Polypurine Reverse-Hoogsteen Hairpins As a Tool for Exon Skipping at the Genomic Level in Mammalian Cells

International Journal of Molecular Sciences

Article Polypurine Reverse-Hoogsteen Hairpins as a Tool for Exon Skipping at the Genomic Level in Mammalian Cells

Véronique Noé * and Carlos J. Ciudad

Department of Biochemistry and Physiology, School of Pharmacy and Food Sciences & IN2UB, University of Barcelona, 08028 Barcelona, Spain; [email protected] * Correspondence: [email protected]; Tel.: +34-934-0344-55

Abstract: Therapeutic strategies for rare diseases based on exon skipping are aimed at mediating the elimination of mutated exons and restoring the reading frame of the affected protein. We explored the capability of polypurine reverse-Hoogsteen hairpins (PPRHs) to cause exon skipping in NB6 cells carrying a duplication of exon 2 of the DHFR gene that causes a frameshift abolishing DHFR activity. Methods: Different editing PPRHs were designed and transfected in NB6 cells followed by incubation in a DHFR-selective medium lacking hypoxanthine and thymidine. Surviving colonies were analyzed by DNA sequencing, RT-PCR, Western blotting and DHFR enzymatic activity. Results: Transfection of editing PPRHs originated colonies in the DHFR-selective medium. DNA sequencing results proved that the DHFR sequence in all these colonies corresponded to the wildtype sequence with just one copy of exon 2. In the edited colonies, the skipping of the additional exon was conﬁrmed at the mRNA level, the DHFR protein was restored, and it showed high levels of DHFR activity. Conclusions: Editing-PPRHs are able to cause exon skipping at the DNA level and could be applied as a possible therapeutic tool for rare diseases.

Citation: Noé, V.; Ciudad, C.J. Keywords: exon skipping; PPRH; DHFR Polypurine Reverse-Hoogsteen Hairpins as a Tool for Exon Skipping at the Genomic Level in Mammalian Cells. Int. J. Mol. Sci. 2021, 22, 3784. 1. Introduction https://doi.org/10.3390/ ijms22073784 Rare diseases are the result of point mutations in gene sequences that can alter the reading frame of the encoded protein or produce a premature stop codon. Exon skipping Academic Editor: Salvador F. Aliño approaches can induce the skipping of specific exons bearing such mutations to restore the reading frame of the protein. This is the case for Duchenne muscular dystrophy Received: 2 March 2021 (DMD), a degenerative muscle disease caused by mutations in the DMD gene encoding Accepted: 1 April 2021 for the dystrophin protein, which causes an aberrant translation [1]. Since dystrophin is Published: 6 April 2021 essential for the muscle, its absence causes an irreversible damage of this tissue, which is then replaced by adipose tissue [2]. Becker muscular dystrophy (BMD) is also a result of Publisher’s Note: MDPI stays neutral mutations in the DMD gene that do not completely disrupt the reading frame of the protein with regard to jurisdictional claims in and allow for the production of a shorter version of a partially functional dystrophin [3]. published maps and institutional affil- A therapeutic strategy for DMD based on exon skipping has been developed, in which iations. antisense oligonucleotides (aODNs) are used to mediate the elimination of the mutated exon, thus restoring the reading frame of the protein. In these conditions, the resulting synthesis of the dystrophin protein mimics the BMD phenotype [4–9]. Exon skipping could theoretically be used in 80–98% of DMD patients harboring deletions, duplications or Copyright: © 2021 by the authors. nonsense mutations in the DMD gene [10]. There are currently four approved therapies of Licensee MDPI, Basel, Switzerland. exon skipping for DMD, three by Sarepta Therapeutics and one by NS Pharma: Exondys 51, This article is an open access article approved in 2016, for patients with a confirmed mutation in exon 51 (13% of all patients); distributed under the terms and Vyondys 53, approved in 2019, for patients with a confirmed mutation in exon 53 (8% conditions of the Creative Commons of all patients); Amondys 45, approved in 2021, for the skipping of exon 45 (8% of all Attribution (CC BY) license (https:// patients); and Vilepso, approved in 2020, designed to skip exon 53 on the DMD primary creativecommons.org/licenses/by/ transcript (8–10% of all patients). Furthermore, researchers are currently working on new 4.0/).

Int. J. Mol. Sci. 2021, 22, 3784. https://doi.org/10.3390/ijms22073784 https://www.mdpi.com/journal/ijms Int. J. Mol. Sci. 2021, 22, 3784 2 of 13

Int. J. Mol. Sci. 2021, 22, 3784 2 of 13 thermore, researchers are currently working on new aODN-based drugs to promote the skipping of exons 44, 45, 50, 52, 53 and 55 of the DMD gene, either individually or in multiple exon skipping approaches [10–12]. aODN-based drugs to promote the skipping of exons 44, 45, 50, 52, 53 and 55 of the DMD Exon skipping based on antisense oligonucleotides is also being explored as a therapeutic gene, either individually or in multiple exon skipping approaches [10–12]. strategyExon for other skipping diseases based such on as antisense mucolipidosis oligonucleotides type II alpha/beta is also (ML being II) explored[13] and titin-based as a thera- dilatedpeutic cardiomyopathy strategy for other [14]. diseases such as mucolipidosis type II alpha/beta (ML II) [13] and titin-basedHowever, dilated DMD cardiomyopathy therapies based on [14 antisense]. oligonucleotides do not provide a permanent treatmentHowever, for DMD the disease, therapies and based nowadays, on antisense the clustered oligonucleotides regularly interspaced do not provide short palin- a per- dromicmanent repeats treatment CRISPR/Cas9 for the disease, technology and nowadays,represents an the alternative clustered regularlyapproach. interspacedIn this direction, short thepalindromic removal of repeatsexon 23 CRISPR/Cas9and exons 21–23 technology in mdx mice represents has been anreported alternative [15–17]. approach. Additionally, In this dystrophindirection, theexpression removal has of been exon restored 23 and exonsin mice 21–23 harboring in mdx a deletion mice has of been exon reported 44 and in [15 dogs–17 ]. harboringAdditionally, a deletion dystrophin of exon expression 50 [18,19]. has been restored in mice harboring a deletion of exon 44 andPPRHs in dogs are non-modified harboring a deletion DNA molecules of exon 50 formed [18,19 ].by two mirror-repeat polypurine se- quencesPPRHs in an antiparallel are non-modiﬁed orientation DNA linked molecules by a pentathymidine formed by two loop mirror-repeat that permits polypurine the estab- lishmentsequences of intramolecular in an antiparallel reverse-Hoogsteen orientation linked bonds by a between pentathymidine both strands. loop thatThese permits hairpins the areestablishment able to bind by of Watson intramolecular and Crick reverse-Hoogsteen bonds to their polypyrimidine bonds between targets both in genomic strands. DNA These withouthairpins losing are abletheir to hairpin bind bystructure Watson [20]. and The Crick binding bonds of tothe their PPRHs polypyrimidine to their target targets polypy- in rimidinegenomic stretches DNA without causes then losing the their displacement hairpin structure of the complementary [20]. The binding polypurine of the PPRHsstrand of to thetheir DNA target [20–22]. polypyrimidine stretches causes then the displacement of the complementary polypurineDepending strand on the of theDNA DNA strand [20 in–22 which]. the polypyrimidine sequence is located, the cor- respondingDepending PPRH ontargets the either DNA the strand template in which or the the coding polypyrimidine strand. Accordingly, sequence PPRHs is located, can actthe as corresponding antigens and also PPRH as targetsantisense either oligon theucleotides template against or the codingRNA if strand.the polypyrimidine Accordingly, stretchPPRHs is located can act in as the antigens coding strand and also of the as DNA antisense target. oligonucleotides PPRHs were first against described RNA for gene if the silencingpolypyrimidine [23]. Next, stretch we provided is located evidence in the coding that repair strand PPRHs, of the DNAwith a target. PPRH PPRHs core and were an ﬁrstex- tensiondescribed tail on for one gene of silencingits ends, have [23]. the Next, ability we to provided correct different evidence types that of repair mutations PPRHs, in mam- with a malianPPRH cells core [24]. and Thus, an extension our technology tail on one could of itsrepr ends,esent have an additional the ability strategy to correct for different gene therapy types inof those mutations approaches in mammalian aiming for cells the [correction24]. Thus, of our point technology mutations could responsible represent for an genetic additional diseases.strategy for gene therapy in those approaches aiming for the correction of point mutations responsibleTo explore for the genetic capability diseases. of PPRHs to cause exon skipping at the DNA level which could be envisagedTo explore as a new the capabilitytherapeutic of tool PPRHs for geneti to causec diseases exon such skipping as DMD, at the we DNA used a level selectable which markercould begene envisaged as a model. as aIn new this therapeutic regard, the toolcell model for genetic NB6 diseasesdeveloped such by Chen as DMD, and weChasin used [25]a selectable was selected marker since geneit contains as a model.an additional In this copy regard, of exon the 2 cellof the model dihydrofolate NB6 developed reductase by (DHFR)Chen and gene Chasin that causes [25] was a frameshift selected which since itabolishes contains DHFR an additional activity in copy these of cells. exon Editing 2 of the PPRHsdihydrofolate were designed reductase to promote (DHFR) thegene skipping that of causes this extra a frameshift exon 2. The which effects abolishes of these editing DHFR PPRHsactivity upon in these transfection cells. Editing in NB6 PPRHs cells and were selection designed in a to DHFR-selective promote the skipping medium of were this ana- extra lyzedexon in 2. individual The effects colonies of these at editing the level PPRHs of DNA, upon mRNA, transfection protein in and NB6 DHFR cells andenzymatic selection activ- in a ity.DHFR-selective medium were analyzed in individual colonies at the level of DNA, mRNA, protein and DHFR enzymatic activity. 2. Results 2. Results 2.1.2.1. Design Design of ofediting Editing PPRHs PPRHs TheThe sequence sequence corresponding corresponding to to the the pD22 pD22 DHFRDHFR minigeneminigene (Figure (Figure 1)1) was was analyzed analyzed for for thethe presence presence of of polypurine polypurine target target regions. regions.

Figure 1. Organization of the pD22 DHFR minigene stably transfected in NB6 cells. A 0.8-kb PstI– FigureBstEII 1. genomic Organization DNA fragment of the pD22 containing DHFR minigene exon 2 and stably flanks transfected of the Chinese in NB6 hamster cells. DHFRA 0.8-kbgene PstI– was BstEIIcloned genomic into the DNA PstI sitefragment in intron containing 1 of pDCH1P exon to2 and obtain flanks the of pD22 the constructChinese hamster as described DHFR in gene Chen was and clonedChasin into [25 ].the PstI site in intron 1 of pDCH1P to obtain the pD22 construct as described in Chen and Chasin [25]. Three putative PPRH target regions were identified in the pD22 minigene, localized in the promoter, exon 3 and exon 6, respectively. These regions are the specific sequences

Int. J. Mol. Sci. 2021, 22, 3784 3 of 13

where each PPRH core binds by means of their polypurine domains. Then, each PPRH core was extended at its 5’ end by a sequence tail homologous to 20 nt upstream and/or 20 nt downstream of the PstI restriction site present in the original DHFR minigene pDCH1P (Table1 and Figure2), which corresponded to the insertion site of the additional sequence including the extra exon 2. All editing PPRHs were designed following the long-distance approach described by Sole et al. [26], in which a pentathymidine sequence was included between the PPRH and the homologous tail. Our rationale was to provide a homologous recombination sequence in order to promote the recombination process and restore the wildtype sequence with just one copy of DHFR exon 2 and the original sequence of intron 1 (Figure2). Depending on the location of the PPRH target with respect to the sequence to be edited, the editing tail was arranged to have the same sequence and orientation as the strand of the DNA to be recombined.

Table 1. Design of the editing PPRHs to skip the additional DHFR exon 2 in pD22 stably transfected in NB6 cells. The name, sequence and location of the target for each editing PPRH are indicated. The sequence highlighted in purple corresponds to the 20 nt upstream of the PstI restriction site, whereas the sequence highlighted in blue corresponds to the 20 nt downstream of this same site; both referred to the original sequence of the wildtype minigene.

Name Editing PPRH Sequence Location of the Target for the PPRH Core 5’ CTGCAGCCGGCGGGCCTACC Int. J. Mol. Sci. 2021, 22, 3784 3 of 13 LDSHpPrI1UPstI TTTTTGGGGAAGGAAAAGTGGG Promoter TGACATTTTTACAGTGGGTGAAA AGGAAGGGG3’ 5’ ACCGCGGGCATGGGCAAGGG Three putative PPRH target regions were identified in the pD22 minigene, localized CTGCAGCCGGCGGGCCTACC LDSHpPrI1UDstI Promoter in the promoter, exon 3 and exon 6, respectiTTTTTGGGGAAGGAAAAGTGGGTvely. These regions are the specific sequences where each PPRH core binds by meansGACATTTTTACAGTGGGTGAAAA of their polypurine domains. Then, each PPRH GGAAGGGG3’ core was extended at its 5’ end by a sequence tail homologous to 20 nt upstream and/or 20 nt downstream of the PstI restriction5’ CCCTTGCCCATGCCCGCGG site present in the original DHFR minigene LDSHpE6I1DPstI TTTTTTAGGAGGAAAAAGGCATC Exon 6 pDCH1P (Table 1 and Figure 2), whichAAGTTTTTGAACTACGGAAAAAG corresponded to the insertion site of the additional sequence including the extra exon 2. All editingGAGGA3’ PPRHs were designed following the long- distance approach described by Sole et5’ GGTAGGCCCGCCGGCTGCAGal. [26], in which a pentathymidine sequence was CCCTTGCCCATGCCCGCGGT included betweenLDSHpE6I1UDPstI the PPRH and the homologous tail. Our rationale was to provideExon a ho- 6 TTTTTAGGAGGAAAAAGGCATCA mologous recombination sequence inAGTTTTTGAACTACGGAAAAAGG order to promote the recombination process and restore the wildtype sequence with just one copyAGGA3’ of DHFR exon 2 and the original sequence of intron 1 (Figure 2). Depending5’ GGTAGGCCCGCCGGCTGCAG on the location of the PPRH target with respect to the sequence toLDSHpE3I1UDPstI be edited, the editingCCCTTGCCCATGCCCGCGGT tail was arranged to have the same sequenceExon and 3 orientation as the strand of the DNA toTTTTTGGACCAAGAGGTAAGGAT be recombined. TTTTAGGAATGGAGAACCAGG3’ As a negative control, sequence UDPstI corresponding only to the extension tail, 20 5’ GGTAGGCCCGCCGGCTGCAG nt upstream and 20 nt UDPst1downstream of the PstI restriction site present in the original NoneDHFR minigene, but without a PPRH core attached,CCCTTGCCCATGCCCGCGGT was used in the transfection3’ experiments.

Figure 2. General approach for the design of the different editing PPRHs to edit the extra sequence (in light blue) including Figure 2. General approach for the design of the different editing PPRHs to edit the extra sequence the additional(in exonlight 2 blue) present including in the DHFR the additionalminigene exon pD22. 2 Thepresent complete in the structure DHFR minigene for each editing pD22. PPRHThe complete contained a PPRH core and a sequencestructure tailfor each in its editing 5’ end homologousPPRH contained to 20 a ntPPRH upstream core and (in a purple) sequence and/or tail in 20 its nt 5’ downstream end homologous (in blue) of the PstI restrictionto 20 site nt presentupstream in (in the purple) original and/or pDCHIP 20 nt minigene. downstream (in blue) of the PstI restriction site present in the original pDCHIP minigene.

2.2. DNA Sequencing in Edited Colonies NB6 cells (30,000 to 150,000) were plated and transfected 24 hours later using 3 or 5 µg of editing PPRHs (117 or 195 nM, respectively, considering an average MW of 25,652 for the different editing PPRHs), either alone or in combination. Transfection of PPRHs carrying the whole homologous tail including both the 20 nt upstream the PstI site and the 20 nt downstream of this same site originated colonies in the DHFR-selective medium. The efficacy of the procedure ranged from 0.03 to 0.33%. When the homologous tail was provided in two separated regions by means of two different editing PPRHs, no colonies were obtained. Transfection of the sequence corresponding only to the homologous tail without a PPRH core only gave rise to a few colonies, less than 1% of those obtained with editing PPRHs. The combination of two different editing PPRHs both carrying a full- length homologous tail did not increase the frequency of edited colonies upon selection in the RPMI medium. For each transfected editing PPRH, several cell colonies were individually expanded, genomic DNA was extracted and the region from DHFR exon 1 to exon 3 was PCR-amplified and sequenced. A negative control was performed with genomic DNA from DHFR-deficient DG44 cells, the recipient cell line for the initial transfection with the pD22 construct in order to establish the NB6 cell line. No band was obtained in these conditions. DNA sequencing results proved that all the analyzed colonies contained the wildtype DHFR sequence with only one copy of Exon 2 (Figure 3).

Int. J. Mol. Sci. 2021, 22, 3784 4 of 13

As a negative control, sequence UDPstI corresponding only to the extension tail, 20 nt upstream and 20 nt downstream of the PstI restriction site present in the original DHFR minigene, but without a PPRH core attached, was used in the transfection experiments.

2.2. DNA Sequencing in Edited Colonies NB6 cells (30,000 to 150,000) were plated and transfected 24 hours later using 3 or 5 µg of editing PPRHs (117 or 195 nM, respectively, considering an average MW of 25,652 for the different editing PPRHs), either alone or in combination. Transfection of PPRHs carrying the whole homologous tail including both the 20 nt upstream the PstI site and the 20 nt downstream of this same site originated colonies in the DHFR-selective medium. The efficacy of the procedure ranged from 0.03 to 0.33%. When the homologous tail was provided in two separated regions by means of two different editing PPRHs, no colonies were obtained. Transfection of the sequence corresponding only to the homologous tail without a PPRH core only gave rise to a few colonies, less than 1% of those obtained with editing PPRHs. The combination of two different editing PPRHs both carrying a full-length homologous tail did not increase the frequency of edited colonies upon selection in the RPMI medium. For each transfected editing PPRH, several cell colonies were individually expanded, genomic DNA was extracted and the region from DHFR exon 1 to exon 3 was PCR- amplified and sequenced. A negative control was performed with genomic DNA from DHFR-deficient DG44 cells, the recipient cell line for the initial transfection with the pD22 Int. J. Mol. Sci. 2021, 22, 3784 4 of 13 construct in order to establish the NB6 cell line. No band was obtained in these conditions. DNA sequencing results proved that all the analyzed colonies contained the wildtype DHFR sequence with only one copy of Exon 2 (Figure3).

Figure 3. (AFigure) PCR 3. products (A) PCR from products genomic from DNA genomic using DNA a pair using of primers a pair in of DHFR primers exon in 1DHFR and exon exon 3, 1 respectively, and exon obtained from either3, NB6 respectively, cells or random obtained edited from colonies, either NB6 which cells were or random used in edited the sequencing colonies, which reactions. were (B used) Highlighted in the in blue, the DHFR DNAsequencing sequence reactions. from exon (B) Highlighted 1 to exon 3 in in the blue, edited the coloniesDHFR DNA compared sequence to the from original exon pD221 to exon minigene, 3 in in which the extra sequencethe edited including colonies thecompared additional to the copy original of exon pD 222 and minigene, its ﬂanking in which regions the is extra highlighted sequence in including grey. The sequences correspondingthe additional to the primers copy used of exon to amplify 2 and theits flanking genomic re DNAgions are is underlined.highlighted Exonsin grey. are The indicated sequences in uppercase corre- whereas the intronicsponding sequence to is the indicated primers in used lowercase. to amplify the genomic DNA are underlined. Exons are indicated in uppercase whereas the intronic sequence is indicated in lowercase. 2.3. DHFR mRNA Expression in Edited Cell Colonies 2.3. DHFR mRNA Expression in Edited Cell Colonies Total RNA was extracted and RT-PCR-analyzed using a forward primer in exon 1 Total RNAand was a reverseextracted primer and RT-PCR-analy in exon 3 to allowzed using evaluating a forward either primer the inclusion in exon or 1 skipping of the and a reverse primeradditional in exon exon 3 to 2 accordingallow evalua to theting sizes either of the the inclusion PCR products, or skipping 166 vs of 116 the bp, respectively. additional exonAs 2 according shown in to Figure the sizes4A,B, of the the mRNA PCR products, species in166 NB6 vs 116 cells bp, revealed respectively. the presence of the As shown in Figureadditional 4A,B, exon the mRNA 2, whereas species in the in editedNB6 cells colonies, revealed the sizethe ofpresence the ampliﬁed of the product corre- additional exonsponded 2, whereas to thein the skipping edited of colo thisnies, additional the size exonof the in amplified accordance product with the corre- wildtype sequence sponded to the presentskipping in of UA21 this additional cells carrying exon onein accordance copy of the with endogenous the wildtypeDHFR sequencegene and in K1 cells present in UA21with cells two carrying copies ofone the copyDHFR of thegene, endogenous both used asDHFR a positive gene control.and in K1 cells with two copies of the DHFR gene, both used as a positive control. In the edited colonies obtained by transfection of LDSHpPRI1UDPstI, only the band corresponding to the skipping of the additional exon 2 was observed (Figure 4A, lanes 1 to 5), whereas in all the other approaches, the band corresponding to the inclusion of the additional exon 2 could still be detected in some colonies, although with a much lower intensity that in NB6 cells, in most of the cases (Figure 4A,B).

Int. J. Mol. Sci. 2021Int. J., 22 Mol., 3784 Sci. 2021, 22, 3784 5 of 13 5 of 13

Figure 4. DHFRFigure mRNA 4. analysisDHFR mRNA in the editedanalysis clones. in the (A edited) Lanes clones. 1 to 5, PCR(A) Lanes products 1 to representative5, PCR products of random representative edited colonies from LDSHpPrI1UDPstI;of random edited lanes 6 colonies to 11, PCR from products LDSHpPrI1UDPstI; representative lanes of random 6 to 11, edited PCR products colonies fromrepresentative LDSHpE3I1UDPstI. of The species originatingrandom edited from NB6, colonies UA21 from and LDSHpE3I1UDPstI. K1 cells (wildtype), The respectively, species originating correspond from to the NB6, three UA21 last lanes.and K1 (B ) Lanes 1 to 5, PCR productscells (wildtype), representative respectively, of random correspond edited to colonies the three from last LDSHpE6I1UDPstI; lanes. (B) Lanes 1 to lanes5, PCR 6 products to 13, PCR rep- products representativeresentative of random editedof random colonies edited obtained colonies with from the LDSHpE6I1UDPstI; combination of LDSHpPrI1UDPstI lanes 6 to 13, PCR and LDSHpE3I1UDPstI.products repre- The species originatingsentative from of NB6, random UA21 edited and K1 colonies cells (wildtype), obtained respectively, with the combination are shown in of the LDSHpPrI1UDPstI last three lanes. and LDSHpE3I1UDPstI. The species originating from NB6, UA21 and K1 cells (wildtype), respectively, are shown in the lastIn three the edited lanes. colonies obtained by transfection of LDSHpPRI1UDPstI, only the band corresponding to the skipping of the additional exon 2 was observed (Figure4A, lanes 1 In all samplesto 5), whereas from the in allcells the stably other transfected approaches, with the bandthe pD22 corresponding minigene (NB6) to the and inclusion of the the correspondingadditional edited exon colonies 2 could obtained still be detectedupon transfection in some colonies, with thealthough different withediting a much lower PPRHs, we intensityobserved that an inamplified NB6 cells, product in most whose of the casessize corresponded (Figure4A,B). to unprocessed mRNA species dueIn allto samplesintron 1 fromretention. the cells Th stablyese PCR transfected products with were the sequenced, pD22 minigene and the (NB6) and the results revealedcorresponding the presence edited of the colonies full sequen obtainedce for upon intron transfection 1 and those with for the DHFR different exons editing 1 PPRHs, and 2. This effectwe observed on mRNA an ampliﬁedprocessing product was exclusive whose size of transfected corresponded cells to since unprocessed the unpro- mRNA species cessed speciesdue was to intronnot present 1 retention. in RNA These samples PCR from products either wereUA21 sequenced, or K1 cells. and the results revealed In orderthe to presencecharacterize of the all full the sequence mRNA species for intron that 1 andcould those be detected for DHFR in exonsthe parental 1 and 2. This effect cell line NB6on and mRNA the edited processing colonies, was exclusivePCR reactions of transfected using a cellsset of since primers theunprocessed hybridizing species was either in intronnot 1 present (Figure in 5A,B) RNA or samples in a comb fromination either pair UA21 for or intron K1 cells. 1 and intron 2 (Figure 5A,C) were carriedIn orderout. This to characterize approach confir all themed mRNA intron species 1 retention that could in all be the detected samples in and the parental cell revealed theline existence NB6 and of unprocessed the edited colonies, mRNA PCRincluding reactions the intron using 2 a region set of primers from the hybridizing orig- either inal DHFR minigenein intron only 1 (Figure in RNAs5A,B) from or in either a combination NB6 cells or pair those for edited intron 1colonies and intron that 2still ( Figure 5A,C ) produced DHFRwere mRNA, carried including out. This the approach extra exon conﬁrmed 2 copy. The intron different 1 retention samples in analyzed all the samples and in Figures 4revealed and 5 were the existenceas follows: of unprocessedlane 1 in Figure mRNA 4A includingcorresponds the intronto lane 2 region1 in Figure from the original 5B,C; lane 4 DHFRin Figureminigene 4A corresponds only in RNAs to lane from 2 in eitherFigure NB6 5B,C; cells lane or 8 in those Figure edited 4A corre- colonies that still sponds to laneproduced 3 in Figure DHFR 5B,C; mRNA, lane 10 including in Figure the 4A extra corresponds exon 2 copy. to lane The 4 in different Figure samples5A,C; analyzed lane 12 in Figurein Figures 4A corresponds4 and5 were to aslane follows: 5 in Figure lane 1 5B,C; in Figure lane4 1A in corresponds Figure 4B corresponds to lane 1 in Figure5B,C; to lane 6 in Figurelane 4 in5B,C; Figure lane4 A3 in corresponds Figure 4B corresponds to lane 2 in Figure to lane5 B,C;6 in Figure lane 8 in5B,C;Figure lane4 5A incorresponds Figure 4B correspondsto lane 3 in to Figure lane5 7B,C; in Figure lane 10 5B,C; in Figure lane4 6A in corresponds Figure 4B corresponds to lane 4 in Figure to lane5A,C; 8 lane 12 in Figure 5B,C;in Figure lane 84 inA Figure corresponds 4B corresponds to lane 5 to in lane Figure 9 in5B,C; Figure lane 5B,C; 1 in lane Figure 10 4inB Figure corresponds to 4B correspondslane to 6 lane in Figure 10 in5 FigureB,C; lane 5B,C 3 in; lane Figure 11 4inB Figure corresponds 4B corresponds to lane 6 to in lane Figure 115 inB,C; lane 5 Figure 5B,C;in lane Figure 12 in4B Figure corresponds 4B corresponds to lane 7 to in lane Figure 125 B,C;in Figure lane 65B,C; in Figure and lane4B corresponds13 in to Figure 4B correspondslane 8 in Figure to lane5B,C; 13 in lane Figure 8 in Figure5B,C. 4B corresponds to lane 9 in Figure5B,C ; lane 10 in Figure4B corresponds to lane 10 in Figure5B,C ; lane 11 in Figure4B corresponds to lane 11 in Figure5B,C ; lane 12 in Figure4B corresponds to lane 12 in Figure5B,C; and lane 13 in Figure4B corresponds to lane 13 in Figure5B,C.

Int. J. Mol. Sci. 2021, 22, 3784 6 of 13 Int.Int. J.J. Mol.Mol. Sci.Sci. 20212021,, 2222,, 37843784 66 of 1313

Figure 5. Intron retention in DHFR mRNA from edited clones. (A) Map of the locations of hybridiza- FigureFigure 5. 5. Intron Intron retention retention in in DHFR DHFR mRNA mRNA from from edited edited clones. clones. (A (A) Map) Map of of the the locations locations of of hybridi- hybridi- tion of the primers used in the analysis. (B) and (C) Lanes 1 and 2, PCR products representative of zationzation of of the the primers primers used used in in the the analysis. analysis. (B ()B and) and (C (C) Lanes) Lanes 1 1and and 2, 2, PCR PCR products products representative representative ofrandomof random random edited edited edited colonies colonies colonies from from from LDSHpPrI1UDPstI; LDSHpPrI1UDPstI; LDSHpPrI1UDPstI; lanes lanes lanes 3 and3 3and and 4, PCR4, 4, PCR PCR products products products representative representative representative of ran-of of randomdomrandom edited edited edited colonies colonies colonies from from from LDSHpE3I1UDPstI; LDSHpE3I1UDPstI; LDSHpE3I1UDPstI; lanes lanes 6lanes and 6 7,6and PCRand 7, 7, productsPCR PCR products products representative representative representative of random of of randomeditedrandom coloniesedited edited colonies fromcolonies LDSHpE6I1UDPstI; from from LDSHpE6I1UDPstI; LDSHpE6I1UDPstI; and lanes an and 8 dlanes to lanes 13, 8 PCR 8to to 13, products13, PCR PCR products products representative representative representative of random of of random edited colonies originating from the combination of LDSHpPrI1UDPstI and editedrandom colonies edited originating colonies from originating the combination from ofthe LDSHpPrI1UDPstI combination of and LDSHpPrI1UDPstI LDSHpE3I1UDPstI; laneand LDSHpE3I1UDPstI; lane NB6, species originating from NB6 cells. NB6,LDSHpE3I1UDPstI; species originating lane fromNB6, NB6spec cells.ies originating from NB6 cells.

2.4.2.4. DHFR DHFR Protein Protein Levels Levels and andand Enzymatic EnzymaticEnzymatic Activity ActivityActivity in inin Edited EditedEdited Cell CellCell Colonies ColoniesColonies TotalTotal extracts extractsextracts from fromfrom the thethe different differentdifferent edited editededited co coloniescolonieslonies were werewere analyzed analyzedanalyzed by byby Western WesternWestern blotting blottingblotting tototo determine determinedetermine DHFR DHFRDHFR protein proteinprotein levels. levels.levels. As As shown shown in in Figure Figure 6A,B,6 6A,B,A,B, in inin all allall thethe the clonesclones clones analyzed, analyzed, analyzed, thethethe DHFR DHFRDHFR protein proteinprotein was was was restored. restored. restored. Furthermore, Furthermore, thethe the expressedexpressed expressed proteinprotein protein showed showed showed high high high levels levels levels of ofDHFRof DHFR DHFR activity activity activity in in allin all all colonies colonies colonies as as determinedas det determinedermined in in thein the the enzymatic enzymatic enzymatic assay assay assay (Figure (Figure (Figure7). 7). 7).

Figure 6. Levels of the DHFR protein. (A) Representative blot of the DHFR protein in total extracts FigureFigure 6 .6 Levels. Levels of of the the DHFR DHFR protein. protein. (A (A) Representative) Representative blot blot of of the the DH DHFRFR protein protein in in total total extracts extracts from edited colonies obtained upon transfection with either LDHpPrI1UDPstI, LDHpE3I1UDPstI or fromfrom edited edited colonies colonies obtained obtained upon upon transfecti transfectionon with with either either LDHpPrI1UDPstI, LDHpPrI1UDPstI, LDHpE3I1UDPstI LDHpE3I1UDPstI orLDHpE6I1UDPstI,or LDHpE6I1UDPstI, LDHpE6I1UDPstI, NB6 NB6 NB6 or or UA21or UA21 UA21 cells. cells. cells. (B ()B Representative()B Representative) Representative blot blot blot of theof of the DHFRthe DHFR DHFR protein protein protein in totalin in total total extracts ex- ex- tractsfromtracts from editedfrom edited edited colonies colonies colonies obtained obtained obtained upon upon upon transfection tran transfectionsfection with with thewith combinationthe the combination combination of LDHpPrI1UDPstI of of LDHpPrI1UDPstI LDHpPrI1UDPstI and andLDHpE3I1UDPstI,and LDHpE3I1UDPstI, LDHpE3I1UDPstI, NB6 NB6 orNB6 UA21 or or UA21 UA21 cells. cells. Tubulincells. Tubulin Tubulin signal si signal wasgnal usedwas was used in used all samplesin in all all samples samples to normalize to to normalize normalize the results. the the results.results.

Int. J. Mol. Sci. 2021, 22, 3784 7 of 13 Int. J. Mol. Sci. 2021, 22, 3784 7 of 13

Figure 7. DHFR activity inin controlcontrol NB6NB6 cellscells and and random random edited edited colonies colonies obtained obtained from from transfections transfec- withtions thewith different the different editing editing PPRHs. PPRHs. Results Results are are represented represented as as the the means means ±± SDSD values values of of three three independent experiments.experiments. **** p < 0.0001 0.0001..

3. Discussion In this work, we described the ability of thethe PPRH technology to cause exon skipping at the DNA level in a cell line model bearing an extra copy ofof DHFR exonexon 22 thatthat leadsleads toto aa frameshift. Previously,Previously, we we showed showed that that repair repair PPRHs PPRHs were were able able to correct to correct single-point single-point mu- tationsmutations in two in two different different mammalian mammalian genes, genes,DHFR DHFR[26] [26] and andAPRT APRT[22], [22], in their in their endogenous endoge- locinous using loci using a design a design in which in which the repair the tailrepair sequence tail sequence contains contains only one only nucleotide one nucleotide change withchange respect with torespect the target to the region target of region the point of the mutation point mutation to be repaired. to be Here,repaired. we designedHere, we editingdesigned PPRHs editing following PPRHs afollowing similar approach, a similar in approach, which the in PPRH which core the bears PPRH an core extension bears tail an homologousextension tail to homologous 20 nt upstream to 20 and nt 20upstream nt downstream and 20 nt of downstream a unique PstI of restriction a unique site PstI that re- correspondsstriction site tothat the corresponds point of insertion to the ofpoint the additionalof insertion sequence of the additional to be skipped. sequence Thus, to the be editingskipped. tail Thus, included the editing two separate tail included regions two that sepa arerate apart regions in the that parental are apart DNA in and the thatparental only comeDNA togetherand that whenonly come the skipping together of when the intervenient the skipping sequence of the intervenient takes place. sequence In all the cases,takes weplace. demonstrated In all the cases, the skippingwe demonstrated of the extra theDHFR skippingexon of 2 the not extra only DHFR at thegenomic exon 2 not level, only but at alsothe genomic at the mRNA level,level, but also which at the led mRNA to the translation level, which of theled functionalto the translation DHFR protein. of the func- tionalWe DHFR previously protein. demonstrated effectiveness of the design of a PPRH core attached to anWe extension previously tail demonstrated to correct point effectiveness mutations of and the its design generality of a PPRH of action core asattached a repair to PPRHan extension technology tail to [22 correct,26]. Since point one mutations limitation and of its this generality design was of action a polypyrimidine as a repair PPRH target sequence in the vicinity of the mutation, we designed long-distance repair PPRHs by technology [22,26]. Since one limitation of this design was a polypyrimidine target se- including an additional pentathymidine loop between the PPRH core and the repair tail quence in the vicinity of the mutation, we designed long-distance repair PPRHs by in- when the target for the repair domain was located hundreds of nt upstream or downstream cluding an additional pentathymidine loop between the PPRH core and the repair tail of the PPRH core. Long-distance repair PPRHs were able to correct their target mutations, when the target for the repair domain was located hundreds of nt upstream or down- indicating that adjacency between the PPRH core and the repair tail was not essential to stream of the PPRH core. Long-distance repair PPRHs were able to correct their target correct the point mutation [22,26]. For the editing PPRHs, the same long-distance approach mutations, indicating that adjacency between the PPRH core and the repair tail was not was used, and the three different PPRH cores located in either the promoter, exon 3 or essential to correct the point mutation [22,26]. For the editing PPRHs, the same long-dis- exon 6 of the DHFR minigene were linked by a pentathymidine loop to the editing tail. tance approach was used, and the three different PPRH cores located in either the pro- As can be seen in Figure4, NB6 cells were able to correctly splice DHFR mRNA to a moter, exon 3 or exon 6 of the DHFR minigene were linked by a pentathymidine loop to certain extent as previously reported when large numbers of NB6 cells were challenged in the editing tail. a DHFR-selective medium [25]. Chen and Chasin described the deletion of the duplicated sequenceAs can in be pD22, seen possibly in Figure by 4, intragenic NB6 cells homologouswere able to correctly recombination, splice DHFR thus restoring mRNA to the a originalcertain extent structure as previously of the pDCHIP1 reported minigene, when large and the numbers appearance of NB6 of pointcells were mutations challenged at the splicein a DHFR-selective sites [25]. Accordingly, medium we[25]. could Chen observe and Chasin a PCR described product fromthe deletion NB6 genomic of the dupli- DNA cated sequence in pD22, possibly by intragenic homologous recombination, thus restoring

Int. J. Mol. Sci. 2021, 22, 3784 8 of 13

with the same size as in the edited colonies, expanding from DHFR exon 1 to 3 (Figure3A). However, in our conditions, these spontaneous revertants from NB6 cells were not able to neither express the DHFR protein nor display its enzymatic activity (Figures6 and7). Nevertheless, this spontaneous deletion was associated with defective processing of DHFR pre-mRNA in NB6 cells, as shown by the levels of intron 1 retention in the corresponding mRNA molecules (Figures4 and5). It is worth mentioning the same inefficient splicing of intron 1 in the pre-mRNA molecules in the edited colonies emerging from transfection with the different editing PPRHs, as shown in Figures4 and5. We speculated that the defective splicing of DHFR pre-mRNA is inherent to the nature of the transfected cell model, since this inefficiency is not observed for the endogenous DHFR gene in UA21 and K1 cells, and that the amount of skipped and correct mRNA achieved upon transfection of the editing PPRHs could be higher in an endogenous gene setting. Nevertheless and despite inefficient processing of DHFR mRNA, we showed that skipping at the DNA level of the additional copy of DHFR exon 2 promoted by editing PPRHs led to the expression of the DHFR protein in these cells with its corresponding enzymatic activity. Up until now, the main strategy to induce exon skipping has been based on antisense oligonucleotides. However, despite the encouraging results and the already available FDA- approved treatments for DMD, it is important to point out that exon skipping by antisense oligonucleotides requires their permanent delivery since this therapeutic approach works exclusively at the mRNA level. Repeated delivery of oligonucleotides is associated with toxicity and absorption by different tissues, mainly, liver and kidneys [27], Despite the safety profile of the current morpholino antisense oligonucleotides approved for DMD treatment, the FDA comments upon kidney toxicity, including potentially fatal glomeru- lonephritis that has been observed after administration of some antisense oligonucleotides and recommends monitoring kidney function in patients taking these drugs. One advantage of the editing PPRH approach is that it promotes exon skipping at the DNA level and therefore does not require permanent treatment. On the other hand, we observed in a screening using PCR arrays for hepatic and renal toxicity that only a low percentage of genes were overexpressed upon transfection of PPRHs. These minor changes in gene expression did not cause any detrimental effect in HepG2 and 786-O human cell lines, respectively, as no toxicity in cell survival assays was observed [28]. Editing PPRHs could be envisaged as an alternative to genome editing technologies and, in particular, to CRISPR/Cas9. Although the frequency of skipping achieved by editing PPRHs is low, it does not require the generation of double-strand breaks. The precise correction of mutations through CRISPR-induced homologous directed repair (HDR) could be achieved, but the current approaches are limited since the frequency of HDR is much lower than that of NHEJ and implies the presence of Cas9, gRNA and donor DNA in the cells. The editing PPRH molecules combine all the elements needed in just one structure that targets a specific region of the DNA through the PPRH core and bears an extension tail that recombines with the original sequence in order to eliminate the intended exon. This structure allows for recombination since triplex-forming oligonucleotides stimulate recombination with donor DNAs depending on HDR [29,30] and transfection of a Rad51 expression vector together with a repair PPRH increased 10-fold their frequency of correction [31], thus confirming that HDR participates in the correction process triggered by repair PPRHs. Several approaches to treat DMD by inducing NHEJ using the CRISPR/Cas9 technology to remove an internal DNA sequence or cause small indels have been described, such as the generation of double-strand breaks on both sides of the genomic region to be removed by a pair of gRNAs or the knockout of splicing sites of exons out of the frame to promote their skipping at the DNA level [32], following a strategy similar to aODN-based exon skipping. However, one of the main concerns with CRISPR/Cas9 is the possibility of small insertions, deletions or substitutions in the edited genome [33–36] that are usually the result Int. J. Mol. Sci. 2021, 22, 3784 9 of 13

of unspeciﬁc cuts of Cas9. On-target effects such as large deletions [37] and unexpected chromosomal truncations [38] have also been reported. In this regard, we determined by whole genome sequencing analyses the absence of any off-target effects in the genomic DNA from repaired cells upon transfection with repair PPRHs with a very similar structure to the present editing PPRHs. Neither unexpected indels caused by a repair PPRH were detected nor the insertion of the repair PPRH itself in any region of the genome [22]. In summary, this study represents a new application of the PPRH technology that pro- vides further knowledge for their usage in genome editing for the treatment of monogenic diseases, either by the correction of point mutations or by exon skipping. Our future work will be aimed at exploring the feasibility of the exon skipping approach by editing PPRHs in endogenous gene loci. In this direction, in the absence of a possible metabolic selection for the corrected cells, next-generation sequencing at high coverage will be needed to evaluate the percentage of gene correction using the editing PPRH technology. In this way, the resulting sequences are aligned against the wildtype reference sequence and the percentage of correction or skipping is assessed with the Low Frequency Variant Detection algorithm. Since the efﬁcacy of the editing procedure is low, next-generation sequencing will allow detecting this range of exon skipping using a depth of sequencing of 10,000× in those approaches without selection of the edited cells.

4. Materials and Methods 4.1. Oligonucleotides PPRHs and primers were synthesized as non-modiﬁed oligodeoxynucleotides by Merck Life Science S.L.U. (Madrid, Spain). They were dissolved in a sterile RNase-free Tris-EDTA buffer (1 mM EDTA and 10 mM Tris, pH 8.0) at 10 µg/µL and stored at −20 ◦C until use. The Triplex-forming Oligonucleotide Target Sequence Search tool available at http://utw10685.utweb.utexas.edu/tfo/ was used to ﬁnd the polypurine tracks present in the DHFR pD22 minigene and thus the polypyrimidine targets in order to design editing PPRHs. Table1 describes all oligonucleotides names and sequences used in this work.

4.2. Cell Culture Chinese hamster ovary cell lines DG44, NB6, UA21 and K1 were maintained at 37 ◦C in a humidified 5% CO2 atmosphere in a Ham’s F12 medium supplemented with 10% fetal bovine serum (both from GIBCO, Fisher Scientific S.L., Madrid, Spain). The cells were detached with 0.05% trypsin (Merck Life Science S.L.U., Madrid, Spain) for expansion and harvesting. To test for the capability of editing PPRHs to cause exon skipping at the DNA level, selection after transfection with the different PPRHs was performed in an RPMI 1640 medium supplemented with 7% dialyzed fetal bovine serum (both from GIBCO, Fisher Scientific S.L., Madrid, Spain), in which only the cells expressing the DHFR protein could survive.

4.3. Transfection of PPRHs and Selection Transfection by editing PPRHs was carried out using 10 µM of the cationic liposome 1,2-Dioleoyl-3-trimethylammonium propane (DOTAP, Biontex, Munich, Germany) following the instructions of the manufacturer. A 200 µL mixture containing a serum-free medium, 10 µM DOTAP and 3–5 µg (117–195 nM) of the editing PPRHs was incubated for 20 min at RT and then added to the cells in 800 µL of a Ham’s F-12 medium containing 10% fetal bovine serum. After 24 h of incubation at 37 ◦C, to select the edited cells, the medium was changed to an RPMI 1640 medium supplemented with 7% dialyzed fetal bovine serum. Each transfection was performed at least three times, and for each successful editing PPRH, three to six colonies from each replicate were expanded.

4.4. DNA Sequencing The Wizard Genomic DNA Purification Kit (Promega, Madrid, Spain) was used to obtain total genomic DNA following the instructions of the manufacturer. The region between DHFR Int. J. Mol. Sci. 2021, 22, 3784 10 of 13

exons 1 and 3 was amplified by PCR using OneTaq DNA Polymerase (New England Biolabs, Ipswich, MA, USA). The primer sequences were 5’-AAGAACGGAGACCTTCCCTGGCCA-3’ in exon 1 and 5’-GAACCAGGTTTTCCGGCCCA-3’ in exon 3. Sequencing was carried out by Macrogen (Amsterdam, the Netherlands).

4.5. RNA Extraction and mRNA Analyses Total RNA from edited cells was extracted using Trizol Reagent (Life Technologies, Madrid, Spain) following the instructions of the manufacturer. RNA concentration was quantified by measuring its absorbance (260 nm) in a Nanodrop ND-1000 spectrophotome- ter (Thermo Scientific, Wilmington, DE, USA). Complementary DNA was synthesized in 20 µL reaction mixture from 1 µg total RNA, 0.5 mM of each deoxyribonucleotide triphos- phate (dNTP, Epicentre, Madison, WI, USA), 250 ng of random hexamers (Roche, Barcelona, Spain), 10 mM dithiothreitol, 200 units of a Moloney murine leukemia virus reverse tran- scriptase (RT), 20 units of an RNase inhibitor and 4 µL buffer (5×) (all three from Lucigen, Middleton, WI, USA). The reaction was incubated at 42 ◦C for 1 h. Then, PCR amplification was performed using 5 µL of the cDNA mixture. PCR reactions were typically carried out as described below. A standard 50 µL mixture contained 5 µL cDNA mixture, 10 µL 5× GC buffer, 0.2 mM dNTPs, 2.5 units of OneTaq (New England Biolabs, Ipswich, MA, USA) and 500 ng of each primer. The primers used were 5’-AAGAACGGAGACCTTCCCTGGCCA-3’ in DHFR exon 1 and 5’-GAACCAGGTTTTCCGGCCCA-3’ in DHFR exon 3. PCR cycling conditions were 3 min at 94 ◦C followed by 30 cycles of 30 s at 94 ◦C, 1 min at 61 ◦C and 1 min at 68 ◦C and a final extension step/stage of 5 min at 68 ◦C. A (-) RT reaction was also amplified for all RNA samples to rule out DNA contamination. PCR products were resolved in a 5% acrylamide gel in 1× TBE and the amplified bands were visualized using ethidium bromide staining. To amplify the region corresponding to DHFR intron 1, the following primers were used: 5’-CCGAGGCGGTTCGCTGAATC-3’ and 5’-CCTGTCACGTGTGCTCAGGC-3’. In order to detect the additional sequence from intron 2 present in pD22, the primers used were 5’-CCGAGGCGGTTCGCTGAATC-3’ and 5’-TCCCACGGGAGACTTCGCACT-3’.

4.6. Western Blot Analyses Total extracts were prepared in a lysis buffer (50 mM HEPES ((4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid), 0.5 M NaCl, 1.5 mM MgCl2, 1 mM EGTA (ethylene glycol- bis(β-aminoethyl ether)-N,N,N0,N0-tetraacetic acid), 10% glycerol, 1% Triton X-100, pH 7.2) supplemented with Protease Inhibitor Mixture (Merck Life Science S.L.U., Madrid, Spain) from the cells harvested by trypsinization. The samples were maintained at 4 ◦C on ice for 1 h with vortexing every 15 min. Cell debris was removed by centrifugation (10,000× g for 10 min) and the total protein concentration was determined in the supernatants using a BioRad protein assay (based on the Bradford method, using bovine serum albumin as a standard (Merck Life Science S.L.U., Madrid, Spain). Total cell extracts (100 µg) were electrophoresed on SDS–12% polyacrylamide gels and transferred to a polyvinylidene diﬂuoride membrane (Immobilon P, Millipore, Madrid, Spain) using a semidry electroblotter. Blots were incubated with antibodies against hamster DHFR (1:200 dilution; Pocono Rabbit Farm & Laboratory, Canadensis, PA, USA), and tubulin (1:100 dilution; CP06, Calbiochem, Merck, Darmstadt, Germany) to normalize the results. The signals were detected with HRP-conjugated anti-rabbit antibodies (1:2500 dilution; P0399, Dako, Denmark) for DHFR or with anti-mouse antibodies (1:2500 dilution; sc-2005, Santa Cruz Biotechnology, Heidelberg, Germany) for tubulin and enhanced chemiluminescence using ECLTM Prime Western Blotting Detection Reagent (GE Healthcare, Barcelona, Spain). Chemiluminescence was detected with Image- Quant LAS 4000 Mini (GE Healthcare, Barcelona, Spain). Int. J. Mol. Sci. 2021, 22, 3784 11 of 13

4.7. DHFR Activity The method to determine DHFR activity is based on the incorporation of radioac- tive deoxyuridine into DNA. DHFR catalyzes transformation of the folate supplied in the medium to tetrahydrofolate, a cofactor needed for the reductive methylation of de- oxyuridylate to thymidylate. Thymidylate is then incorporated into DNA, which is isolated by precipitation [39]. Six-well dishes were plated with either 10,000 NB6 or edited cells in 1 mL RPMI medium. The next day, 2 µCi 6-[3H] deoxyuridine (20 mCi/mmol, Moravek Biochemicals, Inc., USA) was added for 24 h. After two washes with phosphate-buffered saline, the cells were lysed in 100 µL of 0.1% sodium dodecyl sulfate. The lysate was spotted onto 31ET paper (Whatman, Merck Life Science S.L.U., Madrid, Spain), washed three times in 66% cold ethanol containing 250 mM NaCl, dried and counted in a scintillation counter.

4.8. Statistical Analyses All transfections were performed at least in triplicates, and for each experiment, at least ﬁve independent colonies were analyzed for each editing PPRH. For DHFR activity, the data are represented as the means ± SD values of three independent experiments. Statistical analyses were performed using ordinary one-way ANOVA with Dunnett’s multiple comparison tests. Analyses and representation of the data were carried out using the GraphPad Prism version 6.0 software (GraphPad, La Jolla, CA, USA).

Author Contributions: Conceptualization, V.N. and C.J.C.; methodology, V.N.; validation, V.N.; formal analysis, V.N.; writing—original draft preparation, V.N.; writing—review and editing, C.J.C. and V.N.; project administration, V.N.; funding acquisition, V.N and C.J.C. Both authors have read and agreed to the published version of the manuscript. Funding: This research was funded by Ministerio de Ciencia e Innovación, Programa Estatal de I+D+I orientado a los retos de la sociedad, grant number RTI2018-093901-B-I00. The group holds the Quality Mention from Generalitat de Catalunya (2017-SGR-97). Institutional Review Board Statement: Not applicable. Informed Consent Statement: Not applicable. Data Availability Statement: Not applicable. Acknowledgments: We would like to thank Lawrence Chasin (Columbia University, NY) for provid- ing the NB6 cell line and the DHFR antibody. Conﬂicts of Interest: The authors declare no conﬂict of interest.

References 1. Hoffman, E.P.; Brown, R.H.; Kunkel, L.M. Dystrophin: The protein product of the duchenne muscular dystrophy locus. Cell 1987, 51, 919–928. [CrossRef] 2. Mendell, J.R.; Shilling, C.; Leslie, N.D.; Flanigan, K.M.; Al-Dahhak, R.; Gastier-Foster, J.; Kneile, K.; Dunn, D.M.; Duval, B.; Aoyagi, A.; et al. Evidence-based path to newborn screening for duchenne muscular dystrophy. Ann. Neurol. 2012, 71, 304–314. [CrossRef] 3. Koenig, M.; Beggs, A.H.; Moyer, M.; Scherpf, S.; Heindrich, K.; Bettecken, T.; Meng, G.; Müller, C.R.; Lindlöf, M.; Kaariainen, H.; et al. The molecular basis for duchenne versus becker muscular dystrophy: Correlation of severity with type of deletion. Am. J. Hum. Genet. 1989, 45, 498–506. 4. Aartsma-Rus, A.; Fokkema, I.; Verschuuren, J.; Ginjaar, I.; Van Deutekom, J.; Van Ommen, G.J.; Den Dunnen, J.T. Theoretic applicability of antisense-mediated exon skipping for Duchenne muscular dystrophy mutations. Hum. Mutat. 2009, 30, 293–299. [CrossRef][PubMed] 5. Aartsma-Rus, A.; Straub, V.; Hemmings, R.; Haas, M.; Schlosser-Weber, G.; Stoyanova-Beninska, V.; Mercuri, E.; Muntoni, F.; Sepodes, B.; Vroom, E.; et al. Development of Exon Skipping Therapies for Duchenne Muscular Dystrophy: A Critical Review and a Perspective on the Outstanding Issues. Nucleic Acid Ther. 2017, 25, 251–259. [CrossRef] 6. Potaczek, D.P.; Garn, H.; Unger, S.D.; Renz, H. Antisense molecules: A new class of drugs. J. Allergy Clin. Immunol. 2016, 137, 1334–1346. [CrossRef][PubMed] 7. Douglas, A.G.L.; Wood, M.J.A. Splicing therapy for neuromuscular disease. Mol. Cell. Neurosci. 2013, 56, 169–185. [CrossRef] 8. Sardone, V.; Zhou, H.; Muntoni, F.; Ferlini, A.; Falzarano, M.S. Antisense oligonucleotide-based therapy for neuromuscular disease. Molecules 2017, 22, 563. [CrossRef] Int. J. Mol. Sci. 2021, 22, 3784 12 of 13

9. Wang, B.; Li, J.; Xiao, X. Adeno-associated virus vector carrying human minidystrophin genes effectively ameliorates muscular dystrophy in mdx mouse model. Proc. Natl. Acad. Sci. USA 2000, 97, 13714–13719. [CrossRef][PubMed] 10. Echigoya, Y.; Yokota, T. Skipping multiple exons of dystrophin transcripts using cocktail antisense oligonucleotides. Nucleic Acid Ther. 2014, 24, 57–68. [CrossRef] 11. Guncay, A.; Yokota, T. Antisense oligonucleotide drugs for Duchenne muscular dystrophy: How far have we come and what does the future hold? Future Med. Chem. 2015, 7, 1631–1635. [CrossRef][PubMed] 12. Kole, R.; Krieg, A.M. Exon skipping therapy for Duchenne muscular dystrophy. Adv. Drug Deliv. Rev. 2015, 87, 104–107. [CrossRef] 13. Matos, L.; Vilela, R.; Rocha, M.; Santos, J.I.; Coutinho, M.F.; Gaspar, P.; Prata, M.J.; Alves, S. Development of an Antisense Oligonucleotide-Mediated Exon Skipping Therapeutic Strategy for Mucolipidosis II: Validation at RNA Level. Hum. Gene Ther. 2020, 31, 775–783. [CrossRef] 14. Gramlich, M.; Pane, L.S.; Zhou, Q.; Chen, Z.; Murgia, M.; Schötterl, S.; Goedel, A.; Metzger, K.; Brade, T.; Parrotta, E.; et al. Antisense-mediated exon skipping: A therapeutic strategy for titin-based dilated cardiomyopathy. EMBO Mol. Med. 2015, 5, 562–576. [CrossRef][PubMed] 15. Xu, L.; Park, K.H.; Zhao, L.; Xu, J.; El Refaey, M.; Gao, Y.; Zhu, H.; Ma, J.; Han, R. CRISPR-mediated genome editing restores dystrophin expression and function in mdx mice. Mol. Ther. 2016, 24, 564–569. [CrossRef][PubMed] 16. Zhu, P.; Wu, F.; Mosenson, J.; Zhang, H.; He, T.C.; Wu, W.S. CRISPR/Cas9-Mediated Genome Editing Corrects Dystrophin Mutation in Skeletal Muscle Stem Cells in a Mouse Model of Muscle Dystrophy. Mol. Ther. Nucleic Acids 2017, 7, 31–41. [CrossRef] 17. Long, C.; McAnally, J.R.; Shelton, J.M.; Mireault, A.A.; Bassel-Duby, R.; Olson, E.N. Prevention of muscular dystrophy in mice by CRISPR/Cas9-mediated editing of germline DNA. Science 2014, 345, 1184–1188. [CrossRef] 18. Min, Y.L.; Li, H.; Rodriguez-Caycedo, C.; Mireault, A.A.; Huang, J.; Shelton, J.M.; McAnally, J.R.; Amoasii, L.; Mammen, P.P.A.; Bassel-Duby, R.; et al. CRISPR-Cas9 corrects Duchenne muscular dystrophy exon 44 deletion mutations in mice and human cells. Sci. Adv. 2019, 5, eaav4324. [CrossRef] 19. Amoasii, L.; Hildyard, J.C.W.; Li, H.; Sanchez-Ortiz, E.; Mireault, A.; Caballero, D.; Harron, R.; Stathopoulou, T.R.; Massey, C.; Shelton, J.M.; et al. Gene editing restores dystrophin expression in a canine model of Duchenne muscular dystrophy. Science 2018, 362, 86–91. [CrossRef] 20. de Almagro, M.C.; Coma, S.; Noé, V.; Ciudad, C.J. Polypurine hairpins directed against the template strand of DNA knock down the expression of mammalian genes. J. Biol. Chem. 2009, 284, 11579–11589. [CrossRef] 21. Coma, S.; Noé, V.; Eritja, R.; Ciudad, C.J. Strand displacement of double-stranded DNA by triplex-forming antiparallel purine- hairpins. Oligonucleotides 2005, 15, 269–283. [CrossRef] 22. Félix, A.J.; Ciudad, C.J.; Noé, V. Correction of the aprt Gene Using Repair-Polypurine Reverse Hoogsteen Hairpins in Mammalian Cells. Mol. Ther. Nucleic Acids 2020, 19, 683–695. [CrossRef][PubMed] 23. Ciudad, C.J.; Rodríguez, L.; Villalobos, X.; Félix, A.J.; Noé, V. Polypurine Reverse Hoogsteen Hairpins as a Gene Silencing Tool for Cancer. Curr. Med. Chem. 2017, 24, 2809–2826. [CrossRef][PubMed] 24. Félix, A.J.; Solé, A.; Noé, V.; Ciudad, C.J. Gene Correction of Point Mutations Using PolyPurine Reverse Hoogsteen Hairpins Technology. Front. Genome Ed. 2020.[CrossRef] 25. Chen, I.T.; Chasin, L.A. Direct selection for mutations affecting speciﬁc splice sites in a hamster dihydrofolate reductase minigene. Mol. Cell. Biol. 1993, 13, 289–300. [CrossRef][PubMed] 26. Solé, A.; Ciudad, C.J.; Chasin, L.A.; Noé, V. Correction of point mutations at the endogenous locus of the dihydrofolate reductase gene using repair-PolyPurine Reverse Hoogsteen hairpins in mammalian cells. Biochem. Pharmacol. 2016, 110–111, 16–24. [CrossRef][PubMed] 27. Frazier, K.S. Antisense Oligonucleotide Therapies:The Promise and the Challenges from a Toxicologic Pathologist’s Perspective. Toxicol. Pathol. 2015, 43, 78–89. [CrossRef] 28. Félix, A.J.; Ciudad, C.J.; Noé, V. Functional pharmacogenomics and toxicity of PolyPurine Reverse Hoogsteen hairpins directed against survivin in human cells. Biochem. Pharmacol. 2018, 155, 8–20. [CrossRef] 29. Datta, H.J.; Chan, P.P.; Vasquez, K.M.; Gupta, R.C.; Glazer, P.M. Triplex-induced recombination in human cell-free extracts: Dependence on XPA and HsRad51. J. Biol. Chem. 2001, 276, 18018–18023. [CrossRef] 30. Knauert, M.P.; Kalish, J.M.; Hegan, D.C.; Glazer, P.M. Triplex-Stimulated Intermolecular Recombination at a Single-Copy Genomic Target. Mol. Ther. 2006, 14, 392–400. [CrossRef] 31. Solé, A.; Villalobos, X.; Ciudad, C.J.; Noé, V. Repair of single-point mutations by polypurine reverse hoogsteen hairpins. Hum. Gene Ther. Methods 2014, 25, 288–302. [CrossRef][PubMed] 32. Maggio, I.; Stefanucci, L.; Janssen, J.M.; Liu, J.; Chen, X.; Mouly, V.; Gonçalves, M.A.F.V. Selection-free gene repair after adenoviral vector transduction of designer nucleases: Rescue of dystrophin synthesis in DMD muscle cell populations. Nucleic Acids Res. 2016, 44, 1449–1470. [CrossRef] 33. Allen, F.; Crepaldi, L.; Alsinet, C.; Strong, A.J.; Kleshchevnikov, V.; De Angeli, P.; Páleníková, P.; Khodak, A.; Kiselev, V.; Kosicki, M.; et al. Predicting the mutations generated by repair of Cas9-induced double-strand breaks. Nat. Biotechnol. 2018.[CrossRef] 34. Cradick, T.J.; Fine, E.J.; Antico, C.J.; Bao, G. CRISPR/Cas9 systems targeting β-globin and CCR5 genes have substantial off-target activity. Nucleic Acids Res. 2013, 41, 9584–9592. [CrossRef] Int. J. Mol. Sci. 2021, 22, 3784 13 of 13

35. Anderson, K.R.; Haeussler, M.; Watanabe, C.; Janakiraman, V.; Lund, J.; Modrusan, Z.; Stinson, J.; Bei, Q.; Buechler, A.; Yu, C.; et al. CRISPR off-target analysis in genetically engineered rats and mice. Nat. Methods 2018, 15, 512–514. [CrossRef][PubMed] 36. Schaefer, K.A.; Wu, W.H.; Colgan, D.F.; Tsang, S.H.; Bassuk, A.G.; Mahajan, V.B. Unexpected mutations after CRISPR-Cas9 editing in vivo. Nat. Methods 2017, 14, 547–548. [CrossRef] 37. Kosicki, M.; Tomberg, K.; Bradley, A. Repair of double-strand breaks induced by CRISPR–Cas9 leads to large deletions and complex rearrangements. Nat. Biotechnol. 2018, 36, 765–771. [CrossRef] 38. Cullot, G.; Boutin, J.; Toutain, J.; Prat, F.; Pennamen, P.; Rooryck, C.; Teichmann, M.; Rousseau, E.; Lamrissi-Garcia, I.; Guyonnet-Duperat, V.; et al. CRISPR-Cas9 genome editing induces megabase-scale chromosomal truncations. Nat. Commun. 2019, 10, 1136. [CrossRef] 39. Ciudad, C.J.; Urlaub, G.; Chasin, L.A. Deletion analysis of the Chinese hamster dihydrofolate reductase gene promoter. J. Biol. Chem. 1988, 263, 16274–16282. [CrossRef]