DOCSLIB.ORG

Ompa of a Septicemic Escherichia Coli O78 – Secretion and Convergent Evolution Uri Gophna, Diana Ideses, Ran Rosen, Adam Grundland, Eliora Z

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Ompa of a Septicemic Escherichia Coli O78 – Secretion and Convergent Evolution Uri Gophna, Diana Ideses, Ran Rosen, Adam Grundland, Eliora Z ARTICLE IN PRESS International Journal of Medical Microbiology 294 (2004) 373–381 www.elsevier.de/ijmm OmpA of a septicemic Escherichia coli O78 – secretion and convergent evolution Uri Gophna, Diana Ideses, Ran Rosen, Adam Grundland, Eliora Z. Ronà Department of Molecular Microbiology and Biotechnology, The George S. Wise Faculty of Life Sciences, Tel Aviv University, Tel Aviv, Israel Received 7 June 2004; received in revised form 24 August 2004; accepted 26 August 2004 Abstract OmpA is an important constituent of the outer membrane of Gram-negative bacteria. OmpA is involved in a variety of host–bacteria interactions, including crossing of the blood–brain barrier by E. coli strains causing newborn meningitis, and elicits a significant response by the immune system of the host. The bactericidal effect of neutrophil elastase (NE) is also attributed to degradation of the bacterial OmpA. Here we examined the OmpA of septicemic E. coli O78 strains and show that two surface-exposed loops are conserved among invasive strains of E. coli and other pathogenic Enterobacteriaceae. In addition, there is evidence for convergent evolution, implying the existence of selective pressure. Our results also indicate that large quantities of OmpA are secreted into the medium during all phases of growth, where it is present both in secreted vesicles and as a soluble secreted protein. We assume that secreted OmpA can play a role in protection of bacteria from NE by competitive inhibition. Support for this assumption was obtained from experiments indicating that addition of exogenous, purified OmpA reduces killing of bacteria by NE. r 2004 Elsevier GmbH. All rights reserved. Keywords: OmpA; Septicemic E. coli; Molecular evolution; Protein secretion; Outer membrane proteins Introduction periplasm and contains a peptidoglycan-association motif (Koebnik, 1995; Singh et al., 2003). OmpA – outer membrane protein A – is a major OmpA is a prime target of the host immune system: constituent of outer membranes of Gram-negative its binding activates macrophages (Soulas et al., 2000) bacteria, and is required for the structural integrity of and induces dendritic cell maturation (Jeannin et al., the cell surface. The best studied ompA gene variant, 2000). The degradation of OmpA by neutrophil elastase À that of E. coli K-12, encodes a 325-amino-acid (NE) promotes killing of E. coli, and ompA mutants polypeptide (Chen et al., 1980) targeted to the mem- are immune to the effect of NE (Belaaouaj et al., 2000). brane by a 21-amino-acid signal peptide. The N- OmpA has been implicated in the pathogenicity of terminal domain of the mature protein crosses the encapsulated E. coli strains (K1) causing newborn membrane eight times, creating four surface-exposed meningitis (NBM), a disease in which bacteremia is loops. The C-terminal region of OmpA is located in the followed by bacterial crossing of the blood–brain barrier. The E. coli K1 OmpA was shown to be involved ÃCorresponding author. Tel.: +972 (3) 640 9379; fax: in invasion of brain microvascular endothelial cells (an +972 (3) 641 4138. in vitro model for NBM) by a receptor–ligand mecha- E-mail address: [email protected] (E.Z. Ron). nism (Prasadarao et al., 1996b), mediated by the first 1438-4221/$ - see front matter r 2004 Elsevier GmbH. All rights reserved. doi:10.1016/j.ijmm.2004.08.004 ARTICLE IN PRESS 374 U. Gophna et al. / International Journal of Medical Microbiology 294 (2004) 373–381 and second loops. The receptor for OmpA is found in dysenteriae, E. coli O157:H7 EDL933, E. coli K1, brain microvascular endothelial cells but not in vascular and E. coli K-12 were from the NCBI database (acc- endothelial cells (Prasadarao et al., 1996a). The OmpA essions NC_004431, NC_004337, V01344, NC_002655, proteins of E. coli K1 and K-12 differ only in three AF234269 and U00096, respectively). Salmonella ente- amino acids (as inferred from the nucleotide sequence), rica serovar Typhimurium (accession NC_003197) was and K-12 OmpA was found to possess a similar function used for phylogenetic analysis. in invasion of brain microvascular endothelial cells (Kim, 2001). Preparation of secreted proteins for 2D gel analysis Recent reports have shown that OmpA is released by E. coli when incubated in human serum, and is also Two hundred millilitre of bacterial culture were secreted by E. coli serotype O18 and circulates in the harvested by a 10 min centrifugation at 8000g at 4 1C. bloodstream of a septic rat in a sepsis model (Hellman et The supernatant was centrifuged again for 2 h at 10,000g al., 2000; Hellman and Warren, 2001). OmpA was also to remove traces of lysed cells. TCA was added to the shown to be secreted by other Gram-negative bacterial subsequent supernatant to a final concentration of 10% species such as Acinetobacter (Toren et al., 2002), where for an overnight incubation at 4 1C. Pelleted proteins it was also shown to play a role in virulence (Ofori- were obtained by a 2-h centrifugation at 10,000g at 4 1C. Darko et al., 2000). Moreover, analysis of secreted The pellet was washed four times with 95% ethanol membrane vesicles of E. coli K-12 showed that OmpA using 10 min centrifugation steps at 10,000g. The pellet could be detected among other vesicle-secreted proteins was then transferred to a microcentrifuge tube and (Wai et al., 2003). washed again with ethanol for five times and solubilized Avian colisepticemia is a systemic disease of poultry in gel rehydration solution (8 M urea; 2 M thiourea; involving bacterial invasion into the bloodstream and 2 mg/ml dithiothreitol; 5.2 ml/ml Pharmalites (pH 3-10) organs. This disease is of economical importance, and 10 mg/ml CHAPS (Sigma Chemicals Co.)). especially as it often follows vaccination with live attenuated vaccine viruses. The most important avian septicemic strains are of serotype O78, a serotype also Isoelectric focusing and polyacrylamide gel associated with NBM in humans. In this report we show electrophoresis that an avian septicemic E. coli strain releases OmpA into the medium at both logarithmic and stationary Twenty microgram of secreted protein solubilized in growth phases, even when grown in rich medium. gel rehydration solution were loaded on immobilized pH Secretion of OmpA by septicemic strains is probably gradient (IPG) strips (18 cm, pI 4–7) for isoelectric not dependent on its primary structure because sequence focusing, by incubation of the gels in the protein- variations are found mostly in surface-exposed loops of containing rehydration solution for 24 h. The isoelectric the protein and not in regions important for its focusing was carried out in six steps: (1) 0–100 V anchoring. Our study also indicates that the septicemic gradient for 100 Vh; (2) a constant potential of 100 V O78 serotype secretes OmpA not only by means of for 500 Vh; (3) 100–500 V gradient for 2400 Vh; (4) a secreted membrane vesicles, as was shown for E. coli K- constant potential of 500 V for 2500 Vh; (5) 500–3500 V 12 (Wai et al., 2003), but also as a soluble secreted gradient for 10,000 Vh, and (6) a constant potential of protein. Phylogenetic reconstruction shows conservation 3500 V for 35,000 Vh (Rosen et al., 2001). The second of the outer loopmutations among otherwise distant dimension was electrophoresed according to Bernhardt invasive strains. Addition of exogenous OmpA pro- et al. (1999). The gels were stained in a sensitive silver tected bacteria from NE-mediated killing in vitro. We stain for visualization or by Coomassie brilliant blue for therefore suggest that secretion of OmpA may con- subsequent identification (Laemmli, 1970). tribute to bacterial resistance to the immune system of warm-blooded hosts. Protein identification Spots were cut from Coomassie-blue stained gels and were washed for 30 min in 200 ml of 200 mM NH4NCO3, Materials and methods 50% CH3CN at 37 1C. The washed spots were then dried, rehydrated with digestion solution (0.02 mg/ml Bacterial strains used trypsin (Promega), 40 mM NH4NCO3 (pH 8.1), 10% CH3CN) and incubated for 16 h at 37 1C. The extracted E. coli strain 789 is a septicemic strain of serotype O78 peptides were loaded on a POROS 50 R2 (PerSeptive (Babai et al., 1997; Ron et al., 1991). The K-12 strain Biosystems) micro-column for desalting. The peptides used was MG1655 (Blattner et al., 1997). Sequences of were eluted directly into a Q-STAR (Applied Biosys- E. coli UTI strain CFT073, Shigella flexneri, Shigella tems) needle and were measured and identified by ARTICLE IN PRESS U. Gophna et al. / International Journal of Medical Microbiology 294 (2004) 373–381 375 MS/MS using the Analyst QS software (Applied an additional 10 min at 72 1C. A PTC100 programmable Biosystems). thermal cycler (MJ research Inc.) was used for all reactions. Automated DNA sequencing was performed Preparation of protein samples for OmpA on double-stranded DNA templates by the dideoxynu- cleotide chain-termination method (Sanger et al., 1977) quantification with an Applied Biosystems model 3100 sequencer (Foster City, CA, USA), as previously described (Boyd A single colony was grown in LB medium at 37 1C for and Hartl, 1998). The sequencing primers used were 8 h, diluted into 240 ml of LB and grown for 15 h at OmpAf2 (CGGCGCTCGGACAGACCCT) and Om- 37 1C, 150 rpm. Total cell proteins were obtained by pAr2 (CGCAGGCCGCTCCGAAAGATAAC). centrifuging 400 ml of the culture, discarding the super- natant and resuspending the pellet in 50 ml ddH2O. Secreted proteins were determined in culture super- Neutrophil elastase sensitivity assays natants, obtained after 10 min centrifugation at 10,000g at 4 1C, and filtration through a 0.22-mm filter. The NE sensitivity assays were performed as described supernatant was divided in two parts: one was utilized previously (Belaaouaj et al., 2000) with the following for preparing total secreted proteins, and the other was modifications: human NE was supplied by Calbiochem, used for preparing secreted vesicles.
Load more

Recommended publications
  • Like Domains Identified in the Genome Sequences of Leptospira Interrogans
    RESEARCH ARTICLE Features of Two New Proteins with OmpA- Like Domains Identified in the Genome Sequences of Leptospira interrogans Aline F. Teixeira1,2, Zenaide M. de Morais3, Karin Kirchgatter4, Eliete C. Romero5, Silvio A. Vasconcellos3, Ana Lucia T. O. Nascimento1,2* 1 Centro de Biotecnologia, Instituto Butantan, Sao Paulo, SP, Brazil, 2 Programa de Pós-Graduação Interunidades em Biotecnologia,Instituto de Ciencias Biomedicas, Universidade de Sao Paulo, Sao Paulo, SP, Brazil, 3 Laboratório de Zoonoses Bacterianas, Faculdade de Medicina Veterinária e Zootecnia, Universidade de Sao Paulo, Sao Paulo, SP, Brazil, 4 Nucleo de Estudos em Malária, Superintendência de Controle de Endemias - Instituto de Medicina Tropical, Universidade de Sao Paulo, Sao Paulo, SP, Brazil, 5 Centro de Bacteriologia, Instituto Adolfo Lutz, Sao Paulo, Brazil * [email protected] Abstract OPEN ACCESS Citation: Teixeira AF, de Morais ZM, Kirchgatter K, Leptospirosis is an acute febrile disease caused by pathogenic spirochetes of the genus Romero EC, Vasconcellos SA, Nascimento ALTO Leptospira. It is considered an important re-emerging infectious disease that affects humans (2015) Features of Two New Proteins with OmpA- worldwide. The knowledge about the mechanisms by which pathogenic leptospires invade Like Domains Identified in the Genome Sequences of Leptospira interrogans. PLoS ONE 10(4): e0122762. and colonize the host remains limited since very few virulence factors contributing to the doi:10.1371/journal.pone.0122762 pathogenesis of the disease have been identified. Here, we report the identification and char- Academic Editor: Odir A Dellagostin, Federal acterization of two new leptospiral proteins with OmpA-like domains. The recombinant pro- University of Pelotas, BRAZIL teins, which exhibit extracellular matrix-binding properties, are called Lsa46 - LIC13479 and Received: October 17, 2014 Lsa77 - LIC10050 (Leptospiral surface adhesins of 46 and 77 kDa, respectively).
    [Show full text]
  • In Silico Prediction and Threading Based Epitope Mapping of Ompa-Like Outer Membrane Leptospiral Lipoprotein Loa22
    International Journal Of Scientific & Engineering Research, Volume 6, Issue 3, March-2015 477 ISSN 2229-5518 In silico prediction and threading based epitope mapping of OmpA-like outer membrane Leptospiral Lipoprotein Loa22 Angela Asir Ramasamy Victor1$, Sunil Abraham1$, Jebasingh Tennyson1, Nityananda Pradhan2* $ Authors equally contributed to this paper Abstract — Loa22 is OmpA-like outer membrane protein from Leptospira interrogans characterized in the C-terminus domain which play an important role in the infection and immunological responses of leptospirosis. [1,2]. Phylogenetic tree was constructed for Loa22 by comparing it with Lipoproteins (LipL 71, 45, 41, 31, 32, 21 and 48) and with outer membrane proteins (OmpL 1, 47, 54, 36, 37). The comprising lineages of Loa 22 have largely varying rates of evolution. In the present study the physicochemical properties of Loa22 were assessed. The structure of Loa22 was predicted by threading method in RaptorX server and the structure was energy minimized and validated by using SAVES server. The stereochemical quality and the protein backbone conformations were done by Ramachandran Plot analysis. Four sequential and conformational B cell epitopes of Loa22 were found in Ellipro server and mapped to find the sequential epitopes. The same B cell linear epitopes was also predicted by ABC Pred, BepiPred 1.0 server. All these epitopes were found to be in higher values. The results of the present study will help to elucidate the function of Loa22 and epitope-based vaccine development for Leptospirosis. Key words: Leptospira, Lipoprotein, OmpA, outer membrane protein, Loa22, Phylogenetic analysis, B-cell epitope, List of abbreviations: SAVES: Structural Analysis and Verification Server; MEGA: Molecular Evolutionary Genetic Analysis; PI: Protrusion Index; LBP: Local Bootstrap values; ACC: Auto Cross Covariance NEFF: Number of Effective sequence homologs.
    [Show full text]
  • The Borrelia Afzelii Outer Membrane Protein BAPKO 0422 Binds Human Factor-H and Is Predicted to Form a Membrane-Spanning Β-Barrel
    Biosci. Rep. (2015) / 35 / art:e00240 / doi 10.1042/BSR20150095 The Borrelia afzelii outer membrane protein BAPKO_0422 binds human factor-H and is predicted to form a membrane-spanning β-barrel Adam Dyer*1, Gemma Brown*1, Lenka Stejskal*, Peter R. Laity*† and Richard J. Bingham*2 *Department of Biological Sciences, School of Applied Sciences, University of Huddersfield, Queensgate, Huddersfield HD1 3DH, U.K. †Present Address: Department of Materials Science and Engineering, Sir Robert Hadfield Building, Mappin Street, University of Sheffield, Sheffield S1 3JD, U.K. Downloaded from http://portlandpress.com/bioscirep/article-pdf/35/4/e00240/476959/bsr035e240.pdf by guest on 30 September 2021 Synopsis The deep evolutionary history of the Spirochetes places their branch point early in the evolution of the diderms, before the divergence of the present day Proteobacteria.Asaspirochete, the morphology of the Borrelia cell envelope shares characteristics of both Gram-positive and Gram-negative bacteria. A thin layer of peptidoglycan, tightly associated with the cytoplasmic membrane, is surrounded by a more labile outer membrane (OM). This OM is rich in lipoproteins but with few known integral membrane proteins. The outer membrane protein A (OmpA) domain is an eight-stranded membrane-spanning β-barrel, highly conserved among the Proteobacteria but so far unknown in the Spirochetes.Inthe present work, we describe the identification of four novel OmpA-like β-barrels from Borrelia afzelii, the most common cause of erythema migrans (EM) rash in Europe. Structural characterization of one these proteins (BAPKO_0422) by SAXS and CD indicate a compact globular structure rich in β-strand consistent with a monomeric β-barrel.
    [Show full text]
  • Membrane Protein Profiling of Acidovorax Avenae Subsp. Avenae Under Various Growth Conditions
    Arch Microbiol (2015) 197:673–682 DOI 10.1007/s00203-015-1100-9 ORIGINAL PAPER Membrane protein profiling of Acidovorax avenae subsp. avenae under various growth conditions Bin Li1 · Li Wang1 · Muhammad Ibrahim1,3 · Mengyu Ge1 · Yanli Wang2 · Shazia Mannan3 · Muhammad Asif3 · Guochang Sun2 Received: 24 July 2014 / Revised: 1 February 2015 / Accepted: 2 March 2015 / Published online: 13 March 2015 © Springer-Verlag Berlin Heidelberg 2015 Abstract Membrane proteins (MPs) of plant pathogenic transport of small molecules, protein synthesis and secretion bacteria have been reported to be able to regulate many essen- as well as virulence such as NADH, OmpA, secretion pro- tial cellular processes associated with plant disease. The aim teins. Therefore, the result of this study not only suggests that of the current study was to examine and compare the expres- it may be an alternate method to analyze the in vivo expression sion of MPs of the rice bacterial pathogen Acidovorax avenae of proteins by using LE medium to mimic plant conditions, subsp. avenae strain RS-1 under Luria-Bertani (LB) medium, but also reveals that the two sets of differentially expressed M9 medium, in vivo rice plant conditions and leaf extract (LE) MPs, in particular the common MPs between them, might be medium mimicking in vivo plant condition. Proteomic analy- important in energy metabolism, stress response and virulence sis identified 95, 72, 75, and 87 MPs under LB, in vivo, M9 of A. avenae subsp. avenae strain RS-1. and LE conditions, respectively. Among them, six proteins were shared under all tested growth conditions designated as Keywords Acidovorax · Membrane proteins · In vivo · abundant class of proteins.
    [Show full text]
  • Pseudomonas Syringae Pv
    The identification of genes important in pseudomonas syringae pv. phaseolicola plant colonisation using in vitro screening of transposon libraries Article Published Version Creative Commons: Attribution 4.0 (CC-BY) Open Access Manoharan, B., Neale, H. C., Hancock, J. T., Jackson, R. W. and Arnold, D. L. (2015) The identification of genes important in pseudomonas syringae pv. phaseolicola plant colonisation using in vitro screening of transposon libraries. PLoS ONE, 10 (9). e0137355. ISSN 1932-6203 doi: https://doi.org/10.1371/journal.pone.0137355 Available at http://centaur.reading.ac.uk/42119/ It is advisable to refer to the publisher’s version if you intend to cite from the work. See Guidance on citing . Published version at: http://dx.doi.org/10.1371/journal.pone.0137355 To link to this article DOI: http://dx.doi.org/10.1371/journal.pone.0137355 Publisher: Public Library of Science All outputs in CentAUR are protected by Intellectual Property Rights law, including copyright law. Copyright and IPR is retained by the creators or other copyright holders. Terms and conditions for use of this material are defined in the End User Agreement . www.reading.ac.uk/centaur CentAUR Central Archive at the University of Reading Reading’s research outputs online RESEARCH ARTICLE The Identification of Genes Important in Pseudomonas syringae pv. phaseolicola Plant Colonisation Using In Vitro Screening of Transposon Libraries Bharani Manoharan1☯, Helen C. Neale1☯, John T. Hancock1, Robert W. Jackson2, Dawn L. Arnold1* 1 Centre for Research in Bioscience, Faculty of Health and Applied Sciences, University of the West of England, Frenchay Campus, Bristol, BS16 1QY, United Kingdom, 2 School of Biological Sciences, University of Reading, Reading, RG6 6UR, United Kingdom ☯ These authors contributed equally to this work.
    [Show full text]
  • Type VI Secretion Apparatus and Phage Tail-Associated Protein Complexes Share a Common Evolutionary Origin
    Type VI secretion apparatus and phage tail-associated protein complexes share a common evolutionary origin Petr G. Leimana,1,2, Marek Baslerb,1, Udupi A. Ramagopalc, Jeffrey B. Bonannoc, J. Michael Sauderd, Stefan Pukatzkie, Stephen K. Burleyd, Steven C. Almoc, and John J. Mekalanosb,3 aDepartment of Biological Sciences, Purdue University, West Lafayette, IN 47906; bDepartment of Microbiology and Molecular Genetics, Harvard Medical School, 200 Longwood Avenue, Boston, MA 02115; cDepartment of Biochemistry, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461; dSGX Pharmaceuticals, Inc. 10505 Roselle Street, San Diego, CA 92121; and eDepartment of Medical Microbiology and Immunology, University of Alberta, 1-63 Medical Sciences Building, Edmonton, Alberta T6G2H7 Contributed by John J. Mekalanos, December 30, 2008 (sent for review October 24, 2008) Protein secretion is a common property of pathogenic microbes. the (gp5)3-(gp27)3 complex used by the phage to penetrate Gram-negative bacterial pathogens use at least 6 distinct extracel- through the bacterial cell envelope during infection (14). The lular protein secretion systems to export proteins through their distinctive needle-like shape of the complex is due to the multilayered cell envelope and in some cases into host cells. Among C-terminal domain of gp5, which forms a long triple-stranded the most widespread is the newly recognized Type VI secretion ␤-helix. Based on a reasonable sequence similarity between the system (T6SS) which is composed of 15–20 proteins whose bio- V. cholerae VgrG-1 and bacteriophage Mu gp44 protein, which chemical functions are not well understood. Using crystallographic, is very similar structurally to T4 gp27, and on a high probability biochemical, and bioinformatic analyses, we identified 3 T6SS that VgrG-1 contains a ␤-helix, it was proposed that VgrG-1 components, which are homologous to bacteriophage tail pro- is homologous to the T4 gp5-gp27 complex (13).
    [Show full text]
  • The Phage-Shock-Protein (PSP) Envelope Stress Response: Discovery of Novel Partners and Evolutionary History
    bioRxiv preprint doi: https://doi.org/10.1101/2020.09.24.301986; this version posted March 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. The Phage-shock-protein (PSP) Envelope Stress Response: Discovery of Novel Partners and Evolutionary History Janani Ravi1,2*, Vivek Anantharaman3, Samuel Zorn Chen1, Pratik Datta2, L Aravind3*, Maria Laura Gennaro2*. 1Pathobiology and Diagnostic Investigation, Michigan State University, East Lansing, MI, USA; 2Public Health Research Institute, Rutgers University, Newark, NJ, USA; 3National Center for Biotechnology Information, National Institutes of Health, Bethesda, MD, USA. *Corresponding authors. [email protected]; [email protected]; [email protected] Running title: Psp evolution across the tree of life Abstract The phage shock protein (Psp) stress response system stabilizes the bacterial cell membrane and protects bacteria from envelope stress. Our work showed that diferent bacterial clades possess distinct PSP systems expressing similar stress response functions. Their identity, architecture, and phyletic spread remain to be fully characterized. We combined comparative genomics and protein sequence-structure-function analyses to systematically identify sequence homologs, phyletic patterns, domain architectures, gene neighborhoods, and trace the evolution of Psp cognates across the tree of life. This integrative approach traced the universal nature and origin of PspA/Snf7 (Psp/ESCRT systems) to the Last Universal Common Ancestor. We also identifed novel partners of the PSP system: one is the Toastrack domain, which likely facilitates assembling diverse sub-membrane stress-sensing and signaling complexes; another is HAAS–PadR-like-wHTH, which functions as an alternative to two-component-systems interfacing with PSP systems.
    [Show full text]
  • Substrate Adaptability of Periplasmic Substrate-Binding Proteins As a Function of Their Evolutionary Histories" (2014)
    University of Connecticut OpenCommons@UConn Doctoral Dissertations University of Connecticut Graduate School 8-27-2014 Substrate Adaptability of Periplasmic Substrate- binding Proteins as a Function of their Evolutionary Histories Nathalie Boucher University of Connecticut - Storrs, [email protected] Follow this and additional works at: https://opencommons.uconn.edu/dissertations Recommended Citation Boucher, Nathalie, "Substrate Adaptability of Periplasmic Substrate-binding Proteins as a Function of their Evolutionary Histories" (2014). Doctoral Dissertations. 533. https://opencommons.uconn.edu/dissertations/533 β-gal Substrate Adaptability of Periplasmic Substrate-binding Proteins as a Function of their Evolutionary Histories Nathalie Boucher, Ph.D. University of Connecticut, 2014 The ATP-binding cassette (ABC) transporters play an important role in the uptake of nutrients in bacterial and archaeal cells. The bacterium Thermotoga maritima has an unusually high number of ABC transporters. However, only a few of them have been characterized due to the variety of substrates they can transport and the time consuming efforts needed to thoroughly characterize each ABC transporter. In this work, a technique has been optimized to determine the sugars that interact with the substrate- binding proteins (SBP) of the ABC transporter complexes in Thermotoga maritima. Using this high throughput assay, the ligands of trehalose-binding protein (TreE) and xylose-binding protein (XylE2) in Thermotoga maritima as well as representatives of the mannoside-binding proteins (Man) in the Thermotoga species were identified. The phylogeny of the mannose-binding proteins is interesting because of the presence of two paralogous proteins in this family (ManD and ManE). Ten representatives of the mannoside-binding proteins (ManD and ManE) encoded in the Thermotogales were characterized.
    [Show full text]
  • Downloaded From
    Force generation in dividing E. coli cells: A handles-on approach using optical tweezers Verhoeven, G.S. Citation Verhoeven, G. S. (2008, December 2). Force generation in dividing E. coli cells: A handles- on approach using optical tweezers. Retrieved from https://hdl.handle.net/1887/13301 Version: Corrected Publisher’s Version Licence agreement concerning inclusion of doctoral thesis in the License: Institutional Repository of the University of Leiden Downloaded from: https://hdl.handle.net/1887/13301 Note: To cite this publication please use the final published version (if applicable). V Chapter 5: Outer membrane assembly of N- and C-terminal fusions to the OmpA transmembrane domain Abstract With the aim of sub-localizing the OmpA transmembrane (TM) domain to the site of constriction (mid-cell) in dividing Escherichia coli, we studied the outer membrane (OM) assembly of N- or C-terminal fusions to this domain. Various protein domains were genetically fused to the OmpA TM domain. A rare-sugar (D-allose) binding protein (ALBP), and the fluorescent protein mCherry were used that were expected not to interact specifically with other proteins (non-interacting domains). As mid-cell localization domains, the Pal lipoprotein and the septal targeting domain from AmiC (TamiC), a Tat substrate, were used. As the OmpA TM domain had either a FLAG epitope or a streptavidin binding peptide inserted in a surface-exposed loop, OM assembly could be evaluated using cell surface immunolabeling. Furthermore, the in vivo folding state of the OmpA TM domain was determined by a gel-shift assay. In addition, for mCherry fusions, fluorescence microscopy was used to study sub-cellular localization.
    [Show full text]
  • Physiological Models of Geobacter Sulfurreducens and Desulfobacter Postgatei to Understand Uranium Remediation in Subsurface Systems
    University of Massachusetts Amherst ScholarWorks@UMass Amherst Doctoral Dissertations Dissertations and Theses November 2014 PHYSIOLOGICAL MODELS OF GEOBACTER SULFURREDUCENS AND DESULFOBACTER POSTGATEI TO UNDERSTAND URANIUM REMEDIATION IN SUBSURFACE SYSTEMS Roberto Orellana University of Massachusetts Amherst Follow this and additional works at: https://scholarworks.umass.edu/dissertations_2 Part of the Environmental Microbiology and Microbial Ecology Commons, and the Microbial Physiology Commons Recommended Citation Orellana, Roberto, "PHYSIOLOGICAL MODELS OF GEOBACTER SULFURREDUCENS AND DESULFOBACTER POSTGATEI TO UNDERSTAND URANIUM REMEDIATION IN SUBSURFACE SYSTEMS" (2014). Doctoral Dissertations. 278. https://doi.org/10.7275/5822237.0 https://scholarworks.umass.edu/dissertations_2/278 This Open Access Dissertation is brought to you for free and open access by the Dissertations and Theses at ScholarWorks@UMass Amherst. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of ScholarWorks@UMass Amherst. For more information, please contact [email protected]. PHYSIOLOGICAL MODELS OF GEOBACTER SULFURREDUCENS AND DESULFOBACTER POSTGATEI TO UNDERSTAND URANIUM REMEDIATION IN SUBSURFACE SYSTEMS A Dissertation Presented by ROBERTO ORELLANA ROMAN Submitted to the Graduate School of the University of Massachusetts Amherst in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY September 2014 Microbiology Department © Copyright by Roberto Orellana Roman 2014 All Rights
    [Show full text]
  • Genome-Wide Subcellular Localization of Putative Outer Membrane and Extracellular Proteins in Leptospira Interrogans Serovar Lai Genome Using Bioinformatics Approaches
    BMC Genomics BioMed Central Research article Open Access Genome-wide subcellular localization of putative outer membrane and extracellular proteins in Leptospira interrogans serovar Lai genome using bioinformatics approaches Wasna Viratyosin*1, Supawadee Ingsriswang1, Eakasit Pacharawongsakda1 and Prasit Palittapongarnpim1,2 Address: 1BIOTEC Central Research Unit, National Center for Genetic Engineering and Biotechnology, Pathumthani, 12120, Thailand and 2Department of Microbiology, Faculty of Science, Mahidol University, Bangkok, 10400, Thailand Email: Wasna Viratyosin* - [email protected]; Supawadee Ingsriswang - [email protected]; Eakasit Pacharawongsakda - [email protected]; Prasit Palittapongarnpim - [email protected] * Corresponding author Published: 21 April 2008 Received: 4 December 2007 Accepted: 21 April 2008 BMC Genomics 2008, 9:181 doi:10.1186/1471-2164-9-181 This article is available from: http://www.biomedcentral.com/1471-2164/9/181 © 2008 Viratyosin et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: In bacterial pathogens, both cell surface-exposed outer membrane proteins and proteins secreted into the extracellular environment play crucial roles in host-pathogen interaction and pathogenesis. Considerable efforts have been made to identify outer membrane (OM) and extracellular (EX) proteins produced by Leptospira interrogans, which may be used as novel targets for the development of infection markers and leptospirosis vaccines. Result: In this study we used a novel computational framework based on combined prediction methods with deduction concept to identify putative OM and EX proteins encoded by the Leptospira interrogans genome.
    [Show full text]
  • Pseudomonas Syringae Pv
    RESEARCH ARTICLE The Identification of Genes Important in Pseudomonas syringae pv. phaseolicola Plant Colonisation Using In Vitro Screening of Transposon Libraries Bharani Manoharan1☯, Helen C. Neale1☯, John T. Hancock1, Robert W. Jackson2, Dawn L. Arnold1* 1 Centre for Research in Bioscience, Faculty of Health and Applied Sciences, University of the West of England, Frenchay Campus, Bristol, BS16 1QY, United Kingdom, 2 School of Biological Sciences, University of Reading, Reading, RG6 6UR, United Kingdom ☯ These authors contributed equally to this work. * [email protected] OPEN ACCESS Abstract Citation: Manoharan B, Neale HC, Hancock JT, The bacterial plant pathogen Pseudomonas syringae pv. phaseolicola (Pph) colonises the Jackson RW, Arnold DL (2015) The Identification of Genes Important in Pseudomonas syringae pv. surface of common bean plants before moving into the interior of plant tissue, via wounds phaseolicola Plant Colonisation Using In Vitro and stomata. In the intercellular spaces the pathogen proliferates in the apoplastic fluid and Screening of Transposon Libraries. PLoS ONE 10(9): forms microcolonies (biofilms) around plant cells. If the pathogen can suppress the plant’s e0137355. doi:10.1371/journal.pone.0137355 natural resistance response, it will cause halo blight disease. The process of resistance Editor: Hua Lu, UMBC, UNITED STATES suppression is fairly well understood, but the mechanisms used by the pathogen in coloni- Received: May 12, 2015 sation are less clear. We hypothesised that we could apply in vitro genetic screens to look Accepted: August 15, 2015 for changes in motility, colony formation, and adhesion, which are proxies for infection, microcolony formation and cell adhesion. We made transposon (Tn) mutant libraries of Pph Published: September 1, 2015 strains 1448A and 1302A and found 106/1920 mutants exhibited alterations in colony mor- Copyright: © 2015 Manoharan et al.
    [Show full text]