DOCSLIB.ORG

KDM6B Promotes ESCC Cell Proliferation and Metastasis By

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
KDM6B Promotes ESCC Cell Proliferation and Metastasis By Qin et al. BMC Cancer (2021) 21:559 https://doi.org/10.1186/s12885-021-08282-w RESEARCH Open Access KDM6B promotes ESCC cell proliferation and metastasis by facilitating C/EBPβ transcription Mei Qin1†, Fei Han2†, Jian Wu2, Feng-xia Gao1, Yuan Li2, De-xin Yan2, Xue-mei He3, Yang Long3, Xiao-ping Tang3, De-lian Ren1, Yan Gao1* and Tian-yang Dai2* Abstract Background: As an H3K27me3 demethylase and counteracts polycomb-mediated transcription repression, KDM6B has been implicated in the development and malignant progression in various types of cancers. However, its potential roles in esophageal squamous cell carcinoma (ESCC) have not been explored. Methods: The expression of KDM6B in human ESCC tissues and cell lines was examined using RT-qPCR, immunohistochemical staining and immunoblotting. The effects of KDM6B on the proliferation and metastasis of ESCC were examined using in vitro and in vivo functional tests. RNA-seq and ChIP-seq assay were used to demonstrate the molecular biological mechanism of KDM6B in ESCC. Results: We show that the expression level of KDM6B increased significantly in patients with lymph node metastasis. Furthermore, we confirmed that KDM6B knockdown reduces proliferation and metastasis of ESCC cells, while KDM6B overexpression has the opposite effects. Mechanistically, KDM6B regulates TNFA_SIGNALING_VIA_ NFκB signalling pathways, and H3K27me3 binds to the promoter region of C/EBPβ, leading to the promotion of C/ EBPβ transcription. Besides, we show that GSK-J4, a chemical inhibitor of KDM6B, markedly inhibits proliferation and metastasis of ESCC cells. Conclusions: The present study demonstrated that KDM6B promotes ESCC progression by increasing the transcriptional activity of C/EBPβ depending on its H3K27 demethylase activity. Keywords: ESCC, KDM6B, H3K27me3, C/EBPβ Background (ESCC) is currently the major histologic subtype of Esophageal cancer (EC) is one of the most common esophageal cancer [2]. Despite advances in therapeutic gastrointestinal malignancies in the world. According to methods, ESCC remains one of the most common malig- reports in 2018, this disease is ranked as the seventh most nancies in China with an overall five-year survival rate of frequently diagnosed cancer and the sixth cause of cancer less than 20% after surgery [3]. Therefore, a better under- death [1]. In China, esophageal squamous cell carcinoma standing of the molecular mechanisms underlying ESCC progression will supply an arm for improving the diagno- * Correspondence: [email protected]; [email protected] sis and treatment of human ESCC. †Mei Qin and Fei Han contributed equally to this work. Epigenetic modification plays an important role in 1 Department of Immunology, Basic Medicine College, South West Medical tumorigenesis and development. University, Luzhou, Sichuan, China 2Department of Thoracic Surgery, The Affiliated Hospital of Southwest, Many reports have confirmed that epigenetic modifi- Medical University, Sichuan, Luzhou, China cation plays a crucial role in cancer development. As a Full list of author information is available at the end of the article © The Author(s). 2021, corrected publication 2021. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/ licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1. 0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Qin et al. BMC Cancer (2021) 21:559 Page 2 of 16 major epigenetic mechanisms, histone methylation en- IHC analysis in ESCC and adjacent tissues ables the gene promoter to be accessible or inaccess- Samples were collected from 41 patients with ESCC, ible to transcription factors, thereby regulating target who underwent complete surgical resection at the De- gene expression [4, 5]. Methylation of lysine residue partment of Cardiothoracic Surgery of the Affiliated 27 of histone H3 (H3K27), is closely linked to tran- Hospital of Southwest Medical University from January scriptional repression [6]. Among human cancers, 2017 to March 2018. The clinicopathological features of H3K27me3 has been evaluated as a prognostic factor the ESCC patients are summarized in Table 1. Tissue for prostate cancer, breast cancer, ovarian cancer, sections were incubated with rabbit anti-human KDM6B pancreatic cancer and esophageal cancer [7–9]. antibody (1100, ab38113, Abcam, Cambridge, UK), IHC H3K27 methylation and demethylation is a dynamic scoring was blindly assessed by two Pathology doctor. process that can be catalyzed by Methyltransferase The immunohistochemistry procedure and scoring. (e.g., EZH2), demethyltransferase (e.g., KDM6A and of KDM6B expression were performed as previously KDM6B), KDM6B also known as JMJD3 [10]. As an described [26]. Samples with IHC score < 3 were defined important histone demethylase, KDM6B can catalyze as low expression, while samples with IHC score ≥ 3 the demethylation of H3K27me2/3 to activate target were defined as high expression. genes by using Fe2+ and α-ketoglutarate as cofactors [11–13]. Besides, KDM6B also associates with tran- Western blotting scriptional co-activators to facilitate the transcrip- Cells were lysed in Lysis buffer (Beyotime Biotechnology, tional elongation across the H3K27me3-marked gene Shanghai, China) and centrifuged at 4 °C for 15 min. body in an enzyme activity-independent manner [14– Protein concentrations were measured through BCA 16]. KDM6B not only contributes to inflammation, but also contributes to various biological processes in- – Table 1 clinicopathological characteristics of patient samples cluding development and differentiation [17 20]. and expressionof KDM6B in ESCC Lately, some studies have also shown that KDM6B is characteristics Number of cases (%) implicated in the pathogenesis of several cancers in a Age(y) context-dependent fashion [21–25]; however, to date, the biological function of KDM6B in ESCC remains ≥ 60 3 (7.3) to be determined. < 60 38 (92.7) Here we investigate the biological impact of KDM6B Gender in ESCC. We show that KDM6B is overexpressed in Male 11 (26.8) ESCC patients with lymph node metastasis and confirm Female 30 (93.2) that KDM6B can promote ESCC cell proliferation, clone T classification formation, G1/S transformation, migration and invasion. Importantly, we demonstrate that KDM6B, in a T1 1 (2.4) demethylase-independent fashion, upregulates C/EBPβ T2 13 (31.7) mediating ESCC cell proliferation and metastasis. Our T3 23 (56.1) data, therefore, delineate the biologic function of T4 4 (9.8) KDM6B and validate KDM6B may be a novel thera- N classification peutic target for ESCC in the future. N0 23 (56.1) N1 13 (31.7) Materials and methods N2 4 (49.8) Cell lines culture Lymph node Metastasis The human esophageal cancer cell lines (Eca109, No 22 (53.7) Eca9706, TE-1, TE-10, TE-11, KYSE140, and KYSE150) Yes 19 (46.3) were obtained from the Type Culture Collection of Pathologic differentiation Chinese Academy of Sciences (Shanghai, China) and cultured in RPMI-1640 medium (HyClone, USA) supple- Low 6 (14.6) mented with 10% Fetal Bovine Serum (FBS) (Gibco- Medium 18 (43.9) BRL), 100 μg/ml streptomycin and 100 units/ml High 17 (41.5) penicillin G (Beyotime Biotechnology, Shanghai, China) Expression of KDM6B in 5% CO and humidified atmosphere at 37 °C. Cells at 2 Low expression 26 (63.4) the third generation of the exponentially growing state High expression 15 (36.6) were used for all experiments. Qin et al. BMC Cancer (2021) 21:559 Page 3 of 16 Protein Quantitation Assay (Beyotime Biotechnology, Table 2 the specific primers for the genes Shanghai, China). Total cell lysates were equally loaded Primer Name Sequence (5′ to 3′) on 8–15% SDS-polyacrylamide gel for running and then KDM6B Forward:TCCAATGAGACAGGGCACAC transferred to polyvinylidene difluoride (PVDF) mem- Reverse:CTTTCACAGCCAATTCCGGC branes (Amersham, Buckinghamshire, UK). After block- CLDN16 Forward:CTGGGTCTCTGGGTTGCTTT ing for 1 h at room temperature with 5% non-fat milk in Phosphate buffered saline with Tween 20 (PBST), the Reverse:TTTCTCTCAGGTCCAACATCTTT membranes were incubated for overnight with the pri- MMP28 Forward:AGAGCGTTTCAGTGGGTGTC mary antibodies anti-KDM6B (abs103127, Absin, 1: Reverse:AAAGCGTTTCTTACGCCTCA 1000), anti-Tri-Methyl-Histone H3(Lys27) (C36B11) CXCL2 Forward:CGCCCAAACCGAAGTCATAG Rabbit mAb (#9733, Cell Signaling, 1:1000), anti- GAPD Reverse:AGACAAGCTTTCTGCCCATTCT H (AG019, Beyotime Biotechnology, 1:5000), anti- His- BCL6 Forward:CGGAAGATGAGAGATTGCCCTGC tone H3 Mouse Monoclonal Antibody (AF0009, Beyo- time Biotechnology, 1:1000). After staining with Reverse:GCCTGGAGGATGCAGGCATT corresponding horseradish peroxidase (HRP)-linked sec- JUNB Forward:CAGGCTCACGTAGCCGTACT ondary antibodies, signal detection
Load more

Recommended publications
  • Histone H3k27me3 Demethylases Regulate Human Th17 Cell Development and Effector Functions by Impacting on Metabolism
    Histone H3K27me3 demethylases regulate human Th17 cell development and effector functions by impacting on metabolism Adam P. Cribbsa,1, Stefan Terlecki-Zaniewicza, Martin Philpotta, Jeroen Baardmanb, David Ahernc, Morten Lindowd, Susanna Obadd, Henrik Oerumd, Brante Sampeye, Palwinder K. Manderf, Henry Penng, Paul Wordswortha, Paul Bownessa, Menno de Wintherh, Rab K. Prinjhaf, Marc Feldmanna,c,1, and Udo Oppermanna,i,j,k,1 aBotnar Research Center, Nuffield Department of Orthopedics, Rheumatology and Musculoskeletal Sciences, National Institute for Health Research Oxford Biomedical Research Unit, University of Oxford, OX3 7LD Oxford, United Kingdom; bExperimental Vascular Biology, Department of Medical Biochemistry, Amsterdam Cardiovascular Sciences, Amsterdam University Medical Centres, University of Amsterdam, 1105AZ Amsterdam, The Netherlands; cKennedy Institute of Rheumatology, Nuffield Department of Orthopedics, Rheumatology and Musculoskeletal Sciences, National Institute for Health Research Oxford Biomedical Research Unit, University of Oxford, OX3 7FY Oxford, United Kingdom; dRoche Innovation Center Copenhagen A/S, DK 2970 Hørsholm, Denmark; eMetabolon Inc., Durham, NC 27713; fEpinova Discovery Performance Unit, Medicines Research Centre, GlaxoSmithKline R&D, SG1 2NY Stevenage, United Kingdom; gArthritis Centre, Northwick Park Hospital, HA13UJ Harrow, United Kingdom; hInstitute for Cardiovascular Prevention, Ludwig Maximilians University, 80336 Munich, Germany; iStructural Genomics Consortium, University of Oxford, OX3 7DQ Oxford,
    [Show full text]
  • Fine Tuning of Histone Demethylase KDM6A/B Improves the Development of Nuclear 4 Transfer Embryo 5
    bioRxiv preprint doi: https://doi.org/10.1101/390484; this version posted August 14, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Title page 2 3 Fine Tuning of Histone Demethylase KDM6A/B Improves the Development of Nuclear 4 Transfer Embryo 5 6 Lei Yang1, 2, Lishuang Song1, 2, Xuefei Liu1, 2, Lige Bai1, 2, and Guangpeng Li1, 2, * 7 1 State Key Laboratory of Reproductive Regulation and Breeding of Grassland Livestock, 8 Inner Mongolia University, Hohhot 010070, China. 9 2 Research Center for Mammalian Reproductive Biology and Biotechnology, College of Life 10 Sciences, Inner Mongolia University, Hohhot 010070, China. 11 * Corresponding author. Tel: +86 471 4994329; E-mail: [email protected] 12 1 bioRxiv preprint doi: https://doi.org/10.1101/390484; this version posted August 14, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 13 Abstract 14 Despite the success of the production of animals by somatic cell nuclear transfer (SCNT) in 15 many species, the method is limited by a low efficiency. After zygotic genome activation 16 (ZGA), a large number of endogenous retroviruses (ERVs) are expressed, including the 17 murine endogenous retrovirus-L (MuERVL/MERVL). In this study, we generated a series of 18 MERVL-reporter mouse strains to detect the ZGA event in embryos. We found that the 19 majority of SCNT embryos exhibited ZGA failure, and histone H3 lysine 27 trimethylation 20 (H3K27me3) prevented SCNT reprogramming.
    [Show full text]
  • KDM6B Rabbit Polyclonal Antibody – TA319844 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TA319844 KDM6B Rabbit Polyclonal Antibody Product data: Product Type: Primary Antibodies Applications: IF, WB Recommended Dilution: WB: 0.5 ug/mL, IF: 5 ug/mL Reactivity: Human, Mouse, Rat Host: Rabbit Isotype: IgG Clonality: Polyclonal Immunogen: JMJD3 antibody was raised against a 16 amino acid synthetic peptide from near the amino terminus of human JMJD3. Formulation: JMJD3 Antibody is supplied in PBS containing 0.02% sodium azide. Concentration: 1ug/ul Purification: JMJD3 Antibody is affinity chromatography purified via peptide column. Conjugation: Unconjugated Storage: Store at -20°C as received. Stability: Stable for 12 months from date of receipt. Gene Name: lysine demethylase 6B Database Link: NP_001073893 Entrez Gene 216850 MouseEntrez Gene 363630 RatEntrez Gene 23135 Human O15054 Background: JMJD3 Antibody: The Jumonji domain-containing protein 3 (JMJD3) functions as a trimethylation-specific demethylase, converting the trimethylated histone H3 Lys27 residue to the dimethylated form, and is thought to also function as a transcriptional repressor. JMJD3 plays a central role in regulation of posterior development, by regulating HOX gene expression. It is involved in inflammatory response by participating in macrophage differentiation in case of inflammation by regulating gene expression and macrophage differentiation. JMJD3 can also interact with and demethylate p53, resulting in its stabilization and localization to the nucleus in mouse embryo fibroblasts during neural stem cell differentiation. This product is to be used for laboratory only. Not for diagnostic or therapeutic use.
    [Show full text]
  • KDM6B/JMJD3 Histone Demethylase Is Induced by Vitamin D
    KDM6B/JMJD3 histone demethylase is induced by vitamin D and modulates its effects in colon cancer cells Fabio Pereira1, Antonio Barbáchano1, Javier Silva2, Félix Bonilla2, Moray J. Campbell3, Alberto Muñoz1,*and María Jesús Larriba1,* 1Department of Cancer Biology, Instituto de Investigaciones Biomédicas "Alberto Sols", Consejo Superior de Investigaciones Científicas-Universidad Autónoma de Madrid, E-28029 Madrid, Spain, 2Department of Medical Oncology, Hospital Universitario Puerta de Hierro, E- 28223 Majadahonda, Spain and 3Department of Pharmacology & Therapeutics, Roswell Park Cancer Institute, Buffalo, NY 14263, USA *To whom correspondence should be addressed. Instituto de Investigaciones Biomédicas “Alberto Sols”, Arturo Duperier 4, E-28029 Madrid, Spain. Tel: +34-915854451; Fax: +34- 915854401; Email: [email protected], [email protected] 1 Abstract KDM6B/JMJD3 is a histone H3 lysine demethylase with an important gene regulatory role in development and physiology. Here we show that human JMJD3 expression is induced by the active vitamin D metabolite 1,25-dihydroxyvitamin D3 (1,25(OH)2D3) and that JMJD3 modulates the gene regulatory action of this hormone. 1,25(OH)2D3 activates the JMJD3 gene promoter and increases the level of JMJD3 RNA in human cancer cells. JMJD3 upregulation was strictly dependent on vitamin D receptor (VDR) expression and was abolished by cycloheximide. In SW480-ADH colon cancer cells, JMJD3 knockdown or expression of an inactive mutant JMJD3 fragment decreased the induction by 1,25(OH)2D3 of several target genes and of an epithelial adhesive phenotype. Moreover, JMJD3 knockdown upregulated the epithelial-to-mesenchymal transition inducers SNAIL1 and ZEB1 and the mesenchymal markers Fibronectin and LEF1, while it downregulated the epithelial proteins E-cadherin, Claudin-1 and Claudin-7.
    [Show full text]
  • Autism and Cancer Share Risk Genes, Pathways, and Drug Targets
    TIGS 1255 No. of Pages 8 Forum Table 1 summarizes the characteristics of unclear whether this is related to its signal- Autism and Cancer risk genes for ASD that are also risk genes ing function or a consequence of a second for cancers, extending the original finding independent PTEN activity, but this dual Share Risk Genes, that the PI3K-Akt-mTOR signaling axis function may provide the rationale for the (involving PTEN, FMR1, NF1, TSC1, and dominant role of PTEN in cancer and Pathways, and Drug TSC2) was associated with inherited risk autism. Other genes encoding common Targets for both cancer and ASD [6–9]. Recent tumor signaling pathways include MET8[1_TD$IF],[2_TD$IF] genome-wide exome-sequencing studies PTK7, and HRAS, while p53, AKT, mTOR, Jacqueline N. Crawley,1,2,* of de novo variants in ASD and cancer WNT, NOTCH, and MAPK are compo- Wolf-Dietrich Heyer,3,4 and have begun to uncover considerable addi- nents of signaling pathways regulating Janine M. LaSalle1,4,5 tional overlap. What is surprising about the the nuclear factors described above. genes in Table 1 is not necessarily the Autism is a neurodevelopmental number of risk genes found in both autism Autism is comorbid with several mono- and cancer, but the shared functions of genic neurodevelopmental disorders, disorder, diagnosed behaviorally genes in chromatin remodeling and including Fragile X (FMR1), Rett syndrome by social and communication genome maintenance, transcription fac- (MECP2), Phelan-McDermid (SHANK3), fi de cits, repetitive behaviors, tors, and signal transduction pathways 15q duplication syndrome (UBE3A), and restricted interests. Recent leading to nuclear changes [7,8].
    [Show full text]
  • Circrna Circ 102049 Implicates in Pancreatic Ductal Adenocarcinoma Progression Through Activating CD80 by Targeting Mir-455-3P
    Hindawi Mediators of Inflammation Volume 2021, Article ID 8819990, 30 pages https://doi.org/10.1155/2021/8819990 Research Article circRNA circ_102049 Implicates in Pancreatic Ductal Adenocarcinoma Progression through Activating CD80 by Targeting miR-455-3p Jie Zhu,1 Yong Zhou,1 Shanshan Zhu,1 Fei Li,1 Jiajia Xu,1 Liming Zhang,1 and Hairong Shu 2 1Medical Laboratory, Taizhou Central Hospital (Taizhou University Hospital), Taizhou, Zhejiang, China 2Department of Medical Service, Taizhou Central Hospital (Taizhou University Hospital), Taizhou, Zhejiang, China Correspondence should be addressed to Hairong Shu; [email protected] Received 30 September 2020; Revised 27 November 2020; Accepted 13 December 2020; Published 7 January 2021 Academic Editor: Xiaolu Jin Copyright © 2021 Jie Zhu et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Emerging evidence has shown that circular RNAs (circRNAs) and DNA methylation play important roles in the causation and progression of cancers. However, the roles of circRNAs and abnormal methylation genes in the tumorigenesis of pancreatic ductal adenocarcinoma (PDAC) are still largely unknown. Expression profiles of circRNA, gene methylation, and mRNA were downloaded from the GEO database, and differentially expressed genes were obtained via GEO2R, and a ceRNA network was constructed based on circRNA-miRNA pairs and miRNA-mRNA pairs. Inflammation-associated genes were collected from the GeneCards database. Then, functional enrichment analysis and protein-protein interaction (PPI) networks of inflammation- associated methylated expressed genes were investigated using Metascape and STRING databases, respectively, and visualized in Cytoscape.
    [Show full text]
  • The Emerging Role of Histone Lysine Demethylases in Prostate Cancer
    Crea et al. Molecular Cancer 2012, 11:52 http://www.molecular-cancer.com/content/11/1/52 REVIEW Open Access The emerging role of histone lysine demethylases in prostate cancer Francesco Crea1*, Lei Sun3, Antonello Mai4, Yan Ting Chiang1, William L Farrar3, Romano Danesi2 and Cheryl D Helgason1,5* Abstract Early prostate cancer (PCa) is generally treatable and associated with good prognosis. After a variable time, PCa evolves into a highly metastatic and treatment-refractory disease: castration-resistant PCa (CRPC). Currently, few prognostic factors are available to predict the emergence of CRPC, and no curative option is available. Epigenetic gene regulation has been shown to trigger PCa metastasis and androgen-independence. Most epigenetic studies have focused on DNA and histone methyltransferases. While DNA methylation leads to gene silencing, histone methylation can trigger gene activation or inactivation, depending on the target amino acid residues and the extent of methylation (me1, me2, or me3). Interestingly, some histone modifiers are essential for PCa tumor- initiating cell (TIC) self-renewal. TICs are considered the seeds responsible for metastatic spreading and androgen- independence. Histone Lysine Demethylases (KDMs) are a novel class of epigenetic enzymes which can remove both repressive and activating histone marks. KDMs are currently grouped into 7 major classes, each one targeting a specific methylation site. Since their discovery, KDM expression has been found to be deregulated in several neoplasms. In PCa, KDMs may act as either tumor suppressors or oncogenes, depending on their gene regulatory function. For example, KDM1A and KDM4C are essential for PCa androgen-dependent proliferation, while PHF8 is involved in PCa migration and invasion.
    [Show full text]
  • Systematic Phenomics Analysis of Autism-Associated Genes Reveals Parallel Networks Underlying Reversible Impairments in Habituation
    Systematic phenomics analysis of autism-associated genes reveals parallel networks underlying reversible impairments in habituation Troy A. McDiarmida, Manuel Belmadanib,c, Joseph Lianga, Fabian Meilia, Eleanor A. Mathewsd, Gregory P. Mullene, Ardalan Hendif, Wan-Rong Wongg, James B. Randd,h, Kota Mizumotof, Kurt Haasa, Paul Pavlidisa,b,c, and Catharine H. Rankina,i,1 aDjavad Mowafaghian Centre for Brain Health, University of British Columbia, Vancouver, BC V6T 2B5, Canada; bDepartment of Psychiatry, University of British Columbia, Vancouver, BC V6T 2A1, Canada; cMichael Smith Laboratories, University of British Columbia, Vancouver, BC V6T 1Z4, Canada; dGenetic Models of Disease Research Program, Oklahoma Medical Research Foundation, Oklahoma City, OK 73104; eBiology Program, Oklahoma City University, Oklahoma City, OK 73106; fDepartment of Zoology, University of British Columbia, Vancouver, BC V6T 1Z4, Canada; gDivision of Biology and Biological Engineering, California Institute of Technology, Pasadena, CA 91125; hOklahoma Center for Neuroscience, University of Oklahoma Health Sciences Center, Oklahoma City, OK 73104; and iDepartment of Psychology, University of British Columbia, Vancouver, BC V6T 1Z4, Canada Edited by Gene E. Robinson, University of Illinois at Urbana–Champaign, Urbana, IL, and approved October 25, 2019 (received for review July 16, 2019) A major challenge facing the genetics of autism spectrum disorders have dramatically increased the pace of gene discovery in ASD (ASDs) is the large and growing number of candidate risk genes and (5–9). There are now >100 diverse genes with established ties gene variants of unknown functional significance. Here, we used to ASD, many of which are being used in diagnosis. Impor- Caenorhabditis elegans to systematically functionally characterize tantly, each gene accounts for <1% of cases and none have ASD-associated genes in vivo.
    [Show full text]
  • Hypoxia Increases Genome-Wide Bivalent Epigenetic Marking By
    Prickaerts et al. Epigenetics & Chromatin (2016) 9:46 DOI 10.1186/s13072-016-0086-0 Epigenetics & Chromatin RESEARCH Open Access Hypoxia increases genome‑wide bivalent epigenetic marking by specific gain of H3K27me3 Peggy Prickaerts1†, Michiel E. Adriaens2,3†, Twan van den Beucken4,5†, Elizabeth Koch5,6†, Ludwig Dubois4†, Vivian E. H. Dahlmans1, Caroline Gits1, Chris T. A. Evelo2, Michelle Chan‑Seng‑Yue7, Bradly G. Wouters4,5,6,8*† and Jan Willem Voncken1*† Abstract Background: Trimethylation at histone H3 lysine 4 (H3K4me3) and lysine 27 (H3K27me3) controls gene activity dur‑ ing development and differentiation. Whether H3K4me3 and H3K27me3 changes dynamically in response to altered microenvironmental conditions, including low-oxygen conditions commonly present in solid tumors, is relatively unknown. Demethylation of H3K4me3 and H3K27me3 is mediated by oxygen and 2-oxoglutarate dioxygenases enzymes, suggesting that oxygen deprivation (hypoxia) may influence histone trimethylation. Using the MCF7 breast epithelial adenocarcinoma cell model, we have determined the relationship between epigenomic and transcriptomic reprogramming as a function of fluctuating oxygen tension. Results: We find that in MCF7, H3K4me3 and H3K27me3 marks rapidly increase at specific locations throughout the genome and are largely reversed upon reoxygenation. Whereas dynamic changes are relatively highest for H3K27me3 marking under hypoxic conditions, H3K4me3 occupation is identified as the defining epigenetic marker of transcrip‑ tional control. In agreement with the global increase of H3K27 trimethylation, we provide direct evidence that the histone H3K27me3 demethylase KDM6B/JMJD3 is inactivated by limited oxygen. In situ immunohistochemical analy‑ sis confirms a marked rise of histone trimethylation in hypoxic tumor areas. Acquisition of H3K27me3 at H3K4me3- marked loci results in a striking increase in “bivalent” epigenetic marking.
    [Show full text]
  • UCLA Previously Published Works
    UCLA UCLA Previously Published Works Title Genetics of autism spectrum disorder. Permalink https://escholarship.org/uc/item/9zn03530 Journal Handbook of clinical neurology, 147 ISSN 0072-9752 Authors Ramaswami, Gokul Geschwind, Daniel H Publication Date 2018 DOI 10.1016/b978-0-444-63233-3.00021-x Peer reviewed eScholarship.org Powered by the California Digital Library University of California Handbook of Clinical Neurology, Vol. 147 (3rd series) Neurogenetics, Part I D.H. Geschwind, H.L. Paulson, and C. Klein, Editors https://doi.org/10.1016/B978-0-444-63233-3.00021-X Copyright © 2018 Elsevier B.V. All rights reserved Chapter 21 Genetics of autism spectrum disorder GOKUL RAMASWAMI1 AND DANIEL H. GESCHWIND1,2,3* 1Program in Neurogenetics, Department of Neurology, David Geffen School of Medicine, University of California, Los Angeles, CA, United States 2Center for Autism Research and Treatment, Semel Institute, David Geffen School of Medicine, University of California, Los Angeles, CA, United States 3Department of Human Genetics, David Geffen School of Medicine, University of California, Los Angeles, CA, United States Abstract Autism spectrum disorder (ASD) is a prevalent neurodevelopmental disorder characterized by impaired social interaction and stereotyped behaviors. ASD has a strong and complex genetic component, with mul- tiple familial inheritance patterns and an estimate of up to 1000 genes potentially implicated. Over the past decade, genomic technologies have enabled rapid progress in the identification of risk genes for ASD. In this chapter, we review the delineation of ASD disease genes starting from traditional genetic studies such as linkage and association, and then focusing on more recent studies utilizing genomic technologies, such as high-throughput genotyping and exome sequencing.
    [Show full text]
  • Genomic Analyses Reveal Recurrent Mutations in Epigenetic Modifiers
    ARTICLE Received 6 Jul 2015 | Accepted 25 Aug 2015 | Published 29 Sep 2015 DOI: 10.1038/ncomms9470 OPEN Genomic analyses reveal recurrent mutations in epigenetic modifiers and the JAK–STAT pathway in Se´zary syndrome Mark J. Kiel1,*, Anagh A. Sahasrabuddhe1,*,w, Delphine C.M. Rolland2,*, Thirunavukkarasu Velusamy1,*, Fuzon Chung1, Matthew Schaller1, Nathanael G. Bailey1, Bryan L. Betz1, Roberto N. Miranda3, Pierluigi Porcu4, John C. Byrd4, L. Jeffrey Medeiros3, Steven L. Kunkel1, David W. Bahler5, Megan S. Lim2 & Kojo S.J. Elenitoba-Johnson2,6 Se´zary syndrome (SS) is an aggressive leukaemia of mature T cells with poor prognosis and limited options for targeted therapies. The comprehensive genetic alterations underlying the pathogenesis of SS are unknown. Here we integrate whole-genome sequencing (n ¼ 6), whole-exome sequencing (n ¼ 66) and array comparative genomic hybridization-based copy- number analysis (n ¼ 80) of primary SS samples. We identify previously unknown recurrent loss-of-function aberrations targeting members of the chromatin remodelling/histone mod- ification and trithorax families, including ARID1A in which functional loss from nonsense and frameshift mutations and/or targeted deletions is observed in 40.3% of SS genomes. We also identify recurrent gain-of-function mutations targeting PLCG1 (9%) and JAK1, JAK3, STAT3 and STAT5B (JAK/STAT total B11%). Functional studies reveal sensitivity of JAK1-mutated primary SS cells to JAK inhibitor treatment. These results highlight the complex genomic landscape of SS and a role for inhibition of JAK/STAT pathways for the treatment of SS. 1 Department of Pathology, University of Michigan Medical School, Ann Arbor, Michigan 48109, USA.
    [Show full text]
  • Roles of H3k27me3 Demethylase JMJD3 in Inflammation and Cancers
    Chen X, Xiao X, Guo F. Roles of H3K27me3 Demethylase JMJD3 in Inflammation and Journal of Cancers. J Rare Dis Res Treat. (2019) 4(1): 71-76 Rare Diseases Research www.rarediseasesjournal.com & Treatment Minireview Open Access Roles of H3K27me3 Demethylase JMJD3 in Inflammation and Cancers Xia Chen1, Xue Xiao2, Fei Guo3* 1Department of Gynecology and Obstetrics, The First Affiliated Hospital of Nanchang University, Nanchang, China 2Anesthesiology of the Second Clinical Medical College, Nanchang University 3Burn Center, The First Affiliated Hospital of Nanchang University, Nanchang, China Abstract Article Info Histone demethylation is an important part of epigenetic modifications, Article Notes involving in multiple physiological and pathophysiological processes such Received: August 30, 2018 Accepted: January 30, 2019 as proliferation, differentiation, senescence, apoptosis, reprogramming and so on. JmjC domain-containing protein D3 (JMJD3, also called KDM6B) *Correspondence: specifically demethylates lysine 27 on histone H3 (H3K27me3), a repressive Dr. Fei Guo, Burn Center, The First Affiliated Hospital of epigenetic mark, therefore modulating the expression of target genes. Nanchang University, Nanchang, China; JMJD3 can be strongly and quickly induced by various inflammatory stimuli Email: [email protected], [email protected] and cellular stresses, and can enhance pro-inflammatory reactions as well as © 2019 Guo F. This article is distributed under the terms of the anti-inflammatory reactions by targeting diverse transcription factors in gene Creative Commons Attribution 4.0 International License. promoters and bodies. Additionally, JMJD3 has a dual effect on many types of cancers through binding to promoters of oncogenes or suppressor genes. Keywords As is known to us all, in the occurrence and development of various diseases JMJD3 including inflammation and cancer, JMJD3 plays a crucial role, which has H3K27 Histone demethylase triggered a research boom among numerous scholars over the years.
    [Show full text]