Ompa of a Septicemic Escherichia Coli O78 – Secretion and Convergent Evolution Uri Gophna, Diana Ideses, Ran Rosen, Adam Grundland, Eliora Z

ARTICLE IN PRESS

International Journal of Medical Microbiology 294 (2004) 373–381 www.elsevier.de/ijmm

OmpA of a septicemic Escherichia coli O78 – secretion and convergent evolution Uri Gophna, Diana Ideses, Ran Rosen, Adam Grundland, Eliora Z. RonÃ

Department of Molecular Microbiology and Biotechnology, The George S. Wise Faculty of Life Sciences, Tel Aviv University, Tel Aviv, Israel Received 7 June 2004; received in revised form 24 August 2004; accepted 26 August 2004

Abstract

OmpA is an important constituent of the outer membrane of Gram-negative bacteria. OmpA is involved in a variety of host–bacteria interactions, including crossing of the blood–brain barrier by E. coli strains causing newborn meningitis, and elicits a signiﬁcant response by the immune system of the host. The bactericidal effect of neutrophil elastase (NE) is also attributed to degradation of the bacterial OmpA. Here we examined the OmpA of septicemic E. coli O78 strains and show that two surface-exposed loops are conserved among invasive strains of E. coli and other pathogenic Enterobacteriaceae. In addition, there is evidence for convergent evolution, implying the existence of selective pressure. Our results also indicate that large quantities of OmpA are secreted into the medium during all phases of growth, where it is present both in secreted vesicles and as a soluble secreted protein. We assume that secreted OmpA can play a role in protection of bacteria from NE by competitive inhibition. Support for this assumption was obtained from experiments indicating that addition of exogenous, puriﬁed OmpA reduces killing of bacteria by NE. r 2004 Elsevier GmbH. All rights reserved.

Keywords: OmpA; Septicemic E. coli; Molecular evolution; Protein secretion; Outer membrane proteins

Introduction periplasm and contains a peptidoglycan-association motif (Koebnik, 1995; Singh et al., 2003). OmpA – outer membrane protein A – is a major OmpA is a prime target of the host immune system: constituent of outer membranes of Gram-negative its binding activates macrophages (Soulas et al., 2000) bacteria, and is required for the structural integrity of and induces dendritic cell maturation (Jeannin et al., the cell surface. The best studied ompA gene variant, 2000). The degradation of OmpA by neutrophil elastase À that of E. coli K-12, encodes a 325-amino-acid (NE) promotes killing of E. coli, and ompA mutants polypeptide (Chen et al., 1980) targeted to the mem- are immune to the effect of NE (Belaaouaj et al., 2000). brane by a 21-amino-acid signal peptide. The N- OmpA has been implicated in the pathogenicity of terminal domain of the mature protein crosses the encapsulated E. coli strains (K1) causing newborn membrane eight times, creating four surface-exposed meningitis (NBM), a disease in which bacteremia is loops. The C-terminal region of OmpA is located in the followed by bacterial crossing of the blood–brain barrier. The E. coli K1 OmpA was shown to be involved ÃCorresponding author. Tel.: +972 (3) 640 9379; fax: in invasion of brain microvascular endothelial cells (an +972 (3) 641 4138. in vitro model for NBM) by a receptor–ligand mecha- E-mail address: [email protected] (E.Z. Ron). nism (Prasadarao et al., 1996b), mediated by the ﬁrst

1438-4221/$ - see front matter r 2004 Elsevier GmbH. All rights reserved. doi:10.1016/j.ijmm.2004.08.004 ARTICLE IN PRESS 374 U. Gophna et al. / International Journal of Medical Microbiology 294 (2004) 373–381 and second loops. The receptor for OmpA is found in dysenteriae, E. coli O157:H7 EDL933, E. coli K1, brain microvascular endothelial cells but not in vascular and E. coli K-12 were from the NCBI database (acc- endothelial cells (Prasadarao et al., 1996a). The OmpA essions NC_004431, NC_004337, V01344, NC_002655, proteins of E. coli K1 and K-12 differ only in three AF234269 and U00096, respectively). Salmonella ente- amino acids (as inferred from the nucleotide sequence), rica serovar Typhimurium (accession NC_003197) was and K-12 OmpA was found to possess a similar function used for phylogenetic analysis. in invasion of brain microvascular endothelial cells (Kim, 2001). Preparation of secreted proteins for 2D gel analysis Recent reports have shown that OmpA is released by E. coli when incubated in human serum, and is also Two hundred millilitre of bacterial culture were secreted by E. coli serotype O18 and circulates in the harvested by a 10 min centrifugation at 8000g at 4 1C. bloodstream of a septic rat in a sepsis model (Hellman et The supernatant was centrifuged again for 2 h at 10,000g al., 2000; Hellman and Warren, 2001). OmpA was also to remove traces of lysed cells. TCA was added to the shown to be secreted by other Gram-negative bacterial subsequent supernatant to a final concentration of 10% species such as Acinetobacter (Toren et al., 2002), where for an overnight incubation at 4 1C. Pelleted proteins it was also shown to play a role in virulence (Ofori- were obtained by a 2-h centrifugation at 10,000g at 4 1C. Darko et al., 2000). Moreover, analysis of secreted The pellet was washed four times with 95% ethanol membrane vesicles of E. coli K-12 showed that OmpA using 10 min centrifugation steps at 10,000g. The pellet could be detected among other vesicle-secreted proteins was then transferred to a microcentrifuge tube and (Wai et al., 2003). washed again with ethanol for five times and solubilized Avian colisepticemia is a systemic disease of poultry in gel rehydration solution (8 M urea; 2 M thiourea; involving bacterial invasion into the bloodstream and 2 mg/ml dithiothreitol; 5.2 ml/ml Pharmalites (pH 3-10) organs. This disease is of economical importance, and 10 mg/ml CHAPS (Sigma Chemicals Co.)). especially as it often follows vaccination with live attenuated vaccine viruses. The most important avian septicemic strains are of serotype O78, a serotype also Isoelectric focusing and polyacrylamide gel associated with NBM in humans. In this report we show electrophoresis that an avian septicemic E. coli strain releases OmpA into the medium at both logarithmic and stationary Twenty microgram of secreted protein solubilized in growth phases, even when grown in rich medium. gel rehydration solution were loaded on immobilized pH Secretion of OmpA by septicemic strains is probably gradient (IPG) strips (18 cm, pI 4–7) for isoelectric not dependent on its primary structure because sequence focusing, by incubation of the gels in the protein- variations are found mostly in surface-exposed loops of containing rehydration solution for 24 h. The isoelectric the protein and not in regions important for its focusing was carried out in six steps: (1) 0–100 V anchoring. Our study also indicates that the septicemic gradient for 100 Vh; (2) a constant potential of 100 V O78 serotype secretes OmpA not only by means of for 500 Vh; (3) 100–500 V gradient for 2400 Vh; (4) a secreted membrane vesicles, as was shown for E. coli K- constant potential of 500 V for 2500 Vh; (5) 500–3500 V 12 (Wai et al., 2003), but also as a soluble secreted gradient for 10,000 Vh, and (6) a constant potential of protein. Phylogenetic reconstruction shows conservation 3500 V for 35,000 Vh (Rosen et al., 2001). The second of the outer loopmutations among otherwise distant dimension was electrophoresed according to Bernhardt invasive strains. Addition of exogenous OmpA pro- et al. (1999). The gels were stained in a sensitive silver tected bacteria from NE-mediated killing in vitro. We stain for visualization or by Coomassie brilliant blue for therefore suggest that secretion of OmpA may con- subsequent identification (Laemmli, 1970). tribute to bacterial resistance to the immune system of warm-blooded hosts. Protein identification

Spots were cut from Coomassie-blue stained gels and were washed for 30 min in 200 ml of 200 mM NH4NCO3, Materials and methods 50% CH3CN at 37 1C. The washed spots were then dried, rehydrated with digestion solution (0.02 mg/ml Bacterial strains used trypsin (Promega), 40 mM NH4NCO3 (pH 8.1), 10% CH3CN) and incubated for 16 h at 37 1C. The extracted E. coli strain 789 is a septicemic strain of serotype O78 peptides were loaded on a POROS 50 R2 (PerSeptive (Babai et al., 1997; Ron et al., 1991). The K-12 strain Biosystems) micro-column for desalting. The peptides used was MG1655 (Blattner et al., 1997). Sequences of were eluted directly into a Q-STAR (Applied Biosys- E. coli UTI strain CFT073, Shigella ﬂexneri, Shigella tems) needle and were measured and identiﬁed by ARTICLE IN PRESS U. Gophna et al. / International Journal of Medical Microbiology 294 (2004) 373–381 375

MS/MS using the Analyst QS software (Applied an additional 10 min at 72 1C. A PTC100 programmable Biosystems). thermal cycler (MJ research Inc.) was used for all reactions. Automated DNA sequencing was performed Preparation of protein samples for OmpA on double-stranded DNA templates by the dideoxynu- cleotide chain-termination method (Sanger et al., 1977) quantification with an Applied Biosystems model 3100 sequencer (Foster City, CA, USA), as previously described (Boyd A single colony was grown in LB medium at 37 1C for and Hartl, 1998). The sequencing primers used were 8 h, diluted into 240 ml of LB and grown for 15 h at OmpAf2 (CGGCGCTCGGACAGACCCT) and Om- 37 1C, 150 rpm. Total cell proteins were obtained by pAr2 (CGCAGGCCGCTCCGAAAGATAAC). centrifuging 400 ml of the culture, discarding the supernatant and resuspending the pellet in 50 ml ddH2O. Secreted proteins were determined in culture super- Neutrophil elastase sensitivity assays natants, obtained after 10 min centrifugation at 10,000g at 4 1C, and filtration through a 0.22-mm filter. The NE sensitivity assays were performed as described supernatant was divided in two parts: one was utilized previously (Belaaouaj et al., 2000) with the following for preparing total secreted proteins, and the other was modifications: human NE was supplied by Calbiochem, used for preparing secreted vesicles. For preparation of concentration used was 25 mg/ml. Bacteria were incu- total secreted proteins, perchloric acid (PCA) was added bated with NE for upto 5 h at 37 1C, and their numbers to the filtered supernatant to a final concentration of were quantified by viable count. For the OmpA 10%, and the proteins were precipitated for 1 h on ice. inhibition assay, 50 mg/ml OmpA purified from E. coli Pelleted proteins were obtained by centrifugation at K-12 HB101 (kindly provided by Dr. Juanita L. 10,000g for 1 h at 4 1C. The pellet was washed three Merchant) was used. times with 95% ethanol by 10 min centrifugation at 10,000g. Vesicles were prepared by centrifuging the filtered supernatant at 120,000g for 3 h at 4 1C(Kadur- Results ugamuwa and Beveridge, 1995) and washing with 50 mM Tris–HCl buffer (pH 7.4). The vesicle-free OmpA of E. coli serotype O78 is secreted to the supernatant was treated as above, for obtaining the medium soluble secreted proteins. Protein concentration was measured in each sample using the Bradford method, Proteome analysis by two-dimensional gel (2D gel) and equal quantities were loaded on 12% SDS-PAGE electrophoresis indicated that E. coli strain 789 releases and visualized by Coomassie brilliant blue staining outer membrane proteins into the medium, in both (Laemmli, 1970) or transferred to a nitrocellulose logarithmic (Fig. 1A) and stationary (Fig. 1B) cultures membrane (Schleicher and Schuell) for blotting with grown on rich medium without serum. Using a QSTAR polyclonal anti-OmpA antibody kindly provided by Dr. tandem hybrid mass spectrometer, we identified by A.S. Khan. Western blot visualization was performed partial sequencing and by sequence tags three outer using the EZ-ECL chemiluminescence detection kit for membrane proteins among the secreted proteins. Outer horse radish peroxidase (Biological Industries, Israel). membrane proteins identified were OmpA, OmpC and OmpW, which were of the most abundant in the DNA amplification and sequencing secreted proteome (pI 4–7) of E. coli 789. Furthermore, the levels of OmpA (and to a lesser degree OmpC) were Single colonies were picked into 1 ml of deionized high in the supernatant of both logarithmic and water. Samples were incubated at 98 1C for 10 min stationary cultures, whereas OmpW level observed in and the suspension was used as a template. Amplifica- the logarithmic culture was extremely low. OmpA tions were carried out in a total volume of 50 ml constituted about 3% of the secreted proteome of using 5 ml of bacterial suspension, each deoxynuc- septicemic strain 789, as quantified by the Z3 program leoside triphosphate at a concentration of (Compugen) from Coomassie blue-stained 2D gels. In 0.25 mM, 10 pmol of each of the primers OmpAf comparison, the levels of the periplasmic D-ribose (TCTGGCAACGTCTGGCTGGTCTT) and OmpAr binding protein (RBSB) and the cytoplasmic Pnp (CGCATCCTCTCACGCCACGA), 5 ml of 10-fold (polyribonucleotide nucleotidyl transferase) were 0.7% PCR buffer (Takara) and 2.5 U of Taq DNA polymer- and 0.4%, respectively. It should be noted that the total ase (Takara). Reaction conditions used were: 10 min amount of secreted proteins in E. coli K-12 is denaturation at 94 1C, then 30 cycles of 1 min denatura- considerably lower, and their level does not allow tion at 94 1C, 1 min annealing at 56 1C and 1 min detection in 2D gels under the conditions specified extension at 72 1C, and after completion of the cycles, in Fig. 1. ARTICLE IN PRESS 376 U. Gophna et al. / International Journal of Medical Microbiology 294 (2004) 373–381

Fig. 1. Partial proteomes of secreted E. coli 789 proteins. Secreted proteins from exponentially growing (A) and stationary phase (B) cultures were separated on 2D gels as described in Materials and methods. Proteins were identiﬁed by ESI-QqTOF MS/MS. Identiﬁed outer membrane proteins are marked.

Soluble Total secreted secreted Secreted Total cell proteins proteins vesicles proteins

2 2 2 1 9 1 1 12 - 9 - 8 - 8 K 7 K 7 K 789 K- 789

34 KDa

Fig. 2. Western blot of proteins of strains 789 and MG1655, probed with anti-OmpA antibody. Stationary cultures of strain 789 (septicemic) and of strain MG1655 were used for the preparation of total cell proteins, total secreted proteins, secreted membrane vesicles and soluble secreted proteins, as described in Materials and methods. Three-mg aliquots of total cell proteins and ﬁve mgof each preparation of the secreted proteins were separated by 12% SDS-PAGE, transferred to a nitrocellulose membrane and blotted with polyclonal anti-OmpA antibody.

Since OmpA has been shown to be secreted in vesicles demonstrated in Fig. 2. Yet, these results do not exclude (Wai et al., 2003), we determined its levels in vesicles and the possibility that secreted OmpA undergoes minor in the soluble fraction of the secreted proteins. The modiﬁcations, such as proteolytic removal of a few results shown in Fig. 2 indicate that the levels of OmpA amino acids. secreted by cultures of the septicemic strain 789 are considerably higher than in the K-12 culture, in all fractions (Fig. 2). Sequence of the ompA gene of E. coli 789 is highly similar to that of Shigella ﬂexneri

Determination of sequence coverage of secreted While all sequenced peptides of OmpC and OmpW OmpA obtained by mass-spectrometry were identical to E. coli K-12 proteins, one of the peptides derived from OmpA To determine whether OmpA is secreted in its entirety was identical to an S. flexneri OmpA peptide. In order or released from membranes following the action of a to further study the ompA789 gene, it was amplified by specific protease, we examined the sequence coverage PCR using primers from its K-12 MG1655 ortholog, obtained from mass spectrometry analysis with regard and sequenced from both DNA strands. The DNA to the putative OmpA sequence. As shown in Fig. 3, sequence from promoter to stop codon of ompA789 was more than 40% sequence coverage of OmpA (excluding then used for BLAST search at the University of its signal peptide) was obtained, including peptides Wisconsin blast page (http://magpie.genome.wisc.edu) ranging from residue 104 to residue 332. Thus, it against the incomplete S. flexneri 2a genome, using the appears that OmpA is released into the medium in BLASTN algorithm (Altschul et al., 1997). Results intact form and does not undergo further proteolysis on showed a 1207/1228 (98%) identity, one gapof six the outer membrane. Further evidence for this assump- nucleotides resulting in a two-amino-acid gapand three tion is that the apparent molecular weight of OmpA789 is amino acids substitutions (all of them designated not influenced by the fraction from which it is prepared ‘‘similarities’’ by the algorithm). Surprisingly, homology (total cell, vesicles or soluble secreted fraction), as to OmpA of E. coli K-12 and O157:H7 (which share the ARTICLE IN PRESS U. Gophna et al. / International Journal of Medical Microbiology 294 (2004) 373–381 377 same amino acid sequence (accessions U00096 and previous homology searches, we aligned sequences from NC_002655, respectively)) was weaker – 97.1% identity the bacterial species and strains described above, as well at the DNA level. The change in protein is significant, as as from Shigella dysenteriae (accession V01344) and the 12 amino acids are substituted and there is a gapof four putative sequence from the urinary tract infection (UTI) amino acids. Interestingly, nearly all substitutions were strain CFT073 (obtained by conceptual translation of located in the surface-exposed external loops (Fig. 4). sequence from the Wisconsin BLAST page, see above). It is clear that most of the variability between the Multiple alignment analysis of OmpA sequences different OmpA sequences lies in the external loops, in which most of the substitutions are located (Fig. 4). The structure of the transmembrane OmpA domain Comparing OmpA789 to OmpAKÀ12 we observed one has been studied extensively by X-ray diffraction substitution in loop1, three in loop2, and two analysis (Chen et al., 1980) and NMR (Arora et al., substitutions and an insertion of four amino acids in 2001). Therefore, it is possible to predict the locations of loopthree in the strain 789 ortholog. One additional the amino acids of various Escherichia/Shigella ortho- substitution was located in the loop3-membrane inter- logs and determine whether they are located on the face. In contrast, only a single substitution was found in external loops or within the membrane. In view of our a non-looplocation. Focusing on loops1 to 3, it is clear that S. flexneri and E. coli strains 789 and CFT073 constitute one group, whereas E. coli strains K-12 and O157:H7 constitute another group. S. dysenteriae loop2 is identical to that of K-12/O157:H7, but its loops 1 and 3 are dissimilar to those of the other orthologs. Interest- ingly, the C-terminal domain is highly conserved. This finding rules out the possibility that OmpA secretion may be the result of a C-terminal mutation leading to a weaker binding of OmpA to the peptidoglycan.

Fig. 3. Sequence coverage of secreted OmpA of E. coli 789. The 2D gel-separated protein was in-gel digested with trypsin. The peptides were extracted and analyzed by MS and MS/MS. Phylogenetic analysis of OmpA sequences The masses detected in the MS spectra correspond to peptides that cover 133 amino acids (peptide mass ﬁngerprinting). Four Host-exposed residues of bacterial surface proteins peptides were sequenced by MS/MS analysis covering 63 have been shown to undergo rapid evolution (Boyd and amino acids. Sequences covered by spectrometric analysis are Hartl, 1998), probably since mutations in surface- shaded. exposed residues do not affect the integrity of the

Fig. 4. Multiple alignment of OmpA sequences from E. coli and Shigella strains. Surface loops are marked with a gray background. Substitutions in loopresidues are marked in italics, and substitutions in non-loopresidues are marked in bold. Hyphensdenote gaps. ARTICLE IN PRESS 378 U. Gophna et al. / International Journal of Medical Microbiology 294 (2004) 373–381 membrane and are, therefore, under weak selective et al., 1991), the distance of the Salmonella ortholog is pressure. However, in many cases these changes affect hardly surprising, since its codon usage is notably host–bacterium interactions by determining tissue tro- different from that of Escherichia and Shigella.How- pism or helping evasion of the immune system through ever, when we examined the results at the protein antigenic variability. To obtain support for one of these sequence level (Fig. 5B), we observed that S. enterica possibilities, phylogenetic analysis was performed using clusters with S. flexneri (and probably with E. coli protein/DNA sequences. Neighbor-joining trees of the strains 789 and CFT073 as well, since their bootstrap protein and DNA sequences from the strains described support value is not significant). This clustering reflects above were constructed, designating OmpA from the homology of the surface-exposed domain (loops 2 Salmonella enterica serovar Typhimurium as an out- and 3) of the Salmonella OmpA with that of S. flexneri/ groupfor rooting the tree. The results indicate that, E. coli. Moreover, sequences of several invasive isolates predictably, the DNA sequences (Fig. 5A) cluster into of E. coli from our collection also displayed the same the two groups observed previously (Fig. 4) with very loopresidues presentin strains 789/CFT073. Thus, we high bootstrap support values, and the sequence from see a pattern of convergent evolution in which a certain Salmonella appears to be distant from the others, loopstructure is positively selected in otherwise justifying its choice as the outgroup. Since ompA genes unrelated species or strains. Since the extraintestinal are known to exhibit very high codon bias (Lawrence UTI and avian septicemic strains differ greatly in their

Fig. 5. Neighbor-joining phylogenetic tree of OmpA sequences of E. coli and related species. DNA (A) and protein (B) dendrograms were constructed using ClustalX, excluding positions with gaps and correcting for multiple substitutions. Numbers denote bootstrap support values (1000 bootstrap trials). Scale bar represents number of substitutions per site. ARTICLE IN PRESS U. Gophna et al. / International Journal of Medical Microbiology 294 (2004) 373–381 379

AB 6e+7 3e+8

O78 + NE -OmpA 5e+7 3e+8 O78 -NE + OmpA K-12 + NE 4e+7 K-12 --NE 2e+8 CFU/ml

3e+7 2e+8 CFU/ml 2e+7 1e+8

1e+7 5e+7

0 0 02.55 0 5 Incubation Time (Hours)

Fig. 6. Survival of E. coli incubated with NE. Bacteria were incubated upto five hours in the presenceor absence of NE (A) and with NE with or without addition of exogenous purified OmpA (B), and quantified by viable count as described in Materials and methods. Each column is the average of two independent determinations. Error bars represent standard error values. target tissues from S. flexneri, an intestinal pathogen, and replicate. Since OmpA is a major outer membrane the data do not support a link between OmpA constituent and a target of the host immune response, polymorphism and tissue tropism. we assumed that OmpA proteins of septicemic strains could differ from those of non-virulent strains. In this Effect of OmpA on the sensitivity of E. coli 789 to work we have observed two major differences between OmpA and OmpA , namely sequence variations neutrophil elastase 789 KÀ12 and a higher level of secretion to the medium. In what way could these variations contribute to the virulence of It was previously demonstrated that the killing of E. coli strain 789? Gram-negative bacteria by NE is due to the degradation Our study shows convergent evolution of external of OmpA (Belaaouaj et al., 2000). We assumed that an loops 2 and 3 of OmpA in several invasive species and invasive strain will be more resistant to enzymes within strains. Interaction with host tissues could be one neutrophils, as part of their array of virulence factors explanation for such positive selection of a certain loop contributing to its survival in the blood. Since the sequence. Studies on E. coli K1 invasion have estab- OmpA sequence of the invasive strain 789 differs from lished that the glycoprotein receptor for OmpA is found that of K-12 and is similar to other pathogenic strains in brain microvascular endothelial cells but not in (see above), we compared the sensitivities of strain 789 vascular endothelial cells (Prasadarao et al., 1996b). and K-12 MG1655 to NE killing. Such resistance could Loops 1 and 2 of OmpA of E. coli K1 were shown to be be mediated by a protein variant more resistant to associated with invasion of brain microvascular en- enzymatic cleavage. No significant difference in resis- dothelial cells using synthetic peptides derived from tance to the bactericidal effect of NE was observed these loops, which inhibited both invasion and actin between the two strains (Fig. 6A). An alternative condensation in host cells (Prasadarao et al., 1996a, possibility would be that secretion of excess OmpA 1999). A pentapeptide used in those studies corresponds could slow down enzymatic proteolysis of membrane to loop2 of E. coli K1 (Gly–Ser–Val–Glu–Asn) and OmpA. Indeed, addition of exogenous, purified OmpA contains the three amino acids, which differ between the did provide some protection to the bacteria from NE, strains, Ser–Val–Glu. These three amino acids are resulting in an increase of more than twofold in their substituted by Asp–Asn–Ile in E. coli strain 789, S. survival (Fig. 6B). Thus, although it appears that flexneri and E. coli CFT073. Therefore, one may OmpA is not more resistant to proteolytic digestion 789 speculate that the different loop 2 may permit binding by NE, the secretion of large quantities of this protein to epithelial cell receptors from other tissues and may contribute to the resistance of the pathogen in the broaden the scope of epithelial cell entry, as an accessory hostile microenvironment of neutrophils or tissues. to the specific invasion arsenals of these species. An alternative explanation for the convergent evolution of loops 2 and 3 would be selection for less Discussion immunogenic surface-exposed regions. The EMBOSS program Antigenic identified an antigenic site for Septicemic E. coli strains are capable of invading host loop2 of OmpA KÀ12, but not for that of OmpA789 tissues and entering the bloodstream, where they survive (http://www.uk.embnet.org/Software/EMBOSS/Apps/ ARTICLE IN PRESS 380 U. Gophna et al. / International Journal of Medical Microbiology 294 (2004) 373–381 antigenic.html). Other algorithms predicting antigenic the in vitro conditions used to study the effect of NE – properties, preferred peptide presentation to the im- i.e., phosphate buffer instead of rich media. However, mune system and proteolytic cleavage by immune when exogenous OmpA was added to the experimental system proteases did not indicate any significant system, significant increase in the resistance of bacteria immunogenic advantage of OmpA789. We therefore to NE was observed. The secretion of OmpA has been conclude that the difference in external loops is more demonstrated in other septicemic E. coli strains (sero- likely to affect contact with host epithelial cells rather type O18) (Hellman et al., 2000; Hellman and Warren, than with the immune system. 2001) and in other bacterial pathogens (Ofori-Darko et Strains of E. coli able to cause sepsis in mammals were al., 2000). Therefore, the finding that soluble OmpA shown to release OmpA into serum (Hellman et al., protects bacteria from NE is important in understanding 2000; Hellman and Warren, 2001). Here we demonstrate the role of OmpA secretion in the development of sepsis that the avian septicemic strain 789 also secretes high and in virulence. levels of OmpA into the medium, independently of the growth phase. The secreted OmpA is present as a part of secreted membrane vesicles as well as in the soluble Acknowledgements fraction. The soluble secreted OmpA fraction may be derived from degraded vesicles. This possibility would The authors wish to thank Nela Shechter for her help be a consequence of the fact that OmpA is an integral with 2D gels. Purified OmpA was a kind gift from outer membrane protein, the secretion of which would Juanita L. Merchant, and anti-OmpA antibodies were a be unlikely. However, OmpA has been shown to be kind gift of A.S. Khan. This work was supported by the secreted in Acinetobacter radioresistens, where it is a Manja and Morris Leigh Chair for Biophysics and major component of alasan, a high-molecular-weight Biotechnology, the EU project COLIRISK and the emulsifier (Toren et al., 2002). Israel Center for Emerging Diseases. Secretion of OmpA to the medium is energetically costly and therefore would have to contribute to bacterial fitness or virulence, otherwise negative selection would eliminate these strains. Due to its highly References immunogenic nature, OmpA secretion could perhaps Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., divert some of the antibodies, and consequently part of Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST the immune response, away from the bacteria them- and PSI-BLAST: a new generation of protein database selves. This effect may be insignificant in a healthy host, search programs. Nucleic Acids Res. 25, 3389–3402. but in an immuno-compromised host or in a chicken Arora, A., Abildgaard, F., Bushweller, J.H., Tamm, L.K., undergoing anti-viral vaccination, a sufficiently large 2001. Structure of outer membrane protein A transmem- dose of bacteria may secrete OmpA in high enough brane domain by NMR spectroscopy. Nat. Struct. Biol. 8, amounts to overcome the immune system and cause 334–338. sepsis. Babai, R., Blum-Oehler, G., Stern, B.E., Hacker, J., Ron, E.Z., Increasing bacterial resistance to the bactericidal 1997. Virulence patterns from septicemic Escherichia coli effect of NE could also be a mechanism by which O78 strains. FEMS Microbiol. Lett. 149, 99–105. OmpA secretion contributes to the development of Belaaouaj, A., Kim, K.S., Shapiro, S.D., 2000. Degradation of outer membrane protein A in Escherichia coli killing by sepsis. We have shown that the presence of exogenous neutrophil elastase. Science 289, 1185–1188. OmpA significantly impedes the bactericidal effect of Bernhardt, J., Buttner, K., Scharf, C., Hecker, M., 1999. Dual NE. This is compatible with recent results indicating channel imaging of two-dimensional electropherograms in that OmpA is not a very efficient substrate of NE Bacillus subtilis. Electrophoresis 20, 2225–2240. (Weinrauch et al., 2002). Thus, as the process of NE- Blattner, F.R., Plunkett III, G., Bloch, C.A., Perna, N.T., mediated killing is slow, it is reasonable to assume that Burland, V., Riley, M., Collado-Vides, J., Glasner, J.D., excess substrate slows it down even further, allowing Rode, C.K., Mayhew, G.F., Gregor, J., Davis, N.W., bacteria to survive longer within neutrophils and bring Kirkpatrick, H.A., Goeden, M.A., Rose, D.J., Mau, B., into play other potential virulence factors. We did not Shao, Y., 1997. The complete genome sequence of succeed in showing that strain 789, which secretes a high Escherichia coli K-12. Science 277, 1453–1474. level of OmpA, is more resistant to NE in vitro when Boyd, E.F., Hartl, D.L., 1998. Diversifying selection governs sequence polymorphism in the major adhesin proteins compared to a K-12 strain. Since the experiment FimA, PapA, and SfaA of Escherichia coli. J. Mol. Evol. involves several wash steps, it may be possible that 47, 258–267. these washes also removed surface-associated secreted Chen, R., Schmidmayr, W., Kramer, C., Chen-Schmeisser, U., OmpA molecules, or OmpA-containing vesicles, thereby Henning, U., 1980. Primary structure of major outer minimizing the protective effect. Furthermore, it is also membrane protein II (OmpA protein) of Escherichia coli possible that the secretion of OmpA was reduced under K-12. Proc. Natl. Acad. Sci. USA 77, 4592–4596. ARTICLE IN PRESS U. Gophna et al. / International Journal of Medical Microbiology 294 (2004) 373–381 381

Hellman, J., Loiselle, P.M., Tehan, M.M., Allaire, J.E., Boyle, Prasadarao, N.V., Wass, C.A., Weiser, J.N., Stins, M.F., L.A., Kurnick, J.T., Andrews, D.M., Kim, K.S., Warren, Huang, S.H., Kim, K.S., 1996b. Outer membrane protein A H.S., 2000. Outer membrane protein A, peptidoglycan- of Escherichia coli contributes to invasion of brain associated lipoprotein, and murein lipoprotein are released microvascular endothelial cells. Infect. Immun. 64, by Escherichia coli bacteria into serum. Infect. Immun. 68, 146–153. 2566–2572. Prasadarao, N.V., Wass, C.A., Stins, M.F., Shimada, H., Kim, Hellman, J., Warren, H.S., 2001. Outer membrane K.S., 1999. Outer membrane protein A-promoted actin protein A (OmpA), peptidoglycan-associated lipoprotein condensation of brain microvascular endothelial cells is (PAL), and murein lipoprotein (MLP) are released in required for Escherichia coli invasion. Infect. Immun. 67, experimental Gram-negative sepsis. J. Endotoxin Res. 7, 5775–5783. 69–72. Ron, E.Z., Yerushalmi, Z., Naveh, M.W., 1991. Adherence pili Jeannin, P., Renno, T., Goetsch, L., Miconnet, I., Aubry, J.P., of E. coli O78 determine host and tissue speciﬁcity. In: Ron, Delneste, Y., Herbault, N., Baussant, T., Magistrelli, G., E.Z., Rottem, S. (Eds.)., Microbial Surface Components Soulas, C., Romero, P., Cerottini, J.C., Bonnefoy, J.Y., and Toxins in Relation to Pathogenesis. Plenum Press, New 2000. OmpA targets dendritic cells, induces their matura- York, pp. 61–68. tion and delivers antigen into the MHC class I presentation Rosen, R., Buttner, K., Schmid, R., Hecker, M., Ron, E.Z., pathway. Nat. Immunol. 1, 502–509. 2001. Stress-induced proteins of Agrobacterium tumefa- Kadurugamuwa, J.L., Beveridge, T.J., 1995. Virulence factors ciens. FEMS Microbiol. Ecol. 35, 277–285. are released from Pseudomonas aeruginosa in association Sanger, F., Nicklen, S., Coulson, A.R., 1977. DNA sequencing with membrane vesicles during normal growth and with chain-terminating inhibitors. Proc. Natl. Acad. Sci. exposure to gentamicin: a novel mechanism of enzyme USA 74, 5463–5467. secretion. J. Bacteriol. 177, 3998–4008. Singh, S.P., Williams, Y.U., Miller, S., Nikaido, H., 2003. The Kim, K.S., 2001. Escherichia coli translocation at the blood–- C-terminal domain of Salmonella enterica serovar typhi- brain barrier. Infect. Immun. 69, 5217–5222. murium OmpA is an immunodominant antigen in mice but Koebnik, R., 1995. Proposal for a peptidoglycan-associating appears to be only partially exposed on the bacterial cell alpha-helical motif in the C-terminal regions of some surface. Infect. Immun. 71, 3937–3946. bacterial cell-surface proteins. Mol. Microbiol. 16, Soulas, C., Baussant, T., Aubry, J.P., Delneste, Y., Barillat, 1269–1270. N., Caron, G., Renno, T., Bonnefoy, J.Y., Jeannin, P., Laemmli, U.K., 1970. Cleavage of structural proteins during 2000. Outer membrane protein A (OmpA) binds to and the assembly of the head of bacteriophage T4. Nature 227, activates human macrophages. J. Immunol. 165, 680–685. 2335–2340. Lawrence, J.G., Ochman, H., Hartl, D.L., 1991. Molecular Toren, A., Orr, E., Paitan, Y., Ron, E.Z., Rosenberg, E., 2002. and evolutionary relationships among enteric bacteria. The active component of the bioemulsiﬁer alasan from J. Gen. Microbiol. 137, 1911–1921. Acinetobacter radioresistens KA53 is an OmpA-like protein. Ofori-Darko, E., Zavros, Y., Rieder, G., Tarle, S.A., Van J. Bacteriol. 184, 165–170. Antwerp, M., Merchant, J.L., 2000. An OmpA-like protein Wai, S.N., Lindmark, B., Soderblom, T., Takade, A., Wester- from Acinetobacter spp. stimulates gastrin and interleukin-8 mark, M., Oscarsson, J., Jass, J., Richter-Dahlfors, A., promoters. Infect. Immun. 68, 3657–3666. Mizunoe, Y., Uhlin, B.E., 2003. Vesicle-mediated export Prasadarao, N.V., Wass, C.A., Kim, K.S., 1996a. and assembly of pore-forming oligomers of the enterobac- Endothelial cell GlcNAc beta 1–4GlcNAc epitopes for terial ClyA cytotoxin. Cell 115, 25–35. outer membrane protein A enhance traversal of Escherichia Weinrauch, Y., Drujan, D., Shapiro, S.D., Weiss, J., coli across the blood–brain barrier. Infect. Immun. 64, Zychlinsky, A., 2002. Neutrophil elastase targets virulence 154–160. factors of enterobacteria. Nature 417, 91–94.