRNA tained with the informed consent of parents or guardians, and all genes, using the ABI PRISM Dye Terminator Cycle Sequenc- studies were approved by the Institutional Review Board of ing Ready Reaction Kit and 310 Automatic Sequencer (Ap- Columbia University College of Physicians & Surgeons. plied Biosystem, Perkin Elmer, Foster City, CA, U.S.A.). The Biochemical analysis. Measurements of respiratory chain remaining genes were studied by single strand conformational enzymes activities were performed in skeletal muscle as de- polymorphism (SSCP) analysis. scribed (9). COX activity was measured in liver in one patient SSCP analysis. A total of 100 ng of genomic DNA was and in heart in two patients. amplified as described in Table 2. Reactions were carried out in ␮ Histochemical analysis. Muscle biopsies were stained for 25 L of 10 mM Tris-HCl (pH 8.9); 1.5 mM MgCl2; 0.4 mM COX and succinate dehydrogenase as described (10). each forward and reverse oligonucleotides; 0.2 mM each DNA analysis. DNA was extracted from tissues according to dATP, dGTP, and dTTP; 0.02 mM dCTP and 1 ␮Ci of ␣32P standard protocols (11). dCTP; and 1.25 units of TAQ DNA polymerase (Roche, Basel, Table 1. Age of COX activity Patient onset/(death) Sex Clinical Phenotype (% of controls) Family history Group 1: Leigh Syndrome 1 3 mo M Leigh syndrome 24 Negative 2 Birth F Leigh syndrome 13 Negative 3 2 mo M Leigh syndrome 9 Negative 4 2 mo F Leigh syndrome 4 Negative 5 6 mo F Leigh syndrome 23 Parental consanguinity 6 2 mo F Leigh syndrome 16 Negative Group 2: Encephalomyopathy 7 Birth M Encephalopathy, lactic acidosis 28 Negative 8 Birth (9 days) F Encephalomyopathy 30 Negative 9 Birth M Encephalomyopathy, seizures, lactic acidosis 14 Negative 10 Birth M Encephalomyopathy 3 Negative 11 Birth (18 days) F Encephalomyopathy 11 Parental consanguinity, one affected sister. 12 Birth M Encephalomyopathy, lactic acidosis 21 Negative 13 Birth (10 mo) M Encephalomyopathy, lactic acidosis 28 One affected brother 14 6 mo M Encephalomyopathy seizures 24 Negative 15 4 mo F Encephalomyopathy, lactic acidosis 22 Negative 16 3 mo M Encephalomyopathy 19 One affected sister Group 3 Encephalopathy, Myoclonus, and optic atrophy 17 Birth F Encephalopathy, seizures, myoclonus, optic atrophy 25 One affected sister 18 Birth F Encephalomyopathy, myoclonus, optic atrophy lactic 27 Negative acidosis Group 4 Hepatoencephalopathy 19 Birth (3 mo) M Hepatoencephalopathy, HCMP, myopathy 5* Negative 20 7 mo (12 mo) M Hepatoencephalopathy, seizures 16 Negative 21 Birth M Hepatoencephalopathy 1** Negative 22 Birth (9 mo) F Hepatoencephalopathy 12 Negative Group 5 Hypertrophic cardiomyopathy 23 2 years F HCMP 27 Negative 24 Birth (12 mo) F HCMP 6* Negative 25 Birth (16 days) M HCMP, lactic acidosis 21 Negative 26 Birth M HCMP, encephalomyopathy 5 Negative 27 Birth F HCMP, myopathy 29 Negative 28 Birth M HCMP, encephalomyopathy 7 One affected brother Group 6: Other 29 Birth F Isolated myopathy 27 Negative 30 3 years M Myoclonus, white matter disease, cerebellar atrophy, 26 One affected brother high CSF lactate * COX activity measured in heart. ** COX activity measured in liver. 226 SACCONI ET AL. Table 2. Exon Primers PCR Conditions DMSO % COX10 EX1 agacaccacgctctcctttc 94° 3 min, (94° 45 s, 55° 45 s, 72° 30 s) 33 cycles, 5 ctcgcacgtggtaataagag 72° 7 min EX 2 gggaggtgtagtcatcatttg 94° 3 min, (94° 45s, 55° 45s, 72° 30s) 33 cycles, 5 ggcagaaagtaacagagtaag 72° 7 min EX 3a aaccatttgagagcatttggg 94° 3 min, (94° 45s, 55° 45s, 72° 30s) 33 cycles, 5 ccctacatctattgagtcttc 72° 7 min EX 3b gatagaactagagccagactc 94° 3 min (94° 30s, 60° 30s, 72° 30s) 35 cycles, 5 taagacaggacctgcagttc 72° 7 min EX 4 tacagttgggactcctgttg 94° 3 min, (94° 45s, 55° 45s, 72° 30s) 33 cycles, 5 acagccatctaggaaaaagtg 72° 7 min EX 5 gttcagtactaaagcggaag 94° 3 min, (94° 45s, 55° 45s, 72° 30s) 33 cycles, 5 gtgggaaatgattcagatgaac 72° 7 min EX 6* tgatcactccaggttctctg 94° 3 min, (94° 45s, 55° 45s, 72° 30s) 33 cycles, 5 gtgctcatatgagactccac 72° 7 min EX 7a tgatgactgcctttgtctcc 94° 3 min, (94° 45s, 55° 45s, 72° 30s) 33 cycles, 5 ggagatgtacgcattgatgg 72°

Load more