Branch Migration and Holliday Junction Resolution Catalyzed by Activities from Mammalian Cells

View metadata, citation and similar papers at core.ac.uk brought to you by CORE

provided by Elsevier - Publisher Connector Cell, Vol. 104, 259–268, January 26, 2001, Copyright 2001 by Cell Press Branch Migration and Holliday Junction Resolution Catalyzed by Activities from Mammalian Cells

Angelos Constantinou, Adelina A. Davies, duplex DNA to form an intermediate structure in which and Stephen C. West* duplexes are linked by a double crossover (Szostak et Imperial Cancer Research Fund al., 1983; Schwacha and Kleckner, 1995). The nature of Clare Hall Laboratories the crossover, or Holliday junction, is now well charac- Blanche Lane terized at both the biological and structural level (Lilley South Mimms et al., 1999). One remarkable feature of the Holliday Hertfordshire EN6 3LD junction is its ability to move along DNA and so generate United Kingdom increasing lengths of heteroduplex, a step that is critical for recombination. In prokaryotic organisms, the enzymes that promote Summary movement of the junction have been isolated and studied in detail (West, 1997). Although the “branch migra- During homologous recombination, DNA strand ex- tion” process is intrinsically isoenergetic, since DNA change leads to Holliday junction formation. The strands are exchanged by the breakage and reformation movement, or branch migration, of this junction along of hydrogen bonds in DNA duplexes, the E. coli RuvAB DNA extends the length of the heteroduplex joint. In proteins promote branch migration in an ATP-depen- prokaryotes, branch migration and Holliday junction dent reaction (Tsaneva et al., 1992). Unlike spontaneous resolution are catalyzed by the RuvA and RuvB pro- branch migration (Panyutin and Hsieh, 1993, 1994), this teins, which form a complex with RuvC resolvase to enzyme-driven reaction is both processive and direc- form a “resolvasome”. Mammalian cell-free extracts tional, and can bypass mismatched bases, UV-induced have now been fractionated to reveal analogous activi- lesions, and regions of heterology (West, 1997). It does ties. An ATP-dependent branch migration activity, so because the reaction is driven by two molecular which migrates junctions through Ͼ2700 bp, cofraction- pumps (hexameric rings of RuvB) that lie oppositely ates with the Holliday junction resolvase during sev- oriented across the RuvA-bound Holliday junction. In eral chromatographic steps. Together, the two activi- addition to their role in the catalysis of branch migration, ties promote concerted branch migration/resolution the RuvAB proteins cooperate with RuvC protein, a junc- reactions similar to those catalyzed by E. coli RuvABC, tion-specific endonuclease, to promote resolution of the highlighting the preservation of this essential pathway Holliday junction. These reactions occur by a coupled in recombination and DNA repair from prokaryotes to mechanism leading to the separation of recombinant mammals. products (Mandal et al., 1993; Whitby et al., 1996; Eggle- ston et al., 1997; Davies and West, 1998; van Gool et Introduction al., 1998, 1999; Zerbib et al., 1998). The RuvABC–Holliday junction complex, or resolva- DNA double-strand breaks (DSBs) arise as a conse- some, provides the paradigm for studies of similar activi- quence of the effects of ionizing radiation, or from the ties in higher organisms. However, while a mammalian breakdown of stalled or damaged replication forks. Holliday junction resolvase activity has been detected These breaks can be efficiently repaired by homologous in fractionated cell-free extracts (Elborough and West, recombination, a process that uses the sister chromatid 1990; Hyde et al., 1994), efforts to detect and identify as the template for repair (Liang et al., 1998). DSBs also eukaryotic branch migration activities have not been occur in meiotic cells, where they are induced as part forthcoming. Although it has been shown that the prod- of a carefully programmed process that leads to recom- ucts of the Bloom’s (BLM) and Werner’s Syndrome bination between homologous chromosomes (Paques (WRN) genes can promote the translocation of Holliday and Haber, 1999). The efficient repair of DSBs is essen- junctions in vitro (Constantinou et al., 2000; Karow et tial for cell viability, as evidenced by the embryonic lethal al., 2000), mutations in BLM and WRN lead to increased phenotype of the RAD51Ϫ/Ϫ mouse and the chromosomal recombination frequencies, making it unlikely that these fragmentation observed in cells containing a repressible proteins promote branch migration during genetic re- RAD51 transgene (Lim and Hasty, 1996; Tsuzuki et al., combination. Instead, it is thought that BLM and WRN 1996; Sonoda et al., 1998). Moreover, the importance of are involved in the processing of aberrant DNA struc- homologous recombination in DNA repair and genomic tures at sites of blocked replication forks and the preven- stability is highlighted by the involvement of the RAD51 tion of deleterious recombination events (Chakraverty recombinase with BRCA2, a tumor suppressor protein and Hickson, 1999). Efforts to identify likely candidate implicated in hereditary breast cancer (Sharan et al., genes that encode branch migration proteins by se- 1997; Marmorstein et al., 1998). quence homology to RuvA and RuvB have also been The mechanism of homologous recombination and unsuccessful. double-strand break repair (DSBR) involves invasion of In this work, we describe the fractionation of mamma- the ends of a broken DNA molecule into homologous lian cell-free extracts revealing the presence of a novel branch migration activity. Most importantly, we find that, * To whom correspondence should be addressed (e-mail: s.west@ at the early stages of fractionation, the activity is coupled icrf.icnet.uk). to the previously described Holliday junction resolvase Cell 260

Figure 1. Fractionation of Mammalian Cell- Free Extracts to Reveal Branch Migration and Holliday Junction Resolution Activities (A) Schematic representation of the synthetic Holliday junction (X26) and the expected products of branch migration and resolution. The junction contains a 26 base pair homologous core, flanked by heterologous sequences (shaded) that block spontaneous branch migration. Protein-mediated branch migration gives rise to splayed arm products, while nucleolytic resolution by the introduction of symmetrically related nicks at the crossover produces nicked duplex DNA. The 32P end label (at the 5Ј terminus of strand 2) is indicated with an asterisk. (B) After phosphocellulose and ammonium sulfate precipitation, cell-free extracts prepared from calf testis tissue were fractionated ona1cm3 butyl sepharose column using a

10 ml gradient (buffer A-1.0AS to A-0AS). The branch migration/resolution activities eluted at, or close to, A-0AS. Fractions were assayed for branch migration/resolution activities in the presence of ATP using 5Ј-32P-labeled synthetic Holliday junction X26, as described in Experimental Procedures. 32P-labeled DNA products were separated by PAGE and detected by autoradiography. (C) Comparison of the Holliday junction processing activities of the E. coli RuvABC proteins with the mammalian resolvasome. Assays for branch migration and resolution activities were carried out in the presence (ϩ) or absence (Ϫ) of ATP, as described in Experimental Procedures. activity. These studies provide the first demonstration absence of ATP, only nicked duplex resolution products of a functional eukaryotic RuvABC homolog. were observed (Figure 1C, compare lanes g and h, and with RuvABC controls shown in lanes b–f). As expected Results from previous studies with the mammalian Holliday junction resolvase (Hyde et al., 1994), which lacks the more Detection of Mammalian Activities Related stringent sequence specificity of RuvC (Shah et al., to the E. coli RuvABC Resolvasome 1994), a variety of nicked duplex products were formed Synthetic Holliday junctions (60 base pairs in length, from the synthetic Holliday junction substrate (seen as 32P-labeled on strand 2) were used to detect branch a doublet in lanes g and h). These arise from cleavage migration and resolution activities in cell-free extracts at alternative sites within the 26 base pair homologous prepared from calf testis tissue. The substrate, shown core. in Figure 1A, contains a 26 bp homologous core at the The results presented in Figure 1 demonstrate the center of the junction that is flanked by terminal regions formation of branch migration products by fractionated of heterology. As demonstrated previously, ATP-depen- mammalian cell-free extracts. Moreover, they show that dent branch migration by RuvAB leads to the formation this ATP-dependent branch migration activity coelutes of splayed arm DNA products (Figure 1A, and Figure 1C, from butyl sepharose together with the Holliday junction lane d), whereas Holliday junction resolution by RuvC resolvase activity. We define this activity as the mamma- produces nicked duplex DNA (Figure 1A, and Figure 1C, lian “resolvasome.” lane b). Branch migration and resolution by RuvABC in the presence of ATP promotes the formation of both Tissue Specificity types of products (Figure 1C, lane f). To determine whether the branch migration/resolution -kg of calf activities were specific for calf testis tissue or were pres 0.5ف Cell-free extracts were prepared from testis material. Soluble proteins that bound phosphocel- ent in all eukaryotic cells and tissue types, we analyzed lulose were precipitated using ammonium sulfate and extracts from various cell lines and mammalian organs. fractionated by butyl sepharose chromatography. Frac- In each case, relatively crude extracts were assayed tions eluting from the column were then assayed for after phosphocellulose adsorption, elution, and ammo- Holliday junction processing activities. Remarkably, we nium sulfate precipitation. Rabbit spleen, thymus, and observed that fractions 28–34 catalyzed the formation testis tissues were found to be good sources of resolva- of splayed arm and nicked duplex DNA products (Figure some activity (Figure 2A, lanes j, l, and n), whereas only 1B). The active fractions eluted at the end of a linear low levels of activity were detected from comparable ammonium sulfate gradient, indicating that both activi- amounts of protein from liver tissue (lane h). Branch ties exhibit strong hydrophobic interactions with butyl migration and resolution activities were also present in sepharose. At this stage, the fractions were quite impure fractions prepared from rodent (CHO) and human (HeLa) and contained approximately 1%–5% of total protein. cell lines (Figure 2A, lanes p and r). Interestingly, with The branch migration and resolution activities present all cell types, we found that resolvase activity was stimu- in fraction 30 displayed properties similar to E. coli lated by ATP-dependent branch migration. This effect RuvABC: in the presence of ATP, we observed products was particularly obvious with fractions made from rabbit typical of branch migration and resolution (splayed arm spleen and human fibroblasts, in which case very little and nicked duplex DNA, respectively), whereas in the Holliday junction resolution was observed in the ab- A Mammalian Branch Migration Activity 261

Figure 3. Subcellular Compartmentalization of the Resolvase Fractions obtained from CHO cells (equivalent to 4 ␮g protein) were incubated with junction XO (32P-labeled in oligo 6) in the absence or presence of 1% Triton X-100 as indicated. Resolution products were analyzed by denaturing PAGE and detected by autoradiography.

cific nuclease activities hindered our analyses. It was therefore necessary to further fractionate each of the mutant extracts using phenyl sepharose chromatography. We found that the XRCC2Ϫ/Ϫ, XRCC3Ϫ/Ϫ, BLMϪ/Ϫ, Figure 2. Branch Migration and Resolution Activities in Cell-Free and WRNϪ/Ϫ extracts contained comparable levels of Extracts from a Variety of Mammalian Tissues and Cell Lines ATP-dependent branch migration activity (Figure 2B). (A) 32P-labeled Holliday junction DNA was incubated with extracts We therefore conclude that the novel branch migration from rabbit organs, human (HeLa), or rodent (CHO) cell lines (3 activity described here is not due to the actions of the ␮g), in the absence (Ϫ) or presence (ϩ) of ATP (lanes g–r). Branch migration and resolution products were analyzed by neutral PAGE. XRCC2, XRCC3, BLM, or WRN proteins. Control reactions (lanes a–f), contained RuvA, RuvB, and RuvC where indicated. Subcellular Localization of the Resolution Activity (B) Analysis of extracts from recombination/repair–deficient cell Eukaryotic Holliday junction resolvases have been iden- lines. Extracts (3 ␮g) from the indicated cell lines were prepared tified in S. cerevisiae (CCE1) and S. pombe (YDC2) (Sym- and fractionated through phosphocellulose and phenyl sepharose as described, and analyzed for branch migration activity. ington and Kolodner, 1985; Whitby and Dixon, 1997). Both proteins, however, act in mitochondria (Kleff et al., 1992; Doe et al., 2000). To determine the subcellular sence of ATP (Figure 2A, compare lanes i with j and o localization of the mammalian resolvase, CHO cells were with p). The stimulation was remarkably similar to that fractionated into cytosolic, nuclear, and mitochondrial observed previously when E. coli RuvC resolvase was fractions, and each fraction was analyzed for resolvase found to be stimulated by RuvAB-mediated branch mi- activity in the presence and absence of a nonionic deter- gration (Zerbib et al., 1998; van Gool et al., 1999). gent (Triton X-100). Resolvase activity was observed in Recently, it was shown that the human BLM and WRN the cytosolic and nuclear fractions (Figure 3, lanes d–g), proteins could promote branch migration and, based on but very little activity was associated with the mitochon- their phenotypic properties, it has been proposed that drial fractions (lanes h–k). they act as anti-recombinases involved in the mainte- nance of stalled replication forks (Chakraverty and Hick- Separation of the Branch Migration and Resolution son, 1999; Constantinou et al., 2000; Karow et al., 2000; Activities of the Resolvasome Rothstein et al., 2000). To eliminate the possibility that The branch migration/resolution activities isolated from the branch migration activity observed in fractionated calf testis tissue by phosphocellulose and butyl sepha- human extracts might be due to these proteins, which rose fractionation were further purified using heparin are members of the RecQ helicase family (Chakraverty and SP sepharose chromatography (Figure 4A). Al- and Hickson, 1999), we analyzed human BLMϪ/Ϫ and though the two activities coeluted from the butyl sepha- WRNϪ/Ϫ cell lines. Two hamster cell lines (irs1 and rose and heparin columns, at the final chromatographic irs1SF), which are deficient in the XRCC2 and XRCC3 step (SP sepharose), they were found to elute as two genes, respectively (Cartwright et al., 1998; Liu et al., distinct biochemical activities (Figure 4B). Their separa- 1998), were also analyzed since these genes are thought tion permitted subsequent analyses to be performed to encode ATPases that function in genetic recombina- with either the branch migration activity (SP Fraction 19) tion and DNA repair (Johnson et al., 1999; Pierce et al., or the resolvase fraction (SP Fraction 24). As might be 1999). After crude fractionation (phosphocellulose and expected upon the separation of the resolvasome into ammonium sulfate), however, the low levels of branch its individual components, gel filtration analyses re- migration activity together with the presence of nonspe- vealed significant changes in molecular mass consistent Cell 262

Figure 4. Partial Purification of the Branch Migration and Resolution Figure 5. Gel Filtration of the Branch Migration Activity at Early and Activities Late Stages of the Purification (A) Purification scheme (see Experimental Procedures for details). The molecular weight and elution volume (V ) of various protein (B) Elution profile from the final SP sepharose column. Aliquots (1 e standards are indicated: thyroglobulin (670 kDa), ␥-globulin (158 ␮l) of each fraction were incubated with 32P-labeled X26 in the pres- kDa), ovalbumin (44 kDa), and myoglobin (17 kDa). ence of ATP and the products were analyzed by neutral PAGE. (A) Gel filtration of Fraction 19 from SP sepharose (SP-19). Fractions from earlier stages and RuvABC controls are also shown. (B) Gel filtration of Fraction I, purified only by phosphocellulose adsorption and ammonium sulfate precipitation. with the dissociation of a protein complex (Figure 5). Indeed, when the most purified branch migration frac- lized by the presence of a heterologous block at the tion (SP-19) was analyzed by gel filtration, we observed distal end of the linear duplex that prevented the com- a peak of activity consistent with a protein exhibiting a pletion of strand exchange (Figure 6A). When treated molecular mass of approximately 40–50 kDa (Figure 5A). with E. coli RuvAB, branch migration occurs through the Unfortunately, all activity from the resolvase fraction 2765 bp region of homology leading to the dissociation (SP-24) was lost during gel filtration, as observed pre- of the recombination intermediates (Eggleston et al., viously (Hyde et al., 1994). In contrast, gel filtration of 1997), and the release of 32P-labeled linear duplex and the resolvasome activity present at early steps of the unlabeled gapped circular DNA (shown schematically fractionation procedure (FI) revealed a higher molecular in Figure 6A, and experimentally in Figure 6B, lanes mass than that observed with SP-19 (Figure 5B). These a and b). Similarly, treatment with RuvC gives rise to results support the notion that the branch migration and 32P-labeled linear dimer DNA (by resolution in orientation resolution activities may, at least at the earlier stages 2/4) or 32P-labeled nicked circular and gapped linear of purification, associate to form high molecular weight products (by resolution in orientation 1/3; Figure 5A, and complexes. Figure 6B, lane n). When ␣ structures were treated with fraction SP-19 Processing of Recombination Intermediates in the presence of ATP, we observed their dissociation The results obtained with synthetic Holliday junctions and the concomitant appearance of 32P-labeled linear are consistent with the presence of branch migration duplex DNA (Figure 6B, lane d). In the absence of SP- and resolution activities in fractionated mammalian ex- 19, only a small fraction of the recombination intermedi- tracts. We therefore confirmed these observations using ates dissociated through spontaneous branch migration substrates that more fully represent reaction intermedi- (lanes b and c). Similarly, only low amounts of dissocia- ates in genetic recombination and double-strand break tion occurred when reactions containing SP-19 were repair. To do this, we used E. coli RecA protein– carried out in the presence of the nonhydrolyzable ATP promoted strand exchange reactions between gapped analogs ATP␥S (lane e) or AMP-PNP (lane f). These co- circular and 3Ј-32P-end-labeled linear duplex DNA to pre- factors could not substitute for ATP. A time course of pare recombination intermediates (␣ structures) con- SP-19-driven branch migration is shown in Figure 6B -of the ␣ struc %50ف ,taining Holliday junctions. The ␣ structures were stabi- (lanes h–m). After 30 min at 37ЊC A Mammalian Branch Migration Activity 263

Alternatively, their formation might reflect a lack of pro- cessivity. Over the 90 min time course, however, we found that most of the ␣ structures were dissociated by SP-19-promoted branch migration. These results show that SP-19-mediated branch migration is capable of driving the Holliday junctions through distances greater than 2700 bp. Incubation of the recombination intermediates with fraction SP-24 gave rise to the products of Holliday junction resolution, namely 32P-labeled linear dimer, linear monomer, and nicked circular DNA products (Figure 6B, lanes o–t). These result from the introduction of two symmetrically related nicks in either of the two orienta- tions 1/3 or 2/4 (Figure 6A), and are identical to the resolution products produced by RuvC (Figure 6B, lane n). Interestingly, we were unable to observe stimulation of SP-24-mediated Holliday junction resolution by SP- 19. As shown in Figure 6B (lanes u–z) the results obtained after mixing the two fractions appeared to be the sum of the SP-19 and SP-24 reactions, and there was no evidence of the stimulatory effect seen earlier using less pure fractions (Figure 2).

Concerted Branch Migration and Resolution RuvC resolvase displays distinct cleavage preferences during Holliday junction resolution, notably cleaving the A G degenerate consensus 5Ј- /TTT /C-3Ј. For example, in the absence of ATP, RuvABC cleaves the synthetic Holli- day junction (5Ј-32P labeled in strand 2) at two sites within the 26 bp homologous core (Figure 6A, lane f; Figure 6. Processing of Recombination Intermediates (␣ Structures) 5Ј-TGT↓C-3Ј and 5Ј-ATT↓G-3Ј). Symmetrically related by the Mammalian Branch Migration/Resolution Activities nicks were also introduced into the opposite strand 4 (A) Schematic diagram of the recombination intermediates and the (Figure 7A, lane i). Previously, concerted RuvABC-medi- products of branch migration and resolution. Recombination inter- ated branch migration and resolution reactions were mediates were made by RecA-mediated strand exchange between detected using a mixture of ATP and ATP␥S which limits 3Ј-32P-end-labeled linear duplex DNA and gapped circular DNA (gDNA), as described in Experimental Procedures. 32P labels are branch migration (van Gool et al., 1999). As shown in indicated by asterisks. A region of heterology (1670 bp) at the distal Figure 7A (lanes g and j), under these reaction condi- end of the linear duplex (shaded gray) blocks strand exchange and tions, nicking at the 5Ј-ATT↓G-3Ј site was stimulated and stabilizes the recombination intermediates. Branch migration by new incisions, located two, five, and six nucleotides 3Ј ␴ RuvAB, or the mammalian branch migration activity, generates struc- to this preferred cleavage site were observed (lane g). tures as the junction reaches the gap and continues to dissociate These sites, indicated with asterisks, map outside of the recombination intermediates into 32P-labeled linear duplex and unlabeled gDNA. Alternatively, resolution in orientation (1/3) leads the homologous core, and occur as a consequence of to the formation of 32P-labeled nicked circles and gapped linear RuvABC-mediated concerted branch migration/reso- DNA, whereas resolution in orientation (2/4) produces 32P-labeled lution. linear dimer molecules. To determine whether the mammalian resolvasome (B) Branch migration/resolution reactions were performed as de- can also promote concerted cleavage, such that the scribed in Experimental Procedures using 32P-labeled recombina- resolvase cleaves the junction as branch migration is tion intermediates (0.1 nM) in reaction buffer containing 2 mM ATP. Where indicated, ATP was replaced by ATP␥S or AMP-PNP. RuvA, driven outside the region of homology, similar experi- RuvB, and RuvC proteins were used as controls. Aliquots of SP-19 ments were carried out with a calf testis fraction purified (2 ␮l) and/or SP-24 (0.5 ␮l) were present as indicated. For the time by phosphocellulose adsorption, ammonium sulfate course, aliquots were withdrawn at the indicated times. 32P-labeled precipitation, and phenyl sepharose fractionation. In the DNA products were analyzed by electrophoresis through agarose absence of ATP (Figure 7B, lanes f and i), we observed gels and detected by autoradiography. major sites of cleavage in strand 2 at the sequences 5Ј-ATC↓CAT-3Ј (within the homologous core) and 5Ј- tures had been dissociated by branch migration (lane TTG↓TCT-3Ј (at the border between homology and heter- j). In this reaction, a band corresponding to ␴ structures ology). The corresponding sites in strand 4 were also was also observed. These products are formed when incised (Figure 7B, lane i), confirming that these nicks branch migration encounters the gap and one strand were due to Holliday junction resolution. Indeed, cleav- of the linear duplex molecule remains associated with age at these sites was not observed in duplex DNA the complementary single-stranded region (Figure 6A) (Figure 7B, lanes a and b). It must be pointed out, how- (West et al., 1982). It is possible that three-stranded ever, that the crude nature of the phenyl sepharose junctions may be bound by other proteins present in resolvasome fraction leads to some degradation of the fraction SP-19 such that branch migration is blocked. substrate due to the actions of nonspecific exo- Cell 264

Figure 7. Concerted Branch Migration and Resolution by E. coli RuvABC or the Mammalian Resolvasome (A) Reactions catalyzed by RuvABC. Junction X26, 5Ј-32P-end labeled either in strand 2 (*2) or strand 4 (*4), or duplex DNA, was incubated with RuvABC in the absence or presence of a mixture of ATP and ATP␥S(Ϫ/ϩ NTP). Sequencing ladders (G ϩ A, or C Ͼ T) of the labeled strands are shown, as are the nucleotide sequences at the relevant cleavage sites. 5Ј-32P-end labeled products were analyzed by denaturing PAGE. Reactions to which no proteins were added are indicated (Ϫ). (B) Coupled branch migration/resolution by the calf testis resolvasome (phenyl sepharose fraction), as analyzed in (A). In both (A) and (B), novel cleavage sites resulting from coupled branch migration/resolution in the presence of ATP/ATP␥S are indicated with asterisks (lanes g and j). nucleases (Figure 7B, lanes f and i). Remarkably, most Discussion of this nonspecific degradation was inhibited by the presence of the ATP/ATP␥S mixture (Figure 7B, lanes g Although our understanding of the late stages of recom- and j). This result may indicate that nucleotide cofactors bination in prokaryotes is well advanced due to detailed may be required for the efficient assembly of the mam- genetic, biochemical, and crystallographic analyses of malian resolvasome, and that resolvasome assembly the three proteins involved in the process (RuvABC), we protects the DNA substrate from nucleolytic degra- currently know very little about related processes in dation. eukaryotic organisms. Indeed, while Holliday junction Under assay conditions that permit limited branch resolvases that act in recombination in bacteria (e.g., migration by the mammalian resolvasome, we ob- RuvC), bacteriophages (T4 endonuclease VII or T7 endo- served that the nicking signals at 5Ј-ATC↓CAT-3Ј and nuclease I), yeast mitochondria (CCE1), archaea and 5Ј-TTG↓TCT-3Ј in strand 2 were abolished and new sites most recently, the vaccinia virus, have been studied in of cleavage (indicated with asterisks) were observed one detail (West, 1997; Garcia et al., 2000; Lilley and White, (5Ј-TGT↓CTA-3Ј) and nine nucleotides (5Ј-ACG↓TCA-3Ј) 2000), the proteins that promote Holliday junction reso- into the region of heterology (Figure 7B, lane g). As lution in the yeast nucleus or in mammalian cells have observed with the RuvABC resolvasome, the absence proven to be surprisingly elusive. Similarly, branch mi- of homology disrupted the symmetry of the cleavage gration enzymes (RuvAB and RecG) that play clearly reaction (Figure 7B, compare lanes g and j) and the defined roles in recombination and DNA repair have until major site of cleavage by the mammalian resolvasome now only been isolated from prokaryotic cells (West, in strand 4 now occurred at a site located 10 nucleotides 1997; McGlynn and Lloyd, 2000). The identification of into the heterologous region. Cleavage within heterol- functional eukaryotic homologs will therefore provide a ogy, in response to the presence of the ATP/ATP␥S major step forward that will open the door to studies of mixture, provides the characteristic signature of a cou- what are likely to be related mechanisms in eukaryotic pled branch migration and resolution reaction. cells. In this work, we provide the first step toward the These results show that the mammalian fraction iso- identification of such activities, by describing a branch lated by phenyl sepharose chromatography promotes migration activity from mammalian tissues. Most impor- a concerted branch migration/resolution reaction that tantly, we have shown that the mammalian branch mi- is similar in many respects to that catalyzed by the E. gration activity is functionally coupled with Holliday coli RuvABC complex. junction resolution. The functional analogies to the E. A Mammalian Branch Migration Activity 265

coli RuvABC resolvasome are striking, and are based It is known that E. coli RuvC, and other resolvases on a variety of biochemical criteria determined using such as the yeast mitochondrial resolvase CCE1, exhibit well established Holliday junction processing assays. a well defined sequence specificity at the resolution step (Shah et al., 1994; White and Lilley, 1996; Schofield et Branch Migration al., 1998; Fogg et al., 1999). With the mammalian activity, The branch migration activity detected in fractionated we also observed defined sites of cleavage within the mammalian extracts fits the RuvABC resolvasome para- homologous core of the synthetic Holliday junction, as digm for the following reasons: (1) the activity converts observed previously (Hyde et al., 1994). However, at the synthetic Holliday junctions into branch migration prod- present time our analysis of this aspect of the reaction ucts; (2) since the junctions contain a homologous core is too limited to define any clear consensus sequence. flanked by heterologous arm sequences, the formation of splayed arm products reflects the activity’s ability to A Mammalian Holliday Junction “Resolvasome” promote branch migration through DNA heterologies; One key aspect of the work described here is the appar- (3) using plasmid-sized recombination intermediates, it ent association of the branch migration and resolution was shown that branch migration requires ATP hydroly- activities during purification. Following the adsorption sis and occurs over lengths greater than 2700 bp; and of soluble proteins from calf testis extracts onto phos- (4) we find that copurifying Holliday junction resolvase phocellulose and ammonium sulfate precipitation, we activity is both stimulated and modified by branch mi- observed that the two activities coeluted from a butyl gration, suggestive of a coupled branch migration/reso- sepharose column. Moreover, the activities also cofrac- lution reaction. tionated in the 400 mM salt elution step from a heparin The branch migration activity was found in a variety agarose column. Only at the fifth step of the purification of organisms (rabbit, calf, hamster, and human), tissues procedure, chromatography on SP sepharose, did the (spleen, thymus, and testis) and cell types (fibroblasts two activities clearly dissociate from each other. Analy- and lymphoblasts). Attempts to identify the gene(s) en- ses of the comparative molecular mass of the branch coding the activity have so far proven negative, with migration activity at early and late stages of the purifica- BLMϪ/Ϫ Ϫ/Ϫ Ϫ/Ϫ Ϫ/Ϫ , WRN , XRCC2 ,orXRCC3 cell lines exhib- tion scheme also revealed changes consistent with the iting normal levels of activity. It is hoped that the future disruption of a large protein complex. analyses of various DSBR-deficient cell lines may In previous studies with the RuvABC proteins, we car- provide clues to the genetic nature of the activities ried out resolution reactions using synthetic Holliday described here, since a similar approach was used suc- junctions in the presence of a mixture of ATP/ATP␥S. cessfully to identify the E. coli Holliday junction resol- These conditions limited the efficiency of branch migra- vase as the product of the ruvC gene (Connolly et al., tion and thereby allowed us to demonstrate coupled 1991). branch migration and Holliday junction resolution. The Two mammalian proteins, TIP49a (RUVBL1) and same approach, carried out with a mammalian fraction TIP49b (RUVBL2), have been identified through se- containing branch migration and resolution activities, quence homology as potential homologs of RuvB. These provided remarkably similar results, leading us to sug- ATPases contain Walker A and B motifs similar to those gest that mammalian proteins promote coupled reac- of RuvB (Qiu et al., 1998; Kanemaki et al., 1999; Makino tions in a manner that is highly analogous to that of their et al., 1999), and are highly expressed in testis and thy- functional prokaryotic homologs. The studies presented mus tissue. However, neither protein appears capable in this paper lead us to suggest that the essential fea- of promoting branch migration in vitro, and indeed, both tures of Holliday junction processing, detailed in studies have been identified as components of an ATP-depen- of the RuvABC proteins, have been conserved in higher dent chromatin remodeling complex (Ikura et al., 2000; eukaryotes. Shen et al., 2000). Any potential role for these proteins in branch migration and recombination therefore re- Experimental Procedures mains to be elucidated. Proteins Resolution E. coli RecA, RuvA, RuvB, and RuvC were purified as described The mammalian Holliday junction resolvase activity that (Eggleston et al., 1997). T4 polynucleotide kinase, terminal deoxy- associates with the branch migration activity is the same nucleotidyl transferase, and restriction enzymes were obtained from as that reported previously (Elborough and West, 1990; commercial suppliers. Protein concentrations are indicated in moles of monomer. Hyde et al., 1994). It bears all the hallmarks of a true resolvase: (1) the activity is present in nuclear rather than mitochondrial fractions, (2) it resolves small synthetic DNA Substrates The synthetic Holliday junction X26 was made by annealing oligonu- Holliday junctions into nicked duplex DNA products; (3) cleotide 1 (5Ј-CCGCTACCAGTGATCACCAATGGATTGCTAGGACAT cleavage occurs within the homologous core by the CTTTGCCCACCTGCAGGTTCACCC-3Ј),2(5Ј-TGGGTGAACCTGCA introduction of symmetrical cuts into two opposing DNA GGTGGGCAAAGATGTCCTAGCAATCCATTGTCTATGACGTCAA strands; (4) the nuclease activity is specific for Holliday GCT-3Ј), 3 (5Ј-GAGCTTGACGTCATAGACAATGGATTGCTAGGACA junctions; and (5) the activity resolves recombination TCTTTGCCGTCTTGTCAATATCGGC-3Ј)and4(5Ј-TGCCGATATTGA intermediates made by RecA into linear duplex, or CAAGACGGCAAAGATGTCCTAGCAATCCATTGGTGATCACTGGTAG CGG-3Ј). Control duplex DNA was made by annealing oligonucleo- nicked circular and gapped linear products. These DNA tide 2 with its complement. Annealing was carried out as described products represent “splice” and “patch” recombinants (Elborough and West, 1990) using 5Ј-32P-labeled oligonucleotide 2 and are the characteristic signature of a resolvase. or 4 with an excess of the other three oligonucleotides. The immobile Cell 266

junction XO is described elsewhere (Benson and West, 1994). Junc- (10 mM Tris-HCl [pH 8.0], 1 M KCl, 1 mM EDTA, and 2 mM DTT) tions and control duplexes were purified by gel electrophoresis. was added and the extract was centrifuged for 3 hr at 42,000 rpm Recombination intermediates (␣ structures) were prepared by in a Beckman SW50.1 rotor. The salt concentration of the superna- RecA-mediated strand exchange between gapped circular pDEA- tant was diluted to 0.2 M KCl for adsorption onto phosphocellulose. 32 7Z and 3Ј- P-labeled PstI-linearized pAKE-4M DNA as described Proteins were step eluted using buffer A-0.4NaCl and subjected to a (Constantinou et al., 2000). All molar concentrations relate to mole- 25%–55% ammonium sulfate cut as described for tissue extracts.

cules of DNA. The protein pellet was resuspended in buffer A-1.0AS, dialyzed, and fractionated using a phenyl sepharose column with a 10 column Ϫ Њ Cell Lines volume gradient to A-0AS. Active fractions were stored at 80 C. The hamster X-ray sensitive cell lines irs1 (XRCC2Ϫ/Ϫ) and irs1SF (XRCC3Ϫ/Ϫ) were obtained from Penny Jeggo (University of Sussex, Subcellular Fractionation UK). The human lymphoblastoid cell line AG3829 (WRNϪ/Ϫ) and Nuclei and mitochondria were isolated essentially as described GM08505 fibroblasts (BLMϪ/Ϫ) were purchased from NIGMS, Human (Rickwood et al., 1987). In brief, CHO cells were washed in ice-cold Genetic Mutant Cell Repository (Camden, NJ). Fibroblasts were PBS, left on ice for 25 min in hypotonic buffer (10 mM Tris-HCl [pH grown in DMEM medium supplemented with 10% fetal calf serum. 7.5], 10 mM NaCl, 1.5 mM CaCl2, and 1 mM DTT) and lysed by AG3829 was maintained in RPMI1640 medium containing 30% fetal douncing using an “A” pestle (40 strokes) in the presence of protease calf serum. inhibitors. The lysate was then supplemented with 0.35 M sucrose and 1 mM EDTA, and nuclei were collected by low-speed centrifugation (5 min at 1000 ϫ g) and washed with buffer (10 mM Tris-HCl Cell Extract Fractionation [pH 7.5], 10 mM NaCl, 1.5 mM CaCl 1 mM DTT, 1 mM EDTA, and Calf testes were fast frozen in liquid nitrogen and stored at Ϫ80ЊC. 2, 0.35 M sucrose). Typically, 0.5 kg of tissue was diced and homogenized in one liter To obtain a crude pellet of mitochondria, the supernatant was of extraction buffer (50 mM Na HPO /NaH PO [pH 6.8], 200 mM 2 4 2 4 centrifuged for 20 min at 10,000 ϫ g. The mitochondria were further NaCl, 1 mM EDTA, and 1 mM DTT) supplemented with protease purified by isopycnic centrifugation on a 1–2 M sucrose gradient inhibitors (1 mM phenylmethylsulfonyl fluoride, 1.5 ␮g/ml aprotinin, (containing 50 mM Tris-HCl [pH 7.5], 1 mM EDTA, and protease and 1␮g/ml each of leupeptin, pepstatin A, chymostatin, and N␣- inhibitors) for 90 min at 80,000 ϫ g. The integrity of the mitochondria p-tosyl-L-lysine chloromethyl-ketone). The homogenate was stirred was confirmed by electron microscopy. Moreover, mitochondrial on ice for one hour and cellular debris were removed by centrifuga- preparations were assayed for the presence of citrate synthase tion for 30 min at 8000 rpm in a Sorvall GSA rotor. The supernatant (Robinson et al., 1987). This activity was detected only in the pres- was batch adsorbed to 250 cm3 phosphocellulose (Whatman P11; ence of Triton X-100, verifying that the mitochondria were intact. -25g dry weight) preequilibrated with extraction buffer. After extenف sive washing, branch migration and resolution activities were eluted with one matrix volume of extraction buffer containing 0.4 M NaCl. Branch Migration and Resolution Assays ␮ 32 25% (w/v) solid ammonium sulfate (134 g/l) was added to the eluate Reactions (20 l) contained P-labeled synthetic Holliday junction ␮ and dissolved by gentle stirring on ice for 30 min. Insoluble materials DNA (X26 or XO; 1.5 nM) and protein fraction (usually 2 l) in phos- were removed by low speed centrifugation (30 min at 8000 rpm). phate buffer (60 mM Na2HPO4/NaH2PO4 [pH 7.4], 5 mM Mg(OAc)2,1 ␮ The ammonium sulfate concentration was then raised to 55% (an mM DTT, and 100 g/ml BSA) supplemented with 2 mM ATP when Њ additional 179 g/l) and proteins were precipitated during 30 min indicated. After 30 min incubation at 37 C, the DNA was depro- stirring on ice. The pellet (fraction I) that contained resolvasome teinized by incubation with 2 mg/ml proteinase K and 0.4% SDS for Њ activity was recovered by low speed centrifugation and resus- 10 min at 37 C. Labeled DNAs were then analyzed by 10% neutral PAGE or denaturing PAGE. pended in 50 ml buffer A (50 mM Na2HPO4/NaH2PO4 [pH 6.8], 10% ␮ Ј 32 glycerol, 1 mM EDTA, and 1 mM DTT) containing 1 M (NH ) SO Reactions (20 l) containing 3 - P-end-labeled recombination in- ف 4 2 4 (1.0 ). Typically, 125 mg of protein was recovered from 500 g of termediates ( 0.1 nM) were carried out in phosphate buffer con- AS Њ testis tissues. The protein suspension was then dialyzed for 4 hr taining 2.5 mM Mg(OAc)2. After 90 min at 37 C, the DNA products against buffer A-1.0 to completely dissolve the protein pellet. Frac- were deproteinized and separated by electrophoresis through 1% AS ␮ tion I was applied to a 20 cm3 butyl sepharose 4 fast flow column and agarose gels in TAE buffer containing 0.5 g/ml ethidium bromide (Eggleston et al., 1997). washed stepwise with buffer A-1.0AS, A-0.5AS, and A-0.35AS. Active Control reactions with the E. coli RuvABC proteins were carried fractions (5 ml) were then eluted in buffer A-0AS and pooled (fraction II; 13 mg of protein in 30 ml). Fraction II was loaded directly onto a out in 20 mM Tris-acetate (pH 7.5), 15 mM Mg(OAc)2, 2 mM ATP, 1 ␮ 5cm3 heparin high trap column preequilibrated with buffer A con- mM DTT, and 100 g/ml BSA as described (van Gool et al., 1999). taining 0.1 M NaCl. The column was washed stepwise with buffer RuvC reactions were carried out with 100 nM RuvC, RuvAB reactions with 20 nM RuvA and 600 nM RuvB, and RuvABC reactions with 20 A-0.1NaCl and A-0.2NaCl. Branch migration and resolution activities nM RuvA, 600 nM RuvB, and 10 nM RuvC. were recovered in 2.5 ml fractions with buffer A-0.4NaCl. Pooled fractions were diluted with buffer A to 0.15 M NaCl (fraction III, 1.9 mg of protein in 30 ml). Fraction III was further purified using a 1 cm3 Mapping of Resolution Sites SP sepharose high trap column. This was washed with 5 column To generate fractions capable of coupled branch migration/resolu- 3 volumes of buffer A-0.1NaCl and activities were eluted with a 20 ml tion (as shown in Figure 7) fraction I was applied to a 1 cm phenyl

gradient to A-1.0NaCl. Fractions (0.5 ml) containing branch migration sepharose high trap column preequilibrated in buffer A-1.0AS and or resolution activity were frozen in dry ice and stored at Ϫ80ЊC. eluted with a 10 ml gradient to A-0AS. Resolution reactions containing For gel filtration studies, samples (25 ␮l) of each fraction were X26 (32P-end labeled in strand 2 or 4) were carried out as described applied to a superdex 200 PC 3.2/30 SMART column equilibrated above except that ATP was replaced with an ATP/ATP␥S mixture

in buffer A-0.4NaCl. The column was run at 25 ␮l/min and 100 ␮l (1.5 mM and 0.5 mM, respectively), and the reactions contained -nM unlabeled oligonucleotide 2 with its com 10ف) fractions were collected. competitor DNA Rabbit organs were taken post mortem from immunized rabbits plement) to reduce exonuclease activity. DNA products were phenol used for antibody production. Approximately5gofliver, spleen, extracted and ethanol precipitated before loading onto 8% denatur- thymus, and testis tissue were homogenized, adsorbed onto phos- ing gels containing 7 M urea. Sites of cleavage were determined by phocellulose, eluted and precipitated with ammonium sulfate essen- comparison with sequencing ladders as described (van Gool et al., tially as described above. 1999). Cells grown in culture were washed three times in ice-cold PBS and once in hypotonic lysis buffer (10 mM Tris-HCl [pH 8.0], 1 mM Acknowledgments EDTA, and 2 mM DTT) as described (Baumann and West, 1998). They were then resuspended in 2 vol of lysis buffer, left 20 min on We thank Boris Kysela for his efforts in the early stages of the ice and lysed using an “A” pestle (25 strokes) in the presence of resolvase studies, and the members of our laboratory for their sug- protease inhibitors. After 20 min on ice, 0.5 vol of high salt buffer gestions and comments. This work was supported by the Imperial A Mammalian Branch Migration Activity 267

Cancer Research Fund, and the Human Frontiers Science Program. characterization of yeast mutants and the gene for a cruciform cut- A. C. has been supported by a European Science Exchange Fellow- ting endonuclease. EMBO J. 11, 699–704. ship and a fellowship from the Swiss Foundation for Grants in Biol- Liang, F., Han, M.G., Romanienko, P.J., and Jasin, M. (1998). Homol- ogy and Medicine. ogy-directed repair is a major double-strand break repair pathway in mammalian cells. Proc. Natl. Acad. Sci. USA 95, 5172–5177. Received October 31, 2000; revised December 18, 2000. Lilley, D.M.J., Norman, D.G., and Smith, T. (1999). The Holliday junction is finally seen with crystal clarity. Nat. Struct. Biol. 6, 897–899. References Lilley, D.M.J., and White, M.F. (2000). Resolving the relationships of resolving enzymes. Proc. Natl. Acad. Sci. USA 97, 9351–9353. Baumann, P., and West, S.C. (1998). DNA end-joining catalyzed by Lim, D.S., and Hasty, P. (1996). A mutation in mouse RAD51 results human cell-free extracts. Proc. Natl. Acad. Sci. USA 95, 14066– in an early embryonic lethal that is suppressed by a mutation in 14070. p53. Mol. Cell. Biol. 16, 7133–7143. Benson, F.E., and West, S.C. (1994). Substrate specificity of the Liu, N., Lamerdin, J.E., Tebbs, R.S., Schild, D., Tucker, J.D., Shen, Escherichia coli RuvC protein: Resolution of 3- and 4-stranded re- M.R., Brookman, K.W., Siciliano, M.J., Walter, C.A., Fan, W.F., et combination intermediates. J. Biol. Chem. 269, 5195–5201. al. (1998). Xrcc2 and Xrcc3, new human Rad51-family members, Cartwright, R., Tambini, C.E., Simpson, P.J., and Thacker, J. (1998). promote chromosome stability and protect against DNA cross-links The XRCC2 DNA repair gene from human and mouse encodes a and other damages. Mol. Cell. 1, 783–793. novel member of the recA/RAD51 family. Nucleic Acids Res. 26, Makino, Y., Kanemaki, M., Kurokawa, Y., Koji, T., and Tamura, T.A. 3084–3089. (1999). A rat RuvB-like protein, TIP49a, is a germ cell-enriched novel Chakraverty, R.K., and Hickson, I.D. (1999). Defending genome in- DNA helicase. J. Biol. Chem. 274, 15329–15335. tegrity during DNA replication: a proposed role for RecQ family Mandal, T.N., Mahdi, A.A., Sharples, G.J., and Lloyd, R.G. (1993). helicases. Bioessays 21, 286–294. Resolution of Holliday intermediates in recombination and DNA re- Connolly, B., Parsons, C.A., Benson, F.E., Dunderdale, H.J., pair: indirect suppression of ruvA, ruvB, and ruvC mutations. J. Sharples, G.J., Lloyd, R.G., and West, S.C. (1991). Resolution of Bacteriol. 175, 4325–4334. Holliday junctions in vitro requires the Escherichia coli ruvC gene Marmorstein, L.Y., Ouchi, T., and Aaronson, S.A. (1998). The BRCA2 product. Proc. Natl. Acad. Sci. USA 88, 6063–6067. gene product functionally interacts with p53 and Rad51. Proc. Natl. Constantinou, A., Tarsounas, M., Karow, J.K., Brosh, R.M., Bohr, Acad. Sci. USA 95, 13869–13874. V.A., Hickson, I.D., and West, S.C. (2000). Werner’s syndrome protein McGlynn, P., and Lloyd, R.G. (2000). Modulation of RNA polymerase (WRN) migrates Holliday junctions and co-localises with RPA upon by (p)ppGpp reveals a RecG-dependent mechanism for replication replication arrest. EMBO R. 1, 80–84. fork progression. Cell 101, 35–45. Davies, A.A., and West, S.C. (1998). Formation of RuvABC-Holliday Panyutin, I.G., and Hsieh, P. (1993). Formation of a single base junction complexes in vitro. Curr. Biol. 8, 725–727. mismatch impedes spontaneous DNA branch migration. J. Mol. Biol. Doe, C.L., Osman, F., Dixon, J., and Whitby, M.C. (2000). The Holli- 230, 413–424. day junction resolvase SpCCE1 prevents mitochondrial DNA aggre- Panyutin, I.G., and Hsieh, P. (1994). The kinetics of spontaneous gation in Schizosaccharomyces pombe. Mol. Gen. Genet. 263, DNA branch migration. Proc. Natl. Acad. Sci. USA 91, 2021–2025. 889–897. Paques, F., and Haber, J.E. (1999). Multiple pathways of recombina- Eggleston, A.K., Mitchell, A.H., and West, S.C. (1997). In vitro recon- tion induced by double-strand breaks in Saccharomyces cerevisiae. stitution of the late steps of genetic recombination in E. coli. Cell Microbiol. Molec. Biol. Revs. 63, 349–404. 89, 607–617. Pierce, A.J., Johnson, R.D., Thompson, L.H., and Jasin, M. (1999). Elborough, K.M., and West, S.C. (1990). Resolution of synthetic Holli- XRCC3 promotes homology-directed repair of DNA damage in mam- day junctions in DNA by an endonuclease activity from calf thymus. malian cells. Genes Dev. 13, 2633–2638. EMBO J. 9, 2931–2936. Qiu, X.B., Lin, Y.L., Thome, K.C., Pian, P., Schlegel, B.P., Weremo- Fogg, J.M., Schofield, M.J., White, M.F., and Lilley, D.M.J. (1999). wicz, S., Parvin, J.D., and Dutta, A. (1998). An eukaryotic RuvB-like Sequence and functional-group specificity for cleavage of DNA junc- protein (RUVBL1) essential for growth. J. Biol. Chem. 273, 27786– tions by RuvC of Escherichia coli. Biochemistry 38, 11349–11358. 27793. Garcia, A.D., Aravind, L., Koonin, E.V., and Moss, B. (2000). Bacterial- Rickwood, D., Wilson, M.T., and Darley-Usmar, V.M. (1987). Isolation type DNA Holliday junction resolvases in eukaryotic viruses. Proc. and characteristics of intact mitochondria. In Mitochondria: A Practi- Natl. Acad. Sci. USA 97, 8926–8931. cal Approach, V.M. Darley-Usmar, D. Rickwood, and M. T. Wilson, Hyde, H., Davies, A.A., Benson, F.E., and West, S.C. (1994). Resolu- eds. (Oxford: IRL Press), pp. 1–16. tion of recombination intermediates by a mammalian endonuclease Robinson, J.B., Brent, L.G., Sumegi, B., and Srere, P.A. (1987). An activity functionally analogous to Escherichia coli RuvC resolvase. enzymatic approach to the study of the Krebs tricarboxylic acid J. Biol. Chem. 269, 5202–5209. cycle. In Mitochondria: A Practical Approach, V.M. Darley-Usmar, D. Ikura, T., Ogryzko, V.V., Grigoriev, M., Groisman, R., Wang, J., Hori- Rickwood, and M. T. Wilson, eds. (Oxford: IRL Press), pp. 153–170. koshi, M., Scully, R., Qin, J., and Nakatani, Y. (2000). Involvement Rothstein, R., Michel, B., and Gangloff, S. (2000). Replication fork of the TIP60 histone acetylase complex in DNA repair and apoptosis. pausing and recombination or “gimme a break”. Genes Dev. 14, Cell 102, 463–473. 1–10. Johnson, R.D., Liu, N., and Jasin, M. (1999). Mammalian XRCC2 Schofield, M.J., Lilley, D.M.J., and White, M.F. (1998). Dissection of promotes the repair of DNA double-strand breaks by homologous the sequence specificity of the Holliday junction endonuclease recombination. Nature 401, 397–399. Cce1. Biochemistry 37, 7733–7740. Kanemaki, M., Kurokawa, Y., Matsuura, T., Makino, Y., Masani, A., Schwacha, A., and Kleckner, N. (1995). Identification of double Holli- Okazaki, K., Morishita, T., and Tamura, T. (1999). TIP49b, a new day junctions as intermediates in meiotic recombination. Cell 83, RuvB-like DNA helicase, is included in a complex together with 783–791. another RuvB-like DNA helicase, TIP49a. J. Biol. Chem. 274, 22437– Shah, R., Bennett, R.J., and West, S.C. (1994). Genetic recombina- 22444. tion in E. coli: RuvC protein cleaves Holliday junctions at resolution Karow, J.K., Constantinou, A., Li, J.-L., West, S.C., and Hickson, hotspots in vitro. Cell 79, 853–864. I.D. (2000). The Bloom’s Syndrome gene product promotes branch Sharan, S.K., Morimatsu, M., Albrecht, U., Lim, S.S., Regel, E., Dinh, migration of Holliday junctions. Proc. Natl. Acad. Sci. USA 97, 6504– C., Sands, A., Eichele, G., Hasty, P., and Bradley, A. (1997). Embry- 6508. onic lethality and radiation hypersensitivity mediated by Rad51 in Kleff, S., Kemper, B., and Sternglanz, R. (1992). Identification and mice lacking Brca2. Nature 386, 804–810. Cell 268

Shen, X., Mizaguchi, G., Hamiche, A., and Wu, C. (2000). A chromatin remodeling complex involved in transcription and DNA processing. Nature 406, 541–544. Sonoda, E., Sasaki, M.S., Buerstedde, J.M., Bezzubova, O., Shino- hara, A., Ogawa, H., Takata, M., Yamaguchi-Iwai, Y., and Takeda, S. (1998). Rad51 deficient vertebrate cells accumulate chromosomal breaks prior to cell death. EMBO J. 17, 598–608. Symington, L.S., and Kolodner, R. (1985). Partial purification of an enzyme from Saccharomyces cerevisiae that cleaves Holliday junctions. Proc. Natl. Acad. Sci. USA 82, 7247–7251. Szostak, J.W., Orr-Weaver, T.L., Rothstein, R.J., and Stahl, F.W. (1983). The double-strand break repair model for recombination. Cell 33, 25–35. Tsaneva, I.R., Mu¨ ller, B., and West, S.C. (1992). ATP-dependent branch migration of Holliday junctions promoted by the RuvA and RuvB proteins of E. coli. Cell 69, 1171–1180. Tsuzuki, T., Fujii, Y., Sakuma, K., Tominaga, Y., Nakao, K., Sekiguchi, M., Matsushiro, A., Yoshimura, Y., and Morita, T. (1996). Targeted disruption of the RAD51 gene leads to lethality in embryonic mice. Proc. Natl. Acad. Sci. USA 93, 6236–6240. van Gool, A.J., Shah, R., Me´ zard, C., and West, S.C. (1998). Func- tional interactions between the Holliday junction resolvase and the branch migration motor of Escherichia coli. EMBO J. 17, 1838–1845. van Gool, A.J., Hajibagheri, N.M.A., Stasiak, A., and West, S.C. (1999). Assembly of the Escherichia coli RuvABC resolvasome di- rects the orientation of Holliday junction resolution. Genes Dev. 13, 1861–1870. West, S.C. (1997). Processing of recombination intermediates by the RuvABC proteins. Ann. Rev. Genet. 31, 213–244. West, S.C., Cassuto, E., and Howard-Flanders, P. (1982). Postrepli- cation repair in E. coli: Strand exchange reactions of gapped DNA by RecA protein. Mol. Gen. Genet. 187, 209–217. Whitby, M.C., and Dixon, J. (1997). A new Holliday junction resolving enzyme from Schizosaccharomyces pombe that is homologous to Cce1 from Saccharomyces cerevisiae. J. Mol. Biol. 272, 509–522. Whitby, M.C., Bolt, E.L., Chan, S.N., and Lloyd, R.G. (1996). Interac- tions between RuvA and RuvC at Holliday junctions: inhibition of junction cleavage and formation of a RuvA-RuvC-DNA complex. J. Mol. Biol. 264, 878–890. White, M.F., and Lilley, D.M.J. (1996). The structure-selectivity and sequence-preference of the junction-resolving enzyme Cce1 of Sac- charomyces cerevisiae. J. Mol. Biol. 257, 330–341. Zerbib, D., Me´ zard, C., George, H., and West, S.C. (1998). Coordi- nated actions of RuvABC in Holliday junction processing. J. Mol. Biol. 281, 621–630.