DOCSLIB.ORG

Cloning and Characterization of the Gene Cluster Required for Beauvericin Biosynthesis in Fusarium Proliferatum

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Cloning and Characterization of the Gene Cluster Required for Beauvericin Biosynthesis in Fusarium Proliferatum SCIENCE CHINA Life Sciences SPECIAL TOPIC: Biosynthesis and regulation of secondary metabolites in microorganisms July 2013 Vol.56 No.7: 628–637 • RESEARCH PAPER • doi: 10.1007/s11427-013-4505-1 Cloning and characterization of the gene cluster required for beauvericin biosynthesis in Fusarium proliferatum ZHANG Tao1,2†, ZHUO Ying1†, JIA XiaoPeng1,2, LIU JinTao1,2, GAO Hong1, SONG FuHang1, LIU Mei1* & ZHANG LiXin1* 1CAS Key Laboratory of Pathogenic Microbiology and Immunology, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, China; 2University of Chinese Academy of Sciences, Beijing 100049, China Received April 24, 2013; accepted May 28, 2013 Beauvericin, a cyclohexadepsipeptide-possessing natural product with synergistic antifungal, insecticidal, and cytotoxic activi- ties. We isolated and characterized the fpBeas gene cluster, devoted to beauvericin biosynthesis, from the filamentous fungus Fusarium proliferatum LF061. Targeted inactivation of the F. proliferatum genomic copy of fpBeas abolished the production of beauvericin. Comparative sequence analysis of the FpBEAS showed 74% similarity with the BbBEAS that synthesizes the cyclic trimeric ester beauvericin in Beauveria bassiana, which assembles N-methyl-dipeptidol monomer intermediates by the programmed iterative use of the nonribosomal peptide synthetase modules. Differences between the organization of the beau- vericin loci in F. proliferaturm and B. bassiana revealed the mechanism for high production of beauvericin in F. proliferatum. Our work provides new insights into beauvericin biosynthesis, and may lead to beauvericin overproduction and creation of new analogs via synthetic biology approaches. beauvericin, Fusarium proliferatum, biosynthesis gene cluster, synthetic biology Citation: Zhang T, Zhuo Y, Jia X P, et al. Cloning and characterization of the gene cluster required for beauvericin biosynthesis in Fusarium proliferatum. Sci China Life Sci, 2013, 56: 628–637, doi: 10.1007/s11427-013-4505-1 The incidence of invasive fungal infections has dramatically from entomopathogenic fungi, including Beauveria bassi- increased in the past two decades, especially in patients who ana [3]. Its molecular structure consists of an alternating are severely immunocompromised because of cancer chem- sequence of three N-methyl-L-phenylalanine and three otherapy, organ or bone marrow transplantation, or through D-hydroxyisovaleric acids. It has diverse biological func- immunodeficient viral infections [1,2]. Resistance to exist- tions, including insecticidal, synergistic antifungal [1], and ing classes of drugs is also on the rise. In our previous work cytotoxic activities [4]. we showed that beauvericin (BEA) has dramatic synergistic Nonribosomal peptide synthesis occurs via a process of antifungal activity with low dosages of ketoconazole (KTC) stepwise condensations by nonribosomal peptide synthe- against diverse fungal pathogens both in vitro and in vivo tases (NRPSs) [5]. These are modularly organized multi- [1]. Beauvericin belongs to the cyclic nonribosomal hexa- enzyme complexes in which each module is responsible for depsipeptide family of natural products, originally isolated the elongation of proteinogenic and non-protein amino acids, as well as carboxyl and hydroxyacids. Each module of the NRPS system is composed of domains which are distinct †Contributed equally to this work catalytic folds with highly conserved core motifs, im- *Corresponding author (email: [email protected]; [email protected]) © The Author(s) 2013. This article is published with open access at Springerlink.com life.scichina.com www.springer.com/scp Zhang T, et al. Sci China Life Sci July (2013) Vol.56 No.7 629 portant for their catalytic activities [6]. A minimum of three 1 Materials and methods domains are necessary for one NRPS elongation module: an adenylation (A)-domain for substrate recognition and acti- 1.1 Strains, media, and genetic manipulation vation; a peptidyl carrier protein (PCP)-domain that tethers All Escherichia coli strains were grown in Luria-Bertani the growing peptide chain and the incoming aminoacyl unit; (LB) medium. Fusarium proliferatum LF061 was main- and a condensation (C)-domain to catalyze peptide bond tained on potato dextrose agar (PDA). Isolation of Fusarium formation. Optional domains include epimerization (E), genomic DNA was carried out using the modified protocol heterocyclization (Cy), and oxidation (Ox) domains, which from Moller et al. [16]. The genomic library of F. prolifer- may edit the enzyme-bound precursors or intermediates. atum was constructed according to the manufacturer’s in- The full-length NRPS product is normally released by a structions (Epicentre Technologies Corp., Wisconsin, USA, thioesterase (TE) domain giving rise to free acids, lactones, Cat. No. CCFOS059). Agrobacterium tumefaciens AGL-1 or lactams [7]. NRPSs that synthesize cyclooligomer pep- with the plasmid pRF-HU2 [17] was used for Fusarium tides assemble oligopeptide monomer intermediates by the transformation. Antibiotic concentrations routinely used were programmed iterative use of their modules; this differs from ampicillin 100 μg mL1, chloramphenicol 12.5 μg mL1, the classical NRPS paradigm described in bacteria [6], and kanamycin 50 μg mL1, and hygromycin 50 μg mL1. these monomers are also then used in a recursive oligomer- ization and cyclization process [7]. 1.2 Library screening, sequencing, and bioinformatics As previously reported from the Zocher lab, the gene, analysis esyn1, corresponding to the enniatin synthetase from Fusarium equiseti (F. scirpi), encoding an ORF of 9393 bp Two sets of degenerate primers were used to amplify A- (3131 amino acids) has been isolated and characterized domain homologous sequences using F. proliferatum total [8,9]. Beauvericin biosynthesis is catalyzed by the beauver- DNA as the template. The primer pairs EA1f (5′- icin synthetase via a nonribosomal mechanism. The cloning GCYTAYGTYATYTTYACYWSYGG-3′) and EA1r (5′- and enzymatic characterization of the beauvericin synthe- TTYGAYGCYWSYGTYTGG-3′), and EA2f (5′-CCKC- tase from B. bassiana was described by Peeters et al. [10] GRATYTTRACYTGRSWRTCCAT-3′) and EA2r (5′- and Xu et al. [11]. The beauvericin biosynthesis genes are CARATRGTRGTYTCRGTDGGRCCRTA-3′) (S=C, G; clustered with the ketoisovalerate reductase (encoded by the Y=C, T; B=C, G, T; H=A, C, T; R=A, G; W=A, T; D=A, G, kivr gene), which is responsible for catalyzing the NADPH- T), were based on the A3, A8, A4, and A5 motifs of typical specific reduction of ketoisovaleric acid to hydroxyisova- NRPS adenylation domains. This was confirmed by se- lerate [11,12]. In addition to Beauveria, the genera Isaria quencing and BLAST searching. To screen the positive and Fusarium constitute a large group also possessing clones, colony PCR was performed using a pair of specific beauvericin-production capabilities. Those in Fusarium are primers (Table 1). greatly superior in beauvericin production. There is an im- DNA sequencing was conducted by SinoGenoMax Co., pressive series of publications on the fermentation and Ltd (Beijing). Sequencher 4.9 (Gene Codes Corporation, higher productivity of beauvericin derived from Fusarium Michigan, USA) and Vector NTI suite 10.0 (Invitrogen, San species. It has been reported that the titer of beauvericin Diego, USA) were used for sequence assembly and analysis. produced by F. denticulatum could be 3000 μg g1 of dry Gene products of the individual ORFs were deduced and culture [13]. Even in liquid Fusarium-defined medium, F. analyzed using the programs AUGUSTUS [18,19] and oxysprum KFCC 11363P could still produce beauvericin at FGENESH (http://linux1.softberry.com/berry.phtml?topic a level of 420 mg L1; much higher than production in B. =fgenes_plus&group=programs&subgroup=gfs). Gene mo- bassiana [14,15]. However, the beauvericin synthetase and dels were manually curated using exon/intron boundary corresponding encoding gene cluster in Fusarium has not predictions from SPLICEVIEW (http://zeus2.itb.cnr.it/~ been characterized. To gain greater insight into the unique webgene/wwwspliceview_ex.html) and multiple sequence and intriguing features of beauvericin biosynthesis in alignments. The UMA algorithm was used for the predic- Fusarium, we undertook both genetic and biochemical tion of domain boundaries in NRPSs [20], and A domain studies. We describe here the identification and functional specificity signatures were derived by NRPS predictor [21]. analysis of the beauvericin biosynthetic gene cluster in F. TMHMM (http://www.cbs.dtu.dk/services/TMHMM) was proliferatum LF061. Sequence analysis revealed the pres- used for secondary structure analysis. Deduced amino acid ence of a nonribosomal peptide synthetase and a pair of sequences of 17 NRPSs were subjected to protein phyloge- auxiliary pathogenicity genes upstream of beauvericin syn- netic analysis. A phylogenetic tree was generated using the thetase. We also described biochemical experiments sup- neighbor joining method of Saitou and Nei [22] with porting the proposed functions of these encoded biosynthe- MEGA 4.0 software [23]. The length of each branch pair tic enzymes. represents the evolutionary distance between the sequences. 630 Zhang T, et al. Sci China Life Sci July (2013) Vol.56 No.7 Table 1 Primers used in this study Primer Sequence 5′–3′ Description Fragment size EA-QF CAACTGGTCGACCTA AGGGTGTCATGG Fosmid library screening primers EA-QR ATGAGGCCGTCGCCTACTCTGTACC Fosmid library screening primers 750 bp EA-SF GCTTGGACCTCAGCAGTTCG
Load more

Recommended publications
  • Suspect and Target Screening of Natural Toxins in the Ter River Catchment Area in NE Spain and Prioritisation by Their Toxicity
    toxins Article Suspect and Target Screening of Natural Toxins in the Ter River Catchment Area in NE Spain and Prioritisation by Their Toxicity Massimo Picardo 1 , Oscar Núñez 2,3 and Marinella Farré 1,* 1 Department of Environmental Chemistry, IDAEA-CSIC, 08034 Barcelona, Spain; [email protected] 2 Department of Chemical Engineering and Analytical Chemistry, University of Barcelona, 08034 Barcelona, Spain; [email protected] 3 Serra Húnter Professor, Generalitat de Catalunya, 08034 Barcelona, Spain * Correspondence: [email protected] Received: 5 October 2020; Accepted: 26 November 2020; Published: 28 November 2020 Abstract: This study presents the application of a suspect screening approach to screen a wide range of natural toxins, including mycotoxins, bacterial toxins, and plant toxins, in surface waters. The method is based on a generic solid-phase extraction procedure, using three sorbent phases in two cartridges that are connected in series, hence covering a wide range of polarities, followed by liquid chromatography coupled to high-resolution mass spectrometry. The acquisition was performed in the full-scan and data-dependent modes while working under positive and negative ionisation conditions. This method was applied in order to assess the natural toxins in the Ter River water reservoirs, which are used to produce drinking water for Barcelona city (Spain). The study was carried out during a period of seven months, covering the expected prior, during, and post-peak blooming periods of the natural toxins. Fifty-three (53) compounds were tentatively identified, and nine of these were confirmed and quantified. Phytotoxins were identified as the most frequent group of natural toxins in the water, particularly the alkaloids group.
    [Show full text]
  • Cyclodepsipeptide Biosynthesis in Hypocreales Fungi and Sequence Divergence of the Non-Ribosomal Peptide Synthase Genes
    pathogens Article Cyclodepsipeptide Biosynthesis in Hypocreales Fungi and Sequence Divergence of The Non-Ribosomal Peptide Synthase Genes Monika Urbaniak 1,* , Agnieszka Wa´skiewicz 2, Artur Trzebny 3 , Grzegorz Koczyk 4 and Łukasz St˛epie´n 1 1 Plant-Pathogen Interaction Team, Department of Pathogen Genetics and Plant Resistance, Institute of Plant Genetics of the Polish Academy of Sciences, Strzeszy´nska34, 60-479 Pozna´n,Poland; [email protected] 2 Department of Chemistry, Pozna´nUniversity of Life Sciences, Wojska Polskiego 75, 60-625 Pozna´n,Poland; [email protected] 3 Molecular Biology Techniques Laboratory, Faculty of Biology, Adam Mickiewicz University Poznan, Uniwersytetu Pozna´nskiego6, 61–614 Poznan, Poland; [email protected] 4 Functional Evolution of Biological Systems Team, Department of Biometrics and Bioinformatics, Institute of Plant Genetics of the Polish Academy of Sciences, Strzeszy´nska34, 60-479 Pozna´n,Poland; [email protected] * Correspondence: [email protected]; Tel.: +48-616-55-02-19 Received: 19 June 2020; Accepted: 7 July 2020; Published: 9 July 2020 Abstract: Fungi from the Hypocreales order synthesize a range of toxic non-ribosomal cyclic peptides with antimicrobial, insecticidal and cytotoxic activities. Entomopathogenic Beauveria, Isaria and Cordyceps as well as phytopathogenic Fusarium spp. are known producers of beauvericins (BEAs), beauvenniatins (BEAEs) or enniatins (ENNs). The compounds are synthesized by beauvericin/enniatin synthase (BEAS/ESYN1), which shows significant sequence divergence among Hypocreales members. We investigated ENN, BEA and BEAE production among entomopathogenic (Beauveria, Cordyceps, Isaria) and phytopathogenic (Fusarium) fungi; BEA and ENNs were quantified using an LC-MS/MS method. Phylogenetic analysis of partial sequences of putative BEAS/ESYN1 amplicons was also made.
    [Show full text]
  • Enniatin and Beauvericin Biosynthesis in Fusarium Species: Production Profiles and Structural Determinant Prediction
    toxins Article Enniatin and Beauvericin Biosynthesis in Fusarium Species: Production Profiles and Structural Determinant Prediction Vania C. Liuzzi 1, Valentina Mirabelli 2,3, Maria Teresa Cimmarusti 1,3, Miriam Haidukowski 1, John F. Leslie 4, Antonio F. Logrieco 1, Rocco Caliandro 2,*, Francesca Fanelli 1,* and Giuseppina Mulè 1 1 Institute of Sciences of Food Production, CNR, 70126 Bari, Italy; [email protected] (V.C.L.); [email protected] (M.T.C.); [email protected] (M.H.); [email protected] (A.F.L.); [email protected] (G.M.) 2 Institute of Crystallography, CNR, 70126 Bari, Italy; [email protected] 3 Department of Economics, University of Foggia, 71121 Foggia, Italy 4 Department of Plant Pathology, Kansas State University, Manhattan, 66506 KS, USA; jfl@ksu.edu * Correspondence: [email protected] (R.C.); [email protected] (F.F.); Tel.: +39-080-592-9150 (R.C.); +39-080-592-9317 (F.F.) Academic Editor: Marc Maresca Received: 29 November 2016; Accepted: 18 January 2017; Published: 25 January 2017 Abstract: Members of the fungal genus Fusarium can produce numerous secondary metabolites, including the nonribosomal mycotoxins beauvericin (BEA) and enniatins (ENNs). Both mycotoxins are synthesized by the multifunctional enzyme enniatin synthetase (ESYN1) that contains both peptide synthetase and S-adenosyl-L-methionine-dependent N-methyltransferase activities. Several Fusarium species can produce ENNs, BEA or both, but the mechanism(s) enabling these differential metabolic profiles is unknown. In this study, we analyzed the primary structure of ESYN1 by sequencing esyn1 transcripts from different Fusarium species.
    [Show full text]
  • Identification and Production of Beauvericin by Fusarium Subglutinansand F
    Vol.64: e21200088, 2021 https://doi.org/10.1590/1678-4324-2021200088 ISSN 1678-4324 Online Edition Article - Agriculture, Agribusiness and Biotechnology Identification and Production of Beauvericin by Fusarium subglutinansand F. sacchari from Sugarcane AeshahMhana Mohammed1, https://orcid.org/0000-0002-8001-4175 Laith Khalil Tawfeeq Al-Ani 2,3* https://orcid.org/0000-0001-5138-0224 1University of Baghdad,, College of Education for pure science (Ibn al-Haytham), Department of Chemistry, Baghdad, Iraq; 2University of Baghdad, College of Agriculture Engineering Science, Department of Plant Protection, Baghdad, Iraq; 3Universiti Sains Malaysia, School of Biology Science, Minden, Pulau Pinang, Malaysia. Editor-in-Chief:Alexandre Rasi Aoki Associate Editor:Acácio Antonio Ferreira Zielinski Received: 2020.03.08; Accepted: 2021.02.24 *Correspondence: [email protected] (L.K.T.A.A.). HIGHLIGHTS Isolation two species of pathogens Fusarium from sugarcane. Identification the difference in morphological characterization between two species of Fusarium. Determination the ability of pathogens Fusarium to produce mycotoxin Beauvericin. Determination of the toxicity Beauvericin on the brine shrimp. Abstract: Fusarium is producing several important mycotoxins including beauvericin (BEA). Two species of Fusarium viz. F. subglutinans and F. sacchari cause the Pokkahboeng disease of sugarcane. The studies on the occurrence and toxicity of BEA are scarce. Therefore, this study aimed to identify the isolates of Fusarium and detect their ability to produce BEA. The toxicity of BEA was also tested on brine shrimp Artemia salina. Many isolates of Fusarium were isolated from the infected plants of sugarcane in Malaysia. We identified the species of Fusarium according to their morphological characteristics. The capability of Fusarium isolates for producing the BEA was estimated by using a thin layer chromatography.
    [Show full text]
  • Beauvericin Product Number B7510 Storage
    Beauvericin Product Number B7510 Storage Temperature 2-8 °C Product Description Preparation Instructions Molecular Formula: C45H57N3O9 This product is soluble in acetonitrile (1 mg/ml). Molecular Weight: 784.0 It is also soluble in methanol (1 mg/ml). CAS Number: 26048-05-5 Melting Point: 93-94 °C1, 147-148 °C2 References Specific Rotation: +69.0° (benzene)2 1. Hamill, R. L., et al., The structure of beauvericin, a new depsipeptide antibiotic toxic to Artemia salina. Beauvericin is an antibiotic that occurs naturally in the Tetrahedron Lett., 10(49), 4255-4258 (1969). fungus Beauveria bassiana.1 It is a member of the 2. Ovchinnikov, Y. A., et al., The synthesis and some enniatin family of antibiotics and has activity against properties of beauvericin. Tetrahedron Lett., Gram-positive bacteria and mycobacteria, as well as 12(2), 159-162 (1971). against insects and brine shrimp. Beauvericin is a 3. Braden, B., et al., Crystal structure of a cyclic hexadepsipeptide with alternating beauvericin-barium picrate complex. J. Am. L-N-methylphenylalanyl and D-a-hydroxyisovaleryl Chem. Soc., 102(8), 2704-2709 (1980). residues. Its ion-complexing capability allows 4. Steinrauf, L. K., "Beauvericin and the other beauvericin to transport alkaline earth metal and alkali ennantins", in Metal Ions in Biological Systems, metal ions across cell membranes.3,4 A detailed 19, Sigel, H., ed., Marcel Dekker (New York, NY: review of beauvericin and other enniatins has been 1985), pp. 139-171. published.4 The production of beauvericin and other 5. Fotso, J., et al., Production of beauvericin, mycotoxins by several Fusarium species has been moniliformin, fusaproliferin, and fumonisins b1, b2, 5 studied by HPLC.
    [Show full text]
  • FUMONISIN B1 1. Exposure Data
    FUMONISIN B1 This substance was considered by a previous working group in June 1992 (IARC, 1993). Since that time, new data have become available, and these have been incor- porated into the monograph and taken into consideration in the present evaluation. 1. Exposure Data 1.1 Chemical and physical data 1.1.1 Nomenclature Chem. Abstr. Serv. Reg. No.: 116355-83-0 Chem. Abstr. Serv. Name: 1,2,3-Propanetricarboxylic acid, 1,1′-[1-(12-amino-4,9,11- trihydroxy-2-methyltridecyl)-2-(1-methylpentyl)-1,2-ethanediyl] ester Synonyms: FB1; macrofusine 1.1.2 Structural and molecular formulae and relative molecular mass O COOH O CCH2 CH CH2 COOH NH2 OH OH CH3 H3CCHCHCH2 CH (CH2)4 CH CH2 CH CH2 CH CH CH (CH2)3 CH3 OH CH3 HOOC CH2 CH CH2 C O COOH O C34H59NO15 Relative molecular mass: 721 1.1.3 Chemical and physical properties of the pure substance From WHO (2000) unless otherwise noted (a) Description: White hygroscopic powder (b) Melting-point: Not known (has not been crystallized) (c) Spectroscopy: Mass spectral and nuclear magnetic resonance spectroscopy data have been reported (Bezuidenhout et al., 1988; Laurent et al., 1989a; Plattner et al., 1990; Savard & Blackwell, 1994) –301– 302 IARC MONOGRAPHS VOLUME 82 (d ) Solubility: Soluble in water to at least to 20 g/L (National Toxicology Program, 2000); soluble in methanol, acetonitrile–water (e) Octanol/water partition coefficient (log P): 1.84 (Norred et al., 1997) (f ) Stability: Stable in acetonitrile–water (1:1) at 25 °C; unstable in methanol at 25 °C, forming monomethyl or dimethyl esters (Gelderblom et al., 1992a; Visconti et al., 1994); stable in methanol at –18 °C (Visconti et al., 1994); stable at 78 °C in buffer solutions at pH between 4.8 and 9 (Howard et al., 1998) 1.1.4 Analysis Methods for the analysis of fumonisins have been extensively reviewed (WHO, 2000).
    [Show full text]
  • Advances in Occurrence, Importance, and Mycotoxin Control Strategies: Prevention and Detoxification in Foods
    foods Review Advances in Occurrence, Importance, and Mycotoxin Control Strategies: Prevention and Detoxification in Foods Sofia Agriopoulou *, Eygenia Stamatelopoulou and Theodoros Varzakas Department of Food Science and Technology, University of the Peloponnese, Antikalamos, 24100 Kalamata, Greece; [email protected] (E.S.); [email protected] (T.V.) * Correspondence: [email protected]; Tel.: +30-27210-45271 Received: 11 December 2019; Accepted: 22 January 2020; Published: 28 January 2020 Abstract: Mycotoxins are toxic substances that can infect many foods with carcinogenic, genotoxic, teratogenic, nephrotoxic, and hepatotoxic effects. Mycotoxin contamination of foodstuffs causes diseases worldwide. The major classes of mycotoxins that are of the greatest agroeconomic importance are aflatoxins, ochratoxins, fumonisins, trichothecenes, emerging Fusarium mycotoxins, enniatins, ergot alkaloids, Alternaria toxins, and patulin. Thus, in order to mitigate mycotoxin contamination of foods, many control approaches are used. Prevention, detoxification, and decontamination of mycotoxins can contribute in this purpose in the pre-harvest and post-harvest stages. Therefore, the purpose of the review is to elaborate on the recent advances regarding the occurrence of main mycotoxins in many types of important agricultural products, as well as the methods of inactivation and detoxification of foods from mycotoxins in order to reduce or fully eliminate them. Keywords: mycotoxins; occurrence; detoxification; decontamination; foodstuffs; aflatoxins; fumonisins; ochratoxins; food safety; risk 1. Introduction Mycotoxins belong to the category of toxic secondary metabolites, and they have a low molecular weight. They are produced by filamentous fungi belonging to the phylum Ascomycota or molds, and they have great importance in the health of humans and animals, being the cause of acute and chronic diseases [1–4].
    [Show full text]
  • Selected Fungal Natural Products with Antimicrobial Properties
    molecules Review Selected Fungal Natural Products with Antimicrobial Properties 1, , 2, Dorota Jakubczyk * y and Francois Dussart y 1 Institute of Bioorganic Chemistry, Polish Academy of Sciences, 61-704 Pozna´n,Poland 2 Department of Agriculture, Horticulture and Engineering Science, Scotland’s Rural College (SRUC), Edinburgh EH9 3JG, UK; [email protected] * Correspondence: [email protected]; Tel.: +48-61-8528503 (ext. 184) These authors contributed equally to this work. y Academic Editor: Raphaël E. Duval Received: 31 January 2020; Accepted: 14 February 2020; Published: 18 February 2020 Abstract: Fungal natural products and their effects have been known to humankind for hundreds of years. For example, toxic ergot alkaloids produced by filamentous fungi growing on rye poisoned thousands of people and livestock throughout the Middle Ages. However, their later medicinal applications, followed by the discovery of the first class of antibiotics, penicillins and other drugs of fungal origin, such as peptidic natural products, terpenoids or polyketides, have altered the historically negative reputation of fungal “toxins”. The development of new antimicrobial drugs is currently a major global challenge, mainly due to antimicrobial resistance phenomena. Therefore, the structures, biosynthesis and antimicrobial activity of selected fungal natural products are described here. Keywords: antimicrobial properties; antimicrobial resistance; biosynthesis; ergot alkaloids; fungal metabolites; natural products; peptides; polyketides; terpenoids 1. Introduction Natural products (NPs) are a very rich source of antimicrobial drugs. They constitute more than two-thirds of clinically used antibiotics and half of anticancer drugs [1]. Molecules biosynthesised by fungi are a diverse and useful group of NPs. Plant endophytic and pathogenic fungi produce many secondary metabolites that play important roles in virulence and competition against other microbes.
    [Show full text]
  • Impact of Beauvericin on Membrane Properties of Young Initial Leaves of Maize with Different Susceptibility to Fusarium
    Impact of beauvericin on membrane properties of young initial leaves of maize with different susceptibility to Fusarium J. Pavlovkin1, I. Mistríková2, K. Jašková1, L. Tamás1 1Institute of Botany, Slovak Academy of Sciences, Bratislava, Slovakia 2Department of Pharmacognosy and Botany, Faculty of Pharmacy, Comenius University, Bratislava, Slovakia ABSTRACT In the present study the impact of beauvericin (BEA) on the cell membrane properties and respiration of young initial leaves of maize were studied using two maize cultivars differing in their susceptibility to Fusarium sp. BEA significantly depolarized EM of leaf parenchymal cells and this depolarization showed time and dose dependency regardless on the sensitivity of maize cultivars to Fusarium. However, the extent of BEA-induced depolarization was 2–5 times higher in sensitive cv. Pavla than in tolerant cv. Lucia. Membrane permeability and K+ leakage from leaves cells treated with BEA was higher in sensitive cv. Pavla but the differences were not so considerable than the depolarization of EM. Treatment of maize young initial leaves with 40 μmol BEA significantly inhibited respiration. In accord with electrophysiological measurements inhibition of respiration was higher in sensitive cv. Pavla show- ing 70% inhibition already after 90 min of BEA treatment while in tolerant cv. Lucia inhibition represented only 27%. The biological activity of BEA seems to be mediated by the ability of BEA to affect membrane permeability and ion transport. This is probably the initial effect of BEA on plant cell leading to subsequent effect on other cell organelles (mitochondria) and cell metabolism. Keywords: beauvericin; membrane potential; membrane permeability; respiration; phytotoxicity; young maize leaves; Zea mays L.
    [Show full text]
  • Enniatin and Beauvericin Biosynthesis in Fusarium Species: Production Profiles and Structural Determinant Prediction
    toxins Article Enniatin and Beauvericin Biosynthesis in Fusarium Species: Production Profiles and Structural Determinant Prediction Vania C. Liuzzi 1, Valentina Mirabelli 2,3, Maria Teresa Cimmarusti 1,3, Miriam Haidukowski 1, John F. Leslie 4, Antonio F. Logrieco 1, Rocco Caliandro 2,*, Francesca Fanelli 1,* and Giuseppina Mulè 1 1 Institute of Sciences of Food Production, CNR, 70126 Bari, Italy; [email protected] (V.C.L.); [email protected] (M.T.C.); [email protected] (M.H.); [email protected] (A.F.L.); [email protected] (G.M.) 2 Institute of Crystallography, CNR, 70126 Bari, Italy; [email protected] 3 Department of Economics, University of Foggia, 71121 Foggia, Italy 4 Department of Plant Pathology, Kansas State University, Manhattan, 66506 KS, USA; jfl@ksu.edu * Correspondence: [email protected] (R.C.); [email protected] (F.F.); Tel.: +39-080-592-9150 (R.C.); +39-080-592-9317 (F.F.) Academic Editor: Marc Maresca Received: 29 November 2016; Accepted: 18 January 2017; Published: 25 January 2017 Abstract: Members of the fungal genus Fusarium can produce numerous secondary metabolites, including the nonribosomal mycotoxins beauvericin (BEA) and enniatins (ENNs). Both mycotoxins are synthesized by the multifunctional enzyme enniatin synthetase (ESYN1) that contains both peptide synthetase and S-adenosyl-L-methionine-dependent N-methyltransferase activities. Several Fusarium species can produce ENNs, BEA or both, but the mechanism(s) enabling these differential metabolic profiles is unknown. In this study, we analyzed the primary structure of ESYN1 by sequencing esyn1 transcripts from different Fusarium species.
    [Show full text]
  • Diplomarbeit / Diploma Thesis
    DIPLOMARBEIT / DIPLOMA THESIS Titel der Diplomarbeit / Title of the Diploma Thesis „Role of calcium in the cytotoxicity of fungal-derived cyclohexadepsipeptides“ verfasst von / submitted by Kerstin Gürth angestrebter akademischer Grad / in partial fulfilment of the requirements for the degree of Magistra der Pharmazie (Mag.pharm.) Wien, 2017 / Vienna, 2017 Studienkennzahl lt. Studienblatt / A 449 degree programme code as it appears on the student record sheet: Studienrichtung lt. Studienblatt / Diplomstudium Pharmazie degree programme as it appears on the student record sheet: Betreut von / Supervisor: Ao. Univ. Prof. Dr. Rosa Lemmens-Gruber Danksagung Allen voran möchte ich mich bei meiner Betreuerin ao. Univ. Prof. Dr. Rosa Lemmens- Gruber für die Bereitstellung dieses Diplomarbeitsthemas bedanken sowie dafür, dass sie stets Zeit für die Beantwortung meiner Fragen fand. Bei Frau Pakiza Rawnduzi bedanke ich mich für die Einführung in die Arbeitstechniken der Zellkultur. Außerdem bedanke ich mich bei meinen Studienkolleginnen und Freundinnen Rosie und Anna für die jahrelange gegenseitige Unterstützung, die vieles erleichtert hat, sowie dafür, dass die Studienzeit dank ihnen nicht nur aus Lernen bestand. Zu guter Letzt möchte ich mich vor allem bei meinen Eltern und meiner Schwester Petra dafür bedanken, dass sie mir das Studium nicht nur finanziell ermöglicht haben, sondern mir auch in schwierigen Phasen dieser Zeit beigestanden sind, indem sie mich stets ermutigt und immer an mich geglaubt haben. Table of contents 1 Introduction ...................................................................................................................
    [Show full text]
  • Fast Screening of Antibacterial Compounds from Fusaria
    toxins Communication Fast Screening of Antibacterial Compounds from Fusaria Teis Esben Sondergaard 1,*, Marlene Fredborg 2, Ann-Maria Oppenhagen Christensen 1, Sofie K. Damsgaard 1, Nikoline F. Kramer 1, Henriette Giese 1 and Jens Laurids Sørensen 1,3 1 Department of Chemistry and Bioscience, Aalborg University, Frederik Bajers Vej 7H, DK-9220 Aalborg Ø, Denmark; [email protected] (A.-M.O.C.); [email protected] (S.K.D.); [email protected] (N.F.K.); [email protected] (H.G.); [email protected] (J.L.S.) 2 Department of Animal Science, Faculty of Science and Technology, Aarhus University, Blichers Allé 20, DK-8830 Tjele, Denmark; [email protected] 3 Department of Chemistry and Bioscience, Aalborg University, Niels Bohrs Vej 8, 6700 Esbjerg, Denmark * Correspondence: [email protected]; Tel.: +45-9940-8524 Academic Editor: Sven Dänicke Received: 4 November 2016; Accepted: 25 November 2016; Published: 29 November 2016 Abstract: Bio-guided screening is an important method to identify bioactive compounds from fungi. In this study we applied a fast digital time-lapse microscopic method for assessment of the antibacterial properties of secondary metabolites from the fungal genus Fusarium. Here antibacterial effects could be detected for antibiotic Y, aurofusarin, beauvericin, enniatins and fusaric acid after six hours of cultivation. The system was then used in a bio-guided screen of extracts from 14 different Fusarium species, which had been fractionated by HPLC. In this screen, fractions containing the red pigments aurofusarin and bikaverin showed effects against strains of Lactobacillus and Bifidobacterium. The IC50 for aurofusarin against Lactobacillus acidophilus was 8 µM, and against Bifidobacterium breve it was 64 µM.
    [Show full text]