Expression Profile of Ectopic Olfactory Receptors Determined by Deep Sequencing
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Genetic Variation Across the Human Olfactory Receptor Repertoire Alters Odor Perception
bioRxiv preprint doi: https://doi.org/10.1101/212431; this version posted November 1, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Genetic variation across the human olfactory receptor repertoire alters odor perception Casey Trimmer1,*, Andreas Keller2, Nicolle R. Murphy1, Lindsey L. Snyder1, Jason R. Willer3, Maira Nagai4,5, Nicholas Katsanis3, Leslie B. Vosshall2,6,7, Hiroaki Matsunami4,8, and Joel D. Mainland1,9 1Monell Chemical Senses Center, Philadelphia, Pennsylvania, USA 2Laboratory of Neurogenetics and Behavior, The Rockefeller University, New York, New York, USA 3Center for Human Disease Modeling, Duke University Medical Center, Durham, North Carolina, USA 4Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina, USA 5Department of Biochemistry, University of Sao Paulo, Sao Paulo, Brazil 6Howard Hughes Medical Institute, New York, New York, USA 7Kavli Neural Systems Institute, New York, New York, USA 8Department of Neurobiology and Duke Institute for Brain Sciences, Duke University Medical Center, Durham, North Carolina, USA 9Department of Neuroscience, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania, USA *[email protected] ABSTRACT The human olfactory receptor repertoire is characterized by an abundance of genetic variation that affects receptor response, but the perceptual effects of this variation are unclear. To address this issue, we sequenced the OR repertoire in 332 individuals and examined the relationship between genetic variation and 276 olfactory phenotypes, including the perceived intensity and pleasantness of 68 odorants at two concentrations, detection thresholds of three odorants, and general olfactory acuity. -
OR5K2 (NM 001004737) Human Tagged ORF Clone – RG214545
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG214545 OR5K2 (NM_001004737) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: OR5K2 (NM_001004737) Human Tagged ORF Clone Tag: TurboGFP Symbol: OR5K2 Synonyms: OR3-9 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG214545 representing NM_001004737 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGTTGAAGAAAATCATACCATGAAAAATGAGTTTATCCTCACAGGATTTACAGATCACCCTGAGCTGA AGACTCTGCTGTTTGTGGTGTTCTTTGCCATCTATCTGATCACCGTGGTGGGGAATATTAGTTTGGTGGC ACTGATATTTACACACTGTCGGCTTCACACACCAATGTACATCTTTCTGGGAAATCTGGCTCTTGTGGAT TCTTGCTGTGCCTGTGCTATTACCCCCAAAATGTTAGAGAACTTCTTTTCTGAGGGCAAAAGGATTTCCC TCTATGAATGTGCAGTACAGTTTTATTTTCTTTGCACTGTGGAAACTGCAGACTGCTTTCTTCTGGCAGC AGTGGCCTATGACCGCTATGTGGCCATCTGCAACCCACTGCAGTACCACATCATGATGTCCAAGAAACTC TGCATTCAGATGACCACAGGCGCCTTCATAGCTGGAAATCTGCATTCCATGATTCATGTAGGGCTTGTAT TTAGGTTAGTTTTCTGTGGATTGAATCACATCAACCACTTTTACTGTGATACTCTTCCCTTGTATAGACT CTCCTGTGTTGACCCTTTCATCAATGAACTGGTTCTATTCATCTTCTCAGGTTCAGTTCAAGTCTTTACC ATAGGTAGTGTCTTAATATCTTATCTCTATATTCTTCTTACTATTTTCAGAATGAAATCCAAGGAGGGAA GGGCCAAAGCCTTTTCTACTTGTGCATCCCACTTTTCATCAGTTTCATTATTCTATGGATCTATTTTTTT CCTATACATTAGACCAAATTTGCTTGAAGAAGGAGGTAATGATATACCAGCTGCTATTTTATTTACAATA GTAGTTCCCTTACTAAATCCTTTCATTTATAGTCTGAGAAACAAGGAAGTAATAAGTGTCTTAAGAAAAA -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Supplementary Methods
Heterogeneous Contribution of Microdeletions in the Development of Common Generalized and Focal epilepsies. SUPPLEMENTARY METHODS Epilepsy subtype extended description. Genetic Gereralized Epilepsy (GGE): Features unprovoked tonic and/or clonic seizures, originated inconsistently at some focal point within the brain that rapidly generalizes engaging bilateral distributed spikes and waves discharges on the electroencephalogram. This generalization can include cortical and sub cortical structures but not necessarily the entire cortex[1]. GGE is the most common group of epilepsies accounting for 20% of all cases[2]. It is characterized by an age-related onset and a strong familial aggregation and heritability which allows the assumption of a genetic cause. Although genetic associations have been identified, a broad spectrum of causes is acknowledged and remains largely unsolved [3]. Rolandic Epilepsy (RE): Commonly known also as Benign Epilepsy with Centrotemporal Spikes (BECTS), hallmarks early onset diagnosis (mean onset = 7 years old) with brief, focal hemifacial or oropharyngeal sensorimotor seizures alongside speech arrest and secondarily generalized tonic– clonic seizures, which mainly occur during sleep[4]. Rolandic epilepsy features a broad spectrum of less benign related syndromes called atypical Rolandic epilepsy (ARE), including benign partial epilepsy (ABPE), Landau–Kleffner syndrome(LKS) and epileptic encephalopathy with continuous spike-and-waves during sleep (CSWSS)[5]. Together they are the most common childhood epilepsy with a prevalence of 0.2–0.73/1000 (i.e. _1/2500)[6]. Adult Focal Epilepsy (AFE). Focal epilepsy is characterized by sporadic events of seizures originated within a specific brain region and restricted to one hemisphere. Although they can exhibit more than one network of wave discharges on the electroencephalogram, and different degrees of spreading, they feature a consistent site of origin. -
Technologies Available for Licensing
Technologies Available for Licensing Office of Innovation and Industry Alliances www.moffittip.com IMMUNOTHERAPIES CD40: CD40 Agonists for Improved ex vivo TIL Manufacturing 21MA018N T cell: T cells expressing anti-CD3 antibodies autoactivate and decrease expression of T cell receptors to treat GVHD, or make T cells suitable for off-the- 21MA013N shelf treatment of allogeneic subjects ITAM: Human ITAM Mutated Variants For Better Intracellular Signaling Domains 21MA008N For Gamma-Delta CAR T-Cell Activation ESR1: Cancer Vaccine Using Novel ESR1 Derived Peptides For Neoantigen 20MB062N Therapy NOTCH: Single-domain antibodies (nanobodies) targeting the notch ligand DLL4 to 20MB053N Disrupt the interaction of DLL4 and Notch1 for GVHD CD33 CD123 NKG2DL: Bispecific Gamma Delta CAR-T Cells that Recognize 20MB050N CD33, CD123 and NKG2D Ligands for the Treatment of Acute Myeloid Leukemia OR2H1 or OR5V1: Olfactory Receptor Targeting Chimeric Antigen Receptor 20MA027 Expressing T cell (CAR-T) for Solid Tumors HER-2: Combination Therapy of a HER2-DC1 Dendritic Cell Cancer Vaccine and a 20MA016N Probiotic TILs: 12 Chemokine Gene Expression Signature to Increase the Efficacy of 20MA013N Manufacturing Tumor Infiltrating Lymphocytes PERK, IRE1: Method of Enhancing Immunotherapy Using ER Stress Pathway 20MA005 Inhibitors PGC-1α: CAR T Cells Engineered to Express PGC-1 alpha Demonstrate Enhanced 19MB066 Metabolic Fitness PGC-1α: N-Terminal Mutant PGC-1α Overexpression Enhances Metabolic Fitness 19MB066T2 Reducing CAR-T Exhaustion while Maintaining Proliferative Capacity TILs: Fucose increases tumor cell HLA-DRB1 expression increasing CD4+ T-cell 19MB049N activation with synergistic tumor killing activity with anti-PD1 checkpoint inhibitors Antibodies: Fully Human Anti-BDNF Antibodies 19MB048N Antibodies: Fully Human Anti-TSPAN7 Antibodies 19MB047N T-Bet: T-Bet Transcription Factor Armed CAR-T Cells Maintain Memory 19MA035N Phenotypes and Rescue CD4 Cells Leading to Increased Persistence Haskell Adler PhD MBA CLP Charlie Shaw PhD Praba Soundararajan PhD Sr. -
Deep Sequencing of the Human Retinae Reveals the Expression of Odorant Receptors
fncel-11-00003 January 20, 2017 Time: 14:24 # 1 CORE Metadata, citation and similar papers at core.ac.uk Provided by Frontiers - Publisher Connector ORIGINAL RESEARCH published: 24 January 2017 doi: 10.3389/fncel.2017.00003 Deep Sequencing of the Human Retinae Reveals the Expression of Odorant Receptors Nikolina Jovancevic1*, Kirsten A. Wunderlich2, Claudia Haering1, Caroline Flegel1, Désirée Maßberg1, Markus Weinrich1, Lea Weber1, Lars Tebbe2, Anselm Kampik3, Günter Gisselmann1, Uwe Wolfrum2, Hanns Hatt1† and Lian Gelis1† 1 Department of Cell Physiology, Ruhr-University Bochum, Bochum, Germany, 2 Department of Cell and Matrix Biology, Johannes Gutenberg University of Mainz, Mainz, Germany, 3 Department of Ophthalmology, Ludwig Maximilian University of Munich, Munich, Germany Several studies have demonstrated that the expression of odorant receptors (ORs) occurs in various tissues. These findings have served as a basis for functional studies that demonstrate the potential of ORs as drug targets for a clinical application. To the best of our knowledge, this report describes the first evaluation of the mRNA expression of ORs and the localization of OR proteins in the human retina that set a Edited by: stage for subsequent functional analyses. RNA-Sequencing datasets of three individual Hansen Wang, University of Toronto, Canada neural retinae were generated using Next-generation sequencing and were compared Reviewed by: to previously published but reanalyzed datasets of the peripheral and the macular Ewald Grosse-Wilde, human retina and to reference tissues. The protein localization of several ORs was Max Planck Institute for Chemical Ecology (MPG), Germany investigated by immunohistochemistry. The transcriptome analyses detected an average Takaaki Sato, of 14 OR transcripts in the neural retina, of which OR6B3 is one of the most highly National Institute of Advanced expressed ORs. -
Genetics and Extracellular Vesicles of Pediatrics Sleep Disordered Breathing and Epilepsy
International Journal of Molecular Sciences Review Genetics and Extracellular Vesicles of Pediatrics Sleep Disordered Breathing and Epilepsy Abdelnaby Khalyfa 1,2,* and David Sanz-Rubio 2 1 Department of Pediatrics, Section of Sleep Medicine, The University of Chicago, Chicago, IL 60637, USA 2 Department of Child Health and the Child Health Research Institute, University of Missouri School of Medicine, Columbia, MO 65201, USA; [email protected] * Correspondence: [email protected] Received: 20 August 2019; Accepted: 28 October 2019; Published: 4 November 2019 Abstract: Sleep remains one of the least understood phenomena in biology, and sleep disturbances are one of the most common behavioral problems in childhood. The etiology of sleep disorders is complex and involves both genetic and environmental factors. Epilepsy is the most popular childhood neurological condition and is characterized by an enduring predisposition to generate epileptic seizures, and the neurobiological, cognitive, psychological, and social consequences of this condition. Sleep and epilepsy are interrelated, and the importance of sleep in epilepsy is less known. The state of sleep also influences whether a seizure will occur at a given time, and this differs considerably for various epilepsy syndromes. The development of epilepsy has been associated with single or multiple gene variants. The genetics of epilepsy is complex and disorders exhibit significant genetic heterogeneity and variability in the expressivity of seizures. Phenobarbital (PhB) is the most widely used antiepileptic drug. With its principal mechanism of action to prolong the opening time of the γ-aminobutyric acid (GABA)-A receptor-associated chloride channel, it enhances chloride anion influx into neurons, with subsequent hyperpolarization, thereby reducing excitability. -
The Odorant Receptor OR2W3 on Airway Smooth Muscle Evokes Bronchodilation Via a Cooperative Chemosensory Tradeoff Between TMEM16A and CFTR
The odorant receptor OR2W3 on airway smooth muscle evokes bronchodilation via a cooperative chemosensory tradeoff between TMEM16A and CFTR Jessie Huanga,1,2, Hong Lama,1, Cynthia Koziol-Whiteb,c, Nathachit Limjunyawongd, Donghwa Kime, Nicholas Kimb, Nikhil Karmacharyac, Premraj Rajkumarf, Danielle Firera, Nicholas M. Dalesiog, Joseph Judec, Richard C. Kurtenh, Jennifer L. Pluznickf, Deepak A. Deshpandei, Raymond B. Penni, Stephen B. Liggette,j, Reynold A. Panettieri Jrc, Xinzhong Dongd,k, and Steven S. Anb,c,2 aDepartment of Environmental Health and Engineering, The Johns Hopkins University Bloomberg School of Public Health, Baltimore, MD 21205; bDepartment of Pharmacology, Rutgers-Robert Wood Johnson Medical School, The State University of New Jersey, Piscataway, NJ 08854; cRutgers Institute for Translational Medicine and Science, New Brunswick, NJ 08901; dSolomon H. Snyder Department of Neuroscience, The Johns Hopkins University School of Medicine, Baltimore, MD 21205; eCenter for Personalized Medicine, Morsani College of Medicine, University of South Florida, Tampa, FL 33612; fDepartment of Physiology, The Johns Hopkins University School of Medicine, Baltimore, MD 21205; gDepartment of Anesthesiology and Critical Care Medicine, The Johns Hopkins University School of Medicine, Baltimore, MD 21205; hDepartment of Physiology and Biophysics, University of Arkansas for Medical Sciences, Little Rock, AR 72205; iDivision of Pulmonary and Critical Care Medicine, Department of Medicine, Center for Translational Medicine, Jane and Leonard Korman -
Misexpression of Cancer/Testis (Ct) Genes in Tumor Cells and the Potential Role of Dream Complex and the Retinoblastoma Protein Rb in Soma-To-Germline Transformation
Michigan Technological University Digital Commons @ Michigan Tech Dissertations, Master's Theses and Master's Reports 2019 MISEXPRESSION OF CANCER/TESTIS (CT) GENES IN TUMOR CELLS AND THE POTENTIAL ROLE OF DREAM COMPLEX AND THE RETINOBLASTOMA PROTEIN RB IN SOMA-TO-GERMLINE TRANSFORMATION SABHA M. ALHEWAT Michigan Technological University, [email protected] Copyright 2019 SABHA M. ALHEWAT Recommended Citation ALHEWAT, SABHA M., "MISEXPRESSION OF CANCER/TESTIS (CT) GENES IN TUMOR CELLS AND THE POTENTIAL ROLE OF DREAM COMPLEX AND THE RETINOBLASTOMA PROTEIN RB IN SOMA-TO- GERMLINE TRANSFORMATION", Open Access Master's Thesis, Michigan Technological University, 2019. https://doi.org/10.37099/mtu.dc.etdr/933 Follow this and additional works at: https://digitalcommons.mtu.edu/etdr Part of the Cancer Biology Commons, and the Cell Biology Commons MISEXPRESSION OF CANCER/TESTIS (CT) GENES IN TUMOR CELLS AND THE POTENTIAL ROLE OF DREAM COMPLEX AND THE RETINOBLASTOMA PROTEIN RB IN SOMA-TO-GERMLINE TRANSFORMATION By Sabha Salem Alhewati A THESIS Submitted in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE In Biological Sciences MICHIGAN TECHNOLOGICAL UNIVERSITY 2019 © 2019 Sabha Alhewati This thesis has been approved in partial fulfillment of the requirements for the Degree of MASTER OF SCIENCE in Biological Sciences. Department of Biological Sciences Thesis Advisor: Paul Goetsch. Committee Member: Ebenezer Tumban. Committee Member: Zhiying Shan. Department Chair: Chandrashekhar Joshi. Table of Contents List of figures .......................................................................................................................v -
Comparative Transcriptome Profiling of the Human and Mouse Dorsal Root Ganglia: an RNA-Seq-Based Resource for Pain and Sensory Neuroscience Research
bioRxiv preprint doi: https://doi.org/10.1101/165431; this version posted October 13, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Title: Comparative transcriptome profiling of the human and mouse dorsal root ganglia: An RNA-seq-based resource for pain and sensory neuroscience research Short Title: Human and mouse DRG comparative transcriptomics Pradipta Ray 1, 2 #, Andrew Torck 1 , Lilyana Quigley 1, Andi Wangzhou 1, Matthew Neiman 1, Chandranshu Rao 1, Tiffany Lam 1, Ji-Young Kim 1, Tae Hoon Kim 2, Michael Q. Zhang 2, Gregory Dussor 1 and Theodore J. Price 1, # 1 The University of Texas at Dallas, School of Behavioral and Brain Sciences 2 The University of Texas at Dallas, Department of Biological Sciences # Corresponding authors Theodore J Price Pradipta Ray School of Behavioral and Brain Sciences School of Behavioral and Brain Sciences The University of Texas at Dallas The University of Texas at Dallas BSB 14.102G BSB 10.608 800 W Campbell Rd 800 W Campbell Rd Richardson TX 75080 Richardson TX 75080 972-883-4311 972-883-7262 [email protected] [email protected] Number of pages: 27 Number of figures: 9 Number of tables: 8 Supplementary Figures: 4 Supplementary Files: 6 Word count: Abstract = 219; Introduction = 457; Discussion = 1094 Conflict of interest: The authors declare no conflicts of interest Patient anonymity and informed consent: Informed consent for human tissue sources were obtained by Anabios, Inc. (San Diego, CA). Human studies: This work was approved by The University of Texas at Dallas Institutional Review Board (MR 15-237). -
The Potential Druggability of Chemosensory G Protein-Coupled Receptors
International Journal of Molecular Sciences Review Beyond the Flavour: The Potential Druggability of Chemosensory G Protein-Coupled Receptors Antonella Di Pizio * , Maik Behrens and Dietmar Krautwurst Leibniz-Institute for Food Systems Biology at the Technical University of Munich, Freising, 85354, Germany; [email protected] (M.B.); [email protected] (D.K.) * Correspondence: [email protected]; Tel.: +49-8161-71-2904; Fax: +49-8161-71-2970 Received: 13 February 2019; Accepted: 12 March 2019; Published: 20 March 2019 Abstract: G protein-coupled receptors (GPCRs) belong to the largest class of drug targets. Approximately half of the members of the human GPCR superfamily are chemosensory receptors, including odorant receptors (ORs), trace amine-associated receptors (TAARs), bitter taste receptors (TAS2Rs), sweet and umami taste receptors (TAS1Rs). Interestingly, these chemosensory GPCRs (csGPCRs) are expressed in several tissues of the body where they are supposed to play a role in biological functions other than chemosensation. Despite their abundance and physiological/pathological relevance, the druggability of csGPCRs has been suggested but not fully characterized. Here, we aim to explore the potential of targeting csGPCRs to treat diseases by reviewing the current knowledge of csGPCRs expressed throughout the body and by analysing the chemical space and the drug-likeness of flavour molecules. Keywords: smell; taste; flavour molecules; drugs; chemosensory receptors; ecnomotopic expression 1. Introduction Thirty-five percent of approved drugs act by modulating G protein-coupled receptors (GPCRs) [1,2]. GPCRs, also named 7-transmembrane (7TM) receptors, based on their canonical structure, are the largest family of membrane receptors in the human genome. -
Olfactory Receptors in Non-Chemosensory Tissues
BMB Reports Invited Mini Review Olfactory receptors in non-chemosensory tissues NaNa Kang & JaeHyung Koo* Department of Brain Science, Daegu Gyeongbuk Institute of Science and Technology (DGIST), Daegu 711-873, Korea Olfactory receptors (ORs) detect volatile chemicals that lead to freezing behavior (3-5). the initial perception of smell in the brain. The olfactory re- ORs are localized in the cilia of olfactory sensory neurons ceptor (OR) is the first protein that recognizes odorants in the (OSNs) in the olfactory epithelium (OE) and are activated by olfactory signal pathway and it is present in over 1,000 genes chemical cues, typically odorants at the molecular level, in mice. It is also the largest member of the G protein-coupled which lead to the perception of smell in the brain (6). receptors (GPCRs). Most ORs are extensively expressed in the Tremendous research was conducted since Buck and Axel iso- nasal olfactory epithelium where they perform the appropriate lated ORs as an OE-specific expression in 1991 (7). OR genes, physiological functions that fit their location. However, recent the largest family among the G protein-coupled receptors whole-genome sequencing shows that ORs have been found (GPCRs) (8), constitute more than 1,000 genes on the mouse outside of the olfactory system, suggesting that ORs may play chromosome (9, 10) and more than 450 genes in the human an important role in the ectopic expression of non-chemo- genome (11, 12). sensory tissues. The ectopic expressions of ORs and their phys- Odorant activation shows a distinct signal transduction iological functions have attracted more attention recently since pathway for odorant perception.