Importance of TGF-Beta Signaling in Dendritic Cells to Maintain Immune Tolerance

Importance of TGF-beta Signaling in Dendritic Cells to Maintain Immune Tolerance

Item Type text; Electronic Dissertation

Authors Ramalingam, Rajalakshmy

Publisher The University of Arizona.

Rights Copyright © is held by the author. Digital access to this material is made possible by the University Libraries, University of Arizona. Further transmission, reproduction or presentation (such as public display or performance) of protected items is prohibited except with permission of the author.

Download date 07/10/2021 19:37:27

Link to Item http://hdl.handle.net/10150/228458 IMPORTANCE OF TGF-BETA SIGNALING IN DENDRITIC CELLS TO MAINTAIN

IMMUNE TOLERANCE

RAJALAKSHMY RAMALINGAM

A Dissertation Submitted to the Faculty of the

DEPARTMENT OF IMMUNOBIOLOGY

In Partial Fulfillment of the Requirements For the Degree of DOCTOR OF PHILOSOPHY

In the Graduate College

THE UNIVERSITY OF ARIZONA

2012 2

THE UNIVERSITY OF ARIZONA GRADUATE COLLEGE

As members of the Dissertation Committee, we certify that we have read the dissertation prepared by Rajalakshmy Ramalingam entitled “Importance of TGF-beta Signaling in Dendritic Cells to Maintain Immune Tolerance” and recommend that it be accepted as fulfilling the dissertation requirement for the Degree of Doctor of Philosophy

Date: 4/16/2012 Pawel Kiela

Date: 4/16/2012 Thomas Doetschman

Date: 4/16/2012 Fayez Ghishan

Date: 4/16/2012 Janko Nikolich Zugich

Date: 4/16/2012 David Harris

Final approval and acceptance of this dissertation is contingent upon the candidate’s submission of the final copies of the dissertation to the Graduate College.

I hereby certify that I have read this dissertation prepared under my direction and recommend that it be accepted as fulfilling the dissertation requirement.

Date: 4/16/2012 Dissertation Director: Thomas Doetschman

STATEMENT BY AUTHOR

This dissertation has been submitted in partial fulfillment of requirements for an advanced degree at the University of Arizona and is deposited in the University Library to be made available to borrowers under rules of the Library.

Brief quotations from this dissertation are allowable without special permission, provided that accurate acknowledgment of source is made. Requests for permission for extended quotation from or reproduction of this manuscript in whole or in part may be granted by the author.

SIGNED: Rajalakshmy Ramalingam

ACKNOWLEDGEMENTS

This dissertation would not have been possible without the support and encouragement of my mentors, colleagues and friends.

First and foremost, I would like to thank my mentor, Dr. Pawel Kiela, for his guidance, encouragement, support, patience, and most importantly, his friendship during my graduate studies. He has helped me to not only grow as an experimentalist but also as an independent thinker. Thank you Pawel for giving me the opportunity to develop my independence and individuality.

I would also like to extend my sincere gratitude to Dr. Ghishan who has always been a source of inspiration for me with his wealth of knowledge and incredible enthusiasm for science. Thank you Dr. Ghishan for all the opportunities that you have given me and for having faith in me.

I am extremely grateful to my committee members: Dr. Janko Nikolich Zugich, Dr. Thomas Doetschman and Dr. David Harris for all their support and encouragement. Your insights and comments are very much appreciated.

A big thank you to all my lab members (past and present): Monica Kiela, Claire Larmonier, Robert Thurston, Daniel Laubitz, Rita Marie Woodford, Pawel Kojs, Faihza Hill, Hua Xu and Jing Li. I couldn’t have done it without all your help.

I would also like to extend my appreciation to Darya Alizadeh, Paula Campbell, Ramireddy Bommireddy and the Genomics shared facility for all their technical help.

Special thanks to Collin Lacasse for being a good friend and colleague right from my first day in the United States.

Thanks to all the Staff of the Pediatrics and Immunobiology department.

A big hug and thanks to my Tucson friends, Neha, Uma and Bhavani for being there for me. I will always cherish our experiences together.

Finally, thanks to the Dorrance Family foundation for my fellowship without which this dissertation would not have been possible.

DEDICATION

I would like to dedicate this dissertation to my husband, parents, brother and grandparents, who have always supported me in all my endeavors, stood by me in all my decisions and loved me unconditionally.

Vijay, Amma, Appa, Shiva, Paati’s and Thatha’s

I thank you all for loving me and taking care of me. You accepted me for what I am and taught me to become a better person. You gave me strength and showed me that hope remained. You inspired me by your ways, and you showed me that every experience in this life-no matter how bad-serves to teach us a lesson and to give us wisdom. I thank you all for having faith in me and for being there for me. I hope I have given you something to be proud of. Love you all.

TABLE OF CONTENTS

LIST OF FIGURES ...... 8

LIST OF TABLES ...... 11

ABBREVIATIONS ...... 12

ABSTRACT ...... 16

CHAPTER 1 – INTRODUCTION ...... 18 1-1 Overall Aims and Objectives ...... 20 1-2 Significance of Research ...... 21 1-3 Organization of Dissertation ...... 22 CHAPTER 2 – LITERATURE REVIEW ...... 24 2-1 Immunological Tolerance ...... 24 2-1-1 Mechanisms of Tolerance ...... 25 2-1-2 Regulatory T cells and Immune Tolerance ...... 31 2-1-3 Breakdown of Immune Tolerance ...... 38 2-2 TGFβ – An Essential Mediator of Immune Tolerance ...... 39 2-2-1 TGFβ Expression and Activation ...... 39 2-2-2 TGFβ Receptor and Signaling ...... 41 2-2-3 Regulation of Immune responses by TGFβ ...... 42 2-3 Dendritic Cell Mediated Tolerogenic Responses ...... 46 2-3-1 DC Subsets Involved in Tolerance Induction ...... 46 2-3-2 Mechanisms of Tolerance Induction by DCs ...... 50 2-4 Dendritic Cells and TGF-beta...... 53 2-4-1 TGFβ Regulation of Langerhans Cell Development ...... 53 2-4-2 TGFβ Regulation of DC Maturation and Migration ...... 54 2-4-3 TGFβ Regulation of DC Function ...... 55 2-4-4 Regulation of DC Function by TGFβ in vivo ...... 56 CHAPTER 3 – MATERIALS AND METHODS ...... 58 3-1 Mice ...... 58 3-2 PCR ...... 58 3-3 Generation of BMDCs ...... 59 3-4 Flow cytometry ...... 60 3-5 Adoptive transfer of BMDCs in an induced model of colitis ...... 62 3-6 Microarray analysis ...... 62 7

TABLE OF CONTENTS - Continued

3-7 Western blot analysis ...... 63 3-8 Realtime PCR ...... 64 3-9 Histology ...... 64 3-10 Immunohistochemistry ...... 64 3-11 ELISA and multiplex assays ...... 65 3-12 Treg conversion assay ...... 66 3-13 iTreg generation ...... 66 3-14 Statistical analysis ...... 66 CHAPTER 4 – RESULTS ...... 67

4-1 Specificity of Tgfbr2 deletion in DC-Tgfbr2 KO mice ...... 67 4-2 Absence of TGFβ signaling in DCs leads to multi-organ autoimmune inflammation ...... 71 4-3 Impaired TGFβ signaling in DCs leads to T and B cell activation ...... 74 4-4 Tgfbr2-deficiency does not affect differentiation of major DC subtypes or MHCII and co-stimulatory molecule expression in vivo ...... 79 4-5 Dendritic cells from DC-Tgfbr2 KO mice are proinflammatory ...... 82 4-6 Alteration of regulatory T cell phenotype in DC-Tgfbr2 KO mice ...... 91 4-7 Increased IFNγ production by Tgfbr2 KO DCs inhibits As-specific Treg differentiation ...... 94 4-8 In vitro generated iTregs partially protect from autoimmunity in DC- Tgfbr2 KO mice ...... 100 CHAPTER 5 – DISCUSSION...... 104 CHAPTER 6 – POLYCLONAL CD4+FOXP3+ T CELLS GENERATED EX-VIVO INDUCE TGFβ, BUT NOT IL-10 DEPENDENT TOLEROGENIC DENDRITIC CELLS THAT SUPPRESS MURINE LUPUS-LIKE SYNDROME ...... 109 6-1 ABSTRACT ...... 109 6-2 INTRODUCTION...... 111 6-3 METHODS ...... 113 6-4 RESULTS ...... 117 6-5 DISCUSSION ...... 136 CHAPTER 7 – CONCLUSIONS AND FUTURE DIRECTIONS ...... 141 7-1 Conclusions ...... 141 7-2 Future directions ...... 145 REFERENCES ...... 147 8

LIST OF FIGURES

CHAPTER 2

Figure 2.1: Receptor editing in B cells with self-reactive B cell receptors ...... 27

Figure 2.2: Central tolerance mechanisms ...... 28

Figure 2.3: T cell intrinsic mechanisms of peripheral tolerance ...... 30

Figure 2.4: Development of Foxp3+ Tregs in the thymus involves interaction with thymic stromal cells via various molecules ...... 33

Figure 2.5: Basic mechanisms used by Treg cells ...... 38

Figure 2.6: Diagrammatic representation of pre-pro-TGF-beta structure and mechanisms regulating biologic activity of TGF-beta...... 41

Figure 2.7: TGF-beta signaling pathway ...... 42

Figure 2.8: Tolerance induction by immature DCs ...... 51

CHAPTER 3

Figure 3.1: Gating strategy for analysis of dendritic cells from the spleen ...... 61

CHAPTER 4

Figure 4.1: Specificity of Tgfbr2 deletion in DC-Tgfbr2 KO mice ...... 67

Figure 4.2: TGFBR2 expression is not affected in B cells, NK cells and macrophages ...... 68 Figure 4.3: TGFBR2 expression is not affected in CD4 T cells ...... 70

Figure 4.4: DC-Tgfbr2 KO mice die prematurely ...... 71

Figure 4.5: Pathology of DC-Tgfbr2 KO mice ...... 73

Figure 4.6: Premature thymic involution in DC-Tgfbr2 KO mice ...... 75

Figure 4.7: Increased T cell activation in DC-Tgfbr2 KO mice ...... 77

Figure 4.8: Activation of B cell responses in DC-Tgfbr2 KO mice ...... 78 9

LIST OF FIGURES – Continued

Figure 4.9: Tgfbr2-deficiency does not affect differentiation of major DC subtypes in the spleen ...... 80 Figure 4.10: Tgfbr2-deficiency does not affect MHCII or co-stimulatory molecule expression in the spleen...... 81 Figure 4.11: Increased frequency of CCR7+ DCs in DC-Tgfbr2 KO mice ...... 82

Figure 4.12: Increased frequency of E-cadherin+ DCs in MLN of DC-Tgfbr2 KO mice ...... 83 Figure 4.13: Tgfbr2 KO BMDCs are more proinflammatory ...... 84

Figure 4.14: Tgfbr2 KO BMDCs exacerbate severity of disease in a mouse model of colitis ...... 85 Figure 4.15: Microarray analysis of splenic DCs from DC-Tgfbr2 KO mice ...... 87

Figure 4.16: Microarray analysis of CD103+ MLN DCs from DC-Tgfbr2 KO mice ...... 90 Figure 4.17: Tregs in the thymus of DC-Tgfbr2 KO mice ...... 92

Figure 4.18: Tregs in the spleen and MLN of DC-Tgfbr2 KO mice ...... 93

Figure 4.19: CD25+Foxp3+ Tregs in the spleen and MLN of DC-Tgfbr2 KO mice ...... 94 Figure 4.20: Impaired iTreg differentiation by BMDCS from DC-Tgfbr2 KO mice ...... 96 Figure 4.21: Increased IFNγ expression by BMDCs from DC-Tgfbr2 KO mice inhibit Treg differentiation ...... 98 Figure 4.22: Impaired iTreg differentiation by MLN DCs from DC-Tgfbr2 KO mice ...... 99 Figure 4.23: Increased IFNγ expression by MLN DCs from DC-Tgfbr2 KO mice inhibit Treg differentiation ...... 100

Figure 4.24: Adoptive transfer of Tregs partially rescues the autoimmune phenotype of DC-Tgfbr2 KO mice ...... 102 10

LIST OF FIGURES – Continued

CHAPTER 6

Figure 6.1: Differentiation of iTregs from naïve T cells after TGFβ priming ...... 118

Figure 6.2: Polyclonal iTregs suppress anti-CD3 and alloantigen stimulated T cell proliferation and alloantigen mediated cGVHD with a lupus-like Syndrome ...... 120 Figure 6.3: The suppressive effect of iTregs in cGVHD model with a lupus-like syndrome is almost completely dependent upon TGFβ and partially upon IL-10 ...... 124

Figure 6.4: iTregs induce the formation of tolerogenic DCs in vitro ...... 126

Figure 6.5: TGFβ but not IL-10 signaling is required for the formation of tolerogenic DCs induced by iTregs ...... 129

Figure 6.6: Adoptive transfer of iTregs to lupus mice suppresses the expansion of DCs and decreases their B7 expression ...... 131 Figure 6.7: DCs isolated from lupus mice treated with iTregs but not CD4con cells suppress disease development ...... 133 Figure 6.8: Tolerogenic DCs suppress lupus through TGFβ but not IL-10-dependent mechanism ...... 135

CHAPTER 7

Figure 7.1: Proposed model for TGFβ dependent regulation of dendritic cells to prevent inflammation ...... 144

LIST OF TABLES

CHAPTER 2

Table 2.1: Dendritic cell subsets in lymphoid and non-lymphoid organs in mice...... 47

CHAPTER 4

Table 4.1: Table of genes up- or down-regulated by microarray analysis in splenic CD11c+ DCs from DC-Tgfbr2 KO mice as compared to Cre- mice ...... 88

Table 4.2: Selected genes up-regulated in CD103+ DCs from DC-Tgfbr2 KO mice as compared to Cre- mice ...... 91

ABBREVIATIONS

Ag – Antigen

AICD – Activation induced cell death

ALK – Activin receptor-like kinase

APC – Allophycocyanin

APC – Antigen presenting cell

APECED - Autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy

BCR – B cell receptor

BM – Bone marrow

BMDC – Bone marrow derived dendritic cells

CCL – C-C chemokine ligand

CCR – C-C chemokine receptor

CD – Cluster of differentiation cDC – Classical dendritic cells

CFSE – Carboxyfluorescein succinimidyl ester cGVHD – chronic graft versus host disease

CM – Complete medium

CTLA-4 – Cytotoxic T lymphocyte antigen-4

CXCL – C-X-C chemokine ligand

CXCR – C-X-C chemokine receptor

DC – Dendritic cells dnR – dominant negative Receptor 13

EAA – Essential amino acids

EAE – Experimental autoimmune encephalomyelitis

EASE – Expression analysis systematic explorer

ERK – Extracellular signal-regulated kinase

FITC – Fluorescein isothiocyanate

Flt3L – Fms tyrosine like kinase 3 ligand

Foxp3 – Forkhead box p3

GITR – Glucocorticoid-induced TNF receptor family-regulated gene

GM-CSF – Granulocyte monocyte-colony stimulating factor

HMDC – Human monocyte derived dendritic cells

ICAM – Intercellular adhesion molecule

IDO – Indoleamine 2, 3-dioxygenase

IFN – Interferon

Ig – Immunoglobulin

IL- Interleukin

IPEX - Immune dysregulation, polyendocrinopathy,enteropathy, X-linked syndrome

IRF – Interferon regulatory Factor iTreg – induced regulatory T cells

KO – Knock-out

LAP – Latency associated peptide

LCs – Langerhans cells

LFA-1 – Lymphocyte function-associated antigen-1

LLC – Large latent complex

LPS – Lipopolysaccharide 14

LTBP – Latent TGFβ binding protein

MAPK – Mitogen activated protein kinase

MCP – Monocyte chemotactic protein

MFI – Mean fluorescence intensity

MHC – Major histocompatibility complex

MIP – Macrophage inflammatory protein

MLN – Mesenteric lymph nodes mTECs – Medullary thymic epithelial cells

NK – Natural killer nTregs – Natural regulatory T cells

PBMCs – Peripheral blood mononuclear cells

PBS – Phosphate buffered saline

PD1 – Programmed death 1 pDC – Plasmacytoid dendritic cells

PDCA-1 – Plasmacytoid dendritic cell antigen

PDL1 – Programmed death ligand 1

PE – Phycoerythrin

PI3K – Phosphoinositide 3-kinase

RALDH – Retinaldehyde dehydrogenase

ROR – Retinoid related orphan receptor

Siglec – Sialic acid binding Ig-like lectins

SLC – Small latent complex

SLE – Systemic lupus erythematosus

TBP – TATA-binding protein 15

TCR – T cell receptor tDCs – Tolerogenic dendritic cells

TGF – Transforming growth factor

TIM – T cell immunoglobulin mucin family

TNF – Tumor necrosis Factor

Tr1 – Type 1 T regulatory cells

Tregs – Regulatory T cells

ABSTRACT

TGFβ is an immunoregulatory cytokine that has a pivotal function in maintenance of immune tolerance via the control of lymphocyte proliferation, differentiation and survival. Defects in TGFβ1 expression or in its signaling in T cells correlate with the onset of several autoimmune diseases. However, the early effects of this cytokine on the innate immune system, particularly the dendritic cells (DCs) which play an equally important role in development of immune tolerance, are not well documented in vivo.

In the current study, we developed conditional knockout mice with targeted deletion of Tgfbr2 specifically in dendritic cells. DC-Tgfbr2 KO mice developed spontaneous multi-organ autoimmune inflammation with T and B cell activation.

Phenotypic analysis of dendritic cells revealed no significant differences in the expression of MHCII and co-stimulatory molecules between control and DC-Tgfbr2 KO mice. However, we found that DCs from DC-Tgfbr2 KO mice were more proinflammatory, which exacerbated the severity of disease in a T cell transfer model of colitis. Furthermore, increased IFNγ expression by Tgfbr2-deficient DCs inhibited antigen-specific regulatory T cells (Tregs) differentiation by DCs in the presence of

TGF. Since DCs play an important role in Treg homeostasis in vivo, we also examined the phenotype of Tregs and observed a significant increase in the frequency and numbers of Foxp3+ T cells in both the spleen and MLNs of DC-Tgfbr2 KO mice. Further analysis of these Tregs revealed attenuated expression of Foxp3 and an expansion in the numbers 17 of CD4+CD25-Foxp3+ T cells suggesting that the Tregs from KO mice may not be fully immunosuppressive. Adoptive transfer of in vitro differentiated iTregs into 2-3 week old

DC-Tgfbr2 KO mice partially rescued the autoimmune phenotype by reducing the frequency of activated T cells and severity of colitis but did not prevent inflammation in other organs.

The phenotype of this novel mouse model clearly indicates the importance of

TGFβ signaling in DCs in the maintenance of immune homeostasis and prevention of autoimmunity and provides an opportunity to study the pathogenesis of complex disorders such as autoimmune gastritis, pancreatitis, hepatitis and inflammatory bowel diseases.

CHAPTER 1

INTRODUCTION

The immune system is a tightly regulated network of innate and adaptive immune cells that continually monitor their environment to protect against invading pathogens and to maintain immune homeostasis. Indeed, to efficiently protect us from foreign invasion, the adaptive immune system must distinguish self from non-self and attack only the latter. Such a distinction is eforced by several regulatory mechanisms occurring at various stages in the development of the immune system to generate a state of self- tolerance. However, when such mechanisms fail, a misdirected immune response is initiated that attacks the organism’s own cells and tissues, leading to autoimmune disease.

Autoimmune diseases can result from breakdown of either a single mechanism of tolerance or from multiple breaches in different tolerance mechanisms. The relative rarity of these diseases indicates the efficient function of several redundant mechanisms to maintain self-tolerance, some of which are still yet to be identified.

Studies over the past several years have identified regulatory cytokines as essential components of peripheral tolerance mechanisms. TGFβ is one such regulatory cytokine with a pivotal role in regulating the immune response. TGFβ belongs to a family of evolutionarily conserved molecules with pleiotropic roles in development, carcinogenesis, fibrosis, wound healing and immune responses. In the immune system, 19

TGFβ is critical for the maintenance of peripheral tolerance, an effect believed to be primarily mediated through TGFβ signaling in T cells (Li and Flavell, 2008). However, the early effects of the cytokine on the innate component of the immune system, particularly on the dendritic cells which play an equally important role in development of immune tolerance, are not well documented.

Dendritic cells are professional antigen (Ag) presenting cells that play an important role in both immunity and tolerance. Numerous in vitro studies have pointed to a role of TGFβ in maintaining the immature state of DCs (Geissmann et al., 1999;

Yamaguchi et al., 1997), preventing the development of inflammatory DCs (Siddiqui et al., 2010) and promoting their tolerogenic function (Belladonna et al., 2008; Pallotta et al., 2011). However, there is limited literature pointing to a role of TGFβ signaling in

DCs in vivo. Previous studies with a transgenic mouse model of targeted attenuation of

TGFβ signaling in CD11c+ cells (CD11cdnR mice) showed increased activation of self- reactive T cells and heightened susceptibility to experimental autoimmune encephalomyelitis (EAE) when crossed with TCR transgenic mice (Laouar et al., 2008).

However, under steady-state conditions, CD11cdnR mice did not show any signs of autoimmunity, likely due to residual TGFβ signaling in DCs (Sanjabi and Flavell, 2010).

Boomershine et al. described autoimmune pancreatitis in a Cre-lox mouse model with targeted deletion of Tgfbr2 in fibroblasts with Cre expression driven by S100A4 gene promoter. The pathology was attributed to the leaky Cre expression in DCs in which

S100A4 gene promoter was also active (Boomershine et al., 2009). Nevertheless, whether 20 a complete lack of TGF signaling specifically in DCs results in multi-organ autoimmune disease still remains to be investigated.

Another important aspect of DC-mediated tolerance requires the interaction of

DCs with regulatory T cells. Regulatory T cells are immunosuppressive cells that play a dominant role in maintaining tolerance to self-antigens (Sakaguchi, 2005). One of the mechanisms by which Tregs exert their immunosuppressive function relies on their ability to modulate DC function. They not only downmodulate the expression of co- stimulatory molecules such as CD80/CD86 on DCs but also induce a tolerogenic phenotype by upregulating the expression of molecules that negatively regulate T cell activation (reviewed by Shevach, 2009). On the other hand, several observations suggest that DCs may also be involved in homeostasis of natural Tregs (Darrasse-Jeze et al.,

2009; Garbi and Hammerling, 2011; Suffner et al., 2010). A positive feedback loop has been shown to exist between the numbers of DCs and Tregs in vivo which is crucial for the balance between immunity and tolerance (Darrasse-Jeze et al., 2009). In addition,

DCs also actively induce Foxp3+ Tregs from naïve T cell precursors in the presence of

TGFβ (Chen et al., 2003; Fantini et al., 2004; Fu et al., 2004; Yamazaki et al., 2007).

However, whether TGFβ signaling in DCs is critical to maintain Treg homeostasis and differentiation has not been examined in detail.

1-1 Overall Aims and Objectives

The overall goal of the proposed research was to understand the contribution of

TGFβ signaling in dendritic cells to maintain immune homeostasis and immune tolerance in vivo, and its relevance in the pathogenesis of autoimmunity. Based on the current literature, we hypothesized that TGFβ signaling in dendritic cells is essential for maintenance of both DC and Treg homeostasis in vivo. In order to address our hypothesis, we developed the following specific aims.

Specific Aim 1: To generate and characterize a conditional knock-out mouse model with deletion of Tgfbr2 specifically in dendritic cells (DC-Tgfbr2 KO) using the Cre-Lox technology

Specific Aim 2: To analyze the phenotypic and functional characteristics of dendritic cells from DC-Tgfbr2 KO mice

Specific Aim 3: To analyze the phenotype of Tregs in DC-Tgfbr2 KO mice and determine the ability of Tgfbr2-deficient DCs to drive antigen-specific Treg differentiation in vitro.

1-2 Significance of Research

Autoimmune diseases develop as a result of loss of immunological tolerance.

These diseases cause significant and chronic morbidity and disability and are the leading causes of death among young and middle-aged women, and to a lesser extent, men, in the

United States. There are more than eighty illnesses caused by autoimmunity and these diseases cross the different medical specialties, such as rheumatology, endocrinology, hematology, neurology, cardiology, gastroenterology, and dermatology. The exact 22 mechanisms that result in autoimmune disease are still largely unknown although both genetic and environmental factors have shown to predispose or trigger the immune response. Treatments vary widely and depend on the specific disease but are aimed to reduce the symptoms and control the over-reactive immune response. At least 50 million

Americans are living with autoimmunity and the total costs of these diseases have been estimated to be about $86 billion every year (Walsh and Rau, 2000). With such a huge economic burden, there is a significant need for more focused research on the etiology of all autoimmune related diseases rather than a single disease. This will enable us to better understand the root cause of these diseases and develop more effective treatment strategies.

In this dissertation, we have aimed to understand the mechanisms by which TGFβ controls DC function to maintain immune homeostasis and tolerance. We have attempted to test our hypothesis in an animal model through a reverse genetics approach. However, ultimately our goal is to look for defective TGFβ signaling in dendritic cells isolated from biopsies of patients with autoimmune diseases. Functional defects in TGFβ signaling due to mutations in the receptor are associated with different types of cancer (Levy and Hill,

2006); but whether initial inflammation in the tissues predisposes them to oncogenic transformation is not known. Studies in the mouse model will help us to translate the knowledge gained to comparable studies in patients and thus work toward developing immunomodulatory strategies for the prevention or treatment of deadly autoimmune diseases by expanding collaborations with clinicians. 23

1-2 Organization of the Dissertation

My dissertation project involved the development of a mouse model with abrogated

TGFβ signaling specifically in dendritic cells and characterization of the phenotype of

DC-Tgfbr2 KO mice to understand the aspects of DC function controlled by TGFβ.

Chapter 2 provides literature review pertinent to immune tolerance mechanisms currently known and the contributions of TGFβ and dendritic cells to maintenance of tolerogenic responses. Chapter 3 is a detailed description of the materials and methods and statistical analysis that were employed to generate and characterize the phenotype of DC-Tgfbr2

KO mice. Chapter 4 is a description of the results obtained from my studies on DC-

Tgfbr2 KO mice and Chapter 5 discusses the relevance of the results and how our findings contribute to the current literature.

In chapter 6, a study conducted in collaboration with Son-Guo Zheng, an investigator from University of Southern California using DC-Tgfbr2 KO mice is described and further confirms our observations that Tgfbr2-deficient DCs are less tolerogenic.

Finally, chapter 7 describes the conclusions of my research conducted during the course of my PhD work and its contribution to the field of immunology with a focus on the future directions of the project. 24

CHAPTER 2

LITERATURE REVIEW

2-1 Immunological Tolerance

“…when Medawar and his colleagues showed that immunological tolerance could be produced experimentally the new immunology was born. This is a science which to me has far greater potentialities both for practical use in medicine and for the better understanding of living process…” - Sir Frank Macfarlane Burnet

Immunological tolerance is the failure to mount an immune response to an antigen. It can be natural or “self” tolerance wherein the immune system fails to attack the body’s own proteins and other antigens or induced tolerance where tolerance to external antigens is created by deliberately manipulating the immune system. The idea of immunological tolerance was first proposed by Burnet and Fenner in 1949 that ‘if in embryonic life expendable cells from a genetically distinct race are implanted and established, no antibody response should develop against the foreign cell antigen when the animal takes on independent existence’ (Burnet and Fenner, 1949). This logical yet novel proposition spurred a series of experiments by Sir Peter Medawar and his colleagues who demonstrated that early engraftment of donor splenocytes rendered a mouse tolerant to future grafts from the same donor strain but not other strains, thereby leading to the discovery of acquired immunological tolerance. Since then, enormous progress has been made in the field of immunological tolerance, from the discovery of the role of thymus in immunity to the identification of regulatory T cells and their 25 function in the immune system (Liston, 2011). Although several mechanisms, both central and peripheral, have been identified that are involved in the development and maintenance of self-tolerance, there are others that are yet to be uncovered and may be of much greater importance than the existing ones. Acquiring an understanding of how unresponsiveness to self-antigens is established will not only provide insights into the pathogenesis of autoimmune diseases and hypersensitivity, but will also help to develop strategies to counteract pathological immune responses.

2-1-1 Mechanisms of Tolerance

Tolerance encompasses a network of mechanisms that include central and peripheral, cell autonomous and cell interactive forms of tolerance. Our understanding of these mechanisms has greatly improved over the last decade based on studies using genetically engineered transgenic, knockout and mutagenized mice (Evans, 1989;

Goodnow et al., 1989; Miller et al., 1989; Nelms and Goodnow, 2001; Schonrich et al.,

1991) and also using monoclonal antibody probes for lymphocyte membrane markers.

Self-tolerance mechanisms operate on T and B cells right from their development in the primary lymphoid organs to when they encounter antigens in the periphery (reviewed by von Boehmer and Melchers, 2010). These mechanisms can be classified as “central tolerance” and “peripheral tolerance”. The checkpoints at these various stages help considerably to lower the risk of developing harmful autoimmune diseases.

 Central mechanisms of tolerance

The adaptive immune system has evolved to identify and fight infections using a repertoire of receptors that are randomly rearranged and/or mutated from a limited set of gene segments. A disadvantage of this process, however, is that some of the receptors might, by chance bind to self-antigens. The potentially harmful lymphocytes that bear these self-receptors are purged during development by a process called central tolerance

(Kappler et al., 1987; Kisielow et al., 1988; Ramsdell and Fowlkes, 1990; Swat et al.,

1991). Central tolerance mechanisms operate on both B and T cells in the bone marrow and thymus, respectively, and the fate of antigen-exposed self-reactive lymphocytes is determined in a cell-intrinsic manner.

Checkpoints in B cell development are crucial for the prevention of autoimmune diseases like systemic lupus erythematosus (Witsch et al., 2006). Most of the B cells expressing autoreactive B cell receptors (BCR) in the bone marrow are eliminated at the pre-BCR and BCR stage either by deletion or by anergy (Wardemann and Nussenzweig,

2007). Some B cells expressing autoreactive BCRs are given another chance to pass into the periphery after a second gene rearrangement through a different locus, a process known as receptor editing (Figure 2.1). This rearrangement of immunoglobulin gene segments results in a change in the specificity of a previously auto-reactive BCR (Chen et al., 1995; Koralov et al., 2006; Lutz et al., 2006; Nakajima et al., 2009; Zhang et al.,

2003). 27

Figure 2.1: Receptor editing in B cells with self-reactive B cell receptors (adapted from (Nemazee, 2006))

In the case of T cells, the affinity of the T cell receptor for self-peptide-MHC ligands determines their developmental outcome in the thymus. Precursor cells that have no affinity or very low affinity die by neglect. If the TCR has a low affinity for self- peptide-MHC, then the progenitor undergoes positive selection leading to survival and further differentiation. High affinity binding to self-peptide-MHC results in clonal deletion, receptor editing or anergy of the thymocytes, a process known as negative selection (Figure 2.2) (von Boehmer, 2004, 2008). The MHC-bound self-peptides responsible for thymic T cell selection include those derived from ubiquitous intracellular and cell-membrane proteins, circulating serum proteins and peripheral self-antigens presented by medullary dendritic cells (DCs) and tissue specific self-antigens ectopically expressed by Aire+ medullary thymic epithelial cells (Anderson et al., 2002; Liston et al.,

2003). In addition, the activation thresholds of self-reactive T cells may be raised by the 28 expression of inhibitory receptors or negative signaling molecules, or they may not survive long enough due to activation-induced cell death (AICD). Alternatively, high affinity self-reactive cells can also differentiate into specialized T cells called regulatory

T cells (Tregs), which play a role in controlling autoimmune responses in the periphery

(Figure 2.2) and are discussed in detail later (Fontenot and Rudensky, 2005; Sakaguchi,

2005).

Figure 2.2: Central tolerance mechanisms (adapted from(Hogquist et al., 2005))

 Peripheral mechanisms of tolerance

The central tolerance mechanisms are not perfect and do not result in elimination of all self-reactive lymphocytes. Therefore, those auto reactive lymphocytes that escape from primary lymphoid organs are subjected to further checks and fail safes in the periphery. Peripheral tolerance mechanisms include purging of self-reactive lymphocytes as well as tuning of lymphocyte signaling thresholds in both cell intrinsic as well as cell extrinsic manner.

B cells with a potential for attacking self-proteins or antigens are thought to be kept in check by the absence of T-helper cells, since B cell antibody responses largely depend on T cell co-operation (Claman and Chaperon, 1969; Miller and Mitchell, 1968).

In addition, a number of cell surface receptors and their ligands expressed on B cells, antigen-presenting cells (APCs) or tissues are capable of providing extrinsic dampening signals. These inhibitory receptors include FcRII, and members of the sialic acid binding

Ig-like lectins (Siglecs) (Crocker, 2002; Daeron et al., 1995; Van den Herik-Oudijk et al.,

1995). Self-proteins which contain sugar residues at their carboxy terminal provide inhibitory signals through Siglec receptors as opposed to microbial proteins which do not contain this modification (Duong et al.).

Several mechanisms exist for maintaining T cell tolerance, which are both cell- intrinsic and cell-extrinsic. Cell intrinsic mechanisms include anergy induction in self- reactive T cells, possibly through lack of co-stimulation or through the engagement of inhibitory receptors such as cytotoxic T-lymphocyte antigen-4 (CTLA-4) (Walunas et al., 30

1994), T cell immunoglobulin mucin family (TIM) members (Sanchez-Fueyo et al.,

2003), programmed cell death receptor (PD1) and its ligand, PDL1 (Francisco et al.,

2009; Keir et al., 2008). T cells that recognize self-antigens may also get fully activated but may be skewed towards a non-pathogenic phenotype (such as Th2 phenotype). In other cases, auto-reactive T cells may undergo AICD after encountering self-antigens through a Fas-FasL interaction (Watanabe-Fukunaga et al., 1992). On the other hand, some tissues such as the interior of the eye, testes and the brain are hidden behind anatomical barriers and self-reactive T cells may not encounter their antigens in those tissues and therefore exist in a state of ignorance (Alferink et al., 1998) (Figure 2.3).

Figure 2.3: T cell intrinsic mechanisms of peripheral tolerance (adapted from (Walker and Abbas, 2002))

In the cell-extrinsic mechanism of tolerance, certain T cells actively keep in check the activation and expansion of self-reactive lymphocytes. One of the most active and dominant form of tolerance comes from the action of Tregs. These cells are specialized for immunosuppression and are generated both in the thymus and in the periphery. They control adaptive immune responses through different mechanisms which are described in detail below. Disruption in the development or function of Tregs is associated with the development of autoimmune diseases in both humans and animals (Sakaguchi et al.,

2008).

2-1-2 Regulatory T cells and Immune Tolerance

Regulatory T cells expressing CD4, CD25 and the transcription factor Foxp3 are immune suppressor cells that constitute 5%-10% of CD4+ T cells and negatively control almost every adaptive immune response, either physiological or pathological (Sakaguchi,

2005). They can be either naturally produced in the thymus or can differentiate from naïve T cells in the periphery. Deficiency or depletion of Foxp3+ Tregs evokes chronic T- cell mediated autoimmunity and immunopathology highlighting the importance of these cells in exerting dominant tolerance and immune regulation.

 Development and maintenance of thymic Tregs

Naturally occurring Tregs specifically express the transcription factor Foxp3

(forkhead box P3), a member of the fork-head/winged helix family of transcription factors. Foxp3 is a master regulator of Treg development and function. It is critical for αβ 32

TCR positive T cells to differentiate into Tregs in the thymus; it confers suppressive activity to Tregs when expressed at sufficiently high levels (Fontenot et al., 2003a; Hori et al., 2003; Khattri et al., 2003). Mutations in FOXP3/Foxp3 gene result in multi-organ autoimmune inflammation known as IPEX (immune dysregulation, polyendocrinopathy,enteropathy, X-linked syndrome) in humans and Scurfy in mice, respectively (Brunkow et al., 2001; Gambineri et al., 2003).

In the thymus, Foxp3+ cells are detected with increasing frequency from the late

CD4+CD8+ double-positive to CD4+CD8- single-positive stages (Fontenot et al., 2005).

Evidence from recent studies suggests that Foxp3 stabilizes and sustains the Treg cell phenotype and confers suppressive activity but does not determine cell fate of the developing thymocytes (Gavin et al., 2007; Lin et al., 2007). Although the signals that trigger Foxp3 expression are incompletely understood, it has been shown that TCR specificity contributes to thymic Treg cell generation. The TCR repertoire of Treg cells, although as broad as that of conventional T cells, is more self-reactive, because Tregs have higher affinities for self-peptide-MHC ligands expressed in the thymus (Jordan et al., 2001; Kawahata et al., 2002). In addition to TCR, development of Tregs is also dependent on the expression of several T cell accessory molecules such as CD28,

CD40L, CTLA-4 and LFA-1 and their respective interaction partners CD80/86, CD40 and ICAM-1 on thymic stromal cells (Figure 2.4) (Sakaguchi, 2005). Therefore, unlike naïve T cells generated in the thymus, thymus-derived Tregs are already functionally mature and “antigen-primed” in the thymus before encountering antigen in the periphery.

At the cellular level, both medullary thymic epithelial cells (mTECs) and DCs in the 33 thymus contribute to Treg generation. Furthermore, in humans, thymic stromal lymphopoietin produced by mTEC-derived Hassal’s corpuscles stimulate thymic DCs to promote Treg differentiation (Watanabe et al., 2005).

Figure 2.4: Development of Foxp3+ Tregs in the thymus involves interaction with thymic stromal cells via various molecules (adapted from (Sakaguchi et al., 2008))

Apart from Foxp3, IL-2 is also critical for the development, survival, function and maintenance of Tregs. Tregs cannot produce IL-2 and hence depend on activated non- regulatory T cells for their source of IL-2. IL-2 serves in the maintenance, expansion and activation of natural Tregs, which in turn limits the expansion of activated T cells, thereby creating a negative feedback loop for the control of immune responses. Other cytokines such as IL-7 and IL-15 are also required for the peripheral maintenance of

Tregs and possibly also for the survival of mature Tregs in the thymic medulla (reviewed by Sakaguchi et al., 2008). 34

Foxp3+ Tregs that have migrated to lymphoid and non-lymphoid tissues become activated, proliferate and exert immunosuppressive function. It is presumable that natural

Tregs continuously proliferate in vivo through the recognition of self-antigen and commensal microbes (Fisson et al., 2003; Setoguchi et al., 2005), and once activated, these Tregs can exert suppression at a much lower concentration of antigen than naïve T cells. Tregs can also expand both in vivo and in vitro in response to stimulation through accessory molecules like GITR (McHugh et al., 2002; Shimizu et al., 2002), and also in response to TLR ligands (reviewed in Sutmuller et al., 2006). Irrespective of continuous proliferation in the periphery, the number of Tregs is fairly constant (5-10% of CD4+ T cells) indicating that cell death helps to maintain Treg homeostasis.

 Peripheral differentiation of Tregs from naïve T cells

Naive T cells when stimulated in vitro with antigen in the presence of TGFβ can differentiate into Foxp3+ Tregs (iTregs) and become immunosuppressive (Apostolou and von Boehmer, 2004; Chen et al., 2003; Kretschmer et al., 2005). This differentiation is facilitated in the presence of IL-2 (Laurence et al., 2007) and retinoic acid (produced by

DCs in the gut-associated lymphoid tissue), (sanchBenson et al., 2007; Coombes et al.,

2007; Mucida et al., 2007; Sun et al., 2007) but inhibited in the presence of IL-6, where the naïve T cells become Th17 cells (Bettelli et al., 2006; Veldhoen et al., 2006).

However, the stability of these iTregs and the extent to which they contribute to the peripheral pool of T cells is still not clear. For example, the regulatory regions of the

Foxp3 gene in mice are more widely demethylated in natural Tregs but not in iTregs 35

(Floess et al., 2007a), suggesting functional plasticity of the latter. In humans, Foxp3 is expressed at lower levels in naïve T cells stimulated with antigen alone (Gavin et al.,

2006; Yagi et al., 2004). But the functional significance of this Foxp3 expression in activated effector T cells in humans is still under question.

Apart from Foxp3+ iTregs, there are other types of Tregs that can also be induced in the periphery from naïve T cells. These include the CD4+ Tr1 cells that secrete IL-10 and TGFβ and are induced by stimulation of naïve T cells in the presence of IL-10 and

Th3 cells that were originally identified in an oral tolerance study. Although the Tr1 cells do not express Foxp3, they are functionally very similar to Foxp3+ Tregs. However, the long-term stability of these Tregs needs to be assessed in vivo in more detail (reviewed by

Sakaguchi et al., 2008). A variety of other T cell subpopulations including CD8+, CD4-

CD8- and γ/δ T cells have also been reported to exhibit an immunosuppressive activity

(reviewed by Shevach, 2006). However, there is little evidence supporting their role in natural self-tolerance.

 Mechanisms of Treg mediated suppression

CD4+CD25+Foxp3+ Tregs suppress adaptive immune responses by targeting a wide array of cells. They not only suppress proliferation and differentiation of naïve T cells, but also suppress the effector activities of differentiated CD4+ and CD8+ T cells, natural killer (NK) cells, NKT cells, B cells, macrophages, dendritic cells and osteoclasts.

When stimulated with antigen, they suppress responder T cells irrespective of whether they share antigen specificity or not. Several mechanisms of Treg suppression have been 36 proposed and are summarized below and in Figure 2.5. These mechanisms have been reviewed in detail by (Sakaguchi et al., 2008; Shevach, 2009).

 Cell-contact dependent suppression

In this mechanism, Tregs can either kill responder T cells or APCs directly by a granzyme- and perforin- dependent mechanism or can deliver a negative signal to responder T cells. Examples of negative signals include upregulation of intracellular cyclic AMP, which leads to inhibition of T cell proliferation and IL-2 production, or the generation of pericellular adenosine catalyzed by CD39 and CD73 expressed by Tregs.

 Production of immunosuppressive cytokines

Tregs produce different immunosuppressive cytokines such as TGFβ, IL-10, IL-

35 and galectin-1 which all play a role in inhibiting different types of immune responses.

For example, IL-10 produced by Tregs in the lamina propria has an important function to provide mucosal immunity and protect from inflammatory bowel disease. TGFβ directly suppresses responder T cells or conditions them to become more sensitive to suppression.

It has also been shown to maintain Foxp3 expression and function in Tregs.

 Deprivation of cytokines

Since Tregs depend on IL-2 for their survival and maintenance, IL-2 deprivation by Tregs results in starvation of responder T cells thereby affecting their expansion and survival.

 Modulation of dendritic cell function

Activated Tregs modulate DC function through a CTLA-4 dependent mechanism.

They either down-modulate CD80/86 expression on DCs and thereby affect the antigen- presenting capacity of the DCs, or induce the formation of the enzyme indoleamine 2.3- dioxygenase (IDO) in DCs through CTLA-4-CD80/86 interaction. IDO catalyzes the conversion of the amino acid tryptophan into kynurenine, which is a toxic metabolite for

T cells and combined with tryptophan deprivation can lead to apoptosis of T cells. Tregs can also induce the immune regulating transcription factor Foxo3, which leads to inhibition of cytokine production by DCs. These effects of Tregs on DCs inhibit stable contacts between antigen activated T cells and DCs.

 Functional differentiation into specific T-helper lineages

Foxp3+ Tregs can functionally differentiate to acquire the transcription factors associated with specific Th lineages such as T-bet for Th1, IRF-4 for Th2 or RORγt for

Th17 cells. These transcription factors can then help the Tregs to specifically control different immune responses by affecting their function. For example, they can induce the expression of specific chemokine receptors on Tregs which then guide them to the particular inflammation site.

 Infectious tolerance

Infectious tolerance is the process by which Tregs convert naïve T cells or recent thymic emigrants into further cohorts of Tregs when they encounter antigens presented by the same dendritic cells. They do so by inducing the expression of enzymes, such as 38

IDO, that consume at least five different essential amino acids (EAAs). When one or more of these EAAs are limiting, it results in the inhibition of the mTOR pathway in antigen-stimulated naïve T cells, which then in the presence of TGFβ are programmed to express the Treg-specific transcription factor Foxp3 and to become Treg-like themselves.

(Cobbold et al., 2009)

Figure 2.5: Basic suppression mechanisms used by Treg cells (adapted from (Vignali et al., 2008))

2-1-3 Breakdown of Immune Tolerance

The immune tolerance mechanisms that have been discussed above are not perfect and failure of any single mechanism or a combination of different events can evoke an autoimmune response directed against self-tissues. With the exception of certain diseases such as rheumatoid arthritis and thyroiditis, autoimmune diseases are relatively 39 uncommon, affecting about 5% of the population in Western countries. Their relative rarity indicates that for the majority of autoreactive cells, the successive levels and multiple redundancies of tolerance mechanisms keep them in constant check. Some diseases result from genetic deficiencies in certain important components of the tolerance process. For example, mutations in AIRE and FOXP3 genes result in autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED) and IPEX diseases, due to impaired clonal deletion and immunoregulation, respectively (1997; Gambineri et al., 2003). Other diseases such as myasthenia gravis and Hashimoto’s thyroiditis result from the failure of tolerance to particular antigen and the emergence of autoimmune cells in these diseases may require breaches in multiple tolerance mechanisms, which are still poorly understood (reviewed by Mathis and Benoist, 2010). Therefore, identifying the etiology and the course of pathogenesis of different autoimmune diseases, and, especially the various modes of tolerance breakdown involved, will help to develop effective immunomodulatory strategies to prevent or treat autoimmune diseases.

2-2 TGF-β – An Essential Mediator of Immune Tolerance

TGFβ is a pleiotropic cytokine that affects multiple biological processes including development, fibrosis, wound healing, carcinogenesis and immune responses by regulating cell differentiation, proliferation, survival and migration. The first evidence for the involvement of TGFβ in regulating immune responses came from studies using

Tgfb1-/- mice (Shull et al., 1992), which developed multi-organ autoimmune 40 inflammation. Since then, the multifaceted roles of TGFβ in the immune system affecting almost all leukocytic populations have been revealed.

2-2-1 TGFβ Expression and Activation

TGFβ belongs to the TGFβ superfamily which includes other members such as bone morphogenetic proteins, activins and growth differentiation factors. There are three homologous TGFβ isoforms in mammals, TGFβ1, TGFβ2 and TGFβ3 which are encoded by different genes. TGFβ1 is the predominant isoform expressed by the immune system.

It is synthesized as a prepro-TGFβ precursor. The pre region contains a signal peptide and the pro region is cleaved by a furin-like peptidase in the Golgi apparatus to release the mature TGFβ. Homodimer of mature TGFβ then binds noncovalently to a homodimer of the propeptide, termed latency associated protein (LAP) to form a complex called small latent complex (SLC) or latent TGFβ. The SLC is then secreted as such or in association with a latent TGFβ binding protein (LTBP) as a large latent complex (LLC).

LTBP facilitates the binding of TGFβ to the extracellular matrix (Figure 2.6). Once in the extracellular environment, TGFβ activation and release from SLC proceeds through the degradation of LAP by different activators including proteases such as plasmin and matrix metalloproteases, reactive oxygen species, protein thrombospondin-1 and integrins

αvβ6 and αvβ8. Integrins activate TGFβ by binding to an RGD (arginyl-glycyl-aspartic acid) domain in LAP and either induce a conformational change in LAP (as mediated by

αvβ6) or activate metalloproteinases to cause degradation of LAP (as mediated by αvβ8), thereby resulting in the release of active TGFβ1. αvβ6 is expressed by epithelial cells 41

whereas αvβ8 is expressed both by T cells as well as myeloid lineage dendritic cells

(reviewed by Li and Flavell, 2008; Li et al., 2006).

Figure 2.6: Diagrammatic representation of pre-pro-TGF-beta structure (top) and mechanisms regulating biologic activity of TGF-beta (bottom) (adapted from (Tabibzadeh, 2002))

2-2-2 TGFβ Receptor and Signaling

TGFβ1 mediates its functions by binding to type I and type II transmembrane serine/threonine kinase receptors, in particular TGFβRI or ALK5 and TGFβRII. Active

TGFβ1 binds to TGFβRII, which then recruits and activates TGFβRI receptor. Binding of

TGFβ1 to the tetrameric complex of TGFβRII and TGFβRI initiates cell signaling by subsequent phosphorylation of intracellular Smad proteins by TGFβRI. There are eight

Smad proteins in vertebrates which are categorized as either five receptor associated

Smads (R-Smad1, 2, 3, 5 and 8), one common Smad (Co-Smad4) or two inhibitory

Smads (I-Smad 6 and 7). Upon activation by TGFβRI, R-Smads2 and 3 associate with

Smad4 and translocate to the nucleus, where they initiate transcriptional regulation of 42 target genes by binding to Smad binding element. High affinity binding of Smad complexes to DNA is achieved by recruiting either coactivators such as CBP/p300 or corepressors such as Sno/Ski, to activate or repress target genes, respectively. I-Smad7 suppresses TGFβ signaling by either competing with R-Smads for binding to TGFβRI or by recruiting ubiquitin ligases to degrade TGFβRI (Figure 2.7). Apart from signaling through Smad proteins, TGFβ can also initiate signaling through Smad independent pathways such as Ras-ERK, PI3K and Rho-Rac-cdc42 MAPK pathways (reviewed by Li et al., 2006).

Figure 2.7: TGF-beta signaling pathway (adapted from (Hui and Friedman, 2003))

2-2-3 Regulation of Immune Responses by TGFβ

In the immune system, TGFβ has been shown to have an important role in the maintenance of peripheral tolerance. TGFβ1 knockout mice develop a massive multifocal 43 inflammatory disease characterized by an initial inflammatory response (Kulkarni et al.,

1993; Shull et al., 1992) that is followed by an autoimmune manifestation mediated by lymphocytes (Christ et al., 1994; Mombaerts et al., 1992; Ohnmacht et al., 2009). Further studies in mouse models with conditional inactivation of TGFβ signaling have revealed its regulatory function on almost all leukocytic populations. It controls the initiation and resolution of inflammatory responses through its effects on cell proliferation, differentiation and survival of immune cells. The regulatory activity of TGFβ depends on the differentiation status of the cells as well as on the local inflammatory milieu. The role of TGFβ in regulating different immune cell populations is highlighted below (reviewed by Li et al., 2006).

 Regulation of T cells

TGFβ exerts its greatest impact on T cells as is evident from the studies using mouse models with either lack of Tgfbr2 gene or Tgfb1 gene specifically in T cells. From these studies, it became apparent that TGFβ controls T cell development, homeostasis, tolerance and immunity. It promotes the differentiation of CD8+ T cells, nTregs and NKT cells in the thymus. TGFβ also maintains peripheral T cell tolerance by promoting the survival of low affinity naïve CD4+ and CD8+ T cells and inhibiting the proliferation and differentiation of high affinity CD4+ and CD8+ T cells into Th1, T2 and cytotoxic T lymphocytes. In addition, TGFβ signaling in nTregs inhibits their proliferation but supports their survival and maintenance in the periphery. 44

TGFβ also promotes the differentiation of iTreg cells by inducing the transcription factor Foxp3 in naïve T cells. This differentiation is enhanced in the presence of IL-2 and retinoic acid. However in the presence of IL-6, TGFβ induces the differentiation of Th17 cells and maintains them in a regulatory state (rTh17). Once rTh17 cells are stimulated with IL-23 in the absence of TGFβ, they lose their regulatory function and become effector Th17 cells.

 Regulation of B cells

TGFβ also regulates B cell activity by affecting proliferation, differentiation and survival. It inhibits proliferation of both B cell progenitors as well as mature B cells through Smad dependent and independent pathways. However signaling through CD40 molecule induces Smad7 expression in B cells which protects from TGFβ induced growth inhibition. TGFβ is also an important regulator of B cell activation and differentiation. Both cytokine-induced and B cell receptor-induced activation and differentiation of B cells is inhibited by TGFβ. It also blocks class switching to most IgG subtypes. However, it promotes the differentiation of IgA-secreting plasma cells, both in humans and mice. TGFβ also induces apoptosis in immature B cells, resting B cells and

B cell progenitors. Consistent with these regulatory functions, conditional inactivation of

TGFβ signaling in B cells results in elevated serum Ig levels in mice, increased anti-DNA antibody titers and enhanced antibody responses to normally weak antigens. These mice do not have serum IgA, but have increased peritoneal B-1 cells which are responsible for 45 producing autoantibodies. These observations indicate that TGFβ is an important regulator of B cell tolerance to self-antigens in vivo.

 Regulation of innate immune cells

In addition to its effects on the cells of the adaptive immune system, TGFβ also regulates the function and homeostasis of innate immune cells such as NK cells, macrophages, granulocytes, and mast cells. Regulation of dendritic cell function by TGFβ is the focus of this dissertation and literature pertaining to it is discussed later.

Evidence for a role of TGFβ in controlling NK cell function came from studies using transgenic mice in which TGFβ signaling was blocked in both NK cells and dendritic cells. Interestingly, TGFβ was shown to control the homeostasis of NK cells as well as suppress IFNγ production and cytolytic function. Suppression of cytolytic activity was dependent on downregulation of NK cell specific cytotoxic receptors such as NKp30 and NKG2D by TGFβ.

TGFβ differentially regulates the function of monocytes and macrophages; while it stimulates monocyte recruitment and proinflammatory function, it inhibits the functions of macrophages. TGFβ recruits monocytes and granulocytes to the inflammation site by either acting as a chemoattractant or by inducing adhesion molecules on monocytes or by inducing matrix metalloproteinases, which dissolve vascular membranes and facilitate monocyte transmigration. TGFβ also induces monocytes to produce inflammatory cytokines like IL-1, IL-6 and leukotriene C4 synthase, thereby enhancing inflammation.

Once monocytes differentiate into macrophages, TGFβ inhibits their ability to 46 phagocytose by downregulating phagocytic receptors. It also inhibits the production of inflammatory mediators such as nitric oxide, superoxide ion and cytokines and chemokines such as TNF, MIP-1α and MIP-2. The antigen-presenting functions of macrophages are also affected due to downregulation of IFNγ-induced MHCII expression by TGFβ. Collectively, these regulatory processes suggest that TGFβ initiates inflammation, but then limits the activity of the leukocytes at a later stage to prevent damage to host tissues.

2-3 Dendritic Cell Mediated Tolerogenic Responses

Dendritic cells are antigen-presenting cells that are specialized to induce primary immune responses. They are distributed throughout the body, both in lymphoid and non- lymphoid organs and act as sentinels, with the ability to detect and respond to ‘danger signals’. They are generally in an immature state in the tissues with a high capacity to recognize and capture microbial antigens through surface receptors. Recognition of antigen initiates a process called ‘maturation’, during which, DCs acquire the ability to migrate to lymphoid organs and present antigens to T cells to initiate a primary response.

In doing so, DCs have long been thought to act as a link between innate and adaptive immunity. But over the last decade or so, there has been substantial accumulation of evidence supporting its role in inducing immune tolerance and maintaining immune homeostasis.

2-3-1 DC Subsets Involved in Tolerance Induction

DCs are a heterogeneous population and include those found in the lymphoid as well as non-lymphoid organs. There are several distinct DC subtypes, each with a particular location and a specialized function in the immune system. They are broadly classified into conventional DCs and plasmacytoid DCs. Other than these two classes of

DCs, there is a third class of DCs that are especially recruited during inflammation and are called inflammatory DCs (Turley et al.). The phenotype and location of the different

DC subsets is summarized in Table 2.1.

Table 2.1: Dendritic cell subsets in lymphoid and non-lymphoid organs in mice (adapted from (Turley et al.))

Different DC subsets have distinct functions in the immune system. While some are specialized to induce effector T cell responses, some are particularly effective in inducing tolerogenic responses, whereas others can induce both depending on the stimuli.

In this section, we will focus on DC subsets that are involved in inducing tolerance to self- or commensal-antigens.

 Lymphoid organ-resident DCs

Lymphoid-organ resident DCs include CD8+DEC205+ DCs, CD8-33D1+ DCs.

CD8+ are located mainly in the T cell areas of lymphoid tissues, whereas CD8- DCs are found in the red pulp and marginal zone. These subsets differ in their ability to process and present antigens to induce T helper cell development. Both subsets have been implicated in positive and negative regulation of immunity. CD8- DCs can prime regulatory Tr1 cells through TGFβ1 secretion and have been shown to reduce the severity of EAE in murine models through secretion of IL-10 and through tolerizing effects on

Th1 cells. CD8+ DCs, on the other hand, induce Foxp3+ regulatory T cells and can also induce deletional tolerance in an IDO-dependent manner. Targeting of antigen to

DEC205, an endocytic receptor that mediates efficient antigen processing and presentation, by coupling with anti-DEC205 antibodies was shown to induce CD8+ T cell tolerance. These DCs can also process self-antigens and present them to T cells via the cross-presentation pathway thereby inducing tolerance under steady-state conditions

(reviewed by Kushwah and Hu, 2011).

 Plasmacytoid DCs

Plasmacytoid DCs (pDCs) are found both in lymphoid and non-lymphoid organs and are important for protection against viral infections through production of type I interferons. However, there is also evidence supporting the role of pDCs in tolerance induction and maintenance. Under steady-state, pDCs express lower levels of MHCII and co-stimulatory molecules and have been shown to induce regulatory T cells, mediate alloantigen specific T cell tolerance and oral tolerance. During oral tolerance induction, pDCs were shown to induce deletion of CD8+ T cells as well as trigger the suppressive function of Tregs. pDCs can also prevent asthmatic reactions when adoptively transferred to mice and their depletion during inhalation of normally inert antigens results in asthma. pDCs also express IDO and function in induction of tolerogenic responses through regulatory T cell generation (reviewed by Coquerelle and Moser, 2010; Manicassamy and

Pulendran, 2011).

 Non-Lymphoid organ-resident DCs

Tolerogenic DCs in the mucosal compartment of non-lymphoid organs play an important role in tolerance induction and prevent excessive inflammation against commensal and food or environmental antigens. In the intestinal tract, different DC subsets have been identified in the lamina propria, Peyer’s patches and mesenteric lymph nodes (MLN). Of these, the CD103+ subset found in all three sites has been shown to serve a regulatory function. Under steady-state conditions, they can efficiently induce

Foxp3+ Tregs in a TGFβ and retinoic acid dependent manner. Although deletion of 50

CD103+ DCs exacerbates colitis in mice, the tolerogenic properties of these DCs are abrogated in the presence of inflammation and they favor the emergence of IFN producing CD4+ T cells. Similarly, in the lungs and in the liver, CD103+ DCs induce the differentiation of Tregs whereas CD103- DCs produce proinflammatory cytokines. In contrast, in the skin, the CD103-CD11b+ dermal DCs are more potent in inducing Tregs than their CD103+CD11b+ counterparts (reviewed by Kushwah and Hu, 2011;

Manicassamy and Pulendran, 2011).

Therefore, in the absence of any inflammatory stimuli, distinct DC subsets in different tissues induce tolerogenic responses, whereas exposure to antigens through TLR ligands drives these DC subsets to become more immunogenic and trigger inflammatory responses.

2-3-2 Mechanisms of Tolerance Induction by DCs

DCs play an important role in mediating negative selection in the thymus either through clonal deletion of auto-reactive T cells or through induction of regulatory T cells.

In addition, DCs also play a major role in maintaining peripheral tolerance through several mechanisms including induction of T cell anergy/deletion, maintenance of nTregs and generation of iTregs. The importance of DCs to maintain immune tolerance was explicitly demonstrated in a mouse model with constitutive ablation of DCs, which developed spontaneous fatal autoimmunity (Ohnmacht et al., 2009). The mechanisms by which DCs induce tolerance are summarized below (reviewed by Coquerelle and Moser,

2010; Walker and Abbas, 2002) and in Figure 2.8. 51

Figure 2.8: Tolerance induction by immature DCs (adapted from (Banchereau and Palucka, 2005))

 Induction of T cell anergy

Under steady-state conditions, DCs express only moderate levels of MHCII and no or very low levels of co-stimulatory molecules. When these DCs present self- or commensal-antigens to T cells in the absence of co-stimulation, it results in impaired clonal expansion and T cell anergy.

 Peripheral deletion of self-reactive T cells

Several mechanisms of DC-mediated deletion of autoreactive T cells have been identified. One of them requires the expression of IDO by DCs. IDO degrades tryptophan, an amino acid essential for cell proliferation, thereby creating a tryptophan- 52 depleted environment which cannot support T cells. Moreover, tryptophan metabolites such as kynurenine, 3-hydroxy-kynurenine and 3-hydroxy-anthranilic acid are cytotoxic and inhibit T cell proliferation. IDO+ DCs have been identified both in humans and in mice. Murine CD8+ DCs in the spleen express IDO and in humans, a subset of DCs that express CD123 and CCR6 were shown to express IDO. Although autocrine TGFβ signaling has been shown to induce IDO expression in CD8+ DCs, proinflammatory cytokines such as IFN and TNF can also induce IDO expression, thereby limiting excessive activation of T cells at the site of inflammation. Other mechanisms such as Fas-

FasL interaction between DCs and T cells have also been identified that induce T cell deletion.

 Induction and maintenance of regulatory T cells

DCs can also induce differentiation of Tregs from naïve T cell precursors in the periphery. They can induce Foxp3+ Tregs as well as Tr1 and Th3 subsets of regulatory T cells. In addition, DCs are important for the homeostasis and maintenance of nTregs. A positive correlation has been shown between the numbers of DCs and the numbers of

Tregs. Mice deficient for Flt3L show a 10-fold reduction in the numbers of conventional

DCs and 2-fold reduction in the number of nTregs, whereas injection of Flt3L increases the numbers of both cell populations, suggesting the presence of a regulatory circuit that is crucial for the balance between immunity and tolerance.

 Phenotype skewing

DCs can also skew Th cell differentiation from a proinflammatory Th1 to less inflammatory Th2 or regulatory T cell phenotype based on environmental triggers and presence of pro- or anti-inflammatory cytokines.

2-4 Dendritic Cells and TGF-beta

Regulation of dendritic cell function by TGFβ has been an active area of research since the late 1990s. Most of the early studies were conducted using murine bone marrow derived DCs (BMDCs) or human monocyte-derived DCs (HMDCs) due to the relatively few numbers of DCs in lymphoid organs along with difficulty in isolating DCs from peripheral tissues. The first evidence for a role of TGFβ in DC development and function was provided by Strobl et. al. (Strobl et al., 1996). They showed that TGFβ is required to support the growth of Langerhans cells (LCs). Since then, other functions of TGFβ such as inhibition of DC maturation and induction of tolerogenic properties have been identified, although largely based on in vitro studies.

2-4-1 TGFβ Regulation of Langerhans Cell Development

The requirement of TGFβ for Langerhans cell generation has been shown both in vitro and in vivo. In vitro, addition of TGFβ to GM-CSF and IL-4 stimulated cultures of human monocytes induces the expression of LC markers such as E-cadherin and CD1a.

In such cultures, TGFβ promotes both cell differentiation and cell survival. In the absence of TGFβ, monocytes are generated. LC differentiation by TGFβ is associated with the 54 upregulation of the transcription factor Id2. Evidence for a role of TGFβ in LC development in vivo first came from studies using Tgfb-/- mice (Thomas et al., 2001).

These mice lack LCs and it was shown that both autocrine and paracrine sources of TGFβ were sufficient to induce LC differentiation. Furthermore, conditional knock-out mouse models with deletion of TGFβRI specifically in Langerin+ DCs (DC-TβR1del mice) have also established a role for TGFβ in inhibiting LC maturation and migration. Initial seeding of LCs was observed in the epidermis of DC-TβR1del mice, but in the absence of

TβR1 expression, the cells spontaneously matured, gained increased migratory capacity, and gradually disappeared from the epidermis (Geissmann et al., 1998; Jaksits et al.,

1999; Kel et al., 2010; Riedl et al., 1997; Strobl et al., 1996).

2-4-2 TGFβ Regulation of DC Maturation and Migration

Numerous in vitro studies using HMDCs or BMDCs have pointed to a role of

TGFβ in maintaining the immature state of DCs. LCs obtained in vitro from human monocytes in the presence of TGFβ expressed intracellular class II antigens, low levels of

CD80 and no CD83 and CD86. In addition, TGFβ prevented final LC maturation in response to TNF, IL-1 and LPS by downregulating MHCII, CD80, CD86 expression, decreasing IL-12 production and inhibiting FITC-dextran uptake (Geissmann et al., 1999;

Ronger-Savle et al., 2005; Yamaguchi et al., 1997). However, these effects were abolished when the LCs were stimulated with more cognate signals such as CD40

(Geissmann et al., 1999). In another study, TGFβ was also shown to inhibit CD1d expression in PBMCs cultured with GM-CSF and IL-4, suggesting its ability to prevent 55

NK cell activation upon interaction with DCs (Ronger-Savle et al., 2005). Inhibition of

DC maturation has also been shown for murine BMDCs cultured in the presence of

TGFβ (Yamaguchi et al., 1997). Besides preventing the maturation of DCs, TGFβ also suppresses E-cadherin expression and inhibits the development of inflammatory DCs

(Siddiqui et al., 2010). E-cadherin+ DCs produce high amounts of proinflammatory cytokines and chemokines such as IL-6, TNF, IL-12, IL-23, MIP-1α, IL-18, MCP-1 and

RANTES, and have been shown to be increased in colitic mice and Tgfb-/- mice (Siddiqui et al., 2010). TGFβ has also been shown to affect chemotactic responses in DCs by either inhibiting the expression of chemokine receptors such as CCR7 in murine or human DCs

(Ogata et al., 1999), and by increasing the expression of CCR-1, CCR-3, CCR-5, CCR-6 and CXCR-4 in immature HMDCs (Sato et al., 2000). Taken together, these studies suggest that TGFβ prevents DCs from activating aberrant T cell responses. However, the role of TGFβ to maintain an immature state of DCs in vivo still needs to be investigated in detail.

2-4-3 TGFβ Regulation of DC Function

Inhibition of DC maturation by TGFβ affects the antigen presenting capacity of these DCs in vitro (Geissmann et al., 1999). Treatment of murine or human DCs with

TGFβ was shown to impair the allostimulatory function of DCs in mixed lymphocyte reactions (Bonham et al., 1996). Additionally, downregulation of CD1d expression by

TGFβ prevents the activation of CD1d-restricted NK cells by DCs (Ronger-Savle et al.,

2005). Besides affecting the antigen-presenting function of DCs, TGFβ has also been 56 shown to promote the tolerogenic properties of DCs. Autocrine action of TGFβ sustains the activation of IDO in CD8+ DCs through the PI3K/Akt and NF-κB non-canonical pathways. The TGFβ-IDO axis has been shown to mediate durable regulatory functions, with a major role in Treg differentiation and maintenance. Similarly, treatment of pDCs with TGFβ also induces IDO expression, which functions to stably maintain the regulatory phenotype of these DCs for long term tolerance induction (Belladonna et al.,

2008; Grohmann et al., 2003; Pallotta et al., 2011). In the intestine, TGFβ and retinoic acid produced by epithelial cells have been shown to condition DCs to acquire a tolerogenic phenotype. After contact with epithelial cells, DCs upregulated CD103 and were capable of inducing Tregs with gut-homing properties that were protective in a mouse model of colitis (Iliev et al., 2009).

2-4-4 Regulation of DC Function by TGFβ in vivo

There is limited literature pointing to a role of TGFβ signaling in DCs in vivo.

Mice deficient in Runx3, a transcription factor expressed in leukocytes, including DCs, which functions as part of the TGFβ signaling cascade, develop allergic airway inflammation, spontaneous colitis and a late onset progressive hyperplasia of the glandular mucosa of the stomach. The DCs from these mice were more mature with increased efficacy to stimulate T cells (Brenner et al., 2004; Fainaru et al., 2004). Laouar et al. (Laouar et al., 2008) developed a transgenic mouse model of targeted attenuation of

TGFβ signaling in CD11c+ cells (CD11cdnR mice) which showed increased susceptibility to EAE due to activation of self-reactive T cells. However, under homeostatic conditions, 57 these mice did not show any signs of autoimmunity, likely due to residual TGFβ signaling in DCs (Sanjabi and Flavell, 2010). Boomershine et al. (Boomershine et al.,

2009) described autoimmune pancreatitis in a Cre-lox mouse model with targeted deletion of Tgfbr2 in fibroblasts with Cre expression driven by S100A4 gene promoter.

The pathology was attributed to the leaky Cre expression in DCs in which S100A4 gene promoter was also active (Boomershine et al., 2009). Taken together, these studies suggest a role for TGFβ in preserving DC function to maintain immune homeostasis; but whether a complete lack of TGFβ signaling in DCs predispose mice to spontaneous autoimmunity is still not clear. Additionally, the mechanisms by which TGFβ controls

DC function also need to be clarified in vivo.

CHAPTER 3

MATERIALS AND METHODS

3-1 Mice

B6.129S6-Tgfbr2tm1Hlm mice, carrying homozygous loxP site insertion flanking exon 2 of

Tgfbr2 gene (Chytil et al., 2002) were obtained from NCI-Frederick mouse repository

(strain 01XN5). CD11c-Cre transgenic mice (B6.Cg-Tg(Itgax-cre)1-1Reiz/J) (Caton et al., 2007), OT-II transgenic mice (B6.Cg-Tg(TcraTcrb)425Cbn/J), Rag1-/- (B6.129S7-

Rag1tm1Mom/J), and wild-type C57BL/6J (B6) were obtained from the Jackson

Laboratories. All mice were maintained in a conventional animal facility at the

University of Arizona. A separate colony of Cre- and DC-Tgfbr2 KO was established and maintained in an ultraclean (Helicobacter sp.-free) facility through embryo transfer. All animal experiments were approved by the University of Arizona Institutional Animal

Care and Use committee.

3-2 PCR

Cre mediated recombination in T cells and BMDCs was tested using PCR with primers specifically designed to span exon 2 of Tgfbr2 gene. DNA was extracted from cells using the DNA isolation kit from Qiagen and subjected to PCR amplification. Each PCR reaction mixture contained 50-100 ng of DNA, 5 μl of 10X AccuPrime™ Reaction mix,

0.5 μl of 10 μM gene-specific forward and reverse primers, 0.4 μl of AccuPrime™ DNA 59 polymerase, and water to 50 μl. Primers used for exon 2 were Fwd – 5’-

GAGAGGGTATAACTCTCCATC-3’ and Rev – 5’-GTGGATGGATGGTCCTATTAC-

3’ and for exon 5 were Fwd – 5’ – TAGCCACACAGCCATCTCTCA – 3’ and Rev – 5’

–TGGATGGATGCATCTTTCTGG – 3’.

3-3 Generation of BMDCs

BMDCs were prepared as previously described (Xu et al., 2007b). Briefly, bone marrow

(BM) cells were suspended in complete RPMI 1640 supplemented with 10% heat- inactivated fetal bovine serum (Hyclone, USA), 50 mM 2-mercaptoethanol, 100 U/ml penicillin, 100 µg/ml streptomycin and 5 mM glutamine (CM). For GM-CSF/IL-4-DC culture, BM cells were resuspended at 1.5 x 106/ml in CM containing 10 ng/ml GM-CSF and 10 ng/ml IL-4 (Peprotech, USA) and seeded at 3 ml/well in 6-well tissue culture plates. At days 3 and 5, half the medium was removed and fresh medium with cytokines was added to the cells. For Flt3L-DC culture, BM cells were resuspended at 1 x 106 cells/ml in CM containing 100 ng/ml human recombinant Flt3L (Cell signaling

Technology, Inc., USA) and seeded at 3 ml/well in 6-well tissue culture plates. At day 6 for GM-CSF/IL-4 DC or day 8 for Flt3L DC, loosely adherent cells were collected and

CD11c+ cells were purified using magnetic beads. Cells were then replated at 1 x 106 cells/ml in CM. Maturation of the DCs was induced by adding LPS (Calbiochem, USA) at 100 ng/ml. All cells were incubated at 37°C with 10% CO2.

3-4 Flow cytometry

Single cell suspensions were prepared from the thymus, spleen and MLNs and subjected to red cell lysis. After blocking for 15 min with anti CD16/CD32 antibody, the cells were labeled with fluorescent conjugated antibodies and incubated for 30 min at 4oC. Samples were analyzed using FACSCalibur and data were analyzed using FlowJo software

(Treestar, USA). Anti-mouse CD11c-APC/PE, CD3-Percp, MHCII-FITC, CD80-APC,

CD86-APC, CD40-FITC/PE, CCR7-PE, CD11b-PE, CD8a-FITC/APC/Percp, CD4-

PE/FITC, CD24-Pe-Cy7, Qa-2-FITC, CD62L-APC, CD44-APC/PE-Cy7, CD25-APC,

Foxp3-PE were purchased from BD Biosciences, USA or eBioscience, USA. PDCA-1-

PE and B220-FITC were purchased from Miltenyi Biotech, USA. Intracellular staining for Foxp3 was carried out using the regulatory T cell staining kit from eBioscience. 61

Figure 3.1: Gating strategy for analysis of dendritic cells from the spleen. Splenocytes depleted of CD19+ B cells and DX5+ NK cells were incubated with different antibodies to identify dendritic cell subsets. Live cells (gate A) were gated based on forward and side scatter. CD3+ T cells were excluded from further analysis. The CD3- (gate B) cells were selected for further analysis and examined for the expression of CD11c and PDCA-1. The CD11chi (gate C) population includes both myeloid (CD11b+, gate E) and lymphoid populations (CD8+, gate F) and these represent classical 62

DCs. CD11cloPDCA-1+ (gate D) population represents pDCs and were further analyzed for B220 expression.

3-5 Adoptive transfer of BMDCs in an induced model of colitis

BMDCs were generated using GM-CSF and IL-4 and 3x106 CD11c+ cells were i.p. injected into B6 Rag1−/− mice that had received naive CD4+CD45RBhi T cells two weeks earlier. Ten days post transfer, mice were sacrificed and colons were collected for histological analysis and explants cultures. Cytokine expression was determined by quantitative RT-PCR.

3-6 Microarray analysis

Splenic CD11c+ DCs were magnetically (CD11c isolation kit, Miltenyi Biotech, USA) sorted from at least three control or DC-Tgfbr2 KO mice. For isolation of MLN DCs, single cell suspensions of the lymph nodes were stained with a cocktail of antibodies consisting of CD45-Percp, MHCII-FITC, CD11c-APC, CD11b-efluor-450 and CD103-

PE (all from eBioscience, USA). Samples were sorted in a BD FACSAria at the

Cytometry Core facility at the Arizona Cancer Center. Cells were gated on

CD45+MHCII+ population and further gated on the combined population of

CD11c+CD11b+ and CD11c+CD11b-. These cells were then sorted based on CD103 expression. Samples were pooled from four different mice and RNA was isolated using

RNAqueous®-Micro kit (Ambion®, Life Technologies, USA) to yield three samples per genotype. RNA integrity was evaluated with Agilent 2100 BioAnalyzer microfluidics- based platform (Agilent, Foster City, CA). RNA samples were subsequently processed to 63 yield biotinylated cRNA for hybridization to Affymetrix Mouse Exon 1.0 ST arrays. The expression data was obtained in the form of .CEL files and imported into GeneSpring GX

10.0.2 (Agilent technologies, Inc) software package for the data quality control and the statistical analysis of the microarray data. Stringent empirical and statistical analyses were employed to compare gene expression profiles between Cre- and DC-Tgfbr2 KO mice with cross-gene error model based on replicates. Accession code: GEO (pending)

3-7 Western blot analysis

CD11c+ BMDCs were treated with TGFβ (10 ng/ml, Peprotech, USA) for 30 min. Whole cell lysates were collected in RIPA buffer and protein concentration in lysates was determined using BCA reagent (Pierce, USA). 20 µg of protein was subjected to

SDS/PAGE electrophoresis , and separated proteins were transferred on to Nitrocellulose membrane (Biorad, USA), blocked at least for 1 h in 5% BSA in TBST buffer containing

0.1% Tween20, and probed with pSmad2 (Cell Signaling, USA) antibody overnight at

4°C in 5% BSA. The membranes were washed three times with TBST buffer followed by incubation with appropriate horseradish peroxidase-coupled secondary antibody. Super

Signal West Pico detection kit (Pierce, USA) was used for chemiluminescent detection.

Blots were probed for total Smad2 to confirm equal loading. Autoantibodies were detected according to a previously described protocol (Ohnmacht et al., 2009).

3-8 Real time PCR

Total RNA was isolated from tissues or cells using TRIzol reagent (Invitrogen, USA) and its integrity was confirmed by denaturing agarose gel electrophoresis and calculated densitometric 28S/18S ratio. 250ng of total RNA was reverse-transcribed using iScript cDNA synthesis kit (Bio-Rad, USA). Subsequently, 20 µl of PCR reactions were set up in 96-well plates containing 10 µl of 2x IQ Supermix (Bio-Rad), 1 µl TaqMan® respective primer/probe set (Applied Biosystems, Foster City, CA), 2 µl of the cDNA synthesis reaction (10% of RT reaction) and 7 µl of nuclease-free water. Reactions were run and analyzed on a Bio-Rad CFX96 iCycler real–time PCR detection system. Cycling parameters were determined and resulting data were analyzed by using the comparative

Ct method as means of relative quantification, normalized to an endogenous reference

(TATA Box Bonding Protein, TBP) and relative to a calibrator (normalized Ct value obtained from control mice) and expressed as 2-ΔΔCt (Applied Biosystems User Bulletin

#2: Rev B “Relative Quantification of Gene Expression”).

3-9 Histology

Tissues were fixed in 10% formalin, embedded in paraffin and 5 µm sections were stained with hematoxylin and eosin.

3-10 Immunohistochemistry

Sections of liver, stomach and pancreas were harvested, fixed in Tissue-Tek (Sakura

Finetek USA, Torrance, CA) and snap frozen in liquid nitrogen. Sections (5µm) were cut, 65 mounted on slides and fixed for 10 min in cold methanol. After washing in 1X TBS, residual endogenous peroxidase activity was quenched by incubation in 3% H2O2 in water for 10 min. Slides were then incubated with 5% normal goat serum (Vector

Laboratories, Burlingame, CA) for 1 hour in 1X TBS/0.1% Tween-20 (TBST). Next, sections were incubated with a primary antibody against CD4 differentiation antigen

(1/50, BD bioscience, San Jose, CA) in TBST overnight at 4°C. After 3 washes in TBST, slides were incubated with biotinylated secondary antibody and avidin/peroxidase complex according to the manufacturer’s recommendation (Vector laboratories). Slides were then incubated with 3, 3’-diaminobenzidine (DAB) (Vector laboratories) and mounted with Dako mounting medium (Dako North America, Inc). Slide examination was performed independently by 2 experienced scientists in a blind manner using a Zeiss

Axioplan microscope (Carl Zeiss MicroImaging, Thornwood, NY). Images were captured with Nikon Digital Sight DS-Fi1 camera and NIS-Element software (Nikon Instruments,

Melville, NY).

3-11 ELISA and multiplex assays

Cytokines in cell culture supernatants or colonic explant cultures were detected using appropriate ELISA kits from eBioscience, USA. Immunoglobulins in serum were detected using Mouse Immunoglobulin isotyping kit (Millipore, USA) on a Luminex-100 workstation (Liquichip; Qiagen, USA) and analyzed using MasterPlex 2010 software

(MiraiBio, USA).

3-12 Treg conversion assay

CD11c+ Flt3L BMDCs were pretreated with indicated concentrations of ovalbumin

(Sigma Aldrich, USA) for 18 h, washed three times with CM and co-cultured with

CD4+CD62L+ T cells from spleens of OT-II mice in the presence or absence of 5 ng/ml

TGFβ. Cells were incubated for 90 h at 37oC. CD11c+ MLN DCs were co-cultured with naïve OT-II T cells in the presence of 1 mg/ml ovalbumin and 5 ng/ml TGFβ for 90 h at

37 deg C. Foxp3 staining was performed as described earlier. In some conditions, an anti-

IFNγ neutralizing antibody (2 µg/ml, clone XMG 1.2, eBioscience, USA) or an isotype control antibody (rat IgG1) was used.

3-13 iTreg generation

CD4+CD62L+ T cells from wild-type mice were stimulated with anti-CD3/anti-CD28 beads (Invitrogen, USA), TGFβ (5 ng/ml), IL-2 (20 ng/ml, Peprotech, USA) and 0.5 µM retinoic acid (Sigma-Aldrich, USA) for 4 days. >85% of T cells expressed Foxp3 on day

4 as determined by flow cytometry.

3-14 Statistical analysis

Statistical analyses were performed using GraphPad Prism software (GraphPad Software,

Inc., USA) using one way ANOVA followed by Newman-Keuls or Bonferroni post-hoc test, or by Student T-test, whenever appropriate. 67

CHAPTER 4

RESULTS

4-1 Specificity of Tgfbr2 deletion in DC-Tgfbr2 KO mice

To determine the importance of TGFβ signaling in DCs in vivo, we developed a conditional KO mouse model by crossing mice expressing Cre recombinase under the control of CD11c promoter (Caton et al., 2007; Walunas et al., 1994) with mice having exon 2 of Tgfbr2 gene flanked by loxP sites (Chytil et al., 2002). Cre+/fl/fl mice (DC-

Tgfbr2 KO mice) along with their control littermates (Cre-/fl/fl) were used as experimental animals. Efficient reduction of Tgfbr2 mRNA was confirmed by qPCR in CD11c+

BMDCs from DC-Tgfbr2 KO mice (Figure 4.1A). Phosphorylation of Smad-2 induced by exogenous TGFβ was also significantly reduced in BMDCs (Figure 4.1B) from DC-

Tgfbr2 KO mice but not in BMDCs from control Cre- littermates.

Figure 4.1: Specificity of Tgfbr2 deletion in DC-Tgfbr2 KO mice. (A) mRNA expression of Tgfbr2 in BMDCs from control Cre- and DC-Tgfbr2 KO mice. Each sample was normalized to TBP expression. Bars represent means and SEM of samples from five individual mice. P value obtained from Student’s t test; (B) CD11c+ BMDCs were stimulated with TGFβ for 30 min and pSmad2 expression was determined by western blotting 68

(representative results of 3 different experiments). Total Smad2 was used as loading control.

TGFBR2 protein expression in other cell types including, B cells, NK cells and macrophages was also determined and no significant difference was observed between

Cre- and DC-Tgfbr2 KO mice (Figure 4.2 A-C).

A B C

Figure 4.2: TGFBR2 expression is not affected in B cells, NK cells and macrophages. TGFBR2 protein expression was analyzed by Western blotting in protein lysates from magnetically sorted splenic CD19+ B cells (A), DX5+ NK cells (B), and resident peritoneal macrophages (C) of Cre- and DC-Tgfbr2 KO mice. GAPDH is shown as a loading control (representative results of 3 different experiments). Corresponding densitometric analysis of Western blots relative to GAPDH are presented below. P values were obtained using Student’s t test.

Compared to Cre- mice, Tgfbr2 mRNA was decreased by 28% in total splenic CD4+ T cells isolated from DC-Tgfbr2 KO mice, although without reaching statistical significance (p>0.16) (Figure 4.3A). There was no difference in TGFBR2 protein expression in naïve splenic CD4+CD62Lhi T cells (Figure 4.3B). Moreover, we demonstrated the same rates of iTreg (CD25+FoxP3+) conversion from naïve

CD4+CD62L+ T cells isolated from the spleen of Cre- or DC-Tgfbr2 KO mice in the presence of TGFβ and anti-CD3/anti-CD28 beads, thus confirming intact TGFβ signaling in naïve T cells (Figure 4.3C). To address potential Cre-mediated recombination in effector memory T cells, which can also express low levels of CD11c, we isolated splenic

CD4+CD62L- T cells from Cre- and DC-Tgfbr2 KO mice, purified genomic DNA and performed PCR with primers specific to exon 2 (and exon 5 as input control) of Tgfbr2 gene. Efficient recombination of exon 2 could only be demonstrated in CD11c+ BMDCs, but not in activated T cells from DC-Tgfbr2 KO mice (Figure 4.3D). Collectively, these data demonstrate efficient deletion of Tgfbr2 and abrogation of TGFβ signaling specifically in DCs. 70

A B

C D

Figure 4.3: TGFBR2 expression is not affected in CD4 T cells. (A) Tgfbr2 mRNA expression in CD4+ T cells from the spleen of Cre- and DC-Tgfbr2 KO mice. Each sample was normalized to TBP expression. Bars represent means + SEM of 5 individual mice. P value obtained using Student’s t test (B) TGFBR2 expression in CD4+CD62L+ T cells from the spleen of Cre- and DC-Tgfbr2 KO mice. GAPDH was used as a loading control. (C) Percentage of CD4+CD25+Foxp3+ T cells generated after stimulation of naive CD4+CD62L+ T cells with anti-CD3/CD28 beads and indicated concentrations of TGFβ for 3 days. Bars represent means + SEM (N=3). ns – not significant (Student’s t test) (D) PCR detection of Cre- mediated excision of exon 2 of Tgfbr2 in genomic DNA extracted from CD4+CD62L-T cells or CD11c+ BMDCs from control or DC-Tgfbr2 KO mice. Amplicon from exon 5 is shown as an input control. All data are representative of at least three different experiments.

4-2 Absence of TGFβ signaling in DCs leads to multi-organ autoimmune inflammation

Transgenic mice with specific deletion of Tgfbr2 in DCs were phenotypically normal until about 3-4 weeks of age, when they became symptomatic and moribund by 4-14 weeks of age (Figure 4.4A). At 12 weeks of age, their body weight was reduced by ~30-

40% as compared to control Cre- littermates (Figure 4.4B).

Figure 4.4: DC-Tgfbr2 KO mice die prematurely. (A) Survival curve of DC-Tgfbr2 KO mice and controls (n = 22); (B) Body weight of Cre- and DC-Tgfbr2 KO mice at 12 weeks of age (n = 4-6 males,10-14 females). P values obtained using Student’s t test.

Post-mortem analysis revealed hydrocephalus, which was confirmed histologically to be due to the complete blockage of aqueduct of Sylvius (Figure 4.5A). Macroscopic analysis of internal organs revealed gastric hyperplasia and premature thymic involution (Figure

4.5B). Histopathology of DC-Tgfbr2 KO mice revealed the following: severe subacute diffuse gastritis with mucosal hyperplasia (Figure 4.5B); mild to moderate subacute 72 multifocal hepatitis with focal fibrosis (Figure 4.5C); mild to severe subacute multifocal pancreatitis with loss of exocrine cells (Figure 4.5C); and mild to moderate subacute multifocal colitis with loss of goblet cells, mild to moderate crypt hyperplasia and predominantly lymphocytic or mixed lymphocytic and neutrophilic infiltrates (Figure

4.5C). None of these changes were observed in Cre- littermates. Compared to Cre- mice, there was a significant increase in inflammatory cytokine expression in the stomach and colon of DC-Tgfbr2 KO mice (Figure 4.5D, left and right panels, respectively).

Consistently, TNF and IFNγ secretion was significantly elevated in colonic explant cultures from DC-Tgfbr2 KO mice (Figure 4.5E). These findings reveal that loss of TGFβ signaling in DCs leads to the development of autoimmune inflammation in multiple organs. Similar mortality and pathology has been observed in DC-Tgfbr2 KO rederived via embryo transfer into an ultraclean Helicobacter sp.-negative environment (data not shown).

A C

Figure 4.5: Pathology of DC-Tgfbr2 KO mice. (A) Gross morphology (left panel) of the brain from Cre- (left) and DC-Tgfbr2 KO (right) mice and H&E staining of the brain stem (middle and right panels) from 12 week-old mice (representative of >5 mice); (B) Gross morphology (left panel) of the stomach from Cre- (left) and DC-Tgfbr2 KO (right) mice and H&E staining of the forestomach and glandular stomach (top and bottom panels) from 12 week old mice; (C) H&E staining of indicated tissues 74

from 12 week old Cre- and DC-Tgfbr2 KO mice (representative results of >5 mice); (D) mRNA expression of indicated cytokines in the forestomach (left) and proximal colon (right) of Cre- and DC-Tgfbr2 KO mice. Samples were normalized to TBP. Error bars represent means + SEM of samples from 5 mice. **** - p < 0.0001, *** - p < 0.001, ** - p < 0.01, * - p < 0.05 (Student’s t test) (E) TNF and IFNγ expression in the colonic explant cultures of Cre- and DC-Tgfbr2 KO mice. Results are expressed as cytokine release per 50 mg of tissue. Bars represent means + SEM of at least six individual mice. P values were obtained using Student’s t test.

4-3 Impaired TGFβ signaling in DCs leads to T and B cell activation

Dendritic cells contribute to the mechanisms of central tolerance by mediating clonal deletion of self-reactive T cells in the thymus. DC-Tgfbr2 KO mice display premature thymic involution which upon histological analysis revealed nearly complete absence of the thymic cortex (Figure 4.6A). To determine whether Tgfbr2 KO DCs are impaired in their ability to mediate clonal deletion of self-reactive T cells, we looked at the frequency and number of CD4+ and CD8+ single positive (SP) T cells in the thymus.

Thymocytes from 10 week old DC-Tgfbr2 KO mice showed a 2-fold increase in the frequency of CD4+ SP cells, although the total number of CD4+ SP cells did not show a significant difference between Cre- and DC-Tgfbr2 KO mice (Figure 4.6B). However, there was a significant increase in both the frequency and number of Qa2+CD24lo cells among the CD4 SP population in DC-Tgfbr2 KO mice compared to Cre- mice suggesting that the increased frequency of CD4+ SP cells was a result of recirculation of peripheral

CD4 T cells into the thymus (Sprent and Kishimoto, 2002) (Figure 4.6C).

Thymus A Cre- DC-Tgfbr2 KO

Figure 4.6: Premature thymic involution in DC-Tgfbr2 KO mice. (A) H&E staining of the thymus of 10 week old Cre- (left) and DC-Tgfbr2 KO (right) mice showing premature involution with loss of thymic cortex in DC- Tgfbr2 KO mice (representative results of at least 6 mice); (B) CD4+ and CD8+ thymocytes in mice as described in (A). The numbers of CD4+ SP cells are indicated on the right (representative of >6 mice). Bars represent means + SEM, ns – not significant (Student’s t test); (C) Qa2+ and CD24+ thymocytes in mice as described in (A) (gated on CD4+ SP cells). The numbers of Qa2+CD24loCD4 SP cells are indicated on the right (representative of >6 mice). Error bars represent SEM.

Since such recirculation is a classic phenomenon in autoimmunity (Hakim and Gress,

2007), we analyzed the activation status of T cells in the periphery (spleen and MLN) of

DC-Tgfbr2 KO mice and found a marked increase in the frequency of CD62LloCD44hi cells among both CD4+ and CD8+ T cells compared to Cre- littermates (Figure 4.7 A-C).

Consistent with these findings, we also found CD4+ T cell infiltration by immunohistochemistry in the stomach, pancreas and liver of DC- Tgfbr2 KO mice but not in Cre- mice (Fig. 4.7D). 77

B D

Figure 4.7: Increased T cell activation in DC-Tgfbr2 KO mice. (A) CD62L (left) and CD44 (right) expression among CD4+ (top panel) and CD8+ (bottom panel) splenic T cells from 8 week old Cre- and DC-Tgfbr2 KO mice. (B) Frequency of CD62Llo and CD44hi CD4 (top panel) and CD8 (bottom panel) T cells from spleen of 8 week old control Cre- and DC-Tgfbr2 KO mice. Bars represent means + SEM from 5-6 mice. (C) Frequency of CD62Llo and CD44hi CD4 (top panel) and CD8 (bottom panel) T cells from MLN of control Cre- and DC-Tgfbr2 KO mice. Bars represent means + SEM from 4-6 mice. P values obtained using Student’s t test; (D) Immunohistochemistry for CD4+ T cells in the indicated organs 78

of 8 week old Cre- and DC-Tgfbr2 KO mice. Data are representative of at least 6 individual mice.

Autoimmunity is also associated with an activation of the humoral responses resulting in increased levels of immunoglobulins in the serum and generation of autoantibodies. To determine if there is a similar activation of B cells in DC-Tgfbr2 KO mice, we measured the levels of immunoglobulins in their serum and found significant increases in the levels of IgM and IgG1 (Figure 4.8A). To test for the presence of autoantibodies, we probed tissue lysates from Rag-/- mice with serum from either Cre- or

DC-Tgfbr2 KO mice. As shown in Figure 4.8B, several distinct bands were observed only in those tissues that were probed with serum from DC-Tgfbr2 KO mice. Overall, these results suggest that abrogation of TGFβ signaling in DCs result in spontaneous activation of self-reactive T and B cells.

A B A B

Figure 4.8: Activation of B cell responses in DC-Tgfbr2 KO mice. (A) Immunoglobulin isotype concentrations in the serum of Cre- and DC- Tgfbr2 KO mice. Bars represent means + SEM of 10-12 mice per genotype. P values obtained using Student’s t test. ns – not significant; (B) Western blot analysis of indicated Rag-/- tissue lysates showing the 79

staining pattern when incubated with serum of control (n = 3-4) and DC- Tgfbr2 KO mice (n = 2-4)

4-4 Tgfbr2-deficiency does not affect differentiation of major DC subtypes or

MHCII and co-stimulatory molecule expression in vivo.

To determine whether lack of TGFβ signaling in DCs affects their differentiation, we looked at the major DC subsets in the spleen and lymph nodes of DC-Tgfbr2 KO mice using flow cytometry. Splenocytes depleted of B and NK cells or MLN cells were stained with a cocktail of antibodies to identify the myeloid (CD11chiCD11b+), lymphoid

(CD11chiCD8+) and pDC (CD11cloPDCA-1+) population of DCs, based on the gating strategy described in Figure 3.1. We found no significant difference in the frequency of different subsets between Cre- and Cre+ mice both in the spleen and MLN (Figure 4.9 and data not shown).

Figure 4.9: Tgfbr2-deficiency does not affect differentiation of major DC subtypes in the spleen. Staining of DC subsets in CD19- and DX5- depleted splenocytes from 8 week old Cre- (top panel) and DC-Tgfbr2 KO (bottom panel) mice. Dot plots are gated on CD3- cells (data representative of at least 4 different experiments).

Next, we determined the expression of MHCII and co-stimulatory molecules, which have been shown to be down-regulated on the surface of TGFβ-treated DCs

(Geissmann et al., 1999). Contrary to in vitro studies, there was no difference in the expression of MHCII, CD80, CD86 or CD40 in either CD11chi cDCs or pDCs in vivo in the spleens of 8-10 wk old DC-Tgfbr2 KO mice as compared to Cre- mice (Figure 4.10). 81

Figure 4.10: Tgfbr2-deficiency does not affect MHCII or co-stimulatory molecule expression in the spleen. MHCII, CD80, CD86, CD40 expression on splenic CD11chi cDCs (top panel) and CD11cloPDCA-1+ pDCs (bottom panel) of Cre- and DC-Tgfbr2 KO mice. Cells were prepared and gated as described in Fig. 4.9. Data representative of at least 4 experiments.

We observed, however, a 2-fold increase in the frequency of CD11c+CCR7+ DCs in the spleen of DC-Tgfbr2 KO mice (Figure 4.11) indicating increased presence of migratory DCs. Therefore, based on expression of MHCII and co-stimulatory molecules, loss of TGFβ signaling in DCs is unlikely to affect their Ag presenting capacity in vivo.

3.5 p < 0.01 3

cells 2.5 +

2 CCR7 + 1.5

% % CD11c 0.5

0 Cre- DC-Tgfbr2 KO Figure 4.11: Increased frequency of CCR7+ DCs in DC-Tgfbr2 KO mice. CCR7 expression in CD11c+ splenic DCs from 8 week old Cre- and DC- Tgfbr2 KO mice (representative of at least 6 mice per group). Numbers indicate the frequency of CCR7+CD11c+ DCs. (Right panel) Bar graph representing the percentage of CD11c+CCCR7+ DCs in the spleen of Cre- and DC-Tgfbr2 KO mice. Bars represent means + SEM of at least 6 individual mice. P value obtained using Student’s t test.

4-5 Dendritic cells from DC-Tgfbr2 KO mice are more pro-inflammatory

Recently, Siddiqui et. al. (Siddiqui et al., 2010) showed that TGFβ prevents the development of a subset of inflammatory DCs that express E-cadherin. E-cadherin+ DCs were increased in the small intestine, colon, MLN and spleen of Tgfb -/- mice and were more pro-inflammatory. Consistently, we observed a similar increase in the frequency of

E-cadherin+CD11c+ DCs in the MLN of DC-Tgfbr2 KO mice (Figure 4.12 A and B), indeed suggesting that Tgfbr2-deficient DCs are more pro-inflammatory.

A B

Figure 4.12: Increased frequency of E-cadherin+ DCs in MLN of DC- Tgfbr2 KO mice. (A) Histogram of E-cadherin expression among CD11c+ MLN cells from Cre- and DC-Tgfbr2 KO mice by flow cytometry. Cells were gated on CD3- cells; (B) Bar graph representing the percentage of E- cadherin+CD11c+ DCs in the MLN of Cre- and DC-Tgfbr2 KO mice. Bars represent means + SEM of at least 3 individual mice. P value obtained using Student’s t test.

To test whether Tgfbr2 KO DCs are in fact immunostimulatory and contribute to the development of autoimmunity, we analyzed major proinflammatory gene expression by qPCR in CD11c+ generated with GM-CSF and IL-4 from bone marrow of 4-6 wk old asymptomatic mice. As shown in Figure 4.13, DCs from DC-Tgfbr2 KO mice had significantly elevated expression of TNF even at the basal level as compared to control mice. LPS treatment did not further increase TNF expression, but IL-6 and IL-12 were significantly up-regulated compared to DCs from control mice (Figure 4.13).

Figure 4.13: Tgfbr2 KO BMDCs are more proinflammatory. Cytokine mRNA expression in CD11c+ BMDCs +/- LPS for 18 h. Samples were normalized to TBP. Error bars represent means + SEM of triplicate samples. **** - p < 0.0001, *** - p < 0.001, ** - p < 0.01, * - p < 0.05, ns – not significant (One-way ANOVA with Bonferroni test)

To functionally test the proinflammatory potential of Tgfbr2 KO DCs, we examined their ability to affect the early stages of the development of T cell mediated colitis. Rag-/- mice had received CD4+CD45RBhi T cells 2 weeks prior to adoptive transfer of CD11c+ BMDCs and were monitored for another 10 days, after which time, the degree of colonic inflammation was assessed based on the proinflammatory gene expression profile. As shown in Figure 4.14A, administration of Tgfbr2 KO DCs but not control DCs led to a significant increase in the colonic expression of TNF, IL-1β, IL-6 and IFNγ. Although with the exception of IFNγ, cytokine secretion from colonic explants did not reach significance (likely due to the early stage of colitis selected due to short lifespan of transferred DCs), they were markedly elevated compared to mice injected with control DCs (Figure 4.14B). These results demonstrate that Tgfbr2 KO DCs are more proinflammatory and can exacerbate T cell mediated pathology. 85

A B

Figure 4.14: Tgfbr2 KO BMDCs exacerbate severity of disease in a mouse model of colitis. (A) Relative mRNA expression of indicated cytokines in the distal colon of Rag-/- mice transferred with or without CD4+CD45RBhi naïve T cells (0.5 x 106 cells) followed by either Cre- or DC-Tgfbr2 KO BMDCs (3 x 106 cells). Samples were normalized to TBP. Bars represent means + SEM of at least 5-6 mice per group. (B) Cytokine expression in the colonic explant cultures of mice as treated in (A). Results are expressed as cytokine release per 50 mg of tissue. **** - p < 0.0001, *** - p < 0.001, ** - p < 0.01, * - p < 0.05, ns – not significant (One-way ANOVA with Bonferroni test)

In order to determine whether DCs have a similar proinflammatory phenotype in

DC- Tgfbr2 KO mice in vivo, we first performed a complete gene expression profiling in total splenic CD11c+ DC population isolated from 8 week old Cre- or asymptomatic DC-

Tgfbr2 KO mice using mouse Exon ST1.0 arrays (Affymetrix). As shown in Figure

4.15A, about 278 genes were differentially regulated in splenic DCs from DC-Tgfbr2 KO mice (up- or down-regulated, p<0.05) with a fold change of >= 1.5. The 278 genes were categorized based on their biological function and sorted according to the EASE

(Expression analysis systematic explorer) score (Figure 4.15B). Among the genes involved in immune responses, we found upregulation of TNF, several IFNγ inducible 86 genes including T cell chemoattractants Cxcl9, Cxcl10 and Cxcl11 (Table 4.1) which may explain the predominance of Th1 cytokines in the inflamed tissues. Expression of CCR9 chemokine receptor, which may be used to discriminate between immature and mature

DCs (Hadeiba et al., 2008), was downregulated (Table 4.1), thus suggesting a more mature phenotype of Tgfbr2 KO DCs.

Figure 4.15: Microarray analysis of splenic DCs from DC-Tgfbr2 KO mice. (A) Histogram depicting the number of genes/probe sets whose expression was increased or reduced at p < 0.05 in CD11c+ splenic DCs from DC-Tgfbr2 KO mice relative to their wild-type littermates. Increasing stringency of analysis (1.2-2 fold change on x-axis) demonstrates the magnitude of change in splenic DC gene expression profile in DC-Tgfbr2 KO mice; (B) Gene ontology analysis using DAVID Functional Annotation Tool (http://david.abcc.ncifcrf.gov/) of the 535 gene/probe sets, which indicated > 1.4-fold change at p < 0.05 (Student t- test with Benjamini and Hochberg false discovery rate as multiple testing 88

correction). Genes categorized based on biological process were grouped and ranked (threshold of 5, P < 0.05). Categories were sorted according to the EASE score, a modified Fisher exact P value

Table 4.1: Table of genes up- or down-regulated by microarray analysis in splenic CD11c+ DCs from DC-Tgfbr2 KO mice as compared to Cre- mice. n=3 per genotype.

We also compared gene expression patterns in CD103+ MLN DCs flow-sorted from Cre- and DC-Tgfbr2 KO mice. CD103+ DCs found in the MLN and small intestinal lamina propria are considered tolerogenic as they have the enhanced ability to induce

+ Foxp3 in iTregs as well as expression of gut homing receptors (CCR9 and α4β7) in T and

B cells (Siddiqui and Powrie, 2008). The tolerogenic properties of these DCs have been shown to be dependent on TGFβ and retinoic acid produced by the intestinal epithelial cells (Iliev et al., 2009). We found that about 208 genes with a fold change of >= 1.3 were dysregulated (up- or down-regulated, p<0.05) in CD103+ DCs from DC-Tgfbr2 KO mice (Figure 4.16A). The 208 genes were categorized based on their biological function and sorted according to the EASE score (Figure 4.16B). Most notably, IFNγ was upregulated by ~2 fold in these DCs (Table 4.2). Similar to our observations with splenic

CD11c+ DCs, we found increased mRNA expression of the T cell chemoattractants, 89

CXCL9 and CXCL10 along with their receptor, CXCR3. In addition, we also saw an increase in the gene expression of proinflammatory chemokines CCL6 and CCL9, which are also associated with Th1 type inflammatory response (Table 4.2). Therefore, the results of the microarray analysis confirm that Tgfbr2-deficient DCs are in fact more proinflammatory and the observed pathology in DC-Tgfbr2 KO mice may be at least in part due to increased production of proinflammatory cytokines like TNF and IFNγ, which augment a Th1 type inflammatory responses. 90

Figure 4.16: Microarray analysis of CD103+ MLN DCs from DC-Tgfbr2 KO mice. (A) Histogram depicting the number of genes/probe sets whose expression was increased or reduced at p < 0.05 in CD103+ MLN DCs from DC-Tgfbr2 KO mice relative to their wild-type littermates. Increasing stringency of analysis (1.2-2 fold change on x-axis) demonstrates the magnitude of change in MLN DC gene expression profile in DC-Tgfbr2 KO mice; (B) Gene ontology analysis using DAVID 91

Functional Annotation Tool (http://david.abcc.ncifcrf.gov/) of the gene/probe sets, which indicated > 1.4-fold change at p < 0.05 (Student t- test with Benjamini and Hochberg false discovery rate as multiple testing correction). Genes categorized based on biological process were grouped and ranked (threshold of 5, P < 0.05). Categories were sorted according to the EASE score, a modified Fisher exact P value

Table 4.2: Selected genes up-regulated in CD103+ DCs from DC-Tgfbr2 KO mice as compared to Cre- mice. n=3 per genotype with RNA pooled from at least 4 mice per sample.

4-6 Alteration of regulatory T cell phenotype in DC-Tgfbr2 KO mice

CD4+CD25+Foxp3+ Tregs are immunosuppressive cells which are required for the maintenance of immune tolerance. Loss of these cells leads to a fatal autoimmune syndrome affecting multiple organs. We analyzed the frequency and numbers of Tregs in the thymus, spleen and MLN of DC-Tgfbr2 KO mice. In 4 wk old mice with macroscopically intact thymus, we did not find a significant difference in the percentage of thymic CD4+Foxp3+ T cells between Cre- and DC- Tgfbr2 KO mice (Fig. 4.17B).

There was a significant increase in the frequency of CD4+Foxp3+ T cells in the thymus of

10 wk old DC-Tgfbr2 KO mice as compared to Cre- littermates, although the total number of cells was not significantly different (Figure 4.17A). 92

Figure 4.17: Tregs in the thymus of DC-Tgfbr2 KO mice. (A) Percentage (left) and numbers (right) of CD4+Foxp3+ Tregs in the thymus of 10 week old control and DC-Tgfbr2 KO mice. Bars represent means + SEM of 6 mice. (B) Percentage of CD4+Foxp3+ T cells in the thymus of 4-week old DC-Tgfbr2 KO mice. Bars represent means + SEM from at least three individual mice. P value obtained using Student’s t test. ns – not significant.

We next investigated Foxp3 expression in the splenic and MLN T cells from Cre- and DC-Tgfbr2 KO mice. Interestingly, the proportion (both percentage and number) of

CD4+Foxp3+ T cells in the spleen and MLN was increased considerably in DC-Tgfbr2

KO mice compared to Cre- mice (Figure 4.18A) but the intensity of Foxp3 expression was significantly reduced in CD4+ T cells from DC-Tgfbr2 KO mice (Figure 4.18B). 93

Although in Cre- mice almost all Foxp3+ cells were CD25+ (Figure 4.19 A and B), in DC-

Tgfbr2 KO mice, there was a considerable decrease in the proportion of CD25+Foxp3+ cells accompanied by a significant expansion of CD25-Foxp3+ cell population (Figure

4.19 A and B). These results suggest that the phenotype of peripheral Tregs in DC-Tgfbr2

KO mice is altered which in turn may affect the function of these cells (see discussion) leading to development of autoimmune disease.

160 140 p<0.01 120 p<0.001 100 80 60 Mean MFI 40 20 0 Spleen MLN

Figure 4.18: Tregs in the spleen and MLN of DC-Tgfbr2 KO mice. (A) Percentage (left) and numbers (right) of CD4+Foxp3+ Tregs in the spleen and MLN of 10 week old control and DC-Tgfbr2 KO mice. Bars represent means + SEM of 6 mice. P value obtained using Student’s t test; (B) Foxp3 expression in CD4+ T cells from the spleen and MLN of Cre- and 94

DC-Tgfbr2 KO mice (representative of >6 mice per group). Mean MFI of Foxp3 expression is represented on the right. Error bars represent mean + SEM of 6 mice. P value obtained using Student’s t test.

B A

Figure 4.19: CD25+Foxp3+ Tregs in the spleen and MLN of DC-Tgfbr2 KO mice. (A) Frequency of CD25+Foxp3+ (upper right quadrant) and CD25-Foxp3+ T cells (lower right quadrant) in the spleen (top panel) and MLN (bottom panel) of 8 week old asymptomatic control (left) and DC- Tgfbr2 KO mice (right). Plots are gated on CD4+ cells; (B) Percentage (top) and numbers (bottom) of CD4+CD25+Foxp3+ T cells in the spleen and MLN of control and DC-Tgfbr2 KO mice. Bars represent means + SEM of 6 mice. P values obtained using Student’s t test.

4-7 Increased IFNγ production by Tgfbr2 KO DCs inhibits Ag-specific Treg differentiation

In the presence of TGFβ, activation of naïve T cells by DCs leads to the induction of Foxp3 transcription factor and Treg differentiation. To determine whether TGFβ signaling in DCs was also required for efficient differentiation of Tregs, we co-cultured ovalbumin pretreated Flt3L-differentiated BMDCs from either control or DC-Tgfbr2 KO 95 mice with CD4+CD62L+ naïve T cells from OT-II mice in the presence of recombinant

TGFβ. Three days later, the percentage of CD4+CD25+Foxp3+ cells was analyzed by flow cytometry. Despite the presence of TGFβ, DCs from DC-Tgfbr2 KO mice were significantly less efficient in inducing Treg differentiation compared to DCs from Cre- mice (Figure 4.20A, left panel). We saw a similar effect at two different concentrations of ovalbumin (Figure 4.20A, right panel). Analysis of cell co-culture supernatants by ELISA revealed substantial increase in IFNγ, but not IL-6 levels in DCs from DC-Tgfbr2 KO mice (Figure 4.20B).

Figure 4.20: Impaired iTreg differentiation by BMDCS from DC-Tgfbr2 KO mice. (A) Regulatory T cell differentiation assay using Cre- or DC- Tgfbr2 KO CD11c+ Flt3L BMDCs. DCs pretreated with ovalbumin (500 µg/ml) were co-cultured with CD4+CD62L+ naïve OT-II T cells (1:10) in the presence or absence of TGFβ (5 ng/ml) for 90 h. Percentage of CD25+Foxp3+ Tregs is shown as determined by flow cytometry. Cells were gated on live CD4+ cells (representative of at least 2 experiments); Percentage of CD25+Foxp3+ Tregs obtained using two different concentrations of ovalbumin is shown on the right. P values obtained using Student’s t test. (B) IFNγ (top panel) and IL-6 (bottom panel) concentrations in the supernatants of Treg conversion assay as described 97

in (A). Bars represent means + SEM of triplicate samples, * - p < 0.05, ns – not significant (One way ANOVA with Newman-Keuls post-hoc test; data representative of at least 2 individual experiments)

Since GM-CSF and IL-4 differentiated DCs from DC-Tgfbr2 KO mice were more proinflammatory, we next investigated whether Flt3L-BMDCS were also produce proinflammatory cytokines that could potentially inhibit Treg conversion. qPCR analysis revealed ~40 fold increase in IFNγ expression by Flt3L-BMDCS from DC-Tgfbr2 KO mice compared to Cre- mice (Figure 4.21A). In order to investigate whether the overexpression of IFN inhibited Treg conversion as described by others (Caretto et al.,

2010; Chang et al., 2009), we performed an analogous Treg conversion assay with anti-

IFN neutralizing antibody or an isotype control. As shown in Figure 4.21B, isotype control antibody did not affect Treg conversion in either Cre- or Tgfbr2 KO DC-T cell co- cultures. However, neutralization of IFN restored the percentage of Foxp3+ cells to that observed with Cre- DCs (Figure 4.21B). Collectively, these results suggest that increased

IFN production by BMDCs derived from DC-Tgfbr2 KO mice inhibits Treg conversion.

Figure 4.21: increased IFNγ expressions by BMDCs from DC-Tgfbr2 KO mice inhibit Treg differentiation. (A) Ifng mRNA expression in Flt3L CD11c+ BMDCs from Cre- or DC-Tgfbr2 KO mice. Each sample was normalized to TBP. Error bars represent SEM of triplicates. P value obtained using Student’s t test; (B) Neutralization of IFNγ rescues Treg differentiation. Treg conversion assay was performed using Cre- (top panel) and DC-Tgfbr2 KO DCs (bottom panel) as described in Fig. 4.20 either alone (left panel) or with an isotype control antibody (middle panel) or anti-IFN-γ antibody (2 µg/ml) (right panel)

Since microarray analysis also indicated overexpression of IFN in MLN CD103+

DCs, we also examined the potential of MLN DCs to induce Treg differentiation. Similar 99 to our results with BMDCs, we found that MLN DCs from DC-Tgfbr2 KO mice were ineffective in converting naïve T cells into Tregs (Figure 4.22A) even at the highest ratio of DC-T cells (Figure 4.22B). Elevated levels of IFNγ were observed in the supernatants from Tgfbr2 KO DC co-culture (Figure 4.22C). Addition of neutralizing antibody to IFNγ rescued the conversion rate to levels close to that observed with control DCs (Figure

4.23).

A B

Figure 4.22: Impaired iTreg differentiation by MLN DCs from DC- Tgfbr2 KO mice. (A) Percentage of CD25+Foxp3+ Tregs (left) in Treg conversion assay using CD11c+ MLN DCs from Cre- or DC-Tgfbr2 KO mice. Assay was similar to that described in Fig. 4.20 except that DCs were co-cultured with T cells (1:2) in the presence of 1 mg/ml ovalbumin; (B) Percentage of CD25+Foxp3+ Tregs obtained at different ratios of DC: T cells is shown. P values obtained using Student’s t test. (C) IFNγ expression by ELISA in the supernatants of Treg conversion assay with 100

MLN DCs. *** - p < 0.001, ** - p < 0.01, * - p < 0.05 (one way ANOVA with Newman Keuls test).

DC-Tgfbr2 KO

Figure 4.23: increased IFNγ expressions by MLN DCs from DC-Tgfbr2 KO mice inhibit Treg differentiation. Treg conversion assay was performed as described in Fig. 4.22 using Cre- (top panel) and DC-Tgfbr2 KO MLN DCs (bottom panel) either alone (left panel) or with an isotype control antibody (middle panel) or anti-IFN-γ neutralizing antibody (2 µg/ml) (right panel). Representative data from 1 of 3 repetitions is shown.

4-8 In vitro generated iTregs partially protect from autoimmunity in DC-Tgfbr2 KO mice

Lower frequency of activated Tregs or dysfunctional Tregs in DC-Tgfbr2 KO mice may lead or contribute to autoimmune inflammation mediated by the unchecked self-reactive T cells. Transfer of Tregs into young mice has been shown to prevent the development of autoimmune disease in mice. To determine if adoptive transfer of 101

CD4+CD25+Foxp3+ iTregs into DC-Tgfbr2 KO mice can alleviate the autoimmune phenotype, polyclonal iTregs were generated in vitro by stimulating naïve CD4+CD62L+

T cells with anti-CD3/CD28 in the presence of TGFβ, retinoic acid and IL-2 for 3 days.

After this time, > 85% of T cells were CD4+CD25+Foxp3+ as determined by flow cytometry (data not shown). These iTregs were then adoptively transferred (via i.v. injection) into 2-3 week old Cre- or DC-Tgfbr2 KO mice. Control groups received PBS.

The mice were monitored for 6 weeks. 33% of DC-Tgfbr2 KO mice injected with PBS died during the course of the study, while no mortality was observed in DC-Tgfbr2 KO mice transferred with iTregs (Figure 4.24A). DC-Tgfbr2 KO mice transferred with iTregs showed a significant decrease in the percentage of activated CD62LloCD44hi CD4+ and

CD8+ T cells in the spleen, compared with DC-Tgfbr2 KO mice injected with PBS

(Figure 4.24B). Adoptive transfer of iTregs into DC-Tgfbr2 KO mice significantly lowered TNF and IFNγ expression in the proximal and distal colon, as compared to DC-

Tgfbr2 KO mice injected with PBS (Figure 4.24C). Interestingly, iTreg transfer did not influence the development of gastritis, with no significant difference in TNF or IFNγ expression in DC-Tgfbr2 KO mice injected with iTregs or PBS (Figure 4.24D). Similar results were obtained with other tissues including pancreas and liver (data not shown), thus suggesting that the Treg mediated suppression of autoimmune inflammation may be tissue-specific or may require Ag-specific Tregs, and is not sufficient to completely rescue the phenotype of DC-Tgfbr2 KO mice.

102

Figure 4.24: Adoptive transfer of Tregs partially rescues the autoimmune phenotype of DC- Tgfbr2 KO mice. (A) Survival curve of Cre- or DC- Tgfbr2 KO mice injected with PBS or adoptively transferred at 2-3 weeks 103 of age with Foxp3+ iTregs (2 x 106 cells/mouse) generated as described in Methods; (B) Percentage of CD4+ (left) and CD8+ (right) CD62LloCD44hi T cells in the spleen of recipient mice at the end of the experiment described in (A); (C) Cytokine mRNA expression in the proximal and distal colon of recipient mice as described in (A). Bars represent means + SEM of 6-7 individual mice; (D) Cytokine mRNA expression in the fore stomach and glandular stomach of recipient mice as described in (A). Bars represent means + SEM of 6-7 individual mice. **** - p < 0.0001, *** - p < 0.001, ** - p < 0.01, * - p < 0.05 (One way ANOVA with Newman- Keuls test).

104

CHAPTER 5

DISCUSSION

Dendritic cells are antigen presenting cells that maintain a fine balance between immune activation to foreign Ags and tolerance to self-Ags. Under steady state conditions, DCs mediate both clonal deletion of self-reactive T cells in the thymus and control of T cells specific responses to self or harmless Ags in the periphery (Steinman et al., 2003). These DCs are termed tolerogenic DCs, but the signals that drive the tolerogenic pathways in these cells are just beginning to be understood (Manicassamy and Pulendran, 2011). In this report, we provide in vivo evidence that TGFβ provides a signal that is essential to maintain the tolerogenic function of DCs, although in a manner not consistent with the reported in vitro studies. We show that loss of TGFβ signaling in

DCs makes them more pro-inflammatory and less immunosuppressive which in turn leads to the development of autoimmunity in mice. The pathology of DC-Tgfbr2 KO mice resembles that of Tgfb null knockout mice (Shull et al., 1992) although with a delayed onset. Therefore, it is conceivable that apart from the impaired T cell homeostasis and aggravated T cell activation (Li et al., 2006; Marie et al., 2006), impaired DC function may also greatly contribute to disease severity in Tgfb-/- mice.

Although spontaneous upregulation of MHC Class I and II were attributed to the observed autoimmune phenotype in Tgfb-/- mice, we did not see any difference in the expression of MHCII or the co-stimulatory molecules CD80, CD86 and CD40 in DC- 105

Tgfbr2 KO mice, suggesting that loss of TGFβ signaling does not alter the Ag presenting function of DCs as a direct effect. However, Tgfbr2-deficient DCs were more proinflammatory in agreement with previous in vitro studies using BMDCs (Geissmann et al., 1999; Siddiqui et al., 2010). We observed increased TNF expression by splenic

DCs and increased IFNγ expression by MLN DCs. The difference in the expression of inflammatory cytokines by these two populations of DCs could be due to the differences in the DC lineage in these lymphoid organs. It is known that during autoimmune disease, a subset of inflammatory DCs (Tip DCs) that produce TNF and iNOS populate the spleen. These DCs arise from monocyte precursors and can be cultured in vitro from bone marrow precursors using GM-CSF and IL-4 (Shortman and Naik, 2007). Indeed, we found increased TNF production in BMDCs differentiated using GM-CSF and IL-4 and these DCs were able to exacerbate T cell mediated colitis. In contrast, MLN DCs had increased expression of IFNγ similar to their Flt3L-differentiated BMDC counterparts, suggesting that these represent steady state DCs (Shortman and Naik, 2007). The proinflammatory phenotype of Tgfbr2-deficient DCs was not observed in CD11cdnR mice; in fact, splenic DCs from these mice did not produce IFNγ even after stimulation with IL-12 and IL-18 (Laouar, 2005). In contrast, only MLN CD103+ DCs but not splenic DCs from

DC-Tgfbr2 KO showed elevated IFNγ expression, suggesting a more prominent role for

TGFβ in preserving the function of mucosal DCs. This is also consistent with the fact that

CD103+ DCs produce higher levels of active TGFβ (Coombes et al., 2007), which may act in an autocrine or paracrine manner to suppress IFNγ expression, both in CD103+ and

CD103- DCs. 106

Although TGFβ has been shown to induce expression of IDO in DCs (Belladonna et al., 2009; Belladonna et al., 2008), we did not find any significant differences in the expression of IDO at least at the mRNA level in either splenic DCs or MLN CD103+

DCs. Expression and activity of IDO protein in Tgfbr2 KO DCs remains to be investigated. It is plausible that the potential decrease in IDO expression due to defective

TGFβ signaling may be compensated by the autocrine effects of elevated IFNγ which has been shown to induce IDO expression (Mellor and Munn, 2004). It was also recently shown by Pallotta et. al (Pallotta et al., 2011) that in addition to the enzymatic function of

IDO, TGFβ also controls its function as a signaling molecule in pDCs, a mechanism central to maintenance of immune homeostasis in the long term. Therefore, although the expression of IDO was unaltered in the splenic or MLN DCs of DC-Tgfbr2 KO mice, its function as a signaling protein may be skewed towards activating the canonical NFκB pathway to induce a more inflammatory state.

Immunosuppressive Treg cells control T cell activation and prevent the development of autoimmune disease. Different types of Tregs have been identified, of which the CD4+FoxP3+ T cells have received the most attention. Foxp3 deficiency leads to the development of a multi-organ autoimmune disease both in mice and in humans

(Ziegler, 2006). The population of CD4+Foxp3+ T cells in peripheral lymphoid organs includes both natural Tregs which develop in the thymus as well as induced Tregs which differentiate in the periphery from naïve T cells upon activation by DCs in the presence of TGFβ. These Tregs also up-regulate CD25 expression indicative of an activated phenotype. In DC-Tgfbr2 KO mice, consistent with the impaired Treg differentiation due 107 to increased IFNγ production, we saw a decrease in the frequency of CD4+CD25+Foxp3+

Tregs. It was, however, surprising to find that the proportion of CD4+CD25-Foxp3+ T cells increased considerably in DC-Tgfbr2 KO mice. Similar increases in the proportion of CD4+CD25-Foxp3+ T cells have been described in patients with systemic lupus erythematosus (SLE) (Bonelli et al., 2009; Yang et al., 2009). Furthermore, functional analyses of this population from SLE patients revealed a partial loss of function (Bonelli et al., 2009; Horwitz, 2010). Another study by Zelenay et. al.(Zelenay et al., 2005) showed that CD4+CD25-Foxp3+ T cells constitute a reservoir of committed Tregs that regain CD25 expression upon homeostatic proliferation in a lymphopenic host. However, the Tregs identified as the CD45RBloCD25- subset failed to show suppressive function in vitro when freshly isolated from mice. It has also been shown that Tregs with attenuated

Foxp3 expression have lower levels of CD25 and these cells have a tendency to convert to Th2 type cells (Wan and Flavell, 2007). Based on these studies, it is highly likely that the CD4+CD25-Foxp3+ T cells in DC-Tgfbr2 KO mice are less immunosuppressive thereby contributing to the autoimmune pathology. It is noteworthy that such alterations in Treg homoeostasis and spontaneous autoimmunity were not observed in CD11cdnR mice suggesting that residual TGFβ signaling in DCs may have been sufficient to maintain self-tolerance under basal conditions and that the consequences of impaired

TGFβ signaling in DCs may represent a continuum depending on the degree of suppression. Future studies with DC-Tgfbr2 KO crossed with FoxP3-RFP knock-in mice should further clarify the nature and function of the CD4+CD25-Foxp3+ T cells. 108

Although we have demonstrated that in vitro, DC-mediated Ag-specific Treg conversion is impaired due to elevated production of IFNγ by Tgfbr2 KO, we did not observe the expansion of the CD4+CD25-Foxp3+ population as we did in vivo. Therefore, the mechanisms leading to the potential loss of function of Tregs in DC-Tgfbr2 KO mice remain unclear. DC-Treg interactions are bidirectional and are required to maintain immunological tolerance (Lange et al., 2007). DCs induce Treg cell differentiation and proliferation through Ag-dependent and independent interactions but in a cell-cell contact- and IL2-dependent mechanism (Zou et al., 2010). However the suppressive function of the expanded Tregs may still require additional signals that remain unidentified. When we transferred Foxp3+ iTregs into young DC-Tgfbr2 KO mice, we saw partial rescue of the autoimmune phenotype with significant reduction in the proportion of activated T cells and protection from colitis, but not from gastritis, pancreatitis or hepatitis. Although the optimal timing of transfer and lifespan of the injected Tregs may be debatable, loss of their immunosuppressive function in vivo in DC-

Tgfbr2 KO mice cannot be ruled out. On the other hand, iTregs are generally thought to suppress immune responses to environmental, food allergens, and commensal microbiota, whereas nTregs prevent autoimmunity by raising the threshold for activation of immune response (Curotto de Lafaille and Lafaille, 2009). Consistent with our observations, non

Ag-specific iTregs have been shown to be protective in mouse models of colitis (Curotto de Lafaille and Lafaille, 2009). On the other hand, nTregs are selected in the thymus through MHCII dependent TCR interactions and may mediate suppression in an Ag- 109 specific manner. Ag-specific Tregs were required to prevent autoimmune gastritis in mice

(Nguyen et al., 2011), which may explain persistent gastritis in our Treg rescue model.

In conclusion, this novel mouse model highlights the critical importance of TGFβ signaling in DCs in the maintenance of immune homeostasis and in the prevention of autoimmunity. These functions may be independent of the previously ascribed TGFβ control of Ag presentation and co-stimulation. Although a mechanistic relationship between TGFβ signaling in DCs and Foxp3+ regulatory T cell responses still remains to be elucidated in detail, the phenotype of our novel mouse model can be exploited to advance our understanding of the pathogenesis of complex autoimmune disorders.

110

CHAPTER 6

Polyclonal CD4+Foxp3+ T cells generated ex-vivo induce TGF, but not IL-10- dependent tolerogenic dendritic cells that suppress murine lupus-like syndrome

This paper has been submitted for review

Qin Lan1,2, Xiaohui Zhou1,2, Maogen Chen1, Julie Wang1, Bernhard Ryffel3, David

Brand4, Rajalakshmy Ramalingam5, Pawel R. Kiela5, David A Horwitz1, Zhongmin Liu2, and Song Guo Zheng1*

1Division of Rheumatology and Immunology, Department of Medicine, Keck School of

Medicine at University of Southern California, USA; 2Immune Tolerance Center,

Shanghai East Hospital, Tongji University, Shanghai, P.R. China; 3University of Orléans and Molecular Immunology and Embryology, CNRS UMR6218, Orleans, France;

4Research Service, Veterans Affairs Medical Center, Memphis; USA; 5Departments of

Pediatrics and Immunobiology, University of Arizona, Tucson, AZ, USA.

6-1 ABSTRACT

Interplay between Foxp3+ regulatory T (Treg) cells and dendritic cells maintain immunologic tolerance, but the effects of each cell on the other are not well understood.

We report that polyclonal CD4+Foxp3+ Tregs induced ex-vivo with TGFβ (iTreg) suppress a lupus-like chronic graft-versus-host disease by preventing the expansion of immunogenic DCs and inducing protective DCs that generate additional recipient 111

CD4+Foxp3+ cells. The protective effects of the transferred iTregs required both IL-10 and TGFβ, but the tolerogenic effects of the iTregs on DCs, and the immunosuppressive effects of these DCs, was exclusively TGFβ-dependent. The iTregs were unable to tolerize Tgfbr2-deficient DCs. These results support the essential role of DCs in

“infectious tolerance” and emphasize the central role of TGFβ in protective iTreg/DCs interactions in vivo.

6-2 INTRODUCTION

Foxp3+ regulatory T cells consisting of heterogeneous thymus-derived natural and those cells induced in the periphery are essential in maintaining immune tolerance and preventing autoimmune diseases (Andersson et al., 2008; Horwitz et al., 2008; Lan et al.,

2011). Abnormalities in numbers and/or function of Foxp3+ Tregs have been reported in many autoimmune diseases. Tregs are short-lived cells with a rapid turnover. Continuous antigen stimulation provided by tolerogenic dendritic cells is required for Treg persistence.

Dendritic cells are specialized antigen-presenting cells that initiate and regulate immune responses against foreign as well as self-antigens (Steinman et al., 2003).

Different subsets of DCs direct immune responses depending upon their maturation state.

While mature DCs promote adaptive immune responses against microbial invaders, immature and certain semi-mature DCs are tolerogenic. Several cytokines such as TGFβ,

IL-10, IL-27 and other agents such as vitamin D3 and IDO promote the tolerogenic 112 phenotype of DCs (Awasthi et al., 2007; Pallotta et al., 2011). Tolerogenic DCs can control autoimmunity directly by producing anti-inflammatory cytokines such as IL-10 or

TGFβ, or indirectly by an IDO-dependent mechanism (Coombes et al., 2007; Favre et al.,

2010; Kaplan et al., 2007).

Tregs have the ability to induce conventional T cells to become additional tolerant

Foxp3+ cells through a mechanism called “infectious tolerance.” This phenomenon was first described by Waldmann’s group which was investigating transplantation tolerance

(Qin et al., 1993). Subsequent work confirmed that interplay between Tregs and DCs involving TGFβ is required for the generation of new CD4+Foxp3+ Tregs (Cobbold et al.,

2009).

We have investigated the protective role of CD4+Foxp3+ Tregs in the prevention and treatment of established autoimmune diseases. We have reported that unlike

+ + + endogenous CD4 CD25 Foxp3 nTregs which can convert to pathogenic TH17 cells in an inflammatory environment, nTregs treated ex-vivo with retinoic acid, and iTregs induced ex-vivo with IL-2, TGFβ and retinoic acid are resistant to conversion and others recently confirmed this finding (Lu et al., 2011; Zheng et al., 2008; Zhou et al., 2010a). Here, we report that in a chronic graft-versus-host disease (cGVHD) with a lupus-like syndrome, transferred iTregs block the expansion of immunogenic DCs and instead induce tolerogenic DCs that generate more iTregs. These effects were TGFβ-dependent and required TGFBR2 receptor and intact TGFβ signaling in DCs. While IL-10 also contributed to the direct protective effects of iTregs, this cytokine was not required for 113 the necessary iTreg/DC interaction, or for the protective effects of induced tolerogenic

DCs.

6-3 METHODS

Mice

Female DBA/2 (D2, H-2d), C57BL/6 CD45.1 (B6, H-2b), C57BL/6 CD45.2, Rag-1 KO mice and (DBA/2 x C57BL/6)F1. (D2B6F1) mice were purchased from The Jackson

Laboratory (Bar Harbor, ME). C57BL/6 Foxp3 knock-in mice were generously provided by Dr. Talil Chatilla (UCLA). To create DC-specific Tgfbr2 conditional knockout (CKO) mice, B6.129S6-Tgfbr2tm1Hlm mice (Tgfbr2fl/fl), carrying homozygous loxP site insertion flanking exon 2 of Tgfbr2 gene were crossed with CD11c-Cre transgenic mice (B6.Cg-

Tg(Itgax-cre)1-1Reiz/J). Cre-Tgfbr2fl/fl littermates were used as controls for Cre+Tgfbr2fl/fl

(referred to as Cre- and DC-Tgfbr2 KO in the text, respectively). All animals were treated according to National Institutes of Health guidelines for the use of experimental animal with the approval of the University of Southern California and the University of Arizona

Committees for the Use and Care of Animals (IACUC #11481 and #07-126, respectively).

The generation of CD4+ induced regulatory T cells (iTreg) ex vivo

Naïve CD4+CD62L+CD25-CD44low T cells were isolated from spleen cells of DBA2,

C57BL/6 or C57BL/6 Foxp3gfp knock-in mice using naïve CD4+ T cell isolation kit

(MiltenyiBiotec, Auburn, CA). Cells were cultured in 48-well plates and stimulated with 114 anti-CD3/CD28 coated beads (1 bead per 5 cells, Invitrogen) in the presence of IL-2 (40

U/ml; R&D) with (iTreg) or without (CD4con) TGFβ (2ng/ml; R&D) for 4 days. RPMI

1640 medium supplemented with 100 U/ml penicillin, 100 mg/ml streptomycin, 10mM

HEPES (Invitrogen) and 10% heat-inactivated FCS (HyClone Laboratories) was used for all cultures. Foxp3 expression was determined by flow cytometry. The suppressive activity of these cells against T cell proliferation was examined with a standard in vitro suppressive assay as previously reported (Zheng et al., 2007). 5×106 cells were transferred to each D2B6F1 mice.

Co-culture of iTregs or CD4con with DCs

CD11c+ cells were isolated from bone marrow or spleens by flow sorting using

FACSAriaII (BD Bioscience) and cultured with GM-CSF (500 U/ml) and IL-4 (200

U/ml) for 3 days. In some wells, CD4con or iTregs were added to DCs (5:1 CD4 to DC ratio) and co-cultures were activated with anti-CD3 (0.5μg/ml; BD Pharmingen) for three days. CD80, CD86, MHC-II (all from Biolegend) expression on CD11c+ cells were analyzed by flow cytometry.

Induction and assessment of cGVHD with a lupus-like syndrome

Chronic GVHD with a lupus-like syndrome was induced in D2B6F1 mice by injecting

12 x 106 D2 CD4+ cells through the tail vein as described previously (Shustov et al.,

6 5 1998). Other groups received this number of D2 cells plus 5x10 CD4con, iTregs or 5x10

DCs isolated from lupus-like syndrome mice transferred with CD4con or iTregs. To determine the suppressive mechanisms of Tregs and tolerogenic DCs in vivo, anti-TGFβ1 115

(2G.7; R&D) (0.5 mg/kg body weight) or isotype-matched IgG1 antibody, anti-IL-10R

(0.25 mg/kg body weight) or isotype-matched IgG1 antibody, or ALK5 inhibitor (ALK5i;

LY-364947, Sigma, 0.5 mg/mouse) were administered i.p. weekly for a total of six injections. In most experiments, there were 5 mice per group, experiments have been repeated at least two times and data represented the accumulated results from all experiments. Before transfer and weekly thereafter, blood was collected and serum IgG and anti-dsDNA autoantibodies were measured by ELISA (Du Clos et al., 1986). All samples tested for anti-dsDNA antibodies were processed at the same time. Serum was diluted 1/400 or 1/800 for anti-dsDNA and 1/40,000 for IgG measurement. Proteinuria was assessed using Albustix reagent strips (Bayer, Elkart, IN). Mice were sacrificed at time points indicated in the different experiments after transfer of parental T cells for assessment of lymphoid hyperplasia and immune complex glomerulonephritis. The total numbers and phenotypes of the spleen cells were determined from single-cell suspensions. The cells were stained with FITC-anti-H-2b, PE-anti-H-2d (BD PharMingen) and single-positive anti-H-2d cells considered to be parental D2 cells. Mouse survival was monitored every three days.

Co-transfer of tDCs and naïve T cells into Rag1-/- mice

0.5 x 106 CD4+CD45Rbhigh cells flow sorted from splenocytes in naïve C57BL/6 mice

(95-100% purity) were intravenously injected into Rag1-/- mice (C57BL/6). Separate groups also received 2x105 DCs isolated from Cre- and DC-Tgfbr2 KO mice that have been previously primed with iTregs or CD4con cells. Mice were sacrificed 2 weeks after T/DC cell transfer. Colon was removed for RNA isolation, and 116 mesenteric lymph node cell suspensions were cultured in activation plates with anti-

CD3/CD28 activation beads. Cytokine expression was measured by real-time PCR

(TaqMan primer/probe sets from Applied Biosystems, Foster City, CA) and with xMAP multiplex assay (Millipore; Billerica, MA).

Proliferation Assay iTregs generated as above or nTregs expanded as described previously (Zhou et al.,

2010b) were added to fresh naïve T cells (1:4 Treg/T cell ratio) and were stimulated with anti-CD3 mAb (0.025µg/mL) and irradiated APC (30 Gy, 1:1 ratio) for three days. In other experiments, T responder cells were stimulated with allogeneic APC or DC. [3H] was added to cultures for the last 16-18 hours and T cell proliferation ([3H]-thymidine incorporation) was measured by using a scintillation counter.

Histology

For histological examination, mice were anesthetized after the final arthritic index was assessed. Kidneys from each mouse were removed and preserved in 10% buffered formalin or frozen in OCT medium. The specimens were processed, blocked, sectioned, and stained with H&E. Cryostat sections of frozen kidney tissue were examined for deposits of IgG using a standard procedure (Hellmark et al., 1997). Sections were incubated with fluorescence-labeled goat F(ab')2 IgG antiserum to mouse IgG. The sections were read blindly by the same investigator, grading the intensity of fluorescence from 0 to 4+.

117

Statistical analysis

Results were grouped and calculated by using GraphPad Prism 4.0 software (GraphPad

Software, San Diego, CA) and presented as mean ± SEM. Student t test was used to assess statistical significance between two groups, and one-way ANOVA was used to assess statistical significance among multiple groups. P value<0.05 was considered as statistically significant difference.

6-4 RESULTS

Phenotypic characteristics of polyclonally differentiated CD4+Foxp3+ cells generated ex-vivo with IL-2 and TGF

As reported previously, TGFβ is a crucial cytokine that can induce differentiation of iTregs from conventional naïve CD4+CD25- cells (Zheng et al., 2002). Foxp3, an important transcription factor regulating the development and function of Tregs (Fontenot et al., 2003b), was induced in the CD4+ and CD25+ cell population after TGFβ priming in

DBA/2 (D2) WT (Fig. 6.1a, top panel) or C57BL/6 Foxp3gfp knock-in mice (Fig. 6.1a, lower panel). Additionally, these Foxp3+ cells also expressed other Treg-related molecular markers such as CD103, CD39, PD1, CTLA-4 and GITR (data not shown).

These cells expressed membrane-bound TGFβ and secreted active TGFβ and IL-10 (data not shown). Interestingly, these cells did not express Helios (data not shown) , suggesting that iTregs might be a different linage compared to nTregs since the latter express high levels of Helios (Thornton et al., 2010). Since these cells were produced by polyclonal 118 stimulation and displayed suppressive activity, we refer to them as polyclonally differentiated iTregs or simply iTregs.

Figure 6.1: Differentiation of iTregs from naïve T cells after TGFβ priming. iTregs or CD4con cells were generated as described in the Methods section. iTregs induction was confirmed based on CD25 and Foxp3 expression in cells from DBA/B2 mice (top panel) and GFP expression in cells from C57BL/6 Foxp3gfp mice (lower panel).

iTregs suppress in vitro anti-CD3- and alloantigen-triggered T cell responses by cell contact-dependent mechanism

Similar to nTregs, CD4+ cells primed with TGFβ but not CD4+ control cells

(treated without TGFβ, CD4con) suppressed anti-CD3 stimulated T cell proliferation including CD4+ and CD8+ cells. We have documented this result using both CFSE- 119 labeling (Fig. 6.2a) and 3H-thymidine incorporation assays (Fig. 6.2b). Placement of iTregs in a Transwell assay plate containing a semi-permeable membrane that separated iTregs from responder T cells abolished the suppressive activity of the iTregs (Fig. 6.2b).

Furthermore, the addition of blocking antibodies against TGFβ or IL-10R, or ALK5

(TGFBR1) inhibitor did not significantly diminish the suppressive activity of these cells

(Fig. 6.2b), suggesting that cell contact is needed for iTreg suppressive activity in vitro.

It is less known whether polyclonally differentiated iTregs also suppress the antigen-specific immune response. To address this issue, we performed a T cell proliferation assay using responder T cells isolated from D2 mice stimulated with γ- irradiated non-T cells isolated from C57BL/6 mice (allogeneic stimulation). The CD4con or iTregs were added to some cultures (1:5 ratio). After three-day co-culture, the iTreg but not CD4con cells significantly suppressed alloantigen-stimulated T cell proliferation

(Fig. 6.2c), suggesting that iTregs exert both antigen-specific and antigen non-specific suppressive effect against T cell immune responses. 120

b c

Figure 6.2: Polyclonal iTregs suppress anti-CD3 and alloantigen stimulated T cell proliferation. iTregs or CD4con cells generated as described in the Methods section were added to CD25+-depleted CD8 T cells (1:5 ratio) in the presence of anti-CD3 and irradiated APC (a, b), or CD25+-depleted T cells in the presence of allogeneic APC (c) for 3 days. 3H-thymidine was added to cultures for the last 18 hours and incorporation by proliferating T cells was measured. Values were mean ± SEM of three independent experiments. *P<0.05, **P<0.01, ***P<0.001 iTreg vs. baseline.

121

Polyclonally differentiated iTregs suppress cGVHD with a lupus-like syndrome through TGFBR- and IL-10R-dependent signaling pathways

The employed cGVHD is achieved by an adoptive transfer of parental D2 splenocytes, T or CD4+ cells into DBA/2xC57BL/6 F1 (D2B6F1) mice (Zheng et al.,

2004b), and is characterized by a typical lupus-like syndrome including elevated anti- dsDNA antibodies, proteinuria and lupus nephritis. The disease is initiated by the activation of the donor CD4+ cells (H2d) upon the encounter of the B6 (H2b) antigen. Our previous study has revealed that antigen-specific iTregs suppressed cGVHD syndrome

(Zheng et al., 2004b). In the present study, we set out to determine whether polyclonally differentiated iTregs also suppress the alloantigen-mediated cGVHD.

As D2 CD4+ T cells are pathogenic and iTregs originated from D2 cells, we first determined whether the latter exerts a similar pathogenic effect. Adoptive transfer of

12x106 D2 CD4+ T cells to D2B6F1 mice resulted in elevated anti-dsDNA antibody titers compared to mice that received no cells (data not shown). The rapid increase in anti- dsDNA antibodies was observed at 2 weeks and was sustained until at least 12 weeks after cell transfer. The transfer of a similar number of CD4con cells had a similar effect on anti-dsDNA antibody production in D2B6F1mice. In sharp contrast, injection of 12x106 of iTregs did not elicit anti-dsDNA antibody production, which remained at the same level as in naïve D2B6F1 mice. D2B6F1 mice developed marked proteinuria 12 weeks

+ following CD4 D2 or CD4con cells transfer, but not following iTreg transfer (data not 122 shown). Collectively, these findings indicate that TGFβ priming alters the phenotype and behavior of CD4+ D2 cells.

We further determined whether iTregs can suppress immune responses in cGVHD mice. To assess this possibility, we transferred 12x106 D2 CD4+ cells, or plus either

6 5x10 iTregs or CD4con cells. The number of transferred iTregs was based on our earlier study with antigen-specific Tregs required for optimal protection from cGVHD symptoms (Zheng et al., 2004b). As shown in Fig. 6.3a, co-transfer of CD4+ D2 cells with iTregs but not with CD4con markedly suppressed the production of anti-dsDNA antibodies. Transfer of CD4+ D2 cells alone resulted in the death of all mice by 20 weeks post-transfer (Fig. 6.3b). Co-transfer of CD4con cells with D2 cells neither prolonged nor shortened the survival of mice. Co-transfer of iTregs with D2 CD4+ T cells significantly prolonged the survival of cGVHD mice (Fig. 6.3b). Collectively, these results show that iTregs exhibit suppressive function in both antigen specific and antigen non-specific fashions in vitro and in vivo.

The mechanism(s) whereby Tregs suppress immune responses remains incompletely defined. Both nTregs and iTregs express membrane-bound TGFβ and secrete active

TGFβ and/or IL-10 – features important for their suppressive function as well as TH17 cell conversion (Xu et al., 2007a; Zheng et al., 2008). To determine whether these two cytokines are also involved in the suppressive mechanisms of iTregs in cGVHD in vivo, we used neutralizing antibodies and receptor inhibitors. While co-transfer of iTregs with

CD4+ D2 cells significantly suppressed IgG upregulation (data not shown) and prolonged 123

D2B6F1mice survival (Fig. 6.3c), anti-TGFβ antibody not only completely abolished this protective effect of iTregs, but actually led to a further increase in IgG levels. Further studies are needed to determine whether iTregs have converted to a T helper phenotype following anti-TGFβ treatment. Anti-TGFβ antibody also completely reversed the protective effect of iTregs on mouse survival, with a trend toward accelerated death of cGVHD mice. This result could not be explained by the effect of antibody on the primary disease progression since such doses of anti-TGFβ treatment did not alter the levels of

IgG or survival in cGVHD mice (Fig. 6.3c and data not shown).

To further determine whether the TGFβ signaling pathway is crucial for the iTreg- mediated suppression in cGVHD, we also blocked the TGFβ receptor I (ALK5) activity using ALK5 inhibitor (ALK5i) in iTreg-co-transferred D2B6F1 mice. Similar to anti-

TGFβ antibody, injection of ALK5i almost completely abolished the protective effect of iTregs on mouse survival (Fig. 6.3d). DMSO (vehicle) alone did not alter the disease course. Moreover, blockade of IL-10 signaling with anti-IL-10R antibody also significantly altered the survival of lupus mice transferred with iTregs, albeit to a lesser degree than anti-TGF-β antibody or ALK5i (Fig. 6.3e). Together, these results suggest that iTregs can suppress lupus-like autoimmune disease primarily through TGFβ and partially via IL-10 signal pathways. 124

Figure 6.3: The suppressive effect of iTregs in cGVHD model with a lupus-like syndrome is almost completely dependent upon TGFβ and partially upon IL-10. 12x106 fresh D2 CD4+ cells or together with 5x106 iTregs were transferred into D2B6F1 mice, which were co-administered with anti-TGFβ antibody or control IgG. Anti-dsDNA levels (a) were examined and survival (b, c) was monitored. In other groups, ALK5 inhibitor (ALK5i) or DMSO (vehicle), anti-IL-10R or control IgG was administrated and survival was monitored. Five mice in each group were included in each experiment and data were combined from two independent experiments. *P<0.05, **P<0.01, anti-TGFβ, anti-IL-10R or ALK5i vs. control IgG or DMSO.

125

Polyclonally differentiated iTregs induced the formation of tolerogenic DCs through

TGFβ signaling pathway in DCs

Our previous report demonstrated that adoptively transferred iTregs had a limited lifespan in the recipient mice but sustained long-term protective effect in the prevention of allograft rejection (Zheng et al., 2006). As iTregs can educate naïve T cells to become a new generation of Foxp3+ Tregs (Zheng et al., 2004a) and DCs may be involved in this effect (Andersson et al., 2008; Horwitz et al., 2008), we have tested the effect of iTregs on DC maturation and function. When BMDC or splenic CD11c+ DCs were co-cultured

+ + with CD4con or CD4 iTregs derived from congenic CD45.1 C57BL/6 mice, iTregs but not CD4con cells markedly suppressed the up-regulation of CD80 and CD86 expression by

DCs (Fig. 6.4a). These DCs produced low levels of IL-12 and IL-23 (data not shown) and displayed decreased antigen-presenting function (Fig. 6.4b). When DCs that had been co- cultured with iTregs were added to allogenic T cells, proliferation of these T cells was significantly reduced compared to T cells stimulated with freshly isolated DCs or DCs

+ - that had been co-cultured with CD4con cells (Fig. 6.4b). When naïve CD4 CD25 cells from CD45.2+ C57BL/6 mice were co-cultured with DCs that had been previously conditioned by CD45.1+ iTregs in the absence of exogenous TGFβ for three days, about

25% of the naïve CD4+CD25- cells became CD25+Foxp3+ (Fig. 6.4c). This was not observed for DC conditioned by CD4con cells. These newly induced iTregs were gated on

CD45.2, thereby excluding the possibility that the Foxp3+ cells were carried over with the initial iTreg pool. Furthermore, using a T cell suppression assay, we demonstrated that these newly generated CD4+CD25+Foxp3+ cells developed suppressive capacity. Both 126 splenic DCs and BMDC displayed a similar ability to develop into “tolerogenic DCs

(tDCs)” (Fig. 6.4d).

Figure 6.4: iTregs induce the formation of tolerogenic DCs in vitro. + + CD4con or iTregs generated from CD45.1 B6 mice and CD11c cells isolated from B6 mice were co-cultured (5:1 ratio) in the presence of GM- CSF, IL-4 and anti-CD3 for three days. CD80 and CD86 expression on CD11c+ cells were analyzed by flow cytometry (a). Data are representative of three separate experiments. When cells were harvested, CD4+ cells were removed by magnetic beads and the remaining CD11c+ cells were added to CD25+-depleted T cells (1: 5 ratio) for additional three days. 3H-thymidine was added to cultures for the last 18 hours and incorporation by proliferating T cells was measured (b). Values were mean ± SEM of three independent experiments. ***P<0.001, DC primed + with iTregs vs. DC co-cultured with CD4con cells. CD11c cells isolated from either bone marrow (BMDC) or spleen (SDC) and primed with + - iTregs or CD4con cells were added to naïve CD4 CD25 cells isolated from 127

CD45.2+ B6 mice (1:5 ratio) in the presence of IL-2 (40 units/ml) for three days and Foxp3 expression was measured on gated CD4+CD45.2+cells using flow cytometry (c). Data are representative of three separate experiments. CD45.2+CD4+ cells primed with DCs were isolated and added to CD25+-depleted T cells in the presence of anti-CD3 and APC for an additional three days. 3H-thymidine was added to the cultures for the last 18 hours and incorporation by proliferating T cells was measured (d). Values were mean ± SEM of three independent experiments. ***P<0.001, CD4+ cells primed with DCs that had been previously primed with iTregs in comparison to baseline or DCs primed with CD4con cells.

Since both TGFβ and IL-10 are involved in the suppressive activity of iTregs in vivo and have the functional capacity to induce tDCs (Pallotta et al., 2011), we determined the role of these cytokines in the iTreg-induced formation of tDCs. As shown in Fig. 6.5a and 6.5b, co-culture of DCs with iTregs but not CD4con cells suppressed

CD80 and CD86 expression. This effect was completely abrogated by the addition of

ALK5i, but not by anti-IL-10R antibody. DCs that had been primed with iTregs in the presence of ALK5i but with anti-IL-10R antibody mostly restored their antigen- presenting capacity (data not shown) and lost the ability to induce naïve CD4+CD25- cells to acquire Foxp3+expression (not shown). iTregs, therefore, induce the formation of tDCs mainly through TGFβ rather than via the IL-10 signaling pathway.

We further verified the role of TGFβ signaling pathway on the induction of tDCs using mice with a conditional knockout of Tgfbr2 gene in CD11c+ DCs. The DC-Tgfbr2

KO mice were generated in Kiela’s laboratory (see Methods) and their phenotypic features have been described in detail elsewhere (manuscript submitted). Although these mice eventually succumb to multi-organ autoimmune inflammation and die by 14 weeks 128 of age, in asymptomatic mice between 6-8 weeks of age, the CD80 expression by

CD11c+ cells was similar between Cre-(wild type) and Cre+(DC-Tgfbr2 KO) littermates.

CD86 expression on CD11c+ cells was almost undetectable in both Cre- and DC-Tgfbr2

KO mice (Fig. 6.5c). When splenic CD11c+ DCs isolated from Cre- or DC-Tgfbr2 KO mice were stimulated with GM-CSF, TNF-α and IL-2, both CD80 and CD86 expression was similarly up-regulated. Interestingly, the addition of iTregs but not CD4con, significantly suppressed CD80 and CD86 upregulation in DCs derived from Cre- mice but not in DCs from DC-Tgfbr2 KO mice (Fig. 6.5d). Although iTregs did not alter the

MHC-II expression on DCs isolated from Cre- mice, the functional ability of these DCs to trigger allogeneic immune responses was decreased. However, DCs from DC-Tgfbr2 KO mice developed potent antigen-stimulating abilities, even after priming with iTregs (data not shown). These results indicate that the TGFβ signaling pathway in DCs is crucial for the formation of tDCs induced by iTregs. 129

Figure 6.5: TGFβ but not IL-10 signaling is required for the formation of tolerogenic DCs induced by iTregs. CD11c+ cells cultured alone or in combination with CD4con or iTregs (1:5 ratio) were stimulated with GM- CSF, IL-4 and anti-CD3 for three days. In some cultures, anti-IL-10R, control IgG or ALK5i was added to cultures. CD80 (a) and CD86 (b) expression was determined by flow cytometry. Values were mean ± SEM of four independent experiments. ***P<0.001, ALK5i vs. DMSO. (c) CD80 and CD86 expression in splenic CD11c+ cells from naïve Cre- and DC-Tgfbr2 KO mice. Data are representative of five mice in each strain. (d) Splenic CD11c+ cells isolated from Cre-and DC-Tgfbr2 KO mice were co-cultured with CD4con or iTregs (1:5 ratio) in the presence of GM-CSF, IL-4 and anti-CD3 for three days. MHC-II, CD80 and CD86 expression on CD11c+ cells were analyzed by flow cytometry. Data are representative of five independent experiments.

130

Polyclonally differentiated iTregs suppress the expansion and maturation of DCs in a lupus-like mouse model

To verify our in vitro findings in an in vivo model of lupus-like syndrome, we employed the T cell transfer cGVHD model. We demonstrated that in D2B6F1mice three weeks after CD4+ D2 cell transfer, CD11c+ cells expressed substantial amounts of CD80 and CD86. Interestingly, co-transfer of pathogenic D2 cells with iTregs, but not with

+ CD4con cells, prevented the upregulation of CD80 and CD86 on CD11c cells (Fig. 6.6a and b) as well as B cells (not shown).

DCs play an important role in the pathogenesis of SLE (Monrad and Kaplan,

2007). Consistently, D2B6F1 mice displayed three-fold expansion of total splenic

+ CD11c cells three weeks after D2 cell transfer. Co-transfer of CD4con with D2 cells did not alter the total numbers of splenic CD11c+ cells. However, co-transfer of iTregs with

D2 cells almost completely suppressed the expansion of CD11c+ cells in F1 mice (Fig.

6.6c). To determine their functional activity, splenic CD11c+ cells were further sorted and added to BALB/c naïve T cells for a three-day in vitro co-culture. CD11c+ cells sorted from either cGVHD or CD4con cell-transferred cGVHD mice induced strong alloresponses. In contrast, CD11c+ cells sorted from iTreg-transferred cGVHD mice had greatly reduced ability to stimulate allo T cell proliferation (Fig. 6.6d). 131

Figure 6.6: Adoptive transfer of iTregs to lupus mice suppresses the expansion of DCs and decreases their B7 expression. 12x106 fresh D2 + 6 CD4 cells alone or together with 5x10 CD4con or iTregs were transferred into D2B6F1 mice. Three weeks later, CD80 (a) and CD86 (b) expression in each group of mice was examined and total splenic CD11c+ cells were counted (c). Data are representative or values are mean ± SEM of five mice in each experiment and combined from two independent experiments. (d) CD11c+ cells were sorted from each group of mice as above and added to cultures containing CD25+-depleted T cells isolated from BALB/c mice for three days. T cell proliferation was determined as in Fig. 1a. Values are mean ± SEM of three separate experiments.

132 tDCs suppress cGVHD through TGFβ- but not IL-10-dependent signaling pathway

To further analyze the functional characteristics of tDCs in lupus mice treated with iTregs, we isolated CD11c+ DCs from D2B6F1 three weeks after co-transfer of D2 cells with CD4con or iTregs. Sorted DCs were then co-transferred with fresh D2 cells into naïve D2B6F1 mice. As shown in Fig. 6.7a, compared to D2B6F1 mice which received

D2 T cells alone, infusion of CD11c+ cells isolated from lupus mice treated with iTregs tDCs significantly prevented the anti-dsDNA antibody serum titers three weeks post transfer. These DCs also suppressed the donor T cell engraftments in recipient spleens

(Fig. 6.7b). The degree of donor cell engraftment correlates with the disease severity in this lupus model (Zheng et al., 2004b). Importantly, transfer of tDCs also markedly prolonged the survival of lupus mice (Fig. 6.7c). In contrast, transfer of the same number of DCs sorted from lupus mice or mice treated with CD4con did not suppress either anti- dsDNA antibody production, prolong the survival and donor engraftment expansion (Fig.

6.7a-c). tDC suppressed donor engraftment through (data not shown). Because tDCs can suppress immune responses either directly or indirectly, we also examined the Foxp3+ cell frequency in lupus mice after tDC treatment. We observed that transfer of DCs sorted from iTreg-treated lupus mice markedly increased the frequency of Foxp3+ cells as compared to controls. Moreover, the expansion of Foxp3+ cells was dependent on TGFβ rather than IL-10 signaling pathway since only administration of ALK5i could abolish the

Foxp3+ cell increase (Fig. 6.7d) following tDCs treatment. 133

Figure 6.7: DCs isolated from lupus mice treated with iTregs but not 6 + CD4con cells suppress disease development. 12x10 fresh D2 CD4 cells 6 alone or together with 5x10 CD4con or iTregs were transferred into D2B6F1 mice. Three weeks later, spleens were removed, CD11c+ cells were sorted, and 5x105 DCs and 12x106 fresh D2 CD4+ cells were co- transferred into D2B6F1 mice. Anti-dsDNA antibody level in sera (a) and donor engraftments (H-2d+H-2b-cell population) in the spleens (b) were determined 2 weeks following cell transfer. Survival was monitored (c) and Foxp3+ cell frequency at one month following cell transfer was determined by flow cytometry. DCcon: DCs from cGVHD mice transferred with CD4con cells; tDC: DCs from cGVHD mice transferred with iTregs.

We next attempted to explore the underlying mechanism of how tDCs suppress lupus. As shown in Fig. 6.8, co-transfer of tDCs sorted from lupus mice that received iTregs markedly prolonged survival (Fig. 6.8a) and suppressed splenomegaly and lymph 134 node enlargement (Fig. 6.8b). Administration of ALK5i with tDCs not only completely blocked the suppressive activity of tDCs in cGVHD, but also slightly reduced the survival time in these mice. Anti-IL-10R antibody administration did not significantly decrease survival in the tDCs infusion group. tDCs also suppressed renal IgG deposition and ALK5i but not anti-IL-10R antibody reversed those protective effects of tDCs (data not shown). These observations suggest that iTreg transfer induces the formation of tDCs in the context of ongoing inflammation in vivo and that these tDCs suppress T cell- mediated immune responses through TGFβ signaling rather than via the IL-10 signaling pathway.

To further confirm these findings, we tested the ability of in vitro generated tDCs to control immune activation of naïve CD4+ T cells in a lymphopenic host. iTregs were induced in vitro with TGFβ as above from naïve CD4+ in Foxp3gfp knock-in mice. CD11c+ splenic DCs isolated from Cre- or DC-Tgfbr2 KO mice were

+ then co-cultured with flow-sorted GFP iTregs or CD4con cells for three days.

CD11c+ cells were then re-sorted from the co-culture and co-transferred with naïve

CD4+CD45Rbhi cells into Rag1-/- mice. Typically, Rag mice transferred with naïve T cells in an analogous way develop colitis within 6-8 weeks. Due to the anticipated short half-life of the transferred DCs, we limited the evaluation of colitis to 2 weeks post-transfer and to more objective markers of immune activation such as the cytokine production in mesenteric lymph nodes (ELISA) and colonic cytokine expression (real-time RT-PCR). While both IFNγ and TNFα protein (Fig. 6.8c, d) and mRNA (data not shown) were significantly elevated 2 weeks after 135

CD4+CD45Rbhi cell transfer, co-transfer of Cre- DCs primed with iTregs but not

CD4con attenuated both IFNγ and TNFα production. However, co-transfer of Tgfbr2

KO DCs primed with iTregs or CD4con did not suppress IFNγ and TNFα production, further supporting the notion that iTregs induce the formation of tDCs via a TGFβ-dependent mechanism.

Figure 6.8: Tolerogenic DCs suppress lupus through TGFβ but not IL-10- dependent mechanism.5x105 CD11c+ cells were sorted from lupus mice treated with iTregs (tDCs) or CD4con (DCcon) and were co-transferred with 12x106 fresh D2 CD4+ cells into D2B6F1 mice. ALK5i or DMSO (vehicle), anti-IL-10R or control IgG was administrated in separate groups. Survival was monitored (a) and the size of spleens and lymph nodes at 20 weeks following cell transfer were assessed (b). iTregs were co-cultured with DCs from Cre- or DC-Tgfbr2 KO mice for three days. These DCs (2x105) were then co-transferred with naïve CD4+CD45RBhigh cells (5x105) into Rag1-/- mice. Mice were sacrificed 2 136

weeks after cell transfer. MLN cell suspensions cultured in activation plates with anti-CD3/CD28 Ab and supernatants analyzed for TNFα and IFNγ with xMAP multiplex assay (Fig. 6.8c, d). All experiments were repeated at least twice with similar results.

6-5 DISCUSSION

It has been well documented that both nTregs and iTregs suppress the development of autoimmune diseases. However, the mechanisms whereby Treg subsets suppress immune response remain incompletely understood. Although cell contact is required for the suppression of immune response by nTregs in vitro (Piccirillo et al.,

2002), immunosuppressive factors such as TGFβ and/or IL-10 appear to be critically involved in the suppression of immune responses and disease progress by nTregs in vivo

(Fahlen et al., 2005; Maloy et al., 2003). In this study, we have demonstrated that TGFβ signaling is indispensable while IL-10 plays a less prominent role in the suppression of lupus, although these soluble factors did not contribute to the suppressive activity of iTregs in vitro. It is possible that cell contact may play a dominant role in vitro due to the limited cell mobility in confined spaces. However, it is evident that cytokines produced by Tregs have a systemic role in the suppression of immune responses in vivo.

In general, antigen-specific Tregs are believed to have a more potent suppressive ability than non-specific Tregs (Tang and Bluestone, 2008). Another advantage of antigen-specific Tregs is that they can selectively suppress immune responses without compromising other beneficial immune responses, and therefore are especially suitable for providing protection from organ transplant rejection. Nonetheless, in some autoimmune diseases such as lupus, the specific antigens are ill-defined and polyclonal 137

Tregs may be suitable in such situation. In the current study, we demonstrate that polyclonal iTregs suppressed anti-CD3 and alloantigen stimulated T cell responses and alloantigen-mediated cGVHD, implicating that the manipulation of polyclonal iTregs may be of therapeutic value for the systemic autoimmune diseases that lack the identification of specific antigens. An earlier study has demonstrated that the suppressive function of nTregs is antigen-nonspecific when they have been activated (Thornton and

Shevach, 2000). It is also possible that polyclonal iTregs can be selectively expanded following specific antigen stimulation (Godebu et al., 2008).

We have documented therapeutically important interactions between polyclonal iTregs and DCs in mice with a lupus-like cGVHD disease. Although these Tregs are short lived, a single injection doubled the survival of these mice. The transferred iTregs not only inhibited co-stimulatory molecule expression and prevented the expansion of immunogenic DCs, but also induced them to become tolerogenic. The secondary transfer of these tDCs into new mice with this fatal syndrome had protective effects equivalent to the initially transferred iTregs. Moreover, both in vitro and in vivo these tDCs converted

CD4+ cells into additional Foxp3+ iTregs. Although the protective effects of the transferred iTregs in this model was both TGF-β and IL-10 dependent, the tolerogenic effects of the iTregs on DCs and the subsequent therapeutic effects of tDCs on lupus were clearly TGFβ-, but not IL-10-dependent. It is likely that the transferred Foxp3+ iTregs predominately produced active TGFβ over IL-10 (Zheng et al., 2002). 138

Qin et al. (Qin et al., 1993) previously reported that CD4+ cells from mice rendered tolerant to MHC mismatched skin grafts could prevent other T cells in these mice from rejecting the grafts and could transfer this suppressive capacity to other T cells by “infectious tolerance” (Qin et al., 1993). Until recently, it was unclear whether this transfer was a direct effect or mediated by an intermediate antigen-presenting cell. In vitro, several groups have reported that Tregs have a direct effect which is dependent upon IL-10 (Dieckmann et al., 2002), TGFβ (Andersson et al., 2008; Jonuleit et al.,

2002), and most recently IL-35 (Chaturvedi et al., 2011). CD4+Foxp3+ Tregs have a vital role in sustaining infectious tolerance (Kendal et al., 2011).

It has become apparent that in vivo DCs have an essential intermediate role in enabling Tregs to convert other T cells to similar suppressor cells. Initially, CD4+Foxp3+ nTregs were reported to prevent immature DCs from becoming immunogenic by direct contact and inhibiting their expression of B7 (Onishi et al., 2008; Tang et al., 2006).

Cobbold et al. (Cobbold et al., 2009) then described a tolerogenic interaction between

Tregs and DCs in transplant tolerance in vivo. Subsequently, using transplant models, this group has accumulated considerable evidence that Treg effect on DCs leads to a local microenvironment depleted of tryptophan and other essential amino acids and that is rich in adenosine. This environment has tolerogenic properties that in synergy with TGFβ results in generation of new CD4+ Foxp3+ iTregs (Cobbold et al., 2010). In our autoimmune model where Foxp3+ iTregs had the ability to modulate DCs to become tolerogenic and to secondarily induce other Foxp3+ T cells, TGFβ signaling in DCs was similarly critical. 139

Our findings that adoptive transfer of tDCs also suppressed lupus development are novel. Whether the tDCs protection was a direct effect of the DCs or due to their ability to induce or expand other CD4+Foxp3+ Tregs in vivo cannot be distinguished. It has been known that tDCs produce TGFβ, IL-10, IL-27, retinoic acid, IDO, and vitamin

D3 (Wakkach et al., 2003). These factors either suppress immune responses directly or indirectly via the induction of Treg subsets. We now observe that TGFβ but not IL-10 plays an important role in the suppression of lupus-like disease following adoptive transfer of tDCs and TGF-β signal in DCs is crucial for tDCs formation and function.

Laouar et al. (Laouar et al., 2008) have previously reported that TGFβ signaling in DCs is a prerequisite for the control of autoimmune encephalomyelitis. The role for IL-10 in this model was not investigated. IL-10 has broad inhibitory effects on T cell activation, and has been recently reported to enhance the long term viability of CD4+Foxp3+Tregs

(Murai et al., 2009). Although we cannot exclude the direct action of tDCs, we believe that these DCs have at least indirectly caused the suppression of lupus though increased frequency of Foxp3+ Tregs. It is possible that these tDCs secrete TGFβ to educate the recipient’s naïve T cells to become a new generation of Foxp3+ Tregs in the presence of self or foreign antigens through “infectious tolerance”. These new Tregs can continue to maintain immune tolerance and control the disease development.

It is important to emphasize that the effects of Tregs on DCs in this study were conducted with iTregs differentiated ex-vivo with TGFβ. Others have reported that iTregs were unstable and lacked suppressive activity on acute GVHD (Floess et al., 2007b;

Koenecke et al., 2009). However, in our experimental settings and the cGVHD model of 140 lupus-like disease, these iTregs had evidently protective effects. In our earlier studies comparing both mouse and human nTregs and iTregs, the in vivo protective activity of these subsets was equivalent when transferred at the onset of disease (Zheng et al.,

2004b; Zhou et al., 2010b). We have also reported that only iTregs induced ex-vivo are resistant to conversion to Th17 cells following treatment with IL-6 in mice, or IL-1 and

IL-6 in humans (Lu et al., 2010; Zheng et al., 2008). We have recently observed that only transferred iTregs shifted the balance of TH17 cells in draining lymph nodes from

Th17-predominant to Treg-predominant in established CIA (manuscript under revision).

This effect is likely result of Treg-induced shift from immunogenic to tolerogenic DC phenotype/function. Thus, the potential therapeutic effect of Tregs in chronic inflammatory, immune-mediated disease is likely to be determined by their effects on antigen-presenting cells in vivo.

141

CHAPTER 7

CONCLUSIONS AND FUTURE DIRECTIONS

7-1 Conclusions

The immune system has evolved to protect the host against a variety of microbial pathogens, but at the same time prevent spurious immune responses directed against the host. This ability to discriminate self from non-self critically relies upon immune tolerance, which encompasses a network of mechanisms that function at different stages of lymphocyte development. A number of such mechanisms have been identified over the last decade and have provided insights into the pathogenesis of various autoimmune diseases. Yet, it has been difficult to develop strategies to prevent or cure these diseases suggesting that there may be other mechanisms that remain to be discovered.

The goal of this dissertation was to identify one such mechanism that might be important to maintain immune tolerance. It has long been established that TGFβ is an important immunoregulatory cytokine with a critical function on T cell regulation supported by several in vivo studies. However, its effect on other immune cells, including dendritic cells has not been studied in as much detail as in T cells. Although a few in vivo models with attenuated TGFβ signaling in DCs have been developed, these models failed to confirm its role in preserving self-tolerance through maintenance of DC homeostasis at the steady-state. We developed a conditional knock-out mouse model with specific deletion of Tgfbr2 in dendritic cells and observed spontaneous autoimmune manifestation 142 in these mice. We have also demonstrated for the first time that in vivo, TGFβ controls dendritic cell function through two different modes. One, by preventing the production of inflammatory cytokines and the other, by promoting the tolerogenic functions of DCs, primarily through induction and maintenance of regulatory T cells. These functions are in contrast to what has been observed in vitro with TGFβ stimulation of DCs. Although the mechanisms that lead to the development of autoimmune disease in DC-Tgfbr2 KO mice remain incompletely understood, contribution by both DCs and Tregs cannot be completely ruled out. Increased inflammatory cytokine production by DCs combined with quantitative and qualitative difference in Treg numbers and function could have resulted in T and B cell activation. In addition, preliminary studies on DCs isolated from peripheral tissues suggest decreased expression of TGFβ and other regulatory molecules such as IDO and retinaldehyde dehydrogenase (RALDH). Defects in TGFβ expression or its activation by integrins have been associated with multi-organ inflammation and autoimmunity through both cell intrinsic (through effects on effector T cells) and cell extrinsic mechanisms (through effects on nTregs) (reviewed by Li and Flavell, 2008).

Since autocrine or paracrine TGFβ signaling in DCs is often required for its induction or activation (through upregulation of integrins), we speculate that lower expression of active TGFβ in the local microenvironment of DCs, T cells and Tregs may also contribute to T cell activation and inflammation. Furthermore, molecules such as IDO and RALDH are also critical for long term tolerance induction and decreased expression of these factors may also play a significant role in inducing aberrant immune responses in

DC-Tgfbr2 KO mice. We have also shown that TGFβ, but not IL-10 produced by iTregs 143 is critical for inducing tolerogenic dendritic cells in vivo. Therefore, based on our observations, we propose that in the absence of TGFβ signaling in dendritic cells, there is a loss of the immunosuppressive function of DCs and a gain of inflammatory phenotype, which subsequently results in uncontrolled activation of T and B cells leading to inflammation (Figure 7.1).

144

Steady-State

DC -Tgfbr2 KO

Figure 7.1: Proposed Model for TGFβ dependent regulation of dendritic cells to prevent inflammation

145

7-2 Future directions

The phenotype of DC-Tgfbr2 KO mice has revealed a previously unappreciated role of TGFβ on dendritic cell function and has opened up avenues for research in different aspects of dendritic cell biology and autoimmune diseases. Therefore, although several long term studies can be proposed, this part of the dissertation just focuses on a couple of experiments that can be carried out in the immediate future. Of these, we would first like to test the immunosuppressive function of the Tregs by crossing DC-Tgfbr2 KO mice with Foxp3 knock-in mice (C57BL/6-Foxp3tm1Flv/J mice; Jacksons laboratory). We would then conduct functional immunosuppressive assays on sorted Foxp3+ T cells which will help us to determine the contribution of Tregs to the observed autoimmune phenotype in DC-Tgfbr2 KO mice. Based on previous studies related to the observed phenotype of Tregs in DC-Tgfbr2 KO mice, we speculate that the Foxp3+ T cells may not be fully immunosuppressive and in fact behave more like Th2 cells.

We have also demonstrated that Tgfbr2-deficient MLN and BMDCs are unable to drive antigen-specific Treg conversion due to increased IFN production. We would like to confirm these observations in an in vivo setting by injecting DC-Tgfbr2 KO mice with

CD4+Foxp3- T cells from OT-II-CD45.1-Foxp3-GFP mice (Harvard Skin Disease

Research Center) and then feed them with ovalbumin for 5 days. The ability of DCs to induce ova-specific Tregs in MLNs is then determined by flow cytometry based on

CD45.1 and GFP expression. Our in vitro studies combined with decreased frequencies and numbers of Tregs in the MLN of DC-Tgfbr2 KO mice strongly suggest that in vivo 146 differentiation of naïve T cells into Tregs may be inhibited by increased IFN production by Tgfbr2-deficient DCs.

Although we did not observe changes in IDO expression by microarray analysis in splenic or MLN DCs, we would like to reanalyze its expression status in specific dendritic cell subsets such as CD8+ DCs, pDCs and CD103+ DCs from both lymphoid and non-lymphoid organs. In addition we would also like to look at the expression of other regulatory molecules such as RALDH, IL-10 and inhibitory receptors for T cell activation such as ILT3 and ILT4 in DCs from DC-Tgfbr2 KO mice. Preliminary studies with sorted CD103+ DCs from the small intestinal lamina propria indicated lower expression of RALDH, IDO and IL-10 in these DCs. However these experiments need to be repeated and confirmed. The expression of such regulatory molecules is important for

Treg induction and maintenance and therefore their decreased expression would also correlate with altered Treg phenotype in DC-Tgfbr2 KO mice.

Finally, we would like to understand and relate our findings in the mouse model to patients with autoimmune diseases. As a first step towards this goal, we have established collaborations with clinicians at the University of Arizona to obtain colonic biopsies from patients with inflammatory bowel disease. We would isolate dendritic cells from the biopsies and look at Smad2 phosphorylation in response to TGFβ stimulation.

Defects in Smad2 phosphorylation may suggest a causal relationship with colitis induction in these patients based on our findings in DC-Tgfbr2 KO mice

147

REFERENCES

(1997). An autoimmune disease, APECED, caused by mutations in a novel gene featuring two PHD-type zinc-finger domains. Nat Genet 17, 399-403.

Alferink, J., Tafuri, A., Vestweber, D., Hallmann, R., Hammerling, G.J., and Arnold, B. (1998). Control of neonatal tolerance to tissue antigens by peripheral T cell trafficking. Science 282, 1338-1341.

Anderson, M.S., Venanzi, E.S., Klein, L., Chen, Z., Berzins, S.P., Turley, S.J., von Boehmer, H., Bronson, R., Dierich, A., Benoist, C., and Mathis, D. (2002). Projection of an immunological self shadow within the thymus by the aire protein. Science 298, 1395- 1401.

Andersson, J., Tran, D.Q., Pesu, M., Davidson, T.S., Ramsey, H., O'Shea, J.J., and Shevach, E.M. (2008). CD4+ FoxP3+ regulatory T cells confer infectious tolerance in a TGF-beta-dependent manner. J Exp Med 205, 1975-1981.

Apostolou, I., and von Boehmer, H. (2004). In vivo instruction of suppressor commitment in naive T cells. J Exp Med 199, 1401-1408.

Awasthi, A., Carrier, Y., Peron, J.P., Bettelli, E., Kamanaka, M., Flavell, R.A., Kuchroo, V.K., Oukka, M., and Weiner, H.L. (2007). A dominant function for interleukin 27 in generating interleukin 10-producing anti-inflammatory T cells. Nat Immunol 8, 1380- 1389.

Banchereau, J., and Palucka, A.K. (2005). Dendritic cells as therapeutic vaccines against cancer. Nat Rev Immunol 5, 296-306.

Belladonna, M.L., Orabona, C., Grohmann, U., and Puccetti, P. (2009). TGF-beta and kynurenines as the key to infectious tolerance. Trends Mol Med 15, 41-49.

Belladonna, M.L., Volpi, C., Bianchi, R., Vacca, C., Orabona, C., Pallotta, M.T., Boon, L., Gizzi, S., Fioretti, M.C., Grohmann, U., and Puccetti, P. (2008). Cutting edge: Autocrine TGF-beta sustains default tolerogenesis by IDO-competent dendritic cells. J Immunol 181, 5194-5198.

Benson, M.J., Pino-Lagos, K., Rosemblatt, M., and Noelle, R.J. (2007). All-trans retinoic acid mediates enhanced T reg cell growth, differentiation, and gut homing in the face of high levels of co-stimulation. J Exp Med 204, 1765-1774.

Bettelli, E., Carrier, Y., Gao, W., Korn, T., Strom, T.B., Oukka, M., Weiner, H.L., and Kuchroo, V.K. (2006). Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature 441, 235-238. 148

Bonelli, M., Savitskaya, A., Steiner, C.W., Rath, E., Smolen, J.S., and Scheinecker, C. (2009). Phenotypic and functional analysis of CD4+ CD25- Foxp3+ T cells in patients with systemic lupus erythematosus. Journal of immunology 182, 1689-1695.

Bonham, C.A., Lu, L., Banas, R.A., Fontes, P., Rao, A.S., Starzl, T.E., Zeevi, A., and Thomson, A.W. (1996). TGF-beta 1 pretreatment impairs the allostimulatory function of human bone marrow-derived antigen-presenting cells for both naive and primed T cells. Transpl Immunol 4, 186-191.

Boomershine, C.S., Chamberlain, A., Kendall, P., Afshar-Sharif, A.R., Huang, H., Washington, M.K., Lawson, W.E., Thomas, J.W., Blackwell, T.S., and Bhowmick, N.A. (2009). Autoimmune pancreatitis results from loss of TGFbeta signalling in S100A4- positive dendritic cells. Gut 58, 1267-1274.

Brenner, O., Levanon, D., Negreanu, V., Golubkov, O., Fainaru, O., Woolf, E., and Groner, Y. (2004). Loss of Runx3 function in leukocytes is associated with spontaneously developed colitis and gastric mucosal hyperplasia. Proc Natl Acad Sci U S A 101, 16016-16021.

Brunkow, M.E., Jeffery, E.W., Hjerrild, K.A., Paeper, B., Clark, L.B., Yasayko, S.A., Wilkinson, J.E., Galas, D., Ziegler, S.F., and Ramsdell, F. (2001). Disruption of a new forkhead/winged-helix protein, scurfin, results in the fatal lymphoproliferative disorder of the scurfy mouse. Nat Genet 27, 68-73.

Burnet, F.M. and Fenner, F. (1949). The Production of Antibodies, 2nd edition. Macmillan: Melbourne.

Caretto, D., Katzman, S.D., Villarino, A.V., Gallo, E., and Abbas, A.K. (2010). Cutting edge: the Th1 response inhibits the generation of peripheral regulatory T cells. Journal of immunology 184, 30-34.

Caton, M.L., Smith-Raska, M.R., and Reizis, B. (2007). Notch-RBP-J signaling controls the homeostasis of CD8- dendritic cells in the spleen. The Journal of experimental medicine 204, 1653-1664.

Chang, J.H., Kim, Y.J., Han, S.H., and Kang, C.Y. (2009). IFN-gamma-STAT1 signal regulates the differentiation of inducible Treg: potential role for ROS-mediated apoptosis. European journal of immunology 39, 1241-1251.

Chaturvedi, V., Collison, L.W., Guy, C.S., Workman, C.J., and Vignali, D.A. (2011). Cutting edge: Human regulatory T cells require IL-35 to mediate suppression and infectious tolerance. J Immunol 186, 6661-6666.

Chen, C., Nagy, Z., Prak, E.L., and Weigert, M. (1995). Immunoglobulin heavy chain gene replacement: a mechanism of receptor editing. Immunity 3, 747-755. 149

Chen, W., Jin, W., Hardegen, N., Lei, K.J., Li, L., Marinos, N., McGrady, G., and Wahl, S.M. (2003). Conversion of peripheral CD4+CD25- naive T cells to CD4+CD25+ regulatory T cells by TGF-beta induction of transcription factor Foxp3. J Exp Med 198, 1875-1886.

Christ, M., McCartney-Francis, N.L., Kulkarni, A.B., Ward, J.M., Mizel, D.E., Mackall, C.L., Gress, R.E., Hines, K.L., Tian, H., Karlsson, S., and et al. (1994). Immune dysregulation in TGF-beta 1-deficient mice. J Immunol 153, 1936-1946.

Chytil, A., Magnuson, M.A., Wright, C.V., and Moses, H.L. (2002). Conditional inactivation of the TGF-beta type II receptor using Cre:Lox. Genesis 32, 73-75.

Claman, H.N., and Chaperon, E.A. (1969). Immunologic complementation between thymus and marrow cells--a model for the two-cell theory of immunocompetence. Transplant Rev 1, 92-113.

Cobbold, S.P., Adams, E., Farquhar, C.A., Nolan, K.F., Howie, D., Lui, K.O., Fairchild, P.J., Mellor, A.L., Ron, D., and Waldmann, H. (2009). Infectious tolerance via the consumption of essential amino acids and mTOR signaling. Proc Natl Acad Sci U S A 106, 12055-12060.

Cobbold, S.P., Adams, E., Nolan, K.F., Regateiro, F.S., and Waldmann, H. (2010). Connecting the mechanisms of T-cell regulation: dendritic cells as the missing link. Immunol Rev 236, 203-218.

Coombes, J.L., Siddiqui, K.R., Arancibia-Carcamo, C.V., Hall, J., Sun, C.M., Belkaid, Y., and Powrie, F. (2007). A functionally specialized population of mucosal CD103+ DCs induces Foxp3+ regulatory T cells via a TGF-beta and retinoic acid-dependent mechanism. J Exp Med 204, 1757-1764.

Coquerelle, C., and Moser, M. (2010). DC subsets in positive and negative regulation of immunity. Immunological reviews 234, 317-334.

Crocker, P.R. (2002). Siglecs: sialic-acid-binding immunoglobulin-like lectins in cell-cell interactions and signalling. Curr Opin Struct Biol 12, 609-615.

Curotto de Lafaille, M.A., and Lafaille, J.J. (2009). Natural and adaptive foxp3+ regulatory T cells: more of the same or a division of labor? Immunity 30, 626-635.

Daeron, M., Latour, S., Malbec, O., Espinosa, E., Pina, P., Pasmans, S., and Fridman, W.H. (1995). The same tyrosine-based inhibition motif, in the intracytoplasmic domain of Fc gamma RIIB, regulates negatively BCR-, TCR-, and FcR-dependent cell activation. Immunity 3, 635-646. 150

Darrasse-Jeze, G., Deroubaix, S., Mouquet, H., Victora, G.D., Eisenreich, T., Yao, K.H., Masilamani, R.F., Dustin, M.L., Rudensky, A., Liu, K., and Nussenzweig, M.C. (2009). Feedback control of regulatory T cell homeostasis by dendritic cells in vivo. J Exp Med 206, 1853-1862.

Dieckmann, D., Bruett, C.H., Ploettner, H., Lutz, M.B., and Schuler, G. (2002). Human CD4(+)CD25(+) regulatory, contact-dependent T cells induce interleukin 10-producing, contact-independent type 1-like regulatory T cells [corrected]. J Exp Med 196, 247-253.

Du Clos, T.W., Rubin, R.L., and Tan, E.M. (1986). Monoclonal antibody for DNA measurement in biological fluids. J Immunol Methods 88, 185-192.

Duong, B.H., Tian, H., Ota, T., Completo, G., Han, S., Vela, J.L., Ota, M., Kubitz, M., Bovin, N., Paulson, J.C., and Nemazee, D. Decoration of T-independent antigen with ligands for CD22 and Siglec-G can suppress immunity and induce B cell tolerance in vivo. J Exp Med 207, 173-187.

Evans, M.J. (1989). Potential for genetic manipulation of mammals. Mol Biol Med 6, 557-565.

Fahlen, L., Read, S., Gorelik, L., Hurst, S.D., Coffman, R.L., Flavell, R.A., and Powrie, F. (2005). T cells that cannot respond to TGF-beta escape control by CD4(+)CD25(+) regulatory T cells. J Exp Med 201, 737-746.

Fainaru, O., Woolf, E., Lotem, J., Yarmus, M., Brenner, O., Goldenberg, D., Negreanu, V., Bernstein, Y., Levanon, D., Jung, S., and Groner, Y. (2004). Runx3 regulates mouse TGF-beta-mediated dendritic cell function and its absence results in airway inflammation. Embo J 23, 969-979.

Fantini, M.C., Becker, C., Monteleone, G., Pallone, F., Galle, P.R., and Neurath, M.F. (2004). Cutting edge: TGF-beta induces a regulatory phenotype in CD4+CD25- T cells through Foxp3 induction and down-regulation of Smad7. Journal of immunology 172, 5149-5153.

Favre, D., Mold, J., Hunt, P.W., Kanwar, B., Loke, P., Seu, L., Barbour, J.D., Lowe, M.M., Jayawardene, A., Aweeka, F., et al. (2010). Tryptophan catabolism by indoleamine 2,3-dioxygenase 1 alters the balance of TH17 to regulatory T cells in HIV disease. Sci Transl Med 2, 32ra36.

Fisson, S., Darrasse-Jeze, G., Litvinova, E., Septier, F., Klatzmann, D., Liblau, R., and Salomon, B.L. (2003). Continuous activation of autoreactive CD4+ CD25+ regulatory T cells in the steady state. J Exp Med 198, 737-746. 151

Floess, S., Freyer, J., Siewert, C., Baron, U., Olek, S., Polansky, J., Schlawe, K., Chang, H.D., Bopp, T., Schmitt, E., et al. (2007a). Epigenetic control of the foxp3 locus in regulatory T cells. PLoS Biol 5, e38.

Floess, S., Freyer, J., Siewert, C., Baron, U., Olek, S., Polansky, J., Schlawe, K., Chang, H.D., Bopp, T., Schmitt, E., et al. (2007b). Epigenetic control of the foxp3 locus in regulatory T cells. PLoS Biol 5, e38.

Fontenot, J.D., Dooley, J.L., Farr, A.G., and Rudensky, A.Y. (2005). Developmental regulation of Foxp3 expression during ontogeny. The Journal of experimental medicine 202, 901-906.

Fontenot, J.D., Gavin, M.A., and Rudensky, A.Y. (2003a). Foxp3 programs the development and function of CD4+CD25+ regulatory T cells. Nat Immunol 4, 330-336.

Fontenot, J.D., Gavin, M.A., and Rudensky, A.Y. (2003b). Foxp3 programs the development and function of CD4+CD25+ regulatory T cells. Nat Immunol 4, 330-336.

Fontenot, J.D., and Rudensky, A.Y. (2005). A well adapted regulatory contrivance: regulatory T cell development and the forkhead family transcription factor Foxp3. Nat Immunol 6, 331-337.

Francisco, L.M., Salinas, V.H., Brown, K.E., Vanguri, V.K., Freeman, G.J., Kuchroo, V.K., and Sharpe, A.H. (2009). PD-L1 regulates the development, maintenance, and function of induced regulatory T cells. J Exp Med 206, 3015-3029.

Fu, S., Zhang, N., Yopp, A.C., Chen, D., Mao, M., Zhang, H., Ding, Y., and Bromberg, J.S. (2004). TGF-beta induces Foxp3 + T-regulatory cells from CD4 + CD25 - precursors. Am J Transplant 4, 1614-1627.

Gambineri, E., Torgerson, T.R., and Ochs, H.D. (2003). Immune dysregulation, polyendocrinopathy, enteropathy, and X-linked inheritance (IPEX), a syndrome of systemic autoimmunity caused by mutations of FOXP3, a critical regulator of T-cell homeostasis. Curr Opin Rheumatol 15, 430-435.

Garbi, N., and Hammerling, G.J. (2011). Co-stimulation by dendritic cells maintains the peripheral pool of Tregs. European journal of immunology 41, 282-285.

Gavin, M.A., Rasmussen, J.P., Fontenot, J.D., Vasta, V., Manganiello, V.C., Beavo, J.A., and Rudensky, A.Y. (2007). Foxp3-dependent programme of regulatory T-cell differentiation. Nature 445, 771-775.

Gavin, M.A., Torgerson, T.R., Houston, E., DeRoos, P., Ho, W.Y., Stray-Pedersen, A., Ocheltree, E.L., Greenberg, P.D., Ochs, H.D., and Rudensky, A.Y. (2006). Single-cell 152 analysis of normal and FOXP3-mutant human T cells: FOXP3 expression without regulatory T cell development. Proc Natl Acad Sci U S A 103, 6659-6664.

Geissmann, F., Prost, C., Monnet, J.P., Dy, M., Brousse, N., and Hermine, O. (1998). Transforming growth factor beta1, in the presence of granulocyte/macrophage colony- stimulating factor and interleukin 4, induces differentiation of human peripheral blood monocytes into dendritic Langerhans cells. The Journal of experimental medicine 187, 961-966.

Geissmann, F., Revy, P., Regnault, A., Lepelletier, Y., Dy, M., Brousse, N., Amigorena, S., Hermine, O., and Durandy, A. (1999). TGF-beta 1 prevents the noncognate maturation of human dendritic Langerhans cells. J Immunol 162, 4567-4575.

Godebu, E., Summers-Torres, D., Lin, M.M., Baaten, B.J., and Bradley, L.M. (2008). Polyclonal adaptive regulatory CD4 cells that can reverse type I diabetes become oligoclonal long-term protective memory cells. J Immunol 181, 1798-1805.

Goodnow, C.C., Crosbie, J., Jorgensen, H., Brink, R.A., and Basten, A. (1989). Induction of self-tolerance in mature peripheral B lymphocytes. Nature 342, 385-391.

Grohmann, U., Fallarino, F., and Puccetti, P. (2003). Tolerance, DCs and tryptophan: much ado about IDO. Trends in immunology 24, 242-248.

Hadeiba, H., Sato, T., Habtezion, A., Oderup, C., Pan, J., and Butcher, E.C. (2008). CCR9 expression defines tolerogenic plasmacytoid dendritic cells able to suppress acute graft-versus-host disease. Nat Immunol 9, 1253-1260.

Hakim, F.T., and Gress, R.E. (2007). Thymic involution: implications for self-tolerance. Methods in molecular biology 380, 377-390.

Hellmark, T., Niles, J.L., Collins, A.B., McCluskey, R.T., and Brunmark, C. (1997). Comparison of anti-GBM antibodies in sera with or without ANCA. J Am Soc Nephrol 8, 376-385.

Hogquist, K.A., Baldwin, T.A., and Jameson, S.C. (2005). Central tolerance: learning self-control in the thymus. Nat Rev Immunol 5, 772-782.

Hori, S., Nomura, T., and Sakaguchi, S. (2003). Control of regulatory T cell development by the transcription factor Foxp3. Science 299, 1057-1061.

Horwitz, D.A. (2010). Identity of mysterious CD4+CD25-Foxp3+ cells in SLE. Arthritis Res Ther 12, 101. 153

Horwitz, D.A., Zheng, S.G., and Gray, J.D. (2008). Natural and TGF-beta-induced Foxp3(+)CD4(+) CD25(+) regulatory T cells are not mirror images of each other. Trends Immunol 29, 429-435.

Hui, A.Y., and Friedman, S.L. (2003). Molecular basis of hepatic fibrosis. Expert Rev Mol Med 5, 1-23.

Iliev, I.D., Mileti, E., Matteoli, G., Chieppa, M., and Rescigno, M. (2009). Intestinal epithelial cells promote colitis-protective regulatory T-cell differentiation through dendritic cell conditioning. Mucosal Immunol 2, 340-350.

Jaksits, S., Kriehuber, E., Charbonnier, A.S., Rappersberger, K., Stingl, G., and Maurer, D. (1999). CD34+ cell-derived CD14+ precursor cells develop into Langerhans cells in a TGF-beta 1-dependent manner. Journal of immunology 163, 4869-4877.

Jonuleit, H., Schmitt, E., Kakirman, H., Stassen, M., Knop, J., and Enk, A.H. (2002). Infectious tolerance: human CD25(+) regulatory T cells convey suppressor activity to conventional CD4(+) T helper cells. J Exp Med 196, 255-260.

Jordan, M.S., Boesteanu, A., Reed, A.J., Petrone, A.L., Holenbeck, A.E., Lerman, M.A., Naji, A., and Caton, A.J. (2001). Thymic selection of CD4+CD25+ regulatory T cells induced by an agonist self-peptide. Nat Immunol 2, 301-306.

Kaplan, D.H., Li, M.O., Jenison, M.C., Shlomchik, W.D., Flavell, R.A., and Shlomchik, M.J. (2007). Autocrine/paracrine TGFbeta1 is required for the development of epidermal Langerhans cells. J Exp Med 204, 2545-2552.

Kappler, J.W., Roehm, N., and Marrack, P. (1987). T cell tolerance by clonal elimination in the thymus. Cell 49, 273-280.

Kawahata, K., Misaki, Y., Yamauchi, M., Tsunekawa, S., Setoguchi, K., Miyazaki, J., and Yamamoto, K. (2002). Generation of CD4(+)CD25(+) regulatory T cells from autoreactive T cells simultaneously with their negative selection in the thymus and from nonautoreactive T cells by endogenous TCR expression. Journal of immunology 168, 4399-4405.

Keir, M.E., Butte, M.J., Freeman, G.J., and Sharpe, A.H. (2008). PD-1 and its ligands in tolerance and immunity. Annual review of immunology 26, 677-704.

Kel, J.M., Girard-Madoux, M.J., Reizis, B., and Clausen, B.E. (2010). TGF-beta is required to maintain the pool of immature Langerhans cells in the epidermis. Journal of immunology 185, 3248-3255. 154

Kendal, A.R., Chen, Y., Regateiro, F.S., Ma, J., Adams, E., Cobbold, S.P., Hori, S., and Waldmann, H. (2011). Sustained suppression by Foxp3+ regulatory T cells is vital for infectious transplantation tolerance. J Exp Med 208, 2043-2053.

Khattri, R., Cox, T., Yasayko, S.A., and Ramsdell, F. (2003). An essential role for Scurfin in CD4+CD25+ T regulatory cells. Nat Immunol 4, 337-342.

Kisielow, P., Bluthmann, H., Staerz, U.D., Steinmetz, M., and von Boehmer, H. (1988). Tolerance in T-cell-receptor transgenic mice involves deletion of nonmature CD4+8+ thymocytes. Nature 333, 742-746.

Koenecke, C., Czeloth, N., Bubke, A., Schmitz, S., Kissenpfennig, A., Malissen, B., Huehn, J., Ganser, A., Forster, R., and Prinz, I. (2009). Alloantigen-specific de novo- induced Foxp3+ Treg revert in vivo and do not protect from experimental GVHD. Eur J Immunol 39, 3091-3096.

Koralov, S.B., Novobrantseva, T.I., Konigsmann, J., Ehlich, A., and Rajewsky, K. (2006). Antibody repertoires generated by VH replacement and direct VH to JH joining. Immunity 25, 43-53.

Kretschmer, K., Apostolou, I., Hawiger, D., Khazaie, K., Nussenzweig, M.C., and von Boehmer, H. (2005). Inducing and expanding regulatory T cell populations by foreign antigen. Nat Immunol 6, 1219-1227.

Kulkarni, A.B., Huh, C.G., Becker, D., Geiser, A., Lyght, M., Flanders, K.C., Roberts, A.B., Sporn, M.B., Ward, J.M., and Karlsson, S. (1993). Transforming growth factor beta 1 null mutation in mice causes excessive inflammatory response and early death. Proc Natl Acad Sci U S A 90, 770-774.

Kushwah, R., and Hu, J. (2011). Complexity of dendritic cell subsets and their function in the host immune system. Immunology 133, 409-419.

Lan, Q., Fan, H., Quesniaux, V., Ryffel, B., Liu, Z., and Zheng, S.G. (2011). Induced Foxp3+ regulatory T cells: a potential new weapon to treat autoimmune and inflammatory diseases？. J Mol Cell Biol.

Lange, C., Durr, M., Doster, H., Melms, A., and Bischof, F. (2007). Dendritic cell- regulatory T-cell interactions control self-directed immunity. Immunology and cell biology 85, 575-581.

Laouar, Y., Town, T., Jeng, D., Tran, E., Wan, Y., Kuchroo, V.K., and Flavell, R.A. (2008). TGF-beta signaling in dendritic cells is a prerequisite for the control of autoimmune encephalomyelitis. Proc Natl Acad Sci U S A 105, 10865-10870. 155

Laurence, A., Tato, C.M., Davidson, T.S., Kanno, Y., Chen, Z., Yao, Z., Blank, R.B., Meylan, F., Siegel, R., Hennighausen, L., et al. (2007). Interleukin-2 signaling via STAT5 constrains T helper 17 cell generation. Immunity 26, 371-381.

Levy, L., and Hill, C.S. (2006). Alterations in components of the TGF-beta superfamily signaling pathways in human cancer. Cytokine Growth Factor Rev 17, 41-58.

Li, M.O., and Flavell, R.A. (2008). TGF-beta: a master of all T cell trades. Cell 134, 392- 404.

Li, M.O., Wan, Y.Y., Sanjabi, S., Robertson, A.K., and Flavell, R.A. (2006). Transforming growth factor-beta regulation of immune responses. Annu Rev Immunol 24, 99-146.

Lin, W., Haribhai, D., Relland, L.M., Truong, N., Carlson, M.R., Williams, C.B., and Chatila, T.A. (2007). Regulatory T cell development in the absence of functional Foxp3. Nat Immunol 8, 359-368.

Liston, A. (2011). Immunological tolerance 50 years after the Burnet Nobel Prize. Immunology and cell biology 89, 14-15.

Liston, A., Lesage, S., Wilson, J., Peltonen, L., and Goodnow, C.C. (2003). Aire regulates negative selection of organ-specific T cells. Nat Immunol 4, 350-354.

Lu, L., Ma, J., Li, Z., Lan, Q., Chen, M., Liu, Y., Xia, Z., Wang, J., Han, Y., Shi, W., et al. (2011). All-trans retinoic acid promotes TGF-beta-induced Tregs via histone modification but not DNA demethylation on Foxp3 gene locus. PLoS One 6, e24590.

Lu, L., Zhou, X., Wang, J., Zheng, S.G., and Horwitz, D.A. (2010). Characterization of protective human CD4CD25 FOXP3 regulatory T cells generated with IL-2, TGF-beta and retinoic acid. PLoS One 5, e15150.

Lutz, J., Muller, W., and Jack, H.M. (2006). VH replacement rescues progenitor B cells with two nonproductive VDJ alleles. Journal of immunology 177, 7007-7014.

Maloy, K.J., Salaun, L., Cahill, R., Dougan, G., Saunders, N.J., and Powrie, F. (2003). CD4+CD25+ T(R) cells suppress innate immune pathology through cytokine-dependent mechanisms. J Exp Med 197, 111-119.

Manicassamy, S., and Pulendran, B. (2011). Dendritic cell control of tolerogenic responses. Immunological reviews 241, 206-227.

Marie, J.C., Liggitt, D., and Rudensky, A.Y. (2006). Cellular mechanisms of fatal early- onset autoimmunity in mice with the T cell-specific targeting of transforming growth factor-beta receptor. Immunity 25, 441-454. 156

Mathis, D., and Benoist, C. (2010). Levees of immunological tolerance. Nat Immunol 11, 3-6.

McHugh, R.S., Whitters, M.J., Piccirillo, C.A., Young, D.A., Shevach, E.M., Collins, M., and Byrne, M.C. (2002). CD4(+)CD25(+) immunoregulatory T cells: gene expression analysis reveals a functional role for the glucocorticoid-induced TNF receptor. Immunity 16, 311-323.

Mellor, A.L., and Munn, D.H. (2004). IDO expression by dendritic cells: tolerance and tryptophan catabolism. Nature reviews. Immunology 4, 762-774.

Miller, J.F., and Mitchell, G.F. (1968). Cell to cell interaction in the immune response. I. Hemolysin-forming cells in neonatally thymectomized mice reconstituted with thymus or thoracic duct lymphocytes. The Journal of experimental medicine 128, 801-820.

Miller, J.F., Morahan, G., and Allison, J. (1989). Immunological tolerance: new approaches using transgenic mice. Immunol Today 10, 53-57.

Mombaerts, P., Iacomini, J., Johnson, R.S., Herrup, K., Tonegawa, S., and Papaioannou, V.E. (1992). RAG-1-deficient mice have no mature B and T lymphocytes. Cell 68, 869- 877.

Monrad, S., and Kaplan, M.J. (2007). Dendritic cells and the immunopathogenesis of systemic lupus erythematosus. Immunol Res 37, 135-145.

Mucida, D., Park, Y., Kim, G., Turovskaya, O., Scott, I., Kronenberg, M., and Cheroutre, H. (2007). Reciprocal TH17 and regulatory T cell differentiation mediated by retinoic acid. Science 317, 256-260.

Murai, M., Turovskaya, O., Kim, G., Madan, R., Karp, C.L., Cheroutre, H., and Kronenberg, M. (2009). Interleukin 10 acts on regulatory T cells to maintain expression of the transcription factor Foxp3 and suppressive function in mice with colitis. Nat Immunol 10, 1178-1184.

Nakajima, P.B., Kiefer, K., Price, A., Bosma, G.C., and Bosma, M.J. (2009). Two distinct populations of H chain-edited B cells show differential surrogate L chain dependence. Journal of immunology 182, 3583-3596.

Nelms, K.A., and Goodnow, C.C. (2001). Genome-wide ENU mutagenesis to reveal immune regulators. Immunity 15, 409-418.

Nemazee, D. (2006). Receptor editing in lymphocyte development and central tolerance. Nat Rev Immunol 6, 728-740. 157

Nguyen, T.L., Sullivan, N.L., Ebel, M., Teague, R.M., and DiPaolo, R.J. (2011). Antigen-specific TGF-beta-induced regulatory T cells secrete chemokines, regulate T cell trafficking, and suppress ongoing autoimmunity. Journal of immunology 187, 1745-1753.

Ogata, M., Zhang, Y., Wang, Y., Itakura, M., Zhang, Y.Y., Harada, A., Hashimoto, S., and Matsushima, K. (1999). Chemotactic response toward chemokines and its regulation by transforming growth factor-beta1 of murine bone marrow hematopoietic progenitor cell-derived different subset of dendritic cells. Blood 93, 3225-3232.

Ohnmacht, C., Pullner, A., King, S.B., Drexler, I., Meier, S., Brocker, T., and Voehringer, D. (2009). Constitutive ablation of dendritic cells breaks self-tolerance of CD4 T cells and results in spontaneous fatal autoimmunity. J Exp Med 206, 549-559.

Onishi, Y., Fehervari, Z., Yamaguchi, T., and Sakaguchi, S. (2008). Foxp3+ natural regulatory T cells preferentially form aggregates on dendritic cells in vitro and actively inhibit their maturation. Proc Natl Acad Sci U S A 105, 10113-10118.

Pallotta, M.T., Orabona, C., Volpi, C., Vacca, C., Belladonna, M.L., Bianchi, R., Servillo, G., Brunacci, C., Calvitti, M., Bicciato, S., et al. (2011). Indoleamine 2,3- dioxygenase is a signaling protein in long-term tolerance by dendritic cells. Nat Immunol 12, 870-878.

Piccirillo, C.A., Letterio, J.J., Thornton, A.M., McHugh, R.S., Mamura, M., Mizuhara, H., and Shevach, E.M. (2002). CD4(+)CD25(+) regulatory T cells can mediate suppressor function in the absence of transforming growth factor beta1 production and responsiveness. J Exp Med 196, 237-246.

Qin, S., Cobbold, S.P., Pope, H., Elliott, J., Kioussis, D., Davies, J., and Waldmann, H. (1993). "Infectious" transplantation tolerance. Science 259, 974-977.

Ramsdell, F., and Fowlkes, B.J. (1990). Clonal deletion versus clonal anergy: the role of the thymus in inducing self tolerance. Science 248, 1342-1348.

Riedl, E., Strobl, H., Majdic, O., and Knapp, W. (1997). TGF-beta 1 promotes in vitro generation of dendritic cells by protecting progenitor cells from apoptosis. Journal of immunology 158, 1591-1597.

Ronger-Savle, S., Valladeau, J., Claudy, A., Schmitt, D., Peguet-Navarro, J., Dezutter- Dambuyant, C., Thomas, L., and Jullien, D. (2005). TGFbeta inhibits CD1d expression on dendritic cells. J Invest Dermatol 124, 116-118.

Sakaguchi, S. (2005). Naturally arising Foxp3-expressing CD25+CD4+ regulatory T cells in immunological tolerance to self and non-self. Nat Immunol 6, 345-352. 158

Sakaguchi, S., Yamaguchi, T., Nomura, T., and Ono, M. (2008). Regulatory T cells and immune tolerance. Cell 133, 775-787.

Sanchez-Fueyo, A., Tian, J., Picarella, D., Domenig, C., Zheng, X.X., Sabatos, C.A., Manlongat, N., Bender, O., Kamradt, T., Kuchroo, V.K., et al. (2003). Tim-3 inhibits T helper type 1-mediated auto- and alloimmune responses and promotes immunological tolerance. Nat Immunol 4, 1093-1101.

Sanjabi, S., and Flavell, R.A. (2010). Overcoming the hurdles in using mouse genetic models that block TGF-beta signaling. J Immunol Methods 353, 111-114.

Sato, K., Kawasaki, H., Nagayama, H., Enomoto, M., Morimoto, C., Tadokoro, K., Juji, T., and Takahashi, T.A. (2000). TGF-beta 1 reciprocally controls chemotaxis of human peripheral blood monocyte-derived dendritic cells via chemokine receptors. Journal of immunology 164, 2285-2295.

Schonrich, G., Kalinke, U., Momburg, F., Malissen, M., Schmitt-Verhulst, A.M., Malissen, B., Hammerling, G.J., and Arnold, B. (1991). Down-regulation of T cell receptors on self-reactive T cells as a novel mechanism for extrathymic tolerance induction. Cell 65, 293-304.

Setoguchi, R., Hori, S., Takahashi, T., and Sakaguchi, S. (2005). Homeostatic maintenance of natural Foxp3(+) CD25(+) CD4(+) regulatory T cells by interleukin (IL)- 2 and induction of autoimmune disease by IL-2 neutralization. The Journal of experimental medicine 201, 723-735.

Shevach, E.M. (2006). From vanilla to 28 flavors: multiple varieties of T regulatory cells. Immunity 25, 195-201.

Shevach, E.M. (2009). Mechanisms of foxp3+ T regulatory cell-mediated suppression. Immunity 30, 636-645.

Shimizu, J., Yamazaki, S., Takahashi, T., Ishida, Y., and Sakaguchi, S. (2002). Stimulation of CD25(+)CD4(+) regulatory T cells through GITR breaks immunological self-tolerance. Nat Immunol 3, 135-142.

Shortman, K., and Naik, S.H. (2007). Steady-state and inflammatory dendritic-cell development. Nature reviews. Immunology 7, 19-30.

Shull, M.M., Ormsby, I., Kier, A.B., Pawlowski, S., Diebold, R.J., Yin, M., Allen, R., Sidman, C., Proetzel, G., Calvin, D., and et al. (1992). Targeted disruption of the mouse transforming growth factor-beta 1 gene results in multifocal inflammatory disease. Nature 359, 693-699. 159

Shustov, A., Nguyen, P., Finkelman, F., Elkon, K.B., and Via, C.S. (1998). Differential expression of Fas and Fas ligand in acute and chronic graft-versus-host disease: upregulation of Fas and Fas ligand requires CD8+ T cell activation and IFN-gamma production. J Immunol 161, 2848-2855.

Siddiqui, K.R., Laffont, S., and Powrie, F. (2010). E-cadherin marks a subset of inflammatory dendritic cells that promote T cell-mediated colitis. Immunity 32, 557-567.

Siddiqui, K.R., and Powrie, F. (2008). CD103+ GALT DCs promote Foxp3+ regulatory T cells. Mucosal Immunol 1 Suppl 1, S34-38.

Sprent, J., and Kishimoto, H. (2002). The thymus and negative selection. Immunological reviews 185, 126-135.

Steinman, R.M., Hawiger, D., and Nussenzweig, M.C. (2003). Tolerogenic dendritic cells. Annual review of immunology 21, 685-711.

Strobl, H., Riedl, E., Scheinecker, C., Bello-Fernandez, C., Pickl, W.F., Rappersberger, K., Majdic, O., and Knapp, W. (1996). TGF-beta 1 promotes in vitro development of dendritic cells from CD34+ hemopoietic progenitors. Journal of immunology 157, 1499- 1507.

Suffner, J., Hochweller, K., Kuhnle, M.C., Li, X., Kroczek, R.A., Garbi, N., and Hammerling, G.J. (2010). Dendritic cells support homeostatic expansion of Foxp3+ regulatory T cells in Foxp3.LuciDTR mice. Journal of immunology 184, 1810-1820.

Sun, C.M., Hall, J.A., Blank, R.B., Bouladoux, N., Oukka, M., Mora, J.R., and Belkaid, Y. (2007). Small intestine lamina propria dendritic cells promote de novo generation of Foxp3 T reg cells via retinoic acid. J Exp Med 204, 1775-1785.

Sutmuller, R.P., Morgan, M.E., Netea, M.G., Grauer, O., and Adema, G.J. (2006). Toll- like receptors on regulatory T cells: expanding immune regulation. Trends in immunology 27, 387-393.

Swat, W., Ignatowicz, L., von Boehmer, H., and Kisielow, P. (1991). Clonal deletion of immature CD4+8+ thymocytes in suspension culture by extrathymic antigen-presenting cells. Nature 351, 150-153.

Tabibzadeh, S. (2002). Homeostasis of extracellular matrix by TGF-beta and lefty. Front Biosci 7, d1231-1246.

Tang, Q., Adams, J.Y., Tooley, A.J., Bi, M., Fife, B.T., Serra, P., Santamaria, P., Locksley, R.M., Krummel, M.F., and Bluestone, J.A. (2006). Visualizing regulatory T cell control of autoimmune responses in nonobese diabetic mice. Nat Immunol 7, 83-92. 160

Tang, Q., and Bluestone, J.A. (2008). The Foxp3+ regulatory T cell: a jack of all trades, master of regulation. Nat Immunol 9, 239-244.

Thomas, R.M., Belsito, D.V., Huang, C., Chen Lz, L.Z., Ormsby, I., Simmons, W.J., Cowin, P., Shaw, J., Doetschman, T., and Thorbecke, G.J. (2001). Appearance of Langerhans cells in the epidermis of Tgfb1(-/-) SCID mice: paracrine and autocrine effects of transforming growth factor-beta 1 and -beta 2(1). The Journal of investigative dermatology 117, 1574-1580.

Thornton, A.M., Korty, P.E., Tran, D.Q., Wohlfert, E.A., Murray, P.E., Belkaid, Y., and Shevach, E.M. (2010). Expression of Helios, an Ikaros transcription factor family member, differentiates thymic-derived from peripherally induced Foxp3+ T regulatory cells. J Immunol 184, 3433-3441.

Thornton, A.M., and Shevach, E.M. (2000). Suppressor effector function of CD4+CD25+ immunoregulatory T cells is antigen nonspecific. J Immunol 164, 183-190.

Turley, S.J., Fletcher, A.L., and Elpek, K.G. The stromal and haematopoietic antigen- presenting cells that reside in secondary lymphoid organs. Nat Rev Immunol 10, 813- 825.

Van den Herik-Oudijk, I.E., Capel, P.J., van der Bruggen, T., and Van de Winkel, J.G. (1995). Identification of signaling motifs within human Fc gamma RIIa and Fc gamma RIIb isoforms. Blood 85, 2202-2211.

Veldhoen, M., Hocking, R.J., Atkins, C.J., Locksley, R.M., and Stockinger, B. (2006). TGFbeta in the context of an inflammatory cytokine milieu supports de novo differentiation of IL-17-producing T cells. Immunity 24, 179-189.

Vignali, D.A., Collison, L.W., and Workman, C.J. (2008). How regulatory T cells work. Nat Rev Immunol 8, 523-532. von Boehmer, H. (2004). Selection of the T-cell repertoire: receptor-controlled checkpoints in T-cell development. Adv Immunol 84, 201-238. von Boehmer, H. (2008). Positive and negative selection in Basel. Nat Immunol 9, 571- 573. von Boehmer, H., and Melchers, F. (2010). Checkpoints in lymphocyte development and autoimmune disease. Nat Immunol 11, 14-20.

Wakkach, A., Fournier, N., Brun, V., Breittmayer, J.P., Cottrez, F., and Groux, H. (2003). Characterization of dendritic cells that induce tolerance and T regulatory 1 cell differentiation in vivo. Immunity 18, 605-617. 161

Walker, L.S., and Abbas, A.K. (2002). The enemy within: keeping self-reactive T cells at bay in the periphery. Nat Rev Immunol 2, 11-19.

Walsh, S.J., and Rau, L.M. (2000). Autoimmune diseases: a leading cause of death among young and middle-aged women in the United States. Am J Public Health 90, 1463-1466.

Walunas, T.L., Lenschow, D.J., Bakker, C.Y., Linsley, P.S., Freeman, G.J., Green, J.M., Thompson, C.B., and Bluestone, J.A. (1994). CTLA-4 can function as a negative regulator of T cell activation. Immunity 1, 405-413.

Wan, Y.Y., and Flavell, R.A. (2007). Regulatory T-cell functions are subverted and converted owing to attenuated Foxp3 expression. Nature 445, 766-770.

Wardemann, H., and Nussenzweig, M.C. (2007). B-cell self-tolerance in humans. Adv Immunol 95, 83-110.

Watanabe-Fukunaga, R., Brannan, C.I., Copeland, N.G., Jenkins, N.A., and Nagata, S. (1992). Lymphoproliferation disorder in mice explained by defects in Fas antigen that mediates apoptosis. Nature 356, 314-317.

Watanabe, N., Wang, Y.H., Lee, H.K., Ito, T., Cao, W., and Liu, Y.J. (2005). Hassall's corpuscles instruct dendritic cells to induce CD4+CD25+ regulatory T cells in human thymus. Nature 436, 1181-1185.

Witsch, E.J., Cao, H., Fukuyama, H., and Weigert, M. (2006). Light chain editing generates polyreactive antibodies in chronic graft-versus-host reaction. The Journal of experimental medicine 203, 1761-1772.

Xu, L., Kitani, A., Fuss, I., and Strober, W. (2007a). Cutting edge: regulatory T cells induce CD4+CD25-Foxp3- T cells or are self-induced to become Th17 cells in the absence of exogenous TGF-beta. J Immunol 178, 6725-6729.

Xu, Y., Zhan, Y., Lew, A.M., Naik, S.H., and Kershaw, M.H. (2007b). Differential development of murine dendritic cells by GM-CSF versus Flt3 ligand has implications for inflammation and trafficking. Journal of immunology 179, 7577-7584.

Yagi, H., Nomura, T., Nakamura, K., Yamazaki, S., Kitawaki, T., Hori, S., Maeda, M., Onodera, M., Uchiyama, T., Fujii, S., and Sakaguchi, S. (2004). Crucial role of FOXP3 in the development and function of human CD25+CD4+ regulatory T cells. Int Immunol 16, 1643-1656.

Yamaguchi, Y., Tsumura, H., Miwa, M., and Inaba, K. (1997). Contrasting effects of TGF-beta 1 and TNF-alpha on the development of dendritic cells from progenitors in mouse bone marrow. Stem Cells 15, 144-153. 162

Yamazaki, S., Bonito, A.J., Spisek, R., Dhodapkar, M., Inaba, K., and Steinman, R.M. (2007). Dendritic cells are specialized accessory cells along with TGF- for the differentiation of Foxp3+ CD4+ regulatory T cells from peripheral Foxp3 precursors. Blood 110, 4293-4302.

Yang, H.X., Zhang, W., Zhao, L.D., Li, Y., Zhang, F.C., Tang, F.L., He, W., and Zhang, X. (2009). Are CD4+CD25-Foxp3+ cells in untreated new-onset lupus patients regulatory T cells? Arthritis Res Ther 11, R153.

Zelenay, S., Lopes-Carvalho, T., Caramalho, I., Moraes-Fontes, M.F., Rebelo, M., and Demengeot, J. (2005). Foxp3+ CD25- CD4 T cells constitute a reservoir of committed regulatory cells that regain CD25 expression upon homeostatic expansion. Proc Natl Acad Sci U S A 102, 4091-4096.

Zhang, Z., Zemlin, M., Wang, Y.H., Munfus, D., Huye, L.E., Findley, H.W., Bridges, S.L., Roth, D.B., Burrows, P.D., and Cooper, M.D. (2003). Contribution of Vh gene replacement to the primary B cell repertoire. Immunity 19, 21-31.

Zheng, S.G., Gray, J.D., Ohtsuka, K., Yamagiwa, S., and Horwitz, D.A. (2002). Generation ex vivo of TGF-beta-producing regulatory T cells from CD4+CD25- precursors. J Immunol 169, 4183-4189.

Zheng, S.G., Meng, L., Wang, J.H., Watanabe, M., Barr, M.L., Cramer, D.V., Gray, J.D., and Horwitz, D.A. (2006). Transfer of regulatory T cells generated ex vivo modifies graft rejection through induction of tolerogenic CD4+CD25+ cells in the recipient. Int Immunol 18, 279-289.

Zheng, S.G., Wang, J., and Horwitz, D.A. (2008). Cutting edge: Foxp3+CD4+CD25+ regulatory T cells induced by IL-2 and TGF-beta are resistant to Th17 conversion by IL- 6. J Immunol 180, 7112-7116.

Zheng, S.G., Wang, J., Wang, P., Gray, J.D., and Horwitz, D.A. (2007). IL-2 is essential for TGF-beta to convert naive CD4+CD25- cells to CD25+Foxp3+ regulatory T cells and for expansion of these cells. J Immunol 178, 2018-2027.

Zheng, S.G., Wang, J.H., Gray, J.D., Soucier, H., and Horwitz, D.A. (2004a). Natural and induced CD4+CD25+ cells educate CD4+CD25- cells to develop suppressive activity: the role of IL-2, TGF-beta, and IL-10. J Immunol 172, 5213-5221.

Zheng, S.G., Wang, J.H., Koss, M.N., Quismorio, F., Jr., Gray, J.D., and Horwitz, D.A. (2004b). CD4+ and CD8+ regulatory T cells generated ex vivo with IL-2 and TGF-beta suppress a stimulatory graft-versus-host disease with a lupus-like syndrome. J Immunol 172, 1531-1539. 163

Zhou, X., Kong, N., Wang, J., Fan, H., Zou, H., Horwitz, D., Brand, D., Liu, Z., and Zheng, S.G. (2010a). Cutting edge: all-trans retinoic acid sustains the stability and function of natural regulatory T cells in an inflammatory milieu. J Immunol 185, 2675- 2679.

Zhou, X., Wang, J., Shi, W., Brand, D.D., Liu, Z., Fan, H., and Zheng, S.G. (2010b). Isolation of purified and live Foxp3+ regulatory T cells using FACS sorting on scatter plot. J Mol Cell Biol 2, 164-169.

Ziegler, S.F. (2006). FOXP3: of mice and men. Annual review of immunology 24, 209- 226.

Zou, T., Caton, A.J., Koretzky, G.A., and Kambayashi, T. (2010). Dendritic cells induce regulatory T cell proliferation through antigen-dependent and -independent interactions. Journal of immunology 185, 2790-2799.