The Canadian Veterinary Journal La Revue Vétérinaire Canadienne

August/Août 2017 The Canadian Veterinary Journal

Vol. 58, No. 08 Vol. 58, La Revue vétérinaire canadienne

August/Août 2017 Volume 58, No. 08

Agreement among undergraduate and graduate veterinary students and veterinary anesthesiologists on pain assessment in cats and dogs: A preliminary study

Comparative efficacy of intranasal and injectable vaccines in stimulating Bordetella bronchiseptica-reactive anamnestic antibody responses in household dogs

Blood lactate concentration in diabetic dogs

Response to acupuncture treatment in horses with chronic laminitis

Flock-level prevalence, geographical distribution, and seasonal variation of avian reovirus among broiler flocks in Ontario

Use of skin stretching techniques before bilateral caudal superficial epigastric axial flaps in a dog with severe burns

Meningeal dissemination of a pituitary carcinoma to the cauda equina in a dog

Cecal entrapment within the epiploic foramen in a mare

Outcome of prolonged acute vena cava occlusion after iatrogenic transection and repair in a dog

Intranasal mast cell tumor in the dog: A case series

Spontaneous resorption of a herniated cervical disc in a dog detected by magnetic resonance imaging FOR PERSONAL USE ONLY CVMA INSURANCE PROGRAM

INSURANCE TAILORED FOR THE VETERINARY INDUSTRY

PROFESSIONAL LIABILITY EMPLOYEE BENEFITS COMMERCIAL INSURANCE

Available exclusively to members of the Canadian Veterinary Medical Association, the CVMA Insurance Program offers the most comprehensive and cost-effective insurance protection for you, your practice and your employees.

Join now and save 10% on your Commercial Insurance or Employee Benefits!

866-860-CVMA (2862) www.cvmainsurance.com FOR PERSONAL USE ONLY

IMPROVES SIGNS OF COGNITIVE DYSFUNCTION SYNDROME

You can’t stop a dog from aging—but if your patient is showing signs of Cognitive Dysfunction Syndrome, there’s a new way to help. Introducing Purina® Pro Plan Veterinary Diets® NC NeuroCareTM, enhanced with a unique blend of nutrients and medium chain triglyceride oil to help nutritionally manage dogs with CDS. In a clinical study, dogs with CDS were fed a test diet containing a unique blend of nutrients and MCT oil; after 90 days, dogs signiﬁcantly improved across all DISHAA categories (a tool for assessing CDS behaviour).

To learn more about NC NeuroCare TM and DISHAA, visit www.ProPlanVeterinaryDiets.ca

Purina trademarks are owned by Société des Produits Nestlé S.A.

PPPVD NC NeuroCare CDS Print Ad CVJ EN FINAL.indd 1 2017-07-10 1:00 PM ID_79243_PC_Ads_DOG_CVJ_EN.pdf 1 2016-12-12 11:54 AM

FOR PERSONAL USE ONLY

KNOWING MAKES ALL THE Speak to your consultant about DIFFERENCE PREVENTIVE CARE An early diagnosis could save my life. STAFF TRAINING

CMY

You can be the dierence between “I wish we could have done something” and “I’m so glad we caught this soon enough...” Visit IDEXX.ca/preventivecare to learn more

IN-HOUSE DIAGNOSTICS  DIGITAL IMAGING AND TELEMEDICINE  REFERENCE LABORATORIES  CLIENT AND PRACTICE MANAGEMENT

© 2017 IDEXX Laboratories, Inc. All rights reserved. • 108679-00 All ®/TM marks are owned by IDEXX Laboratories, Inc. or its aliates in the United States and/or other countries. The IDEXX Privacy Policy is available at idexx.ca.

FINAL AR TWORK MATERIAL STATUS: NEW | The above approval is for artwork and colour separation only and may not accurately reflect actual production colours. FOR PERSONAL USE ONLY

AUGUST/AOÛT 2017 Contents Table des matières

SCIENTIFIC RUBRIQUE SCIENTIFIQUE

ARTICLES CASE REPORTS 805 Agreement among undergraduate and RAPPORTS DE CAS graduate veterinary students and veterinary 835 Use of skin stretching techniques before anesthesiologists on pain assessment in bilateral caudal superficial epigastric axial cats and dogs: A preliminary study flaps in a dog with severe burns Graeme M. Doodnaught, Javier Benito, Michelle M. Zingel, Sherisse A. Sakals Beatriz P. Monteiro, Guy Beauchamp, Stefania C. Grasso, Paulo V. Steagall 839 Meningeal dissemination of a pituitary carcinoma to the cauda equina in a dog 809 Comparative efficacy of intranasal and Nora K. Sheehan, Helena Rylander, injectable vaccines in stimulating Bordetella Neil Christensen, Laura A. Nafe bronchiseptica-reactive anamnestic antibody responses in household dogs 842 Cecal entrapment within the epiploic foramen in a mare John A. Ellis, Sheryl P. Gow, Lindsey B. Lee, Stacey Lacoste, Eileen C. Ball Remigiusz M. Grzeskowiak, Elizabeth J. Barrett, Dwayne H. Rodgerson 817 Blood lactate concentration in diabetic dogs 845 Outcome of prolonged acute vena cava Poliana Claus, André M. Gimenes, Jacqueline R. Castro, Matheus M. Mantovani, occlusion after iatrogenic transection Khadine K. Kanayama, Denise M.N. Simões, and repair in a dog Denise S. Schwartz Marie-Chantal Halwagi, Evan Crawford, Katie Hoddinott, Michelle L. Oblak 823 Response to acupuncture treatment in horses with chronic laminitis 851 Intranasal mast cell tumor in the dog: Babak Faramarzi, Dongbin Lee, Kevin May, A case series Fanglong Dong Alison Khoo, Amy Lane, Ken Wyatt 828 Flock-level prevalence, geographical 855 Spontaneous resorption of a herniated distribution, and seasonal variation of avian cervical disc in a dog detected by magnetic reovirus among broiler flocks in Ontario resonance imaging Eric G. Nham, David L. Pearl, Durda Slavic, Francesca Raimondi, Beatriz Moreno-Aguado, Rachel Ouckama, Davor Ojkic, Michele T. Guerin Phil Witte, Nadia Shihab

785 QUIZ CORNER TEST ÉCLAIR

CVJ / VOL 58 / AUGUST 2017 771 FOR PERSONAL USE ONLY

BECAUSE CATS DESERVE UP TO 12 EXTRAORDINARY WEEKS* OF PROTECTION, TOO

INTRODUCING BRAVECTO® TOPICAL SOLUTION FOR CATS

Now, you can extend the fast, persistent efficacy ofBRAVECTO ® to your feline patients, with BRAVECTO® Topical Solution for Cats. NEW! Easy-to-administer topical solution Help take fleas and ticks out of the picture with the first and FOR CATS only topical solution for cats that kills BOTH fleas (for 12 weeks*) and ticks (for 8 weeks*) ...which is nothing short of extraordinary!

* BRAVECTO® topical solution for cats is indicated for the treatment and prevention of flea infestations (Ctenocephalides felis) for 12 weeks, and for the treatment and control of tick infestations (Dermacentor variabilis and Ixodes scapularis) for 8 weeks. BRAVECTO® is a registered trademark of Intervet International B.V. Used under license. EXPECT THE EXTRAORDINARYTM is a trademark of Intervet International B.V. Used under license. MERCK® is a registered trademark of Merck Canada Inc. © 2017 Intervet Canada Corp. All rights reserved. CA/BRV/0616/0090

Bravecto Cat ad EN CVJ.indd 1 2017-03-27 1:38 PM FOR PERSONAL USE ONLY

AUGUST/AOÛT 2017 Contents Table des matières

FEATURES RUBRIQUES SPÉCIALES

EDITORIAL THE ART OF PRIVATE ÉDITORIAL VETERINARY PRACTICE 777 Brachycephalic dogs — time for action L’ART DE LA PRATIQUE Chiens brachycéphales — il est temps d’agir VÉTÉRINAIRE PRIVÉE Carlton Gyles 865 Communication: Touchy at-home treatment communication dilemmas 781 VETERINARY MEDICAL ETHICS Myrna Milani DÉONTOLOGIE VÉTÉRINAIRE BOOK REVIEWS CROSS-CANADA DISEASE REPORT COMPTE RENDU DE LIVRES RAPPORT DES MALADIES 858 Canine & Feline Endocrinology, 4th edition DIAGNOSTIQUÉES AU CANADA Greg Parks 802 Canada: Serotyping of Haemophilus 860 Blackwell’s Five Minute Veterinary Consult: parasuis field isolates from diseased pigs Avian in Quebec by indirect hemagglutination Janeen Junaid assay and multiplex polymerase chain reaction (PCR) NOTICES ANNONCES Sonia Lacouture, Edisleidy Rodriguez, Katrin Strutzberg-Minder, Marcelo Gottschalk 816 New Products VETERINARY HISTORY Nouveaux produits HISTOIRE VÉTÉRINAIRE 864 Index of Advertisers 859 The eradication of bovine tuberculosis Index des annonceurs in Canada 868 Classifieds Hugh G. Whitney Petites annonces

VETERINARY WELLNESS BIEN-ÊTRE VÉTÉRINAIRE NEWS | NOUVELLES 861 Dimensions of wellness: Change your habits, change your life Debbie L. Stoewen 787 NEWS NOUVELLES WHAT CAN’T BE TAUGHT Heather Broughton, Isabelle Vallières CE QUI NE S’ENSEIGNE PAS 863 Establishing self-confidence through learned knowledge Sara Watt

Contributors

“Instructions for authors” are available online (www.canadianveterinarians.net). Les «Directives à l’intention des auteurs» sont disponibles en ligne (www.veterinairesaucanada.net).

CVJ / VOL 58 / AUGUST 2017 773 FOR PERSONAL USE ONLY

The Canadian Veterinary Journal Editorial policy: All published articles including editorials and letters reflect the La Revue vétérinaire canadienne opinions of the authors and do not necessarily reflect the opinion of the publisher. Publication of an advertisement does not necessarily imply that the publisher agrees 339 rue Booth Street with or supports the claims therein. Ottawa, Ontario K1R 7K1 Politique de la Rédaction : Tous les articles publiés, y compris les éditoriaux et les Telephone: (613) 236-1162 lettres, représentent l’opinion de l’auteur et non pas nécessairement la position de Fax: (613) 236-9681 l’éditeur. E-mail: [email protected] La publication d’une annonce ne signifie pas nécessairement que l’éditeur est d’accord Website/Site Web: www.canadianveterinarians.net avec son contenu ou qu’il l’appuie. www.veterinairesaucanada.net Editor-in-Chief/Rédacteur en chef © C anadian Veterinary Medical Association 2017 Carlton Gyles, Guelph, Ontario L’Association canadienne des médecins vétérinaires 2017 Associate Editors/Rédacteurs associés Bruce Grahn, Saskatoon, Saskatchewan The Canadian Veterinary Journal is indexed or abstracted in: Wayne McDonell, Guelph, Ontario La Revue vétérinaire canadienne est indexée ou ses articles sont Feature Editors/Rédacteurs des chroniques résumés dans : Jangi Bajwa, Burnaby, British Columbia AGRICOL, Biological Abstracts, Capsule Report, Current Contents — Agriculture, Bruce Grahn, Saskatoon, Saskatchewan Derwent Veterinary Drug File, EMBASE/Excerpta Medica, Myrna Milani, Charlestown, New Hampshire Index Veterinarius, Index Medicus, Quarterly Index, Science Citation Index, Small Debbie Stoewen, Ayr, Ontario Animal Practice, Veterinary Bulletin, Veterinary Reference Service, Veterinary Update. Tim Blackwell, Fergus, Ontario Assistant Editors/Rédacteurs adjoints Photo by/Photo de : Shutterstock Robert Friendship, Guelph, Ontario Greg Harasen, Regina, Saskatchewan Typesetting/Typographie Jacob Thundathil, Calgary, Alberta AN Design Communications Ron Johnson, Guelph, Ontario Richard Kennedy, Pincher Creek, Alberta Printed by/Imprimé par Shawn McKenna, Charlottetown, P.E.I. The Lowe-Martin Group Ottawa, Ontario Managing Editor/Directrice de la rédaction Heather Broughton, Ottawa, Ontario ISSN 0008-5286 Assistant Managing Editor/Directrice adjointe de la rédaction Stella Wheatley, Ottawa, Ontario Return undeliverable Canadian addresses to: Editorial Coordinator/Coordonnatrice de la rédaction 339 rue Booth Street Kelly Gray-Sabourin, Ottawa, Ontario Ottawa, Ontario K1R 7K1 e-mail: [email protected] Advertising Manager/Gérante de la publicité Laima Laffitte, Wendover, Ontario Subscriptions (2017). Annual: Canada $205 + applicable GST or HST; foreign $220 US; institutional $275. Express subscriptions available. Single issue/back issue: Published monthly by/ $25 each, institutional single issue = $50.00 + GST or HST, if applicable. (All prices Publication mensuelle de subject to change.) Missing issues will be replaced if the Subscriptions Office is Canadian Veterinary Medical Association notified within 6 months (for requests within Canada) and 1 year (for requests from abroad) of the issue date. The publisher expects to supply missing issues only when losses have been sustained in transit and when the reserve stock will permit. Telephone (613-236-1162) or (1-800-567-2862) and fax (613-236-9681) orders accepted with a valid Visa or MasterCard number. Please advise the publisher of address changes promptly. Abonnements (2017). Annuel : Canada 205 $ + TPS ou TVH en vigueur; pays étranger 220 $ É-U; prix d’une institution 275 $. Abonnement express disponible. Anciens numéros (chacun) : 25 $, ancien numéro d’institution 50 $ + TPS ou TVH en vigueur. Les prix sont sujets à changement sans préavis. Les numéros qui ne sont pas reçus seront remplacés si l’éditeur en est informée dans les 6 mois (pour les demandes venant du Canada) et 1 an (pour les demandes venant de l’étranger) suivant la date de parution. L’éditeur s’engage à remplacer les numéros manquants seulement lorsque les pertes ont été subies en transit et lorsque ses réserves le permettent. On peut payer son abonnement par téléphone (613-236-1162) ou (1-800-567-2862), par télécopieur (613-236-9681) ou par carte de crédit (Visa ou MasterCard). Veuillez aviser le bureau de l’éditeur de tout changement d’adresse.

774 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY

Your CVMA membership means MORE...

INFLUENCE KNOWLEDGE ADVANCING YOUR ISSUES, YOUR CONCERNS KEEPING YOU CURRENT ON VETERINARY SCIENCE AND YOUR PROFESSIONAL INTERESTS. AND PRACTICE, RESEARCH, INNOVATION AND The CVMA looks at policy matters in terms of their potential impact on TRENDS TO ENHANCE YOUR CAREER DEVELOPMENT the profession. Our role as an advocate for animal welfare and veterinary AND LIFELONG LEARNING. medicine at the national level influences your access to critical drugs, contributes to the development of responsible animal welfare policies, The CVMA provides you with the latest news, information, and clinical and mitigates decisions that could adversely affect your delivery of veterinary non-clinical continuing professional development. Our role as a knowledge care, and fosters a wider appreciation of the role of veterinarians in the provider enables you to broaden your knowledge and skills and maintain One Health concept. your competence to the highest professional standards.

As a CVMA member you benefit from… As a CVMA member you benefit from…

• Engagement with Government and key stakeholders to influence policy • The Canadian Veterinary Journal decisions • Canadian Journal of Veterinary Research • International relations to provide the Canadian veterinary perspective • Clinician’s Brief™ (free global digital edition) • Media and public relations to provide balanced and trustworthy information • CVMA national convention and to promote veterinary professionals • CVMA Veterinary Summit • Position statements on animal welfare and national veterinary issues • CVMA National Issues Forum • Codes of practice for Canadian kennel and cattery operations, and for the • CVMA Emerging Leaders Program care and handling of farm animals • CVMA Canadian Veterinary Reserve • Member consultations and online discussions on key veterinary issues • Member e-newsletter ‘Online from 339’ • Pan-Canadian Framework for Professional Standards in Veterinary Oversight of Antimicrobial Use • CVMA online continuing education portal • VetFolio® online educational resources (subscription discount)

RESOURCES SAVINGS SUPPORTING OUR MEMBERS THROUGH EVERY PUTTING MONEY IN YOUR POCKET AND DELIVERING STAGE OF THEIR CAREER WITH ACCESS TO A RANGE MORE VALUE TO INCREASE YOUR PROFITABILITY. OF EXCLUSIVE PRACTICE TOOLS AND RESOURCES. The CVMA provides members access to professional resources, veterinary The CVMA uses its national purchase power and strategic partnerships economic reports, practice management solutions, client education so that you can benefit from discount rates and money-saving services. resources, and exclusive online content to support you and your practice team in the effective delivery of veterinary services.

As a CVMA member you benefit from… As a CVMA member you benefit from…

• MyVetStore.caTM - CVMA web store solution for clinics • Hotel discounts worldwide • NEW! MonerisTM preferred payment processing rates • National and Enterprise Rent-a-Car discounts • NEW! CVMA Petcard Program - financing options for your clients • The Personal Insurance home and auto group savings • Practice owner’s economic survey • Scotiabank® business banking and lending solutions • Individual practice diagnostic and valuation report • The CVJ classified ads discount • Provincial suggested fee guide • Staples Advantage™ business products • Associate compensation and benefits report • Adtel® telephone hold service and digital signage • Compensation report for non-DVM staff • Petro-Canada SuperPass™ fuel/diesel/car wash discount • Compensation report for DVMs outside private practice • WSAVA World Congress (registration discount) • Practice management articles and resources • WVA Congress (registration discount) • CVMA group insurance program • Plumb’s Veterinary Drugs™ (subscription discount) • CVMA mentoring program • NEW! GoodLife Fitness Corporate Discount • VetLaw Online™ legal advice column • NEW! HRdownloads™ discounts • CVMA Green Veterinary Practice and self-audit tool • Antimicrobial SmartVet mobile app • Veterinarian health and wellness resources For information about the many benefits and privileges • Early career DVM web resource hub of membership. • Guidelines for the successful employment of new veterinary graduates • Sedative, anaesthetic and pain management protocols posters • Guidelines for the legitimate use of compounded drugs in veterinary practice CANADIAN VETERINARY MEDICAL ASSOCIATION • Antimicrobial prudent use guidelines for beef cattle, dairy cattle, poultry and 339 Booth Street, Ottawa (Ontario) K1R 7K1 swine T • (800) 567-2862 • (613) 236-1162 • Therapeutic decision cascade poster F • (613) 236-9681 • Animal abuse resources for practitioners faced with this issue [email protected] • Preventive healthcare, nutritional assessment and client education tools and canadianveterinarians.net resources • Animal health week annual public awareness campaign

05/2017 FOR PERSONAL USE ONLY

Treating otitis externa just got easier.

Breakthrough product, innovative dosing

• Two easy doses, one week apart • Smart gel formulation stays in the ear • Same dose for any dog, regardless of its size and weight • Single-dose tube with soft, exible tip is gentle on a dog’s ears • Easy application leads to better compliance

Ask your Elanco sales representative about Osurnia™ today.

OSU-005_Ad_ENG_8.125x10.875_Print.indd 1 2017-05-23 1:37 PM FOR PERSONAL USE ONLY Editorial Éditorial

Brachycephalic dogs — time for action Chiens brachycéphales — il est temps d’agir

little over 4 years ago, Fraser Hale, a veterinary dentist, l y a un peu plus de quatre ans, Fraser Hale, un dentiste A wrote an opinion piece in this journal entitled “Stop I vétérinaire, a rédigé un article d’opinion dans cette revue brachycephalism, now!” (1). The article focused on the dental qui s’intitulait «Stop brachycephalism, now!» (Mettons fin au problems encountered by brachycephalic dogs and argued that brachycéphalisme dès maintenant!) (1). L’article portait sur les breeding of these animals was a serious animal welfare issue that problèmes dentaires dont souffrent les chiens brachycéphales et needed to be addressed. The author anticipated that his article il faisait valoir que l’élevage de ces animaux constituait un sérieux would “stimulate some lively, possibly acrimonious response.” problème de bien-être animal qui devait être abordé. L’auteur That never happened. This journal received no comments about s’attendait à ce que son article «suscite une réponse animée et the article. potentiellement acrimonieuse», ce qui ne s’est jamais produit, car Three developments made me decide to write on this topic. cette revue n’a jamais reçu de commentaires à propos de l’article. One was information that brachycephalic breeds are gaining Trois faits nouveaux m’ont décidé à écrire sur ce sujet. popularity as pets (2,3). Another was a report that in response to Le premier était des informations indiquant que les races calls from veterinarians and members of the public, the British brachycéphales gagnent en popularité en tant qu’animaux de Veterinary Association (BVA) had recently adopted a strong compagnie (2,3). Un autre était un rapport à l’effet que la British position on the breeding of dogs with extreme conformation Veterinary Association (BVA), en réponse à des appels lancés par (2). The 3rd was a recent US report on the numerous health des vétérinaires et des membres du public, avait récemment adopté issues of brachycephalic dogs (3). une position s’opposant fermement à l’élevage de chiens avec une Several writers have discussed the health problems of brachy- conformation extrême (2). Le troisième était un rapport récent cephalic dogs. The dental problems and constant respiratory dis- des États-Unis sur les nombreux problèmes de santé des chiens tress associated with these breeds are probably the best known. brachycéphales (3). A recent analysis of disease prevalence in over 1.27 million dogs Plusieurs auteurs ont discuté des problèmes de santé des over 9 years (based on pet health insurance claims) identified chiens brachycéphales. Les problèmes dentaires et la détresse several other conditions that occurred at exceptional frequency respiratoire constante associés à ces races sont probablement les in brachycephalic breeds (3). The study did not involve the mieux connus. Une analyse récente de la prévalence des maladies conditions well known to be a part of the Brachycephalic chez plus de 1,27 million de chiens sur une période de neuf ans Obstructive Airway Syndrome (BOAS) (stenotic nares, elon- (basée sur les réclamations d’assurance maladie pour animaux de gated soft palate, tracheal hypoplasia, everted laryngeal saccules). compagnie) a identifié plusieurs autres affections qui s’étaient The aim of the analysis was to determine whether brachyce- produites à une fréquence exceptionnelle (3). L’étude ne portait phalic dogs had health issues other than those of BOAS. pas sur les affections qui sont reconnues comme faisant partie The protruding eyes of brachycephalic dogs were found to du syndrome brachycéphale d’obstruction des voies respiratoires cause a higher prevalence of ocular disease than in other breeds: (narines pincées, palais mou allongé, hypoplasie trachéale, sacs corneal ulcers were 3 to 4 times more frequent in brachycephalic laryngés évasés). Le but de l’analyse consistait à déterminer si les dogs and there was a significant increase in the prevalence of chiens brachycéphales avaient des problèmes de santé autres que conjunctivitis and corneal trauma (3). Excessive skin folds in le syndrome brachycéphale.

Use of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere. L’usage du présent article se limite à un seul exemplaire pour étude personnelle. Les personnes intéressées à se procurer des réimpressions devraient communiquer avec le bureau de l’ACMV ([email protected]) pour obtenir des exemplaires additionnels ou la permission d’utiliser cet article ailleurs.

CVJ / VOL 58 / AUGUST 2017 777 FOR PERSONAL USE ONLY SAV E THE DATE July 5 - 8, 2018 CVMA CONVENTION Vancouver, BritisH Columbia

canadianveterinarians.net FOR PERSONAL USE ONLY some brachycephalic breeds resulted in increased rates of skin On a constaté que les yeux protubérants des chiens disease. Other conditions that were found at higher frequency brachycéphales causaient une prévalence supérieure de maladie include heat intolerance, digestive disorders, urinary tract oculaire par rapport aux autres races : les ulcères cornéens étaient infection, dental disease, pneumonia, and intervertebral disk de 3 ou 4 fois plus fréquents chez les chiens brachycéphales et il disease (3). y avait une hausse importante de la prévalence de la conjonctivite The question of the increasing popularity of brachycephalic et des traumatismes cornéens (3). Des lambeaux de peau excessifs breeds in spite of their heightened health risk bears looking chez certaines races brachycéphales se sont traduits par des EDITORIAL into. It is suggested that these dogs are considered “cute” and taux accrus de maladies de la peau. D’autres affections ont été several prominent celebrities own such dogs. At the same time, observées à une fréquence supérieure, dont l’intolérance à la veterinarians, with few exceptions (1,2) have not been speaking chaleur, les troubles digestifs, les infections des voies urinaires, out about the welfare issues (many of the dogs are in constant les maladies dentaires, la pneumonie et les maladies des disques respiratory distress and have to contend with the wide array of intervertébraux (3). problems inflicted on them by their breeding). A British veteri- La question de la popularité grandissante des races narian recently wrote about the problems with brachycephalic brachycéphales malgré leurs risques de santé accrus mérite d’être dogs and the reasons veterinarians seem to be unwilling to étudiée. On suggère que ces chiens sont considérés comme étant discuss the issue (4). He/she argued that veterinarians are con- «mignons» et plusieurs célébrités en vue possèdent de tels chiens. cerned that speaking up on this topic is likely to result in a loss Parallèlement, les vétérinaires, à quelques exceptions près (1,2), ne of clients. In fact, the author would not identify him- or herself se sont pas prononcés contre les enjeux de bien-être (beaucoup des and wrote anonymously. Given this concern, it is important that chiens souffrent d’une détresse respiratoire constante et doivent professional veterinary organizations take up the challenge of vivre avec un vaste éventail de problèmes qui leur sont infligés en seeing what can be done. raison de leur élevage). Un vétérinaire britannique a récemment The BVA recognizes the need for the profession to play a écrit à propos des problèmes des chiens brachycéphales et des leading role and to involve all stakeholders including veterinar- raisons pour lesquelles les vétérinaires ne semblent pas disposés à ians, dog breeders, kennel clubs, and prospective dog owners. discuter de la question (4). Il/elle a fait valoir que les vétérinaires The BVA and the British Small Animal Veterinary Association s’inquiètent probablement du fait qu’ils pourraient perdre des (BSAVA) both recommend against the use for breeding of ani- clients s’ils abordent le sujet. En fait, l’auteur ne voulait pas mals with extreme conformation that negatively impacts their s’identifier et a écrit sous le couvert de l’anonymat. Compte tenu welfare and health (2). The BVA is also suggesting revision of de cette préoccupation, il est important que les organisations breed standards to place limits on features such as shortness of vétérinaires professionnelles relèvent le défi d’envisager les mesures the muzzle, and to investigate approaches such as outcrossing éventuelles à prendre. in order to relieve the unnecessary suffering of dogs such as the La BVA reconnaît le besoin pour la profession de jouer un English bulldog. rôle de premier plan et d’inviter la participation de tous les The CVMA’s Position Statement on dog breeding is that intervenants, y compris les vétérinaires, les éleveurs de chiens, “The CVMA opposes the selective breeding of dogs resulting les clubs canins et les futurs propriétaires de chiens. La BVA in changes in body form, function or temperament that are det- et la British Small Animal Veterinary Association (BSAVA) rimental to the health and quality of life of the dog.” Recently, déconseillent tous deux le recours à l’élevage d’animaux avec une the American Veterinary Medical Association (AVMA) adopted conformation extrême qui affecte négativement leur bien-être et a similar position (5). These are sound positions and a good leur santé (2). La BVA suggère aussi la révision des standards des base for action involving education of the public and working races afin d’établir des limites pour les caractéristiques comme un with breeders, kennel clubs, and humane societies to address the museau court et d’examiner des approches comme l’accouplement health and welfare concerns. croisé afin de soulager les souffrances inutiles des chiens comme Interestingly, the AVMA’s Animal Welfare Committee had le bouledogue anglais. recommended that companion animals with inherited features L’énoncé de position de l’ACMV sur l’élevage des chiens stipule that adversely affect their welfare and health should not be bred que : «L’ACMV s’oppose à l’accouplement sélectif des chiens pour and had included brachycephalic syndrome among a number produire des changements au niveau du corps, de la fonction of inherited conditions in this category. This was opposed by a ou du tempérament qui sont néfastes pour la santé et la qualité number of breed organizations, leading to a final statement in de vie du chien». Récemment, l’American Veterinary Medical which the mention of specific conditions was omitted. Association (AVMA) a adopté un énoncé de position semblable The public needs to be educated about these dogs, which are (5). Il s’agit d’énoncés de position équilibrés et d’un bon point doomed to a lifetime of poor health and suffering. Veterinarians de départ pour des activités axées sur la sensibilisation du public can be enormously helpful in advising prospective owners to do et le travail avec les éleveurs, les clubs canins et les sociétés de pre-purchase research and to consider the welfare issues associ- protection des animaux afin d’aborder les préoccupations en ated with brachycephalic dogs. Veterinary professional organiza- matière de santé et de bien-être. tions in Canada and the US can follow the British lead and take Fait intéressant, le Comité sur le bien-être animal de l’AVMA an active role in finding solutions to the problem. avait recommandé que les animaux de compagnie ayant des caractéristiques héréditaires qui affectent négativement leur bien- Carlton Gyles être et leur santé ne devraient pas être accouplés et il avait inclus

CVJ / VOL 58 / AUGUST 2017 779 FOR PERSONAL USE ONLY

References 1. Hale F. Stop brachycephalism, now! Can Vet J 2013;54:185–186. 2. Wedderburn P. Urgent call by vet profession to stop suffering of brachycephalic dogs and cats. May 9, 2016. Available from: https://vethelpdirect. com/vetblog/2016/05/09/vets-to-end-suffering-of-brachycephalic-dogs/# Last accessed June 12, 2017. 3. Feng T, McConnell C, O’Hara K, Chai J, Spadafori G. Nationwide’s brachycephalic breed disease prevalence study. March 2017. Available from: http://nationwidedvm.com/wp-content/uploads/2017/03/ NWBrachycelphalicStudy0317.pdf Last accessed June 1, 2017. 4. Anonymous. Pugs are anatomical disasters. Vets must speak out — even if it’s bad for business. The Guardian. Available from: https://www. theguardian.com/commentisfree/2016/sep/22/pugs-anatomical-disasters- vets-must-speak-out-even-bad-business Last accessed June 1, 2017. 5. Burns K. JAVMA News, March 01, 2017. AVMA passes policy on responsible pet breeding. Available from: https://www.avma.org/News/ JAVMANews/Pages/170301c.aspx Last accessed June 8, 2017. ■

spécifiquement le syndrome brachycéphale parmi les affections héréditaires dans cette catégorie. Plusieurs organisations d’élevage s’étaient opposées à cette prise de position, ce qui avait donné lieu à la publication d’une version finale de l’énoncé où l’on omettait la mention d’affections spécifiques. Le public doit être sensibilisé à propos de ces chiens, qui sont condamnés à une vie en mauvaise santé et affligée de souffrances. Les vétérinaires peuvent être d’un secours immense pour conseiller aux futurs propriétaires d’effectuer une recherche avant l’achat et de considérer les enjeux de bien-être associés aux chiens brachycéphales. Les organisations professionnelles vétérinaires au Canada et aux États-Unis peuvent suivre l’exemple WHEN IT COMES TO SAFETY, des Britanniques et jouer un rôle actif pour trouver des solutions EE EY 1,2 WWEE SSEE EYE TO EYE au problème. ven ocu vers pro e g ox® deli rumcov Carlton Gyles Veraﬂaﬂ ox® deliversad-sp eprovenct ocular safety andand bbroad-spectrumro coverage Renvois y to aneas 1. HALE, F. «Stop brachycephalism, now!», Can Vet J, 2013, vol. 54, in an easy-to-use oral suspension. p. 185–186. 2. WEDDERBURN, P. Urgent call by vet profession to stop suffering of brachycephalic dogs and cats. Le 9 mai 2016. Disponible au : https:// vethelpdirect.com/vetblog/2016/05/09/vets-to-end-suffering-of- brachycephalic-dogs/# Dernière consultation le 12 juin 2017. 3. FENG, T., C. McCONNELL, K. O’HARA, J. CHAI et G. SPADAFORI. Nationwide’s brachycephalic breed disease prevalence study. Mars 2017. Disponible au : http://nationwidedvm.com/wp-content/uploads/2017/03/ NWBrachycelphalicStudy0317.pdf Dernière consultation le 1er juin 2017. 4. ANONYME. «Pugs are anatomical disasters. Vets must speak out — even if it’s bad for business», The Guardian. Disponible au : https://www. theguardian.com/commentisfree/2016/sep/22/pugs-anatomical-disasters- vets-must-speak-out-even-bad-business Dernière consultation le 1er juin 2017. 5. BURNS, K. JAVMA News, le 1er mars 2017. «AVMA passes policy on responsible pet breeding». Disponible au : https://www.avma.org/News/ LEAVE SECOND GUESSES BEHIND. JAVMANews/Pages/170301c.aspx Dernière consultation le 8 juin 2017. ■ Choose Vera ox® for feline skin infections, wounds and abscesses.

Contact your Bayer representative or email [email protected] for more information.

1Freedom of Information Summary, 2012. NADA: 141-344. 2Messias A, Gekeler F, Wegener A, et al. (2008). Retinal safety of a new uoroquinolone, prado oxacin, in cats: assessment with electroretinography. Doc Ophthalmol. 116(3):177-191.

977143_Canadian Vet Jrnl_August_Half Page Vertical Ad_4x10.875_v2 2.indd 1 5/12/17 11:33 AM FOR PERSONAL USE ONLY Veterinary Medical Ethics Déontologie vétérinaire

Ethical question of the month — August 2017 Veterinarians work at provincial sales barns in Ontario to oversee animal health. One of their responsibilities is to euthanize animals that are deemed unfit for sale. A large proportion of cattle to be euthanized at sales barns are cull cows in transit to slaughter that are deemed unfit for transport. Veterinarians, livestock caretakers, and the general public understand the rationale for these cases of humane euthanasia. Young bull calves are another class of livestock that come to sales barns and are euthanized by veterinarians. These calves are intended to be sold to local veal or beef producers. However, if calves appear sick on sale day they are left unsold. At the end of the sale day the sales barn veterinarian is asked to euthanize them. These calves have a reasonable chance of responding to treatment if given time and nursing care. However sales barns are not designed for this purpose and owners don’t want calves returned to the farm. The same veterinarian who euthanizes cull cows in good conscience is reluctant to euthanize calves he/ she believes have a good chance for recovery. Is there an ethically sound basis for such a distinction? Submitted by Ann Godkin, Elora, Ontario. Question de déontologie du mois — Août 2017 Des médecins vétérinaires travaillent dans les enchères de bestiaux provinciales en Ontario afin de superviser la santé animale. L’une de leurs responsabilités consiste à euthanasier les animaux qui sont jugés impropres à la vente. Une grande proportion du bétail à euthanasier dans les enchères de bestiaux se compose de vaches de réforme en transit vers l’abattoir qui sont jugées inaptes au transport. Les vétérinaires, les préposés au bétail et le grand public comprennent la justification de ces cas d’euthanasie sans cruauté. Les jeunes taureaux sont une autre catégorie de bestiaux qui viennent dans les enchères et sont euthanasiés par les vétérinaires. Ces veaux sont destinés à la vente à des producteurs de veaux ou de bovins de boucherie locaux. Cependant, si les veaux semblent malades le jour de la vente, ils demeurent invendus. À la fin de la journée des enchères, on demande au vétérinaire présent de les euthanasier. Ces veaux ont une chance raisonnable de répondre au traitement si on leur en donne le temps et qu’on leur prodigue des soins. Cependant, les enchères de bestiaux ne sont pas conçues à cette fin et les propriétaires ne veulent pas que les veaux retournent à la ferme. Le même vétérinaire qui euthanasie les vaches de réforme est réticent à euthanasier des veaux qui, selon son opinion, ont de bonnes chances de se rétablir. Existe-t-il des fondements éthiques pour une telle distinction? Soumise par Ann Godkin, Elora (Ontario).

Responses to the case presented are welcome. Please limit your Les réponses au cas présenté sont les bienvenues. Veuillez reply to approximately 50 words and forward along with your limiter votre réponse à environ 50 mots et nous la faire parvenir name and address to: Ethical Choices, c/o Dr. Tim Blackwell, par la poste avec vos nom et adresse à l’adresse suivante : 6486 E. Garafraxa, Townline, Belwood, Ontario N0B 1J0; Choix déontologiques, a/s du Dr Tim Blackwell, 6486, telephone: (519) 846-3413; fax: (519) 846-8178; e-mail: E. Garafraxa, Townline, Belwood (Ontario) N0B 1J0; [email protected] téléphone : (519) 846-3413; télécopieur : (519) 846-8178; Suggested ethical questions of the month are also welcome! All courriel : [email protected] ethical questions or scenarios in the ethics column are based Les propositions de questions déontologiques sont toujours on actual events, which are changed, including names, loca- bienvenues! Toutes les questions et situations présentées dans tions, species, etc., to protect the confidentiality of the parties cette chronique s’inspirent d’événements réels dont nous involved. modifions certains éléments, comme les noms, les endroits ou les espèces, pour protéger l’anonymat des personnes en cause.

CVJ / VOL 58 / AUGUST 2017 781 FOR PERSONAL USE ONLY

Ethical question of the month — May 2017 The use of animals for testing new pharmaceutical products that may prove effective in the treatment or prevention of serious human diseases is considered acceptable by a large proportion of Canadians, as well as citizens of many other countries. This is in contrast to the use of animals for testing the safety of cosmetics. Testing of cosmetics in animals is banned in all 27 countries in the European Union but is still performed in Canada. Is there an ethical basis for the continued testing of beauty products on animals in Canada? Can a veterinarian in good conscience work in laboratories performing this type of testing? Question de déontologie du mois — Mai 2017 L’utilisation des animaux pour les essais de nouveaux produits pharmaceutiques qui pourraient s’avérer efficaces dans le traitement ou la prévention des maladies humaines graves est considérée acceptable par une grande proportion de Canadiens ainsi que par les citoyens de beaucoup d’autres pays. Cette situation contraste avec DÉONTOLOGIEVÉTÉRINAIRE l’utilisation des animaux pour des tests d’innocuité des cosmétiques. Les tests de cosmétiques sur les animaux sont interdits dans les 27 pays de l’Union européenne, mais ils sont toujours réalisés au Canada. Existe-t-il des fondements éthiques pour poursuivre les tests des produits de beauté sur les animaux au Canada? Un médecin vétérinaire peut-il travailler en toute conscience dans des laboratoires qui effectuent ce type de tests?

Is it ethical to work in an animal-based cosmetic toxicology facility? — A comment The question implies a dichotomy between the necessary and necessity of testing human medications on animal models, with inevitable on one hand (testing of medications), and the “elec- the goal of finding better models and methods. tive” or frivolous (testing of cosmetics) on the other. Rather than condemning the latter and leaving it at that, veterinarians and Veronica Gventsadze, MA, PhD, DVM scientists in general would benefit from questioning the accepted

An ethicist’s commentary on if it is ethical to work in an animal-based cosmetic toxicology facility Science is inherently conservative and, in many cases, rightly chronic toxicity. However, such “well-established” tests were in so. An excellent case in which conservatism was warranted was fact the legal requirements for protecting corporate interests the infamous instance of two scientists allegedly achieving cold from lawsuits. fusion. Their experiments were not replicable, and the research Interestingly, there is no legal requirement in the United community was wise to be prudently skeptical. On the other States that cosmetics be tested on animals. The US Food and hand, conservatism can turn into obdurate dogmatism. A para- Drug Administration (FDA) advises cosmetics manufacturers digmatic example of this latter situation can be found in the “to employ whatever testing is appropriate and effective for case of ulcers, where conventional wisdom affirmed that ulcers substantiating the safety of their products,” and notes that the were caused by excessive stomach acid engendered by stress. One Federal Food, Drug, and Cosmetic Act “does not specifically researcher amassed considerable evidence that ulcers were caused require the use of animals in testing cosmetics for safety.” There by Helicobacter pylori. His results were ignored for many years, is a massive amount of data showing that in vitro methods of but eventually he was vindicated and awarded the Nobel Prize. testing are far more reliable than traditional blunt instruments Probably as a result of its close connection with legal liabil- of animal testing. As a result of such data, 27 European coun- ity for corporations producing beauty products, toxicology in tries in the European Union, as well as Israel and India have this area has been extremely conservative. Apparently, in order banned cosmetic testing on animals. Nonetheless, as the case to protect themselves, companies need to perform tests that presentation indicates, antiquated animal-based methods are are traditionally performed, but may not necessarily work. In still employed, even though many companies have made their fact, when I gave the keynote address to the annual meeting of commitment to not testing on animals a mainstay of their mar- toxicological pathologists, this was a common complaint that I keting. As early as the late 1970’s, readers of Glamour magazine, heard from them. Tests such as the Draize test, which involves surely a readership very concerned about cosmetics, indicated placing cosmetics in a rabbit’s eye and scoring the resultant in a survey their belief that animal suffering was too big a price lesion, are still being performed, despite the radical disanalo- to pay for new cosmetics! gies that obtain between the rabbit’s eye and the human eye. During the 1980’s, a colleague of mine gave me a very

Similarly, the LD50 test, which is known to be a test for acute dramatic example of reactionary scientism in this area. In toxicity, has historically been the test of choice for chronic toxic- keeping with the principle of the 3R’s (i.e., replacement, reduc- ity, despite the fact that the test does not designate mechanisms tion, and refinement), he had developed a method of testing of toxicity, and that acute toxicity tells us virtually nothing about for heavy metal toxicity by using Planaria (flatworms), rather

782 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY than m ammals. This allowed him to do thousands of tests on his desktop, saving countless animal lives and suffering, and a great deal of money, with comparable accuracy. The toxicological community rejected his work on the grounds that they didn’t Emerging tapeworm use flatworms; whereas mainstream journals rejected it on the grounds that they had no interest in toxicology! infecting dogs and Returning to the major question of this case, namely whether a veterinarian can in good conscience continue to work in foxes can also prove laboratories utilizing animal testing for cosmetics — this is not a simple question. The answer lies in his or her reasoning for fatal in humans. continuing to work there. If, he or she believes that they can change accepted practice, that is good reason to continue to Tapeworm disease in dogs is not a new story, but there is a new species that is an emerging threat to pets and people. work there. If however, they believe that they are not making any headway, it would be extremely difficult for a morally con- Echinococcus multilocularis is a tapeworm that lives in the small intestine of foxes, scientious person to stay in that job, as one is directly colluding coyotes, wolves and dogs (definitive hosts) and infects domestic dogs (accidental in causing animal suffering for no good purpose, and putting hosts) via ingestion of small rodents (intermediate hosts). Infected dogs shed consumers at greater risk by utilizing archaic methods. tapeworm eggs into the environment and are immediately infectious to people and animals. Unintentional ingestion of eggs by humans can develop into alveolar echinococcosis Bernard E. Rollin, PhD (AE) and cause parasitic tumors in the liver, lungs, brain and other organs.1 These cysts grow slowly and may not produce clinical signs in humans for up to 15 years. AE in humans has only a 5% cure rate.2 Left untreated, it is usually fatal.3

Human liver infected with alveolar echinococcosis

E. multilocularisBayer in Canada · Drontal · Brands + additives examples June 2012 The number of people infected by E. multilocularis in Canada is unknown since the disease does not currently have to be reported to Public Health by physicians. However, at least 12 human cases of AE have been identified since 2001. Many more may be currently infected but not yet showing symptoms.1 As Brand additives DE: Hund, Katze E. multilocularis becomes a greater public health concern, it is more important EN: Puppy, Dog, Cat than ever to discuss this health risk with pet owners. Intestinal infection with FR: Chiot, Chien, Chat DDronronttalal DDronronttalal DDronronttalal DDronronttalal DDronronttalal IT: Cucciolo, Cane, Gatto E. multilocularis in dogs can be treated with dewormers containing praziquantel, Cat Cat XL Chat Gatos ES: Cachorro, Perro, Gato such as Drontal® Plus. If the dog is currently being23 treated0/ with20 Advantage mg Multi®, PT/BR: Filhote, Cão, Gato Droncit® will add tapeworm control to your treatment plan. Droncit® and now DE: Fleischaroma EN: Flavour Drontal® Plus are both approved to treat and control E. multilocularis in dogs. FR: Arôme Boeuf IT: Sapore Carne For more information, contact your Bayer Sales Representative, ES: Sabor Carne PT/BR: Sabor Carne call 1-888-663-5326, or visit AnimalHealth.Bayer.ca.DDronron ccitit DDronronccitit DDronronccitit Like us on Facebook: /Bayer4vets Spot-on 50 mg 9 % 1Massolo A, Liccioli S, Budke C, et al. (2014). Echinococcus multilocularis in North America: the great unknown. Parasite. 21:73. 2 Kern P, Bardonnet K, Renner E, et al. (2003). European echinococcosis registry: human alveolar echinococcosis, Europe, 1982-2000. Emerg Infect Dis. 9(3):343-349. 3 Parasites – Echinococcosis: General Information. Centers for Disease Control and Prevention website. Available at: http://www.cdc.gov/parasites/ DDronronttalal DDronronttalal DDronronttalal DDronronttalal DDronronttalal DDronronttalal DDronronttalal echinococcosis/index.html. Accessed March 16, 2017. Plus Plus Plus XL Plus XL Large Dog Large Dog Comp. vet. tabl. ©2017 Bayer Inc., Mississauga, Ontario L4W 5R6,flavour Canada flavour flavour töflur ® TM see bayer.ca/tm-mc DDronronttalal P DDronronttalal P Chien Chien Arôme boeuf WWelelppanan DDronronsstoptop DDronronttalal DDronronttalal DDronronttalal Chiot Chiot Puppy Pup FOR PERSONAL USE ONLY 2017 CanWest VETERINARY CONFERENCE OCTOBER 14-17, 2017 | FAIRMONT BANFF SPRINGS HOTEL

PROGRAM AAAHT PRE-CONFERENCE CE EVENT • Equine Ophthalmology: “You see • Growing Leaders in Your Practice • Nutrition Myths: Five Common what you know” – Dr. Dennis Brooks, – Dr. Wendy Hauser, Peak Veterinary Myths and the Truth Behind Them University of Florida, College of Consulting – Ms. Ann Wortinger, Veterinary Veterinary Medicine Technology Program, Wayne State VETERINARY TECHNOLOGIST University FOOD ANIMAL • Compassionate Closure: End-of-Life • No Feet, No Cow! Identifying and Issues for Veterinary Professionals COMPANION ANIMAL Managing Common Foot Ailments – Dr. Cherie Buisson, Helping Hands • Fire Fast, Hire Slow: How to in Cattle and Calf Diarrhea - Worst Hospice/A Happy Vet Source, Screen and Retain – Dr. Odie Case Scenario – Dr. Frank Welker, • Predator Attacks on Wildlife Marcovici, Recruiting & Professional Ohio State University – Department of – Mr. Mike Ewald, Regional Problem Relations Director, VCA Veterinary Preventive Medicine Wildlife Specialist, Fish and Wildlife • All You Need to Know about • Pharmacology: Enforcement Branch Toxicology in your Canine and » NSAIDS in Food Animals, • Diabetes Mellitus – Let’s Not Sugar Feline Pets – Dr. Justine Lee, VETgirl Dr. Merle Olson, Alberta Coat It!; Fanconi Syndrome; and • Mast Cell Tumors: The Latest and Veterinary Laboratories Pancreatitis – Ms. Rachel Poulin, Greatest; Top 10 Recent Advances » Mucosal Immune System Coral Springs Animal Hospital – in Veterinary Oncology; Lymphoma Development in Food Animal Department of Internal Medicine – How Do I treat?; Feline Calves, Dr. Phil Griebel, Interactive Oncology Cases – VIDO – InterVac, Vaccine and KEYNOTE LUNCHEON Dr. Philip Bergman, Director of Clinical Infectious Disease Organization • Public Views of Animal Treatments: Studies, VCA – International Vaccine Centre, Misplaced or Realistic Concerns? • Which Antibiotic, When and University of Saskatchewan – Dr. Ellen Goddard, University of For How Long? – Dr. Jane Sykes, » Antibiotic Resistance and Alberta, Faculty of Agricultural, Life Professor Medicine & Epidemiology, Stewardship in Food Animals, and Environmental Sciences UC Davis – Veterinary Medicine Dr. Brian Lubbers, Kansas State University ABVMA/UCVM WET LABS EQUINE • Response to Animal Health FRIDAY, OCTOBER 13 • In the field, practical medicine with Outbreaks Referred to the UCVM (INSTRUCTED BY UCVM FACILITY) UCVM faculty: – Dr. Eugene Janzen, University • Reconstructive Surgery Techniques » Infectious Diseases of Calgary, Faculty of Veterinary (half-day lab), Dr. Aylin Atilla – Dr. Jean-Yin Tan Medicine • Clinical Pathology: Urinalysis and » Laminitis and Colic • Newborn Beef Calf Health Urine Sediment Examinations (half-day – Dr. Heidi Banse Management – Dr. Elizabeth lab), Drs. Cathy Wagg and Amy Warren » How to do Blood Transfusions in Homerosky, Veterinary Agri-Health • Introductory Abdominal Ultrasound the Field – Dr. Ashley Whitelaw Services (full-day lab), Drs. Soren Boysen and » Horse Not Performing Well: Serge Chalhoub How to Work It Up VETERINARY TEAM • Equine Internal Medicine: Examining – Dr. Renaud Leguillette • Hands-Free Veterinary Radiography and Sampling the Horse’s Airway • Equine Alternative Medicine: – Ms. Julia Bitan and Ms. Ashley (half-day lab), Drs. Renaud L�guillette Acupuncture, Chinese Medicine, Jenner, Hands-Free Veterinary and Marie-France Roy Veterinary Medical Manipulation Radiography • Equine: How to Provide Advance Techniques and Philosophies – • JumpStart Boot Camp Workshop GI Diagnostics in the Field (half-day Dr. Vasiliki (Vickie) Harvey, Chi Institute/ – Ms. Terra Shastri, Ontario Veterinary lab), Drs. Jean-Yin Tan and Ashley Integrative Veterinary Insititute Medical Association Whitehead

CLINICAL EDUCATION, COMMUNICATION AND PRACTICE MANAGEMENT SKILLS… SURROUNDED BY THE BEAUTY OF THE ROCKY MOUNTAINS! WWW.CANWESTCONFERENCE.CA FOR PERSONAL USE ONLY

Quiz Corner Test éclair

1. Which of the following is true regarding liver enzymes? 1. Lequel des énoncés suivants est vrai à propos des enzymes A. SDH is liver-specific and is a leakage enzyme. hépatiques? B. Aspartate aminotransferase (AST) is liver-specific and is A. La sorbitol déshydrogénase (SDH) est une enzyme a leakage enzyme. spécifique au foie et une enzyme qui fuit. C. Alkaline phosphatase (ALP) is liver-specific and is an B. L’aspartate aminotransférase (AST) est une enzyme induced enzyme. spécifique au foie et une enzyme qui fuit. D. Alanine aminotransferase (ALT) is not liver-specific and is C. La phospharase alcaline (PA) est une enzyme spécifique au an induced enzyme. foie et une enzyme induite. E. AST is not liver-specific and is an induced enzyme. D. L’alaline aminotransférase (ALT) n’est pas une enzyme spécifique au foie et est une enzyme induite. 2. Which of the following statements is most correct concern- E. L’aspartate aminotransférase (AST) n’est pas une enzyme ing endodontic disease in dogs? spécifique au foie et est une enzyme induite. A. The most common cause of endodontic disease in dogs is dental caries. 2. Lequel des énoncés suivants est correct à propos de la B. Radiographic signs of endodontic disease include periapi- maladie endodontique chez le chien? cal or apical lysis and large endodontic canals compared A. La cause la plus commune de la maladie endodontique chez to contralateral teeth. le chien est la carie dentaire. C. The only successful treatment plan for dogs with end- B. Les signes radiographiques de la maladie endodontique odontic disease is timely extraction of the affected tooth. comprennent la lyse périapicale ou apicale et de grands D. Endodontic disease in dogs is caused by demineraliza- canaux endodontiques par comparaison à la dent tion of calcified dental tissues when plaque bacteria use controlatérale. fermentable carbohydrates as a source of energy. C. Le seul traitement efficace pour un chien souffrant de maladie endodontique est l’extraction au bon moment de 3. A 12-year-old male dog undergoes surgical excision of a la dent malade. perianal gland neoplasm and castration at the same time. D. La maladie endodontique chez le chien est causée par la Sectioning of the testes — which externally are of normal déminéralisation des tissus dentaires calcifiés lorsque les size — reveals 1 or 2 soft, yellow nodules in each. The most bactéries responsables de la plaque dentaire utilisent les likely diagnosis for these masses is: glucides fermentescibles comme source d’énergie. A. Leydig cell neoplasms B. Seminomas C. Sertoli cell neoplasms D. Lipogranulomas E. Metastasis of the perianal gland neoplasm

quiz corner is generously sponsored by le test éclair est généreusement commandité par

BRAVECTO CVJ - Quiz Corner Question ad.indd 1 2016-03-31 10:45 AM

CVJ / VOL 58 / AUGUST 2017 785 FOR PERSONAL USE ONLY

4. A 5-year-old Quarter Horse mare is experiencing agalactia 3. On fait l’excision chirurgicale d’un néoplasme des glandes following the birth of a large weak foal. Which of the fol- périanales chez un chien mâle âgé de 12 ans et, en même lowing forages could be responsible for this problem? temps, on pratique la castration. La section des testicules — A. Orchard grass qui sont extérieurement de grosseur normale — révèle B. Perennial ryegrass 1 à 2 nodules de texture molle et de couleur jaune dans C. Fescue chacun des testicules. Le diagnostic le plus probable de ces D. Alfalfa masses est : E. Timothy A. un néoplasme des cellules de Leydig; B. un séminome; 5. Displaced abomasa may be corrected by blind procedures C. un néoplasme des cellules de Sertolli;

TESTÉCLAIR if which of the following is true? D. un lipogranulome; A. The displacement is to the right. E. des métastases provenant du néoplasme des glandes B. The cow is 7 months pregnant. périanales. C. The cow has metritis. D. The cow is standing during the procedure. 4. Une jument Quarter horse âgée de 5 ans démontre de E. Abomasal surgery is in the cow’s history. l’agalactie à la suite de la naissance d’un gros poulain souffrant de faiblesse. Lequel des fourrages suivants est responsable de ce problème? A. dactyle pelotonné; B. ivraie vivace; C. fétuque; D. luzerne; E. mil. 5. Le déplacement de l’abomasum peut être corrigé par des procédures à l’aveugle si l’un des énoncés suivants est vrai : lequel? A. Le déplacement de l’abomasum est à droite. B. La vache est en gestation depuis 7 mois. C. La vache souffre de métrite. D. La vache peut se tenir debout lors de l’intervention. E. La vache présente une anamnèse de chirurgie de l’abomasum.

(See p. 867 for answers./Voir les réponses à la page 867.)

Questions and answers were derived from Review Questions and Answers Les questions et les réponses sont extraites de Review Questions and for Veterinary Boards 2nd ed., a 5-volume series including Basic Sciences, Answers for Veterinary Boards 2nd ed., une série de cinq volumes qui Clinical Sciences, Small Animal Medicine and Surgery, Large Animal comprend Basic Sciences, Clinical Sciences, Small Animal Medicine and Medicine and Surgery, and Ancillary Topics, by kind permission of the Surgery, Large Animal Medicine and Surgery, et Ancillary Topics, avec publisher, Mosby–Year Book, Inc., St. Louis, Missouri. l’aimable permission de l’éditeur, Mosby–Year Book, Inc. de St. Louis (Missouri).

786 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY

NEWS | NOUVELLES

Annual Awards Ceremony Recognizes CVMA Members for Outstanding Contributions to Veterinary Medicine La cérémonie annuelle de remise des prix reconnaît les membres de l’ACMV pour des contributions exceptionnelles à la médecine vétérinaire or over 30 years, the Canadian Veterinary Medical epuis plus de 30 ans, l’Association canadienne des médecins FAssociation (CVMA) has proudly recognized its members Dvétérinaires (ACMV) reconnaît avec fierté les contributions for their exceptional contributions to the veterinary profession, extraordinaires de ses membres à la profession vétérinaire ainsi and animal health and welfare. This year was no exception as qu’à la santé et au bien-être des animaux. Cette année n’a pas individuals were honored at the CVMA Awards Ceremony in fait exception lorsque des personnes ont été honorées durant Charlottetown, Prince Edward Island, which took place during la Cérémonie annuelle de remise des prix de l’ACMV qui s’est the 2017 CVMA Convention in July. déroulée à Charlottetown, à l’Île-du-Prince-Édouard, durant le Dr. David Condon was honored with the CVMA Small congrès 2017 de l’ACMV Animal Practitioner Award, sponsored by Petsecure Pet Health Le Prix du praticien des petits animaux de l’ACMV, qui Insurance, for his compassion and dedication to animals since est commandité par Petsecure assurance maladie pour animaux, early childhood. Growing up on a small family farm on Prince a été décerné au Dr David Condon pour sa compassion et son Edward Island, Dr. Condon decided at the age of 6 that he dévouement continu envers les animaux depuis sa tendre enfance. wanted to become a veterinarian and he graduated from the Le Dr Condon, qui a grandi dans une petite ferme familiale à Atlantic Veterinary College (AVC) in 1991. After graduation, l’Île-du-Prince-Édouard, a décidé à l’âge de six ans qu’il désirait he worked at a mixed animal practice in Seaforth, Ontario, devenir vétérinaire et il a obtenu son diplôme de l’Atlantic Veterinary for 1 year. Being a true Islander, he returned to Prince Edward College (AVC) en 1991. Après la fin des études, il a travaillé dans Island and worked in Montague for the next year. Dr. Condon une pratique mixte à Seaforth, en Ontario, pendant un an. Un purchased the Abegweit Animal Hospital in 1993, which moved véritable natif de l’Île-du-Prince-Édouard, il est retourné dans l’île him away from large animal practice into primarily small animal et a travaillé à Montague pendant l’année suivante. Le Dr Condon practice, which he enjoys to this day. He has developed a strong a ensuite acheté la clinique Abegweit Animal Hospital en 1993, interest in veterinary dentistry and has devoted a significant ce qui lui a permis de se concentrer principalement sur la pratique portion of his time pursuing continuing education in this area. des petits animaux, qu’il aime toujours exercer aujourd’hui. Il a

Mona Campbell Centre for Animal Cancer Staff, 2017 CVMA Practice of the Year Award Recipient. Employés du Mona Campbell Centre for Animal Cancer, récipiendaire du Prix de la pratique de l’année de l’ACMV 2017.

CVJ / VOL 58 / AUGUST 2017 787 FOR PERSONAL USE ONLY

N He was instrumental in the formation of the student chapter of développé un vif intérêt pour la dentisterie vétérinaire et a consacré the Foundation for Veterinary Dentistry for AVC students and une partie importante de son temps à la formation continue dans hosts dental wet labs for students at his clinic and offers lunch ce domaine. Il a joué un rôle crucial dans la formation de la section lectures on veterinary dentistry at AVC. Dr. Condon travels with étudiante de la Foundation for Veterinary Dentistry à l’AVC et il the Peter Emily International Veterinary Dental Foundation to organise des laboratoires de travaux pratiques dentaires pour provide free veterinary dental care to captive large cats (tiger, les étudiants à sa clinique et offre des conférences du midi en lions, etc.). He is a member of the Foundation for Veterinary dentisterie vétérinaire à l’AVC. Le Dr Condon voyage avec la Peter Dentistry, the CVMA, the PEI Veterinary Medical Association, Emily International Veterinary Dental Foundation afin d’offrir des and the Canadian Veterinary Reserve. He currently serves on the soins vétérinaires dentaires gratuits aux grands félidés en captivité board of directors of his local watershed group and has had past (tigres, lions, etc.). Il est membre de la Foundation for Veterinary involvement with the PEI Wildlife Federation. Dentistry, de l’ACMV, de la PEI Veterinary Medical Association et Veterinarian Dr. Anne McDonald was awarded the de la Réserve vétérinaire canadienne. Il est actuellement membre CVMA Humane Award, sponsored by Merck Animal Health. du conseil d’administration de son groupe local de protection du Dr. McDonald graduated from the Western College of Veterinary bassin hydrographique et il a déjà œuvré au sein de la PEI Wildlife Medicine (WCVM) in 1976 and completed a 1-year internship Federation. at Texas A&M University in small animal clinics, followed by Le Prix humanitaire de l’ACMV, qui est commandité par Merck a 2-year residency in surgery. After leaving Texas, she worked Santé animale, a été décerné à la vétérinaire Dre Anne McDonald. in Red Deer, Alberta, for 6 months, and then returned to La Dre McDonald a obtenu son diplôme du Western College of Vancouver, British Columbia to work at the Vancouver Animal Veterinary Medicine (WCVM) en 1976 et a suivi un internat d’un an Emergency Clinic for the next 11 years. Dr. McDonald pur- à l’Université Texas A&M en pratique des petits animaux, suivi d’une chased the Night Owl Bird Hospital in 1990, which has been her résidence de deux ans en chirurgie. Après avoir quitté le Texas, elle focus ever since. Dr. McDonald has been recognized for her tre- a travaillé à Red Deer, en Alberta, pendant six mois et est ensuite mendous efforts in the treatment of, caring for, and re-homing of retournée à Vancouver, en Colombie-Britannique, pour travailler à almost 600 parrots from the World Parrot Refuge on Vancouver la Vancouver Animal Emergency Clinic au cours des onze années Island after the death of its owner in May 2016. Many of the suivantes. La Dre McDonald a acheté la clinique Night Owl Bird birds from the Refuge had health issues, with over 100 small and Hospital en 1990 et c’est à cet endroit qu’elle consacre toute large birds being hospitalized for the first few months. son énergie depuis ce temps. La Dre McDonald a été reconnue The Merck Veterinary Award, sponsored by Merck Animal pour ses efforts exceptionnels pour le traitement, les soins et Health, was presented to Dr. Stephen LeBlanc for his work as le repérage d’un nouveau foyer pour près de 600 perroquets a professor in the Department of Population Medicine at the du World Parrot Refuge sur l’île de Vancouver après la mort du Ontario Veterinary College, and as research program director — propriétaire en mai 2016. Bon nombre des oiseaux du refuge Animal Production Systems at the University of Guelph. He avaient des problèmes de santé et près de 100 petits et grands received a Bachelor of Science (Agriculture) in Animal Science oiseaux ont été hospitalisés au cours des premiers mois. from McGill University in 1992, and a Doctor of Veterinary Le Prix vétérinaire Merck, qui est commandité par Merck Medicine (1997) and Doctor of Veterinary Science (2001) Santé animale, a été présenté au Dr Stephen LeBlanc pour son from the University of Guelph. After 5 years of private dairy travail à titre de professeur au Département de médecine de la veterinary practice, he joined the faculty at the University of population à l’Ontario Veterinary College et en tant que directeur Guelph where he teaches veterinary and agriculture students du programme de recherche sur les systèmes de production

Dr. David Condon, 2017 Small Animal Practitioner Dr. Anne McDonald, 2017 CVMA Humane Award Dr. Stephen LeBlanc, 2017 Merck Veterinary Award Award Recipient. Recipient. Recipient. Dr David Condon, récipiendaire du Prix du praticien Dre Anne McDonald, récipiendaire du Prix Dr Stephen LeBlanc, récipiendaire du Prix vétérinaire des petits animaux de l’ACMV 2017. humanitaire de l’ACMV 2017. Merck 2017.

788 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY and provides clinical farm service. He is past-president of the animale à l’Université de Guelph. Il a obtenu un baccalauréat en N Dairy Cattle Reproduction Council and serves as section editor sciences (agriculture) en sciences animales de l’Université McGill for the Journal of Dairy Science. His research focuses on transi- en 1992 ainsi qu’un doctorat en médecine vétérinaire (1997) et tion dairy cow metabolic and reproductive health and manage- un doctorat en sciences vétérinaires (2001) de l’Université de ment, including field validation of precision technologies. With Guelph. Après avoir passé cinq ans en pratique vétérinaire privée graduate students and collaborators, this work has resulted in des bovins laitiers, il s’est joint à l’Université de Guelph en tant que over 100 peer-reviewed papers. He has given invited talks in professeur où il enseigne aux étudiants en médecine vétérinaire 20 countries. et en agriculture et offre des services cliniques aux fermes. Il est The Practice of the Year Award, sponsored by Scotiabank, ancien président du Dairy Cattle Reproduction Council et agit à was presented to the Mona Campbell Centre for Animal titre de rédacteur de section pour la revue Journal of Dairy Science. Cancer (MCCAC) for creating a comprehensive veterinary Ses travaux de recherche portent sur la santé métabolique et cancer centre serving central Canada and beyond, while creat- reproductive des vaches laitières en transition et leur gestion, y ing unique clinical trial research opportunities for the Ontario compris la validation sur le terrain des technologies de précision. Veterinary College (OVC) and the University of Guelph. The De concert avec des étudiants diplômés et des collaborateurs, ses Centre offers surgery, radiation, chemotherapy, and investiga- efforts ont donné lieu à plus de 100 articles évalués par les pairs. tional therapies in conjunction with clinical trials to diagnose Il a aussi présenté des conférences dans 20 pays. and treat cancer in animals. The MCCAC provides experiential Le Prix de la pratique de l’année, qui est commandité par oncology teaching in the Doctor of Veterinary Medicine program la Banque Scotia, a été décerné au Mona Campbell Centre for and provides postgraduate training for veterinarians seeking Animal Cancer (MCCAC) pour la création d’un centre vétérinaire further clinical training in oncology in residencies, internships, à services complets pour les animaux atteints de cancer qui dessert and for students seeking postgraduate degrees. Clinicians and le centre du Canada et des régions périphériques, tout en créant researchers at the MCCAC continually seek better ways to treat des occasions de recherche pour des essais cliniques uniques cancer in pets (some of which may translate into helping people pour l’Ontario Veterinary College (OVC) et l’Université de Guelph. with cancer) through clinical trials. The Centre is the only inter- Le Centre offre de la chirurgie, de la radiation, de la chimiothérapie national member of the National Institutes of Health Center for et des thérapies expérimentales conjointement à des essais Cancer Research Comparative Oncology Trials Consortium. The cliniques pour diagnostiquer et traiter le cancer chez les animaux. clinical caseload has facilitated the creation of the Companion Le MCCAC offre de l’enseignement expérientiel en oncologie Animal Tumour Sample Bank in the MCCAC, which is a unique dans le cadre du programme de doctorat en médecine vétérinaire resource providing access to clinical specimens from naturally et offre une formation aux 2e et 3e cycles pour les vétérinaires occurring cancers to the scientific research community. Since qui cherchent à améliorer leur formation clinique en oncologie inception, the veterinarians, students, and staff who serve in dans le cadre de résidences, d’internats et pour les étudiants aux the Mona Campbell Centre for Animal Cancer have worked in études supérieures. Les cliniciens et les chercheurs au MCCAC conjunction with veterinary cancer patients and their families sont continuellement à la recherche de meilleures façons de traiter to create an internationally recognized comprehensive veterinary le cancer chez les animaux (dont certains traitements peuvent cancer centre with the goal of compassionately treating compan- se traduire par l’assistance des humains atteints du cancer) lors ion animals with cancer while advancing the understanding of d’essais cliniques. Le Centre est le seul membre international cancer and improving treatment options to benefit both animal du National Institutes of Health Center for Cancer Research and human patients. Comparative Oncology Trials Consortium. Le volume de cas a

Dr. Jeanne Lofstedt, 2017 CVMA Life Dr. Bob Bellamy, 2017 CVMA President’s Award Ms. Elizabeth Hartnett, 2017 R.V.L. Walker Award Membership Recipient. Recipient. Recipient. Dre Jeanne Lofstedt, récipiendaire du titre Dr Bob Bellamy, récipiendaire du Prix du président Mme Elizabeth Hartnett, récipiendaire du Prix R.V.L. de Membre à vie de l’ACMV 2017. de l’ACMV 2017. Walker 2017.

CVJ / VOL 58 / AUGUST 2017 789 FOR PERSONAL USE ONLY

N Dr. Jeanne Lofstedt, a native of Benoni, South Africa, was facilité la création de la Companion Animal Tumour Sample Bank honored with a Life Membership this year for her significant au MCCAC, qui est une ressource unique fournissant l’accès à contributions to the CVMA and the veterinary profession. des spécimens cliniques de cancers naturels pour la collectivité Summers spent on the sheep and dairy farms of close relatives, de la recherche scientifique. Depuis sa fondation, les vétérinaires, the influence of an uncle who was a veterinarian, as well as the les étudiants et le personnel qui travaillent au Mona Campbell opportunity to volunteer at a mixed animal practice during high Centre for Animal Cancer ont œuvré, de concert avec des patients school inspired Dr. Lofstedt to pursue a career in veterinary cancéreux vétérinaires et leurs familles, afin de créer un centre du medicine. In 1975, she received a Bachelor of Veterinary Science cancer vétérinaire à services complets qui est reconnu à l’échelle degree with honors from the University of Pretoria in South internationale et qui a pour but de traiter les animaux de compagnie Africa and was awarded the Sir Arnold Theiler Medal for the stu- atteints du cancer avec compassion tout en faisant progresser dent with the highest academic standing overall. After 7 months la compréhension du cancer et en améliorant les options de in a mixed animal practice in Krugersdorp, South Africa, she was traitement pour le bénéfice des patients animaux et humains. accepted into a rotating internship in Large Animal Medicine Cette année, le titre de membre à vie a été décerné à la and Surgery at the Western College of Veterinary Medicine Dre Jeanne Lofstedt, qui est originaire de Benoni, en Afrique du in Saskatoon, Saskatchewan. In 1981, she completed a 3-year Sud, pour ses contributions importantes à l’ACMV et à la profession residency in Food Animal Medicine and Surgery and received vétérinaire. Des étés passés dans les fermes de moutons et de a Master of Science degree in Pathology, both at Iowa State bovins laitiers de parents proches, l’influence d’un oncle qui était University. She then joined Tufts University as an assistant pro- vétérinaire ainsi que l’occasion de faire du bénévolat dans une fessor in Large Animal Medicine from 1981 to 1987 and became pratique mixte pendant l’école secondaire ont inspiré la Dre Lofstedt board certified in Large Animal Internal Medicine in 1987. That à poursuivre une carrière en médecine vétérinaire. En 1975, elle same year she moved to Prince Edward Island to assume a faculty a obtenu un baccalauréat en sciences vétérinaires de l’Université position at the Atlantic Veterinary College (AVC) where she is de Pretoria en Afrique du Sud et elle a reçu la médaille Sir Arnold currently professor of Large Animal Medicine in the Department Theiler pour l’étudiante avec la meilleure moyenne à l’université. of Health Management. Dr. Lofstedt has held various leadership Après sept mois passés dans une pratique mixte à Krugersdorp, positions at the AVC and volunteer positions with the CVMA en Afrique du Sud, elle a été acceptée dans un internat par and other veterinary organizations. Among other activities, rotations au Western College of Veterinary Medicine à Saskatoon, she served as the associate dean of Academic Affairs at AVC, en Saskatchewan. En 1981, elle a terminé une résidence de was a member of the American College of Veterinary Internal trois ans en médecine et en chirurgie des animaux destinés à Medicine Examination Committee, a member of the Journal of l’alimentation et elle a reçu une maîtrise en sciences spécialisée Veterinary Medical Education Editorial Board, a North American en pathologie, tous deux à l’Université de l’État de l’Iowa. Elle Veterinary Licensing Examination item writer, a site visit team s’est ensuite jointe à l’Université Tufts en tant que chargée de member for the American Veterinary Medical Association cours en médecine des grands animaux de 1981 à 1987, puis Council on Education and the CVMA, a member of the CVMA elle a obtenu sa spécialisation du conseil d’agrément pour la National Issues and Professional Development Committees, and médecine interne des grands animaux en 1987. La même année, CVMA president from 2002–2003. She has been the scientific elle est déménagée à l’Île-du-Prince-Édouard pour assumer ses program coordinator for the CVMA since 2004. fonctions de professeur à l’Atlantic Veterinary College (AVC) Dr. Bob Bellamy was awarded the 2017 CVMA President’s où elle est actuellement professeure de médecine des grands Award for his expertise and outstanding dedication to the vet- animaux au Département de gestion de la santé. La Dre Lofstedt erinary profession. Shortly after graduating from the Western a toujours occupée divers postes de leadership à l’AVC ainsi que College of Veterinary Medicine (WCVM), University of des postes de bénévole à l’ACMV et dans d’autres organisations Saskatchewan in 1976, Dr. Bellamy established a mixed animal vétérinaires. Elle a notamment occupé le poste de doyenne practice in Moose Jaw, Saskatchewan. A former Saskatchewan associée aux Affaires universitaires de l’AVC, a été membre du Veterinary Medical Association (SVMA) president (2004), he comité d’examen de l’American College of Veterinary Internal has chaired the SVMA Practice Economic Committee for the Medicine, membre du comité de la rédaction de la revue Journal of past 25 years and served as the chair of the CVMA Business Veterinary Medical Education, rédactrice de questions pour l’Examen Management Committee until its status was changed to an nord-américain d’agrément en médecine vétérinaire, membre Advisory Group in 2015. After 40 years in practice, Dr. Bellamy de l’équipe d’inspection du Conseil de l’éducation de l’American remains passionate about the value veterinary medicine returns Veterinary Medical Association et de l’ACMV, membre des comités to both humans and animals. He established the SVMA’s social sur les enjeux nationaux de l’ACMV et du perfectionnement media initiative, SaskVets, and remains the project coordina- professionnel et présidente de l’ACMV en 2002–2003. Elle est tor. The SVMA is proud to boast one of the highest number coordonnatrice du programme scientifique de l’ACMV depuis 2004. of followers of any veterinary group in the country with the Le Prix du président de l’ACMV 2017 a été décerné popularity of SaskVets. Dr. Bellamy, turning a photography au Dr Bob Bellamy pour son expertise et son dévouement hobby into video production, produced a series called “Just Like exceptionnel envers la profession vétérinaire. Peu de temps You” informational videos that focus on client information and après avoir obtenu son diplôme du Western College of Veterinary are available to any veterinarian. The videos are hosted on the Medicine (WCVM) de l’Université de la Saskatchewan en 1976, CVMA’s YouTube channel and a variety of Vimeo sites. The goal le Dr Bellamy a fondé une pratique mixte à Moose Jaw, en

790 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY is to “not only tell clients what is being done, but show them.” Saskatchewan. Il est ancien président de la Saskatchewan N Dr. Bellamy is adamant that the veterinary profession retain Veterinary Medical Association (SVMA) (2004) et il préside le the privilege to both prescribe and dispense. He coordinated Comité économique de la pratique de la SVMA depuis 25 ans et a the production of the Saskatchewan Dispensing Manual for occupé le poste de président du Comité de la gestion commerciale Veterinarians, which reviews the relevant federal and provincial de l’ACMV jusqu’à ce que son statut change en groupe consultatif legislation regulating veterinary drug sales. en 2015. Après 40 ans de pratique, le Dr Bellamy demeure The R.V.L. Walker Award is presented annually to the passionné pour la valeur de la médecine vétérinaire tant pour les president of the Students of the CVMA (SCVMA) for his/her humains que pour les animaux. Il a établi l’initiative des médias work to promote student interests in the Association. This award sociaux de la SVMA, SaskVets, et en demeure le coordonnateur features 2 recipients — a plaque is presented to the president of de projet. La SVMA est fière d’avoir l’un des plus grands nombres the Students of the CVMA and a cash award is made available to d’adeptes des médias sociaux de tous les groupes vétérinaires the veterinary college where the president is registered to provide au pays grâce à la popularité de SaskVets. Le Dr Bellamy, qui a financial assistance to a student veterinarian in need. The recipi- transformé son passe-temps de photographie en de la production ent of this year’s R.V.L. Walker Award plaque is Ms. Elizabeth vidéo, a produit une série de vidéos d’information qui s’intitule «Just Hartnett, from the Ontario Veterinary College. Ms. Hartnett Like You» qui vise à informer les clients et est offerte à tous les decided she wanted to be a veterinarian at the age of 5 and has vétérinaires. Les vidéos sont hébergées dans le canal YouTube de always been fascinated by the natural world. Growing up in l’ACMV et divers sites Vimeo. Le but consiste «non seulement à dire a military family, she lived in several different places — from aux clients ce qui se fait, mais aussi de leur montrer». Le Dr Bellamy Germany to Manitoba to Québec — before her family settled est aussi convaincu que la profession doit conserver le privilège in Kingston, Ontario. She completed her undergraduate studies de prescrire et de distribuer des médicaments. Il a coordonné in Environmental Biology at Queen’s University and received a la production du manuel Saskatchewan Dispensing Manual for Master in Environmental Studies degree from York University, Veterinarians, qui passe en revue les diverses lois fédérales et where she focused on humane education and environmental provinciales pertinentes pour la vente de médicaments. ethics. For several years, Ms. Hartnett worked in environmental Le Prix R.V.L. Walker est décerné annuellement au président research and policy, while volunteering at the Toronto Wildlife des Étudiants de l’ACMV (ÉACMV) pour son travail en vue de Centre on weekends. Realizing her interests in the environment, promouvoir l’intérêt des étudiants envers l’Association. Il y a public policy, and wildlife health were compatible with a career deux récipiendaires de ce prix — une plaque est présentée au in veterinary medicine, she decided to finally apply to veterinary président des Étudiants de l’ACMV et une bourse est remise school. Ms. Hartnett enjoys being involved at OVC and in the au collège où est inscrit le président afin d’offrir de l’assistance wider community, and loves to practice her clinical skills by financière à un étudiant en médecine vétérinaire dans le besoin. volunteering with Community Veterinary Outreach. Cette année, la récipiendaire est Mme Elizabeth Hartnett, de Nominations for the 2018 CVMA Awards will open in the l’Ontario Veterinary College. Mme Hartnett a décidé qu’elle voulait fall of 2017. The submission deadline is January 31, 2018. devenir vétérinaire à l’âge de cinq ans et elle a toujours été Visit the CVMA website (www.canadianveterinarians.net/about/ fascinée par le monde naturel. Elle a grandi dans une famille awards) to learn more. militaire et a vécu à plusieurs endroits différents — de l’Allemagne au Manitoba en passant par le Québec — avant que sa famille ne s’établisse à Kingston, en Ontario. Elle a suivi des études de premier cycle en biologie environnementale à l’Université Queen’s et a obtenu une maîtrise en études environnementales de l’Université York, où elle s’est concentrée sur l’éducation humanitaire et l’éthique environnementale. Pendant plusieurs années, Mme Hartnett a travaillé en recherche et en politiques environnementales tout en faisant du bénévolat au Toronto Wildlife Centre la fin de semaine. Elle a constaté que ses intérêts envers l’environnement, les politiques publiques et la santé de la faune étaient compatibles avec une carrière en médecine vétérinaire et elle a décidé de finalement présenter une demande à l’école de médecine vétérinaire. Mme Hartnett aime participer aux activités de l’OVC et de la collectivité en général et elle adore exercer ses compétences cliniques en faisant du bénévolat auprès de Community Veterinary Outreach. Les mises en candidature pour les Prix 2018 de l’ACMV ouvriront à l’automne 2017. La date limite pour les soumissions est le 31 janvier 2018. Visitez le site Web de l’ACMV (www.veterinairesaucanada.net/about/awards) pour en apprendre davantage.

CVJ / VOL 58 / AUGUST 2017 791 FOR PERSONAL USE ONLY

N CVMA Begins Process to Enhance Stewardship of Veterinary Antimicrobial Medications L’AMV entame le processus d’améliorer la gouvernance des médicaments antimicrobiens vétérinaires he Canadian Veterinary Medical Association (CVMA) with Association canadienne des médecins vétérinaires (ACMV), Tthe financial support of Agriculture and Agri-Food Canada L’ avec le soutien financier d’Agriculture et Agroalimentaire (AAFC) and under the leadership of an Expert Advisory Group Canada (AAC) et sous le leadership d’un Groupe consultatif (EAG) led by Dr. Phil Buote of Alberta held a workshop in d’experts (GCE) qui est dirigé par le Dr Phil Buote de l’Alberta, a Ottawa May 9–10, 2017 aimed at initiating a project to enhance tenu un atelier les 9 et 10 mai 2017 à Ottawa afin d’entamer un veterinary antimicrobial use (AMU) stewardship through the projet qui améliorera l’utilisation des antimicrobiens vétérinaires development of guidelines to support responsible and prudent par l’élaboration de lignes directrices qui appuieront une utilisation use of antimicrobial medications in animals. responsable et prudente des médicaments antimicrobiens chez The workshop marked the start of a process to develop ready- les animaux. for-delivery, practical tools to assist veterinarians in the prudent L’atelier a marqué le début d’un processus pour élaborer use of antimicrobials for 6 defined species groups (beef, dairy, des outils pratiques prêts à la mise en œuvre afin d’appuyer les poultry, swine, small ruminants, and companion animals). The vétérinaires en lien avec l’utilisation prudente des antimicrobiens objective of the workshop was to engage stakeholders and obtain pour six groupes d’espèces (bovins, bovins laitiers, volaille, porcs, their input into defining the needs for the future toolset. The petits ruminants et animaux de compagnie). L’objectif de l’atelier timing of the initiative is significant given that amended federal consistait à engager les intervenants et à obtenir leur rétroaction regulations pertaining to veterinary drugs are expected to come pour la définition des besoins de la boîte à outils future. Le moment into force November 2017 and July 2019. de cette initiative est important car on prévoit que la réglementation Over 40 participants represented veterinarian associations, fédérale visant les médicaments vétérinaires entrera en vigueur en species groups and practices, as well as government, industry, and novembre 2017 et en juillet 2019. academic stakeholders. Participants collaborated in both mixed Plus de 40 participants provenaient des associations de groups and species-specific groups to collectively analyze the médecins vétérinaires, des groupes d’espèces et des pratiques et broader AMU environment and identify key stakeholders; review il y avait aussi des intervenants du gouvernement, de l’industrie et other initiatives and tools of relevance in Canada and elsewhere; des universités. Les participants ont collaboré aux groupes mixtes identify the factors that influence how veterinarians in practice et aux groupes d’espèces spécifiques afin d’analyser collectivement make decisions on antimicrobial use; identify key considerations l’environnement global de l’utilisation des antimicrobiens et regarding tool formats and testing; and develop recommenda- d’identifier les principaux intervenants; d’examiner d’autres tions on both project and post-project outputs and outcomes. initiatives et outils pertinents au Canada et ailleurs; d’identifier Next steps include the establishment of 5 work streams les facteurs qui influencent la façon dont les vétérinaires en including: antimicrobial stewardship principles and decision pratique prennent des décisions sur l’utilisation des antimicrobiens;

Invited veterinarians and other key stakeholders from across Canada gathered for a workshop in May to begin the initial steps in developing a tool set to provide veterinary practitioners with principles and guidelines to support responsible and prudent use of antimicrobial medications in animals. Des vétérinaires invités et d’autres intervenants clés provenant de tous les coins du Canada se sont rassemblés pour un atelier en mai afin d’entamer les étapes initiales pour l’élaboration d’un ensemble d’outils afin de communiquer aux praticiens vétérinaires les principes et les lignes directrices qui appuient l’utilisation responsable et prudente des médicaments antimicrobiens chez les animaux.

792 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY support practices; guidelines for prudent use of antimicrobials; d’identifier les principales considérations concernant les formats N platforms for hosting of tools and templates; sustainability; and et les essais des outils; et d’élaborer des recommandations sur les communication strategies. A 6th work stream on surveillance is résultats du projet et après le projet. proposed that would be funded through a separate program and Les prochaines étapes incluent l’établissement de cinq volets build upon work conducted at an AMU Surveillance Workshop de travail, notamment : les principes de l’antibiogouvernance held Feb. 28 to Mar. 1 (see editorial in The CVJ’s May 2017 et les pratiques de soutien à la décision; les lignes directrices issue). The above work streams will require the EAG and project pour l’administration judicieuse des antimicrobiens; des plates- team over the coming months to revise and finalize the project formes pour héberger les outils et les modèles; la durabilité; et plan, engage subject matter experts, and initiate activity across les stratégies de communication. Un sixième volet proposé sur la all work streams. surveillance sera financé dans le cadre d’un programme séparé et misera sur les travaux réalisés lors d’un Atelier sur la surveillance de l’utilisation des antimicrobiens tenu le 28 février et le 1er mars (voir l’éditorial dans le numéro de mai 2017 de La RVC). Au cours des prochains mois, les volets de travail susmentionnés exigeront que le GCE et l’équipe de projet révisent et finalisent le plan du projet, engagent les experts en la matière et entament les travaux dans tous les volets.

How Green is your Veterinary Votre pratique vétérinaire est-elle Practice? écoresponsable? Evaluate how your practice measures up Évaluez le rendement de votre pratique with Self-Audit Tool à l’aide de l’outil d’autovérification he Canadian Veterinary Medical Association (CVMA) Association canadienne des médecins vétérinaires (ACMV) a Tdeveloped a checklist to help you do a “self-audit” on your L’ mis au point une liste de contrôle pour vous aider à effectuer practice to evaluate how your practice measures up from an une «autovérification» de votre pratique et à évaluer le rendement environmental sustainability perspective. de votre pratique du point de vue de la durabilité environnementale. It will help you identify the changes you have made that posi- Cet outil vous aidera à identifier les changements que vous tively impact the environment, and will also provide new ideas avez apportés et qui ont un impact positif sur l’environnement et on other initiatives that could be implemented. To access the il vous communiquera de nouvelles idées sur d’autres initiatives self-audit tool, visit the website (www.canadianveterinarians.net) qui pourraient être mises en œuvre. Pour accéder à l’outil and under the Practice & Economics tab the Green Veterinary d’autovérification, visitez le site Web (www.veterinairesaucanada.net) Practice information can be found under Practice Tools (your et, sous l’onglet Pratique et finances, vous pourrez trouver les CVMA member login will be required). renseignements sur une pratique vétérinaire écoresponsable sous The CVMA encourages veterinarians to submit their green Outils pour la pratique (vous devrez ouvrir une session). practice success stories! Send your completed Self-Audit Tool, L’ACMV encourage les vétérinaires à soumettre leurs histoires along with a brief description of how your practice has reduced de réussite en ligne sur les pratiques écoresponsables! Envoyez its environmental footprint; send photos too! l’outil d’autovérification rempli, de même qu’une brève description Your practice could be profiled to inspire others to introduce de la façon dont votre pratique a réduit son empreinte écologique. green change in their veterinary hospital. Details can be sent to Vous pouvez aussi envoyer des photos! ([email protected]). Votre pratique pourrait être le sujet d’un article afin d’inspirer The CVMA’s Green Veterinary Practice initiative, a collection vos collègues à introduire des changements écologiques dans of eco-friendly resources for veterinary practices, is a web-based leur clinique vétérinaire. Vous pouvez acheminer les détails à resource that offers tips on how to make your veterinary practice ([email protected]). more environmentally friendly. L’initiative d’une Pratique vétérinaire écoresponsable de l’ACMV, une collection de ressources écologiques pour les pratiques vétérinaires, est une ressource Web qui offre des conseils sur la façon d’améliorer l’empreinte écologique de votre pratique vétérinaire.

CVJ / VOL 58 / AUGUST 2017 793 FOR PERSONAL USE ONLY

N CVMA Practice Diagnostic Report: Rapport diagnostique de la pratique Evidence Based Management de l’ACMV : une gestion factuelle echnology and communication advances made cutting-edge es progrès de la technologie et de la communication ont permis Tlaboratory testing ubiquitous in North American veterinary Lde réaliser des essais de laboratoire de pointe dans toutes hospitals. The availability and affordability of both in-house les cliniques vétérinaires de l’Amérique du Nord. La disponibilité laboratory equipment and referral labs helped to level the playing et l’abordabilité de l’équipement de laboratoire à l’interne et des field between smaller single doctor practices and large multi- laboratoires spécialisés ont contribué à l’uniformisation des règles doctor referral hospitals. The result is a healthier pet population du jeu entre les petites pratiques comportant un seul médecin et through better evidence-based medicine. les grandes cliniques spécialisées. Le résultat est une population The CVMA Practice Diagnostic Report extends this opportu- d’animaux en santé grâce à la médecine factuelle. nity to financial matters. Increased availability of financial bench- Le Rapport diagnostique de la pratique de l’ACMV offre marks provided in the Practice Diagnostic Report helps improve cette possibilité pour les affaires financières. Une disponibilité individual practices’ and the veterinary profession’s economic accrue des mesures de rendement financier fournies dans le health. CVMA members who complete the Practice Owners Rapport diagnostique de la pratique aide à améliorer les pratiques Economic Survey have access to complimentary benchmarking individuelles ainsi que la santé financière de la profession on revenue, expenses, hours worked, fees, and staff. The report vétérinaire. Les membres de l’ACMV qui remplissent le Sondage calculates their financial metrics and compares them to the average auprès des propriétaires de pratique ont accès à une analyse and top-performing hospitals in their provinces. New in 2016, the comparative gratuite pour le chiffre d’affaires, les dépenses, les Practice Diagnostic Report compares year-to-year trends for indi- heures travaillées, les honoraires et les employés. Le rapport vidual hospitals that have submitted 2 consecutive years of data. Successful managers know that evidence-based management calcule les paramètres financiers et les comparent à ceux des is essential to the financial success of practice; measure, manage, cliniques moyennes et les plus performantes dans la province. and measure again to track improvement. The CVMA Practice Pour la première fois en 2016, le Rapport diagnostique de la Diagnostic Report is the quintessential tool to help veterinarians pratique a comparé les tendances annuelles pour les cliniques measure and manage their practice. individuelles qui ont soumis des données pendant deux années consécutives. Revenue metrics Les gestionnaires accomplis savent que la gestion factuelle est In isolation, annual or monthly revenue has limited applicability. essentielle au succès financier de la pratique : il faut mesurer, gérer Comparing one month to the same month of the previous year et mesurer de nouveau pour effectuer un suivi des améliorations. shows growth, but without benchmarks, veterinarians don’t know Le Rapport diagnostique pour la pratique de l’ACMV est l’outil par how revenue growth compares to their colleagues. For example, excellence pour aider les vétérinaires à mesurer et à gérer leur you could have 5% growth in revenues, which you think is great, pratique. until you find out the average practice in the province grew by 10% over the same time. Similarly, your annual revenues could Données sur le chiffre d’affaires have topped one million dollars last year but when you find out Examinés en vase clos, les chiffres d’affaires annuels ou mensuels the average hospital earned $1.5 million with the same number ont une utilité limitée. La comparaison d’un mois au même mois de of veterinarians, you realize there is room for improvement. l’année précédente indique de la croissance mais, sans les données Revenue mix is another important practice benchmark to comparatives, les vétérinaires ne savent pas comment la croissance measure their effort’s effectiveness to promote a specific area. de leur chiffre d’affaire se compare à celle de leurs collègues. Par For example, if a hospital prides itself on nutrition, they could exemple, vous pourriez avoir une croissance de 5 % du chiffre expect diet sales contributing a higher than average revenue d’affaires, et vous pensez que cela est excellent, jusqu’à ce que share. If, according to their Practice Diagnostic Report, their diet vous appreniez que la pratique moyenne dans la province a connu sales contribute less than the benchmark, they have work to do. une croissance de 10 % pendant la même période. Parallèlement, Client metrics votre chiffre d’affaires annuel a pu atteindre un million de dollars The Practice Diagnostic Report provides benchmarks on clients l’an dernier, mais quand vous apprenez que la clinique moyenne per veterinarian, revenue per client, client visits per year and, a connu un chiffre d’affaires de 1,5 million $ avec le même for practices that provide consistent client data for 2 consecutive nombre de vétérinaires, vous réalisez qu’il y a encore place à years, client retention. Client benchmarks can be used to develop l’amélioration. and track production targets. For example, practices that have La répartition du chiffre d’affaires est une autre mesure fewer clients per veterinarian need higher revenue per client to comparative importante pour mesurer l’efficacité de leurs efforts hit revenue targets, and can expect to see higher visits per client visant à promouvoir un domaine particulier. Par exemple, si to account for higher than average diet sales. une clinique est fière de ses activités de nutrition, elle pourrait Staff metrics s’attendre à ce que ses ventes d’aliments contribuent à une part There is no “right way” to staff a veterinary hospital. Some du chiffre d’affaires qui est supérieure à la moyenne. Si, selon see success with a slower pace and less staff per veterinarian, le Rapport diagnostique de la pratique, les ventes d’aliments while others thrive with higher staff per doctor. The Practice contribuent à une part inférieure à celle des données comparatives Diagnostic Report can show if your staff strategy is working by du rendement, les cliniques ont alors du travail à faire.

794 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY examining the staff numbers per doctor as Données sur les clients N well staff wages as a gross revenue percentage. Le Rapport diagnostique de la pratique fournit des mesures comparatives sur les If staff wages as a gross revenue percentage are clients par vétérinaire, les recettes par client, les visites des clients par année et, pour higher than average, the staff strategy may not les pratiques qui fournissent des données constantes sur les clients pendant deux be working and the practice owner can look années consécutives, la rétention des clients. Les mesures comparatives sur les clients to the staff per doctor benchmarks to fine peuvent être utilisées pour établir et effectuer le suivi des cibles de production. Par tune or develop an entirely new staff strategy. exemple, les pratiques qui ont moins de clients par vétérinaire ont besoin de produire Expenses as a percent of des recettes supérieures par client pour atteindre leurs cibles de recettes et elles gross revenue peuvent s’attendre à voir un nombre supérieur de visites par client pour expliquer des ventes d’aliments supérieures à la moyenne. The Practice Diagnostic Report’s cornerstone is the expense analysis. Expenses as a gross Données sur les employés percentage are compared to the average and Il n’y a pas de «bonne façon» de déterminer la dotation d’une clinique vétérinaire. previous year, highlighting areas where there Certaines cliniques obtiennent du succès avez un rythme plus ralenti et moins may be potential cost savings by reining in d’employés par vétérinaire, tandis que d’autres prospèrent avec un nombre élevé expenses. Many practice owners reported they d’employés par médecin. Le Rapport diagnostique de la pratique peut montrer si la cancelled yellow pages, reduced office supply stratégie de personnel fonctionne en examinant le nombre d’employés par médecin costs, and started managing inventory better ainsi que les salaires des employés en tant que pourcentage du chiffre d’affaires brut. once they saw their expenses were higher Si les salaires des employés en tant que pourcentage du chiffre d’affaires brut sont than average. supérieurs à la moyenne, la stratégie des ressources humaines peut ne pas fonctionner Fees et le propriétaire de pratique peut consulter les données comparatives sur les employés par médecin pour ajuster sa stratégie ou en développer une nouvelle. One of the most important revenue determinants is veterinary fees. The Practice Dépenses en tant que pourcentage du chiffre d’affaires brut Diagnostic Report shows veterinarians how Le pilier du Rapport diagnostique de la pratique est l’analyse des dépenses. Les their fees compare to the average and their dépenses en tant que pourcentage brut sont comparées à la moyenne et à l’année province’s fee guide. A year over year compari- précédente en soulignant les domaines où il pourrait y avoir des économies potentielles son is also provided with an analysis show- en réduisant les dépenses. Beaucoup de propriétaires de pratique ont signalé qu’ils ing how incomes could improve with fee ont annulé les pages jaunes, réduit le coût des fournitures de bureau et commencé increases. à mieux gérer leur inventaire une fois qu’ils ont constaté que leurs dépenses étaient Practice Value Estimate supérieures à la moyenne. Based on information from the Practice Honoraires Owners Economic Survey and financial state- Les honoraires vétérinaires représentent l’un des facteurs déterminants du chiffre ments, the Practice Value Estimate provides d’affaires les plus importants. Le Rapport diagnostique pour la pratique montre aux a practice value estimate based on cash flow. vétérinaires comment leurs honoraires se comparent à la moyenne et à leur guide Presented as a gross revenue percentage, the tarifaire provincial. Une comparaison entre les années est aussi fournie avec une Practice Value Estimate incorporates revenue, analyse indiquant comment les bénéfices pourraient progresser avec une hausse des expenses and veterinary production. Some tarifs. veterinarians see the figure as an annual financial grade. If the Practice Value Estimate has Estimation de la valeur d’une pratique gone up then the practice is in better shape L’Estimation de la valeur de la pratique, qui se fonde sur les renseignements contenus than the previous year. dans le Sondage économique auprès des propriétaires de pratique et les états financiers, fournit une estimation de la valeur de la pratique qui se base sur l’encaisse. Help line Présentée sous forme de pourcentage du chiffre d’affaires brut, l’Estimation de la valeur The Practice Owners Economic Survey is de la pratique inclut les recettes, les dépenses et la production vétérinaire. Certains designed for the “average” veterinarian. If vétérinaires considèrent ce chiffre comme une note financière annuelle. Si l’Estimation you have questions about the survey or need de la valeur de la pratique a augmenté, alors la pratique se trouve dans une meilleure help getting your practice management soft- situation que l’année précédente. ware information, contact Darren Osborne or Terra Shastri at the Ontario Veterinary Ligne d’assistance Medical Association (OVMA) to get help Le Sondage économique auprès des propriétaires de pratique est conçu pour le from experts: call 800-670-1702 or fax vétérinaire «moyen». Si vous avez des questions à propos du sondage ou si vous avez 877-482-5941 or e-mail (dosborne@ovma. besoin d’aide pour obtenir les données dans le logiciel de gestion de la pratique, veuillez org) ([email protected]). contacter Darren Osborne ou Terra Shastri à l’Ontario Veterinary Medical Association The CVMA Practice Owners Economic (OVMA) pour obtenir l’aide des experts; composez le 800-670-1702 ou envoyez une Survey, the Individual Practice Diagnostic télécopie au 877-482-5941 ou un courriel ([email protected]) ([email protected]). Report and the Practice Value Estimate are Le Sondage économique de l’ACMV auprès des propriétaires de pratique, le Rapport free for CVMA members. diagnostique pour la pratique individuelle et l’Estimation de la valeur de la pratique sont offerts gratuitement aux membres de l’ACMV. (by Darren Osborne, MA) (par Darren Osborne, M.A.)

CVJ / VOL 58 / AUGUST 2017 795 FOR PERSONAL USE ONLY

N The CVMA and GoodLife Fitness Partner to Offer Members Discounted Gym Memberships L’ACMV et GoodLife Fitness forment un partenariat afin d’offrir des abonnements à tarif réduit aux membres he topic of wellness in veterinary medicine is important e sujet du bien-être en médecine vétérinaire est important Tand must be considered a priority. The Canadian Veterinary Let nous devons assurer que cet enjeu demeure une priorité. Medical Association (CVMA) has been looking at ways to sup- L’Association canadienne des médecins vétérinaires (ACMV) a port Canadian veterinarians on their wellness journey and con- examiné des façons d’appuyer les médecins vétérinaires canadiens tribute to their success in achieving a work-life balance. One new dans leur parcours de bien-être ainsi que de contribuer à leur CVMA Health and Wellness initiative is the CVMA-GoodLife succès afin qu’ils parviennent à atteindre un équilibre travail-vie. Fitness Corporate Discount Program for CVMA members. Une nouvelle initiative de l’ACMV en matière de santé et de bien- Why it’s important to have regular physical activity: être est le Programme de rabais d’entreprise de l’ACMV-GoodLife • Weight control à l’intention des membres de l’ACMV. • Prevention or management of health conditions and diseases Pourquoi il est important de s’adonner régulièrement à de • Mood and mental health improvement l’activité physique : • Increasing energy • Contrôle du poids • Sleep improvement • Prévention ou gestion des troubles de santé et des maladies Why it’s important for you and your employees to be active • Amélioration de l’humeur et de la santé mentale and healthy: • Regain d’énergie • 60% of Canadians are overweight and 23% are clinically • Sommeil de meilleure qualité obese. These factors could inhibit work performance and Pourquoi il est important que vous et vos employés demeuriez contribute to increased employer costs related to absentee- actifs et en santé : ism, benefit costs and short- and long-term disability leaves. • 60 % des Canadiens souffrent d’embonpoint et 23 % sont • Work-related stress — the number one health risk affecting cliniquement obèses. Ces facteurs pourraient entraver leur Canadian employees — is linked to poor health. rendement au travail et contribuer à une hausse des coûts de In the veterinary profession, stress and the danger of long- l’employeur à cause de l’absentéisme, des coûts des avantages term exhaustion are significant, and the risk of suicide among sociaux ainsi que des congés d’invalidité de courte et de longue veterinarians is disturbing. The long hours, heavy workload, durée. and poor work-life balance threaten the health and well-being • Le stress relié au travail — le risque numéro un pour la santé of all veterinary professionals, whether you’re a student, faculty, qui affecte tous les employés canadiens — est associé à une practice owner, practice manager or associate veterinarian. mauvaise santé. A healthier, happier life is one step away. The CVMA corpo- Dans la profession vétérinaire, le stress et le danger rate membership can save you up to 40% off regular individual d’épuisement à long terme sont importants et le risque de suicide membership rates. To view the GoodLife flyer or FAQs, visit parmi les vétérinaires est troublant. Les longues heures, la lourde the CVMA website’s Member Benefits and Services section charge de travail et un mauvais équilibre travail-vie menacent (www.canadianveterinarians.net/membership/benefits-services). la santé et le bien-être de tous les professionnels vétérinaires, To join now, visit (corporate.goodlifefitness.com), have your que vous soyez étudiant, professeur, propriétaire de pratique, CVMA Membership ID Number ready and select Canadian gestionnaire de pratique ou vétérinaire salarié. Veterinary Medical Association (ACMV). If you do not have Une vie plus heureuse et en meilleure santé se trouve à votre or forget your ID number or have additional questions, please portée. L’abonnement d’entreprise de l’ACMV peut vous économiser contact the CVMA ([email protected]). jusqu’à 40 % sur le prix de l’abonnement individuel régulier. Pour visualiser le feuillet GoodLife ou la FAQ, visitez la section des Avantages et services aux membres du site Web de l’ACMV (veterinairesaucanada.net/membership/benefits-services). Pour vous abonner maintenant, visitez (corporate.goodlifefitness. com), ayez votre numéro de membre de l’ACMV à portée de la main et choisissez Association canadienne des médecins vétérinaires (ACMV). Si vous n’avez pas votre numéro de membre ou si vous l’avez oublié ou pour toute autre question, veuillez contacter l’ACMV ([email protected]).

796 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY

Animal Welfare: Safeguarding the Protégez les cinq libertés afin N Five Animal Freedoms d’assurer le bien-être animal Animal Health Week 2017 Semaine de la vie animale 2017 he Canadian Veterinary Medical Association (CVMA) is Association canadienne des médecins vétérinaires (ACMV) Treminding animal owners about the 5 basic freedoms animals L’ désire rappeler aux propriétaires d’animaux les cinq libertés require to survive and thrive: adequate shelter, proper nutrition, animales fondamentales dont ils ont besoin pour survivre et appropriate veterinary care, proper socialization, and the ability s’épanouir : un hébergement adéquat, une alimentation appropriée, to exhibit normal behaviors. des soins vétérinaires appropriés, une socialisation appropriée et Under the campaign slogan, “Animal Welfare: Safeguarding la capacité de manifester un comportement normal. the Five Animal Freedoms,” Animal Health Week, a national Sous la bannière du slogan de la campagne «Protégez les public awareness campaign running from October 1 to 7, 2017, cinq libertés afin d’assurer le bien-être animal», la Semaine highlights the fundamental elements animal owners are required de la vie animale, une campagne nationale de sensibilisation du to provide the animal(s) in their care to ensure them healthy public qui se déroulera du 1er au 7 octobre 2017, soulignera les and happy lives. éléments fondamentaux que les propriétaires doivent fournir aux Dr. Troy Bourque, 2016–17 CVMA president, explains why animaux confiés à leurs soins afin d’assurer qu’ils mènent une vie his clinic is celebrating this year’s Animal Health Week. heureuse et en santé. “We are becoming more acutely aware as a society that it is Le Dr Troy Bourque, président 2016–2017 de l’ACMV, our responsibility as guardians to provide the animals in our explique pourquoi sa clinique célèbre la Semaine de la vie animale care with the necessities they require to live healthy and happy de cette année. lives. It is our duty to fulfill each of the Five Animal Freedoms «Nous devenons de plus en plus conscients en tant que and provide pets and other animals in our care with these ele- société de notre responsabilité de gardiens afin de fournir aux ments that not only allow them to survive, but to thrive. We’re animaux confiés à nos soins ce dont ils ont besoin pour vivre celebrating Animal Health Week at our clinic because we rec- heureux et en santé. C’est notre devoir de respecter chacune des ognize the importance of instilling this sense of responsibility cinq libertés animales et de fournir aux animaux de compagnie et in our clients.” aux autres animaux confiés à nos soins tous les éléments dont We invite you to share your celebrations on Facebook or ils ont besoin non seulement pour survivre, mais pour s’épanouir. Twitter using the hashtag #AnimalHealthWeek. Nous célébrons la Semaine de la vie animale à notre clinique parce Our generous supporters que nous reconnaissons l’importance d’inculquer ce sentiment de responsabilité à nos clients.» Generous support of the 2017 Animal Health Week campaign Nous vous invitons à partager vos célébrations sur Facebook is provided by Principal Plus Sponsor, Boehringer Ingelheim, ou Twitter en utilisant le mot-clic #CélébronslaSVA. Principal Sponsor, Petsecure, and Program Sponsors, Elanco and iFinance Canada (Petcard). This month, we invite you to Nos généreux commanditaires learn more about our Program Sponsor, Elanco. La campagne 2017 de la Semaine de la vie animale est A message from Elanco généreusement appuyée par le commanditaire principal plus, Boehringer Ingelheim, le commanditaire principal, Petsecure, et As an animal health company, Elanco is dedicated to safe- les commanditaires de programme, Elanco et iFinance Canada guarding animal welfare and respect for animals around the (Petcard). Ce mois-ci, nous vous invitons à en apprendre davantage world. Our products and services empower veterinarians, pet à propos de notre commanditaire de programme, Elanco. owners, and farmers to achieve good welfare outcomes for animals — from pain relief, to disease prevention, to efficient Un message d’Elanco use of resources. We believe animal welfare is integral to the En tant que compagnie de santé animale, Elanco se consacre à la sustainability of our global communities, which means looking préservation du bien-être animal et du respect pour les animaux

CVJ / VOL 58 / AUGUST 2017 797 FOR PERSONAL USE ONLY

N partout dans le monde. Nos produits et services habilitent les vétérinaires, les propriétaires d’animaux et les agriculteurs à obtenir de bons résultats de bien-être pour les animaux — allant du soulagement de la douleur à la prévention des maladies en passant par l’utilisation efficace des ressources. Nous croyons que le bien-être animal fait partie intégrante de la durabilité de nos collectivités mondiales, ce qui signifie que nous devons envisager at the whole picture of animal care, not just the role that our les soins aux animaux de manière globale et non seulement le products play. Respect for animals means taking responsibility rôle de nos produits. Le respect des animaux signifie assumer for our role in safeguarding their welfare and supporting food la responsabilité de notre rôle de protection de leur bien-être et and companionship that enriches lives. appuyer les aliments et la compagnie qui enrichissent nos vies. We are empowering stakeholders worldwide with a science- Nous habilitons les intervenants à l’échelle mondiale en ayant based approach to understanding and practicing good animal recours à une approche scientifique face à la compréhension et à care that provides positive outcomes for animals. Elanco applies la prestation des bons soins aux animaux qui assure des résultats the principles of animal welfare from product development positifs pour les animaux. Elanco applique les principes de bien- through support for the responsible use of animal health prod- être des animaux depuis le développement des produits jusqu’au ucts and services — for all animals. To improve or sustain good soutien de l’utilisation responsable des produits et des services animal care today, and set the stage for future generations, we de santé animale — pour tous les animaux. Afin d’améliorer ou de are actively collaborating with diverse stakeholders to listen, soutenir les bons soins aux animaux aujourd’hui et de préparer learn, and share knowledge so we can work together to focus on l’avenir pour les générations futures, nous collaborons activement housing, feeding, health, and appropriate behaviors that sustain avec divers intervenants pour écouter, apprendre et partager nos or improve animal welfare outcomes and the critical relationship connaissances afin que nous puissions travailler ensemble pour to sustainability. nous pencher sur l’hébergement, l’alimentation, la santé et des Ultimately, how we contribute to the Five Freedoms for ani- comportements appropriés qui appuient ou améliorent les résultats mals is less about us, and more about empowering others in their de bien-être animal et le lien critique avec la viabilité. efforts to provide good animal care and innovative solutions that En bout de ligne, nous contribuons aux cinq libertés animales support animals having a life worth living. We say thank you to non pas en nous penchant sur nos besoins mais en habilitant les all the veterinarians, pet owners, and farmers who are responsible autres dans leurs efforts en vue de fournir des bons soins aux for animal welfare outcomes every day. animaux ainsi que des solutions innovatrices qui appuient une For more information about Elanco or the products that we vie animale qui vaut la peine d’être vécue. Nous remercions tous sell, visit (elanco.ca). les vétérinaires, propriétaires d’animaux et agriculteurs qui sont responsables des résultats de bien-être animal tous les jours. Pour en savoir davantage à propos d’Elanco ou des produits que nous vendons, visitez (elanco.ca).

CVMA’s Group Insurance Program Provides Protection and Saves You Money Le Programme d’assurance de groupe de l’ACMV fournit de la protection et vous permet de réaliser des économies he Canadian Veterinary Medical Association’s Group e Programme d’assurance de groupe de l’Association TInsurance Program offers CVMA members exclusive, spe- Lcanadienne des médecins vétérinaires offre aux membres cialized group insurance solutions including liability/malpractice, de l’ACMV des solutions d’assurance de groupe spécialisées et commercial, employee benefits and life and disability. The exclusives, dont l’assurance responsabilité et faute professionnelle, CVMA Program also offers members exclusive rates, discounts l’assurance commerciale, des avantages sociaux pour les employés and benefits on home, automobile, recreational vehicle and ainsi que l’assurance vie et invalidité. Le Programme de l’ACMV travel insurance. offre aussi aux membres des tarifs et des avantages exclusifs sur l’assurance habitation et automobile ainsi que sur l’assurance des Western Financial Insurance Group véhicules récréatifs et de voyage. Solutions CVMA’s endorsed partner, Western Financial Group Insurance Solutions de Western Financial Insurance Solutions (WFGIS) delivers policies tailored to every CVMA Group member’s unique needs. Since its inception in 2005, the CVMA Le partenaire approuvé de l’ACMV, Western Financial Group Insurance Program has provided stable pricing and coverage Insurance Solutions (WFGIS), offre des polices conçues sur flexibility to over 1800 practices. mesure afin de répondre aux besoins uniques des membres de

798 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY

The best time to review your insurance is 2 to 3 months prior l’ACMV. Depuis sa création en 2005, le Programme d’assurance N to the policy renewal date. During the year, WFGIS may contact de l’ACMV a fourni des tarifs stables et une couverture flexible à non-participating CVMA members, identifying themselves as plus de 1800 pratiques. CVMA’s insurance partner, to determine your policy renewal Le meilleur moment pour examiner votre assurance est de date and ensure sufficient time to review with you your insurance deux à trois mois avant la date de renouvellement de la police. needs and coverage options. Pendant l’année, WFGIS pourra contacter des membres de l’ACMV WFGIS requires practice information to develop coverage non-participants en s’identifiant comme le partenaire d’assurance proposals and may have questions about the physical property, de l’ACMV afin de déterminer la date de renouvellement de votre operations, sales, claims history and current insurance situation, police et d’assurer suffisamment de temps afin d’examiner avec including the existing commercial policy or coverage booklets, vous vos besoins d’assurance et vos options de couverture. employee data and a recent employee group benefits invoice. WFGIS a besoin de renseignements sur la pratique afin de This information ensures the coverage offered is tailored to the préparer des propositions d’assurance et l’entreprise pourra avoir practice’s specific needs and is comparable or superior to your des questions à propos des biens physiques, de l’exploitation, du current insurance policy. To honor the guaranteed 10% reduc- chiffre d’affaires, des antécédents de réclamations et de la situation tion for equivalent coverage, WFGIS may review your current actuelle d’assurance, y compris la police commerciale en vigueur policy to provide a comparable coverage quote. ou les livrets d’assurance, des données sur les employés et une The coverage proposal and insurance plan comparison illus- facture récente pour les avantages sociaux collectifs des employés. trates the differences between your expiring policy and the Ces renseignements garantissent que la couverture offerte sera Program coverage offered and is reviewed with you to explain conçue en fonction des besoins spécifiques de la pratique et qu’elle the coverage and address your questions or concerns. WFGIS sera comparable ou supérieure à votre police d’assurance actuelle. ensures a seamless transition to the CVMA Program by arranging Afin d’honorer la réduction garantie de 10 % pour une couverture proper documentation for all parties. équivalente, WFGIS pourra examiner votre police actuelle afin de fournir une soumission de couverture comparable. The Personal Home and Auto Insurance La proposition d’assurance et la comparaison du régime CVMA’s partner, The Personal Insurance Company’s Home and d’assurance illustrent les différences entre la police qui expirera Auto Group Insurance, offers CVMA members personalized et la couverture offerte par le programme et elle est examinée coverage, discounts and quality service with no-hassle claims avec vous afin de vous expliquer la couverture et répondre à and fast convenient service from knowledgeable agents. Your vos questions ou à vos préoccupations. WFGIS assurera une spouse and dependents can also benefit from your group offer, transition harmonieuse au Programme de l’ACMV en préparant les including: documents appropriés pour toutes les parties. • Save 5% on your premium all year when driving with 4 winter tires during the winter months. Assurance habitation et auto • Switch and you’re welcomed with savings up to 7%. La Personnelle Le partenaire de l’ACMV, l’assurance habitation et auto de groupe La Personnelle, offre aux membres de l’ACMV une couverture personnalisée, des rabais ainsi qu’un service de qualité avec un service de réclamations sans tracas et rapide offert par des agents expérimentés. Votre conjoint et vos personnes à charge peuvent aussi profiter de votre offre de groupe, y compris les avantages suivants : • Économisez 5 % sur votre prime toute l’année lorsque vous conduisez avec quatre pneus d’hiver durant les mois d’hiver. • Souscrivez une police et vous recevrez un rabais de bienvenue pouvant atteindre 7 %. • Les étudiants au collège ou à l’université qui sont à charge et âgés de moins de 25 ans réalisent des économies. • Vous économiserez si un système d’alarme central est installé à votre domicile.

CVJ / VOL 58 / AUGUST 2017 799 FOR PERSONAL USE ONLY

N • Dependent college or university students under 25 save. • Économisez sur votre assurance habitation lorsque vous assurez • You’ll save if your home has a central alarm system. aussi votre automobile. • Save on your home insurance when you also insure your car. • Vous payez une seule franchise si vous devez déposer une • You only pay one deductible should you have a claim involv- réclamation pour votre habitation et votre automobile. ing home and auto. La Personnelle rend l’assurance encore plus facile en vous Now, The Personal Insurance Co. made insurance even easier offrant Alerte, des notifications en temps réel qui sont envoyées with Alert; real time smartphone notifications if water leakage is à votre téléphone intelligent en cas de détection d’inondation. detected. With Alert, you can relax knowing you will be notified Grâce à Alerte, vous aurez l’esprit tranquille en sachant que l’on before water leakage worsens. Alert is exclusive to all insured vous avisera avant que les dégâts d’eau ne deviennent encore plus with The Personal and the water and freeze detector are free! importants. Alerte est offerte en exclusivité à tous les assurés de The Personal App also features online services to manage your La Personnelle et vous obtiendrez gratuitement un détecteur de policies or file a claim anytime, anywhere. fuite d’eau et de gel! L’appli La Personnelle offre aussi des services If you’re looking for travel or pet insurance, or need insurance en ligne qui vous permettent de gérer vos polices ou de déposer for your recreational vehicle, talk to The Personal. They also une réclamation partout et en tout temps. provide this type of coverage. Si vous cherchez de l’assurance voyage ou de l’assurance To get a quote, download the App (promo.thepersonal. maladie pour animaux de compagnie ou si vous avez besoin com/mobile-app) or call the Personal Insurance Co. at d’assurance pour votre véhicule récréatif, parlez à un représentant 1-866-860-CVMA (2862). de La Personnelle, car la compagnie offre aussi cette couverture. The CVMA Insurance Program was designed for veterinar- Pour obtenir une soumission, téléchargez l’appli (promo. ians and is overseen by the CVMA for the protection of its thepersonal.com/mobile-app) ou appelez La Personnelle au members. For additional information, call 1-866-860-2862 or 1-866-860-CVMA (2862). visit (cvmainsurance.com). Le Programme d’assurance de l’ACMV a été conçu pour les vétérinaires et est supervisé par l’ACMV pour la protection de ses membres. Pour obtenir des renseignements additionnels, composez le 1-866-860-2862 ou visitez (cvmainsurance.com).

The Role of CVMA Position Statements Le rôle des énoncés de position de l’ACMV ne important way that Canadian veterinarians can support ne façon importante dont les vétérinaires canadiens peuvent Othe national veterinary community and help veterinar- Uappuyer la collectivité vétérinaire nationale et aider les ians to lead the stewardship of animal welfare in Canada, is vétérinaires à orienter la gestion du bien-être animal au Canada est to contribute to the development and presentation of strong, de contribuer à l’élaboration et à la présentation de positions solides unified positions on important matters of concern to Canadian et solidaires sur des questions importantes pour les vétérinaires veterinarians. canadiens. The CVMA National Issues Committee (NIC) and Animal Le Comité sur les enjeux nationaux (CEN) et le Comité sur Welfare Committee (AWC) continually review and monitor le bien-être animal (CBA) de l’ACMV examinent et surveillent de veterinary and animal welfare issues. On important issues, and manière continue les enjeux vétérinaires et les questions liées au where concerns exist based on ethics and/or scientific evidence, bien-être animal. Les comités pourront se fonder sur des enjeux the committees may develop Position Statements and present importants et les situations où il existe des preuves déontologiques them to the CVMA Council for approval and adoption. et/ou scientifiques pour élaborer des énoncés de position et les CVMA Position Statements are used by CVMA members, the présenter au Conseil de l’ACMV aux fins d’approbation et d’adoption. public, and the media. When specific issues arise, media outlets Les énoncés de position sont utilisés par les membres de l’ACMV, may contact the CVMA seeking current Canadian veterinary le public et les médias. Lorsque des questions spécifiques sont soulevées, les médias pourront contacter l’ACMV afin d’obtenir les points de vue des vétérinaires canadiens. Les exemples incluent des enjeux sur les usines à chiots, la violence envers les animaux, l’euthanasie, le recours et la résistance aux antimicrobiens et les lois sur les chiens méchants. Les énoncés de position servent de fondement aux déclarations de l’ACMV aux médias et ils sont fournis aux porte-parole de l’ACMV lorsqu’on leur demande de représenter l’ACMV auprès des médias afin qu’ils possèdent des notes factuelles et conformes à l’opinion solidaire de tous les vétérinaires canadiens.

800 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY viewpoints. Examples include issues related to puppy mills, ani- Les énoncés de position de l’ACMV, qui abordent des enjeux N mal abuse, euthanasia, antimicrobial use/resistance, and vicious vétérinaires nationaux et des questions liées au bien-être animal, ont dog legislation. Position Statements form the basis of CVMA’s pour but d’orienter la profession et d’informer le public sur le point media statements and are provided to CVMA spokespersons de vue de la collectivité vétérinaire. Les positions visent à présenter when they are asked to represent the CVMA to the media so des points de vue «avant-gardistes» sur des questions sociétales they have concise, evidence-based speaking notes, unifying the et vétérinaires canadiennes et internationales. Cependant, on voices of all Canadian veterinarians. reconnaît et encourage les organismes de réglementation à en tenir CVMA Position Statements, addressing national veterinary compte lors de la mise à jour ou de la modification des règlements issues and animal welfare, are meant to guide the profession and vétérinaires (p. ex., chirurgie esthétique, dentisterie vétérinaire). to educate the public from the point of view of the veterinary Le but du CBA consiste à appuyer l’ACMV en étant un défenseur community. Positions are intended to present “forward-thinking” solide, visible, actif et avant-gardiste du bien-être animal. Le viewpoints on Canadian and international societal and veterinary CBA examine surtout des preuves scientifiques qui serviront de issues. Positions are not developed to regulate the veterinary pro- fondements factuels pour les positions sur le bien-être animal. Le fession; however, it is recognized and encouraged that provincial CBA considère aussi les enjeux éthiques, philosophiques et moraux regulatory bodies consider them when updating or amending entourant les questions liées au bien-être animal. veterinary bylaws (e.g., cosmetic surgery, veterinary dentistry). Le CEN a pour but d’appuyer l’ACMV afin d’aider les vétérinaires The goal of the AWC is to support the CVMA by being a canadiens à identifier, à évaluer et à aborder les enjeux nationaux strong, visible, active and leading advocate for animal welfare. et de défendre leurs intérêts sur des questions portant sur la santé The AWC deals primarily with scientific evidence providing the animale, la santé publique, la santé des écosystèmes et la salubrité factual basis for animal welfare positions. The AWC also consid- des aliments. Le CEN se penche principalement sur les preuves ers the ethical, philosophical, and moral concerns surrounding scientifiques servant de données probantes aux positions. animal welfare issues. Lorsque le CBA ou le CEN identifie des enjeux exigeant The goal of the NIC is to support the CVMA in leading une position, ils sont présentés au Conseil de l’ACMV aux fins Canadian veterinarians in identifying, assessing and address- d’approbation. Le Conseil peut aussi identifier un enjeu et demander ing national issues and advocate on their behalf on matters of au CBA ou au CEN d’élaborer une position. Les membres de animal health, public health, eco-system health, and food safety. l’ACMV sont invités à formuler des commentaires sur l’ébauche The NIC deals primarily with scientific evidence providing the des énoncés de position afin que le CEN ou le CBA puissent tenir factual basis for positions. compte de la rétroaction dans la version finale. On transmet aussi When the AWC or the NIC identifies issues requiring a posi- l’ébauche aux organismes de réglementation provinciaux de la tion they are brought to the attention of the CVMA Council for médecine vétérinaire pour qu’ils la fassent circuler et ils sont invités its approval. Council may also identify an issue and request that à fournir des commentaires. Les ébauches finales des positions sont the AWC or the NIC develop a position. CVMA members are examinées par le Conseil et les positions approuvées sont affichées invited to comment on draft Position Statements so the NIC or sur le site Web de l’ACMV. the AWC can take the feedback into account in the final draft. Provincial veterinary regulatory bodies are also provided the draft to circulate with an invitation to comment. Final position drafts are reviewed by Council, and approved positions are posted on the CVMA Website.

CVJ / VOL 58 / AUGUST 2017 801 FOR PERSONAL USE ONLY Cross-Canada Disease Report Rapport des maladies diagnostiquées au Canada

Canada Serotyping of Haemophilus parasuis field isolates from diseased pigs in Quebec by indirect hemagglutination assay and multiplex polymerase chain reaction (PCR)

Sonia Lacouture, Edisleidy Rodriguez, Katrin Strutzberg-Minder, Marcelo Gottschalk

aemophilus parasuis, the etiological agent of Glässer’s dis- L S1 S3 S4 S7 S14 S2 S9 S13 S15 S6 S8 S10 S11 S5/12 H ease, is one of the most important bacterial pathogens of swine (1). It usually causes polyserositis, but infection may also result in arthritis, meningitis, and septicemia (sudden death) (1). Haemophilus parasuis also contributes to porcine respiratory disease complex, one of the leading causes of mortality in grower-finisher pigs worldwide (1). Although considered as a primary cause of pneumonia (1), strains isolated from lungs have been described as being different from those recovered from systemic infections (2). In addition, low or non-virulent strains have also been isolated from healhy lungs and bronchoalveolar fluid (1,3). Serotyping of this pathogen is important for decisions on vaccination strategy to prevent future outbreaks as bacterins which PM1 PM2 PM3 are usually used induce mainly serotype-specific immunity. The original serotyping scheme, based on reactions between Figure 1. Band patterns for the molecular serotyping antisera and surface antigens, classifies H. parasuis into 15 sero- polymerase chain reaction for all 15 serovars of H. parasuis with primer mix (PM)1, PM2, and PM3. Lane L, 100-bp DNA ladder; types. Originally, gel immunodiffusion assay (GID) was used S1 to S15 represent the 15 serotypes of H. parasuis. to describe these 15 serotypes and to perform epidemiological studies. However, the arrival of the indirect hemagglutination test (IHA) allowed identification of the serotype of many observable antigen-antibody reaction (4). Also, when several strains that had been non-typable using the GID. An isolate antisera reacted with the same isolate, it would be considered would usually be reported as non-typable if there was no as non-typable or it would be assigned the serotype indicated by the strongest agglutination reaction (4), depending on the laboratory in which the serotyping was carried out. Using these Groupe de Recherche sur les Maladies Infectieuses du methods, distribution of serotypes in various countries showed Porc (GREMIP) and Diagnostic Service, Faculté de méde- that, in general, the prelevant serotypes were (the order may vary cine vétérinaire, Université de Montréal, 3200 rue Sicotte, depending on the country): 2, 5, 4, 7, 13, and 14 (5). More Saint-Hyacinthe, Québec J2S 2M2 (Lacouture, Gottschalk); specifically, the sole serotyping report from Canada (Quebec) Laboratoire d’expertise en pathologie animale du Québec more than 10 y ago showed that serotypes 4 (27%), 5 (15%), (LEPAQ), 2650, rue Einstein, Québec, Québec G1P 4S8 13 (14%), and 7 (12%) were the most prevalent (6). In the (Rodriguez); IVD Innovative Veterinary Diagnostics Laboratory, same study, serotypes 4 (25%), 12 (23%), and 5 (15%) were Seelze, Germany (Strutzberg-Minder). shown to be mainly present among US strains (6). During the Address all correspondence to: Dr. Marcelo Gottschalk; e-mail: last few years, a relatively high percentage of untypable and/or [email protected] cross-reacting strains have been reported elsewhere (5) as well as Use of this article is limited to a single copy for personal study. in isolates from Quebec (Laboratoire d’expertise en pathologie Anyone interested in obtaining reprints should contact the animale du Québec, LEPAQ, unpublished data). Based on the CVMA office ([email protected]) for additional concept that the capsule locus is responsible for the phenotype copies or permission to use this material elsewhere. of the capsule, a single-step multiplex polymerase chain reaction

802 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY

14 REPORT DISEASE CROSS-CANADA 30 12 25 10 20 8 15 Frequency 6

10 Frequency 4 5 2 0 1 2 3 4 5 or 6 7 8 9 10 11 13 14 15 NT 0 12 1 2 3 4 5 or 12 6 7 8 9 13 14 Serotype Serotype mPCR serotyping IHA serotyping Systemic isolates Respiratory isolates

Figure 2. Serotype distribution of 90 Canadian isolates of Figure 3. Serotype distribution of H. parasuis among systemic H. parasuis as determined by IHA (black) and mPCR (white). (white) and respiratory (black) isolates tested by mPCR.

(mPCR) was developed (4). Fourteen out of 15 serotypes could isolates by using PCR has been recently reported (4,5). More be individually identified, as no gene could be identified to dif- than half of serotype 7 isolates (52.9%) could not be originally ferentiate between serovars 5 and 12, as shown by whole-genome serotyped by IHA; the remaining isolates belonged to serotypes sequences of these serovars (7). In the present study, strains 2 (17.6%), 5/12 (17.6%), and 3, 6, 8, and 13 (2.9% each sero- recovered from diseased pigs in Quebec were serotyped using type). Failure in serotyping of these strains by IHA may be due IHA and a modified version of the mPCR test. to factors such as a lower sensitivity of the serological test or A total of 90 isolates of H. parasuis recovered from diseased lack of phenotypic expression of the capsule (4). pigs in Quebec were included in this study: 25 isolates were Using the mPCR technique, serotypes 7 and 5/12 (22.2% recovered from systemic diseases (polyserositis, meningitis, each) were the most common serotypes found, followed by arthritis), 62 isolates were obtained from lungs of animals with serotypes 4 (15. 6%) and 13 (11.1%). Although this is not a respiratory disease, and 3 isolates had no accompanying infor- prevalence study, it is interesting to note that these 4 serotypes mation. The IHA test was conducted as previously described (6). are the same that were most commonly detected in the previous The mPCR test was a modification of a previously published study which also included strains from Quebec (6). Serotypes protocol (4). In our hands, results from the the original single- 2 (7.8%), 1, 3, and 9 (5.6% each one) were also detected. step mPCR were sometimes difficult to interpret because many Serotypes 10, 11, and 15 were not found. bands were closely clustered. Hence, the test was modified in The site of isolation may also have some importance, as iso- a 3-step mPCR to clearly differentiate the serotypes. Briefly, lates cultured from sytemic diseases survived serum killing and a loopful of bacteria was suspended in 100 mL of Instagene phagocytosis and might be considered as being more virulent Matrix (Bio-Rad, Mississauga, Ontario) and manufacturer’s than those recovered from the lungs (4). The serotype distribu- instructions were followed. A 3-mL volume of Instagene extract tion of strains isolated from systemic and respiratory disease for each sample was added to each of the 3 mPCR mixtures, is shown in Figure 3. Serotypes 5/12, 7, and 2 (in decreasing which included 12.5 mL of Multiplex PCR kit (2X master mix; order) were most frequently detected among strains recovered Qiagen, Toronto, Ontario), 2.5 mL of the primer mix (PM)1, from systemic disease, whereas serotypes 7 and 13, followed by m PM2, or PM3, and 8 L of UltraPure H2O. The primer mixes serotypes 4 and 5/12 were frequently identified among respira- consisted of reverse and forward primers that target the follow- tory strains. Interestingly, all serotype 13 strains originated from ing genes: lungs. However, more studies are needed to establish a possible • PM1: funB, glyC, wciP, funQ, funAB, and HPS_219690793; relationship between the serotype and type of infection (systemic • PM2: wzx, funV, gltP, funI, and HPS_219690793; and versus respiratory). It would also be interesting to conduct the • PM3: wcwK, gltI, scdA, funX, amtA, and HPS_219690793. mPCR serotyping on isolates recovered from healthy pigs. The mPCR mixtures were heated at 95°C for 15 min, followed In conclusion, the modified mPCR is a reliable method for by 30 cycles of 94°C for 30 s, 58°C for 90 s, 72°C for 90 s, and serotyping of H. parasuis. As multiple infections of the same a final extension at 72°C for 10 min. Expected results for each individual and within herds can occur (2), a highly sensitive serotype are shown in Figure 1. test (such as the mPCR) may identify additional isolates that Serotyping results for both tests are shown in Figure 2. Of the contribute to disease in animals that are not commonly investi- 53 isolates that could be serotyped by the IHA test, only 3 gave gated. Indeed, and using the mPCR, we have already observed a result that was different from that with the mPCR (94.3% that more than one serotype may be present in the same sample agreement). A high concordance for typable isolates by both (unpublished observations). Therefore, the molecular serotyping techniques has previously been described (4). However, 37.8% assay used herein represents a significant improvement in the of isolates in this study were untypable by IHA, but all of these tools available to characterize H. parasuis isolates. could be serotyped by mPCR. A drastic reduction in untypable

CVJ / VOL 58 / AUGUST 2017 803 FOR PERSONAL USE ONLY

Acknowledgments 4. Howell KJ, Peters SE, Wang J, et al. Development of a multiplex PCR assay for rapid molecular serotyping of Haemophilus parasuis. J Clin We thank all personnel from the Laboratoire d’expertise en Microbiol 2015;53:3812–3821. pathologie animale du Québec (LEPAQ) for providing the 5. Ma L, Wang L, Chu Y, et al. Characterization of Chinese Haemophilus parasuis isolates by traditional serotyping and molecular serotyping isolates and performing the IHA tests. This study was funded methods. PLoS One 2016;11:e0168903. by CDEVQ-MAPAQ. 6. Tadjine M, Mittal KR, Bourdon S, Gottschalk M. Development of a new serological test for serotyping Haemophilus parasuis isolates and References determination of their prevalence in North America. J Clin Microbiol 2004;42:839–840. 1. Aragon V, Segalés J, Oliveira S. Glässer’s disease. In: Zimmerman J, 7. Howell KJ, Weinert LA, Luan S-L, et al. Gene content and diversity Karriker L, Ramirez A, Schwartz K, Stevenson G. eds. Diseases of Swine. of the loci encoding biosynthesis of capsular polysaccharides of the 2012. Ames, Iowa: Wiley-Blackwell 2012:760–778. fifteen serovar reference strains of Haemophilus parasuis. J Bacteriol AU CANADA AU 2. Olvera A, Cerdà-Cuéllar M, Nofrarías M, Revilla E, Segalés J, Aragon 2013;195:4264–4273. V. Dynamics of Haemophilus parasuis genotypes in a farm recovered from an outbreak of Glässer’s disease. Vet Microbiol 2007;123:230–237. 3. Moorkamp L, Nathues H, Spergser J, Tegeler R, Grosse Beilage E. Detection of respiratory pathogens in porcine lung tissue and lavage fluid. Vet J 2008;175:273–275. RAPPORT DES MALADIES DIAGNOSTIQUÉES

804 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY Article

Agreement among undergraduate and graduate veterinary students and veterinary anesthesiologists on pain assessment in cats and dogs: A preliminary study

Graeme M. Doodnaught, Javier Benito, Beatriz P. Monteiro, Guy Beauchamp, Stefania C. Grasso, Paulo V. Steagall

Abstract — This study investigated agreement among undergraduate and graduate veterinary students and veterinary anesthesiologists on video pain assessment at the University of Montreal. Pain assessment in dogs and cats appeared to be affected by gender, previous experience, and degree of training despite a small population of observers.

Résumé — Accord entre étudiants de premier cycle, diplômés en médicine vétérinaire et anesthésistes pour l’évaluation de la douleur chez les chats et les chiens : étude préliminaire. Cette étude a évalué l’accord entre les étudiants de premier cycle, les étudiants diplômés en médicine vétérinaire et les anesthésiologistes vétérinaires pour l’évaluation de la douleur sur vidéo, à l’Université de Montréal. L’évaluation de la douleur chez les chiens et les chats était influencée par le sexe, l’expérience antérieure et le niveau de formation, malgré une population d’observateurs limitée. (Traduit par les auteurs) Can Vet J 2017;58:805–808 Introduction Materials and methods ffective pain management can only be achieved and This preliminary investigation was conducted immediately after E maintained when pain is assessed accurately and reliably. a week-long course (6 h of teaching divided in 3 blocks of 2 h) The guidelines for recognition and assessment of pain from the on pathophysiology, assessment, and treatment of pain presented World Small Animal Veterinary Association (WSAVA) Global by one of the anesthesiologists (PS) to third-year veterinary Pain Council note that there is a disparity between the occur- students at the University of Montreal. Lectures were given as rence and the successful management of pain, despite advances part of course DMV3132 — “Veterinary Anesthesia, Analgesia, in the area. The inability to accurately diagnose pain, limited and Resuscitation.” availability of analgesics, and limitations in clinical understanding remain the most important causes (1). Pain assessment has Participants and study groups been shown to be influenced by several factors including gender, A total of 93 undergraduate third-year veterinary students cultural differences, and training experience (2). (student group, SG) were invited by e-mail to participate. The aim of this preliminary study was to investigate the Participation was anonymous and voluntary, and the results had agreement among undergraduate and graduate veterinary stu- no impact on final grades. Three graduate students [2 individu- dents and veterinary anesthesiologists on pain assessment in als enrolled in a 3-year residency training program approved by canine and feline patients. The authors hypothesized that the American College of Veterinary Anesthesia and Analgesia undergraduate third-year veterinary students would score pain in (ACVAA) and 1 PhD student studying the pharmacology of dogs and cats similarly to graduate students and board-certified pain; graduate students group, GG] and 2 diplomates of the anesthesiologists. ACVAA (anesthesiologists group, AG) were also included.

Departments of Clinical Sciences (Doodnaught, Benito, Grasso, Steagall), Biomedical Sciences (Monteiro), and Associate Dean Office for Research and Graduate Studies (Beauchamp), Faculty of Veterinary Medicine, University of Montreal, 3200 Rue Sicotte, Saint-Hyacinthe, Quebec J2S 2M2. Address all correspondence to Dr. Paulo Steagall; e-mail: [email protected] Presented in part at the Association of Veterinary Anaesthetists Spring Meeting, Lyon, France, April 2016. Dr. Monteiro is a recipient of the Vanier Canada Graduate Scholarship. Use of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.

CVJ / VOL 58 / AUGUST 2017 805 FOR PERSONAL USE ONLY

Study design and performance Table 1. Demographic data collected from third-year veterinary students at the University of Montreal who completed video-based The post-training survey model used was designed as a pre- pain assessments liminary, exploratory, prospective study. The vice-dean of stu- Number of dent affairs at the University of Montreal approved the study. Collected information individuals Approval from the animal ethics committee of the University of Gender Montreal was not required since live animals were not included. Female 47 Male 9 Questionnaire Previous work experience Participants completed an anonymous questionnaire before Healthcare professional 2 ARTICLE video analysis. The questionnaire, composed in French, con- Veterinary technician 3 Worked in a veterinary clinic 12 sisted of items to determine the participant’s age, gender, previ- Veterinarian (foreign-trained) 1 ous work experience (health professional, veterinary technician, Previous pain experience veterinarian, and/or previous work in a veterinary clinic) and Students who have had surgery which 16 previous pain experience. The latter was investigated by asking required general anesthesia the following questions (Yes/No answer): “Have you ever had Students who have taken analgesics for 7 a chronic condition surgery while under general anesthesia?” and “Have you ever taken analgesics for a chronic painful condition?” with the group (SG, GG, AG) as a between-subject factor. The Videos unequal variances in the different groups were also taken into Four videos of approximately 5 min each were presented in account using the Tukey-Kramer post-hoc test (P # 0.05). For the same order. The content of the videos included 2 domes- the analysis of the question, “Should the animal in the video tic female shorthaired cats (cats 1 and 2) in the postopera- receive rescue analgesia treatment?” responses among groups tive period following ovariohysterectomy (available online at were compared using an exact Chi-squared test. The GG and www.animalpain.com.br, test videos numbers 4 and 7), 1 male AG groups were combined for the Chi-squared analysis due to Doberman dog with suspected prostatic disease (dog 1) and the limited number of respondents in these groups. A P-value 1 female Dogue de Bordeaux following exploratory celiotomy # 0.05 was considered to be statistically significant. Standard (dog 2). Before each video, participants were informed about the software was used to carry out statistical analyses (SAS, version patient’s signalment (age, gender, and breed), as well as medical 9.3, SAS Institute, Cary, North Carolina, USA). condition (dog 1) or type of surgery performed (dog 2, cats 1 and 2). However, they were blinded to any analgesic treatment Results and were not allowed to discuss the cases. Mean 6 standard deviation of students’ age was 23.8 6 8.5 y. Student demographics are presented in Table 1. Fifty-six (60%) Pain scales students participated and 8 (14%) completed all sections of the The pain assessment of the video cases was performed individu- questionnaire and pain assessment. With respect to pain evalua- ally using ordinal validated instruments, 2 for each cat, and 1 for tions, response rate to the MCPS and canine GCMPS-SF were each dog. Pain in cats was evaluated using the French version of at least 77% (n $ 43), case-specific response rates are shown the UNESP-Botucatu multidimensional composite pain scale in Table 2. (MCPS) (3) and the short-form of the Glasgow composite pain Female participants (n = 47) recorded lower pain scores scale (GCMPS-SF) (4). Pain in dogs was evaluated using the for cat 1 (P = 0.01) and higher scores for dog 2 (P = 0.04) French version of the Glasgow composite pain scale short-form compared with male participants in SG using the GCMPS-SF. (GCMPS-SF) (5). These instruments require both static and Previous work experience in veterinary practice or healthcare dynamic behavioral evaluations. After watching each video and was associated with significantly decreased pain scoring for completing the scales, participants were asked if they would dog 2 (P = 0.02). Undergraduate students did not score pain administer rescue analgesia to the animal: “Should the animal of significant difference with respect to their previous painful on the video receive rescue analgesia?” (Dichotomous answer, experiences (Table 2). Additionally, no significant differences Yes/No). for age were found when the SG was compared with GG and AG. Pain scores were only different between groups for dog 2, Statistical analysis in which SG scored significantly higher compared with GG Statistical analysis was conducted using unequal variances t-tests (P = 0.01) and AG (P = 0.01). (P # 0.05) for investigating differences among the undergradu- Undergraduate students were significantly more likely to ate students group (SG), for gender, previous work experience administer rescue analgesia for dog 2 (P = 0.01) compared with (e.g., health professional, veterinary technician, veterinarian, the combined GG and AG. No significant differences were previous clinical work), and previous pain experience (e.g., if detected for the other video assessments. they were under surgery previously, if they were treated with analgesics anytime). Comparisons among the different groups Discussion (SG, GG, AG) were investigated for age and for the pain scores This study compared the agreement among undergraduate recorded for the various videos assessed. Data were compared students and graduate veterinary students and veterinary

806 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY

Table 2. Pain scores (mean 6 SEM) with respect to previous painful experiences. Undergraduate students did not score pain significantly different with respect to their previous painful experiences Video case Cat 1 Cat 2 Dog 1 Dog 2 UNESP- GCPS UNESP- GCPS GCPS-SF GCPS-SF Pain scale MCPS feline MCPS feline canine Canine QUESTION 1: Have you ever had an operation under general anesthesia? ARTICLE Number of total answers (N) 45 15 44 13 50 43 No n 29 10 31 9 34 28 mean (6 SEM) 18.8 (6 0.4) 10.3 (6 1.8) 6.6 (6 0.7) 4.7 (6 1.1) 3.3 (6 0.5) 7.2 (6 0.5) Yes n 16 5 13 4 16 15 mean (6 SEM) 19.7 (6 0.5) 9.6 (6 2.4) 7.3 (6 1.3) 3.0 (6 1.1) 4.6 (6 0.8) 8.1 (6 1.0) P-value (P , 0.05) P = 0.14 P = 0.82 P = 0.62 P = 0.31 P = 0.19 P = 0.42 QUESTION 2: Have you ever taken painkillers for chronic disease? Number of total answers (N) 45 15 44 13 50 43 No n 50 15 40 13 43 37 mean (6 SEM) 19.1 (6 0.3) 10.1 (6 1.4) 7.1 (6 0.6) 4.2 (6 0.9) 3.7 (6 0.4) 7.6 (6 0.5) Yes n 5 0 4 0 7 6 mean (6 SEM) 18.8 (6 0.8) — 4.0 (6 1.4) — 3.6 (6 1.4) 6.8 (6 2.0) P-value (P , 0.05) P = 0.72 — P = 0.11 — P = 0.96 P = 0.70

UNESP — multidimensional composite pain scale (MCPS); Glasgow composite pain scale (GCPS); SF — Short form; SEM — standard error of the mean.

anesthesiologists on pain assessment in cats and dogs. Results Gender differences were seen on a case-specific basis in the showed that following an introductory course, differences on present study; for example, male participants provided higher pain assessment in cats and dogs by veterinary students might be pain scores for “cat 1” than did their female counterparts, and affected by gender and previous experience. Despite using vali- vice versa for “dog 2.” Interestingly, no difference was seen dated instruments, veterinary students scored pain differently for using the MCPS for cat 1, possibly because most individuals dog 2 compared with graduate students and anesthesiologists. completed the MCPS and often left the GCMPS-SF blank. A better appreciation of pain management has been attributed Regardless, the feline MCPS scale was simply more robust in to previous experience in a survey with Canadian pet owners this comparison among the students. Further investigation into (6). The pain assessments for “dog 2” showed the most incon- gender differences and pain instrument validity for veterinary sistencies not only within SG but also in the comparisons with students is warranted. GG/AG. The dog was filmed in the early postoperative period The current literature on pain education in veterinary medical and was showing signs of sedation and residual anesthesia. These curricula has generally shown improved appreciation, under- findings suggest previous experience with anesthetic recovery, standing, and treatment of pain following both didactic and pain assessment, and postoperative care may help in differenti- “hands-on” approaches to teaching (7,8,13). As this is an initial ating sedation and pain. The absence of practical, “hands-on” investigation and internal audit on the subject in our institu- training early in the veterinary curriculum could be an explana- tion, follow-up investigation should focus on specific teaching tion, as observed in another veterinary academic institution (7). methods and determine strengths and weaknesses, both student- Clinical practice-based training improved perceptions and the perceived and clinical outcome-driven. ability of veterinary students to assess and control pain (8). It There are several limitations in the current study that should would be of interest to explore whether this disparity in pain be addressed. Small group sizes may have led to type II error assessments persists with further training. within the study, potentially excluding any differences attrib- Proxy pain assessment is influenced by the observers’ per- utable to age or personal pain experiences, or even between sonal societal and professional experience. Female participants groups (SG versus GG and AG) that may exist. Beyond this, the appeared to be more empathetic and likely to score pain higher, study was entirely based on video assessment. The instruments particularly for female-specific (e.g., metritis/pyometra) con- provided (MCPS and GCMPS-SF) both require patient interac- ditions (9). Historically, female veterinary practitioners have tion. The absence of tactile and dynamic interaction with the been more likely to assess pain and administer analgesics in animal may influence students’ perceptions about pain. It would the acute setting (10,11). In addition, at least in Canada, there be of interest to investigate how the students’ first anesthesia was a trend favoring increased pain recognition and analgesic course itself may have affected the scores, if at all. Participation administration with younger veterinarians (more recent gradu- was optional; possibly creating an artificial selection bias in ates). This was substantiated in a follow-up study in 2001 (12). which students with greater interest in pain were more likely

CVJ / VOL 58 / AUGUST 2017 807 FOR PERSONAL USE ONLY

to participate. Finally, the study involved only one academic (CMPS-SF) and derivation of an analgesic intervention score. Animal veterinary institution in which courses are taught in French. Welfare 2007;16:97–104. 6. Steagall PV, Luca G, Monteiro BP, et al. Perceptions and opinions of It is not clear how language, veterinary curricula, and cultural Canadian pet owners about anesthesia, pain and surgery in small ani- differences would have changed these results. mals. J Small Anim Pract 2017. In press. In conclusion, the evaluation of pain in cats and dogs seemed 7. Barletta M, Young CN, Quandt JE, Hofmeister EH. Agreement between veterinary students and anesthesiologists regarding postoperative pain to be affected by gender, previous work experience, and degree assessment in dogs. Vet Anaesth Analg 2016;43:91–98. of training in this preliminary study. Further investigation into 8. Schull DN, Morton JM, Coleman GT, Mills PC. Veterinary students’ the impact of teaching methods and demographics is required perceptions of their day-one abilities before and after final-year clinical practice-based training. J Vet Med Educ 2011;38:251–261. to confirm and better understand these results. CVJ 9. Catanzaro A, Di Salvo A, Steagall PV, Zampini D, Polisca A, Della

ARTICLE Rocca G. Preliminary study on attitudes, opinions and knowledge of References Italian veterinarians with regard to abdominal visceral pain in dogs. Vet Anaesth Analg 2016;43:361–370. . 1 Mathews K, Kronen PW, Lascelles D, et al. Guidelines for recogni- 10. Dohoo SE, Dohoo IR. Factors influencing the postoperative use tion, assessment and treatment of pain: WSAVA Global Pain Council of analgesics in dogs and cats by Canadian veterinarians. Can Vet J members and co-authors of this document. J Small Anim Pract 2014; 1996;37:552–556. 55:E10–68. 11. Hugonnard M, Leblond A, Keroack S, Cadore JL, Troncy E. Attitudes 2. Benito J, Lavoie A-M, Monteiro BP, Beauchamp G, Lascelles BDX, and concerns of French veterinarians towards pain and analgesia in dogs Steagall PVM. Agreement between observers on postoperative pain and and cats. Vet Anaesth Analg 2004;31:154–163. sedation assessment in cats. J Am Vet Med Assoc 2017. In press. 12. Hewson CJ, Dohoo IR, Lemke KA. Factors affecting the use of post 3. Steagall PV, Monteiro BP, Lavoie AM, et al. Validation of the French incisional analgesics in dogs and cats by Canadian veterinarians in 2001. version of the UNESP-Botucatu multidimensional composite pain scale Can Vet J 2006;47:453–459. for assessing postoperative pain in cats. Can Vet J 2017;58:56–64. 13. Lim MY, Chen HC, Omar MA. Assessment of post-operative pain in 4. Calvo G, Holden E, Reid J, et al. Development of a behaviour-based cats: A case study on veterinary students of Universiti Putra Malaysia. measurement tool with defined intervention level for assessing acute J Vet Med Educ 2014;41:197–203. pain in cats. J Small Anim Pract 2014;55:622–629. 5. Reid J, Nolan AM, Hughes JML, Lascelles D, Pawson P, Scott EM. Development of the short-form Glasgow Composite Measure Pain Scale

While you’re taking care of them, we’re looking out for you.

Specialized insurance programs and risk management services for CVMA members

• Professional liability insurance • Commercial insurance • Employee benefits • Individual life and disability • Student and graduate insurance • Personal auto and home insurance

1-866-860-2862 • cvmainsurance.com

808 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY Article

Comparative efficacy of intranasal and injectable vaccines in stimulating Bordetella bronchiseptica-reactive anamnestic antibody responses in household dogs

John A. Ellis, Sheryl P. Gow, Lindsey B. Lee, Stacey Lacoste, Eileen C. Ball

Abstract — In order to determine the comparative efficacy of injectable and intranasal vaccines to stimulate Bordetella bronchiseptica (Bb)-reactive anamnestic antibodies, a trial was conducted using 144 adult household dogs of various breeds and ages, which had been previously administered intranasal Bb vaccine approximately 12 months before enrollment. Dogs were randomized into 2 groups and blood, nasal swabs, and pharyngeal swabs were collected prior to the administration of single component Bb vaccines intranasally or parenterally. Ten to 14 days later all dogs were resampled to measure changes in systemic and local antibody to Bb. There were no differences in the changes in Bb-reactive serum IgG and nasal IgA between the groups, whereas intranasally vaccinated dogs had significantly higher Bb-reactive serum IgA. These data indicate that both of the current generation of intranasal (modified-live) and injectable (acellular) Bb vaccines can stimulate anamnestic local and systemic antibody responses in previously vaccinated, Bb-seropositive adult household dogs.

Résumé — Efficacité comparative des vaccins intranasaux et injectables pour stimuler les réponses des anticorps anamnestiques réagissant à Bordetella bronchiseptica chez les chiens domestiques. Afin de déterminer l’efficacité comparative des vaccins injectables et intranasaux pour stimuler les anticorps anamnestiques réagissant à Bordetella bronchiseptica (Bb), un essai a été réalisé à l’aide de 144 chiens domestiques adultes de diverses races et d’âges différents, auxquels l’on avait déjà administré le vaccin Bb intranasal environ 12 mois avant le recrutement. Les chiens ont été assignés au hasard à deux groupes et des échantillons sanguins, et écouvillons nasaux et pharyngés ont été prélevés avant l’administration de vaccins Bb à composant unique soit par voie intranasale ou parentérale. Dix à 14 jours plus tard, on a prélevé de nouveaux échantillons pour tous les chiens afin de mesurer les changements dans les anticorps systémiques et locaux pour Bb. Il n’y avait aucune différence au niveau des changements pour l’IgG sérique et l’IgA nasal réactif à Bb entre les groupes, tandis que les chiens vaccinés par voie intranasale présentaient un niveau significativement supérieur d’IgA sériques réactives à Bb. Ces données indiquent que les deux générations actuelles de vaccins Bb intranasal (vivant modifié) et injectable (acellulaire) peuvent stimuler les réponses locale et systémique des anticorps Bb chez les chiens adultes domestiques antérieurement vaccinés. (Traduit par Isabelle Vallières) Can Vet J 2017;58:809–815

Department of Veterinary Microbiology (Ellis, Lacoste), Department of Large Animal Clinical Sciences (Gow), Western College of Veterinary Medicine, 52 Campus Drive, University of Saskatchewan, Saskatoon, Saskatchewan, S7N 5B4; Thomas Crossroads Animal Hospital, 32 Oak Hill Blvd, Newman Georgia 30265, USA (Lee); Zoetis, 100 Campus Drive Florham Park, New Jersey 07932, USA (Ball). Address all correspondence to Dr. John Ellis; e-mail: [email protected] Conflict of interest statement One of the authors (EB) is an employee of Zoetis. Zoetis played no direct role in the acquisition of data, or in the analysis of data. None of the authors has any other financial or personal relationships that could inappropriately influence or bias the content of the paper. Use of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.

CVJ / VOL 58 / AUGUST 2017 809 FOR PERSONAL USE ONLY

Introduction Vaccines ordetella bronchiseptica (Bb) is a Gram-negative bacterium Single component injectable (Bronchicine; Zoetis, Parsippany, B that is one of about 12 pathogens that have been causally New Jersey, USA) and intranasal (Vanguard B; Zoetis) Bb vac- associated with the canine infectious respiratory disease complex cines were obtained from a distributor. (CIRDC) (1). Various parenteral and mucosal vaccines against Quantitation of Bb-reactive antibodies Bb are available and have frequently been used in veterinary Enzyme-linked immunosorbent assays (ELISAs) to measure practices for more than 30 y (2). Throughout this period there IgG and IgA reactive with Bb were performed as previously has been controversy about the relative efficacy of these vaccines described (8) using Bb-antibody positive and negative sera and in stimulating primary protective immune responses and in their ARTICLE saliva as controls. comparative utility as “booster shots” (2). Environmental co-factors, such as natural exposure to Bb, Polymerase chain reaction (PCR) that could provide a “boosting” effect for iatrogenically primed A real time PCR for Bb (and other respiratory pathogens; immune responses likely significantly contribute to vaccine RealPCR test code 2524; Idexx Reference Laboratories, Calgary, efficacy and duration of immunity (DOI) in client-owned dogs Alberta) was performed on deep pharyngeal swabs. (3,4). The involvement of these cofactors, including dose and frequency of Bb exposure in settings such as boarding kennels Statistical analysis and grooming operations, is virtually impossible to model in a Statistical analyses were performed using a commercial soft- laboratory setting, requiring the use of household dogs to best ware package (SPSS Statistics 23.0; IBM, Markham, Ontario). gauge the Gestalt of immunity to Bb and other pathogens. For Changes in Bb-reactive serum IgG, serum IgA, and nasal IgA various reasons, perhaps most notably logistical difficulties between the enrollment/vaccination visit and the follow-up related to owner participation and compliance, there are few visit were the 3 outcome variables examined. Non-parametric studies that have sequentially examined immune responses Mann-Whitney U-tests were used to determine the differences to Bb vaccines in real-world dogs (5). Neither are there many between treatment groups (9). Baseline data collected from the recent data concerning the carriage of Bb in clinically normal primary visit were also used to examine the secondary hypoth- household dogs, that could affect responses to vaccination and esis that activities which increase the likelihood of interaction DOI (6,7). The purpose of this study was to extend extant labo- with other dogs increase the chance of natural exposure to Bb, ratory findings related to the immunogenicity of Bb vaccines and subsequently provide a “boosting” effect for iatrogenically by comparing the anamnestic systemic and mucosal antibody primed immune responses. A score was created for each dog responses induced by the current generation of injectable or by categorizing the potential risk of natural Bb exposure based intranasal single component Bb vaccines in adult household on activities (boarding, grooming, etc.) which could increase dogs presenting for their annual “booster shots.” interaction with other dogs in the 12 mo prior to the onset of Materials and methods the study (Table 2). These categories were then summed for each dog in order to create a total risk score. The risk for natu- Study population and experimental design ral Bb exposure was considered greater for dogs with a higher Clinically normal client-owned household dogs of various ages total score for these parameters. The relationships between and breeds (Table 1) with a documented history of intranasal baseline IgG or IgA and the total risk score for potential natural vaccination for Bb approximately 1 y before enrollment (a com- Bb exposure were examined using a Spearman’s correlation (10). mon and often recommended interval between vaccinations for Bb) (2) were subjects, and had written owner consent. Results Owners were questioned regarding their dogs’ lifestyle as related A total of 144 dogs were enrolled between September 4, 2014 to potential exposures to other dogs. Patients were randomized and October 28, 2015. Seventy-seven dogs were randomly into 2 groups using a computerized random number generator. assigned to the injectable Bb vaccine group and 67 to the intra- Dogs in 1 group received a single injectable Bb vaccine; those in nasal Bb vaccine group. Before initiation of the study, historical the other received a single intranasal vaccine. When there were data revealed that there were 22 dogs in the injectable Bb vac- 2 or more dogs in a household, all dogs received the same treat- cine group which were vaccinated for Bb between January and ment. Venous blood (for serum), nasal swabs (sterile polyester November of 2013, and 55 dogs vaccinated between January tipped), and pharyngeal swabs were collected on day 0 prior and October of 2014. In the intranasal Bb vaccine group, there to vaccination and again 10 to 14 d later. Individual swabbing were 16 dogs vaccinated between July and December of 2013, was performed in both nares, left first, and then in the deep 50 dogs vaccinated between January and October of 2014, and pharynx (including tonsil whenever possible). All sampling 1 dog in May of 2012. There was no statistical difference in was done away from owners, and fractious dogs were mildly the previous vaccination dates between the 2 treatment groups sedated, if necessary. Only pharyngeal swabbing was done in (P = 0.87). dogs with stenotic nares (i.e., too small to insert swab). Nasal There were also no statistical differences between breed clas- swabs were placed in 1 mL, and pharyngeal swabs in 2 mL, of sification (large, medium, small) between the 2 treatment groups transport medium and frozen at 220°C, then 280°C prior to (Table 1, P = 0.24). The dogs in the injectable Bb vaccine group analysis. and the intranasal Bb vaccine group were also not different from

810 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY

Table 1. Dog breeds categorized by treatment group and breed size Treatment group Treatment group Injectable Intranasal Injectable Intranasal Dog breeds Bb vaccine Bb vaccine Total Breeds Bb vaccine Bb vaccine Total Large breed dogs Small breed dogs Alaskan malamute 0 1 1 Bichon frisé 0 3 3

American foxhound 1 0 1 Boston terrier 0 1 1 ARTICLE Boxer mix 1 1 2 Cairn terrier 1 0 1 Bullmastiff 0 1 1 Chihuahua 1 1 2 Dalmatian 0 1 1 Chihuahua mix 1 0 1 Doberman 0 1 1 Dachshund 1 3 4 Flat-coated retriever 1 0 1 Dachshund mix 0 2 2 Fox terrier (wire-haired) 2 0 2 Jack Russell terrier 1 1 2 German shepherd 7 1 8 Maltese 0 1 1 German shepherd mix 0 2 2 Maltese mix 1 1 2 Great Dane mix 1 0 1 Miniature dachshund 1 0 1 Greyhound 0 1 1 Miniature schnauzer 3 0 3 German shorthaired pointer 0 1 1 Papillion 1 0 1 Hound mix 1 0 1 Pekingese 1 0 1 Husky 0 1 1 Pomeranian 1 0 1 Husky mix 0 1 1 Pomeranian mix 0 1 1 Labrador 3 8 11 Poodle mix 0 1 1 Labrador mix 2 0 2 Pug 0 1 1 Old English sheepdog 0 1 1 Scottish terrier 1 0 1 Rhodesian ridgeback 2 0 2 Shih tzu 3 4 7 Schnauzer 0 2 2 Terrier mix 3 1 4 Weimaraner 1 0 1 Toy poodle 1 2 3 Total 24 23 47 West Highland terrier 1 2 3 West Highland terrier mix 0 1 1 Medium breed dogs Welsh corgi 2 0 2 Australian shepherd 1 0 1 Welsh corgi mix 1 0 1 Australian shepherd mix 1 0 1 Yorkshire terrier 2 1 3 Bassett hound 0 2 2 Yorkshire terrier mix 1 0 1 Beagle 2 2 4 Total 28 27 55 Beagle mix 1 1 2 Border collie 0 1 1 No classification Brittany spaniel 0 1 1 Mix 14 5 19 Cocker spaniel 1 1 2 Collie 0 1 1 French bulldog 1 0 1 King Charles spaniel 1 0 1 Pitbull 1 1 2 Pitbull Mix 1 0 1 Pointer Mix 0 1 1 Shar Pei 1 0 1 Shetland sheepdog 0 1 1 Total 11 12 23

each other for any of the other potential confounding vari- and no dogs excluded. Interpretation of the analyses for both ables explored (Bb exposure variables, Tables 2, 3 and baseline the explanatory variables or primary outcomes of interest did Bb-reactive antibodies, Table 4). not change regardless of the dataset used; therefore, for brevity In a subset of dogs the Bb-reactive serum IgG (n = 9 dogs), only the analysis for all of the enrolled dogs is presented. serum IgA (n = 12 dogs) and nasal IgA (n = 30 dogs) decreased The changes in Bb-reactive serum IgG and nasal IgA were between the enrollment/vaccination visit and follow-up visits. not significantly different between the 2 vaccination types Therefore, when calculating the change in these parameters from (Table 5; Figures 1, 2); whereas the change in Bb-reactive baseline a negative value was obtained. Since, it is biologically serum IgA was significantly higher in the intranasally vac- less probable to have these parameters decrease in the 10- to cinated (median = 32, range 242 to 154) versus the injected 14-day period between the initial vaccination and follow-up dogs (median 16, range 232 to 103) (Table 5; Figure 3) visit there was uncertainty as to the best way to manage these (P = 0.007). data. To ensure that either including or excluding dogs that had There was no statistical association between the calculated lower serum IgG, IgA, and/or nasal IgA after vaccination did not total lifestyle risk score for potential natural Bb exposure and bias the outcomes, the data were analyzed using 5 approaches; baseline IgG (P = 0.12) or IgA (P = 0.93). dogs that had a lower serum IgG on the post-vaccination Pharyngeal swabs from 4/101 dogs from 2014 (3 injectable- visit excluded, dogs that had a lower serum IgA on the post- vaccinated/1 intranasally vaccinated) were positive for Bb vaccination visit excluded, dogs that had a lower nasal IgA on DNA. Because of the low prevalence and variable baseline and the post-vaccination visit excluded, dogs with a lower serum post-vaccination responses, the pharyngeal swab data were not IgG, IgA, or nasal IgA on the post-vaccination visit excluded further analyzed.

CVJ / VOL 58 / AUGUST 2017 811 FOR PERSONAL USE ONLY

Table 2. Categorization of potential risk factors for being naturally Table 3. Counts and associated P-values for potential Bordetella exposed to Bordetella bronchiseptica bronchiseptica exposure variables Bordetella Treatment group exposure risk Potential Bordetella exposure variables category Injectable Intranasal Bb vaccine Bb vaccine Boarded (previous 12 months) Number Number a. None 0 Bordetella exposure variables of dogs of dogs P-value b. 1 time 1 c. 1 to 2 times 2 Boarded (previous 12 months) 0.98 d. 2 times 3 a. None 21 17 e. 2 to 3 times 4 b. 1 time 4 6 ARTICLE f. 3 times 5 c. 1 to 2 times 1 1 g. 3 to 4 times 6 d. 2 times 21 17 h. . 4 times 7 e. 2 to 3 times 10 12 i. Other 8 f. 3 times 2 3 g. 3 to 4 times 5 2 Groomed (last 12 months) h. . 4 times 7 5 a. None 0 i. Other 6 4 b. Monthly 6 Total 77 67 c. Every other month 5 d. 4 to 5 times per year 4 Groomed (previous 12 months) 0.87 e. 2 to 3 times per year 3 a. None 47 40 f. 1 time per year 2 b. Monthly 6 5 g. Other (stated regularly but not specified) 1 c. Every other month 8 9 d. 4 to 5 times per year 4 7 Other factors in last 12 months for risk of exposure e. 2 to 3 times per year 6 4 a. None 0 f. 1 time per year 0 0 b. Dog park 1 g. Other (regularly) 6 2 c. Travel with family 1 Total 77 67 d. Interact with other dogs 1 e. Fostering other dogs (75 dogs in a home) 2 Other exposure factors 0.64 (previous 12 months) a. None 67 60 b. Dog park 2 1 Discussion c. Travel with family 4 3 d. Interact with other dogs 0 1 The results of this study extend our previous investigations e. Fostering other dogs 4 2 related to the immunogenicity of the current generation of Total 77 67 parenteral vaccines for Bb in dogs, an acellular nonadjuvanted Potential exposure 0.40 filtrate preparation similar to the vaccines used against Bordetella (1 month prior to sample) pertussis (Bp) in humans (5,10). To our knowledge, this is the a. None 55 52 b. Boarded 5 1 first study to compare the ability of injectable and intranasal c. Groomed 7 11 vaccines to stimulate anamnestic mucosal and systemic antibody d. Foster dogs 3 1 responses in a large cohort of previously intranasally vaccinated, e. Other (travel, dog day care, 7 2 dog show, extended family variably Bb seropositive adult household dogs. dog interaction) To the extent that there were no significant differences in the Total 77 67 change in Bb-reactive IgG responses in serum between groups Potential exposure 0.84 that received the injectable versus intranasal vaccines, these (between 2 test periods) results are in contrast to a previous study that documented a. None 61 54 b. Boarded 8 7 significantly higher systemic antibody responses, that developed c. Groomed 2 5 more rapidly in parenterally vaccinated Bb-seropositive adult d. Foster dogs 3 0 laboratory beagles compared to a similar group of intranasally e. Other (travel, dog day care, 3 1 dog show, extended family vaccinated dogs (8). That study examined a whole cell alum- dog interaction) adjuvanted bacterin; therefore, it is perhaps not surprising that Total 77 67 the latter vaccine was apparently more immunogenic since it contained orders of magnitude more of the protein antigen (5,8,10). As well, the whole cell bacterin contained more and the PAMPs in the whole cell vaccines were responsible for not different pathogens associated molecular patterns (PAMPs) or only adjuvant effects but also for inducing the inflammatory “danger signals” that likely had adjuvant activity (5,10,11,12) responses that constituted the majority of the adverse reactions in addition to the inclusion of aluminum hydroxide. (10,12). These adverse reactions were a main instigator in the In human medicine, until about the early 1990’s, various development of less reactive acellular vaccines containing both whole cell Bp vaccines were used to successfully control whoop- less PAMPs and less potential antigens (10). The adverse reac- ing cough in vaccinated populations (10). However, these tion rate to the previously widely used whole cell Bb vaccines vaccines were associated with an approximately 50% incidence in dogs was apparently considerably less than with the Bp vac- of adverse reactions, most often local inflammatory reactions cines according to available, primarily anecdotal data; however, and/or transient malaise and pyrexia (10). It is most likely that there is a dearth of reliable prevalence data on adverse reactions

812 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY

Table 4. Descriptive statistics and associated P-values for dog gender, age, baseline Bordetella bronchiseptica (Bb)-specific serum IgG, baseline Bb-specific serum IgA and baseline Bb-specific nasal IgA Treatment group Injectable Bb vaccine Intranasal Bb vaccine Number Number Variable of dogs Female Male of dogs Female Male P-value

Gender (male/female) 77 44 33 67 40 27 0.8 ARTICLE Number Number of dogs Median Range of dogs Median Range P-value Age (years) 77 6.5 1 to 15 67 6 1 to 13 0.85 Baseline Bb-specific serum IgG 77 72.1 5.5 to 111.1 67 75.1 23.5 to 128.9 0.62 Baseline Bb-specific serum IgA 77 67 0 to 169 67 63.5 0 to 173 0.99 Baseline Bb-specific nasal IgA 62 66 3 to 116 58 73 0 to 137 0.41

Table 5. Descriptive statistics and associated P-values for the 3 outcomes of interest; change in Bordetella bronchiseptica (Bb)-specific serum IgG, change in Bb-specific serum IgA, and change in Bb-specific nasal IgA between initial and final sampling Treatment group Injectable Bb vaccine Intranasal Bb vaccine Number Number Variable of dogs Median Range of dogs Median Range P-value Change in Bb-specific serum IgG 77 15 239 to 69 67 13 216 to 95 0.31 Change in Bb-specific serum IgA 77 16 232 to 103 67 32 242 to 154 0.007 Change in Bb-specific nasal IgA 60 6.5 283 to 76 55 12 69 to 134 0.23

to Bb vaccines in dogs. Nevertheless, a similar desire to reduce accurately measure responses to immunodominant Bb antigens perceived reaction rates was a major reason for the development or different IgG subtype antibody responses in different dogs of the current acellular Bb vaccine. Therefore, a safety-driven (13,16,17). In other words, after boosting with vaccine some “parallel-evolution” has occurred in human and veterinary medi- dogs may respond preferentially to particular antigens versus cine related to vaccines for relevant Bordetella spp., resulting in others, which could then be detected in an apparent overall less reactive acellular vaccines. However, as part of that process decrease in reaction with the standardized constellation of anti- it is important to acknowledge the expected “trade-off’ between gens in the whole cell preparation used as the ELISA antigen. overall immunogenicity and less reactogenicity; it is generally The site of production and immunological relevance of canine not biologically possible to have both (10,12,13). serum IgA has been controversial (18,19). The finding that It was of interest that in some dogs, Bb-reactive antibodies most adult dogs in this study that received intranasal vaccine in the serum and nasal secretions apparently decreased 10 to had increases in Bb-reactive IgA in the serum post-vaccination 14 d after vaccination. In the case of the nasal secretions, this is consistent with the concept, based primarily on studies in the could simply be a sampling “artifact” related to the volume of gut, that mucosal production following antigen exposure is nasal secretion collected on the swabs prior to placement into a the source of the dimeric IgA in the serum (20–22). This con- standard amount of transport medium; there is a high degree of cept is supported by our recent finding of substantial increases variation in collection of these samples. This factor is difficult to in serum IgA subsequent to the administration of a single dose control, especially when collecting from client-owned dogs, with of oral or intranasal Bb, to young Bb-seronegative beagle pup- variably sized, often small, nares. This constraint alludes to the pies (14). Perhaps more controversial is the ability of parenteral logistical difficulty of conducting minimally invasive studies in immunization to boost measurable IgA on non-diseased muco- household dogs, and warrants the use of the immunological sur- sal surfaces, and there are few comparative data that address rogate, serum IgA, as an indicator of a relevant mucosal response this issue. Although the numbers of nasal swab samples were (14). In the case of serum antibodies this possible dilution decreased compared to serum, the finding that there were no effect is not relevant, as a standard dilution of serum is tested significant differences in mucosal Bb-reactive IgA in the groups in the ELISAs. A decrease in antibody 10 to 14 d after antigen of dogs that received injectable or intranasal vaccines is consis- exposure in serum or nasal secretions could be an indicator of a tent with the concept that parenteral administration of vaccine variable lack of response to the vaccine in an already antibody can result in increases in antigen-specific IgA in nasal secretions positive animal, in combination with a decay in antibody in mucosally-primed individuals (23). More relevant to Bb, it related to the expected half-life of those proteins in plasma and has been demonstrated that parenteral vaccination of previously on mucosal surfaces, and/or immune complexing of antibody naturally exposed human adolescents with acellular Bp (DTaP) with vaccinal antigens (15). Alternatively, an apparent decrease stimulated not only anamnestic Bp-specific IgG responses, in antibody measured in the ELISAs which used a whole cell but IgA as well (24). This was not the case following primary preparation of Bb as antigen, could be due to the failure to parenteral immunization with the DTaP vaccine indicating

CVJ / VOL 58 / AUGUST 2017 813 FOR PERSONAL USE ONLY

100 150

60 100

50 20 ARTICLE

Change in Bb -specific serum IgG 0 Change in Bb -specific serum IgA 220

240 250 Injectable Bb vaccine Intranasal Bb vaccine Injectable Bb vaccine Intranasal Bb vaccine Treatment group Treatment group

Figure 1. Beeswarm plot of change in Bordetella Figure 3. Beeswarm plot of change in Bordetella bronchiseptica-reactive serum IgG concentrations between bronchiseptica-reactive serum IgA concentrations between initial and final sampling. Solid lines depict the median values initial and final sampling. Solid lines depict the median values for each treatment group. for each treatment group.

to other dogs with baseline antibody responses to Bb in this cohort of dogs. This may be due to limitations of the data such as recall bias of owners, inadvertently missing or misclassifying 100 key exposure risk(s), or an inability to quantify the exposure risk appropriately; for example, a lack of knowledge related to the “circulation” of Bb in subsets of the canine population. 50 Data concerning the carriage of Bb by asymptomatic dogs are somewhat conflicting. Early studies based on culture reported no isolation of Bb in 2 populations of laboratory beagles 0 [n = 467 (27); n = 25 (28)], and 3/50 (6.0%) asymptomatic dogs entering, or housed in a university veterinary clinic (29)

Change in Bb -specific nasal IgA were Bb culture positive. In recent studies using potentially more 250 sensitive PCR, 2/22 (9.1%) normal dogs presenting at veterinary clinics (7) and 98/503 (19.5%) asymptomatic dogs presenting at shelters were positive for Bb DNA (30). Unfortunately, the

Injectable Bb vaccine Intranasal Bb vaccine immune status to Bb was not known/reported in any of those Treatment group studies. Based on the low prevalence of Bb positive dogs (4%) in this population of routinely vaccinated dogs, carriage of Figure 2. Beeswarm plot of change in Bordetella Bb could not be implicated as an important co-factor in the bronchiseptica-reactive IgA in nasal secretions between initial and final sampling. Solid lines depict the median values for response to Bb vaccines in this study. Nevertheless, exposure each treatment group. to Bb from acutely infected individuals, carrier animals, or fomites is undoubtedly an important, if difficult to measure co-factor in the response to Bb vaccines (4), which begs further that mucosal priming was required to affect the latter response investigation. (24). The practical implication from these observations is that In conclusion, these data demonstrate that both intranasal priming puppies with intranasal vaccine followed by parenteral and parenteral administration of current vaccines for Bb to delivery in an initial series achieves boosting of both systemic previously intranasally vaccinated variably Bb seropositive adult and mucosal antibody responses (25,26). household dogs can stimulate anamnestic systemic and mucosal It was suggested 40 y ago that natural transmission of Bb antibody responses that have been associated with disease spar- from clinically affected, convalescent, or asymptomatic carrier ing in Bordetella infections (10,25). Therefore, these data suggest dogs could contribute to the duration of immunity to Bb, and that either vaccine could be considered for use as a booster in that this effect could vary with a dog’s “lifestyle” (3). We were animals with immunological memory established by previous unable to associate the lifestyle co-factor of potential exposure immunization (25) and/or natural exposure.

814 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY

Acknowledgments 16. Hijnen M, He Q, Schepp R, et al. Antibody responses to defined regions of the Boredetella pertussis virulence factor pertactin. Scan J Infect Dis This work was supported in part by an unrestricted grant from 2008;40:94–104. Zoetis to study the clinical immunity to Bb vaccines, and by 17. Leininger E, Bowen S, Renauld-Mongenie G, et al. Immunodominant domains present on the Bordetella pertussis vaccine component filamen- the principal author’s discretionary funds to study clinical tous hemagglutinin. J Infect Dis 1997;175:1423–1431. immunology. CVJ 18. Davis RB, Jayappa H, Abdelmagid OY, Armstrong R, Sweeney D, Lehr C. Comparison of the mucosal immune response in dogs vac-

References cinated with either an intranasal avirulent live culture or a subcuta- ARTICLE neous antigen extract vaccine of Bordetella bronchiseptica. Vet Ther 1. Priestnall SL, Mitchell JA, Walker CA, Erles K, Brownlie J. New and 2007;8:32–40. emerging pathogens in canine infectious respiratory disease. Vet Pathol 19. Larson LJ, Thiel BE, Sharp P, Schultz RD. A comparative study 2014;51:492–504. of protective immunity provided by oral, intranasal and parenteral 2. Ellis JA. How well do vaccines for Bordetella bronchiseptica work in dogs? canine Bordetella bronchiseptica vaccines. Int J Appl Res Vet Med A critical review of the literature 1997–2014. Vet J 2015;204:5–16. 2013;11:153–160. 3. Bemis DA, Carmichael LE, Appel MJG. Naturally occurring respira- 20. Vaerman JP, Heremans JE. Origin and molecular size of tory disease in a kennel caused by Bordetella bronchiseptica. Cornell Vet immunoglobuliin-A in the mesenteric lymph of the dog. Immunol 1977;67:282–293. 1970;18:27–38. 4. Lavine JS, King AA, Bjørnstad ON. Natural immune boosting in pertus- 21. Batt RM, Barnes A, Rutgers HC, Carter SD. Relative IgA deficiency sis dynamics and the potential for long-term vaccine failure. Proc Natl and small intestinal bacterial overgrowth in German shepherd dogs. Res Acad Sci (USA) 2011;108:7259–7264. Vet Sci 1991;50:106–111. 5. Ellis JA, Rhodes C, Lacoste S, Krakowka S. Antibodies to Bordetella 22. Olsson M, Frankowiack M, Tengvall K, et al. The dog as a genetic bronchiseptica in vaccinated and infected dogs. Can Vet J 2014;55:1–8. model for immunoglobulin A (IgA) deficiency: Identification of several 6. Ellis JA, Anseeuw E, Gow S, et al. Seroepidemiology of respiratory breeds with low serum IgA concentrations. Vet Immunol Immunopathol (group 2) canine coronavirus, canine parainfluenza virus and Bordetella 2014;160:255–259. bronchiseptica infections in urban dogs in a humane shelter and in rural 23. Brown TA, Murphy BR, Radl J, Haaijman JJ, Mestecky J. Subclass dis- dogs in small communities. Can Vet J 2011;52:861–868. tribution and molecular form of immunoglobulin A hemagglutinin anti- 7. Joffe DJ, Lelewski R, Weese JS, et al. Factors associated with the devel- bodies in sera and nasal secretions after experimental secondary infection opment of Canine Infectious Respiratory Disease Complex (CIRDC) in with influenza A virus in humans. J Clin Microbiol 1985;22:259–264. dogs in 5 Canadian small animal practices. Can Vet J 2016;57:46–51. 24. Thuan L, Cherry JD, Chang ST, et al. Immune responses and antibody 8. Ellis JA, Krakowka GS, Dayton AD, Konoby C. Comparative efficacy of decay afer immunization of adolescents and adults with an acellular an injectable vaccine and an intranasal vaccine in stimulating Bordetella pertussis vaccine: The APERT study. J Infect Dis 2004;190:535–544. bronchiseptica-reactive antibody responses in seropositive dogs. J Am Vet 25. Ellis JA, Haines DM, West KH, et al. Effect of vaccination on experi- Med Assoc 2002;220:43–48. mental infection with Bordetella bronchiseptica dogs. J Am Vet Med 9. Dohoo I, Martin W, Henrik S. Veterinary Epidemiologic Research. Assoc 2001;218:367–375. Charlottetown, Prince Edward Island: VER, 2009. 26. Feunou PF, Kammoun H, Debrie A-S, Locht C. Heterologous prime- 10. Mattoo S, Cherry JD. Molecular pathogenesis, epidemiology, and clini- boost immunization with live attenuated B. pertussis BPZE1 followed cal manifestations of respiratory infections due to Bordetella pertussis by acellular pertussis vaccine in mice. Vaccine 2014;32:4281–4288. and other Bordetella subspecies. Clin Microbiol Rev 2005;18:326–382. 27. Brennan PC, Simkins RC. Throat flora of a closed colony of beagles. 11. Benn CS, Netea MG, Selin LK, Aaby P. A small jab — A big differ- Proc Soc Exptl Biol Med 1970;134:566–570. ence: Nonspecific immunomodulation by vaccines. Trends Immunol 28. Clapper WE, Meade GH. Normal flora of the nose, throat, and lower 2013;34:43–439. intestine of dogs. J Bacteriol 1956;85:399–420. 12. Kumar H, Kawai T, Akira S. Pathogen recognition by the innate 29. Bailie WE, Stowe EC, Schmitt AM. Aerobic bacterial flora of oral and immune system. Int Rev Immunol 2011;30:16–34. nasal fluids of canines with reference to bacteria associated with bites. 13. Vaughan K, Seymour E, Peters B, Sette A. Substantial gaps in knowledge J Clin Microbiol 1978;7:223–231. of Bordetella pertussis antibody and T cell epitopes relevant for natural 30. Lavan R, Knesl O. Prevalence of canine infectious respiratory pathogens immunity and vaccine efficacy. Hum Immunol 2014;75:440–451. in asymptomatic dogs presented at US animal shelters. J Small Anim 14. Ellis JA, Gow SP, Waldner CL, et al. Comparative efficacy of intra- Pract 2015;56:572–576. nasal and oral vaccines against Bordetella bronchiseptica in dogs. Vet J 2016;212:71–77. 15. Dixon FJ, Talmage DW, Maurer PH, Deichmille M. The half-life of homologous gamma globulin (antibody) in several species. J Exptl Med 1952;96:313–318.

Have you been checking your e-mail inbox ?

The Canadian Veterinary Medical Association (CVMA) communicates time-sensitive and relevant information and news to its members by e-mail based on the addresses we have on record in our database. If you are not receiving e-mail communication from us, it may be that we do not have a valid e-mail address for you.

Review/update your contact information and stay connected! Also, ensure that you add us ([email protected]) to your safe sender’s list so that our messages do not get blocked. Online Log on at www.canadianveterinarians.net and view your contact information. You can make changes directly online. Contact CVMA By e-mail at [email protected] or by telephone at 1.800.567.2862. We will confirm the e-mail address we currently have for you and make any necessary changes.

CVJ / VOL 58 / AUGUST 2017 815 FOR PERSONAL USE ONLY

New Products Nouveaux produits

NEW VET 2K — Glucose and Ketone Urine Strips New VET 2K — Glucose and results prior to the development of any major kidney illness. Ketone strips are now available Each box contains 10 single test strips, making them ideal for from Sensor Health Veterinary mobile veterinary units. The new VET 2K — Glucose and Diagnostics and are only sold Ketone urine strips offer personal preventive care for clients that through veterinarians! The VET is economical and easy to use. For ordering information, contact 2K — Glucose and Ketone Urine your Purchasing Group or Sensor Health Veterinary Diagnostics. strips have a long shelf life, and the easy to read Urine Dip Stick for Contact: Sensor Health Veterinary Diagnostics, 110–6 Turnbull in-home detection of ketone and Court, Cambridge, Ontario N1T 1K6; Phone: 1-888-777-7080; glucose are convenient for clients website: www.sensorhealthvet.com to take home. The strips can be used as an in-home monitoring measure between visits and allows clients to test and report

Elanco launches Component® TE-G with Tylan® In Canada! lanco Canada recently announced the launch of Component fall/winter grazing significantly improved grazing performance E TE-G with Tylan to its extensive range of implant products without negatively impacting feedlot performance or carcass available in Canada. Product has arrived and is now available yield and quality.4 for sale. Producers can trust the only implant that offers the added “With the addition of TE-G with Tylan to our Component value of Tylan’s abscess defense to help protect and maximize product portfolio, all Elanco implants now have the Tylan pel- their implant ROI. Elanco offers Zero-Defect Implanting (ZDI) let. It is our Tylan pellet that sets us apart as it reduces the inci- which includes training on sanitation protocols, guidance on dence of abscess formation at the implant site1 and provides an critical control points and ear check services for quality control; advantage to our customers. It is very exciting news for Elanco, all great resources to bring you, our valued customers, increased and for our customers,” comments Gord Roger, Beef Business value. Maximize implant ROI by minimizing defects today by Manager for Elanco Canada. contacting your Elanco Sales Representative for more informa- You can only access implants with a localized antibacterial at tion on TE-G with Tylan and all other Elanco implants. the implant site with the Elanco Component with Tylan product Please refer to the product label which contains complete portfolio. Through the use of Component TE-G with Tylan use information, including cautions and warnings. Always read, implant defects can be reduced while increasing weight gain. understand and follow the label and use directions. Furthermore, Component with Tylan consistently improves weight gain by 15 to 40 lbs over non-implanted controls,1 and References effectively increases rate of gain, live weight and value in each 1. Kuhl GL. 1997. Abstract: Stocker cattle responses to Implants. Oklahoma phase of beef production.2 More specifically implants increase State University Symposium: Impact of Implants on Performance and Carcass Value of Beef Cattle, 51–62. value by an average $15.45 to $41.20 per head when used in 2. Duckett SK and Andrae JG. 2001. Implant strategies in an integrated calves and stocker cattle, respectively.† beef production system. J. Anim. Sci. 79:E110. An Oklahoma State University study was conducted to 3. Peel D. Plains Nutrition Council 2012. 4. Sharman ED, Lancaster PA, Horn GW and Hufstedler GD. Effects of determine the effects of grass cattle implants on the perfor- energy supplements and a combination grazing implant to performance mance of steers grazing summer warm-season grass pastures and carcass characteristics of growing cattle on wheat pasture. Plains during 2008 and 2009. The study found that cattle implanted Nutrition Council 2011. 5. Oklahoma Farm Report. 2014. http://oklahomafarmreport.com/wire/ TM with Component TE-G with Tylan outperformed Ralgro news/2014/08/00426_PeelAnalysis08182014_100628.php by 11% in the last phase of the grazing period (day 95–126). † Based on grazing implant data presented by Kuhl1 and the calculated 3 5 Additionally, Component TE-G with Tylan increased aver- value of gain described by Peel using current economic data means age daily gain (ADG) over the entire grazing period by 9% compared to the control and 4.5% over Ralgro. Furthermore, Contact: Elanco Canada Ltd., 150 Research Lane, Suite 120, implanting steers with Component TE-G with Tylan during Guelph, ON N1G 4T2; website: www.elanco.ca

816 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY Article

Blood lactate concentration in diabetic dogs

Poliana Claus, André M. Gimenes, Jacqueline R. Castro, Matheus M. Mantovani, Khadine K. Kanayama, Denise M.N. Simões, Denise S. Schwartz

Abstract — Human diabetic patients may have increased lactate levels compared to non-diabetics. Despite the use of lactate levels in critical care assessment, information is lacking for diabetic dogs. Therefore, this prospective cross-sectional clinical study aimed to determine lactate concentrations in 75 diabetic dogs [25 newly diagnosed non-ketotic diabetics, 25 under insulin treatment, and 25 in diabetic ketoacidosis (DKA)], compared to 25 non- diabetic dogs. Lactate levels (mmol/L) were not different among groups (P = 0.20); median and 25th to

75th percentile were 2.23 and P25–75 = 1.46 to 2.83 for controls, 1.69 and P25–75 = 1.09 to 2.40 for newly diagnosed non-ketotic diabetics, 2.27 and P25–75 = 1.44 to 2.90 for dogs under insulin treatment for at least 30 days, and 2.40 and P25–75 = 1.58 to 3.01 for dogs in DKA. Longitudinal studies assessing both isomers (L- and D-lactate) are needed to better elucidate the role of lactate in the pathophysiology of diabetes acid-base status in dogs.

Résumé — La concentration de lactate de sang chez les chiens diabétiques. Des patients humains avec diabète peuvent présenter augmentation des niveaux de lactate, quand comparés aux non diabetiques. Bien que est utilisé d’évaluer les patients dans un état critique, cette information manque pour les chiens diabétiques. Par conséquent, cette étude clinique s’agit d’une prospective transversale en vue de detérminer les concentrations du lactate en 75 chiens diabétiques [25 au moment du diagnostic, 25 sous traitement à l’insuline et 25 dans l’acido-cétose diabétique (ACD)], par rapport aux 25 chiens non diabétiques. Les niveaux de L-lactate ne différaient pas entre

les groupes (P = 0,20). Les valeurs médianes et les centiles 25 % et 75 % étaient de 2,23 mmol/L (P25–75 = 1,46 à 2,83) pour les contrôles, 1,69 mmol/L (P25–75 = 1,09 à 2,40) au diagnostic, 2,27 mmol/L (P25–75 = 1,44 à 2,90) sous traitement à l’insuline pendant au moins 30 jours, et 2,40 mmol/L (P25–75 = 1,58 à 3,01) dans ACD. Des études longitudinales évaluant les deux isomères (L et D-lactate) sont nécessaires pour élucider son rôle dans la physiopathologie et le déséquilibre acide-base chez les chiens diabétiques. (Traduit par Ana Carolina Possas Viana) Can Vet J 2017;58:817–822

Introduction dosis is further divided into B1, B2, and B3 types. Type B1 is actate, a product of glucose anaerobic metabolism, is con- related to systemic diseases, and has been identified in human L sidered a diagnostic and prognostic biomarker for shock patients with diabetes mellitus (DM), malignancy, bowel disease, in human and veterinary medicine, and can be considered as pancreatitis, infection, renal failure, hepatic failure, and other a marker for detecting hypoperfusion, although with some conditions. Type B2 includes causes related to some drugs (as limitations (1). Poor tissue perfusion/oxygenation is strongly metformin, beta-adrenergic agents, salicylates, sulfasalazine, and correlated with morbidity and mortality (2–6). toxins) and Type B3 is related to inborn defects of metabolism The imbalance between lactate production, breakdown, and such as some enzymes deficiencies (7–9). This classification is clearance, will be reflected in circulating lactate concentration considered over-simplified by some authors, as in critical illness (7). Hyperlactatemia, a persistent increase in blood lactate there is overlap of factors that influence lactate dynamics (9). concentration, can arise from impaired tissue oxygenation Lactate concentration is significantly higher in type II dia- (hypoxic) and also from non-hypoxic processes, and may result betic human patients than in controls, and it is higher in in lactic acidosis (7–9). The most common identified form is patients with severe glucose intolerance than in patients with Type A lactic acidosis, caused by hypoxic conditions, whereas mild glucose intolerance (10). It has also been reported that Type B is secondary to non-hypoxic causes. Type B lactic aci- lactate concentration is consistently higher in human patients

Department of Internal Medicine, School of Veterinary Medicine and Animal Science, University of São Paulo, São Paulo, SP, Brazil. Address all correspondence to Dr. Denise S. Schwartz; e-mail: [email protected] Use of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.

CVJ / VOL 58 / AUGUST 2017 817 FOR PERSONAL USE ONLY

with stable (non-complicated) type I DM, than in normal b-hydroxybutyrate strips (Abbott Diabetes Care, Witney, Oxon, individuals (11). England, UK). Considering that lactate concentration may vary Diabetic ketoacidosis (DKA) is considered the main endo- depending on venous sampling site (2,16), blood samples were crine emergency in small animals (12), characterized by fluid, always obtained from the jugular vein. electrolyte, and acid-base imbalance, and is frequently associ- Blood glucose was measured in a portable glucometer ated with comorbidities and high mortality rates (13,14). Lactic (Optium Xceed; Abbott Diabetes Care, Alameda, California, acidosis has been reported in human diabetic patients (11) and USA) and lactate concentrations, in a point-of-care blood ana- may occur in dogs with DKA, contributing to metabolic acidosis lyzer (iSTAT; Abbott Point of Care, Abbott Laboratories, Abbott (1). It is important to differentiate between lactic acidosis and Park, Illinois, USA). Both were determined from whole blood,

ARTICLE ketoacidosis in acidemic diabetic patients, as a different treat- immediately after collection. ment is required for each condition (7,15). The motivation for Blood glucose values obtained in the glucometer were com- this study was the lack of information in the veterinary literature pared to values obtained in the same sample, and sent to a regarding lactate levels in diabetic dogs, as in humans it has been clinical pathology laboratory for analysis. Considering that determined that non-ketotic diabetic patients have higher lactate the average values were within the 95% confidence interval levels compared with non-diabetics. Therefore, the aim of this (CI), and this is not considered clinically relevant as it does not study was to determine if newly diagnosed diabetics and known change the diagnosis, we decided to use the portable glucometer diabetics undergoing treatment for a minimum of 30 d have values, as this is the method mostly used in clinical practice higher blood lactate concentrations than normal individuals. (data not shown). An additional goal was to determine if lactate concentrations Venous blood gas analysis on the point-of-care blood analyzer

differ among non-ketotic diabetics compared with patients with (iSTAT; Abbott Point of Care) included pH, tCO2, pCO2, pO2, DKA. As a secondary objective, we aimed to determine whether base excess (BE), HCO3, SO2, anion gap (AG), concentration lactate levels were associated with an increased likelihood of of sodium (Na1), potassium (K1), cloride (Cl2), and ionized negative outcomes for DKA dogs (death or euthanasia due to calcium (iCa21). non-improvement of DKA symptoms). Urine samples for analysis were obtained by cystocentesis. Urinary specific gravity was measured in a portable refractom- Materials and methods eter. Urine culture was performed in all dogs to determine the A prospective cross-sectional clinical study was conducted presence of urinary tract infection and to conduct antimicrobial following ethical principles of animal research, approved by susceptibility tests for treatment. the Institution Animal Use & Ethics Committee (Protocol: Diabetic dogs were allocated to the different groups based on 2542/2012). Client-owned dogs presented to the Veterinary blood glucose tests, blood gas analysis, and b-OHB concentra- Teaching Hospital of the School of Veterinary Medicine and tion. For the diagnosis of DKA, and considering that there is no Animal Science, University of São Paulo, Brazil (94 dogs) or to consensus in the veterinary literature for bicarbonate levels and a private Veterinary Hospital (6 dogs) between January 2011 blood pH (12,17,18), criteria recommended in human medicine , 2 and August 2013, were recruited consecutively. were used: acidemia (blood pH 7.3) or acidosis (HCO3 Dogs were included if they had a diagnosis of diabetes mellitus , 15 mmol/L) associated ketonemia and hyperglycemia (blood and had been under treatment with insulin for more than 30 d, if glucose . 13.9 mmol/L) (19), with or without ketonuria. The they were newly diagnosed non-ketotic diabetics and if they were criteria were similar to those used by Durocher et al (20). diagnosed with DKA and were under treatment or newly diagnosed. The exclusion criterion for all the groups was the presence Statistical methods

of any of the following comorbidities: acute hepatic failure, renal Results are presented as median and percentiles (P25–75) for each failure, heart failure, advanced respiratory disease, anticonvulsive group. The Shapiro-Wilk normality test was used to determine therapy, sepsis, septic and cardiogenic shock, as these conditions whether data followed Gaussian distribution. The Kruskal-Wallis may alter lactate levels. Dogs with DKA had similar exclusion test was used for comparison of groups for non-parametric criteria, with the exception of comorbidities that were linked to quantitative variables, followed by Dunn’s test. Spearman cor- decompensation, which are indicated in the results section. relation was applied to assess relations between lactate levels The dogs were assigned to 4 groups: 25 healthy controls and glycemia, blood urea nitrogen (BUN), creatinine, anion and 75 diabetics, as follows: 25 newly diagnosed non-ketotic gap, and b-hydroxybutyrate, as well as correlation between pH diabetics, 25 diabetics under insulin therapy, and 25 in DKA. and lactate, BUN and creatinine. A Chi-squared test was used All dogs underwent a complete physical examination, hemo- to compare all groups for gender distribution. Fisher’s exact test gram [complete blood (cell) count (CBC)] (Horiba ABX; model was applied to evaluate association between increased lactate ABC Vet, Montpellier, France), serum biochemical profile, levels and mortality risk. A Mann-Whitney test was used as (Labmax 240; Tokyo Boeki Machinery, Hatchobori, Chuo-ku, a post-hoc subgroup analysis to compare DKA dogs that were Tokyo, Japan), blood glucose, urinalysis, urine culture, and already under treatment with DKA dogs that were newly diag- blood lactate concentration. Venous blood gas analysis was nosed for analyzed variables (blood glucose, lactate, pH, anion used to assess acid-base status and electrolytes. Ketosis was gap, creatinine, BUN). determined by whole blood b-hydroxybutyrate (b-OHB) con- Spearman correlation was used to assess the relation between centration at admission, using the same glucometer with specific the measured variables of interest, including the whole study

818 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY

Table 1. Study population characteristics for gender, age, and weight by group distribution Control At diagnosis Under treatment DKA Statistic Variables n = 25 n = 25 n = 25 n = 25 P-value Gender/Condition, n (%) M 20 (55.9) 8 (66.7) 5 (83.3) 4 (50) 3 (37.5) CM 14 (41.2) 4 (33.3) 1 (16.7) 4 (50) 5 (62.5) x2 0.2372

F 30 (45.5) 7 (53.8) 11 (57.9) 4 (23.5) 8 (47.1) ARTICLE SF 36 (54.5) 6 (46.2) 8 (42.1) 13 (76.5) 9 (52.9) Age (months) Med 53a 118b 120b 120b KW , (P25-P75) (24–75.5) (101.5–132) (90–144) (96–143) 0.0001 Weight (kg) Med 18 9.8 8.9 14 KW

(P25-P75) (12.45–32.7) (6.2–20.5) (5.3–20.8) (7.9–27.25) 0.071 DKA — diabetic ketoacidosis; M — male; CM — castrated male; F — female; SF — spayed female; x2 — Chi-squared;

KW — Kruskal-Wallis; Med — median; P25 — 25th percentile; P75 — 75th percentile. a,b Different letters between groups show differences by Dunn’s test (P , 0.05).

Figure 1. Box-and-whisker plots representing (A) glucose (mmol/L) and (B) lactate (mmol/L) concentration. Median and interquartile range (box), and minimum and maximum values (whiskers) in study groups (control, at diagnosis, under insulin treatment, DKA). Note that diabetic dogs under treatment show lower blood glucose values than those at diagnosis and DKA, but higher than controls (P , 0.05; Kruskal-Wallis/Dunn). Lactate concentrations were similar among groups.

population. Fisher’s exact test was used to assess, as a secondary Factors that may have contributed to DKA were urinary tract aim, whether lactate was associated with a negative outcome in infection (n = 13), hyperadrenocorticism (n = 8), corticosteroid DKA patients (death or euthanasia due to non-improvement use (n = 7), mammary tumor, diestrus, obesity (n = 2 each), of DKA symptoms). pancreatitis, abscess, and estrus (n = 1 each). Among the dogs Statistical analysis was performed using GraphPad Prism with DKA, 15 were newly diagnosed cases of DM. version 5.0 (San Diego, California, USA). Values of P , 0.05 By definition, dogs in diabetic groups had higher glycemic were considered significant. values than controls. Blood glucose levels were significantly higher in dogs with newly diagnosed DM and those with DKA Results compared with those under treatment (P , 0.0001) (Figure 1A). Groups were equivalent with respect to gender and weight dis- The post-hoc subgroup analysis between dogs with DKA that tribution. Diabetic groups were older than the control group were already under treatment and dogs with DKA that had (P , 0.0001) (Table 1). been newly diagnosed showed that glycemia was higher in newly Mixed breed dogs were predominant (27%), followed by diagnosed DKA cases (23.8 versus 19.6 mmol/L; P = 0.045). miniature poodle (13%), Labrador (8%), and dachshund (5%). None of the other measured variables differed. Other breeds (bichon frise, bull terrier, bulldog, cocker spaniel, Lactate concentrations were similar among the groups Dalmatian, Brazilian terrier, golden retriever, Siberian husky, (Figure 1B; Table 2). Anion gap was higher in the DKA group lhasa apso, Maltese, German shepherd, miniature pinscher, pit compared with control and under treatment groups (P , 0.0001) bull, pug, Rottweiler, miniature schnauzer, shar-pei, and shih (Table 2). There was no correlation between lactate and glycemia tzu) were less than 5% each. (r = 0.055; P = 0.62), and no correlation between lactate and

CVJ / VOL 58 / AUGUST 2017 819 FOR PERSONAL USE ONLY

Table 2. Comparison of measured variables among groups Under Control At diagnosis treatment DKA Variables n = 25 n = 25 n = 25 n = 25 P-value Lactate (mmol/L) Med 2.23 1.69 2.27 2.29 0.2466 (P25-P75) (1.46–2.23) (1.09–2.40) (1.44–2.90) (1.48–2.86) Glucose (mmol/L) Med 4.77a 28.81b 14.21c 22.51b,c , 0.0001 P ( 25-P75) (4.33–5.38) (22.15–33.31) (10.02–19.40) (17.43–33.31) ARTICLE Anion gap (mmol/L) Med 14.0a 14.5a,b 13.0a 17.0b , 0.0001 P ( 25-P75) (13.0–15.5) (12.2–16.0) (10.0–14.0) (16.0–21.0) Sodium (Na) (mmol/L) Med 147.0a 140.0b 142.0b 140.0b , 0.0001 P ( 25-P75) (146.5–148.5) (135.5–141.0) (140.0–143.0) (133.0–153.0) Potassium (K) (mmol/L) Med 4.00a 4.80b 4.50b 4.20a,b , 0.001 P ( 25-P75) (3.65–4.30) (4.40–5.05) (4.30–4.80) (3.00–5.09) Chloride (Cl) (mmol/L) Med 117.0a 108.0b 114.0a,b 110.0b , 0.0001 P ( 25-P75) (115.0–118.5) (102.9–114.0) (110.0–115.8) (107.3–126.0) Ionized calcium (iCa) (mmol/L) Med 1.38a 1.27b,c 1.35a,b 1.23c , 0.0001 P ( 25-P75) (1.35–1.41) (1.18–1.35) (1.28–1.40) (1.15–1.30) Beta-OHB (mmol/L) Med 0.20a 1.00b 0.30a 4.15b , 0.0001 P ( 25-P75) (0.20–0.30) (0.65–1.75) (0.20–0.40) (1.45–5.77) Urea nitrogen (BUN) (mmol/L) Med 12.14a 12.85a 13.92a,b 31.42b , 0.001 P ( 25-P75) (9.64–14.28) (8.92–16.78) (10.12–18.74) (9.99–71.76) Creatinine (mmol/L) Med 0.08a 0.07a,b 0.06b 0.11a 0.0016 P ( 25-P75) (0.07–0.084) (0.05–0.10) (0.04–0.07) (0.06–0.30)

DKA — diabetic ketoacidosis; Beta-OHB — beta-hydroxybutyrate; Med — median; P25 — 25th percentile; P75 — 75th percentile. a,b,c Different letters between groups show differences by Dunn’s test (P , 0.05).

anion gap (r = 0.149; P = 0.17). Correlations between variables most common cause of hyperlactatemia (type A lactic acidosis). are shown in Table 3. There was no association between lactate In DM, inadequate oxygen utilization by the tissues may also levels and outcome. play a role in lactate increase rather than deficient oxygen supply (21). Considering the exclusion criteria, none of the dogs Discussion had systemic diseases, other than DM, that could account for Lactate concentration in diabetic dogs, newly diagnosed and type B1 lactic acidosis (7–9), except in a few of the DKA cases, under treatment, as well as in dogs with DKA was not signifi- which may not constitute enough power to detect a difference. cantly different from controls (Figure 1B), in this population. The positive correlation between lactate and glucose con- The lack of significant difference on lactate concentration centration noted by other authors (10,22) was not observed in among the groups may have been due to the study design, i.e., this study. This finding may also be related to the fact that we cross-sectional; in the study on non-insulin-dependent diabetic had no dogs in critical condition, due to the adopted exclusion humans, the patients were followed for 24 h with sequential criteria. Lactate blood concentration was not correlated with any lactate measurements. In that study, non-obese patients with of the measured variables for this study population. In human moderate-to-severe glucose intolerance had higher lactate levels patients with DKA, a significant but weak correlation between compared to patients with normal glucose tolerance (10). b-OHB and glucose levels was observed on admission (23). In Our results also differed from a study that evaluated acid- the present study, there was a moderate correlation between base abnormalities and found higher lactate concentration in glycemia and b-OHB. This correlation was stronger than that diabetic dogs compared to controls, with median values of 2.0 reported in humans, likely because a larger range of glycemia and 1.0 mmol/L, respectively; although all results were within and b-OHB blood levels was taken into account in the pres- normal ranges for dogs (20). ent study (the study population included not only DKA, but One possibility for not finding increased lactate levels in dogs nonketotic diabetics that were newly diagnosed, non-ketotic with DKA, other than study design, may be that none of the diabetics under insulin treatment that were clinically stable, dogs were in hypovolemic shock and, therefore, did not have the and healthy dogs). This association is understandable based on

820 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY

Table 3. Spearman’s Rank-Order Correlation between the measured variables of interest, including the whole study population (n = 100) b 2 Glycemia BUN Creatinine pH -OHB Anion gap HCO3 Lactate r = 0.05 r = 0.09 r = 0.02 r = 20.16 r = 0.01 r = 0.15 r = 20.12 P = 0.62 P = 0.37 P = 0.83 P = 0.11 P = 0.91 P = 0.17 P = 0.23 Glucose r = 0.25 r = 0.005 r = 20.18 r = 0.66 r = 0.07 r = 20.10

P = 0.02 P = 0.96 P = 0.07 P , 0.0001 P = 0.53 P = 0.32 ARTICLE BUN r = 0.48 r = 20.20 r = 0.23 r = 20.36 r = 20.06 P , 0.0001 P = 0.048 P = 0.02 P = 0.0007 P = 0.54 Creatinine r = 20.18 r = 0.17 r = 20.11 r = 20.14 P = 0.08 P = 0.09 P = 0.30 P = 0.17 pH r = 20.47 r = 20.37 r = 0.68 P , 0.0001 P = 0.0005 P , 0.0001 b-OHB r = 0.30 r = 20.45 P = 0.005 P , 0.0001 Anion gap r = 20.61 P , 0.0001 b 2 BUN — blood urea nitrogen; -OHB — beta-hydroxybutyrate; HCO3 — bicarbonate. Significant correlations are indicated in bold font within the table. the pathophysiology of DKA. An absolute or relative insulin ruled out, although none of our patients had overt GI blood deficiency or insulin resistance facilitated by a comorbidity and loss. We did not assess the amount of protein intake in these secondary increase in cortisol, epinephrine, and glucagon leads dogs, and the DKA dogs were anorexic. In dogs with DKA, to increased breakdown of triglycerides due to cellular starva- there is an increased protein catabolic state (26), which may tion, with consequent production of b-OHB, derived from also contribute to increased plasma BUN. Acetyl-Coenzyme A (24,25). The negative weak correlation between BUN and pH may Glycemia levels were positively correlated with BUN, but be explained by a metabolic acidemia related to azotemia. The not with creatinine in this cohort. This is probably related to moderate negative correlation between b-OHB and blood pH pre-renal azotemia secondary to increased diuresis related to is in agreement with the ketoacidosis state. glucosuria (osmotic diuresis), but there are other possibilities. Hypoperfusion and ketosis are not the exclusive reasons to Blood urea nitrogen levels can rise in situations of increased explain the acidic state in DKA, as changes in glucose metabo- production of urea, by excessive protein catabolic rate, decrease lism and reduction of lactate removal from circulation may play in glomerular filtration rate, and increase in tubular urea absorp- a role (1,6), which deserves more investigation regarding DM tion, influenced by antidiuretic hormone (ADH) (26–28). The pathophysiology and its complications. clinical syndrome of pre-renal or functional renal failure, also The equipment routinely used for lactate measurement referred to as pre-renal azotemia, is characterized by a dispro- assesses L-lactate isomer, the predominant portion derived from portionate increase in BUN in relation to creatinine (high BUN pyruvic acid breakdown in anaerobic conditions. D-lactate is to creatinine ratio) and a low urine volume, in the presence of produced from methylglyoxal (MG) and is increased in diabetic an intact renal parenchyma, and related to renal hypoperfusion humans and animals, possibly caused by increased production (27,28). There are, however, situations in which urine flow may of its precursor in these subjects (31,32). The handheld analyzer be high (28), as with corticosteroid use and osmotic diuresis (i-STAT) used herein for measurement of lactate, measures only (as happens in DM). In a simplistic way, disproportionate the L-lactate isomer. This may be the reason why we could BUN increase is often attributed only to a decreased glomeru- not find differences among groups, especially between control lar filtration rate (27,29). However, the antidiuretic hormone and diabetics. The studies that report differences in lactate released in response to hypovolemia and/or hypotension, also concentration do not specify whether L- or D-lactate had been plays a role as it increases reabsorption of both water and urea measured (10,20). in the distal renal tubules (30), based on that fact that urea can An experimental study showed that plasma, liver, and skeletal “back-diffuse” into papillary interstitium under the influence of muscle from diabetic rats had increased D-lactate compared with ADH (28). Both hypovolemia and increased plasma osmolar- that of control rats, while L-lactate was not increased in plasma, ity contribute to ADH secretion; therefore, hypovolemia was but was elevated in the liver and decreased in muscle. In this probably not the only factor involved, since DKA patients may same study, excretion of D-lactate was higher than L-lactate and have increased plasma osmolarity because of hyperglycemia. diabetic rats excreted more D-lactate than L-lactate compared Other causes for volume depletion are extra-renal fluid loss with controls (33). A positive correlation was observed between (vomiting, diarrhea). MG and D-lactate in humans, but not with L-lactate (31). Diabetic ketoacidosis patients may have all these contribu- In humans with DKA, D-lactate is associated with metabolic tions to the enhanced blood urea concentration, as pre-renal acidosis and increased anion gap (31,34). A contribution of factors. Besides those, gastrointestinal (GI) bleeding cannot be L-lactate to the increased AG in DKA was not found in dogs in

CVJ / VOL 58 / AUGUST 2017 821 FOR PERSONAL USE ONLY

one study (20). In order to determine whether diabetic dogs and 11. Becker KL. Disorders of fuel metabolism. In: Principles and Practice dogs with DKA also have increased D-lactate, specific methods of Endocrinology and Metabolism. 3rd ed. Philadelphia, Pennsylvania: Lippincott William & Wilkins, 2001:1448–1449. must be used, as the ones routinely used measure only L-lactate. 12. Macintire DK. Treatment of diabetic ketoacidosis in dogs by continuous Consistently elevated lactate has been reported in stable low-dose intravenous infusion of insulin. J Am Vet Med Assoc 1993; human patients with Type I DM compared with non-diabetics, 202:1266–1272. 13. Nichols R, Crenshaw KL. Complications and concurrent disease asso- and 10% to 15% of DKA patients have elevated lactate con- ciated with diabetic ketoacidosis and other severe forms of diabetes centrations (. 5 mmol/L) (11). A similar percentage (12%) mellitus. Diabetes Mellitus 1995;25:617–650. was observed in another study in humans (23). In the pres- 14. Boysen SR. Fluid and electrolyte therapy in endocrine disorders: Diabetes mellitus and hypoadrenocorticism. Vet Clin North Am Small ent study, 16% of dogs in DKA had a lactate concentration Anim Pract 2008;38:699–717.

ARTICLE . 5 mmol/L, even though the comparison of groups did not 15. Castagnino J, Reussi RR, Mercado J, Torreno M, Tajer C, Charask A. show a significant difference for lactate values. Lactate levels Niveles elevados de lactato medidos a la cabecera del paciente se aso- cian a mayor riesgo de muerte em cuidados intensivos. Revista de were not associated with outcome in the DKA group; however, La Associación Médica Argentina 1998;111:10–16. this was a secondary analysis and may be underpowered to 16. Ferasin L, Nguyenba TP. Comparison of canine capillary and jugular answer this question. venous blood lactate concentrations determined by use of an enzymatic- amperometric bedside system. Am J Vet Res 2008;69:208–211. In conclusion, the most common clinically measured lactate 17. Bruyette DS. Diabetic ketoacidosis. Semin Vet Med Surg (Small Anim) isomer, L-lactate, plasma concentration was not different in 1997;12:239–247. diabetic dogs, compared with healthy dogs. Dogs with DKA 18. Feldman EC, Nelson RW. Canine diabetes mellitus. In: Canine and Feline Endocrinology and Reproduction. 3rd ed. Philadelphia, may present with a higher lactate concentration depending on Pennsylvania: WB Saunders, 2004:580–615. volemia status, related to tissue perfusion; however, this associa- 19. American Diabetes Association. Report of the expert committee on tion was not observed herein, probably because the patients were the diagnosis and classification of diabetes mellitus. Diabetes Care 1997;20:1183–1197. not severely hypovolemic. Longitudinal studies that assess both 20. Durocher LL, Hinchcliff KW, Dibartola SP, Johnson SE. Acid-base isomers (L- and D-lactate) and include more severely ill diabetic and hormonal abnormalities in dogs with naturally occurring diabetes dogs are needed to better elucidate the role of these isomers in mellitus. J Am Vet Med Assoc 2008;232:1310–1320. 21. Blomkalns AL. Lactate — A Marker for Sepsis and Trauma. Emergency the pathophysiology of diabetes acid-base status in dogs. Medicine Cardiac Research and Education Group 2006;2:1–6. Available from: http://www.emcreg.org/pdf/monographs/lactate06.pdf Last Acknowledgments accessed June 14, 2017. 22. Cox K, Cocchi M, Salciccioli J, Carney E, Howell M, Donnino MW. The authors thank the entire Veterinary Hospital of the School Prevalence and significance of lactic acidosis in diabetic ketoacidosis. of Veterinary Medicine and Animal Science, University of São J Crit Care 2012;27:132–137. b Paulo (USP). We also acknowledge the institutional support, 23. Sheikh-Ali M, Karon BS, Basu A, et al. Can serum -hydroxybutyrate be used to diagnose diabetic ketoacidosis? Diabetes Care 2008;31:643–647. the Department of Internal Medicine (VCM) FMVZ-USP, and 24. Stojanovic V, Ihle S. Role of beta-hydroxybutyric acid in diabetic keto- a financial grant by FAPESP (Process n. 2011-21116-1) and acidosis: A review. Can Vet J 2011;52:426–430. CAPES. We also thank Ms. Maria Amelia Ahren Beraldo for 25. Henderson DW, Schlesinger DP. Use of a point-of-care beta- hydroxybutyrate sensor for detection of ketonemia in dogs. Can Vet J. reviewing the French translation of the abstract. CVJ 2010;51:1000–1002. 26. Adrogué HJ. Fluid-electrolyte and acid-base disorders complicating References diabetes mellitus. In: Schrier RW. Diseases of the Kidney and Urinary Tract. 8th ed. Philadelphia, Pennsylvania: Lippincott Williams & . 1 Allen SE, Holm JL. Lactate: Physiology and clinical utility. J Vet Emerg Wilkins, 2007:2353–2378. Crit Care 2008;18:123–132. 27. Feinfeld DA, Bargouthi H, Niaz Q, Carvounis CP. Massive and dispro- 2. Hughes D, Rozanski ER, Shofer FS, Laster LL, Drobatz KJ. Effect of portionate elevation of blood urea nitrogen in acute azotemia. Int Urol sampling site, repeated sampling, pH, and PCO on plasma lactate 2 Nephrol 2002;34:143–145. concentration in healthy dogs. Am J Vet Res 1999;60:521–524. 28. Blantz RC. Nephrology forum: Pathophysiology of pre-renal azotemia. 3. Nemec A, Pecar J, Seliskar A, Kompan L, Butinar J. Assessment of acid- Kidney Int 1998;53:512–523. base status and plasma lactate concentrations in arterial, mixed venous 29. Morgan DB, Carver ME, Payne RB. Plasma creatinine and urea:creatinine and portal blood from dogs during experimental hepatic blood inflow ratio in patients with raised plasma urea. Brit Med J 1977;2:929–932. occlusion. Am J Vet Res 2003;64:599–608. 30. Badr KF, Ichikawa I. Prerenal failure: A deleterious shift from renal 4. Thorneloe C, Bédard C, Boysen S. Evaluation of a hand-held lactate compensation to decompensation. N Engl J Med 1988;319:623–629. analyzer in dogs. Can Vet J 2007;48:283–288. 31. Lu J, Zello GA, Randell E, Adeli K, Krahn J, Meng QH. Closing the 5. Tas O, De Rooster H, Baert E, Doom MH, Duchateau L. The accuracy anion gap: Contribution of D-lactate to diabetic ketoacidosis. Clin of the Lactate Pro hand-held analyser to determine blood lactate in Chim Acta 2012;412:286–291. healthy dogs. J Small Anim Pract 2008;49:504–508. 32. Tsutsui H, Mochizuki T, Maeda T, et al. Simultaneous determination 6. Zacher LA, Berg J, Shaw SP, Kudej RK. Association between outcome of DL-lactic acid and DL-3-hydroxybutyric acid enantiomers in saliva and changes in plasma lactate concentration during presurgical treat- of diabetes mellitus patients by high-throughput LC-ESI-MS/MS. Anal ment in dogs with gastric dilatation-volvulus: 64 cases (2002–2008). Bioanal Chem 2012;414:1925–1934. J Am Vet Med Assoc 2010;236:892–897. 33. Kondoh Y, Kawase M, Kawakami Y, Ohmori S. Concentrations of 7. Kovacic JP. Lactic acidosis. In: Silvesrtain DC, Hopper K, eds. Small D-lactate and its related metabolic intermediates in liver, blood, and Animal Critical Care Medicine. St. Louis, Missouri: Saunders-Elsevier, muscle of diabetic and starved rats. Res Exp Med (Berl) 1992;192: 2009. 407–414. 8. Gunnerson KJ, Harvey CE. Lactic Acidosis. Updated: Apr 25, 2016. 34. Forni LG, Mckinnon W, Lord GA, Treacher DF, Peron JM, Hilton PJ. Available from: http://emedicine.medscape.com/article/167027- Circulating anions usually associated with the Krebs cycle in patients overview#a5 Last accessed June 14, 2017. with metabolic acidosis. Crit Care 2005;9:591–595. 9. Phypers B, Pierce JM. Lactate physiology in health and disease. Cont Educ Anaesth Crit Care Pain 2006;6:128–132. 10. Reaven GM, Hollenbeck C, Jeng CY, Wu MS, Chen YD. Measurement of plasma glucose, free fatty acid, lactate, and insulin for 24 h in patients with NIDDM. Diabetes 1988;37:1020–1024.

822 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY Article

Response to acupuncture treatment in horses with chronic laminitis

Babak Faramarzi, Dongbin Lee, Kevin May, Fanglong Dong

Abstract — There is a need for evidence-based scientific research to address the question of the effectiveness of acupuncture in improving clinical signs of laminitis in horses. The objective of this study was to compare lameness levels before and after 2 acupuncture treatments in horses with chronic laminitis. Twelve adult horses with chronic laminitis received 2 acupuncture treatments 1 week apart. The points were treated using dry needling, hemo- acupuncture, and aqua-acupuncture. Lameness level was objectively evaluated using an inertial sensor-based lameness evaluation system (Lameness Locator), as well as routine examinations following American Association of Equine Practitioners scoring before the first and 1 week after the second acupuncture treatment. Data were analyzed using Wilcoxon signed-rank test and P-values , 0.05 were considered statistically significant. Both the Lameness Locator (P = 0.0269) and routine lameness examination (P = 0.0039) showed a significant reduction in lameness severity. Our results support using acupuncture, along with other treatment options, in treating chronic equine laminitis.

Résumé — Réponse à un traitement à l’acupuncture chez des chevaux atteints de laminite chronique. Il existe un besoin de recherche scientifique factuelle afin d’aborder la question de l’efficacité de l’acupuncture pour améliorer les signes cliniques de la laminite chez les chevaux. L’objectif de cette étude consistait à comparer les niveaux de boiterie avant et après deux traitements d’acupuncture chez des chevaux atteints de laminite chronique. Douze chevaux adultes souffrant de laminite chronique ont reçu deux traitements d’acupuncture à 1 semaine d’intervalle. Les points ont été traités en utilisant des aiguilles, l’hémo-acupuncture et l’aqua-acupuncture. Le niveau de boiterie a été évalué objectivement en utilisant un système inertiel d’évaluation de la boiterie à base de sonde (repérage de la boiterie) ainsi qu’à l’aide d’examens de routine en se basant sur la notation de l’American Association of Equine Practitioners avant le premier traitement et 1 semaine après le deuxième traitement d’acupuncture. Les données ont été analysées en utilisant les tests de rang signés de Wilcoxon et des valeurs P , 0,05 étaient considérées comme étant significatives sur le plan statistique. Le repérage de la boiterie (P = 0,0269) et l’examen de routine de la boiterie (P = 0,0039) ont montré une réduction significative de la gravité de la boiterie. Nos résultats appuient l’utilisation de l’acupuncture, conjointement à d’autres options de traitement, pour traiter la laminite équine chronique. (Traduit par Isabelle Vallières) Can Vet J 2017;58:823–827

Introduction consequently inflicts severe pain and disability in horses (1). Within the horse population, laminitis is a common and severe aminitis is a complicated and interrelated sequence of disease. A previous study reported that 13% of horse operations inflammatory and vascular events which affect the lamellar L were affected by laminitis annually (2). Furthermore, 48% of tissues of the hoof. These events result in breakdown of inter- horses with laminitis referred to veterinary teaching hospitals digitation between the epidermal and dermal lamellae which were eventually euthanized (3). Though several theories have been presented, including mechanical, metabolic, and nutri- College of Veterinary Medicine (Faramarzi, Lee), Graduate tional disorders, the etiology and pathogenesis of laminitis College of Biomedical Sciences (Dong), Western University remain inconclusive and largely unknown; the treatment options of Health Sciences, 309 E Second Street, Pomona, California therefore have only a limited scientific basis (4,5). Generally, 91766, USA; El Cajon Valley Veterinary Hospital, 560 N multi-modal and symptomatic therapy has been indicated Johnson Avenue, El Cajon, California 92020, USA (May). including medication, mechanical support, and dietary restric- Address all correspondence to Dr. Babak Faramarzi; e-mail: tion (1). However, efficacy is often limited and, at times, eutha- [email protected] nasia is inevitable (3,6,7). Use of this article is limited to a single copy for personal study. While allopathic medicine has not been very successful in Anyone interested in obtaining reprints should contact the treating laminitis, there is circumstantial evidence that acu- CVMA office ([email protected]) for additional puncture reduces patient’s lameness and suffering; however, copies or permission to use this material elsewhere. evidenced-based scientific research is scarce (8). Acupuncture

CVJ / VOL 58 / AUGUST 2017 823 FOR PERSONAL USE ONLY ARTICLE

Figure 1. Additional selected acupoints based on the results of diagnostic acupuncture palpation examination: ① Stomach-45, ➁ Gallbladder-44, ➂ Bladder-67, ➃ Bladder-25, ➄ Bladder-26, ➅ Bladder-27, and ➆ BAI-HUI point.

Figure 2. Treatment formula. Hemo-acupuncture in dorsal region (left); from lateral (L) to medial (M): ➀ Small Intestine-1, ➁ QIAN-TI- TOU point, ➂ Triple Heater-1, ➃ QIAN-TI-TOU mirror point, and ➄ Large Intestine-1. Dry needling in palmar region (right); from lateral (L) to medial (M), ➅ Heart-9, ➆ QIAN-TI-MEN point, ➇ Pericardium-9, and ➈ Lung-11.

has been widely used as a complementary treatment option in Materials and methods human and veterinary medicine to produce analgesic effects, Animals normalize physiologic functions, and treat clinical disorders Twelve adult horses [mean 16.9 y 6 5.7 y standard deviation (9). Many recent studies have focused on the effect of acupuncture in treating various aspects of equine diseases such as (SD) old] with chronic laminitis from one geographical area musculoskeletal, gastrointestinal, respiratory, and reproductive were selected. Age, breed, gender, initial degree of lameness, disorders; nonetheless, there is a lack of evidence-based research and duration of lameness were recorded. All horses in this supporting the efficacy of acupuncture in treating laminitis study had been suffering from chronic laminitis for several (6,8). The purpose of this study was to objectively evaluate the months. Referring veterinarians had confirmed a diagnosis effect of acupuncture treatment on the lameness level in horses via clinical examination and radiography more than a month with chronic laminitis. It was hypothesized that acupuncture before the study was performed. The etiology of laminitis would reduce lameness severity in horses with chronic laminitis. was beyond the scope of this study but the owners suggested

824 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY

Objective lameness evaluation Visual lameness evaluation ARTICLE AAEP grade Lameness locator score

Baseline 1 wk after Baseline 1 wk after 2nd acupuncture 2nd acupuncture

Figure 3. Differences in the lameness level between the baseline (before the first acupuncture) and 1 week after the second acupuncture by objective (Lameness Locator) lameness evaluation (left) and routine (AAEP grading) lameness evaluation (right). There was a significant reduction in lameness severity after acupuncture treatment. *P , 0.05; **P , 0.01.

metabolic disorder (n = 2), nutrition (n = 2), mechanical failure/ horse received 2 treatments one week apart. The acupuncture improper shoeing (n = 2), and unidentified reasons (n = 6) as treatments included dry needling, hemo-acupuncture, and likely etiologies. The duration and cause of laminitis were not aqua-acupuncture depending on the nature of the problem and included in the analysis. A few horses were regularly receiv- the location of the acupuncture points treated. For consistency, ing medications (e.g., Pergolide, Firocoxib) or supplements, hemo-acupuncture (Small Intestine-1, Triple Heater-1, Large and the owners were advised to maintain previous medicinal Intestine-1, QIAN-TI-TOU, and QIAN-TI-TOU mirror points) treatments during the study. Eight horses were using thera- and dry needling (Heart-9, Pericardium-9, Lung-11, and QIAN- peutic shoeing; no further trimming/shoeing was advised dur- TI-MEN points) were used as a basic treatment formula for all ing the study. This study was approved by the Institutional the horses in this study (Figure 2). Animal Care and Use Committee and owners’ consent was obtained. Statistical analysis All statistical analyses were conducted using SAS software for Lameness evaluation Windows version 9.3 (SAS Institute, Cary, North Carolina, An objective lameness evaluation was conducted using a wire- USA). Descriptive statistics are presented as means and standard less, body-mounted inertial gyroscope and accelerometer sys- deviations for continuous variables. Data were not normally tem called the “Lameness Locator” (Equinosis LLC, St. Louis, distributed; therefore, non-parametric analysis was required. Missouri, USA). Three small wireless sensors were mounted Lameness severity from before the first and after the second on the horse’s body. One axial accelerometer was mounted on acupuncture treatment was analyzed via Wilcoxon signed-rank the head and one on the pelvis, while a single-axial gyroscope test. All statistical tests were one-sided and P-values , 0.05 were was placed on the dorsal aspect of the right front pastern. The considered statistically significant. wireless data from vertical acceleration of the head and pelvis and angular velocity of the right forelimb were collected using Results a laptop computer, analyzed, and reported as ‘Vector Sum.’ The The severity and painfulness of the condition, and resultant Lameness Locator has been successfully used in previous studies lameness severity, varied among horses. Using the AAEP evalu- to evaluate lameness in horses (10–12). In addition, lameness ation scale, lameness varied from 1 degree to 4 degrees before severity was evaluated using a routine visual lameness examina- the treatment and 1 degree to 3.5 degrees after. The mean tion based on the American Association of Equine Practitioners lameness severity, following AAEP grading, decreased 1 degree, (AAEP) recommended 0 to 5 grading system (13). Lameness from 3.27 degrees at baseline to 2.27 degrees after the second examination was carried out before the first and 1 wk after acupuncture treatment. Results from the objective lameness the second acupuncture treatment. To ensure consistency and evaluation using the Lameness Locator (LL) were consistent with accuracy, the lameness evaluation was replicated 3 times for AAEP grading. Results from both visual lameness evaluation each horse and the arithmetic mean was calculated and used (P = 0.0039) and LL (P = 0.0269) showed a significant reduction for statistical analyses. in lameness severity between these 2 time periods (Figure 3).

Acupuncture treatments Discussion A diagnostic acupuncture palpation examination was per- Due to limited research studies and a growing interest in holistic formed on all horses before each treatment and appropriate medicine from both clinicians and clients, there is a need for acupuncture points were selected and treated (Figure 1). Each advancing evidentiary research in veterinary acupuncture (14).

CVJ / VOL 58 / AUGUST 2017 825 FOR PERSONAL USE ONLY

Our results support the anecdotal evidence that acupuncture can the optimum number and frequency of acupuncture treatments alleviate the level of lameness and pain in horses with chronic to achieve the maximum benefit for this condition, as well as laminitis. how long the therapeutic effects of the acupuncture continue The treatment of chronic laminitis varies with the severity after the last treatment. Future studies should include a focus on of clinical signs and response to treatment. Overall, the goal treatment effect in relation to causative factors as this study did is to treat the underlying disease, if applicable, decrease the not differentiate among laminitis etiologies. Due to the limited pain and lameness with medications [e.g., non-steroidal anti- number of available horses for the study, it was not feasible to inflammatory drugs (NSAIDs)], and reduce stress of the lamellar include a control group and maintain the required power for junction (e.g., modifying hoof biomechanics by therapeutic statistical analysis. Investigation into acupuncture treatments

ARTICLE trimming/shoeing) (1). Nonetheless, the treatment plan may not involving a robust control group will also illuminate important be successful; it has been reported that 67% of laminitic horses aspects of this procedure. suffering from persistent lameness were eventually euthanized Pain control in horses with chronic laminitis is critical for (3). While current treatment options are limited, and at times prognosis and rehabilitation. The results of this study provide unsuccessful, acupuncture has been successfully implemented objective evidence that acupuncture treatment reduces the sever- in a gradually increasing number of cases. Acupuncture provides ity of lameness in horses with chronic laminitis; consequently, a drug-free and safe alternative treatment with minimum side acupuncture could be considered along with other treatment effects and rare adverse reactions (15,16). options in horses suffering from chronic laminitis. Acupuncture influences multiple organs and tissues which are commonly involved in the development of laminitis, such as the Acknowledgments musculoskeletal, gastrointestinal, and immune systems (17). It This study was supported by the American Holistic Veterinary has been suggested that acupuncture prevents and modifies the Medicine Foundation, the National Research Foundation of perception of pain at many different levels of the nervous system Korea (NRF), Ministry of Education (2015R1A6A3A03016859), including an increase in opioid peptides secretion, oxytocin and Western University of Health Sciences, College of Veterinary concentration, and activation of serotonin receptors (18–21). Medicine. CVJ Acupuncture may also increase nitric oxide (NO) synthase activity around meridians and acupoints (22). It has been reported References that NO is a key regulator of local circulation and may improve . 1 Schramme MCA, Labens R. Orthopaedics 2. Diseases of the foot and distal limbs. In: Mair TS, Love S, Schumacher J, Smith RKW, Frazer G, local circulation of L-arginine and glyceryl trinitrate (23,24). eds. Equine Medicine, Surgery and Reproduction. 2nd ed. Amsterdam, In the present study, we used hemo-acupuncture as part of our The Netherlands: Elsevier Health Sciences, 2013:329–368. treatment formula for all horses. Hemo-acupuncture causes 2. United States Department of Agriculture: Animal and Plant Health Inspection Service: Veterinary Services, Centers for Epidemiology and bleeding at acupoints and is associated with the phlebotomy Animal Health, National Health Monitoring System. Lameness and effect, which might relieve extravasated blood stagnation and Laminitis in US Horses. Fort Collins, Colorado: 2000. therefore improve local circulation (25). Laminitis is associated 3. Hunt RJ. A retrospective evaluation of laminitis in horses. Equine Vet with hypoperfusion, ischemia, and necrosis of lamellae (1). J 1993;25:61–64. 4. Heymering HW. 80 causes, predispositions, and pathways of laminitis. It has been stated that destruction of the lamellar basement Vet Clin N Am Equine Pract 2010;26:13–19. membrane is associated with activation and deactivation of 5. Eades SC. Overview of current laminitis research. Vet Clin N Am metalloproteinases (MMPs), including MMP-2 and MMP-9 Equine Pract 2010;26:51–63. 6. Lancaster LS, Bowker RM. Acupuncture points of the horse’s distal as well as a disintegrin and metalloproteinase with thrombo- thoracic limb: A neuroanatomic approach to the transposition of tra- spondin motifs-4 (ADAMTS-4); which are significant in the ditional points. Animals 2012;2:455–471. development of laminitis (26–29). Previous studies on human 7. Hood DM. Practical — Laminitis: Treatment by design. J Equine Vet Sci 2011;31:592–594. and laboratory animals showed that acupuncture inhibits expres- 8. Shmalberg J, Xie H. The clinical application of equine acupuncture. sion and activation of MMP-2 and MMP-9 (30,31). Hence, it J Equine Vet Sci 2009;29:645–652. is possible that acupuncture may not only improve the imme- 9. Vincent C, Richardson P. The evaluation of therapeutic acupuncture: Concepts and methods. Pain 1986;24:1–13. diate clinical signs, but may also prevent the progression and 10. Keegan KG, Kramer J, Yonezawa Y, et al. Assessment of repeatability of recurrence (e.g., occurrence of acute episodes) of laminitis; yet, a wireless, inertial sensor–based lameness evaluation system for horses. more research is warranted. The complex nature of laminitis Am J Vet Res 2011;72:1156–1163. 11. McCracken MJ, Kramer J, Keegan KG, et al. Comparison of an inertial and the likelihood of acupuncture influence on several body sensor system of lameness quantification with subjective lameness evalu- systems suggest acupuncture as an appropriate ancillary treat- ation. Equine Vet J 2012;44:652–656. ment (6,32). Furthermore, acupuncture treatment does not 12. Keegan KG, Wilson DA, Kramer J, et al. Comparison of a body- mounted inertial sensor system–based method with subjective evaluation interfere with other treatments such as therapeutic shoeing, for detection of lameness in horses. Am J Vet Res 2013;74:17–24. medications, dietary restrictions; thus, it can be offered in paral- 13. Lameness exams: Evaluating the lame horse. American Association lel with other treatments of chronic laminitis. Our data suggest of Equine Practitioners [homepage on the Internet]. Lexington, KY, USA: American Association of Equine Practitioners [updated monthly]. that acupuncture is effective in decreasing lameness in horses Available from: https://aaep.org/horsehealth/lameness-exams-evaluating- with chronic laminitis. lame-horse Last accessed June 7, 2017. This study applied 2 weekly acupuncture treatments with 14. Kendall DE. Energy-meridian misconceptions of Chinese Medicine. Schweiz Z Ganz Med 2008;20:112–117. lameness examinations before the treatment and 1 week after 15. Hulea CI, Cristina RT. Acupuncture as a therapeutic tool in health disor- the second treatment. Further research is needed to determine ders in animals: A Review. Sci Pap Anim Sci Biotechnol 2012;45:166–177.

826 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY

16. Robinson KA, Manning ST. Efficacy of a single-formula acupunc- 25. Kim MS, Xie H, Seo KM, Nam TC. The effect of electro-acupuncture ture treatment for horses with palmar heel pain. Can Vet J 2015;56: treatment for chronic back pain in horses. J Vet Clin 2005;22:144–147. 1257–1260. 26. Pollitt CC. Equine laminitis. Clin Tech Equine Pract 2004;3:34–44. 17. Lancaster LS. Medical acupuncture for equine laminitis. J Equine Vet 27. Loftus JP, Johnson PJ, Belknap JK, Pettigrew A, Black SJ. Leukocyte- Sci 2011;31:604. derived and endogenous matrix metalloproteinases in the lamellae of 18. Han JS. Acupuncture and endorphins. Neurosci Lett 2004;361: horses with naturally acquired and experimentally induced laminitis. 258–261. Vet Immunol Immunopathol 2009;129:221–230. 19. Pomeranz B. Scientific research into acupuncture for the relief of pain. 28. Coyne MJ, Cousin H, Loftus JP, et al. Cloning and expression of

J Altern Complement Med 1996;2:53–60. ADAM-related metalloproteases in equine laminitis. Vet Immunol ARTICLE 20. Zhang Y, Li A, Xin J, et al. Involvement of spinal serotonin receptors Immunopathol 2009;129:231–241. in electroacupuncture anti-hyperalgesia in an inflammatory pain rat 29. Budak MT, Orsini JA, Pollitt CC, Rubinstein NA. Gene expression model. Neurochem Res 2011;36:1785–1792. in the lamellar dermis–epidermis during the developmental phase of 21. Yang J, Yang Y, Chen J-M, Liu W-Y, Wang C-H, Lin B-C. Effect of carbohydrate overload-induced laminitis in the horse. Vet Immunol oxytocin on acupuncture analgesia in the rat. Neuropeptides 2007; Immunopathol 2009;131:86–96. 41:285–292. 30. Cayir Y, Ozdemir G, Celik M, et al. Acupuncture decreases matrix 22. Tsuchiya M, Sato EF, Inoue M, Asada A. Acupuncture enhances gen- metalloproteinase-2 activity in patients with migraine. Acupunct Med eration of nitric oxide and increases local circulation. Anesth Analg 2014;32:376–380. 2007;104:301–307. 31. Choi DC, Lee JY, Moon YJ, Kim SW, Oh TH, Yune TY. Acupuncture- 23. Hinckley KA, Fearn S, Howard BR, Henderson IW. Nitric oxide donors mediated inhibition of inflammation facilitates significant functional as treatment for grass induced acute laminitis in ponies. Equine Vet J recovery after spinal cord injury. Neurobiol Dis 2010;39:272–282. 1996;28:17–28. 32. Uchida S, Hotta H. Acupuncture affects regional blood flow in various 24. Bailey SR, Marr CM, Elliott J. Current research and theories on the organs. Evid Based Complement Alternat Med 2008;5:145–151. pathogenesis of acute laminitis in the horse. Vet J 2004;167:129–142.

Animal Health Information Sources

Below is a list of several links to Canadian sources of information on animal health and disease. Our goal is to provide current information while not duplicating existing efforts. We hope that this contact information will be of assistance to veterinarians across the country.

Canadian Animal Health Coalition (CAHC/CCSA) newsletter 1 http://service.meltwaternews.com/mnews-ws/resources/pastnewsletter/latestHtml?n=MTUwNTUz&r=MTUyNzQz

Alberta Animal Health Source (ABVMA) site: 2 http://www.albertaanimalhealthsource.ca/

Animal Health Laboratory — University of Guelph 3 http://www.guelphlabservices.com/ahl/

British Columbia — Animal Health Monitor 4 http://www2.gov.bc.ca/gov/content/industry/agriculture-seafood/animals-and-crops/animal-health/animal-health-centre/newsletter

Prairie Diagnostic Services Inc. (Animal Health Perspectives newsletter) 5 http://pdsinc.ca/

Ministry of Agriculture, Food and Rural Affairs (Ceptor — Animal Health News) 6 http://www.omafra.gov.on.ca/english/livestock/ceptor/news.html

University of PEI — Diagnostic Services (Newsletter) 7 http://www.upei.ca/avc/diagnostic-services/newsletters

CVJ / VOL 58 / AUGUST 2017 827 FOR PERSONAL USE ONLY Article

Flock-level prevalence, geographical distribution, and seasonal variation of avian reovirus among broiler flocks in Ontario

Eric G. Nham, David L. Pearl, Durda Slavic, Rachel Ouckama, Davor Ojkic, Michele T. Guerin

Abstract — Avian reovirus (ARV) is an economically significant pathogen of broiler chickens. Our objective was to determine the prevalence, geographical distribution, and seasonal variation of ARV infection among commercial broiler flocks in Ontario, Canada during grow-out. A cross-sectional study of 231 randomly selected flocks was conducted from July 2010 to January 2012. Fifteen blood samples, 15 whole intestines, and 15 cloacal swabs per flock were collected at slaughter; ELISA and PCR were used to determine a flock’s ARV exposure status. Avian reovirus prevalence was 91% (95% CI: 87 to 94). District alone did not significantly explain the overall variation in the prevalence of ARV (univariable logistic regression; P = 0.073), although geographical differences were identified. The odds of ARV presence were significantly lower in the summer/autumn compared to the winter/ spring (univariable exact logistic regression; P , 0.001). There was no association between flock mortality and flock ELISA mean titer or PCR status.

Résumé — Prévalence au niveau du troupeau, distribution géographique et variations saisonnières du réovirus aviaire parmi les troupeaux de poulets à griller en Ontario. Le réovirus aviaire (RVA) est un agent pathogène important sur le plan économique pour les poulets à griller. Notre objectif consistait à déterminer la prévalence, la distribution géographique et les variations saisonnières de l’infection par le RVA parmi les troupeaux de poulets à griller commerciaux en Ontario, au Canada, durant la phase d’engraissement. Une étude transversale de 231 troupeaux choisis au hasard a été réalisée de juillet 2010 à janvier 2012. Quinze échantillons sanguins, 15 intestins complets et 15 écouvillons cloacaux ont été prélevés à l’abattage; des tests ELISA et ACP ont été utilisés pour déterminer l’état d’exposition du troupeau au RVA. La prévalence du réovirus aviaire était de 91 % (IC de 95 % : de 87 à 94). Le district à lui seul ne peut pas expliquer significativement la variation générale dans la prévalence du RVA (régression logistique univariable; P = 0,073), quoique des différences géographiques ont été identifiées. Les risques de la présence du RVA étaient significativement inférieurs à l’été/automne comparativement à l’hiver/printemps (régression logistique exacte univariable; P , 0,001). Il n’y avait aucune association entre la mortalité du troupeau et le titre moyen ELISA du troupeau ou de son état d’ACP. (Traduit par Isabelle Vallières) Can Vet J 2017;58:828–834

Introduction joint(s). Depending on the severity of the inflammation, affected vian reoviruses (ARVs) are members of the Orthoreovirus birds are unable to move toward feed and water resulting in A genus in the family Reoviridae. Avian reoviruses are associ- poor growth, culling, or death. Birds that survive to slaughter ated with various diseases in chickens, such as respiratory and may be downgraded because of inflamed hock joints. This is a enteric disease, hydropericardium, pericarditis, myocarditis, serious economic concern for broiler producers due to the costs and hepatitis (1). However, the most recognized form of ARV- associated with feed, labor, and lost production. associated diseases, and also a significant cause of lameness, is Avian reovirus infection in broiler chicken flocks appears to tenosynovitis (1). be high. Owoade et al (2) reported a seroprevalence of 41.0% Tenosynovitis, also known as viral arthritis, is predominantly among Nigerian broiler flocks, whereas studies conducted a problem in broiler chickens, and results in swelling of the hock in Iran (3), Turkey (4), and Romania (5) reported higher

Department of Population Medicine, Ontario Veterinary College, University of Guelph, Guelph, Ontario N1G 2W1 (Nham, Pearl, Guerin); Animal Health Laboratory, Laboratory Services Division, University of Guelph, Box 3612, Guelph, Ontario N1H 6R8 (Slavic, Ojkic); Curtis Chicks Limited, 101 Fox Road, Port Hope, Ontario L1A 3V5 (Ouckama). Address all correspondence to Dr. Eric G. Nham; e-mail: [email protected] Use of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.

828 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY

Table 1. a. Primer and probe sequences Final Oligo name Sequence 59-39 concentration AReoV_For_111027 AGCGTGCAAGCCGCAAT 0.25 mM AReoV_Pr_111027 GGAGGTACGTGTGCCAAACTTT 0.50 mM

AReoV_Rev_111027 TGTWATDCCTTCAACRAAMGAGTG 0.25 mM ARTICLE b. Real-time PCR cycling parameters Temperature Hold Ramp Cycles Step (°C) (min:s) (°C/s) (X) Reverse transcription 45 10:00 4.4 1 Activation 95 10:00 4.4 1 Denaturation 94 00:05 2.2 45 Annealing/extension 60 01:00 2.2 Cooling 40 10:00 2.2 1

seroprevalences (70.6% to 98.3%). At present, there is insuf- Table 2. Criteria used to classify commercial broiler chicken flocks sampled at processing between July 2010 and January 2012 in ficient information on the prevalence or distribution of ARV in Ontario, Canada, as positive or negative for avian reovirus (ARV) the Ontario broiler industry. An understanding of the baseline based on enzyme-linked immunosorbent assay (ELISA) and prevalence is the first step toward developing disease control polymerase chain reaction (PCR) results, and the number and strategies and determining the effectiveness of current biosecu- percentage of flocks per criterion (n = 231 flocks) rity and management practices on the risk of ARV infection. ELISAa PCR positiveb PCR negative Thus, the objectives of this study were to establish the baseline Mean titer . 396 Flock ARV positive Flock ARV positive flock-level prevalence, geographical distribution, and seasonal 76 (32.9%) 70 (30.3%) variation of ARV among commercial broiler chicken flocks in Mean titer # 396 and Flock ARV positive Flock ARV positive Ontario during the grow-out period. % samples $ 10%c 31 (13.4%) 19 (8.2%) Mean titer # 396 and Flock ARV positive Flock ARV negative Materials and methods % samples , 10%d 13 (5.6%) 22 (9.5%)

Sampling a The cut-point used for the ELISA mean titer was that specified in the IDEXX This study was part of a larger project designed to estimate reference guide (IDEXX Laboratories, Westbrook, Maine, USA). b The total number of samples tested per flock using PCR was 6 (3 pooled samples the flock-level prevalence and risk factors for 13 pathogens of of cecal tonsil tissues and 3 pooled samples of cloacal swabs); if $ 1 of 6 samples poultry health significance in the Ontario broiler industry. The tested positive, the flock was considered to be PCR-positive. c At least 10% of the blood samples were in profile group 1 (titers of 397 to 999) or sampling frame was all broiler producers in Ontario who were higher. Profile groups are based on titer levels; as the level of antibody titer in a contracted with 6 major processing plants (5 federal and 1 pro- sample increases, the group number increases. The profile groups for this test range from 0 to 18 (Appendix 1). vincial). These plants represent approximately 70% of broiler d The percentage of blood samples in profile group 1 or higher was less than 10%. chickens processed in the province. Sample size estimates were based on identifying risk factors. Thus, using 95% confidence, corresponding producer was phoned and invited to participate 80% power, and a difference of 20% between the proportions in the study. The number of flocks sampled per farm was limited of exposed and unexposed flocks with an estimated baseline to 1; if . 1 flock was selected from the same farm, only the first flock-level (i.e., between-flock) prevalence of 20%, the target flock was considered for inclusion in the study. Flocks originat- sample size to simultaneously evaluate multiple risk factors was ing from Quebec were excluded from the study. 240 flocks. Our estimated baseline prevalence is lower than The number of samples required per flock to detect that of ARV studies conducted elsewhere (41% to 98%) (2–5); ARV within the flock was determined using the formula however, because we were estimating the flock-level prevalence n = lna/lnq (6), with an a priori within-flock prevalence estimate of 13 pathogens, we chose a single, relatively conservative value of 15% and a confidence level of 90%. This a priori estimate of 20% for all pathogens. Approximately equal numbers of was deemed sufficient to detect all pathogens of interest in the randomly selected flocks were enrolled every 4 wk during the context of the larger project. At the processing plants, 15 blood sampling period (July 2010 to January 2012) to account for samples, 15 cloacal swabs pooled into 3 samples (5 swabs per potential seasonal variation in pathogen prevalence. The number sample), and 15 whole intestines (duodenum to cloaca) were of flocks sampled from each processing plant was proportional collected conveniently from each flock. Each blood sample to the plant’s market share of Ontario’s broiler processing. contained blood from 1 or more birds depending on the line- The days on which each plant was visited during each 4-week speed and set-up of the plant. If a flock was shipped by more period were randomized using MiniTab 14 statistical software than 1 truck, the number of samples collected from each truck- (Minitab, State College, Pennsylvania, USA). For each sampling load of birds was approximately equal. For example, if 5 trucks day, 1 flock was randomly selected using numbered coins from were used to ship a flock, 3 samples were collected from each the list of flocks scheduled to be slaughtered that day, and the truckload of birds to ensure representative sampling of the flock.

CVJ / VOL 58 / AUGUST 2017 829 FOR PERSONAL USE ONLY

Table 3. Number of commercial broiler chicken flocks sampled at processing between July 2010 and January 2012 in Ontario, Canada stratified by enzyme-linked immunosorbent assay (ELISA) and polymerase chain reaction (PCR) test results for avian reovirus (n = 231 flocks); the average flock mortalitya per stratum is provided PCR Average (range) PCR Average (range) ELISA mean titer positiveb flock mortality (%) negative flock mortality (%) 5000 to 5999 1 3.1 0 — 4000 to 4999 2 3.2 (0.8 to 5.7) 0 — 3000 to 3999 2 3.0 (2.4 to 3.5) 2 3.0 (2.9 to 3.2) 2000 to 2999 8 3.9 (2.3 to 7.6) 5 4.8 (2.2 to 9.4) 1000 to 1999 18 3.6 (0.3 to 6.3)c 2 2 3.5 (1.7 to 6.4)g ARTICLE 500 to 999 31 3.6 (0.6 to 5.8)d 6 2 3.6 (1.3 to 7.6)h 397 to 499 14 3.3 (0.8 to 8.9)e 5 1 4.4 (2.1 to 6.4)i 0 to 396 44 3.2 (1.9 to 5.5)f 1 4 3.4 (0.6 to 12.7)j

a For each flock, mortality was estimated as the number of chicks placed minus the number of birds shipped, divided by the number of chicks placed, and multiplied by 100. For each stratum, average mortality was calculated as the sum of flock mortality in the stratum divided by the number of flocks in the stratum. b The total number of samples tested per flock using PCR was 6 (3 pooled samples of caecal tonsil tissues and 3 pooled samples of cloacal swabs); if $ 1 of 6 samples tested positive, the flock was considered to be PCR-positive. Due to missing mortality data the number of flocks used for the calculations were c16 of 18, d23 of 31, e11 of 14, f37 of 44, g18 of 22, h23 of 26, i14 of 15, j38 of 41.

Sample processing appearance of syncytia suggestive of reovirus replication and Samples were transported in coolers with ice packs to the Animal 1 additional blind passage was carried out. Health Laboratory, Guelph, Ontario. The samples were then further processed before submission for laboratory testing; for Polymerase chain reaction (PCR) cecal tonsil tissue samples, 3 pools of 5 cecal tonsil tissues were Polymerase chain reaction was carried out on cell culture fluids collected from whole intestines. Instruments were autoclaved after the second passage. Total nucleic acids for ARV-specific between flocks. real-time PCR were extracted using MagMAX-96 Viral RNA Isolation Kit in a MagMAX Express-96 Magnetic Particle Enzyme-linked immunosorbent assay (ELISA) Processor (Applied Biosystems, Foster City, California, USA) A commercial ELISA kit (IDEXX Laboratories, Westbrook, according to the manufacturer’s instructions. Viral RNA was Maine, USA) was used to detect ARV antibodies in 15 serum detected using a real-time PCR assay with primers and a probe samples. Samples were diluted 1 in 500 in the sample diluent designed to amplify a conserved 63 bp fragment of reovirus buffer provided by the manufacturer. A 100-mL volume of S3 segment (Table 1a); the test does not differentiate between diluted sample was added to the wells of the ELISA microplate “pathogenic” and “non-pathogenic” strains. The PCR ampli- and incubated for 30 min at room temperature. The liquid fication was carried out in 25 mL reactions in a LightCycler content of the wells was then removed and each well was washed 480 Real-Time PCR System (Roche, Laval, Quebec) using 5 times with 300 mL of distilled water. A 100-mL volume of AgPath-ID One-Step RT-PCR Kit (Applied Biosystems) under (goat) anti-chicken horseradish peroxidase conjugate was then standard conditions (Table 1b). dispensed into each well and incubated for 30 min at room temperature. The liquid content of the wells was then removed Data analysis and each well was washed 5 times with 300 mL of distilled The total number of samples tested per flock using PCR was 6 water. A 100-mL volume of 3,39,5,59-tetramethylbenzidine (3 pooled samples of cecal tonsil tissues and 3 pooled samples of substrate solution was added and incubated for 15 min at room cloacal swabs); if $ 1 of 6 samples tested positive, the flock was temperature. After incubation, 100 mL of “Stop Solution” was considered to be PCR-positive. Criteria used to classify flocks as dispensed to stop the reaction and absorbance values were then positive or negative for ARV based on ELISA and PCR results measured at 650 nm. are shown in Table 2. For ELISA mean titers, the cut-point used (396) was that specified in the IDEXX reference guide. Titer Virus isolation groups provided by IDEXX are shown in Appendix 1. Flocks Three pools of cloacal swabs and 3 pools of cecal tonsils were were further stratified by ELISA and PCR test results and the used for virus isolation in cell culture to detect viral shedding average flock mortality per stratum was estimated (Table 3). and persistence, respectively. Virus isolation was conducted For each flock, mortality was calculated as the number of chicks in Leghorn male hepatoma cells obtained from American placed minus the number of birds shipped, divided by the num- Type Culture Collection (ATCC#CRL-2117). The cells were ber of chicks placed, and multiplied by 100. For each stratum, propagated in Dulbecco’s Modified Eagle’s Medium -F12 average mortality was calculated as the sum of flock mortality supplemented with 5% fetal bovine serum, 2 mM L-glutamine, in the stratum divided by the number of flocks in the stratum. 100 units/mL penicillin, and 100 mg/mL streptomycin (Gibco, A bi-variable linear regression model was used to determine if Carlsbad, California, USA). Cells were monitored daily for the there was an association between flock mortality (dependent

830 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY

Table 4. Final regression models for the associations between flock mortality and flock avian reovirus (ARV) ELISAa and PCRb test results (linear), ARV presence and season of grow-out (exact logistic), and ARV presence and district of grow-out (logistic), in commercial broiler chicken flocks in Ontario Linear regression: flock mortality and flock ARV ELISA and PCR test results (n = 198 flocks) P-value P-value Variable Coefficient 95% CI of coefficient (t-test) (partial F-test)

Flock ELISA mean titer 0.634 ARTICLE 5000 to 5999 2.70 (20.60, 6.00) 0.108 4000 to 4999 0.96 (21.39, 3.30) 0.421 3000 to 3999 0.34 (21.34, 2.02) 0.687 2000 to 2999 20.21 (21.23, 0.81) 0.686 1000 to 1999 0.09 (20.59, 0.77) 0.794 500 to 999 0.11 (20.50, 0.73) 0.716 397 to 499 20.38 (21.15, 0.39) 0.334 0 to 396 Referent Flock positive to ARV on PCRc Yes 20.16 (20.63, 0.32) 0.519 No Referent Intercept 3.62 (3.15, 4.10) , 0.001 Significance of overall model 0.716; R2 = 0.028 Exact logistic regression: ARV presence and season (n = 227 flocks) Variable Odds ratiod 95% CI of OR (exact) P-value (exact) Season Winter and spring 17.53 (2.98, 1 ∞) 0.0002 Summer and autumn Referent Logistic regression: ARV presence and district (n = 231 flocks) P-value P-value (Likelihood Variable Odds ratio Coefficient 95% CI of coefficient (Wald’s test) ratio test) Districte 0.073 District 1 0.08 22.54 (24.87, 20.22) 0.032 District 3 0.09 22.43 (24.58, 20.28) 0.027 District 4 0.07 22.60 (24.93, 20.28) 0.028 District 5 0.06 22.89 (25.23, 20.55) 0.016 District 6 0.11 22.20 (25.06, 0.70) 0.133 District 7 0.19 21.64 (24.08, 0.80) 0.188 District 9 0.08 22.48 (24.80, 20.16) 0.036 District 2 1 8 Referent Intercept 4.28 (2.30, 6.25) , 0.001

a ELISA = enzyme-linked immunosorbent assay. b PCR = polymerase chain reaction. c At least 1 of 6 pooled cecal tonsil tissue or pooled cloacal swab samples tested positive to ARV on PCR. d Median unbiased estimate. e The Chicken Farmers of Ontario, a producer-run, non-profit organization representing registered Ontario chicken producers, partitions Ontario into 9 administrative/geographical areas referred to as broiler districts. Districts 2 and 8 were chosen as the referent because the highest prevalence was observed in these districts.

variable) and flock ELISA mean titer (categorical) and flock immunity is expected to decrease after approximately 14 d of PCR status (dichotomous) (Table 3); model assumptions of age, leaving the chicks vulnerable to infection if exposed to the normality and homoscedasticity were evaluated visually using virus. Of 231 flocks, 4 were excluded from the seasonal analysis a normal quantile plot and a plot of the standardized residuals due to incomplete data on age at processing. For each season, against the predicted outcome, respectively. prevalence was calculated as the number of flocks that were To explore potential seasonal variation in ARV preva- positive for ARV during the season divided by the number of lence, each flock was categorized into 1 of 4 seasons (sum- flocks sampled during the season. Initially, a univariable logistic mer = June 21 to September 20; autumn = September 21 to regression model was used to determine if there were statistically December 20; winter = December 21 to March 20; spring = significant differences in prevalence between seasons. However, March 21 to June 20). For example, a flock was considered to a model using season as a categorical independent variable could have been raised in the summer if the half age of the flock (19 d not be built due to perfect prediction (100% prevalence of ARV on average in the study population) was before the first calendar in the winter and spring). Season was therefore re-categorized day of autumn. Half age of the flock was chosen because broiler into a dichotomous variable; winter and spring were collapsed breeders in Ontario are vaccinated against ARV, and maternal into 1 category, and summer and autumn, which had similar

CVJ / VOL 58 / AUGUST 2017 831 FOR PERSONAL USE ONLY

Table 5. Flock-level avian reovirus prevalence among commercial broiler chicken flocks sampled at processing between July 2010 and January 2012 in Ontario, Canada by broiler district (n = 231 flocks) District 1 2 3 4 5 6 7 8 9 17/20a 38/39 38/44 16/19 12/15 8/9 28/30 34/34 18/21 (85.0%) (97.4%) (86.4%) (84.2%) (80.0%) (88.9%) (93.3%) (100%) (85.7%)

a The denominator indicates the number of flocks sampled per district. ARTICLE prevalence, were collapsed into another category (the referent 38 d (range: 31 to 53 d). The mean mortality per flock was category), and the 2 categories were compared using a univari- 3.5% (range: 0.3% to 12.7%); this included both natural death able exact logistic regression model. and culling. The median flock size was 25 092 birds (range: For each broiler district (administrative area), prevalence 7242 to 104 040 birds; flock size was available for 200 flocks). was calculated as the number of flocks that were positive for The number of flocks raised using an all-in-all-out system of ARV in the district divided by the number of flocks sampled in production at the flock level (i.e., all birds within a flock were the district. A choropleth map of the geographical distribution placed on the same date and also shipped for processing simul- of ARV prevalence in Ontario was created using ArcGIS 10.4 taneously) was 223 of 227 flocks (98.2%). The number of barns (Esri, Redlands, California, USA). A reference map of Ontario’s in which the flock was raised varied: 1 barn (168/227 flocks; 9 broiler districts was obtained from the Chicken Farmers of 74.0%), 2 barns (46/227 flocks; 20.3%), 3 barns (8/227 flocks; Ontario (CFO; Ontario’s chicken marketing board) and used 3.5%), or 4 barns (5/227 flocks; 2.2%). to create the prevalence map; a manual classification method was used to create prevalence classes with ranges of equal size Avian reovirus prevalence in ArcMap (ArcGIS 10.4; Esri, Redlands, California, USA). In total, 117 of 692 cloacal swabs (16.9%) and 169 of 691 cecal This method was selected because of the very high prevalence tonsils (24.5%) were positive for ARV on real-time PCR, and and relatively low variation of ARV across the province coupled 1756 of 3445 blood samples (51.0%) were in profile group 1 with the uneven distribution of flocks per district. A univariable (titers of 397 to 999) or higher. Overall, 209 of 231 flocks logistic regression model was used to determine if there were sta- (90.5%, 95% CI: 86.8 to 94.3) were positive for ARV. The tistically significant differences in prevalence between districts. number and percentage of flocks per classification criterion However, a model using district as a categorical independent are shown in Table 2. The ELISA mean titers ranged from 1 to variable (districts 1 through 9) could not be developed because 5222; 120 flocks (51.9%) tested positive and 111 flocks (48.1%) district 8, which had a prevalence of 100%, dropped out of tested negative on PCR (Table 3). The average flock mortality the model due to perfect prediction. Therefore, districts 8 and stratified by ELISA mean titer and PCR status ranged from 2 (second highest prevalence and adjacent to district 8) were 3.0% to 4.8% (Table 3); the stratum-specific ranges were vari- combined and used as the category to which all other districts able in both the PCR-positive and -negative groups, with very were compared. A Hosmer-Lemeshow test was used to assess high flock-level mortality on some farms. There was no associa- the fit of the model, with P # 0.05 indicating a lack of fit. A tion between flock mortality, and flock ELISA and PCR results Hosmer-Lemeshow test was chosen because the Pearson Chi- (Table 4), and the assumptions of linear regression were met. squared goodness-of-fit test could not estimate the P-value for The prevalence of ARV by season was 88.4% in the summer the test statistic, most likely due to a low number of data points (61/69 flocks), 84.0% in the autumn (68/81), and 100% in the for some covariate patterns. All statistical analyses (a = 0.05, winter (48/48) and the spring (29/29). The results of the exact 2-tailed) were performed using Stata Intercooled version 13 logistic regression showed that flocks raised in the winter and (StataCorp, College Station, Texas, USA). spring were at higher odds of testing positive for ARV compared with flocks raised in the summer and autumn [OR (median Results unbiased estimate) = 17.53, exact 95% CI: 2.98 to 1 ∞, exact In total, 231 flocks were sampled between July 2010 and January P = 0.0002; Table 4]. 2012. One flock had 16 blood samples collected, 2 flocks had The prevalence of ARV by broiler district ranged from 80% 10 blood samples collected, 11 had 14 collected, and the remain- (district 5) to 100% (district 8) (Table 5, Figure 1). District der (217, 93.9%) had 15 blood samples collected. alone did not significantly explain the overall variation in the prevalence of ARV (LRT x2 = 12.98, P = 0.073; Table 4); how- Characteristics of the study population ever, the odds of testing positive for ARV were lower for flocks Four producers who allowed sample collection at the process- raised in district 1 (OR = 0.08, P = 0.032), district 3 (OR = ing plant did not complete an interview. Consequently, farm/ 0.09, P = 0.027), district 4 (OR = 0.07, P = 0.028), district 5 flock-level data were available for 227 flocks. None of the study (OR = 0.06, P = 0.016), and district 9 (OR = 0.08, P = 0.036) flocks were vaccinated for ARV during the grow-out period. compared to the districts with the highest prevalence (districts 8 The mean and median weight of birds at processing was 2.2 kg and 2). The logistic regression model fit the data (Hosmer- (range: 1.7 to 3.1 kg). The median flock age at shipment was Lemeshow x2 = 0.00, P = 1.000).

832 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY

flocks. Interpretation of the mean titer and PCR results could indicate when (early versus late) exposure likely occurred. For example, flocks with high mean titers were likely exposed to

9 ARV earlier during the grow-out period, therefore had high

1 antibody titers at the time of slaughter, yet may or may not 7 have been shedding virus at that time. In contrast, PCR-positive 2 Prevalence (%) 8 flocks with low mean titers were likely exposed to ARV late ARTICLE 6 80–83 5 84–87 3 4 in the grow-out period, and therefore had not mounted a full 88–91 92–95 immune response at the time of slaughter, yet were shedding 96–100 virus that could be detected on PCR. Such detail might be important when exploring associations between ARV exposure and production data. Figure 1. Flock-level avian reovirus prevalence among Although several flocks in our study had high mean titers, commercial broiler chicken flocks sampled at processing between July 2010 and January 2012 in Ontario, Canada by approximately 3/4 had a mean titer , 1000. This is somewhat broiler district (n = 231 flocks). The map was produced using comparable to the geometric mean titers of ARV from serologi- ArcGIS 10.4 (Esri, Redlands, California, USA). cal samples from a small study in Romania (7 broiler farms), which ranged between 89 and 775 using IDEXX’s ELISA kit Discussion (5). It should be noted that the mean mortality in our study Avian reovirus has been found on many poultry farms with population was consistent with the provincial average; the CFO chickens suffering from tenosynovitis, malabsorption syn- reported that the average mortality for the province between drome, and enteric/respiratory diseases (1). These diseases result 2005 and 2009 was 4.0% (range: 3.6% to 6.1%) for all slaugh- in significant economic losses; however, there is insufficient ter ages and weights. However, there was no statistically signifi- information on the prevalence and distribution of the virus cant association between flock mortality and the flock’s ELISA in the commercial broiler population in Canada. This study mean titer and PCR status, suggesting that there was no direct captured the baseline prevalence of ARV among a large sample relationship between the antibody titers and mortality in this of randomly selected broiler flocks at processing in Ontario baseline surveillance study. This finding might be related to a between July 2010 and January 2012. Although ARV infec- lack of differentiation between pathogenic and non-pathogenic tion was common (90.5%) among broiler flocks in Ontario, strains. Conversely, because we could not differentiate between this was not synonymous with ARV-associated diseases. Our natural mortality and culling, mortality in our study might be findings are similar to the reported prevalence in Iran (98.3%) a surrogate for poor management or heavy culling for ARV- (3), Romania (85.7%) (5), and 4 western provinces in Turkey associated diseases or other diseases, as suggested by the widely (70.6% to 77.2%) (4), and higher than the prevalence reported varied flock-level mortality in several of the low to mid-titer in Nigeria (41.0%) (2). Notwithstanding, there were several strata. aspects of study design/population that differed among these Randomization resulted in excellent representation of the dis- studies and our study, including the classification criteria used tribution of broiler production in the province (7). The preva- to determine flock status (positive/negative), antibody titer lence of ARV was very high across the province, and although thresholds for reovirus seropositivity, the age of broilers at sam- overall, district was not a significant predictor of ARV presence, pling, and vaccination of breeders, which make it difficult to statistically significant differences in prevalence between districts compare findings. Most of these studies used only 1 test (i.e., were identified. The variation in the geographical distribution of ELISA) to determine the flocks’ ARV status (3–5). The mean ARV could be due to localized differences in risk factors, such titer threshold used in the Nigerian study was higher than in as environmental challenges, the density of farms, early mortal- our study (1351 versus 396); the thresholds used in the Iranian ity associated with E. coli, or subtle differences in management and Romanian studies were not specified. Similar to our study, and biosecurity practices among districts. The virus can survive sampling in the Iranian study was conducted at the time of under farm conditions for 12 to 15 wk — it is heat resistant, slaughter, although the age was not specified. In the Romanian stable in a wide spectrum of pH (3.0 to 9.0), and resistant to study, samples were collected from 35-day-old broilers, which disinfectants commonly used in poultry houses (8). This envi- is in line with the average flock age of 38 d in our study. The ronmental resistance of the virus is likely one of the reasons for study conducted in Nigeria sampled blood from 1-day-old to the high prevalence across the province. 8-week-old broilers. Furthermore, in contrast to our study, in To our knowledge, this is the first observational study that which all domestic broiler breeder flocks are vaccinated for ARV has investigated the seasonal variation in ARV prevalence. Avian several times as pullets, including at least 2 live vaccines and reovirus was common in all seasons. Meulemanns and Halen 2 killed vaccines, the parent flocks in the Iranian and Nigerian (9) found that ARV was active at temperatures up to 50°C, studies were not vaccinated against reovirus. indicating the hardiness of the virus. However, information on In our study population, the proportion of flocks that were the seasonal adaptation of the virus to certain temperatures is PCR positive was approximately equal to the proportion that unknown. We found that ARV was less prevalent in the sum- was PCR negative. Further, the distribution of ELISA mean mer and autumn compared to the winter and spring. It is pos- titers was similar among the PCR-positive and PCR-negative sible that factors, such as cleaning and disinfection practices or

CVJ / VOL 58 / AUGUST 2017 833 FOR PERSONAL USE ONLY

ventilation, which vary among seasons, might have contributed Appendix 1. Titer groups provided by IDEXX (IDEXX Laboratories, Westbrook, Maine, USA) for their enzyme-linked to the minor seasonal variation in prevalence. In Ontario, the immunosorbent assay (ELISA) CFO’s On-Farm Food Safety Assurance Program dictates that broiler barns must be disinfected at least once per year (10). Avian reovirus Given the climate in Ontario, it is possible that many produc- Titer 1: 397 Titer 10: 12 000 ers carry out this task in the summer and early autumn when Titer 2: 1000 Titer 11: 14 000 Titer 3: 2000 Titer 12: 16 000 ambient temperatures are more favourable for thorough cleaning Titer 4: 3000 Titer 13: 18 000 and disinfection (9). Titer 5: 4000 Titer 14: 20 000 Avian reovirus has been associated with several poultry Titer 6: 5000 Titer 15: 22 000 Titer 7: 6000 Titer 16: 24 000 ARTICLE diseases. However, the pathogenesis is unclear and its presen- Titer 8: 8000 Titer 17: 28 000 tation is likely influenced by unknown factors. Commercial Titer 9: 10 000 Titer 18: 32 000 ELISA cannot distinguish pathogenic strains of reovirus from non-pathogenic strains (11); therefore, it is not known what percentage of flocks in our study was exposed to pathogenic References strains. Given that ARVs are ubiquitous in domestic fowl, and . 1 Jones RC. Viral arthritis. In: Saif YM, Fadly AM, Glissen JR, that the majority of reoviruses isolated from poultry farms are McDougald LR, Nolan LK, Swayne DE, eds. Diseases of Poultry. 12th ed. Hoboken, New Jersey: Wiley-Blackwell, 2008:309–328. non-pathogenic, it is likely that mainly non-pathogenic strains 2. Owoade A, Ducatez M, Muller C. Seroprevalence of avian influenza accounted for the high prevalence of ARV in broiler farms in virus, infectious bronchitis virus, reovirus, avian pneumovirus, infectious Ontario. Notwithstanding, because there is considerable varia- laryngotracheitis virus, and avian leucosis virus in Nigerian poultry. Avian Dis 2006;50:222–227. tion in virulence between antigenically similar isolates and there 3. Bokaie S, Shojadoost B, Pourbakhsh S, Pourseyyed S, Sharifi L. Sero can be reassortment of genes when a cell is infected by more prevalence survey on reovirus infection of broiler chickens in Tehran than one strain of ARV (12), the high prevalence is of concern province. Iran J Vet Res 2008;9:181–183. 4. Erol N, Şengűl SS. Seroprevalence of avian reovirus infections in because of the potential for the development of new, potentially chickens in western provinces of Turkey. Kafkas Univ Vet Fak Derg pathogenic variants that can lead to clinical disease. Genotyping 2012;18:653–656. of isolates is warranted to identify pathogenic strains. 5. Ona P, Bucur I, Fluerasu L, Stancu A. Serological screening for avian reovirosis. Lucrari Stintifice Medicina Veterinara 2014;47:96–98. Our study findings indicate that ARV is common among 6. Dohoo I, Martin W, Stryhn H. Veterinary Epidemiologic Research. commercial Ontario broiler flocks in all seasons and in all broiler 2nd ed. Charlottetown, Prince Edward Island: VER Inc, 2009:33–56. districts. Investigation of associations between ARV and aspects 7. Eregae ME. The epidemiology of chicken anaemia virus, fowl adenovi- rus, and infectious bursal disease virus in Ontario broiler flocks [PhD of flock management, such as biosecurity and management dissertation]. Guelph, Ontario: University of Guelph, 2014. practices is warranted, as is investigation of associations between 8. Jones RC, Savage CE. The survival of avian reoviruses on materials ARV and flock production parameters. associated with the poultry house environment. Avian Pathol 2003; 32:419–425. 9. Meulemanns G, Halen P. Efficacy of some disinfectants against infec- Acknowledgments tious bursal disease virus and avian reovirus. Vet Rec 1982;111: We are grateful to Dr. Marina Brash, Elise Myers, Thelma 412–413. 10. Chicken Farmers of Ontario [homepage on the Internet] c2016 Martinez, Heather McFarlane, Stephanie Wong, Veronique On-Farm Food Safety Assurance Program Manual (2014). Available Gulde, Christian Sandrock, and Chanelle Taylor, as well as from: https://www.ontariochicken.ca/About-CFO/Quality-Chicken/ fellow graduate students Dr. Michael Eregae and Hind Kasab- On-Farm-Food-Safety-Assurance-Program.aspx Last accessed May 31, 2017. Bachi, for their help during this project. The cooperation of 11. Xie Z, Qin C, Xie L, et al. Recombinant protein-based ELISA for detec- the Chicken Farmers of Ontario, broiler producers, and broiler tion and differentiation of antibodies against avian reovirus in vaccinated processing plants was much appreciated. and non-vaccinated chickens. J Virol Methods 2010;165:108–111. 12. McNulty MS, Jones RC, Gough RE. Reoviridae. In: Pattison M, This project was funded by the Ontario Ministry of McMullin PF, Bradbury JM, Alexander DJ, eds. Poultry Diseases. Agriculture, Food and Rural Affairs (OMAFRA)/University of 6th ed. Philadelphia, Pennsylvania: Saunders Elsevier, 2008:382–391. Guelph Partnership, OMAFRA-University of Guelph Agreement through the Animal Health Strategic Investment (AHSI) fund managed by the Animal Health Laboratory of the University of Guelph, the Poultry Industry Council, and the Chicken Farmers of Ontario. CVJ

834 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY Case Report Rapport de cas

Use of skin stretching techniques before bilateral caudal superficial epigastric axial flaps in a dog with severe burns

Michelle M. Zingel, Sherisse A. Sakals

Abstract — This report describes how 2 days of skin stretching facilitated a tension-free closure of single event bilateral caudal superficial epigastric flaps in a dog with severe hindquarter burns. Full healing at all surgical sites with only minor dehiscence and without further treatment or abnormalities of gait or coat regrowth was achieved.

Résumé — Usage des techniques d’étirement de la peau avant des lambeaux de peau axiaux épigastriques caudaux bilatéraux chez un chien atteint de graves brûlures. Ce rapport décrit comment deux jours d’étirement de peau ont facilité la fermeture sans tension d’un événement unique de lambeaux épigastriques superficiels caudaux bilatéraux chez un chien souffrant de graves brûlures à la cuisse. Une guérison complète a été obtenue à tous les sites chirurgicaux, avec seulement une déhiscence mineure, sans aucun autre traitement ni anomalie de la démarche ou de la repousse de la fourrure. (Traduit par Isabelle Vallières) Can Vet J 2017;58:835–838 Case description glucose testing revealed a slight hypoglycemia [4.0 mmol/L; reference interval (RI): 4.4 to 7.2 mmol/L]. No other abnormalities 2-year-old female standard poodle was referred to the were detected on physical and laboratory examination. Western College of Veterinary Medicine (WCVM) for A The burn wounds were most severe on the caudal hind limbs reconstructive surgery following extensive full thickness burns. and perineum, where a full thickness skin defect extended The dog was a passenger in a vehicle that was involved in an over the entire inguinal area, inner and caudal thighs, extend- accident and subsequently caught fire. The dog sustained burn ing dorsally to the tail base (Figure 1). The defect was almost injuries to the caudal dorsum, inner thighs, buttocks, perineum, symmetrical. A healthy granulation bed was present over this and vulva (Figure 1). The initial recovery was managed by the large wound, and no debridement was necessary. The tail had referring veterinarian, and included debridement of necrotic tis- an exposed caudal vertebra at the distal end. Smaller wounds sue, daily hydrotherapy treatments, and bandaging with grocery were noted on the upper eyelids, left upper and lower lip, dorsal grade honey as the primary layer. Medications administered left caudal thorax, and cranial abdomen. These areas also had included a fentanyl patch (Duragesic; ALZA Corporation, Palo a healthy granulation tissue covering, and no debridement was Alto, California, USA) 75 mg/h transdermally, amoxicillin/ needed. Multiple small areas of flaking skin and small healing clavulanic acid (Clavaseptin; Vétoquinol, Lavaltrie, Quebec), wounds with scabs were noted over the dog’s legs, trunk, neck, 375 mg, PO, q12h, and enrofloxacin (Baytril; Bayer, Shawnee and face. Mission, Kansas, USA), 450 mg, PO, q24h. Bilateral caudal superficial epigastric flaps were planned On presentation to WCVM, approximately 2 wk after the to cover the major defect on the caudal hind limbs and inner trauma, the dog was quiet, alert, and appeared comfortable. thighs. Skin stretching was performed 2 d before the surgery Physical examination revealed a stiff and short-strided hind limb using the technique described by Pavletic and Trout (1) using gait, due to the contraction of wound margins. The patient was Velcro (Velcro Canada, Brampton, Ontario) and cyanoacrylate in thin body condition (body condition score 3/9), and had an (KrazyGlue; Westerville, Ohio, USA). To place the skin stretch- estimated 20% loss of body weight since the trauma. Due to the ing materials, the patient was sedated using hydromorphone wounds, her abdomen was not palpated for abnormalities. Blood (Hydromorphone hydrochloride; Sandoz Canada, Boucherville, Quebec), 0.5 mg/kg body weight (BW), IV, dexmedetomi- Small Animal Clinical Sciences, Western College of Veterinary dine (Dexdomitor; Zoetis, Kalamazoo, Michigan, USA), Medicine, University of Saskatchewan, 52 Campus Drive, 0.0015 mg/kg BW, IV, and ketamine (Narketan; Vétoquinol, Saskatoon, Saskatchewan S7N 5B4. Lavaltrie, Quebec), 0.5 mg/kg BW, IV. The patient was clipped Address all correspondence to Dr. Sherisse Sakals; e-mail: from the mid-sternum to the pubis, extending to the lateral [email protected] abdomen and thorax. Velcro with hooks were adhered to the left Use of this article is limited to a single copy for personal study. lateral abdomen with KrazyGlue, while Velcro with loops were Anyone interested in obtaining reprints should contact the adhered to the right lateral abdomen. Once the KrazyGlue had CVMA office ([email protected]) for additional dried, the hook side of the Velcro was stretched ventrally from copies or permission to use this material elsewhere. the left lateral abdomen, and attached to the looped Velcro on

CVJ / VOL 58 / AUGUST 2017 835 FOR PERSONAL USE ONLY

the right lateral abdomen (Figure 2). The Velcro distance was shortened every 8 h to continue stretching the skin. The skin was monitored for elasticity. After 48 h there was enough skin recruitment estimated to cover the defect. The patient was premedicated with hydromorphone (Hydromorphone hydrochloride; Sandoz), 0.05 mg/kg BW, IV, and dexmedetomidine (Dexdomitor; Zoetis), 0.0015 mg/kg BW, IV. To induce anesthesia, ketamine (Narketan; Vétoquinol), 2.5 mg/kg BW, IV and diazepam (Diazepam; Sandoz), 0.25 mg/kg BW, IV were given. Anesthesia was maintained with 0.5% to 1.75% isoflurane (Pharmaceutical partners of Canada; RAPPORTCAS DE Richmond Hill, Ontario) in 100% oxygen. Ten minutes into the anesthesia, a continuous rate infusion (CRI) of ketamine (Narketan; Vétoquinol), 10 mg/kg BW per hour and remi- fentanyl (Teva Canada; Toronto, Ontario), 10 mg/kg BW per hour were added. An hour into anesthesia, a CRI of lidocaine (Lidocaine Hydrochloride; Pfizer Animal Health, Pfizer Canada, Kirkland, Quebec), 30 mg/kg BW/min lidocaine was started. At the same time, lidocaine (Lidocaine Hydrochloride; Pfizer Canada), 2 mg/kg BW, IV was given. Cefazolin (Cefazolin injection; Hospira, Lake Forrest, Illinois), 22 mg/kg BW, IV was given every 90 min during surgery. Two hours into anesthesia, nitrous Figure 1. Photograph of the burn wounds on the caudal and oxide was added at a rate of 1.4 L/min. Due to mild hypotension inner thighs of the patient at presentation to our facility. (systolic blood pressure of 80 mmHg and mean arterial pressure of 60 mmHg), dobutamine (dobutamine injection; Hospira), 5 mg/kg BW per minute CRI was started, and a tetrastarch After surgery, the patient was administered fentanyl (fentanyl (Voluven; Fresenius Kabi Canada, Mississauga, Ontario) bolus citrate; Sandoz) at 3 mg/kg BW per hour, IV, CRI, meloxicam of 5 mg/kg IV was administered over 6 min. (Metacam, Boeringer Ingelheim; St. Joseph, Missouri, USA), The patient was anesthetized, placed in dorsal recumbency, 0.1 mg/kg BW, SC, and ketamine (Narketan; Vétoquinol), and prepared and draped for surgery using standard procedure. 1 mg/kg BW, SC. The dog appeared comfortable and began Bilateral island caudal superficial epigastric axial pattern flaps standing and walking with a normal gait the morning after were developed (Figure 3). A ventral midline abdominal inci- surgery. Three days after surgery, the patient began squatting sion was made through the skin, extending from between the normally to urinate and started sleeping in a dorsal position second and third nipples to caudal to the last nipple. The flap with legs extended. Together the drains produced 48 to 60 mL/d was undermined deep to the supramammarius muscle and of clear serosanguinous fluid for 6 d after surgery. On the sev- superficial to the external abdominal oblique muscle in a cau- enth day, fluid decreased to , 10 mL/day, and the drains were dal direction. Each flap was elevated and rotated 180° around removed. Mild dehiscence of approximately 3 cm was noted on the caudal aspect of the ipsilateral leg. The lateral margins of the caudal distal portion of each flap 2 d after surgery. each of the 2 donor site sides were apposed at midline without A second surgery was performed 5 d after the initial surgery tension to the level of the inguinal area using 2-0 polydioxa- to debride the tail tip and cover the exposed tail vertebra. At the none (PDSII; Ethicon, Guaynabo, Puerto Rico) in a simple same time, the 2 small areas of caudal distal flap dehiscence were continuous pattern. The subcutaneous tissue was closed using closed. The patient was pre-medicated with dexmedetomidine 3-0 poliglecaprone 25 (Monocryl; Ethicon) in a simple continu- (Dexdomitor; Zoetis), 0.002 mg/kg BW, IV, and hydromor- ous pattern and the same suture was used to close the skin in an phone (Hydromorphone hydrochloride; Sandoz), 0.05 mg/kg intradermal pattern. The large granulation beds at the caudal BW, IV. Heavy sedation was achieved with ketamine (Narketan; aspects of the thighs and buttocks were freshened at the edges Vétoquinol), 0.5 mg/kg BW boluses, IV. A regional tail block where epithelialization was evident. A bridging incision was was also given subcutaneously along the tail using 1 mL of made between the wound bed and the flap on each side. The bupivacaine (Bupivacaine HCl Injection 0.5%; Hospira). The flaps were positioned over the wound bed following the lateral tail tip wound was undermined cranially and advanced over edges, and then turned back cranially to cover the remainder the exposed bone. The subcutaneous tissue was closed using of the medial aspects of the wound beds. The subcutaneous 3-0 poliglecaprone 25 (Monocryl; Ethicon) in a simple con- skin tissue was closed using 3-0 polydioxanone suture (PDSII; tinuous pattern. The skin was closed using 3-0 nylon suture Ethicon) in a simple continuous pattern, and the skin was closed (Ethilon; Ethicon) in a simple interrupted pattern. using 3-0 nylon suture (Ethilon; Ethicon) in a simple inter- Eight days after surgery the incisions were 95% intact, with rupted pattern. Active drains with vacuum bulbs (Jackson-Pratt several areas of 5 mm length exposure of underlying granula- Bulb; Cardinal Health, Waukegan, Illinois, USA) were placed tion tissue. The patient was sent home 10 d after surgery with on each side. a normal gait, and her major burn wounds fully covered. No

836 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY CASE REPORT CASE

Figure 2. The external skin stretching used before surgery. Typically the patient would wear a bandage over the skin stretching materials to prevent self-mutilation.

Figure 3. Seven days postoperative bilateral caudal superficial further intervention was needed after suture removal. The epigastric skin flaps. patient fully healed at all the injury and surgical sites without further dehiscence. There were no gait abnormalities and a full coat of fur grew back in due course. The axial pattern graft allows the closure of large defects while decreasing the time of open wound management (3). Discussion In 1 retrospective study of 10 caudal superficial epigastric Full thickness burns tend to heal slowly, by contraction and epi- flaps, the mean area of flap survival was 99.96% (4). Small areas thelialization, and patients are vulnerable to local and systemic of necrosis occurred near the tip of the flap (0.4% of flap surface infection due to skin necrosis (1). In the patient we describe, area), and around a stab incision that was used for an external healing by contraction would have led to a gait disturbance skeletal fixator (4). Overall, the complications associated with and impaired ability to ambulate. Impairment of normal gait the caudal superficial epigastric flaps were minor and success- was noted when the patient arrived at WCVM, seemingly due fully treated with conservative management (4). In another to the beginning of contraction at the wound margins. The retrospective study of 73 cases of axial pattern flaps in dogs and wounds would also have taken a long time to heal and would cats, incisional dehiscence was the most common complication have resulted in coverage with fragile epithelium, if indeed (5). Successful outcomes occurred in 93% of these cases, with coverage of the entire defect could be achieved at all. Wound approximately 1/3 of cases requiring a second procedure (5). The closure options included skin grafts, advancement flaps, and results in our patient were similar to these findings. Excellent axial pattern flaps. Axial pattern flaps were chosen in this case flap survival was noted, with only minor dehiscence, estimated because of their robust nature and the availability of donor tis- to be maximum 1% of the flap area. We attached the flaps to sue for the flaps which could be used to cover the major defects the recipient bed in a semicircular pattern, and the small area present in this dog. of dehiscence was where there was a confluence of the incision Axial pattern flaps, such as the caudal superficial epigastric into 3 lines meeting at 1 point. flap, incorporate a direct cutaneous artery and vein, and thus In order to stretch the skin for simultaneous bilateral flaps, supply blood to the subdermal plexus (2). The direct blood the process of mechanical creep and stress relaxation were used. supply in an axial flap is advantageous over other reconstructive Mechanical creep is the use of tension applied to the skin over methods, because it leads to comparably higher skin survival a period of time (6). As the dermal collagen fibers are stretched, rates (3). Experimental studies and clinical trials have shown they progressively align and compact in the direction of the that axial pattern flaps can be safely elevated and transferred in stretching force (6). As the collagen fibers align, stress relaxation a single stage to close major defects in their general radius (2). reduces the amount of force that is necessary to maintain a

CVJ / VOL 58 / AUGUST 2017 837 FOR PERSONAL USE ONLY

given strength (6). By applying an appropriate amount of force, In our patient, the use of skin stretching was primarily skin can be recruited and used to cover defects. Skin stretching intended to provide a tension-free donor site closure. However, technique options include external skin stretchers, surgically an added advantage was expansion of the dimensions of the flaps placed tissue expanders, and walking sutures. Complications themselves. It is possible that without this added dimension to of skin stretching can occur if there is continuous stretching the flaps a defect may have remained at the primary site. Skin beyond maximal mechanical creep. This can result in breakage stretching has been used for the primary purpose of expanding of dermal collagen fibers and skin damage (7). an axial pattern flap to cover a large defect (13) and it is likely The technique we used in this patient was described by that our patient benefitted from this effect as well. Pavletic (8). This technique was used to facilitate the closure of Our patient healed fully at both the donor site and the pri- large wounds in several dogs and cats. Use of the technique has mary defect site without further treatment. There was no further also been reported for successful closure of a large wound over dehiscence, no gait deficits or abnormalities, and a full coat of RAPPORTCAS DE the dorsum and flank in a rabbit (9). A recent paper evaluated fur regrew over all the injured areas and surgical sites. With the use of this technique on the extremities of dogs and found the use of skin stretching, 100% wound coverage of extensive that it was not as amenable to successful closure of large wounds defects over the caudal thighs and buttocks was achieved in this as it has been reported to be on the trunk of small animals (10). patient in 1 surgical event. Postoperative complications were External skin stretching was chosen in this case due to its ease minor, and included small areas of dehiscence. With the use of of use, low cost, and to maintain comfort in this hyperesthetic skin stretching, bilateral caudal superficial epigastric flaps can dog. Tissue expanders would require an additional anesthetic be used in dogs to cover major wounds on the caudal thighs. event and surgical procedure, whereas skin stretching was achiev- CVJ able with 1 short sedation event (8). The skin stretching was accomplished without disturbance of the many smaller regional References wounds in various stages of healing, which would make other . 1 Pavletic MM, Trout NJ. Bullet, bite, and burn wounds in dogs and cats. Vet Clin North Am Small Anim Pract 2006;36:873–893. methods of skin recruitment vulnerable to tissue compromise, 2. Pavletic MM. Plastic and reconstructive surgery. Vet Clin North Am and more painful. The hook side of 2-inch Velcro stripping was Small Anim Pract 1990;20:81–103. adhered to the skin on each side of the patient from the lateral 3. Remedios A. Axial pattern flaps. In: Fowler D, Williams JM, eds. Manual of Canine and Feline Wound Management and Reconstruction. thorax to the lateral flank. Strips of the loop side of the Velcro Cheltenham, UK: British Small Animal Veterinary Association, 1999: were then apposed to the hook stripping on one side, stretched 69–81. under the abdomen and across to adhere to the hook strip- 4. Asper RL, Smeak DD. Clinical evaluation of caudal superficial epigastric axial pattern flap reconstruction of skin defects in 10 dogs (1989–2001). ping on the contralateral side. The tension was adjusted every J Small Anim Hosp Assoc 2005;41:185–192. 8 h to maintain tension as the skin progressively stretched and 5. Field EJ, Kelly G, Pleuvry D, Demetriou J, Baines SJ. Indications, relaxed, loosening the overlying Velcro strips, in accordance with outcome and complications with axial pattern skin flaps in dogs and cats: 73 cases. J Small Anim Pract 2015;56:698–706. published guidelines described by Pavletic (6,8). After 48 h the 6. Pavletic MM. Atlas of Small Animal Wound Management and patient was taken to surgery and the Velcro strips were removed. Reconstructive Surgery. 3rd ed. Hoboken, New Jersey: Wiley-Blackwell, Bilateral caudal superficial epigastric flaps without skin 2010:287–295. 7. Cohen B, Cosmetto A. The suture tension adjustment reel, a new stretching has been described in the cat (11). Entire wound device for the management of skin closure. J Dermatol Surg Oncol coverage was achieved within 1 surgery, with moderate edema 1992;18:112–123. and crusting after surgery (11). However, this difference in skin 8. Pavletic MM. Use of an external skin-stretching device for wound closure in dogs and cats. J Am Vet Med Assoc 2000;217:350–354. stretching is likely due to the vast difference between the avail- 9. Bostrom B, Wilson H, Radlinksy M. The use of an external skin- ability of skin in the cat compared to that in most dogs. stretching device for wound management in a rabbit (Oryctolagus Bilateral flaps were indicated in this dog because the wounds cuniculus). J Exot Pet Med 2006;15:145–149. 10. Tsioli V, Papazoglou LG, Papaioannou N, et al. Comparison of three were large and almost symmetrical, covering most of the caudal skin-stretching devices for closing skin defects on the limbs of dogs. buttock and upper thigh region on each side. Considering that J Vet Sci 2015;16:99–106. standard poodles have little excess skin, and this dog was in lean 11. Woods S, Marques AI de C, Yool DA. Simultaneous bilateral caudal superficial epigastric skin flaps in a cat. Vet Rec 2009;164:434–435. body condition, skin stretching was used to decrease the tension 12. Mayhew PD, Holt DE. Simultaneous use of bilateral caudal superficial that would occur at the donor sites with simultaneous bilateral epigastric axial pattern flaps for wound closure in a dog. J Small Anim development of caudal superficial epigastric flaps. In 1 case Pract 2003;44:534–538. 13. Holt DE, Runge J. Use of skin stretchers to elongate a peninsular tho- report, bilateral simultaneous caudal superficial epigastric flaps racodorsal axial pattern flap for antebrachial wound closure in a dog. were raised in a dog and 90% coverage was achieved without the Vet Surg 2011;40:352–356. use of skin stretching (12). Considerable tension was noted at closure of the donor sites (12). Three months after surgery, the remainder of the defect was closed during a second surgery (12).

838 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY Case Report Rapport de cas

Meningeal dissemination of a pituitary carcinoma to the cauda equina in a dog

Nora K. Sheehan, Helena Rylander, Neil Christensen, Laura A. Nafe

Abstract — An 8-year-old spayed female border collie dog was diagnosed with an invasive pituitary macrotumor. Five months after radiation therapy, the patient developed paraparesis and lumbosacral pain. Necropsy revealed a pituitary carcinoma with cauda equina drop metastasis. In cases of pituitary masses, meningeal dissemination should be considered if neurologic status declines.

Résumé — Dissémination méningée d’un carcinome pituitaire à la queue de cheval chez un chien. Une chienne Border collie stérilisée âgée de 8 ans a été diagnostiquée avec une macrotumeur pituitaire invasive. Cinq mois après la radiothérapie, la patiente a développé de la paraparésie et de la douleur lombo-sacrée. La nécropsie a révélé un carcinome pituitaire avec une métastase de la partie inférieure de la queue de cheval. Dans les cas des masses pituitaires, la dissémination méningée devrait être considérée s’il se produit un déclin de l’état neurologique. (Traduit par Isabelle Vallières) Can Vet J 2017;58:839–841 anine tumors of pituitary origin are classified based on Case description size as either microtumors (measuring , 10 mm in C An 8-year-old spayed female border collie dog was presented diameter) or macrotumors (. 10 mm in diameter). Macro- and for evaluation of a right-sided facial nerve paralysis, weight loss, micro-tumors may be further subdivided into functional or and generalized lethargy. Five months earlier, the patient had non-functional groups based on secretory or hormonal activity. been evaluated for polyuria/polydipsia (PU/PD) by its primary The majority of canine pituitary macrotumors are adenomas, care veterinarian and was diagnosed with presumptive central resulting in neurologic signs caused by enlargement of the diabetes insipidus (CDI) based on a positive response to des- pituitary gland and involvement of surrounding structures (1). mopressin (DDAVP). A low dose dexamethasone suppression Pituitary carcinomas, classified by the presence of metastatic (LDDS) test was performed and results were consistent with lesions, are uncommon, making up only an estimated 6% of hyperadrenocorticism (baseline cortisol 176.6 mmol/L, 4-hour canine and 0.1% to 0.2% of human pituitary tumors (2,3). The cortisol 135.2 mmol/L, 8-hour cortisol 74.5 mmol/L), although estimate of 6% for canine pituitary carcinomas may be an over- a false positive result due to non-adrenal illness could not be or underestimate, as clinical signs of pituitary adenomas and ruled out. An abdominal ultrasound examination revealed nor- carcinomas are similar and necropsy is required to differentiate mal adrenal gland size bilaterally. between them. Most pituitary macrotumors are functional and Neurologic examination findings consisted of right facial actively secrete adrenocorticotropic hormone (ACTH), resulting nerve paralysis. Magnetic resonance imaging (MRI; Signa in clinical signs of hyperadrenocorticism (4). As such, primary Horizon 1.5 T, GE Medical Systems, Milwaukee, Wisconsin, pituitary tumors may present with a wide range of clinical signs USA) of brain and cerebrospinal fluid (CSF) collection was related to intracranial compressive lesions, hormonal imbalance, conducted. The MRI revealed a round to oval, homogenously and/or metastatic disease. contrast enhancing mass in the pituitary gland (2.04 3 1.9 3 1.82 cm) consistent with a pituitary macrotumor. The mass compressed the third ventricle and interthalamic adhesion, and there were small regions consistent with intralesional hemor- The University of Wisconsin, School of Veterinary Medicine, rhage and perilesional edema. The cerebrospinal fluid (CSF) Madison, Wisconsin, USA (Sheehan, Rylander, Christensen); was poorly cellular with a mild increase in protein content Oklahoma State University, Center for Veterinary Health [total nucleated cell count 5 cells/mL; reference interval (RI): Sciences, Stillwater, Oklahoma, USA (Nafe). , 5; total protein 0.31 g/L (RI :, 0.25)] with a majority of Address all correspondence to Dr. Laura A. Nafe; e-mail: cells identified as large mononuclear cells. The right facial nerve [email protected] paralysis was thought to be idiopathic and unrelated to the pitu- Use of this article is limited to a single copy for personal study. itary lesion, as the lesion and surrounding compressive area did Anyone interested in obtaining reprints should contact the not involve the caudal brainstem or facial nerve. CVMA office ([email protected]) for additional One week later, the patient underwent computed tomography copies or permission to use this material elsewhere. (CT; GE Lightspeed, GE Medical Systems) of the brain for

CVJ / VOL 58 / AUGUST 2017 839 FOR PERSONAL USE ONLY

500 mm RAPPORTCAS DE Figure 1. Photomicrograph showing a cross section of the pituitary, H&E stain. Primary pituitary carcinoma displaying a sheet of polygonal neoplastic epithelial cells with marked anisocytosis and anisokaryosis and a single mitotic figure. There is moderate to abundant eosinophilic cytoplasm occasionally containing faint basophilic granules.

radiation treatment planning. Intensity modulated radiation was delivered with a TomoTherapy Hi-Art unit (TomoTherapy, Madison, Wisconsin, USA). The dose prescribed was 50 Gy to 95% of the planning target volume (PTV) delivered in 20 daily 500 mm fractions. Prednisone, 0.55 mg/kg body weight (BW), PO, Figure 2. Photomicrograph showing a cross section of the q24h, was administered during treatment for perilesional edema. cauda equina, H&E stain. The epithelial population in the sub- Recheck examination 2 wk after the final dose of radiation arachnoid space is compressing the adjacent cauda equina nerves. There are extensive areas of hemorrhage within the therapy revealed slow hair regrowth in the area previously compressive lesion. shaved for CSF collection and progressive skin irritation over the entire dorsal midline. A skin biopsy was obtained from the dorsum and histopathologic changes were consistent with lumbar region revealed mild intervertebral disc space narrowing calcinosis cutis with secondary pyoderma. The patient was at L5/L6 with moderate spondylosis deformans and bilateral presented for re-evaluation of suspected hyperadrenocorticism. coxofemoral osteoarthritis. The patient was treated supportively An ACTH stimulation test was performed at the time of skin with tramadol (Anneal Pharmaceuticals, Hauppauge, New York, biopsy and results were considered borderline for hyperadre- USA), 2.8 mg/kg BW, PO, q8-12h, and gabapentin (Glenmark nocorticism [pre-cosyntropin cortisol: 88.3 mmol/L (RI: 27.6 Pharmaceuticals, Mahwah, New Jersey, USA), 8.5 mg/kg BW, to 138.0 mmol/L); 1 h post-cosyntropin: 549.0 (RI: 275.9 to PO, q8-12h, for analgesia. 551.8 mmol/L)]. A recheck ACTH stimulation test 5 wk later Three weeks later, the patient was presented for evaluation was normal [pre-cosyntropin cortisol: 44.1 mmol/L (R: 27.6 to of right pelvic limb lameness, non-specific pain, and an acute 138.0 mmol/L); 1 h post-cosyntropin: 397.3 mmol/L (RI: 275.9 decrease in appetite. Neurologic examination revealed obtun- to 551.8)]. In the 2 mo following the ACTH stimulation dation with a normal cranial nerve examination, moderate recheck, calcinosis cutis was reported to be resolving and the ambulatory paraparesis, absent paw replacement test in the left secondary pyoderma was responding to cefovecin sodium pelvic limb, delayed paw replacement test in the left thoracic (Convenia; Zoetis, Parsippany, New Jersey, USA; 8 mg/kg BW, limb, incomplete withdrawal reflexes in both pelvic limbs, and SC, once) and topical 2% chlorhexidine spray. Facial nerve absent cutaneous trunci reflex bilaterally. Pain was elicited on paralysis was reported to have spontaneously resolved. tail manipulation and lumbosacral spinal palpation. The owner Six months after radiation treatment, the patient was pre- elected humane euthanasia at this time. sented for evaluation of worsening PU/PD, decreased appetite, A complete necropsy examination revealed an enlarged reduced pelvic limb mobility, and lethargy. Orthopedic exami- (2.0 3 1.2 3 2.0 cm), grey to white pituitary gland. Histologic nation revealed findings consistent with a previously diagnosed examination of the pituitary gland mass revealed a poorly cranial cruciate ligament rupture. Pain was elicited with mid demarcated and non-encapsulated neoplasm that invaded and caudal lumbar palpation, proximal tail palpation, and dorsal and effaced the overlying hypothalamus and ventral thalamus tail extension. Neurologic examination revealed mild parapare- (Figure 1). The mass was noted to have completely effaced the sis, low tail carriage, delayed paw replacement test in the left normal pituitary gland. The cells were of epithelial origin based pelvic limb, and reduced withdrawal reflex in the right pelvic on cellular morphology and were arranged as sheets, cords, limb, consistent with a lesion in the cauda equina. Computed and trabeculae. The mitotic rate was 21 per 10 high powered tomography (CT) scans of the brain and lumbar vertebral fields (1003). Examination of the adrenal glands revealed column were carried out to evaluate the previously diagnosed marked bilateral cortical hyperplasia. Gross evaluation of the pituitary mass and a potential lumbosacral lesion, respectively. liver revealed multifocal pinpoint to 1 cm, faintly demarcated The pituitary mass was static in size and a CT of the caudal masses that were most consistent with hepatomas based on

840 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY

histopathologic evaluation [composed of sheets of polygonal to dissemination in this patient. The proposed mechanism of cells with distinct cell borders and zero mitotic figures per meningeal dissemination in this case is seeding of tumor cells 10 high powered fields (1003)]. Other regions of hepatic tissue with the flow of CSF in the subarachnoid space. Dissemination contained moderate to multifocal coalescing areas of hepato- due to radiation therapy is unlikely, as the tumor was not cellular glycogen accumulation. Within the lung tissue there directly manipulated during treatment. was marked multifocal to coalescing alveolar and bronchiolar The presumptive central diabetes insipidus diagnosed may REPORT CASE mineralization with interstitial and pleural fibrosis through- have been due to compression of the hypothalamus from the out. Mineralization, fibrosis, and osseous metaplasia were also pituitary neoplasm and/or decreased secretion of antidiuretic detected in the deep dermal layer of the skin. Moderate adnexal hormone from the posterior pituitary. The low dose dexametha- and epidermal atrophy were noted. These findings were consis- sone suppression test was consistent with hyperadrenocorticism tent with a functional pituitary pars distalis carcinoma. (presumed pituitary-dependent) prior to the diagnosis and There was a 2.2 3 0.6 3 0.4 cm, focal, white to red, moder- treatment of the pituitary mass. The patient was never treated ately swollen area in the cauda equina. Histopathologic examina- with medications to reduce hypercortisolemia. The multiple tion of this region showed a moderately well-demarcated neo- normal ACTH stimulation tests following radiation therapy plastic mass of epithelial origin identical to the neoplastic cells were thought to be either due to reduced ACTH secretion post- identified in the pituitary gland (Figure 2). This mass, located in radiation therapy or a false negative result. the subarachnoid space (intradural-extraparenchymal), resulted The ultimate cause of neurologic decline and death in this in compression of the nerves of the cauda equina and multifocal patient was related to signs associated both with the pituitary axonal degeneration. Based on the findings, the diagnosis was mass and the metastatic lesion to the cauda equina. Although metastatic pituitary carcinoma. rare, meningeal dissemination or metastasis of pituitary carci- Discussion noma should be considered in cases of spinal or neurologic signs seen without or in tandem with signs of endocrine dysfunction. This is the first reported case of a pituitary carcinoma with meningeal dissemination to the cauda equina in the dog. Although Acknowledgment the patient was diagnosed with a large, invasive pituitary mass The authors acknowledge Dr. Tamara Chamberlin for her con- based on brain MRI, the presence of neoplastic dissemination tribution to the manuscript. CVJ resulting in cauda equina syndrome was not diagnosed until necropsy. This report serves to inform clinicians of the potential References for meningeal dissemination of pituitary carcinoma resulting in 1. Nelson RW, Ihle SL, Feldman EC. Pituitary macroadenomas and worsening or progression of neurologic signs. macroadenocarcinomas in dogs treated with mitotane for pituitary- dependent hyperadrenocorticism: 13 cases (1981–1986). J Am Vet Med A diagnosis of pituitary carcinoma is supported in this case by Assoc 1989;194:1612–1617. the presence of high mitotic index, effacement of normal pitu- 2. Pollard RE, Reilly CM, Uerling MR, Wood FD, Feldman EC. Cross- itary gland, invasion into normal brain tissue, and lumbosacral sectional imaging characteristics of pituitary adenomas, invasive adenomas and adenocarcinomas in dogs: 33 cases (1988–2006). J Vet Intern subarachnoid metastasis. Pituitary carcinoma has been reported Med 2010;24:160–165. in dogs; however, there are few reports of cerebrospinal and 3. van der Klaauw AA, Kienitz T, Strasburger CJ, Smit JW, Romijn JA. systemic metastasis (1,2,5). Meningeal dissemination is thought Malignant pituitary corticotroph adenomas: Report of two cases and a comprehensive review of the literature. Pituitary 2009;12:57–69. to be more likely than hematologic metastasis in this case due 4. Kent MS, Bommarito D, Feldman E, Theon AP. Survival, neurologic to the absence of neoplastic cells in the lungs and other organs response, and prognostic factors in dogs with pituitary masses treated that are commonly affected by hematologic metastasis. Although with radiation therapy and untreated dogs. J Vet Intern Med 2007; 21:1027–1033. it is a less common mechanism of metastasis, tumor cells may 5. Gestier S, Cook RW, Agnew W, Kiupel M. Silent pituitary corticotroph be carried by the flow of CSF and distributed throughout the carcinoma in a young dog. J Comp Pathol 2012;146:327–331. central nervous system. This process was reported in a canine 6. Koch MW, Sánchez MD, Long S. Multifocal oligodendroma in three dogs. J Am Anim Hosp Assoc 2011;47:77–85. choroid plexus tumor wherein neoplastic cells could be observed 7. Pastorello A, Constantino-Casas F, Archer J. Choroid plexus carcinoma in cerebrospinal fluid samples (6). Similarly, meningeal dissemi- cells in the cerebrospinal fluid of a Staffordshire Bull Terrier. Vet Clin nation was suspected as the cause of metastasis in 3 canine cases Pathol 2010;39:505–510. of noncontiguous, multifocal oligodendromas (7). One case of 8. Takeuchi K, Hagiwara Y, Kanaya K, Wada K, Shiba M, Kato Y. Drop metastasis of adrenocorticotropic hormone-producing pituitary carci- cauda equina metastasis from a primary functional pituitary noma to the cauda equina. Asian Spine J 2014;8:680–683. mass was reported in a human patient, but to the authors’ 9. Gutierrez-Quintana R, Carrera I, Dobromylskyj M, Patterson-Kane knowledge this has not been reported in a canine patient (8). J, Ortega M, Wessmann A. Pituitary metastasis of pancreatic origin in a dog presenting with acute-onset blindness. J Am Anim Hosp Assoc More commonly seen are reports of neoplastic metastasis to 2013;49:403–406. the pituitary gland originating from the pancreas, thyroid, or 10. Spence JA, Holt PE, Sayer PD, Rottcher D, Cooper JE. Metastasis of transmissible venereal tumor (9–11). a transmissible venereal tumour to the pituitary. J Small Anim Pract 1978;19:175–184. Meningeal dissemination of pituitary tumors may be cor- 11. Tamura S, Tamura Y, Suzuoka N, Ohoka A, Hasegawa T, Uchida K. related with surgical manipulation of the tumor by removal, Multiple metastases of thyroid cancer in the cranium and pituitary gland resection, or debulking in humans (12). This poses the question in two dogs. J Small Anim Pract 2007;48:237–239. 12. Della Casa S, Corsello MA, Satta CA, et al. Intracranial and spinal dis- as to whether radiation treatment creates a similar manipulation semination of an ACTH secreting pituitary neoplasia: Case report and risk to neoplastic lesions in the CNS and may have contributed review of the literature. Ann Endocrinol 1997;58:503–509.

CVJ / VOL 58 / AUGUST 2017 841 FOR PERSONAL USE ONLY Case Report Rapport de cas

Cecal entrapment within the epiploic foramen in a mare

Remigiusz M. Grzeskowiak, Elizabeth J. Barrett, Dwayne H. Rodgerson

Abstract — An 11-year-old Thoroughbred mare with colic unresponsive to medical treatment underwent exploratory laparotomy. During surgery the cecum was found entrapped within the epiploic foramen from left to right. The entrapped cecum was reduced through the foramen by gentle traction. After reduction of the cecum, rupture of the portal vein was detected. Loss of a large amount of blood prompted euthanasia during surgery.

Résumé — Encapsulation du cæcum dans le foramen omental chez une jument. Une jument Thoroughbred âgée de 11 ans atteinte de coliques ne répondant pas au traitement médical a subi une laparatomie exploratoire. Durant la chirurgie, le cæcum a été trouvé encapsulé dans le foramen omental de gauche à droite. Le cæcum encapsulé a été réduit par le foramen à l’aide d’une légère traction. Après la réduction du cæcum, la rupture de la veine porte a été détectée. La perte d’une grande quantité de sang a entraîné l’euthanasie durant la chirurgie. (Traduit par Isabelle Vallières) Can Vet J 2017;58:842–844

everal case reports, case series, and retrospective studies (66 to 68 beats/min), mucous membranes were pink and moist, S have reported on epiploic foramen entrapment (EFE), capillary refill time was , 2 s, and her temperature was 37.0°C. involving various portions of intestine. The articles, for the most The mare passed mucus-covered manure. Lung sounds were nor- part, describe small intestinal entrapment, but segments of large mal, and the respiratory rate was slightly increased (20 breaths/ intestine have also been found within the epiploic foramen (EF). min). A complete blood (cell) count (CBC) with standard To the best of our knowledge cecal EFE has only been reported chemistry revealed pre-renal azotemia and dehydration [packed in a supplement to Scheidemann’s thesis from 1989 (1). The cell volume (PCV) 45%, total protein (TP) 70 g/L, creatinine aim of the current case report is to present a rare condition, and 221 mmol/L]. The mare was sedated with xylazine (Xylazine, to describe the diagnostic process, clinical manifestations, and AnaSed LA; MWI, Boise, Idaho, USA), 1.1 mg/kg BW, IV and postmortem findings. Butorphanol (Torbugesic; Pfizer, New York, New York, USA), 0.05 mg/kg BW, IV to allow further examination. Rectal palpa- Case description tion was not done, because even with sedation, the examination An 11-year-old Thoroughbred mare had been exhibiting signs could not be performed safely. A nasogastric tube was placed and of colic 6 h before arrival at the equine hospital. Initial signs no gastric reflux was recovered. On abdominal ultrasonography of colic were mild to moderate, and included anxiety, pawing, the ventral colon wall thickness was , 9 mm. Based on the and getting up and down. At the farm the mare had received lack of response to analgesics an exploratory laparotomy was non-steroidal anti-inflammatory medication (Flunixin meglu- advised. The mare received 5 L of lactated Ringer’s solution mine, Banamine; Akorn, Decatur, Illinois, USA), 1.1 mg/kg before surgery. body weight (BW), IV at the first sign of colic. Although the The patient was sedated with Xylazine (MWI), 1.1 mg/kg mare improved for a short time, recurrence of signs prompted BW, IV, and anesthesia was induced with ketamine (KetaVet; transport to our hospital. Akorn, Decatur, Illinois, USA) 2.2 mg/kg BW, IV, and diaz- Upon arrival the mare was in pain and it was difficult to carry epam (Hospira, Lake Forest, Illinois, USA), 0.1 mg/kg BW, out the admission examination. Her heart rate was increased IV. General anesthesia was maintained in dorsal recumbency with isoflurane inhalant anesthetic. The ventral abdomen was clipped and aseptically prepared and draped. An 30 cm ventral Hagyard Equine Medical Institute, 4250 Iron Works Pike, midline incision was made using a #10 scalpel blade. Abdominal 40511 Lexington, Kentucky, USA. exploration revealed an edematous colon and a thickened, Address all correspondence to Dr. Remigiusz Grzeskowiak; hyperemic cecum. A 180° large colon volvulus was found; this e-mail: [email protected] was reduced but neither the cecum nor the cecocolic ligament Use of this article is limited to a single copy for personal study. could be exteriorized. Anyone interested in obtaining reprints should contact the The apex of the cecum was found entrapped within the EF CVMA office ([email protected]) for additional from left to right. The entrapped cecum was reduced through copies or permission to use this material elsewhere. the foramen. Reduction of the incarceration was accomplished

842 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY by gentle traction with one hand on the left side and manipula- to the transverse colon, and to the root of the mesentery (11). tion with the other hand on the right side of the EF. Attempts The body of the cecum is attached to the ileum by the ileoce- to manually dilate the foramen were not undertaken. During cal fold, and to the right ventral colon by the cecocolic fold. repositioning of the cecum rupture of a major vessel (presumably The apex of the cecum lies medially to the right ventral colon the hepatic portal vein) was noted when the abdomen began and is not attached, which allows for free movement (11). It filling with blood. Blind palpation was used to detect a tear in has been suggested that tapeworms (Anoplocephala perfoliata) REPORT CASE the bleeding vessel. A significant amount of blood was lost. The can cause changes in cecal motility due to inflammation in the mare’s systolic blood pressure dropped to 12 mmHg and her cecal mucosa, causing intussusceptions (9). In the present case heart rate became too high to count. Given the grave prognosis, no tapeworms were found in the cecum during postmortem the decision was made to perform euthanasia. examination. On postmortem examination the peritoneal cavity was filled Predisposing factors for EFE are behavior disorders such with approximately 20 to 30 L of partially clotted blood. The as crib-biting or windsucking (12,13). On the other hand, cecum was diffusely edematous, with severe mucosal hemor- horses that are easily frightened, sweat when excited, or go off rhage, and contained a large quantity of blood-tinged liquid. their food in response to a stressful situation appear to be at The wall and mucosa of the colon were slightly edematous. The reduced risk of EFE (12). The mare did not show any of these contents of the colon were normal in color and loose in consis- behavior disorders. Several studies have not found any correla- tency. The circumference of the EF was 13 cm. The liver was tion between age-related decreased liver size and risk of small torn in the region of the entrance of the portal vein, near the EF. intestine EFE (12–14,15) or between gender of horses and The edges of the right liver lobe were thin and fibrous. The seg- this kind of entrapment (4,5,12). The risk of EFE is increased ment of portal vein between the hepatic capsule and the splenic for horses that had a colic episode within the last 12 mo and vein was torn, and a mesenteric rent in the mesoduodenum was horses with considerable height (mean height: 160 cm) (12). found adjacent to the EF. All horses that underwent colic surgery for EFE, or those in the higher risk group, could be considered candidates for prophy- Discussion lactic laparoscopic closure of the EF. A method for EF closure To the best of our knowledge, there is only 1 previous report on with titanium coils has been described and is considered safe, entrapment of the apex of the cecum within the equine EF (1). without major postoperative complications (16). A more recent The condition is rare, but known to occur in humans (2). Most study by Van Bergen et al (17) described closure of the EF with equine reports concern small intestinal entrapment within the polypropylene mesh (FEMC) and, compared to closure with EF (3–5), but various parts of intestine can be entrapped within the coils, this method led to a more consistent closure of the EF the EF (6–8). Large intestine was found entrapped in the EF (17). Van Bergen et al (18) have published a follow-up study, in in a 6-year-old crossbred gelding (6). The horse was euthanized which spontaneous closure of the EF after an EFE colic surgery during surgery, because reduction of the edematous and hyper- was documented in about 50% of the cases. emic colon through the EF was impossible due to differences The mare herein had shown moderate to severe signs of in size. Another report described entrapment of the entire left abdominal pain. The severity of pain varies among horses dorsal colon within the EF (7). Reduction of the incarcerated affected by EFE. One study reported that 38% of horses with intestine was possible after enterotomy of the pelvic flexure. herniation of the small intestine through the EF did not show The horse recovered uneventfully. In another report the colon signs of abdominal pain at the referral hospital (3). Other could be reduced through the EF after transection of the pelvic studies report horses with signs of moderate to severe pain at flexure (8). In this case the necrotic part of the intestine was admission (4,5,12). resected before the reduction and an end-to-end anastomosis of The short-term survival rate after surgery for small intestinal the colon was performed. This horse also recovered uneventfully. EFE is 78.5% (3,19), whereas the survival rates at 1 and 2 y We considered performing a partial typhlectomy before after surgery were 50.6% and 34.3%, respectively (19). The reducing the cecum from the EF. The prognosis for this pro- major factors influencing long-term post-surgery survival are: cedure is considered good when the cecum can be exteriorized preoperative TP level, preoperative PCV, duration of surgery, fully from the abdomen (9). The apex of the cecum was fixed and repeated laparotomy (20). Specific postsurgical complica- within the EF, and the amputation would have to be performed tions of EFE described in 1 report (21) were fatal hypoglycemia, within the abdomen on the right side of the EF to reach a a large thrombus in the portal vein, and areas of ischemic necro- healthy area of the cecum. We considered using 2 TA 90 staplers sis in the liver. One study focused on fatal bleeding from the to carry out this amputation, to avoid contamination as much portal vein. Rupture of the portal vein can occur spontaneously as possible (10). However, attempts to milk out the content or as a complication of a correction (21). from the entrapped part of the cecum to decrease its diameter The size of the EF ranges from 11.6 cm 1/2 2.6 cm (22). before reduction only produced a mild decrease in size of the The cecum has a larger diameter (15 cm for the cecal body) distended apex. than the window of the foramen. The circumference of the The anatomy of the cecum promotes free wandering of EF reported in the postmortem examination was 13 cm. this part of the intestine within the abdomen. The base of the The difference in diameters confirms that the reduction of the cecum is attached to the ventral surface of the right kidney, to edematous cecum from the EF was difficult to perform without the right lobe of the pancreas, to a part of the abdominal wall, causing a tear in the hepatic portal vein.

CVJ / VOL 58 / AUGUST 2017 843 FOR PERSONAL USE ONLY

The necropsy revealed that the lethal bleeding had occurred 5. Vasey JR. Incarceration of the small intestine by the epiploic foramen from the hepatic portal vein. Theoretically this could have in fifteen horses. Can Vet J 1988;29:378–382. 6. Segura D, Garzon N, Nomen C, Prades M, Valls S. Entrapment of also happened from the other vasculature structure enclosed large colon through the epiploic foramen in a horse. Equine Vet Educ within the EF boundaries. Van Bergen et al (15) confirmed 1999;11:227–228. the presence of 3 vasculature structures in the EF, which are 7. Steenhaut M, Vandenreyt I, Van Royt M. Incarceration of the large colon through the epiploic foramen in a horse. Equine Vet J immediately adjacent to the omental vestibule. These are the 1993;25:550–551. caudal vena cava, which lies dorsally and is largely embedded 8. Foerner JJ, Ringle MJ, Junkins DS, Fischer AT, MacHarg MA, Phillips in the hepatic tissue; the hepatic artery, that runs for part of its TN. Transection of the pelvic flexure to reduce incarceration of the large colon through the epiploic foramen in a horse. J Am Vet Med Assoc course within the hepatopancreatic fold and the hepatoduode- 1993;203:1312–1313. nal ligament, ventral to the omental vestibule; and the hepatic 9. Martin BB, Jr, Freeman DE, Ross MW, Richardson DW, Johnston JK, portal vein, which runs parallel to the hepatic artery, close to Orsini JA. Cecocolic and cecocecal intussusception in horses: 30 cases

RAPPORTCAS DE (1976–1996). J Am Vet Med Assoc 1999;214:80–84. the omental vestibule and EF and can be observed through the 10. Dabareiner RM, White NA. Diseases and surgery of the cecum. Vet hepatoduodenal ligament. All 3 vasculature structures should be Clin North Am Equine Pract 1997;13:303–1513. considered as potential sources of perioperative lethal bleeding 11. Getty R. Sisson and Grossman’s Anatomy of Domestic Animals. 5th ed. Philadelphia, Pennsylvania: Saunders, 1975. during colic surgery. 12. Archer DC, Pinchbeck GL, French NP, Proudman CJ. Risk factors for Cecal EFE is difficult to diagnose before surgery. Clinical epiploic foramen entrapment colic: An international study. Equine Vet J 2008;40:224–230. signs are nonspecific and consist mostly of pain not responsive 13. Archer DC, Freeman DE, Doyle AJ. Association between cribbing and to conservative treatment. This pain is often the reason for entrapment of the small intestine in the epiploic foramen in horses: deciding to proceed with surgical treatment. Time between first 68 cases (1991–2002). J Am Vet Med Assoc 2004;224:562–564. 14. Freeman DE, Schaeffer DJ. Age distribution of horses with strangulation colic symptoms and surgery is very important, and strongly of the small intestine by a lipoma or in the epiploic foramen: 46 cases related to short- and long-term survival. In the present case the (1994–2000). J Am Vet Med Assoc 2001;219:87–89. entrapped cecum was already edematous and hemorrhagic, and 15. Van Bergen T, Doom M, Van Den Broeck W, et al. Topographic anatomical study of the equine epiploic foramen and comparison with this made the reduction of the cecum very difficult, which led laparoscopic visualization. Equine Vet J 2015;47:313–318. to portal vein rupture. 16. Munsterman AS, Hanson RR, Cattley RC, Barrett EJ, Albanese V. Surgical technique and short-term outcome for experimental laparoscopic closure of the epiploic foramen in 6 horses. Vet Surg 2014; Acknowledgment 43:105–113. The authors thank the Department of Pathology of the 17. Van Bergen T, Wiemer P, Bosseler L, Ugahary F, Martens A. Development of a new laparoscopic Foramen Epiploicum Mesh Closure University of Kentucky for conducting the necropsy and pro- (FEMC) technique in 6 horses. Equine Vet J 2016;48:331–337. viding a comprehensive report. CVJ 18. Van Bergen T, Wiemer P, Schauvliege S, Paulussen E, Uguhary F, Martens A. Laparoscopic evaluation of the epiploic foramen after celiotomy for epiploic foramen entrapment in the horse. Vet Surg References 2016;45:596–601. 1. Scheidemann W. Beitrag zur diagnostic und therapie der kolik des 19. Archer DC, Pinchbeck G, Proudman CJ. Factors associated with sur- pferdes die hernia foraminis omentalis. [DVM thesis]. Munich: Ludwig vival of epiploic foramen entrapment colic: A multicentre, international Maximillian University, 1989. study. Equine Vet J 2011;43:56–62. 2. Koh CE, Woods SDS, Usatoff V. Foramen of Winslow hernia. Surg 20. Proudman CJ, Edwards GB, Barnes J, French NP. Factors affecting long- Pract 2007;11:81–83. term survival of horses recovering from surgery of the small intestine. 3. Vachon AM, Fischer AT. Small-intestinal herniation through the Equine Vet J 2005;37:360–365. epiploic foramen: 53 cases (1987–1993). Equine Vet J 1995;27: 21. Davis DM, McClure JR, Bertone AL, Cazayoux CA, Vice JD. 373–380. Hypoglycemia and hepatic necrosis after small intestinal incarceration 4. Archer DC, Proudman CJ, Pinchbeck G, Smith JE, French NP, Edwards through the epiploic foramen in a horse. Cornell Vet 1992;82:173–179. GB. Entrapment of the small intestine in the epiploic foramen in horses: 22. Livesey MA, Little CB, Boyd C. Fatal hemorrhage associated with A retrospective analysis of 71 cases recorded between 1991 and 2001. incarceration of small intestine by the epiploic foramen in three horses. Vet Rec 2004;155:793–797. Can Vet J 1991;32:434–436.

844 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY Case Report Rapport de cas

Outcome of prolonged acute vena cava occlusion after iatrogenic transection and repair in a dog

Marie-Chantal Halwagi, Evan Crawford, Katie Hoddinott, Michelle L. Oblak

Abstract — A 12-year-old castrated male Airedale terrier dog was diagnosed with a hepatocellular carcinoma in the right medial liver lobe. During tumor resection, inadvertent stapling and transection of the caudal vena cava occurred. Complete caval occlusion was required for 18 minutes and primary anastomosis was completed. The dog received 2 blood transfusions and developed mild pelvic limb edema after surgery. Computed tomography evaluation 9 months after surgery showed collateral circulation and suspected stricture of the vena cava with an absence of clinical effect. The dog remained alive and asymptomatic more than 1 year after surgery.

Résumé — Résultat d’une occlusion aiguë et prolongée de la veine cave caudale après transsection iatrogénique et réparation, chez un chien. Un Airedale terrier mâle stérilisé de 12 ans fut diagnostiqué avec un carcinome hépatocellulaire du lobe hépatique médian droit. Durant l’excision de la tumeur, la veine cave caudale fut malencontreusement agrafée et sectionnée. Une occlusion cavale complète s’est avérée nécessaire pour un total de 18 minutes, le temps de faire l’anastomose du vaisseau sanguin. Deux transfusions sanguines furent administrées et le chien développa de l’œdème léger des membres pelviens. Après huit jours d’hospitalisation, le patient reçut son congé. Plusieurs réévaluations ont pu confirmer l’absence de dysfonction d’organes ou de formation de thrombus. Une tomodensitométrie effectuée 9 mois après la procédure chirurgicale a pu mettre en évidence la formation d’une circulation collatérale en réponse à une stricture suspectée de la veine cave caudale. Le chien demeura en vie et asymptomatique plus d’un an après la chirurgie en question. (Traduit par Dre Marie-Chantal Halwagi) Can Vet J 2017;58:845–850

urgery is the treatment of choice for hepatic tumors in Case description dogs and there is a median survival of . 1460 d following S A 12-year-old castrated male Airedale terrier dog, weighing complete surgical resection of a single massive hepatocellular 29 kg, was presented to the Ontario Veterinary College Health carcinoma (1). Morbidity and mortality associated with liver Sciences Centre for evaluation because of a 5-day history of lobectomy depend on which lobe is affected (2). Due to the inappetence. Physical examination was unremarkable and vital location and close proximity to the vena cava, large right-sided parameters were within normal limits. A marked elevation in tumors carry an increased risk of accidental vessel transection alanine aminotransferase (ALT) and aspartate aminotransferase and hemorrhage with a 4.8% intraoperative mortality rate, due (AST) and a mild increase in alkaline phosphatase (ALP) were to exsanguination, in 1 study (1). This case report records a noted on the serum biochemistry profile (Table 1). A coagula- successful clinical outcome following supra-renal caudal vena tion profile was within the normal range. Three-view thoracic cava transection, transient occlusion for more than 15 minutes radiographs showed no evidence of pulmonary metastatic disease and primary repair of the vessel. and a large right-sided hepatic mass was noted on abdominal ultrasound with possible invasion of the caudal vena cava Centre Vétérinaire Daubigny, 3405 Wilfrid-Hamel boulevard, (CVC). Quebec G1P 2J3 (Halwagi); Boundary Bay Veterinary Specialty Computed tomography (CT) evaluation (Brightspeed; GE Hospital, 6325 204 Street #306, Langley, British Columbia Healthcare, Milwaukee, Wisconsin, USA) of the abdomen V2Y 3B3 (Crawford); Department of Clinical Sciences, Ontario identified an 11.6 3 10.7 3 13.7 cm mass located in the Veterinary College, University of Guelph, 28 College Avenue cranial right quadrant, most consistent with hepatic origin. West, Guelph, Ontario N1G 2W1 (Hoddinott, Oblak). Adjacent to the mass was marked compression of the CVC as Address all correspondence to Dr. Michelle L. Oblak; e-mail: well as moderate narrowing of the portal vein with no evidence [email protected] of thrombi (Figures 1, 2). In the left lateral and medial hepatic Use of this article is limited to a single copy for personal study. lobes, 2 well-circumscribed intraparenchymal nodules were Anyone interested in obtaining reprints should contact the noted measuring 2.5 cm each. Mild abdominal effusion was CVMA office ([email protected]) for additional present. The originating liver lobe could not be conclusively copies or permission to use this material elsewhere. determined based on imaging but was suspected to be the right

CVJ / VOL 58 / AUGUST 2017 845 FOR PERSONAL USE ONLY

Table 1. Summary of relevant laboratory data during hospitalization PCV (%) Lactate BUN ALT ALP AST [reference TS (g/L) (mmol/L) (mmol/L) (U/L) (U/L) (U/L) PT (s) PTT (s) range (RR): (RR: 55 to (reference: (RR: 3.5 to USG (RR: 19 to (RR: 22 to (RR: 16 to (RR: 7 to (RR: 10.8 to 39% to 56%] 75 g/L) , 2.5 mmol/L) 9.0 mmol/L) (. 1.030) 107 U/L) 143 U/L) 55 U/L 9.8 s) 14.7 s) Admission 38 82 1.0 5 to 15a 5195 193 243 Pre-op 38 75 1.5 5 to 15a 8.4 13.3 0 h post-op 23 40 1.0 12 h post-op 40 50 2.6 5 to 15a 1.032 24 h post-op 36 50 4.5 15 to 26a 1.021 566 142 RAPPORTCAS DE 36 h post-op 28 52 1.7 30 to 40a 1.018 48 h post-op 26 50 2.1 30 to 40a 1.015 72 h post-op 25 56 1.3 15 to 26a 1.012 5 152 5 d post-op 17 51 1.1 14 d post-op 46 81 Urea = 15.5 78 477 (RR: 3.5 to 9.0) Creatinine = 110 (RR: 2 to 150)

a Measured with the Azostix. op — operation; PCV — packed cell volume; TS — total solids; BUN — blood urea nitrogen; USG — urine specific gravity; ALP — alkaline phosphatase; ALT — alanine aminotransferase; AST — aspartate aminotransferase; PT — prothrombin time; PTT — partial thromboplastin time.

lateral lobe with concern for adhesions to the hepatic CVC tion of the transected CVC. A second Satinsky clamp was then without invasion. placed across the cranial margin of the resection site and the The patient was placed under general anesthesia for sur- staples were removed from the vena cava portion of the staple gery with a standard protocol and antibiotics (Cefazolin; Teva line. The cranial border of the CVC was debrided minimally Canada, Toronto, Ontario), 22 mg/kg body weight (BW), IV, to avoid significant shortening and anastomosis of the 2 ends were administered every 90 min. On exploration, caudal dis- of the CVC was carried out using 5-0 polypropylene suture placement of the stomach and duodenum was visualized and a (Prolene; Ethicon, Somerville, New Jersey, USA). First the large mass was present with adhesions to the diaphragm. The dorsal margins were apposed with a simple continuous suture additional hepatic nodules noted using computed tomography line followed by a second continuous suture line on the ventral (CT) could not be visualized. A releasing incision was per- margin. The caudal Satinsky clamp was released and several formed along the central tendinous portion of the diaphragm, additional small caval tears were noted associated with previ- approximately 2 cm long in the dorsal to ventral direction, to ous staple lines. The clamp was replaced and the defects were allow for caudal retraction of the mass. The mass was identified repaired with interrupted sutures of 5-0 polypropylene. Release filling the right side of the cranial abdomen, and associated of the clamps resulted in return of blood flow with an additional with the right medial liver lobe. The mass was dissected free longitudinal defect noted on the dorsolateral wall of the vena from the diaphragm and lateral liver lobe. The gallbladder cava. Partial occlusion with a Satinsky clamp allowed repair of was preserved. Following dissection, the mass was more freely the defect with 5-0 polypropylene in an interrupted pattern moveable and could be partially exteriorized from the abdo- while permitting some resumption of caval flow. Following men, although cranial visualization remained challenging. The release of all clamps, minimal blood loss was noted through the suspected vascular pedicle was identified, the stapler was placed needle puncture sites and complete blood flow was returned. An as high on the pedicle as possible, 5 mm proximal to the tumor approximately 25% reduction in caval diameter was noted at the and against the diaphragm at the hilus. The pedicle was stapled level of the main suture line. The time for total CVC occlusion with a 30-mm vascular thoraco-abdominal stapler [TA30V; was estimated at 18 min, with partial occlusion occurring for an Covidien (Medtronic), Mansfield, Massachusetts, USA] and additional 5 min. The remaining vascular pedicle of the affected transected distal to the staple line to remove the associated mass lobe and associated mass was stapled with a thoraco-abdominal and liver lobe. Following transection, the mass and associated stapler and was transected distal to the staples. The diaphragm liver lobe remained attached to the liver craniolaterally and there was closed with 3-0 polydioxanone (PDS; Ethicon) in a simple was significant hemorrhage from the transected stump distal continuous pattern and transdiaphragmatic thoracocentesis to the staples. The origin of the hemorrhage was determined was performed to achieve negative pressure. The vena cava was to be the caudal margin of the transected CVC with the staple re-evaluated and no evidence of bleeding was present at that line identified crossing the cranial margin. The mass remained time. The anastomosis site was covered with an absorbable adhered to the caudal portion of the CVC. A Satinsky clamp hemostatic agent (Surgicel Absorbable Hemostat; Ethicon). was immediately placed on the CVC, caudal to the mass. The Following transection and during complete occlusion of the mass and liver lobe were dissected away from the distal por- CVC, the patient received a 200 mL whole blood transfusion

846 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY CASE REPORT CASE

Figure 1. Dorsal reformat of computed tomography images Figure 2. Sagittal reformat of computed tomography images of the canine patient’s abdomen (soft tissue algorithm, portal of the canine patient’s abdomen (soft tissue algorithm, portal phase). The caudal vena cava (black stars) is opacified with phase). The caudal vena cava (black stars) is opacified with contrast medium and markedly compressed by the hepatic mass. contrast medium and markedly compressed by the hepatic mass.

(3.6 mL/kg BW) and 4.28 mL/kg BW of hydroxyethyl starch (Voluven; Fresenius, Bad Homburg, Germany) during the surgery. The arterial blood pressures ranged from 165/85 mmHg (mean: 105 mmHg) to 45/35 mmHg (mean: 38 mmHg). Isoflurane was reduced from 2.0% to 0.5% during hypotension. The patient was maintained on continuous rate infusion (CRI) of fentanyl (Sandoz Canada, Boucherville, Quebec), 0.005 to 0.01 mg/kg BW per hour and dopamine (Baxter, Mississauga, Ontario), 0.003 to 0.01 mg/kg BW per minute throughout the surgery. No central venous access was available to monitor changes in venous pressure following the caval occlusion. Recovery from anesthesia was uneventful. Isofluorane was discontinued and the patient was extubated 10 min later. Prior to extubation, direct arterial blood pressure was 120/55 mmHg (mean: 72 mmHg) and the patient was maintained on the same Figure 3. Follow-up computed tomography examination. Dorsal fluid supplementations and infusions (fentanyl; dopamine) until reformat of the cranial abdomen in soft tissue window, after contrast administration, venous phase. The previous right-sided recovery in the intensive care unit (ICU). hepatic mass has been removed. Just caudal to the diaphragm On admission to the ICU, the patient was tachycardic and and to the cranial aspect of the right kidney, the caudal vena anemic and intravenous crystalloids with electrolyte supple- cava is reduced in size with no contrast filling of the lumen as it extends dorsal to the liver (white arrows). Contrast medium mentation were administered after an additional 200 mL of was seen again in the caudal vena cava at the site of the hepatic whole blood, which resulted in stabilization of the heart rate veins draining into the cava. Note: there are multiple renal cortical and a post-transfusion PCV of 23%. Direct arterial blood cysts bilaterally (some identified with black arrows). pressure remained . 114/72 mmHg (mean: 81 mmHg). A urinary catheter was placed and the patient was maintained During the first 12 h after surgery, occasional ventricular with Fentanyl, 2 to 6 mg/kg BW per hour constant rate infusion premature contractions (VPC) were present but no abnormali- (CRI) and Ketamine (Vetalar; Bioniche Animal Health Canada, ties requiring intervention were noted. Twenty-four hours after Belleville, Ontario), 0.1 to 1 mg/kg BW per hour CRI, for pain surgery the patient was treated with a CRI of magnesium sulfate management. (Fresenius Kabi Canada, Richmond Hill, Ontario), 5 mg/kg BW

CVJ / VOL 58 / AUGUST 2017 847 FOR PERSONAL USE ONLY

RAPPORTCAS DE Figure 4 (A, B, C). Follow-up computed tomography examination. Transverse images in soft tissue window after contrast administration, venous phase. Multiple veins were enlarged compared to the first CT examination. A — enlarged right circumflex iliac vein (white arrow), which drained into an enlarged dorsal subcutaneous vein (white arrow, B), and eventually into an enlarged intercostal vein (right T12 intercostal, white arrow) and azygous vein (C).

per hour, IV due to increasing numbers of VPCs. The PCV transfusion was administered, which resulted in improvement and TS remained about the same, slightly under the low end of both the anemia and attitude. No further decrease in PCV of normal. Lactate value spiked 24 h following surgery, but was noted over the 3 remaining days prior to discharge and quickly returned within normal range. Renal parameters were the patient was discharged 8 d after surgery. At the time of monitored with Azostix Reagant Strips (Siemens Healthcare discharge, the PCV had reached 30%. Mild pelvic limb edema Diagnostics, New York, New York, USA) and elevated blood was still present but rapidly improving. Histopathology of the urea nitrogen (BUN) was noted 36 h after surgery (Table 1). resected mass was consistent with hepatocellular carcinoma This was suspected to be pre-renal in origin, as urea and cre- (HCC). atinine remained normal on the biochemistry profile 24 and Recheck examination 6 d after discharge as well as 2, 3, 6, 48 h after surgery. The rate of intravenous fluids was increased, and 9 mo after surgery showed a good clinical condition and from 3 times (150 mL/h) to 4 times the estimated maintenance a normalized alanine aminotransferase (ALT). The pelvic limb requirements (200 mL/h) to address the suspected dehydration. edema was completely resolved by the 2-month recheck. Repeat Presumed pigmenturia was noted in the urine collection bag ultrasounds were performed at the rechecks and at 2 mo there 36 h after surgery with a urine PCV of 3%. Throughout the was some restriction of visualization at the anastomosis site but remainder of hospitalization, the patient’s urine varied from no evidence of thrombus formation within the visualized seg- red to a normal yellow color. A urine culture demonstrated an ments of the CVC. At 6 mo, ultrasound showed no evidence absence of bacterial growth. of caval thrombus formation but a hyperechoic hepatic nodule An ultrasonographic evaluation (Philips iU22 ultrasound; was noted in the left medial lobe, that was previously visible on Andover, Massachusetts, USA) was performed 24 h after sur- CT but not ultrasonographically. A CT-scan performed 9 mo gery to visualize the anastomosis site and evaluate for evidence after surgery showed no evidence of local recurrence and that of thrombus. A minimal amount of free abdominal fluid was the previously visualized nodule in the left medial lobe was noted, with a PCV of only 3%. The affected portion of the CVC slightly larger (3.6 3 2.7 3 4 cm) (Figure 3). A caval narrowing could not be imaged due to residual free gas in the abdomen but with secondary extensive venous collateral circulation was also adequate blood flow was present at the level of the porta hepatis identified (Figures 4A, B, C). The owner reported the patient as well as within the hepatic veins; therefore, caval thrombus had great energy and appetite. was thus deemed unlikely. Forty-eight hours following surgery, the patient developed moderate edema in the right pelvic limb. Discussion Frequent massage and physiotherapy was initiated. The patient This case report describes a successful outcome following acute was otherwise stable with unchanged blood gas and electrolyte transection and repair of the CVC during right liver lobectomy values. resulting in complete occlusion of the CVC for more than From 72 h after surgery to discharge, the patient’s clinical 15 min. Following accidental transection, the options for this condition progressively improved. Intravenous medications were patient were primary repair or euthanasia. Repair was elected as transitioned from CRI (Fentanyl 2 to 6 mg/kg BW per hour the patient was stable under general anesthesia prior to transec- CRI; Ketamine 0.1 to 1 mg/kg BW per hour CRI) to intermit- tion. Good long-term outcome would be expected with adequate tent administration [Hydromorphone hydrocholoride (Sandoz removal of the primary tumor as it was localized and invading Canada)], 0.025 to 0.05 mg/kg BW, IV q6h, and then to oral one side of the liver (1,2). While there are several reports of medication (Tramadol HCl; Chiron Compounding Pharmacy, cavectomy for obstructive neoplastic disease and experimental Guelph, Ontario), 100 mg PO, q8h. Intravenous fluid therapy studies of recovery following temporary caval occlusion, to the was decreased to daily maintenance requirements. The PCV authors’ knowledge this is the first report in a clinical case under- progressively decreased with no overt source of hemorrhage. going prolonged caval occlusion with complete recovery (3–5). On day 5 following surgery, the dog became lethargic and blood Liver lobectomy in dogs is a relatively straightforward proce- gas analysis showed a drop in PCV to 17% (Table 1). A pRBC dure as the liver has a consistent vascular and biliary anatomy

848 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY

(6). Right liver lobectomies have been associated with a higher nated intravascular coagulation, thromboembolic disease, and morbidity and mortality, due to their close proximity to the potentially death (11). The only documented side-effect in this CVC (1). In our patient, the mass was very large, hilar, and patient was the development of pelvic limb edema after surgery. adherent to the surrounding structures, including the diaphragm The development of edema in this patient may have been for a and vena cava. In addition, our patient was very deep chested, number of reasons including the presence of a small thrombus

resulting in limited cranial visualization. We suspect all of these in an iliac vein or vascular stasis from prolonged recumbency. REPORT CASE factors contributed to the iatrogenic transection. To avoid this No specific treatment was required for resolution of the edema, complication in the future, the authors recommend being aside from application of warm packs and massage to encourage cautious when attempting to exteriorize such a large mass, to lymphatic flow, and no additional swelling or thrombotic events avoid flattening the large vessels, in addition to visualizing the were noted. Thromboelastography could have been helpful, in path of the vena cava prior to transection. In this patient, the order to detect an early hypercoagulable state (12). diaphragm was released to allow caudal retraction of the mass Venous stasis and thrombus formation due to acute occlusion but it may have been more appropriate to perform a caudal and endothelial injury were potential consequences of occlusion sternotomy in order to improve visualization. Due to the size of and anastomosis of the CVC (13). Due to the potential com- the mass and proximity to the diaphragm, stapling was the only plications associated with systemic anticoagulants, challenges feasible method for ligation without a sternotomy, but improved with dosing and monitoring effects in veterinary patients, and visualization may have allowed for more careful dissection and concerns for potential continued hemorrhage from the CVC alternative ligation methods. anastomosis site, we did not elect postoperative anticoagulants Experimental studies have shown that dogs are able to achieve in this patient. A plan was in place to initiate this treatment complete hemodynamic recovery within 5 min, following acute if clinical evidence of a significant thrombus developed. Two complete caval occlusion for 8 min (7). The intraoperative ultrasound examinations were performed following the surgery hemodynamic effects of complete occlusion in our patient to monitor for signs of venous turbulence or appearance of were similar to those reported by Hunt et al (7) and included a thrombosis. On the first ultrasound examination, evaluation moderate drop in arterial blood pressure with a compensatory of the site was limited due to the presence of a pneumoperito- increase in heart rate, which improved following anastomosis neum but a thrombus was not suspected at that time, nor was and re-establishment of blood flow. In our case the hemody- one present on ultrasound 2 wk after surgery. Clinically, the namic effects were confounded by blood loss, which may have patient did not demonstrate signs of caval hypertension or any prolonged the hypotension, but ultimately there were no sig- evidence of major thrombotic disease. Despite lack of evidence nificant postoperative cardiovascular effects noted in our dog. of a thrombus and presumed patency of the vena cava at the The presence of collateral circulation is one possible reason anastomosis site, the patient went on the develop collateral for the lack of significant long-term effects of prolonged occlu- circulation 9 mo after surgery which could have been an indica- sion in our patient. Previously, complete occlusion has been tion of partial or complete occlusion, either due to thrombosis shown to result in the development of collateral circulation in or eventual stricture. the dog. A 1961 experimental study by Horvath et al (4) cre- The patient’s PCV declined following surgery and had ated permanent complete acute occlusion of the caudal vena decreased from 23% after surgery to 17% on day 5 despite the cava to quantify the development of collateral circulation. In absence of hemoabdomen or clinical hemorrhage (Table 1). the report, the authors hypothesized that collateral circulation The reason for this progressive decline in PCV is unclear, but developed quickly and this was the reason for the lack of signifi- likely multifactorial. We suspect that this decrease could have cant physiologic effects after observing minimal change in blood been due to hemolysis secondary to a transfusion reaction, volume measured before and during acute occlusion. Chronic especially given the development of pigmenturia around the progressive CVC occlusion has also been documented to result same time. Furthermore, hemodilution due to the high rate of in the development of collateral circulation. In one experimental crystalloid administration, as well as redistribution and splenic study, gradual occlusion over a 2-week period, with complete sequestration could have participated in the drop in PCV. Other occlusion at week 2, resulted in the formation and development hypotheses include endothelial injury causing red blood cell of collateral vessels on venograms performed 3 wk after surgery damage or a consumptive hemolytic anemia due to an inflamma- (8). While unusual, the absence of visible collateral circulation tory process (14). Given the progressive anemia and consistent in our case did not preclude its presence. In fact, 9 mo after clinical signs, a second pRBC transfusion was administered at surgery, CT scan images identified an extensive venous collateral 5 d post-surgery and the PCV remained stable until discharge. circulation and caval narrowing. This finding may have been a At 6 and 9 mo follow-up there was no evidence of progressive new development, or could have been present but progressive or recurrent anemia. with the decreased vena cava diameter secondary to the repair. This clinical case confirms the findings of previously pub- In addition to the hemodynamic effects of acute CVC lished experimental studies, reporting the ability of dogs to occlusion during surgery, possible postoperative consequences survive prolonged acute vena cava occlusion. It also demon- anticipated in this patient included pelvic limb edema, post- strates that a good outcome and long-term survival are possible hepatic portal hypertension, reduced cardiac output leading to following accidental transection and re-anastomosis of the CVC. myocardial ischemia, protein-rich abdominal effusion (Budd- Based on our experience, acute transection and prolonged occlu- Chiari like syndrome), renal or hepatic failure (9,10), dissemi- sion of the hepatic CVC can result in minimal p ostoperative

CVJ / VOL 58 / AUGUST 2017 849 FOR PERSONAL USE ONLY

complications in a dog undergoing resection of HCC and 6. Covey JL, Degner DA, Jackson AH, Hofeling AD, Walshaw R. Hilar surgical repair should therefore be considered in similar clinical liver resection in dogs. Vet Surg 2009;38:104–111. 7. Hunt GB, Malik R, Bellenger CR, Pearson MR. A new technique for situations where inadvertent CVC transection occurs, if primary surgery of the caudal vena cava in dogs using partial venous inflow repair is possible. occlusion. Res Vet Sci 1992;52:378–381. 8. Peacock JT, Fossum TW, Bahr AM, Miller MW, Edwards JF. Evaluation Acknowledgment of gradual occlusion of the caudal vena cava in clinically normal dogs. Am J Vet Res 2003;64:1347–1353. The authors acknowledge Dr. Cyrielle Fink for her assistance 9. Rosa C, Schoeman JP, Dvir E. Budd-chiari-like syndrome associated with a pheochromocytoma invading the right atrium in a dog. Isr J Vet with image collection and labelling. CVJ Med 2012;67:180–185. 10. Buob S, Johnston AN, Webster CRL. Portal hypertension: Pathophysiol References ogy, diagnosis and treatment. J Vet Intern Med 2011;25:169–186. 1. Liptak JM, Dernell WS, Monnet E, et al. Massive hepatocellular 11. Raju S, Hollis K, Neglen P. Obstructive lesions of the inferior vena

RAPPORTCAS DE carcinoma in dogs: 48 cases (1992–2002). J Am Vet Med Assoc 2004; cava: Clinical features and endovenous treatment. J Vasc Surg 2006;44: 225:1225–1230. 820–827. 2. Patnaik AK, Hurvitz AI, Lieberman PH, Johnson GF. Canine hepatocel- 12. Donahue SM, Otto CM. Thromboelastography: A tool for measuring lular carcinoma. Vet Pathol 1981;18:427–438. hypercoagulability, hypocoagulability, and fibrinolysis. J Vet Emerg Crit 3. Cohen M, Lillehei CW. Quantitative study of “Azygos Factor” during Care 2005;15:9–16. vena cava occlusion in the dog. Surg Gynec Obstet 1954;98:225–232. 13. Andrews JC. Vascular complications following liver transplantation. 4. Horvath SM, Bender AD. Complete occlusion of the abdominal vena Semin Intervent Radiol 2004;21:221–233. cava in the dog. Studies of the splanchnic, hemodynamic, and metabolic 14. Roy CN. Anemia of inflammation. Hematology Am Soc Hematol Educ responses to vena caval occlusion. Arch Surg 1961;82:668–673. Program 2010;2010:276–280. 5. Guillaumot PJ, Heripret D, Bouvy BM, et al. 49-month survival following caval venectomy without nephrectomy in a dog with a pheochromocytoma. J Am Anim Hosp Assoc 2012;48:352–358.

850 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY Case Report Rapport de cas

Intranasal mast cell tumor in the dog: A case series

Alison Khoo, Amy Lane, Ken Wyatt

Abstract — The medical records of 4 dogs with histologically confirmed intranasal mast cell tumors (MCTs) were retrospectively evaluated to determine their biological behavior. Information on signalment, presenting clinical signs, tumor grade, treatment administered, and survival times was obtained from the medical record. All 4 patients had high grade tumors and received chemotherapy. Survival times ranged from 27 to 134 days. All 4 dogs showed signs of local or distant disease progression, suggestive of an aggressive behavior of intranasal MCTs.

Résumé — Tumeur mastocytaire intranasale chez le chien : une série de cas. Les dossiers médicaux de quatre chiens qui avaient eu des tumeurs mastocytaires intranasales confirmées par histologie ont été rétrospectivement évalués afin de déterminer leur comportement biologique. Des renseignements sur le signalement, les signes cliniques de présentation, le grade de la tumeur, le traitement administré et les temps de survie ont été obtenus dans le dossier médical. Les quatre patients avaient des tumeurs de grade élevé et ont reçu de la chimiothérapie. Les temps de survie ont varié de 27 à 134 jours. Les quatre chiens ont manifesté des signes de progression locale ou distante de la maladie, suggérant un comportement agressif des tumeurs mastocytaires intranasales. (Traduit par Isabelle Vallières) Can Vet J 2017;58:851–854

ast cell tumors are a commonly diagnosed cutaneous behavior and prognosis of dogs with intranasal MCTs. The M tumor, accounting for 7% to 21% of all canine skin clinical, diagnostic, and histologic findings associated with a tumors (1,2). These tumors have a range of clinical presenta- series of 4 dogs diagnosed with intranasal MCTs are described. tion, varying from benign to malignant behavior. The extent of ancillary diagnostic workup and treatment is predicated on Case descriptions the presence or absence of negative prognostic factors such as Case 1 histological grade, clinical stage, growth rate, cell proliferation A 14-year-old neutered male crossbreed dog (Table 1) was pre- rate, recurrent disease, and the presence of systemic signs (3,4). sented to the referring veterinarian for vomiting of unknown In some studies, anatomic location has been used as a predic- cause. Three days prior to presentation the dog was anorexic, tor of the biologic behavior of MCTs in dogs, with tumors in polydipsic, and lethargic. Previous clinical signs included noisy the preputial, scrotal, subungual region, oral cavity, and other inspiratory stertor with nasal discharge. mucous membrane sites associated with a higher grade tumor Physical examination by the referring veterinarian revealed and poorer prognosis (3,4). Visceral MCTs are rare but are abdominal discomfort and enlarged mandibular and pres- associated with systemic signs and carry a guarded prognosis capular lymph nodes. Cytology of a fine-needle aspirate (FNA) (5,6). There have been few reports discussing mucosal or muco- from the lymph nodes showed an eosinophilic lymphadenitis. cutaneous MCTs, with most reports focusing on oral, perineal, Thoracic and abdominal radiographs showed no significant preputial, and subungual sites. One study investigating MCTs abnormalities. Blood tests showed a mild decrease in potassium located on the canine muzzle showed a regional metastatic [3.6 mmol/L; reference range (RR): 3.9 to 5.1 mmol/L] and rate of 58% (7). To our knowledge, there have been no reports chloride (96 mEq/L; RR: 110 to 124 mEq/L) levels; signs of describing the behavior of intranasal MCTs. The purpose of the mild dehydration; and a mature neutrophilia and monocytosis. study reported here was to retrospectively analyze the biologic The patient was treated conservatively with an oral electrolyte solution, dietary modification, and metoclopramide (Metomide; Delvet Pty, Asquith, NSW, Australia), 0.2 mg/kg body weight Western College of Veterinary Medicine — Internal Medicine, (BW), IV, q12h, with no improvement, and was subsequently 106–102 Kingsmere Place, Saskatoon, Saskatchewan S7J 2K3. referred to an internal medicine specialist. Address all correspondence to Dr. Alison Khoo; e-mail: Physical examination at the referral hospital revealed persis- [email protected] tently enlarged left mandibular lymph nodes. All other findings Use of this article is limited to a single copy for personal study. were unremarkable. An abdominal ultrasound examination Anyone interested in obtaining reprints should contact the revealed no abnormalities. The patient was again managed con- CVMA office ([email protected]) for additional servatively for 2 wk using dietary modification and anti-emetics, copies or permission to use this material elsewhere. but there was no clinical improvement.

CVJ / VOL 58 / AUGUST 2017 851 FOR PERSONAL USE ONLY

Table 1. Case summaries Overall survival Case Presenting Histological times Concurrent number Signalment clinical signs Stage Substage grade (days) illnesses

1 14-year-old MN Vomiting and T1 N1 M0 b Grade 3 65 Nil crossbreed dog inspiratory stertor

2 15-year-old MN Sneezing T1 N0 M0 a Undifferentiated 40 Nil Maltese cross round cell tumor

3 12-year-old Stertorous T1 N1 M0 a High grade 27 Grade 3/6 mitral FS Kelpie cross breathing well-differentiated valve murmur RAPPORTCAS DE 4 13-year-old FS Sneezing, reverse T1 N0 M0 b Grade 3 134 Nil Shetland sheepdog sneezing, open mouth breathing

5 5-year-old ME Depigmentation T1 N1 M0 a Grade 3 661 Nil Kerry blue terrier of left nares

MN — male neutered; FS — female spayed.

Upper gastrointestinal endoscopy revealed fresh ulceration North Ryde, NSW, Australia), 0.6 mg/kg BW, PO, q24h, were of the mucosa of the esophagus, pyloric antrum, and duode- also prescribed. After the first cycle of the chemotherapeutic num. The mucosa of the duodenum also had a cobblestone protocol, the patient was switched to single agent lomustine appearance and certain sections appeared to be edematous. (Bristol-Myers Squibb) for the remaining 3 treatments due to a The patient was examined for possible causes of gastric ulcer- better initial clinical response to this drug. During this time the ation. A subcutaneous mass on the neck was aspirated and patient showed variable responses to treatment with intermit- confirmed to be a lipoma. The mandibular lymph nodes were tent nasal discharge and dyspnea, a decrease in overall swelling aspirated again and showed large numbers of eosinophils. of the mandibular area, and occasional vomiting. Worsening The patient’s owner confirmed that the dog had not received clinical signs were seen when attempts were made to reduce the any ulcerogenic drugs or seen to consume any erosive sub- dose of prednisolone. The patient developed neurological signs stances. Histopathology results from the stomach and duodenal including head pressing, pacing, and ataxia, suggestive of brain biopsies showed a mild gastritis and enteritis with no sign of involvement, and was euthanized 4 mo after diagnosis. neoplasia. A few days after the endoscopy, the patient developed epi- Case 2 staxis from the left nostril and soft tissue swelling around the A 15-year-old neutered male Maltese cross dog (Table 1) was left eye and lower conjunctiva. Pain was noted on opening the presented to the referring veterinarian for sneezing and gag- mouth. ging and was treated with doxycycline (Doxycycline; Apex Magnetic resonance imaging (MRI) of the nose showed a Laboratories) and chlorpheniramine (Iramine; Mavlab Pty, mass effect with surrounding inflammation occupying a sig- Slacks Creek, QSLD, Australia) with no clinical improvement. nificant portion of the left nasal passage. Repeat aspirates of the Skull radiographs showed a soft tissue opacity in the caudal left mandibular lymph nodes were suggestive, but not definitive, of nasal cavity. A nasal flush was conducted and 50% of the cells a metastatic MCT with necrosis. Nasal biopsies demonstrated were mast cells. Bacterial and fungal culture was negative. The a granulomatous reaction with an eosinophilic component but patient was subsequently referred to an oncologist for further no convincing evidence of neoplasia. The dog was treated for investigation. eosinophilic rhinitis using prednisolone (Prednisone; Apex Rhinoscopic examination showed increased mucus in the left Laboratories, Somersby NSW, Australia), 0.6 mg/kg BW, PO, nasal cavity and a normal right nasal cavity. In-house impres- q24h, and gastroprotectants. sion smears from the left cavity mucosa showed an almost pure Two weeks later the patient developed recurrent swelling of population of mast cells. While awaiting histopathology results the neck and jaw. The left mandibular lymph node was still from nasal biopsies, the patient was treated with a single dose enlarged and the patient had developed mild dyspnea. of dexamethasone (Dexafort; Intervet/Schering-Plough Animal Repeat nasal biopsies and wedge biopsies of the mandibular Health, Bendigo East Vic, Australia), 0.1 mg/kg BW, IV, and lymph node confirmed the presence of a high grade MCT in chlorpheniramine (Iramine; Mavlab), 0.5 mg/kg BW, IM. both sites based on Patnaik grading criteria. Treatment was The histopathologic diagnosis was an undifferentiated round initiated following a vinblastine (DBL Vinblastine; Aspen cell tumor, most likely a MCT. The patient commenced a vin- Australia, St Leonards NSW, Australia), lomustine (Ceenu; blastine, lomustine, and prednisolone chemotherapy protocol Bristol-Myers Squibb, Noble Park, North Vic, Australia), and (8). Half way through the second cycle, the patient developed prednisolone (Apex Laboratories) chemotherapy protocol (8). multiple masses in the liver, ascites, and a neck mass which Famotidine (Pfizer, Belmont WA, Australia), 0.6 mg/kg BW, was aspirated and showed poorly differentiated mast cells. The PO, q24h, and omeprazole (Gastroshield; Merial Australia Pty, patient was subsequently euthanized 40 d after diagnosis.

852 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY

Case 3 None of the breeds in this study are reported to be predisposed A 12-year-old neutered female Kelpie cross dog (Table 1) was to developing cutaneous MCTs (15). presented to the referring veterinarian with a history of progres- Clinical signs in our patients overlapped with those seen sive stertorous breathing and snoring while asleep. The dog was in other intranasal diseases. These included intermittent and treated with cephalexin (Cephalexin; Apex Laboratories) and progressive unilateral epistaxis, mucopurulent nasal discharge, antihistamines and showed slight improvement, but clinical sneezing, difficulty breathing, and ocular discharge (9,11,16). REPORT CASE signs recurred when the medication was discontinued. A com- One patient in our series also presented for vomiting, which puted tomography (CT) scan of the head revealed a nasopharyn- was subsequently diagnosed as secondary to gastric ulceration. geal mass extending into the nasal cavity and markedly enlarged, This was suspected to be a paraneoplastic syndrome secondary contrast-enhancing retropharyngeal lymph nodes. The dog was to the MCT, due to increased circulating histamine levels and subsequently referred to an oncologist. Physical examination at stimulation of the gastric H2 receptors. the referral hospital revealed enlarged left mandibular and left Mast cell tumors involving mucocutaneous areas have been prescapular lymph nodes. Fine-needle aspirate cytology of the described as having a grave prognosis (3,7,17). Results of the mass revealed a round cell population with large numbers of present study suggest that dogs with intranasal MCTs frequently cytoplasmic granules. The histopathologic diagnosis from nasal have aggressive disease with 3 of the 4 cases diagnosed on histo- tissue biopsies was a high grade MCT. The patient was treated pathology with a high grade MCT and the remaining case being with imatinib (Glivec; Novartis Australia, North Ryde, NSW, described as anaplastic with a high mitotic index. Despite the Australia) for a month before being euthanized due to local variation and lack of consensus among pathologists regarding progression of the disease. MCT grading criteria, the present study demonstrates that 3 of 4 affected dogs were diagnosed with a high grade MCT, with Case 4 short overall survival times ranging from 27 to 134 d. A previ- A 13-year-old neutered female Shetland sheepdog (Table 1) was ous study of grade 3 mucocutaneous MCTs showed a relatively presented to the referring veterinarian with a history of increased short median survival time (MST) of 8 mo (17). In contrast, sneezing, reverse sneezing, throat clearing, and open-mouthed another study showed that patients with oral MCTs had a much breathing. Rhinoscopic examination revealed a hemorrhagic longer MST of 52 mo (3). The decreased survival time seen with mass in the right nasal cavity and histopathologic examination intranasal MCTs compared with other mucocutaneous MCTs of nasal tissue biopsies resulted in a diagnosis of a high grade could be associated with complicating factors such as brain or MCT. The patient was prescribed doxycycline and prednisolone optic involvement, advanced stage of disease at presentation due and was subsequently referred to an oncologist for chemother- to late onset of clinical signs, and complex regional anatomy apy. The patient commenced a prednisolone, vinblastine, and preventing surgical treatment. Although the grading system for lomustine chemotherapy protocol (8). Clinical examination at MCTs applies only to cutaneous masses, the use of these criteria the final treatment reported minimal airflow through the right may be clinically relevant for patients with nasal MCTs. nostril with dried blood visible at the right nares, suggestive A limitation of the present study was the lack of CD117 of tumor recurrence. Four days later the patient developed immunohistochemical analysis of the biopsy samples. CD117 seizures which were suspected to be secondary to tumor involve- is a receptor tyrosine kinase protein involved in mast cell growth ment of the brain. The patient was euthanized 134 d after and differentiation. A C-kit staining pattern has been used for diagnosis. its predictive role of histological grade, tumor necrosis, and the biologic behavior in MCTs (18,19). Further studies on CD117 Discussion immunohistochemical analysis are needed to evaluate its prog- Primary tumors of the sinonasal cavity account for 1% to 2% of nostic value in predicting the biological behavior of mucocu- all neoplasms in dogs (9). Of these neoplasms, about 80% have taneous MCTs. AgNOR and Ki67 count as well as polymerase histologic characteristics of malignancy with adenocarcinomas chain reaction (PCR) for C-kit mutation may also be beneficial. being the most common, followed by squamous cell carcinomas, Regional lymph node involvement was detected in 2 of 4 dogs chondrosarcomas, and undifferentiated (anaplastic) carcinomas in our series. In the remaining 2 patients, despite palpably nor- (10). Less frequently diagnosed sinonasal malignancies include mal lymph nodes, lymph node involvement cannot be excluded hemangiosarcoma (11), transmissible venereal tumor, mela- due to lack of further lymph node evaluation. Due to the ret- noma, leiomyosarcoma, neuroendocrine carcinomas, and round rospective nature of the study, staging tests were not uniformly cell tumors (9,12). Little information exists on the biological performed. On presentation, none of the patients in this study behavior, prognostic factors, and recommended treatment for showed signs of distant metastasis, which is a consistent feature these less commonly occurring sinonasal neoplasms. of sinonasal neoplasms in general (9,16,20). However, all 4 dogs The average age of dogs diagnosed with sinonasal tumors is in the present study were euthanized due to progression of dis- 10 y with medium to large breed male dogs more commonly ease beyond the nasal cavity suggesting that complete staging affected (9). It is speculated that dolicocephalic breeds may be at presentation, including a computed tomography (CT) scan at a higher risk for developing sinonasal cancer (13,14). This and local lymph node aspiration, is warranted. is not a finding in the present study, with only 1 of 4 patients Treatment received by each patient in this series was largely being dolicocephalic. Two of the 4 patients in this case series dependent on clinician choice, the stage of disease at the time were male and all 4 patients were 12 y or older at presentation. of diagnosis, and the owner’s decisions and financial constraints.

CVJ / VOL 58 / AUGUST 2017 853 FOR PERSONAL USE ONLY

Three of the 4 patients received a similar chemotherapeutic 8. Cooper M, Tsai X, Bennett P. Combination CCNU and vinblastine protocol involving alternating vinblastine and lomustine treat- chemotherapy for canine mast cell tumors: 57 cases. Vet Comp Oncol 2009;7:196–206. ments, with concurrent prednisolone administration. Three of 9. Malinowski C. Canine and feline nasal neoplasia. Clin Tech Small Anim 4 patients included in the present study experienced survival Pract 2006;21:89–94. times of less than 19 wk. This may be due to the selection of 10. Adams WM, Kleiter MM, Thrall DE, et al. Prognostic significance of tumor histology and computed tomographic staging for radiation patients with MCT of cutaneous origin in the previous study treatment responses of canine nasal tumors. Vet Radiol Ultrasound having a less aggressive behavior (15). 2009;50:330–335. Radiation therapy for the treatment of intranasal carcinomas 11. Fujita M, Takaishi Y, Yasuda D, et al. Intranasal haemangiosarcoma in a dog. J Vet Med Sci 2008;70:525–528. and sarcomas has demonstrated efficacy in improving patient 12. Patnaik A, Ludwig L, Erlandson R. Neuroendocrine carcinoma of the survival times (16). One study suggested that survival times nasopharynx in a dog. Vet Pathol 2002;39:496–500. can be further improved if patients were treated surgically after 13. Hayes HM, Wilson GP, Fraumeni HF, Jr. Carcinoma of the nasal cavity

RAPPORTCAS DE and paranasal sinuses in dogs: Descriptive epidemiology. Cornell Vet radiation, although these patients developed delayed complica- 1982;72:168–179. tions including chronic rhinitis, osteomyelitis, and osteonecrosis 14. Reif JS, Bruns C, Lower KS. Cancer of the nasal cavity and paransal (21). To the authors’ knowledge, there have been no studies to sinuses and exposure to the environmental tobacco smoke in pet dogs. Am J Epidemiology 1988;147:488–492. confirm the efficacy of radiation therapy in treating intranasal 15. Welle M, Bley C, Howard J Rufenacht S. Canine mast cell tumors: round cell tumors. Radiation therapy may be useful as adjuvant A review of the pathogenesis, clinical features, pathology and treatment. or definitive therapy for unresectable intranasal MCT disease, Vet Dermatol 2008;19:321–339. 16. Elliot K, Mayer M. Radiation therapy for tumors of the nasal cavity and and the lack of treatment with radiation could account for the paranasal sinuses in dogs. Can Vet J 2009;50:309–312. shorter survival times of dogs in this study (22–28). 17. Hume C, Kiupel M, Rigatti L, Shofer FS, Skorupski KA, Sorenmo KU. Despite the retrospective nature and small sample size of Outcomes of dogs with grade 3 mast cell tumors: 43 cases (1997–2007). J Am Anim Hosp Assoc 2011;47:37–44. the present study, this study was able to better characterize the 18. Costa R, Matos E, Rema A, Lopes C, Pires MA, Gärtner F. CD117 biological behavior of intranasal MCTs and confirm that tumor immunoexpression in canine mast cell tumors: Correlations with patho- location is an important prognostic indicator of canine MCTs. logical variables and proliferation markers. BMC Vet Res 2007;3:19. 19. Preziosi R, Morini M, Sarli G. Expression of the KIT protein (CD117) Based on the results of this report, affected patients experienced in primary cutaneous mast cell tumors of the dog. J Vet Diagn Invest a relatively short survival time with a potential for local disease 2004;16:554–561. progression compared with MCTs at other sites. 20. Elliot M, Mayer M. Radiation therapy for tumors of the nasal cavity and paranasal sinuses in dogs. Can Vet J 2009;50:309–312. 21. Endicott MM, Charney SC, Mcknight JA, Loar AS, Barger AM, Acknowledgments Bergman PJ. Clinicopathological findings and results of bone mar- The authors acknowledge the assistance of Dr. Peter Bennett row aspirations in dogs with cutaneous mast cell tumors: 157 cases (1999–2002). Vet Comp Oncol 2007;5:31–37 and associated veterinary pathologists Dr. Rodney Straw and 22. Adams W, Bjorling D, McAnulty J, Green EM, Forrest LJ, Vail DM. Dr. Jerome Gagnon. CVJ Outcome of accelerated radiotherapy alone or accelerated radiotherapy followed by exenteration of the nasal cavity in dogs with intranasal neo- References plasia: 53 cases (1990–2002). J Am Vet Med Assoc 2005;227:936–941. 23. Cianchetti M, Amichetti M. Sinonasal malignancies and charged parti- 1. Rothwell TLW, Howlett CR, Middleton DJ, Griffiths DA, Duff BC. cle radiation treatment: A systematic literature review. Int J Otolaryngol Skin neoplasms of dogs in Sydney. Aust Vet J 1987;64:161–164. 2012, Article ID: 325891, 15 p. 2. Cohen D, Reif SS, Brodey RS, Keiser H. Epidemiological analysis of 24. Poirier VJ, Adams WM, Forrest LJ, Green EM, Dubielzig RR, Vail DM. the most prevalent sites and types of canine neoplasia observed in a Radiation therapy for incompletely excised grade II canine mast cell veterinary hospital. Cancer Res 1974;34:2580–2868. tumors. J Am Anim Hosp Assoc 2006;42:430–434. 3. Hillman LA, Garrett LD, de Lorimier LP, Charney SC, Borst CB, Fan 25. Hahn KA, King GK, Carreras JK. Efficacy of radiation therapy for TM. Biological behavior of oral and perioral mast cell tumors in dogs: incompletely resected grade 3 mast cell tumors in dogs: 31 cases 44 cases (1996–2006). J Am Vet Med Assoc 2010;237:936–942. (1987–1998). J Am Vet Med Assoc 2004;224:79–82. 4. Thamm DH, Turek MM, Vail DM. Outcome and prognostic factors 26. Chaffin K, Thrall DE. Results of radiation therapy in 19 dogs with following adjuvant prednisolone/vinblastine chemotherapy for high- cutaneous mast cell tumor and regional lymph node metastasis. Vet risk canine mast cell tumor: 61 cases. J Vet Med Sci 2006;68:581–587. Radiol Ultrasound 2002;43:392–395. 5. Jacobs T, Hoppe B, Moore F. Visceral mast cell tumor in a dog with 27. LaDue T, Price GS, Dodge R, Page RL, Thrall DE. Radiation ther- haemabdomen and mastocytaemia. J Small Anim Pract 2007;48:180 apy for incompletely resected canine mast cell tumors. Vet Radiol 6. Quintas-Cardama A, Jain N, Versotovsek S. Advances and controversies Ultrasound 1998;39:57–62. in the diagnosis, pathogenesis and treatment of systemic mastocytosis. 28. Tan-Coleman B, Lyons J, Lewis C, Rosenberg M, Ruiz A. Prospective Cancer 2011;117:5439–5449. evaluation of a 5 3 4 Gy prescription for palliation of canine nasal 7. Gieger TL, Theon AP, Werner JA, McEntee MC, Rassnick KM, tumors. Vet Radiol Ultrasound 2013;54:89–92. DeCock HE. Biologic behaviour and prognostic factors for mast cell tumors of the canine muzzle: 24 cases (1990–2001). J Vet Intern Med 2003;17:687–692.

854 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY Case Report Rapport de cas

Spontaneous resorption of a herniated cervical disc in a dog detected by magnetic resonance imaging

Francesca Raimondi, Beatriz Moreno-Aguado, Phil Witte, Nadia Shihab

Abstract — This report describes, for the first time in small animal literature, the spontaneous resorption of herniated Hansen type I intervertebral disc material in the cervical spine of a chondrodystrophic dog over a 4-month period, documented by magnetic resonance imaging. Clinical signs (cervical hyperpathia) responded to conservative treatment during the same period.

Résumé — Résorption spontanée d’une hernie discale chez un chien détectée par imagerie par résonance magnétique. Cet article décrit, pour la première fois dans la littérature des petits animaux, la résorption spontanée d’une hernie Hansen de type I du matériel du disque intervertébral dans la colonne cervicale d’un chien chondrodystrophique pendant une période de 4 mois et documentée par imagerie par résonance magnétique (IRM). Les signes cliniques (hyperpathie cervicale) ont répondu à un traitement conservateur durant la même période. (Traduit par Isabelle Vallières) Can Vet J 2017;58:855–858

ervical disc herniation is reported in 15% of dogs that report describes the MRI-documented spontaneous disap- C suffer from intervertebral disc (IVD) herniation (1–3). pearance of an acute cervical intervertebral disc herniation A total of 15% to 61% of dogs that suffer from IVD herniation in 1 patient which was treated conservatively. Relevant cases in the cervical spine present with signs of cervical hyperpathia reported in the human literature are reviewed and the biochemi- (3,4), guarding of the neck and muscle fasciculations without cal and biological factors that may be involved in the resorption neurological deficits (1,2). The lower rate of neurological defi- of herniated cervical intervertebral disc material are discussed. cits compared to patients with thoracolumbar IVD herniation is thought to be related to the high vertebral canal/spinal cord Case description ratio of the cervical vertebral column (1–4). A 4-year-old, 14-kg, spayed female, cocker spaniel dog was Treatments for IVD extrusion in dogs include conservative referred to a clinic with a history of cervical hyperpathia and management (strict avoidance of activity and the administra- exercise intolerance of acute onset approximately 4 mo previ- tion of anti-inflammatory and/or other analgesic medications) ously. At first examination the local veterinary surgeon had (1,2,4–6) and surgical decompression (1,2,4,5). The choice recorded a low head carriage, stiffness affecting all 4 limbs, between conservative and surgical management depends on guarding of the neck, and occasional diffuse muscular tremors the severity of neurological dysfunction, the degree of neuronal affecting the neck and both forelimbs. Management had been tissue compression apparent on imaging, and financial consid- conservative, involving cage rest and anti-inflammatory medi- erations (1–7). Most neurologists agree that an initial period of cation [gabapentin (Gabapentin Zentiva; Zentiva, Guildford, conservative management is appropriate for patients that present Surrey, UK)], 10 mg/kg body weight (BW), PO, q12h for the with cervical hyperpathia (1,2,4,6). initial 2 wk. Spontaneous resorption of degenerate nuclear material within According to the dog’s owner, the signs of neck pain had the vertebral canal has not been documented by advanced responded well during this period. However, following discon- diagnostic imaging [Computed Tomography (CT)/Magnetic tinuation of the medication the dog had shown a recurrence Resonance Imaging (MRI)] in previous reports. The current of signs of neck pain, again without any evidence of motor or sensory deficits. Southern Counties Veterinary Specialists (SCVS), Unit 6, Because of difficulties accessing a referral center a second Forest Corner Farm BH24 3JW, Hangersley Hill, Ringwood, opinion was delayed and magnetic resonance imaging (MRI) Hampshire, United Kingdom. was carried out at the local veterinary practice using a mobile Address all correspondence to Dr. Francesca Raimondi; e-mail: 1.5-Tesla MRI scanner (Philips, Guildford, Surrey, UK). The [email protected] study included T2-weighted (T2W) and T1-weighted (T1W) Use of this article is limited to a single copy for personal study. sagittal and transverse sequences. The resulting MRI images Anyone interested in obtaining reprints should contact the showed a moderate quantity of well-defined T2W hypointense, CVMA office ([email protected]) for additional T1W hypointense extradural material, located dorsal to the copies or permission to use this material elsewhere. C3-C4 IVD space that extended cranially and caudally over a

CVJ / VOL 58 / AUGUST 2017 855 FOR PERSONAL USE ONLY

As 4 mo had passed since the first MRI study at the local veterinary practice, a follow-up MRI investigation was recommended. The MRI was carried out using a 1.5 Tesla MRI scanner (Petvet Hallmarq, Surrey, UK). The following sequences were acquired: sagittal T2W Half-Fourier Acquisition Single- Shot Turbo Spin-Echo (HASTE) (TR 9000, TE 192, slice thickness 2.5 mm), T2W images in the sagittal (TR 2500, TE 110, slice thickness 2.5 mm) and transverse (TR 2522, TE 110, slice thickness 3.5 mm) planes and T1W images in the sagittal (TR 300, TE 17, slice thickness 2.5 mm) and transverse (TR 300, TE 17 slice thickness 3.5 mm) planes. The MRI RAPPORTCAS DE images revealed complete resolution of the previously described IVD herniation. The changes described in the C3-C4 IVD and Figure 1. T2-weighted magnetic resonance imaging (MRI). A — Sagittal view. B — Transverse view. Note the this IVD space remained present (Figures 1C, D). T2-weighted hypointense extradural material that is located Given the MRI study findings and the dog’s clinical improve- above the C3-C4 intervertebral disc space and causing mild ment, medical treatment was gradually discontinued over the focal ventral compression of the spinal cord at the level of C3-C4 intervertebral disc space (arrow). Notably, the normal course of 2 wk. At telephone follow-ups 3 mo and 2 y following CSF signal of the subarachnoid space and the normal epidural the second MRI investigation the clients reported no recurrence fat signal in the ventral and dorsal aspect of the spinal cord at of clinical signs of cervical hyperpathia. the compression site have been lost. The C3-C4 intervertebral disc exhibits a marked reduction in T2-weighted signal, indicating degeneration. The narrowing of the C3-C4 intervertebral Discussion disc space is observed. C — Sagittal view. D — Transverse Limited information is available on the clinical success of con- view of the cervical vertebral column of the dog depicted in parts A and B, obtained 4 months after the previous MRI. servative treatment for suspected or confirmed IVD herniation Notably, the intervertebral disc herniation and compression in dogs (1,2,6) with recurrence rates reported at 33% to 36%. characterized by the presence of spinal fluid and an epidural This report provides the first description of spontaneous resorp- fat signal (T2W hyperintense) dorsal and ventral to the spinal cord have resolved (arrow). The changes described earlier in tion of Hansen type I disc extrusion in small animals at the level the C3-C4 intervertebral disc and the intervertebral disc space of the cervical spine that has been documented using MRI. remain present. Only 1 previous veterinary case on small animals reported resolution of a Hansen type I intervertebral disc extrusion at total length of approximately 7.4 mm. This material was located the level of the lumbar spine detected using MRI (8). In con- ventrally and slightly lateral to the right side of the vertebral trast, the human literature has several reports and case series of canal and reduced its cross-sectional diameter by ,25% at the spontaneous regression of herniated lumbar and cervical IVDs level of its greatest severity. There was an associated loss of both (9–19). The difficulty in justifying follow-up advanced imag- the normal spinal fluid signal of the subarachnoid space and the ing in patients which have returned to a healthy clinical status normal epidural fat signal. The C3-C4 IVD exhibited a marked may be a contributing factor to this disparity. The ability to reduction in T2W signal, indicating degeneration. Subjective perform advanced imaging in humans without the associated narrowing of the C3-C4 IVD was observed (Figures 1A, B). risks of anesthesia, makes it feasible to perform safe standard- Hansen type I C3-C4-disc extrusion was diagnosed based on ized follow-up protocols documenting the extent of any disc the imaging and clinical signs. reabsorption, while in dogs the follow-up is often limited to a Conservative treatment consisting of strict cage rest, anti- clinical examination only. inflammatory meloxicam (Metacam; Boehringer Ingelheim, The previous veterinary case documented a 3-year-old French Vetmedica GmbH, Ingelheim/Rhein, Germany), 0.1 mg/kg BW, bulldog that was presented with hyperpathia, neurological PO, q24h and pain relief medication gabapentin (Gabapentin deficits, and spastic paraparesis associated with MRI findings Zentiva; Zentiva), 10 mg/kg BW, PO, q12h was reintroduced. consistent with IVD extrusion at the level of the L3-L4 inter- Four months later the dog was referred to our practice for vertebral disc space (8). According to the report there was a investigation. According to the client, the signs of neck pain dramatic improvement in the clinical signs (mild residual hind were well-controlled with the prescribed treatment, which had limbs ataxia) over approximately 5 wk and a significant reduc- been administered continuously in the interim, and the dog had tion of the extruded intervertebral disc material was documented been more lively and active, particularly during the previous at a recheck MRI study. Similarities were detected with the case month. Anti-inflammatory and pain relief medications had been described in our study: both dogs affected were young adults discontinued for 24 h prior to the consultation. A neurological (3- to 4-years-old) and belonging to a chondrodystrophic type examination was conducted by a board-certified neurologist. breed of dogs. Clinical notes from this examination record that the dog was In the human literature, although the spontaneous regres- bright and alert. The neurological examination revealed no sion of herniated IVD material at the level of the lumbar spine sensory, motor, or proprioceptive deficits. Gait and posture were documented by imaging has been well-established (9–14), this within normal limits. There was no evidence of resentment to outcome has less frequently been reported for herniated discs palpation of the cervical spine. at the level of the cervical spine (15–19).

856 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY

The mechanism by which herniated IVD material under- study; therefore, the information that could have been obtained goes spontaneous regression remains incompletely understood, using this medium is missing. although multiple factors related to the resorption process have This report demonstrates the spontaneous regression of herni- been identified and described in humans (9–24) and small ani- ated cervical disc material in a chondrodystrophic dog and the mals (5,25). The first (inflammatory) phase is triggered by the associated resolution of clinical signs of cervical hyperpathia. traumatic rupture of the dorsal annulus fibrosus causing contu- REPORT CASE sion and compression of the spinal cord, local vasoconstriction Acknowledgment followed by vasodilation and inflammation. A second phase is The authors thank the team at New Era Veterinary Hospital characterized by new blood vessel formation extending into the (Jersey) for their collaboration in the management of the cellular matrix of the herniated intervertebral disc material; and reported case and for providing consent for our use of the initial by development of a strong inflammatory process, including MRI images obtained at their practice. CVJ invasion neutrophils followed by macrophages. These phagocytic cells are considered essential for removal of cellular debris and References extruded IVD material (17–21). 1. Brisson BA. Intervertebral disc disease in dogs. Vet Clin North Am In humans the type of disc herniation can also affect the Small Anim Pract 2010;40:829–858. resorption process, with spontaneous regression observed more 2. Lorenz MD, Coates JR, Kent R. Handbook of Veterinary Neurology. 5th ed. St. Louis, Missouri: Saunders, 2011:164–188. frequently for extruded discs (Hansen type I) than for protruded 3. Cherrone KL, Dewey CW, Coates JR, Bergman RL. A retrospective discs (Hansen type II) (14–17,19). It has been suggested that comparison of cervical intervertebral disk disease in nonchondrodys- this may relate to the vascularity of the tissues involved. Only trophic large dogs versus small dogs. J Am Anim Hosp Assoc 2004; 40:316–320. the outer layer of the annulus fibrosus and the dorsal longitu- 4. Sharp NJH, Wheeler SJ. Thoracolumbar disc disease. In: Small dinal ligament are believed to be directly supplied by blood Animal Spinal Disorders: Diagnosis and Surgery. 2nd ed. Philadelphia, vessels, whereas the nucleus pulposus and most of the annulus Pennsylvania: Mosby, 2005;125. 5. Jeffery ND, Levine JM, Olby NJ, Stein VM. Intervertebral disk fibrosus receive nutrition by diffusion from the cartilaginous end degeneration in dogs: Consequences, diagnosis, treatment, and future plates (1,5,26). Extruded disk material that extends through the directions. J Vet Intern Med 2013;27:1318–1333. ruptured dorsal longitudinal ligament is therefore resorbed more 6. Levine JM, Levine GJ, Johnson SI, Kerwin SC, Hettlich BF, Fosgate GT. Evaluation of success of medical management for presumptive cervical effectively than protruded disc material that is confined between intervertebral disk herniation in dogs. Vet Surg 2007;36:492–499. the layers of the annulus fibrosus, where there is a profound lack 7. Olby N, Harris T, Burr J, Munana K, Sharp N, Keene B. Recovery of of vascularization. pelvic limb function in dogs following acute intervertebral disc herniations. J Neurotrauma 2004;21:49–59. These findings are consistent with reports in the small animal 8. Steffen F, Kircher PR, Dennler M. Spontaneous regression of lumbar literature that have described repeated MRI examinations fol- Hansen type 1 disc extrusion detected with magnetic resonance imaging lowing the conservative treatment of dogs with Hansen type II in a dog. J Am Vet Med Assoc 2014;244:715–718. 9. Maigne JY, Deligne I. Computed tomographic follow-up study of IVD — associated cervical spondylomyelopathy that indicated 48 cases of nonoperatively treated lumbar intervertebral disc herniation. that the protruding disc material does not decrease in size Spine 1992;17:1071–1074. (27–28). In contrast, the Hansen type I disc extrusion previously 10. Saal JA, Saal JS, Herzog RJ. The natural history of lumbar intervertebral disc extrusions treated nonoperatively. Spine 1990;15:683–686. reported in the lumbar region (8) and the one detailed in this 11. Benson RT, Tavares SP, Robertson SC, Sharp R, Marshall RW. case report spontaneously resorbed. Conservatively treated massive prolapsed discs: A 7-year-follow-up. Studies in humans have suggested a correlation between the Ann Royal Coll Surg Engl 2010;92:147–153. 12. Bozzao A, Gallucci M, Masciocchi C, Aprile I, Barile A, Passariello R. size of a cervical disc herniation and the likelihood of spon- Lumbar disk herniation: MR imaging assessment of natural history in taneous resorption, with larger volume herniated discs being patients treated without surgery. Radiology 1992;185:135–141. observed to regress more rapidly than smaller ones. This find- 13. Henmi T, Sairyo K, Nakano S, et al. Natural history of extruded lumbar intervertebral disc herniation. J Med Invest 2002;49:40–43. ing has been consistently reported by various authors and the 14. Kim ES, Oladunjoye AO, Li JA, Kim KD. Spontaneous regression of common conclusion was that larger volumes of extruded disc herniated lumbar discs. J Clin Neurosci 2014;21:909–913. material and sequestrated-type disc herniations were more likely 15. Maigne JY, Deligne L. Computed tomographic follow-up study of 21 cases of nonoperatively treated cervical intervertebral soft disc her- to regress. This was postulated to be associated with the severity niation. Spine 1994;19:189–191. of the inflammatory reactions, and, as such, the strength of the 16. Vinas FC, Wilner H, Rengachary S. The spontaneous resorption of neovascularization and phagocytic response induced at the level herniated cervical discs. J Clin Neurosci 200;8:542–546. 17. Han SR, Choi CY. Spontaneous regression of cervical disc herniation: of the epidural space (9–15,17–21). A case report. Korean J Spine 2014;11:235–237. In evaluations of neovascularization, enhancement with the 18. Gurkanlar D, Yucel E, Er U, Keskil S. Sponateous regression of cervical MRI contrast agent gadolinium-diethylenetriamine penta- disc herniations. Minim Invasive Neurosurg 2006;49:179–183. 19. Kobayashi N, Asamoto S, Doi H, Ikeda Y, Matusmoto K. Spontaneous acetic acid (Gd-DTPA) (Magnevist; Bayer Schering Pharma, regression of herniated cervical disc. Spine J 2003;3:171–173. Leverkusen, Germany) has been reported to be a good indi- 20. Autio RA, Karppinen J, Niinima J, et al. Determinants of spontaneous cator for predicting the probability that a herniated disc will resorption of intervertebral disc herniations. Spine 2006;31:1247–1252. 21. Orief T, Orz Y, Attia W. Almusrea: Spontaneous resorption of spontaneously regress. The extension and thickness of rim sequestrated intervertebral disc herniation. World Neurosurg 2012; enhancement in MRI is reported to be greater in extruded and 77:146–152. sequestrated discs that are spontaneously resorbed over time 22. Minamide A, Hashizume H, Yoshida M, Kawakami M, Hayashi N, Tamaki T. Effects of basic fibroblast growth factor on spontaneous (20). Unfortunately, in the present report the contrast medium resorption of herniated intervertebral discs. An experimental study in was not administered to the patient during the initial MRI the rabbit. Spine 1999;24:940 –945.

CVJ / VOL 58 / AUGUST 2017 857 FOR PERSONAL USE ONLY

23. Kato T, Haro H, Komori H, Shinomiya K. Sequential dynamics vertebral disc and characteristics of intervertebral disc degeneration. of inflammatory cytokine, angiogenesis inducing factor and matrix Vet J 2013;195:282–291. degrading enzymes during spontaneous resorption of the herniated disc. 27. Da Costa RC, Parent JM. One-year clinical and magnetic resonance J Orthop Res 2004;22:895–900. imaging follow-up of Doberman Pinschers with cervical spondy- 24. Haro H, Kato T, Komori H, Osada M, Shinomiya K. Vascular endo- lomyelopathy treated medically or surgically. J Am Vet Med Assoc thelial growth factor (VEGF)-induced angiogenesis in herniated disc 2007;231:243–250. resorption. J Orthop Res 2002;20:409–415. 28. De Decker S, Gielen IMVL, Duchateau L, et al. Evolution of clinical 25. Olby NJ. Current concepts in the management of acute spinal cord signs and predictors of outcome after conservative medical treatment injury. J Vet Intern Med 1999;13:399–407. for disk-associated cervical spondylomyelopathy in dogs. J Am Vet Med 26. Bergknut N, Smolders LA, Grinwis GC, et al. Intervertebral disc Assoc 2012;240:848–857. degeneration in the dog. Part 1: Anatomy and physiology of the inter- RAPPORTCAS DE

Book Review Compte rendu de livre

Canine & Feline Endocrinology, 4th edition Available treatment options for the veterinary patient along with prognosis and success rates for each condition are similarly Feldman EC, Nelson RW, Reusch CE, Scott-Moncrieff JCR, contained within each section. A strength of this book is how it Behrend EN. Elsevier Saunders, St. Louis, Missouri, USA. 2015. enables the reader to readily access species-specific information 696 pp. ISBN: 9781-4557-4456-5. without having to sift through extraneous details that may not be immediately applicable or of interest. It is important to note his book presents information pertaining to the endocrine that anyone interested in details surrounding the topic of repro- T pancreas, pituitary, thyroid, adrenal, and parathyroid ductive endocrinology will have to seek an alternate reference. glands together with their respective disorders for both canine This text would be of significant value to veterinary students and feline subjects. The material is packaged in a logical and as it successfully consolidates the anatomy, physiology, and predictable format with each chapter beginning with a detailed clinical aspects of canine and feline endocrinology. For practic- anatomical and physiological review of each endocrine system. ing veterinarians, the volume provides a thorough summary of The material then advances into the etiological and clinical pre- clinicopathological findings of endocrine conditions together sentation of endocrine derangements in the veterinary patient. with valuable information regarding diagnostic testing proce- One of the most valuable elements of each chapter is the detail dures and management options for their patients. It would be regarding the selection, performance, and interpretation of advised that anyone adding this text to their professional library diagnostic testing for species-specific conditions. The reader is take the time to familiarize themselves with the layout of the not only provided with a comprehensive outline of the clini- chapters in order to maximize their value. Ultimately this book cal presentation of illness but is guided on how to practically would serve an individual well as an essential clinical reference apply this information for the benefit of their patients. The or as a source for more in-depth study of the endocrine system. authors’ use of concise summary tables, flowcharts, and clinical imagery are invaluable in preventing the reader from becoming Reviewed by Greg Parks, DVM, MPH, Currents Veterinary overwhelmed while consulting the text in a clinical setting. Centre, Edmonton, Alberta.

858 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY Veterinary History Histoire vétérinaire

The eradication of bovine tuberculosis in Canada

Hugh G. Whitney

n an unmarked grave, in a forgotten corner of St. Mary’s I Anglican Cemetery in Portage la Prairie, Manitoba, lie the mortal remains of 6-month-old Geoffrey Gunion Rutherford; “laid to rest under the cool sod of the prairie” (1). Geoffrey, born in early 1888, was fed milk from the family’s Jersey cow, once weaned from his mother’s milk at 3 wk of age. A short time later, a “peculiar, obstinate and intractable diarrhoea set up in the body of the child” (1) and he died on October 13, 1888 (2). Tuberculosis was a common cause of infant death at the time but was thought to be an inherited condition. Geoffrey’s family excluded this possibility as “his ancestors, male and female, had all been people of robust and vigorous constitutions” (1). The German microbiologist, Robert Koch, had isolated the cause of human tuberculosis and published his findings in 1882; however, as late as 1901 he publicly stated that only rarely was bovine tuberculosis the cause of the human disease (3). Geoffrey’s father, veterinarian John Gunion Rutherford, dis- agreed with Koch. Dr. Rutherford graduated from the Ontario

Veterinary College in 1879 and was practicing in Portage la 3237077). Mikan Canada, Library (Photocredit: Archives and Prairie at the time. In 1887 he married Edith Boultbee with Dr. John Gunion Rutherford (1857–1923). whom he had 4 children, Geoffrey being their firstborn and only son. Suspicion fell on the family cow, which was slaughtered and its udder described as a “mass of tuberculous disease” (1). Eventually, control was required in 3 fields: within the Dr. Rutherford was active in many aspects of the agricultural cattle population, within the milk supply, and within the industry including clinical veterinary practice and animal breed- meat industry. As the first had little technical history to guide ing; however, the growing field of disease control became his it, advances were more rapid in the latter two. In 1905, the passion, with tuberculosis being primary amongst the recog- US novelist Upton Sinclair published The Jungle, a serialized nized infectious diseases of the day. Since cattle provided milk story of immigrant labor in Chicago meat packing plants (4). and meat for human consumption, both products were now Intended to be an exposé on working conditions in this indus- identified threats. As the national and international community try, its unintended result was to reveal the poor hygiene and struggled with the science, economics, and politics of tuberculo- food safety standards such that meat from tuberculous animals sis, Rutherford put himself into this arena, both through federal ended up in the human food system. The reaction in the US politics (MP from 1897 to 1900), administrative leadership was a follow-up investigation of these packing plants and the (Canada’s first Veterinary Director-General, 1904), as well as in eventual establishment of its Meat Inspection Act, Pure Food and the scientific community (President of the American Veterinary Drug Act of 1906 and its Food and Drug Administration (FDA). Medical Association from 1908 to 1909). Similarly, in Canada, the book’s publication resulted in a review of the meat packing industry (a follow-up to one commissioned by Rutherford in 1904) and though the conditions weren’t as St. John’s, Newfoundland. bad as those revealed in the US, they did help the passage of a Address all correspondence to Dr. Hugh Whitney; e-mail: federal Meat and Canned Food Act in 1907, requiring ante- and [email protected] post-mortem inspection. Pasteurization of milk was commonly Dr. Whitney is a writer and former Chief Veterinary Officer of regulated at the municipal level, though later supported by the Newfoundland and Labrador. federal government, so was not within the purview of federal Use of this article is limited to a single copy for personal study. regulation. However, in 1910 Rutherford bluntly stated that Anyone interested in obtaining reprints should contact the “any community that permits the sale of such milk is an acces- CVMA office ([email protected]) for additional sory to the crime” (3). In 1911, Rutherford, in his capacity as copies or permission to use this material elsewhere. Chairman of the International Commission on the Control

CVJ / VOL 58 / AUGUST 2017 859 FOR PERSONAL USE ONLY

of Bovine Tuberculosis, stated that “Milk is the staple food of of Parliament (1897 to 1900), President of the American infants and young children and is usually taken in the raw state. Veterinary Medical Association (1908 to 1909), Veterinary If this milk is from a tuberculous cow, it may contain millions Director of Canada (1904 to 1912), Livestock Commissioner of living tubercle germs. Young children fed on such milk often of Canada (1906 to 1912), and Companion of the Order of St. contract the disease, and it is a frequent cause of death among Michael and St. George (1910). Surely he is someone worthy them” (5). of a complete biographical effort. At that moment, and from that lofty position, was Dr. Rutherford, politician and scientist, thinking about the growth References in scientific evidence, the economic and trade impacts on the 1. Library and Archives Canada. Letter to R.S. Weir from Dr. Wm Moore, dated 21 November 1904, MG28-175 Accession 1981/0053, Box 5, cattle industry, the need for greater public health intervention; barcode 1000083917, Ottawa, Ontario. or was he simply reflecting that, as a father, 23 years earlier, in 2. Manitoba Vital Statistics, Available from: www.vitalstats.gov.mb.ca Last an unmarked grave, in a forgotten corner of St. Mary’s Anglican accessed May 16, 2017. 3. Dictionary of Canadian Biography, Available from: www.biographi.ca/ HISTOIREVÉTÉRINAIRE Cemetery in Portage la Prairie, Manitoba, were laid the mor- en/bio/rutherford_john_gunion_15E.html Last accessed May 16, 2017. tal remains of 6-month-old Geoffrey Gunion Rutherford. If 4. First published in a socialist newspaper Appeal to Reason in 1905, the better known version was published as a book: Sinclair U. The Jungle. it hadn’t been Dr. Rutherford who championed tuberculosis New York, New York: Doubleday, Page and Co, 1906. eradication, it would have been someone else, but it wasn’t, and 5. International Commission on the Control of Bovine Tuberculosis. this was how it started. Tuberculosis: A plain statement of facts regarding the disease prepared especially for farmers and others interested in livestock. JG Rutherford, Dr. Rutherford was a veterinarian, Member of the Manitoba Veterinary Director General and Live Stock Commissioner. Ottawa, Legislative Assembly (1892 to 1896), federal Member Ontario: Government Printing Bureau, 1911.

Book Review Compte rendu de livre

Blackwell’s Five Minute Veterinary and practical treatment advice. Seven appendices and algorithms Consult: Avian provide guidance in addition to handouts and pictures of common clinical procedures found on the companion website. The Graham EJ. Wiley-Blackwell, Ames, Iowa, USA. 2016. 384 pp. appendices are easy to use, and are a helpful mix, including a ISBN: 9781-1189-3459-3. formulary, hematology and biochemistry reference ranges, lab testing available, and potential zoonoses. The “Five Minute” lackwell’s “Five Minute” series needs no introduction, template is carried into this avian text, allowing one to hone into B and this “Avian” text needs none either. It is a stand-alone the area of pressing concern, such as diagnostic guidance, medi- text yet follows the usual “Five Minute” format, alphabetically cations, or background pathophysiology. If one has enjoyed the covering 123 diseases and syndromes. It is useful that topics “Canine and Feline” Five Minute text, this “Avian” edition will can be found in various places in the table of contents based definitely be welcome. This is a useful resource with scope and on assorted common terminology, although it would have depth adequate for both vets seasoned in avian veterinary care been helpful to also list clinical signs cross-linked to diseases and for those who see birds flying into the clinic as a rare event. and conditions. One cannot always label the disease at initial presentation. A large group of veterinary contributors, all well entrenched in the avian/exotic veterinary specialty, have worked Reviewed by Janeen Junaid, DVM, MVSc, Small Animal and together to provide quick access to essential clinical information Locum Veterinarian, Hamilton, Ontario.

860 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY Veterinary Wellness Bien-être vétérinaire

Dimensions of wellness: Change your habits, change your life

Debbie L. Stoewen

eople often think about wellness in terms of physical tain ideals” (5). It allows us to act in our short- and long-term best P health — nutrition, exercise, weight management, etc., but interests, consistent with our deepest values (6). There’s just one it is so much more. Wellness is a holistic integration of physical, limitation: self-regulation requires mental energy, and the brain is mental, and spiritual well-being, fueling the body, engaging the always looking for ways to conserve energy (i.e., save effort) (7,8). mind, and nurturing the spirit (1). Although it always includes striving for health, it’s more about living life fully (1), and is Habits “a lifestyle and a personalized approach to living life in a way Habits, in contrast, require very little energy (7,8). As Duhigg, that… allows you to become the best kind of person that your author of The Power of Habit: Why We Do What We Do in Life potentials, circumstances, and fate will allow” (2). and Business says, “Any behavior that can be reduced to a routine Wellness necessitates good self-stewardship, for ourselves and is one less behavior that we must spend time and energy con- for those we care about and who care about us. For those in the sciously thinking about and deciding upon” (7). With the cogni- helping professions, such as ourselves in veterinary medicine, tive economy and performance efficiency of habits (9), the brain wellness is a professional as well as personal responsibility. In can conserve self-regulatory strength to focus on the important order to ensure high-quality patient and client services, we have decisions in life (9), and free us to engage in thoughtful activi- an ethical obligation to attend to our own health and well-being ties, such as reflecting on the past and planning for the future. (3). Sufficient self-care prevents us from harming those we serve, Habits are powerful. With about 40% of our everyday behav- Green Cross Standards of Self Care Guidelines, and according to ior repeated in the form of habits, they shape our very existence, no situation or person can justify neglecting it (3). and ultimately, our future (8). Habits, in fact, are key to well- Wellness encompasses 8 mutually interdependent dimensions: ness. For better or worse, habits very much influence health, physical, intellectual, emotional, social, spiritual, vocational, well-being, and quality of life. If you are striving to improve financial, and environmental (Table 1) (1). Attention must be these, you need to think about habits, because if you change given to all the dimensions, as neglect of any one over time your habits for the better, you change your life for the better (8). will adversely affect the others, and ultimately one’s health, Technically, a habit is “a behavior that is recurrent, is cued well-being, and quality of life. They do not, however, have to by a specific context, often happens without much awareness or be equally balanced (1). We should aim, instead, to strive for conscious intent, and is acquired through frequent repetition” a “personal harmony” that feels most authentic to us (1). We naturally have our own priorities, approaches, and aspirations, (8). It can be regarded as a formula (or “habit loop”) that the including our own views of what it means to live life fully. brain automatically follows: “When I see cue, I will do routine Making the right choices for health and well-being can be in order to get a reward” (7). Studies indicate that once formed, challenging. Although we know what is good for us and how habits become encoded in brain structures and can never truly we can do — and be — better, we may not act on it, or if we be eradicated — only replaced with stronger habits (7). That’s do, we may, in due course, slide back to familiar ways. Human why they are so difficult to change. It’s not just a matter of will- behavior — what we do, how we do it, and whether we will power (i.e., self-regulation); it’s a matter of rewiring the brain. succeed — is influenced by many factors, 2 of which are of To change a habit, you need to create new routines: Keep the particular relevance when it comes to wellness: self-regulation old cue, and deliver the old reward, but insert a new routine (7). and habits. Inserting new routines is not easy. Despite knowing what’s good for us and best intentions, habits tend to keep us doing Self-regulation what we always do (10). They are difficult to change — any of Self-regulation is central to effective human functioning (4). It us can attest to this. But we can maximize the probabilities for is “our ability to direct our behavior and control our impulses so success with 2 essentials: self-awareness and strategies. Both are that we meet certain standards, achieve certain goals, or reach cer- indispensable to successful habit formation (8).

Dr. Debbie Stoewen is the Care & Empathy Officer and Director of Veterinary Services for Pets Plus Us, Oakville, Ontario. She is a licensed veterinarian and registered social worker with a special interest in “the social side” of veterinary medicine. Use of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.

CVJ / VOL 58 / AUGUST 2017 861 FOR PERSONAL USE ONLY

Table 1. Dimensions of wellness Strategies Physical Dimension Change also becomes more achievable if you choose strategies • Caring for your body to stay healthy now and in the future that enhance your chance for success. Such strategies include Intellectual Dimension monitoring; scheduling; investing in systems of accountability; • Growing intellectually, maintaining curiosity about all there is to learn, valuing lifelong learning, and responding positively to intellectual abstaining; increasing or decreasing convenience; planning challenges safeguards; detecting rationalizations and false assumptions; • Expanding knowledge and skills while discovering the potential for using distractions, rewards, and treats; pairing activities; and sharing your gifts with others beginning with habits that directly strengthen self-control Emotional Dimension (8). Most successful habit change requires the coordination of • Understanding and respecting your feelings, values, and attitudes multiple strategies to establish a single new behavior (8), and • Appreciating the feelings of others • Managing your emotions in a constructive way new habits, on average, take 66 days to form (12), so the more • Feeling positive and enthusiastic about your life strategies used, the better. BIEN-ÊTREVÉTÉRINAIRE Social Dimension Change your habits, change your life • Maintaining healthy relationships, enjoying being with others, developing friendships and intimate relations, caring about others, Sometimes change takes a long time. Sometimes it requires and letting others care about you repeated experiments and failures. But for ongoing betterment, • Contributing to your community the attempts are unquestionably worthwhile and one success Spiritual Dimension often leads to another. When thinking about habits, wellness, • Finding purpose, value, and meaning in your life with or without organized religion and the health, well-being, and quality of life to which you • Participating in activities that are consistent with your beliefs aspire, consider the following: “Are you going to accept yourself or and values expect more from yourself?” “Are you going to embrace the present Vocational Dimension or consider the future?” and “Are you going to care about yourself • Preparing for and participating in work that provides personal or overlook yourself?” satisfaction and life enrichment that is consistent with your values, Wellness is a dynamic, ever-changing, fluctuating process goals, and lifestyle • Contributing your unique gifts, skills, and talents to work that is (13). It is a lifestyle, a personalized approach to living life in a personally meaningful and rewarding way that allows you to become the best kind of person that your potentials, circumstances, and fate will allow. The past is history; Financial Dimension • Managing your resources to live within your means, making informed the present and future lie in the choices you make today. Don’t financial decisions and investments, setting realistic goals, and worry about getting it perfect; just get it going, and become the preparing for short-term and long-term needs or emergencies best kind of person you can be. • Being aware that everyone’s financial values, needs, and circumstances are unique References Environmental Dimension 1. 8 Dimensions of Wellness, (UMD) University of Maryland’s Your Guide • Understanding how your social, natural, and built environments affect to Living Well. Available from: https://umwellness.wordpress.com/8- your health and well-being dimensions-of-wellness/ Last accessed June 27, 2017. • Being aware of the unstable state of the earth and the effects of your 2. Ardell DB. Definition of Wellness. Ardell Wellness Report 1999;18:1–5. daily habits on the physical environment 3. Standards of Self Care Guidelines, Green Cross Academy of • Demonstrating commitment to a healthy planet Traumatology. Available from: http://home.cogeco.ca/~cmc/Standards_ of_Self_Care.pdf Last accessed June 27, 2017. 4. Murtagh AM, Todd SA. Self-regulation: A Challenge to the Strength Self-awareness Model. JASNH 2004;3:19–51. 5. Psychology Glossary. Available from: http://www.alleydog.com/glos- Change becomes much more achievable if you pay attention sary/definition.php?term=Self%20Regulation#ixzz4G60TdnKX Last to who you are and insert routines that take advantage of accessed June 27, 2017. 6. Stosny S. Self-Regulation: To feel better, focus on what is most impor- your strengths, tendencies, and aptitudes. With self-awareness, tant. Available from: https://www.psychologytoday.com/blog/anger-in- you can cultivate the habits that work for you. Consider, for the-age-entitlement/201110/self-regulation Last accessed June 27, 2017. instance, differences in circadian rhythms. Circadian rhythms 7. Duhigg C. The Power of Habit: Why We Do What We Do in Life and Business. New York, New York: Random House, 2012. reflect our natural tendencies for sleeping and waking and influ- 8. Rubin G. Better Than Before: Mastering the Habits of Our Everyday ence our energy and productivity at different times in the day Lives. Toronto, Ontario: Penguin Random House; Doubleday Canada, (11). The odds of success to improve your fitness won’t increase 2015. 9. Wood W, Quinn JM, Kashy DA. Habits in everyday life: Thought, if, for example, you decide to rise an hour earlier to exercise each emotion, and action. J Pers Soc Psychol 2002;83:1281–1297. day when you happen to be a “night owl” rather than “morning 10. Neal DT, Wood W, Quinn JM. Habits — A repeat performance. Assoc lark.” Self-awareness includes knowledge about other aspects of Psychol Sci 2006;15:198–202. 11. Hamada T, LeSauter J, Venuti JM, Silver R. Expression of period genes: self as well, such as whether you are a marathoner, sprinter, or Rhythmic and nonrhythmic compartments of the suprachiasmatic procrastinator; under- or over-buyer; simplicity or abundance nucleus pacemaker. J Neurosci 2001;21:7742–7750. lover; finisher or opener; and familiarity or novelty lover (8). It 12. Lally P, Van Jaarsveld CHM, Potts HWW, Wardle J. How are habits formed: Modelling habit formation in the real world. Eur J Soc Psychol also includes whether you are promotion- or prevention-focused, 2010;40:998–1009. and whether you like taking small or big steps (8). 13. Ardell DB. Definition of Wellness. Ardell Wellness Report 1986;18:1–5.

862 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY What Can’t Be Taught Ce qui ne s’enseigne pas

Establishing self-confidence through learned knowledge

Sara Watt

y first year of practice brought new challenges, adventure, to be patient and sort through the options until I found a posi- M and excitement. After graduating from WCVM in the tion suitable for me and in a location where we wanted to live. spring of 2009, I had a brief stint of locum experience in the After a month of looking around and traveling, seeing some Okanagan Valley at a clinic I had volunteered with since my of the different areas of the south island, we decided to plop teens. It was a really great place to start, the vets there were very down in a little farming town by the name of Culverden, just supportive and patient with me as I flipped through my small north of Christchurch on the mid-eastern side of the island. animal internal med notes to sort out my differential diagnosis Culverden was home to 500 people and 500 dairy cows to each and treatment plans. I could even say I felt they were a bit proud one of those people. The dairies there were enormous, all rotary of me finally achieving my goal of becoming a veterinarian milking parlors and grass-fed cows. There were very few left or myself. It was a hard battle, 4 years of a Bachelor of Science, right displaced abomasums and C-sections, I’m not too sure cleaning kennels and restraining pets during my summers off, why, maybe because their cows and calves are smaller and fed then going through 2 interview processes before being accepted differently. One thing I did see a lot of was frothy grass bloat. to vet med. I remember one of the vets asking me after I did not The dairy farmers there were in many cases relatively new to gain acceptance after my first interview, “Are you really sure you the dairy industry, having switched over from cattle and sheep want to be a vet? You know it’s still a job right? Dentists earn farming. They really liked to stab their cows in the rumen to way more.” But no, I had no intention of looking at human release the pressure, with a knife, not a trocar, but being frothy mouths all day, I wanted to be a vet. grass bloat, there wasn’t just gas that came exploding out of Anyway, I digress. Once that summer came to an end, my the hole. Approximately 50% of the cows later succumbed to partner and I moved to New Zealand with 1-year working visas, peritonitis and died. I was only able to convince one farmer the which were effortless to obtain being under the age of 35, and whole year I was there to let me do a rumenotomy to help pre- a license to practice by simply paying the relatively inexpensive vent the extent of abdominal contamination. He always called annual registration fee to the NZ Veterinary Association. By me after that and he was so happy his cows stopped dying. One writing the NAVLE exam here in Canada, no further examina- farmer, but I guess that’s better than none, right? They did have tion was required to practice within the commonwealth, which some more advanced equipment that I had never seen before includes NZ. I had always wanted to travel, and when there and honestly haven’t seen since come to think of it, such as a weren’t any permanent job opportunities in my home town portable oxygen concentrator which uses room air to power the after I graduated, I decided to take the opportunity to live and anesthetic machine, eliminating the need for an oxygen tank. work abroad. It was a daunting experience, especially being a I thought that was pretty neat, and it was especially handy when new grad, honing your skills, wondering if they do things the hooking up a patient to an oxygen cage overnight and not hav- same as we do here at home. But I am really glad I went. And ing to worry about using up all the compressed gas. yes they do do things differently over there, sometimes a whole Boar hunting was another thing the rural New Zealanders lot differently! enjoyed doing, especially on weekends. I had several after-hours My first job I took basically over the phone, without seeing emergencies during which I had to stitch up torn hind limb the clinic, without meeting the staff, and without seeing the muscles, flush wounds, and stem jugular vein hemorrhage. area. I will never do that again! I lasted 2 weeks. Let’s just say I often requested the help of the client in these afterhours situ- that clinic was not for me; fortunately, NZ is really short on ations, and I learned very quickly that some of the things we vets and there were plenty of other job opportunities. I learned are comfortable seeing as vets is not something our clients are comfortable seeing, on their own pets especially. I saw many a Okanagan Veterinary Hospital, Kelowna, British Columbia. pale face and instructed the odd burley hunter to have a seat on Address all correspondence to Dr. Sara Watt; e-mail: the floor while I finished up. Many of them swore to me they [email protected] would never go boar hunting again after witnessing the surgery Use of this article is limited to a single copy for personal study. their beloved boar dog had to go through, and I don’t doubt Anyone interested in obtaining reprints should contact the that was true! It was fun working in New Zealand, yes they did CVMA office ([email protected]) for additional things sometimes frustratingly differently, but I just stuck to my copies or permission to use this material elsewhere. guns and I think that they taught me just as much as I taught

CVJ / VOL 58 / AUGUST 2017 863 FOR PERSONAL USE ONLY

them. That is something to remember; as a new grad yes you induction agent?’ ‘Thiopental.’ Still confused, I asked ‘Okay so lack in experience, but you are full of knowledge. what do you have on hand for pain control?’ ‘He doesn’t need Veterinary medicine is constantly changing, and the new pain control, he’s sleeping.’ ‘What?!’ I say in shock, then repeat- grads gain new knowledge. For me, I was happiest working ing what I was drilled numerous times during my anesthesia somewhere where my coworkers were willing to be not only course at vet school, ‘Anesthesia is not analgesia!’ After scolding mentors, but also willing to listen and learn from me. The best him, he calmly asked me what I would have done for pain con- example I have of that is when I was casually sitting in on a trol, then after the surgery I gave him a copy of the chapter on stifle surgery my boss was performing, and just asking him for pain control from my textbook, which I don’t believe he actually my own knowledge really, what his anesthetic protocol was. read, but every time he did another surgery, he asked me what Our conversation went something like this: ‘So what was your his pain control protocol should be and he did it. pre-med?’ ‘Ace.’ Hmm I thought. ‘So what was your anesthetic CE QUI CE NE S’ENSEIGNEPAS

Index of Advertisers Index des annonceurs

Artistree Construction, Inc...... 880 Lebalab, Inc...... IBC

Bayer Inc...... 780, 783 Merck Canada...... 772

Borden Ladner Gervais LLP...... 879 Nestle Purina Canada, Inc...... 769

Canadian Veterinary Medical Association...... 775, 778 Pawsitive Resources...... 878

CanWest Veterinary Conference...... 784 Practice One Consulting...... 878

Elanco Canada Ltd...... 776 ROI Corporation...... 880

FMS Medical Systems Ltd...... 879 University of Saskatchewan...... 877

Gallant Custom Laboratories, Inc...... 879 UXR, Inc...... 880

Hill’s Pet Nutrition Canada, Inc...... OBC Veterinary Education Today...... 879

IDEXX Laboratories, Inc...... 770 Ward & Uptigrove...... 880.

Jackson & Associates...... 879 Western Financial Group Insurance Solutions...... IFC

The participation of advertisers in the CVJ is an indication of their com- Le support des annonceurs démontre leur engagement pour mitment to the advancement of veterinary medicine in Canada. We l’avancement de la médecine vétérinaire au Canada. Nous vous encourage our readers to give their products and services appropriate encourageons à prendre connaissance de leurs services et produits. consideration. — Ed. — NDLR

864 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY The Art of Private Veterinary Practice L’art de la pratique vétérinaire privée

Communication: Touchy at-home treatment communication dilemmas

Myrna Milani

ultiple veterinary sources offer handouts practitioners quickly became apparent to both practitioners that some clients M can share with their clients. Among these are those that desiring the service were less competent than others. Although provide how-to instructions for clients who desire to do basic Dr. Bernard’s client, Mr. Erikson, wanted to treat his rambunc- procedures, such as injecting certain medications or administer- tious golden retriever at home for financial and convenience ing subcutaneous fluids, at home. reasons, the elderly client lacked the physical ability to restrain When Dr. Bernard first began sharing such handouts with the animal properly. Add that the client’s arthritic hands and her clients, she considered this a win-win for her, her clients, failing vision made administration of medications of any kind and her patients. an “iffy” proposition at best, and Dr. Bernard initially found “I practice in a low-income area where many people live pay- herself in a difficult position. check to paycheck. But my clients do care about their animals “I wanted to acknowledge my client’s legitimate concerns and they do try to do the best they can,” she explains. “Providing and fulfill his wishes. But there was no way I could support his them with the wherewithal to do simple treatments at home like performing a procedure that potentially could put him and his injecting medications or giving SQ fluids to a cat with renal animal at risk,” she explains. “It took me a while to figure out problems is more than a convenience in some of these cases. It how to tell Mr. Erickson this in a way that wouldn’t jeopardize enables those people to provide care for their animals that they our clinician-client relationship.” wouldn’t be able to afford otherwise.” To accomplish this, Dr. Bernard began by acknowledging the Meanwhile her colleague, Dr. Dougherty who practices in legitimacy of Mr. Erickson’s desire to medicate his dog at home. a more affluent area, considers these handouts beneficial for a Then she explained her concerns about her client’s and his ani- completely different reason. mal’s safety. However, she did not end the discussion there. She “There are times when doing routine, repetitive treatments also provided Mr. Erikson with a viable alternative. She would in-house stresses the animal or the client sufficiently that it help him solicit help to restrain the dog from willing and able decreases the efficacy of the treatment. I’ve had several cases friends, and have one of her technicians who lives near him stop where it became stressful enough that clients started missing in to medicate the dog daily for a reasonable fee. In such a way, appointments or tried to convince me their animals no longer the veterinarian provided the client with a compromise that needed treatment even though I knew the animals did,” the addressed his needs as well as those of his animal. practitioner comments. “When I gave those clients the option Dr. Doherty’s communication challenge takes the form of of treating their animals at home themselves, they were thrilled.” what he calls “Give ‘em an inch and they’ll take a mile” clients. However, Drs. Bernard and Dougherty soon realized that pro- “I fully support clients with terminally ill animals who want viding this service had a downside as well as an upside one that to make their animals’ last days as comfortable as possible. And could create communication dilemmas for them. For example, it I also accept that there are certain procedures many clients can do at home, such as change bandages or give injectable medical support of one kind or another to treat their animals with Dr. Milani is a behavior and bond practitioner, teacher, and chronic problems,” he declares. “But it irks me when those same author of several books on the interaction of animal behavior, people expect me to dispense medications for a new or even health, and the human-animal relationship. recurrent problem in an animal I haven’t seen in ages. After Use of this article is limited to a single copy for personal study. one client tried to badger me into dispensing medication for a Anyone interested in obtaining reprints should contact the relative’s animal I’d never even seen, I decided I had to come CVMA office ([email protected]) for additional up with a standard response to avoid saying something to these copies or permission to use this material elsewhere. clients that I’d regret.”

CVJ / VOL 58 / AUGUST 2017 865 FOR PERSONAL USE ONLY

After trying several different approaches, Dr. Doherty decided They also felt obligated to replace the contaminated apparatus that the one that worked best for him was the simplest as well at no charge. When the same circumstances arose again, they as most professional one. He told these people he could not do became frustrated and angry. as they asked because it would be poor veterinary medicine and Based on these unrewarding experiences, the practitioners a disservice to them and their animals to do so. once again developed a basic communication protocol to “I know you think Sherwood is perfectly healthy except for accompany their medical ones to ensure their patients safety his ears bothering him again, and I certainly hope that’s true” and well-being. Instead of dispensing more or other controlled he tells Ms. Rasmussen. “But it’s been more than a year since drugs and apparatus for home use when problems arise, they I’ve seen him. And while it’s possible he has the same kind of immediately hospitalize the animal to determine what is going infection he did the last time, he might not. If he doesn’t, it’s not on. If the animal responds as expected to the prescribed treat- just that the wrong medication might not work. It could make ment properly administered in their facilities then they knew his infection worse and much more difficult and costly to treat.” that, whatever the problem was, it was related to something The third at-home treatment challenge is one practitioners in going on in the home environment. all areas increasingly may encounter: dispensing certain drugs or When they discharge such an animal to the owner’s care, the apparatus for home use in a household in which the potential veterinarians’ remarks avoid blame or speculation in favor of

L’ART DE LA PRATIQUE VÉTÉRINAIREPRATIQUE LA DE PRIVÉE L’ART for abuse is suspected or known to exist in one of its residents. focusing on the animal’s well-being. Unlike clients such as Mr. Erikson and Ms. Rasmussen who “Because Chelsey didn’t respond to the medication when fully intend to use any medications and apparatus from the you gave it at home, I want to medicate her here daily or send a veterinarian to treat an animal, substance abusers want any skilled technician to medicate her for you at home,” Dr. Bernard medication or equipment for their own use. This obviously can tells her client. create problems for practitioners that have implications for their If the client protests about the added expense, she also notes patients’ well-being. that she could dispense a different, but unfortunately less In general, substance abusers who steal medications or needles effective nonnarcotic oral medication for home use if the client prescribed for animals belonging to other family members or would prefer this. housemates are secretive about this. Some may feel embarrassed “This isn’t a perfect solution, but we can only work with what that their addiction causes them to behave in such a deceitful we know for sure,” Dr. Doherty sums up these difficult situa- manner. Additionally, most abusers do not want to compro- tions. “No matter how suspicious we may be about the potential mise what they perceive as a reliable source of medication or for human drug abuse, all we know is that at-home treatment useful medical apparatus. But regardless of the abuser’s specific with that drug or the way of administering it isn’t working in motivation, it may result in liquid medications intended for the that client’s home and that’s jeopardizing the animal’s health. animal being surreptitiously removed from vials and replaced It’s our responsibility to do the best we can to help the animal with water, or tablets replaced with over-the-counter look-alikes. within those limits, not to identify and out a substance abuser.” Sterile needles meant to inject medications or fluids to treat the Fortunately, touchy situations related to at-home controlled animal may be taken and replaced with used ones. drug administration or injected treatments of any kind comprise When this occurs, practitioners may assume that clients are the minority. But when they do occur, they can take up a dis- treating their animals with specific amounts of specific medica- proportionate amount of practitioners’ time unless a standard tions and administering these using sterile apparatus when this protocol exists to address them. But although most practitioners may not be the case. When their patients do not respond to routinely master protocols that strictly address the animal’s their prescribed medications as anticipated, Drs. Barnard and physical needs, they may assume that the words that will enable Dougherty used to increase the dosage or switch to a different them to accomplish the sometimes delicate client communica- medication. If the animal displayed symptoms related to con- tion skill associated with these will magically occur to them. tamination of any administration apparatus, the veterinarians Unfortunately, though, sometimes when they need her the most, lost valuable time and sleep trying to determine the source of the muse of quality client communication lets them down. the problem as well as treating the animal for its negative results.

866 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY

Answers to Quiz Corner Les réponses du test éclair

1. A) AST and ALP are not liver-specific. ALT and AST are leakage 3. A) Leydig or interstitial cell neoplasms of the testes are typi - enzymes. cally soft and yellow. Seminomas tend to be firm and white A) L’AST et la PA ne sont pas des enzymes spécifiques au foie. to pink gray, and Sertoli cell tumors are usually firm, white, L’ALT et l’AST sont des enzymes qui fuient. and lobulated. Perianal gland neoplasms are usually benign (adenomas), so metastasis to the testis is unlikely. 2. B) The most common cause of endodontic disease in dogs is A) Les néoplasmes testiculaires des cellules de Leydig ou dental trauma, with a tooth being fractured and secondary interstitielles sont de façon caractéristique de consistance pulpal exposure. Radiographically, signs of chronic end - molle et de couleur jaune. Les séminomes ont tendance à odontic disease include periapical or apical lysis and large être durs et de couleur blanche à rose; les tumeurs des cellules endodontic canals compared to contralateral canals. This de Sertoli sont habituellement jaunes, blanches et lobulées. is because inflammatory products leak into the periapical Les néoplasmes des glandes périanales sont habituellement tissues and cause resorption of the periapical bone or apex bénignes (adénomes) de sorte que les métastases aux of the root itself. The endodontic canal (pulp) may be larger testicules sont peu probables. in the affected tooth compared to the contralateral normal tooth; this is due to a failure of dentin deposition second - 4. C) Fescue is the only forage in the group above that is known to ary to early pulpal necrosis in a young dog with a fractured be infected with an endophyte that produces toxins capable tooth. Endodontic therapy, including vital pulpotomy, con- of causing the described problems. ventional endodontic therapy, and surgical endodontic C) La fétuque est le seul fourrage du groupe qui est reconnu therapy, is a viable alternative to extraction in dogs with pour être infecté avec un endophyte qui produit des toxines endodontic disease. capables de causer les troubles décrits. B) La cause la plus fréquente de maladie endodontique chez 5. C) Blind abomasal pexies are recommended if displacement is to le chien est un traumatisme à une dent, lorsque celle-ci est the left side of the abdomen, there are unlikely to be abdomi- fracturée et que la pulpe est secondairement exposée. Du point nal adhesions, and a gravid uterus will not be positioned by de vue radiographique, les signes de maladie endodontique the right cranioventral abdomen, such as occurs after the chronique comprennent une lyse périapicale ou apicale et de fifth month of gestation. Metritis does not preclude these grands canaux endodontiques par comparaison aux canaux techniques, and recovery may be enhanced since uterine controlatéraux. Cela est dû aux produits inflammatoires qui drainage occurs in dorsal recumbency. This is the only posi- fuient dans les tissus périapicaux et causent la résorption de tion in which the procedure can be performed. l’os périapical ou de l’apex de la racine elle-même. Le canal C) Les abomasopexies à l’aveugle sont recommandées si le endodontique (pulpaire) peut être plus grand dans la dent déplacement est du côté gauche de l’abdomen; il est peu affectée par comparaison à la dent controlatérale normale; probable qu’il y ait des adhérences abdominales et un utérus cela est dû à un défaut de dépôt de la dentine, secondairement gravide ne sera pas placé en position cranioventrale droite à une nécrose précoce de la pulpe chez un jeune chien qui dans l’abdomen, tel qu’il se produit après le cinquième mois présente une dent fracturée. Le traitement endodontique, de gestation. Une métrite n’empêche pas ces techniques et la incluant une pulpotomie vitale, un traitement endodontique récupération peut être stimulée puisque le drainage de l’utérus conventionnel et un traitement endodontique chirurgical, est se produit en décubitus dorsal. C’est la seule position dans une solution de remplacement viable à l’extraction chez le laquelle l’intervention peut être pratiquée. chien souffrant de maladie endodontique.

quiz corner is generously sponsored by le test éclair est généreusement commandité par

BRAVECTO CVJ - Quiz Corner Answer ad.indd 1 2016-03-31 10:47 AM

CVJ / VOL 58 / AUGUST 2017 867 FOR PERSONAL USE ONLY Classifieds Petites annonces Business Directory

Providing Pet Loss Sympathy Resources for Veterinarians

Condolence Cards • Memorial Keepsakes Books on Pet Loss and Grief for Children End of Life Brochures

WWW.PAWSITIVERESOURCES.COM

Created with Care by Canadian Veterinarians

Practice One Consulting

Practice Valuations  Practice Purchase Practice Sale  Practice Management

Dr. Frank Richardson, DVM, MBA Veterinary Management Consultant

PO Box 176 Phone: (902) 531-2617 Western Shore, Nova Scotia E-mail: [email protected] B0J 3M0 Fax: (902) 531-2618

X-Ray Digital & Analog Ultrasound ElectroSurgery & Laser Autoclave, Centrifuge & Microscope Procedure & Surgery Light Vital Sign Monitor

1480 Pemberton Avenue IV Pump & Warmer North Vancouver, BC V7P 2S1 Phone (604) 446-9099 Anesthesia & Surgery Accessories www.fmsmeds.com Stainless Steel & Veterinary Table Email: [email protected] Dental Unit & Dental X-Ray

VetAdvise.com

All About Veterinarians Consulting, Coaching, Valuations, Negotiations, Purchase / Sale

TERRY JACKSON, C.P.A. - C.G.A. Phone: 604.939.2323 [email protected]

868 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY Business Directory

DOUGLAS C. JACK – Partner Experts in Autogenous Bacterins, and • Practice Management Agreements Swine Influenza Virus Vaccines • Incorporations • Employment Matters • Discipline Proceedings and Malpractice Defence • Buying and Selling a Practice ✓ High quality Autogenous Biologics P 416.367.6389 | TF 800.563.2595 F 416.367.6749 | [email protected] ✓ Licensed by the CFIA ✓ We make Vaccines for We make autogenous vaccines Bay Adelaide Centre, East Tower • Swine 22 Adelaide St W, Toronto, ON Canada M5H 4E3 • Poultry For more information, contact: Sam Mostafa Phone: 1-888-838-5223 Calgary | Montréal | Ottawa • Bovine Toronto | Vancouver e-mail: [email protected] Lawyers | Patent & Trademark Agents Borden Ladner Gervais LLP www.gallantcustomlaboratories.com is an Ontario Limited Liability Partnership. blg.com

YOUR SUCCESS IS OUR BUSINESS Committed to helping you achieve financial success in your veterinary practice

ERIC HOFFMANN

514 695 4114 514 695 4926 514 889 1580 [email protected] www.uxr.ca WARD & UPTIGROVE CHARTERED PROFESSIONAL ACCOUNTANTS 227G Brunswick Blvd., Pointe-Claire, QC H9R 4X5 DAVE LEGAULT | [email protected] | 519.291.3040 | WARDANDUPTIGROVE.COM

You care for them. We care for You and Your practice. A dedicated team offering appraisal, consulting and brokerage services. Call us at (888) 764-4145 or email [email protected].

roicorp.com

BROKERAGE

CVJ / VOL 58 / AUGUST 2017 869 FOR PERSONAL USE ONLY Business Directory

Reaching Canada’s Veterinarians Get your message into

The Canadian Veterinary Journal For more information contact: Laima Laffitte Advertising Manager Tel.: (613) 673-2659 Fax: (613) 673-2462 e-mail: [email protected]

870 CVJ / VOL 58 / AUGUST 2017 FOR PERSONAL USE ONLY FOR PERSONAL USE ONLY

OBESITY + ARTHRITIS

The only way to manage both is to work together

FORMULATED TO:

REDUCE BODY WEIGHT BY 13% IN 60 DAYS1

IMPROVE MOBILITY IN AS LITTLE AS 21 DAYS2

PRESCRIPTION DIET® Metabolic+Mobility Meet the single solution for both obesity and arthritis that helps elevate your care for patients with concurrent conditions. For more information, talk to your Hill’s Veterinary Account Manager.