ARTICLE IN PRESS International Journal of Medical Microbiology 294 (2004) 373–381 www.elsevier.de/ijmm OmpA of a septicemic Escherichia coli O78 – secretion and convergent evolution Uri Gophna, Diana Ideses, Ran Rosen, Adam Grundland, Eliora Z. Ronà Department of Molecular Microbiology and Biotechnology, The George S. Wise Faculty of Life Sciences, Tel Aviv University, Tel Aviv, Israel Received 7 June 2004; received in revised form 24 August 2004; accepted 26 August 2004 Abstract OmpA is an important constituent of the outer membrane of Gram-negative bacteria. OmpA is involved in a variety of host–bacteria interactions, including crossing of the blood–brain barrier by E. coli strains causing newborn meningitis, and elicits a significant response by the immune system of the host. The bactericidal effect of neutrophil elastase (NE) is also attributed to degradation of the bacterial OmpA. Here we examined the OmpA of septicemic E. coli O78 strains and show that two surface-exposed loops are conserved among invasive strains of E. coli and other pathogenic Enterobacteriaceae. In addition, there is evidence for convergent evolution, implying the existence of selective pressure. Our results also indicate that large quantities of OmpA are secreted into the medium during all phases of growth, where it is present both in secreted vesicles and as a soluble secreted protein. We assume that secreted OmpA can play a role in protection of bacteria from NE by competitive inhibition. Support for this assumption was obtained from experiments indicating that addition of exogenous, purified OmpA reduces killing of bacteria by NE. r 2004 Elsevier GmbH. All rights reserved. Keywords: OmpA; Septicemic E. coli; Molecular evolution; Protein secretion; Outer membrane proteins Introduction periplasm and contains a peptidoglycan-association motif (Koebnik, 1995; Singh et al., 2003). OmpA – outer membrane protein A – is a major OmpA is a prime target of the host immune system: constituent of outer membranes of Gram-negative its binding activates macrophages (Soulas et al., 2000) bacteria, and is required for the structural integrity of and induces dendritic cell maturation (Jeannin et al., the cell surface. The best studied ompA gene variant, 2000). The degradation of OmpA by neutrophil elastase À that of E. coli K-12, encodes a 325-amino-acid (NE) promotes killing of E. coli, and ompA mutants polypeptide (Chen et al., 1980) targeted to the mem- are immune to the effect of NE (Belaaouaj et al., 2000). brane by a 21-amino-acid signal peptide. The N- OmpA has been implicated in the pathogenicity of terminal domain of the mature protein crosses the encapsulated E. coli strains (K1) causing newborn membrane eight times, creating four surface-exposed meningitis (NBM), a disease in which bacteremia is loops. The C-terminal region of OmpA is located in the followed by bacterial crossing of the blood–brain barrier. The E. coli K1 OmpA was shown to be involved ÃCorresponding author. Tel.: +972 (3) 640 9379; fax: in invasion of brain microvascular endothelial cells (an +972 (3) 641 4138. in vitro model for NBM) by a receptor–ligand mecha- E-mail address: [email protected] (E.Z. Ron). nism (Prasadarao et al., 1996b), mediated by the first 1438-4221/$ - see front matter r 2004 Elsevier GmbH. All rights reserved. doi:10.1016/j.ijmm.2004.08.004 ARTICLE IN PRESS 374 U. Gophna et al. / International Journal of Medical Microbiology 294 (2004) 373–381 and second loops. The receptor for OmpA is found in dysenteriae, E. coli O157:H7 EDL933, E. coli K1, brain microvascular endothelial cells but not in vascular and E. coli K-12 were from the NCBI database (acc- endothelial cells (Prasadarao et al., 1996a). The OmpA essions NC_004431, NC_004337, V01344, NC_002655, proteins of E. coli K1 and K-12 differ only in three AF234269 and U00096, respectively). Salmonella ente- amino acids (as inferred from the nucleotide sequence), rica serovar Typhimurium (accession NC_003197) was and K-12 OmpA was found to possess a similar function used for phylogenetic analysis. in invasion of brain microvascular endothelial cells (Kim, 2001). Preparation of secreted proteins for 2D gel analysis Recent reports have shown that OmpA is released by E. coli when incubated in human serum, and is also Two hundred millilitre of bacterial culture were secreted by E. coli serotype O18 and circulates in the harvested by a 10 min centrifugation at 8000g at 4 1C. bloodstream of a septic rat in a sepsis model (Hellman et The supernatant was centrifuged again for 2 h at 10,000g al., 2000; Hellman and Warren, 2001). OmpA was also to remove traces of lysed cells. TCA was added to the shown to be secreted by other Gram-negative bacterial subsequent supernatant to a final concentration of 10% species such as Acinetobacter (Toren et al., 2002), where for an overnight incubation at 4 1C. Pelleted proteins it was also shown to play a role in virulence (Ofori- were obtained by a 2-h centrifugation at 10,000g at 4 1C. Darko et al., 2000). Moreover, analysis of secreted The pellet was washed four times with 95% ethanol membrane vesicles of E. coli K-12 showed that OmpA using 10 min centrifugation steps at 10,000g. The pellet could be detected among other vesicle-secreted proteins was then transferred to a microcentrifuge tube and (Wai et al., 2003). washed again with ethanol for five times and solubilized Avian colisepticemia is a systemic disease of poultry in gel rehydration solution (8 M urea; 2 M thiourea; involving bacterial invasion into the bloodstream and 2 mg/ml dithiothreitol; 5.2 ml/ml Pharmalites (pH 3-10) organs. This disease is of economical importance, and 10 mg/ml CHAPS (Sigma Chemicals Co.)). especially as it often follows vaccination with live attenuated vaccine viruses. The most important avian septicemic strains are of serotype O78, a serotype also Isoelectric focusing and polyacrylamide gel associated with NBM in humans. In this report we show electrophoresis that an avian septicemic E. coli strain releases OmpA into the medium at both logarithmic and stationary Twenty microgram of secreted protein solubilized in growth phases, even when grown in rich medium. gel rehydration solution were loaded on immobilized pH Secretion of OmpA by septicemic strains is probably gradient (IPG) strips (18 cm, pI 4–7) for isoelectric not dependent on its primary structure because sequence focusing, by incubation of the gels in the protein- variations are found mostly in surface-exposed loops of containing rehydration solution for 24 h. The isoelectric the protein and not in regions important for its focusing was carried out in six steps: (1) 0–100 V anchoring. Our study also indicates that the septicemic gradient for 100 Vh; (2) a constant potential of 100 V O78 serotype secretes OmpA not only by means of for 500 Vh; (3) 100–500 V gradient for 2400 Vh; (4) a secreted membrane vesicles, as was shown for E. coli K- constant potential of 500 V for 2500 Vh; (5) 500–3500 V 12 (Wai et al., 2003), but also as a soluble secreted gradient for 10,000 Vh, and (6) a constant potential of protein. Phylogenetic reconstruction shows conservation 3500 V for 35,000 Vh (Rosen et al., 2001). The second of the outer loopmutations among otherwise distant dimension was electrophoresed according to Bernhardt invasive strains. Addition of exogenous OmpA pro- et al. (1999). The gels were stained in a sensitive silver tected bacteria from NE-mediated killing in vitro. We stain for visualization or by Coomassie brilliant blue for therefore suggest that secretion of OmpA may con- subsequent identification (Laemmli, 1970). tribute to bacterial resistance to the immune system of warm-blooded hosts. Protein identification Spots were cut from Coomassie-blue stained gels and were washed for 30 min in 200 ml of 200 mM NH4NCO3, Materials and methods 50% CH3CN at 37 1C. The washed spots were then dried, rehydrated with digestion solution (0.02 mg/ml Bacterial strains used trypsin (Promega), 40 mM NH4NCO3 (pH 8.1), 10% CH3CN) and incubated for 16 h at 37 1C. The extracted E. coli strain 789 is a septicemic strain of serotype O78 peptides were loaded on a POROS 50 R2 (PerSeptive (Babai et al., 1997; Ron et al., 1991). The K-12 strain Biosystems) micro-column for desalting. The peptides used was MG1655 (Blattner et al., 1997). Sequences of were eluted directly into a Q-STAR (Applied Biosys- E. coli UTI strain CFT073, Shigella flexneri, Shigella tems) needle and were measured and identified by ARTICLE IN PRESS U. Gophna et al. / International Journal of Medical Microbiology 294 (2004) 373–381 375 MS/MS using the Analyst QS software (Applied an additional 10 min at 72 1C. A PTC100 programmable Biosystems). thermal cycler (MJ research Inc.) was used for all reactions. Automated DNA sequencing was performed Preparation of protein samples for OmpA on double-stranded DNA templates by the dideoxynu- cleotide chain-termination method (Sanger et al., 1977) quantification with an Applied Biosystems model 3100 sequencer (Foster City, CA, USA), as previously described (Boyd A single colony was grown in LB medium at 37 1C for and Hartl, 1998). The sequencing primers used were 8 h, diluted into 240 ml of LB and grown for 15 h at OmpAf2 (CGGCGCTCGGACAGACCCT) and Om- 37 1C, 150 rpm. Total cell proteins were obtained by pAr2 (CGCAGGCCGCTCCGAAAGATAAC). centrifuging 400 ml of the culture, discarding the super- natant and resuspending the pellet in 50 ml ddH2O. Secreted proteins were determined in culture super- Neutrophil elastase sensitivity assays natants, obtained after 10 min centrifugation at 10,000g at 4 1C, and filtration through a 0.22-mm filter. The NE sensitivity assays were performed as described supernatant was divided in two parts: one was utilized previously (Belaaouaj et al., 2000) with the following for preparing total secreted proteins, and the other was modifications: human NE was supplied by Calbiochem, used for preparing secreted vesicles.