Meprin Metalloproteases Modulate Epithelial Barrier Integrity and Monocyte Migration

Home , Collagenase, MEP1B, Meprin A, Meprin B, Serralysin

The Pennsylvania State University The Graduate School

MEPRIN METALLOPROTEASES MODULATE EPITHELIAL BARRIER INTEGRITY AND MONOCYTE MIGRATION

A Dissertation in Biochemistry and Molecular Biology by Jialing Bao

Submitted in Partial Fulfillment of the Requirements for the Degree of

Doctor of Philosophy

May 2012

The dissertation of Jialing Bao was reviewed and approved* by the following:

Judith S. Bond Evan Pugh and Distinguished Professor, Chair of Biochemistry and Molecular Biology Dissertation Advisor Co-Chair of Committee

Gail L. Matters Associate Professor of Biochemistry and Molecular Biology Co-Chair of Committee

Sergei A. Grigoryev Professor of Biochemistry and Molecular Biology

W. Brian Reeves Professor of Medicine

Harriet C. Isom Distinguished Professor of Microbiology and Immunology

* Signatures are on file in the Graduate School

Abstract

Meprin metalloproteases have been implicated in a number of normal developmental and pathological processes. However, it has been difficult to establish the cellular and molecular basis for the biological role of meprin metalloproteases in health and disease, possibly because of the large number of metalloproteases, many having overlapping substrate specificities. A number of important biological molecules have been demonstrated to be meprin substrates in vitro, such as extracellular matrix and cytokines. With the development of congenic mice lacking meprin activity, it has been possible to relate in vitro results with in vivo data to examine cellular and molecular processes. The hypothesis of the thesis work is that meprins relax epithelial barriers by cleaving tight junction proteins, and facilitate monocyte migration. The study demonstrated that homomeric meprin A and meprin B cleaved the tight junction protein occludin, but not claudin-4, in membrane fractions from MDCK cells. Meprin A, but not meprin B, added exogenously to MDCK monolayers cleaved occludin. Meprin A, but not meprin B, cleaved recombinant occludin extracellular loops, and the cleavage site was determined in the first extracellular loop of occludin. Different cleavage site preferences at extracellular regions explain the different results between meprin A and meprin B to cleave occludin in intact cells and cell extacts. The biological relevance of the in vitro experiments was demonstrated by studies in cell culture, in vivo and ex vivo. Meprin A disrupted the immunostaining of tight junction proteins occludin and ZO-1 on MDCK monolayers. In addition, meprin A impaired the barrier function of MDCK monolayers, as shown by increased small molecule flux and decreased transepithelial electrical resistance. To elucidate the role of meprin A in acute urinary tract infections, meprin A was infused into the mouse bladder and the effects on bladder epithelium wall was investigated. The results showed that active meprin A increased the permeability of the epithelium as demonstrated by the influx of a fluorescene dye. The hypothesis that meprin A disrupts epithelial barriers and facilitates monocyte migration was further investigated by co-culturing monocytes with MDCK monolayers and measuring monocyte migration. Monocytes from mice lacking

iii

meprin A (meprin αKO) were less able to migrate through MDCK monolayers than monocytes from wild-type mice. It is concluded that the capability of meprin A to disrupt epithelial barriers is one important factor by which meprin A modulates inflammation.

Table of Contents List of Figures………………………………………………………………………...ix List of Tables………………………………………………………...……………….xii List of Abbreviations………………………………………………...…………… xiii Acknowledgements………………………………………………………...……….xvi

Chapter 1. Introduction 1.1 Overview…………………………………………………………………………….1 1.2 Proteases……………………………………………………………….....……..…...1 1.2.1 Protease classification………………………………………………………..1 1.2.2 Classification and structure of metalloprotease……………………………2 1.2.3 Function of metalloprotease………………………………………………....2 1.3 Meprin metalloproteases…………………………………………………………….4 1.3.1 History and classification of meprin………………………………………..4 1.3.2 Meprin domain structure and oligomerization…………………………….5 1.3.3 Meprin tissue expression…………………………………………………….7 1.3.4 Activation and inhibition of meprins……………………………………….9 1.3.5 Meprin peptide bond and substrate specificities ……………………….…9 1.3.6 Meprins in inflammation………………………………………………...... 11 1.4 Epithelial barrier and leukocyte migration……………………………………….12 1.4.1 Epithelial barrier functions……………………………...………………...12 1.4.2 Tight junctions and component proteins…………………………...…….13 1.4.3 Tight junctions and leukocyte migration……………………………...….16 1.5 Rationale for this work………………………………………………………...….17

Chapter 2. Materials and methods 2.1 Meprins………………………………………………………………………...…...18 2.1.1 Meprin purification, activation and activity assays……………..……...18 2.1.2 Meprin activity inhibition………………………………………………..19

2.2 Cell culture……………….……………………………………………………..….19 2.3 Animal model……………………………..…………………………….………….19 2.3.1 Generation and validation of meprin αKO mice………………………..19 2.3.2 Anesthesia..………………………………………………………………...20 2.3.3 Transurethral catheterization…………………………………………….20 2.3.4 Assessment of bladder permeability……………………………………...21 2.4 Preparation of recombinant occludins……………………………………….…...21 2.4.1 Recombinant occludin (49-290 amino acids)……………………………21 2.4.2 MBP conjugated occludin extracellular loops…………………………..21 2.4.2.1 Construction of occludin extracelluar loops expressing vectors…………………...…………………………..21 2.4.2.2 Induction and purification of MBP-occludin extracellular loops………..……………………………………………………..22 2.5 Assays………………………………………………..………..…………………….22 2.5.1 MDCK epithelial barrier set-up………………………………………….22 2.5.2 Immunocytochemistry and confocal microscopy of tight junction proteins……………………………………………………………………..24 2.5.3 Permeability assay………………………………………………………...24 2.5.4 Transepithelial electrical resistance (TER)……………………………...24 2.5.5 Cell viability………………………………………………………………..25 2.5.6 Preparation of membrane-enriched fractions of MDCK cells…………25 2.5.7 Western blot analysis……………………………………………………...26 2.5.8 Isolation of monocytes from mouse bone marrow………………………26 2.5.9 Transmigration of monocyte through MDCK monolayers……….……..26 2.6 Statistical analysis and graphing software……………………………..………..27

Chapter 3. Meprin A weakens epithelial barriers and facilitates monocyte migration 3.1 Meprin A impairs MDCK monolayer’s barrier function……….…….………..28 3.2 Meprin A increases mouse bladder permeability………………………...... 32 3.3 Impaired barrier function was not due to cell toxicity of meprin A….……….34

3.4 Meprin A disrupts TJs on MDCK monolayers……………..…………..….……35 3.5 Occludin in MDCK monolayer is degraded by exogenous meprin A….……....39 3.6 Claudin-4 in MDCK monolayer is not degraded by exogenous meprin A….....43 3.7 Meprin A does not disrupt claudin-4 staining on MDCK monolayers………...43 3.8 Occludin in MDCK cell extracts is cleaved by meprin A…...……..….………...46 3.9 Claudin-4 in MDCK cell extracts is not degraded by meprin A…...………...... 48 3.10 Recombinant occludin is cleaved by meprin A…………………………….…...49 3.11 Meprin A regulates monocyte transmigration…………………………………54

Chapter 4. Determine the cleavage site(s) of meprin A on occludin 4.1 Construction of recombinant maltose binding protein (MBP) conjugated occludin extracelluar loops……….….……………...…………………………….56 4.2 Occludin extracellular loops are cleaved by meprin A……………..……..…….56 4.3 Determination of the occludin cleavage site(s) by Mass-spectrometric analysis……………………………………………………………………...………60

Chapter 5. Meprin B weakens epithelial barriers 5.1 Meprin B impairs MDCK monolayer’s barrier function……....……………62 5.2 Meprin B disrupts TJs on MDCK monolayers…………………....………...….65 5.3 Meprin B has little proteolytic activity on occludin in MDCK monolayer…...65 5.4 Occludin in MDCK cell extracts is cleaved by meprin B………………………69 5.5 Claudin-4 in membrane fractions of MDCK cells is not degraded by meprin B…………………………………………………………………...……..71

Chapter 6. General conclusions and discussion 6.1 Meprins in inflammation: acute and chronic conditions…….………..….…….72 6.2 Meprins cleave certain tight junction proteins…………..….………….……….75 6.3 Meprins modulate epithelial barrier functions…………………….………...….76 6.4 Meprins facilitate leukocyte migration……………………………….……...…..79 6.5 Meprins modulate cytokine profiles in inflammation………………….……….80

vii

6.6 Meprins participation in wound healing and tissue repair……………...….….80 6.7 Closing……………………………………………………………………………..81

Appendix: Characterization of immune-cell derived meprin A in a model of inflammatory bowel disease A.1 Overview……………………………………………………………...……………85 A.2 Methods………………………………………………………………...…………..85 A.2.1 Bone marrow transplantation………………………………..…...…….85 A.2.2 Induction of experimental Ulcerative Colitis…………………..………86 A.2.3 Measurement of weight loss and disease activity index…………..…...86 A.2.4 Myeloperoxidase assay………………………………………………….86 A.3 Results……………………………………………………………………..………87 A.3.1 Mixed background meprin αKO showed greater weight loss after DSS treatment………………………………………………………….87 A.3.2 Congenic meprin αKO and wild-type mice lost similar percentage of weight after DSS treatment…………………………………………….87 A.3.3 Bone marrow transplantation……………………………………..……90 A.3.4 Meprin αKO recipient mice show greater weight loss after DSS challenge………….……………………………………………………..90 A.3.5 Meprin WT to αKO chimeras have higher DAI scores after DSS challenge…………….…………………………………………………..95 A.3.6 Meprin αKO recipientmice and WT recipient mice have comparable levels of colon inflammation……….…………………………………..96

References……………………………………………………………………………99

viii

List of Figures Figure 1.1 Classification of proteolytic enzymes……………………………………....3 Figure 1.2 Meprin subunits and domain structures…………………………………….6 Figure 1.3 Meprin isoforms and oligomerization…………………………...... 8 Figure 1.4 Meprin substrate specificities……………………………………………...10 Figure 1.5 Tight junctions component proteins and Adherens junctions……………..14 Figure 2. Diagram of ex vivo MDCK epithelial barrier set-up……………...... 23 Figure 3.1 MDCK monolayer permeability to FITC-dextran (40 kDa) was increased after exposure to active meprin A ……………………………….…29 Figure 3.2 MDCK monolayer’s permeability to FITC-dextran (10 kDa) was significantly increased after exposure to active meprin A …………30 Figure 3.3 The transepithelial electrical resistance (TER) across MDCK monolayers was decreased after exposure to active meprin A…………………………31 Figure 3.4 The bladder permeability to sodium fluorescein was increased after exposure to active meprin A ………………………………………..……33 Figure 3.5 Meprin A has no cytotoxicity on MDCK cells……………………………34 Figure 3.6 Loss of occludin staining at MDCK cell surface after active meprin A treatment…………………………………………………………………36 Figure 3.7 Loss of ZO-1 staining at MDCK cell surface after active meprin A treatment…………………………………………………………………38 Figure 3.8 Computational predictions by PoPS……………………………………...40 Figure 3.9 Degradation of occludin in MDCK monolayers by meprin A……...…….41 Figure 3.10 Meprin A does not cleave claudin-4 in MDCK monolayers……………...43 Figure 3.11 Loss of occludin staining, but not claudin-4 staining, at MDCK cell surface after active meprin A treatment…………………………………………..44 Figure 3.12 Cleavage of occludin in membrane-enriched fractions of MDCK cells by meprin A……………………………………...... 46 Figure 3.13 Meprin A does not cleave claudin-4 in MDCK membrane fractions……..48 Figure 3.14A Recombinant occludin is cleaved by homomeric meprin A (Coomassie stain)………………………………………………………………………50 Figure 3.14B Recombinant occludin is cleaved by homomeric meprin A (Western blot

assay)…………………………………………………………………...... 51 Figure 3.15 Meprin A regulates monocytes transmigration…………………………...55 Figure 4.1 pMTTH cloning/expressing region………………………………………57 Figure 4.2 Occludin extracellular loop 1 is cleaved by meprin A…………………...58 Figure 4.3 Occludin extracellular loop 2 is cleaved by meprin A……………...... 59 Figure 4.4 Protein sequence of occludin and the cleavage site determined by Mass Spectrometry analysis…………………………………………...……….61 Figure 5.1 MDCK monolayer permeability was increased after exposure to active meprin B………………………………………………………………….63 Figure 5.2 Homomeric meprin B does not significantly decrease trans-epithelial electrical resistance (TER)…………...……...…………………………...64 Figure 5.3 Meprin B disrupted the immunostaining of ZO-1 on MDCK monolayer..66 Figure 5.4 Meprin B does not cleave occludin in MDCK monolayers……………...67 Figure 5.5 Cleavage of occludin in membrane-enriched fractions of MDCK cells by meprin B………………………………………………………………….69 Figure 5.6 Meprin B does not cleave claudin-4 in MDCK membrane fractions…….71 Figure 6.1 Proteases in disease and inflammation…………………………………...73 Figure 6.2 Meprins’ effects on junctional proteins and barrier function…………….78 Figure 6.3A Modulation of meprins in acute inflammation in wild-type mice..………83 Figure 6.3 B Comparison of acute inflammation in wild-type and KO mice…………..84

Appendix Figure A1 Mixed background meprin αKO mice showed greater weight loss after DSS challenge…………………………………………………………...88 Figure A2 Congenic meprin aKO and WT mice showed similar percentage of weight loss after DSS challenge…………………………………………………89 Figure A3 Bone marrow transplantation…………………………………………….91 Figure A4. Meprin αKO recipient mice show greater weight loss after DSS treatments compared to wild-type mice………………………………….94 Figure A5 Meprin WT to αKO chimeras have higher DAI scores after DSS treatments compared to wild-type mice………………………………….95

Figure A6 Meprin αKO recipient mice have less colon shortening after DSS treatments compared to wild-type mice…………………………….……96 Figure A7 Meprin αKO recipient mice and WT recipient mice have comparable levels of colon inflammation………………………………………….....97

List of Tables Table 1. Computational prediction of meprins cleaving tight junction proteins…….40 Table 2. Densitometry of meprin A cleavage of occludin in MDCK monolayer…...42 Table 3. Densitometry of meprin A cleavage of occludin in MDCK membrane fractions………………………………………………………….………….47 Table 4A. Densitometry of meprin A cleavage of recombinant occludin (Coomassie stain)……………… ………………………………………………………...52 Table 4B. Densitometry of meprin A cleavage of recombinant occludin (Western blot assay)………………………………………………………………………...53 Table 5. Densitometry of meprin B cleavage of occludin in MDCK monolayers…...68 Table 6. Densitometry of meprin B cleavage of occludin in MDCK membrane fractions……………………………………..……………………………….70 Table 7. Survival rate of bone marrow transplanted mice…………….……………...92 Table 8. Average of daily body weight of bone marrow transplanted mice treated with DSS…………...……………………………………………………….93

xii

List of Abbreviations ADAM A Disintegrin And Metalloproteinase BBB Blood Brain Barrier BSA Bovine Serum Albumin BUN Blood Urea Nitrogen CCL CC chemokine Ligand CD Crohn’s Disease CXCL CXC chemokine Ligand DAI Disease Activity Index DC Dendritic Cell DMSO Dimethyl Sulfoxide DSS Dextran Sulfate Sodium E. coli Escherichia coli ECM Extracellular Matrix EDTA Ethylene Diamine Tetraacetic Acid EGF Epidermal Growth Factor ELISA Enzyme-Linked Immunosorbent Assay ER Endoplasmic Reticulum FBS Fetal Bovine Serum FITC Fluorescein Isothiocyanate HEK Human Embryonic Kidney HTAB Hexadecyltrimethylammonium Bromide I Inserted domain i.p. intraperitoneal IBD Inflammatory Bowel Disease IFN Interferon IL Interleukin Ki inhibition constant KO Knockout LB Luria Bertani LPS Lipopolysaccharide

xiii

MAM Meprin A5 protein tyrosine phosphatase μ MBP Maltose Binding Protein MBL Mannose Binding Lectin MCP-1 Monocyte Chemoattractant Protein 1 MDCK Madin Darby Canine Kidney MEM Minimum Essential Medium MHC Major Histocompatibility Complex MMP Matrix Metalloprotease MPO Myeloperoxidase MTT 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide MyD88 Myeloid Differentiation Primary Response Protein 88 NaFl Sodium Fluorescein NF-κB Nuclear factor-kappa B NK Natural Killer OD Optical Density PAGE Polyacrylamide Gel Electrophoresis PBS Phosphate Buffered Saline PCR Polymerase Chain Reaction PMN Polymorphonuclear Leukocytes PoPS Prediction of Protease Specificity RANTES Regulated on Activation Normal T cell Expressed and Secreted RNA Ribonucleic Acid S Signal sequence SDS Sodium Dodecyl Sulfate SNP Single Nucleotide Polymorphism STI Soybean Trypsin Inhibitor TACE Tumor necrosis factor α (TNFα) Converting Enzyme TGF Transforming Growth Factor TIMP Tissue Inhibitor of Metalloproteases TLR Toll-Like Receptors TM Transmembrane Domain

xiv

TNFα Tumor Necrosis Factor α TRAF Tumor necrosis factor Receptor Associated Factor UC Ulcerative Colitis UTI Urinary Tract Infection WT Wild-type

Acknowledgements This is a holiday season that everybody is sending and receiving good wishes with beloved family and friends. I would very much like to share this joyful mood and express my warm and heartfelt appreciation to people who have been enormously helpful and supportive along the way throughout my graduate career and without whom this thesis dissertation would never have been possible. First and foremost, I would like to express gratitude to my mentor and thesis advisor Dr. Judith S. Bond. I am sincerely grateful for her mentorship and encouragement throughout the years. She has always supported me, never gives up on me and pushed me through the hard times. I also admire the scientific freedom that she gave me and the critical thinking that she embedded in the back of my mind. Dr. Bond also taught me the importance of looking into bigger scientific pictures and collaborating with scientific community. The opportunities she provided me to share my work and being recognized by peers will be a most valuable fortune for my future career. I would also like to thank Dr. S. Gaylen Bradley for his brilliant ideas and continued interest in my work. His constant “nagging” is what really thought-stimulating and always keeps me motivated whenever I was about to slack off. I am thankful to Dr. Gail Matters. Her encouragement and confidence in me regardless of success or failure have founed my confidence as a researcher. I have had many stimulating discussions with her and that have taken my work miles ahead. My thesis committee members, Dr. Sergei Grigoryev, Dr. W. Brian Reeves and Dr. Harriet Isom, have always been helpful and supportive throughout the years. Their advice and criticism of my thesis work helped to mold my thinking into a more sophisticated and critically-scientific way. I would like to extend my thanks to Dr. David Antonetti who used to work in the Department of Microbiogy for his help with MDCK cell culture and barrier function measurements; Dr. Fan Tian from the Department of Biochemistry and Molecular Biology for his instrumental help with the construction and purification of recombinant occludins, without which the thesis work could not have been completed. I express my thanks to the past and present members of the Bond laboratory. My colleagues in the Bond lab certainly make working in this lab a great pleasure, for their

xvi

support, careness and stimulating discussions. Dr. Renee Yura has been extremely helpful throughout the years. She taught me many things from technique skills, scientific writing to how to enjoy life and work hard at the same time. Tim Keiffer and I joined the lab one year apart, thus we experienced lots of things together and became good friends. His help and encouragement really make the graduate career more tolerable. I would also like to thank Ge Jin, Sanjita Banerjee, Moige Ongeri and John Bylander for their help throughout the years. My thanks to the Biochemistry Office especially Ruth Dean, and to the Graduate Student Office as well as Kathy Simon. Finally, I want to recognize the support and encouragement from my parents, Chengqun Wu and Anquan Bao, and other family members, for their love, understanding and support.

xvii

Chapter 1: Introduction 1.1 Overview Meprin metalloproteases have been implicated in a large number of normal developmental and pathological processes, including the varied expressions in mouse kidney/intestine from embryo to adulthood, the dissemination of monocytes from bone marrow, as well as the inflammatory bowel disease and urinary tract infections [1-4]. Histologic studies and gene expression analysis have provided insights into the anatomic distribution of meprins and their temporal appearance and disappearance at various sites and at various stages of development. Other studies have focused on substrate specificity to gain insight into the biologic role of meprins. However, the cellular and molecular basis for the biologic role of meprin metalloproteases in health and disease still needs to be elucidated. With the development of congenic mice, it is possible to relate studies using in vitro and in vivo models to probe the cellular and molecular roles of the meprins. The model examined in the present study focuses on soluble homomeric meprin A as a determinative factor in disrupting an epithelial barrier. MDCK cells were used to investigate the molecular basis of meprin actions. The hypothesis is that meprin A impairs epithelial barrier by cleaving tight junction proteins, and facilitates monocyte migration. Inflammation is a hallmark of many diseases that have been linked to meprin metalloproteases, for example, acute renal failure, inflammatory bowel disease and urinary tract infections in both the murine models and humans. In this study, direct evidence has been obtained that soluble homomeric meprin A selectively degrades epithelial tight junction proteins with concurrent loss of barrier integrity. Before presenting the rational for the experimental approaches addressed here, the current level of understanding of meprins and epithelial tight junction is reviewed briefly.

1.2 Proteases 1.2.1 Protease classification Proteases are enzymes that catalyze proteolytic reactions in which peptide bonds in a protein or peptide are hydrolyzed. Proteases form the largest enzyme gene family among all enzymes in vertebrates, and 1-5% of gene content in all organisms [5]. Proteases are expressed by nearly all cell types and throughout the life span of nearly all

organisms [6-8]. Thus, proteases are involved in a wide variety of biological processes, such as growth, fertilization, digestion, apoptosis, cytokine regulation, extracellular matrix (ECM) remodeling and cell invasion [9-11]. There are six protease classes based on the catalytic mechanisms of proteases (Figure 1.1). They are serine, cysteine, threonine, aspartate, glutamate and metallo proteases [12, 13]. For example, serine proteases, including trypsin and thrombin, require a serine in the active site; while the catalytic mechanism of metalloproteases involves a metal, usually zinc, in the active site. The ligands co-ordinating the metal could be histidine, glutamic acid, aspartic acid, arginine or lysine. The catalytic mechanism for metalloproteases in general is that, the glutamic acid residue within the catalytic motif activates the metal ion-bound H2O molecule, which provides the nucleophile that cleaves the peptide bond [14].

1.2.2 Classification and structure of metalloproteases Metalloproteases include non-zincins, inverzincins and zincins. Zincins, which have the conserved zinc binding motif HEXXH (H=Histidine, E=Glutamic acid, X=any amino acid), are composed of aspzincins, gluzincins and metzincins. Metzincin metalloproteases have a characteristic ‘met turn’ beneath the active site and a conserved zinc binding motif HEXXHXXG/NXXH/D (H=Histidine, E=Glutamic acid, G=Glycine, N=Asparagine, D=Aspartic acid, X=any amino acid) [15]. Leishmanolysins, pappalysins, serralysins, ADAMs (A Disintegrin And Metalloproteinase), MMPs (matrix metalloproteinases) and astacins all belong to the metzincin superfamily.

1.2.3 Function of metalloprotease Metzincins are involved in a wide variety of biological processes and in many life processes, such as digestion, angiogenesis and metastasis. The role of metalloproteases in inflammation processes is of particular interest in the current work. The accumulating studies indicated that metzincins are involved in multiple aspects of inflammation, including host defense, leukocyte migration, cytokines modulation, epithelial remodeling and wound healing [16-18]. There is evidence that metzincins mediate ectodomain

cleavage, which is a determinative step to modulate the activities of many membrane- associated molecules, including cytokines/chemokines, receptors and cell adhesion molecules [10, 19]. For example, TACE (TNFα converting enzyme, one of the ADAMs)

Proteases

Serine Cysteine Metallo- Threonine Aspartate Glutamate Proteases Proteases Proteases Proteases Proteases Proteases

Non-Zincins Zincins Inverzincins

Gluzincins Metzincins Aspzincins

Leishmanolysins Serralysin MMPs Pappalysins ADAMs Astacins

Meprins

Figure 1.1 Classification of proteolytic enzymes. There are six proteases classes: serine proteases (Ser), cysteine proteases (Cys), metalloproteases, threonine proteases (Thr), aspartate and glutamate proteases (Asp/Glu). Metalloproteases include non-zincins, inverzincins and zincins. Zincins are composed of gluzincins, aspzincins and metzincins. Astacins, leishmanolysins, serralysins, pappalysins, matrix metalloproteases (MMPs), a disintegrin and metalloprotease (ADAMs) all belong to metzincins category. Meprin metalloproteases belong to the astacin family, which has a signature sequence in protease domain: HEXXHXXGFXHEXXRXDR.

is able to release TNFα from cells. TACE also mediates the shedding of ICAM-1 (intercellular adhesion molecule 1) to facilitate leukocyte adhesion and transmigration during inflammation [19]. Several studies have implicated MMPs in inflammation. Multiple MMPs are expressed during wound healing and are active in epithelial/tissue remodeling [20]. In addition to that, matrix metalloproteases (e.g., MMP-7, MMP-9) mediated cleavages of tight junction proteins and adherence junction proteins are important mechanisms of epithelial/endothelial damage. For example, inhibiting MMP-9- mediated occludin degradation can attenuate blood-brain barrier disruption in cerebral ischemia [21, 22].

1.3 Meprin metalloproteases 1.3.1 History and classification of meprin Meprin metalloproteases were first purified and characterized from BALB/C mouse kidney as a glycoprotein with a subunit molecular mass of 81 kDa (heteromeric meprin A) [23]. This protease was able to degrade azocasein and the activity could be inhibited by metal chelators such as EDTA. It was distinctive from other known metalloproteases in many aspects, such as lack of inhibition by phosphoramidon or TIMPs (tissue inhibitors of metalloproteases), common inhibitors of several other metalloproteases such as MMPs [23, 24]. In 1983, it was found that certain strains of mice had low azocaseinase activity (later termed “low-meprin”) in the kidney (e.g., C3H/He mice), while some strains had high azocaseinase activity (“high-meprin”) in the kidney (e.g., BALB/C and C57BL/6 mice). The cross between “high-meprin” and “low- meprin” strains of mice gave high-meprin offsprings indicating the trait of “low-meprin” to be recessive [25, 26]. This led to further studies to identify two meprin subunits, meprin alpha (α) and meprin beta (β). Low-meprin stains (C3H/He mice) have only meprin β expression and in latent form, while high-meprin strains (C57BL/6 mice) express both α and β subunits with α in the active form [27-29]. The locations of meprin genes were determined to be on mouse chromosomes 17 (Mep-1a) and 18 (Mep-1b), and human chromosomes 6p (MEP1A) and 18q (MEP1B) respectively. The meprin α gene was shown be linked to the major histocompatibility

complex (MHC) [30-32]. This is noteworthy because many genes located in or near the MHC are important in immune processes. Meprin metalloproteases belong to the astacin family of the metzincin superfamily. Meprin α and meprin β subunits are approximately 32 and 36 % identical to astacin respectively within their protease domains [33]. Astacin is a digestive enzyme originally found in crayfish. Several hundred astacin family metalloproteases have been identified, and are classified into three major groups: tolloids/BMP1 (Bone Morphogenetic protein) proteinases, hatching enzymes and meprins [13]. All astacin family metalloproteases have a signature sequence in the protease domain: HEXXHXXGFXHEXXRXDR. In addition, most astacin family members contain signal/pro-sequence and EGF (epidermal growth factor)-like domains [33]. Meprins are distinct from other astacins by possessing a transmembrane domain.

1.3.2 Meprin domain structure and oligomerization Meprins are composed of two evolutionary related subunits, alpha (α) and beta (β). Meprin α and β subunits are 42% identical in amino acid sequence and have similar domain structures. Both subunits are multi-domain proteases containing a signal sequence (S), prosequence [34], protease domain, meprin A5 protein tyrosine phosphatase μ (MAM) domain, tumor necrosis factor receptor associated factor (TRAF) domain, EGF-like domain, transmembrane (TM) domain, and a C-terminal (C) domain [35] (Figure 1.2). The signal sequence directs the protein into the rough endoplasmic reticulum (ER). The pro-sequence needs to be cleaved off for the enzyme to gain proteolytic activity. The protease domain is 34% identical to crayfish astacin in amino acid sequence. Homology models indicate that the protease domain contains a five-stranded β-sheet, three α-helices and a characteristic Met-turn [13, 36]. The MAM domain has been suggested to be involved in protein-protein interactions and signal transduction [37, 38]. The MAM domain is present in the extracellular region of functionally diverse proteins, such as ALK (anaplastic lymphoma kinase) and EGFL6 (epidermal growth factor-like protein 6) [37]. Meprins are the only membrane proteins that have an extracellular TRAF domain, which is implicated in protein-protein interaction and signal transduction [39,

40]. The TRAF domain in meprins is thought to be involved in oligomerization of meprin subunits [41]. For example, the TRAF domain of rat meprin β is proposed to form intercesubunit disulfide bridges [42]. The function of meprin’s EGF-like domain is not clear so far, however the tolloids EGF-like domains are thought to be important for substrate recognition and binding [43, 44]. The C-termini domains of meprin α and β subunits are different in many ways. For example, human meprin α has only six amino acids, while the one of human mepirn β consists of 28 amino acids and has a phosphorylation site [45]. A unique sequence in meprin α is the inserted (I) domain, which is cleaved during biosynthesis. This results in the loss of the EGF and transmembrane domains and the release of this subunit from the membrane.

Meprin α S Pro Protease MAM TRAF I EGF TM C

Meprin β S Pro Protease MAM TRAF EGF TM C

Figure 1.2 Meprin subunits and domain structures. Meprin metalloproteases are composed of meprin α and meprin β subunits. Both subunits contain a signal sequence (S), prosequence, protease domain, meprin A5 protein tyrosine phosphatase µ (MAM) domain, tumor necrosis factor receptor associated factor (TRAF) domain, EGF-like domain, transmembrane (TM) domain, and a c-terminal (C) domain. The meprin α subunit contains an additional inserted (I) domain between EGF and TRAF domains. Thus, while the meprin β subunit is a membrane-bound protein, the meprin α subunit is proteolytically processed at the I domain (black arrow) during biosynthesis thus loses its transmembrane domain.

There are three meprin isoforms: the heteromeric meprin A (α2β2, α3β1) and meprin B (β2) are membrane-bound, while the homomeric meprin A (α2) is secreted into the lumen of the intestine and urinary tract (Figure 1.3). Cysteine residues in the MAM domain were found to be involved in the inter-subunit S-S bridging in α2, β2 and α/β dimerization [42, 46]. Electron microscopy studies showed that the higher associations were of a non-covalent nature [47]. While meprin B could only form dimers, heteromeric meprin A was restricted to tetramers. Homomeric meprin A, on the other hand, formed crescent shaped or ring structures composed of as high 100 subunits, making them the largest known secreted protease [28, 47, 48].

1.3.3 Meprin tissue expression Meprins are abundantly expressed in the brush border membranes of polarized epithelial cells lining in the intestine and proximal tubules in kidney [23, 49]. In addition to the kidney and intestine, meprins have also been found in other tissues, such as salivary glands, heart and the skin [50, 51]. A recent study indicated that meprins are also found in the brain [52]. Of particular interest to current study, meprins have also been detected in certain population of immune cells, including macrophages of mesenteric lymph nodes, leukocytes from lamina propria of human inflammatory bowel tissue and monocytes in bone marrow [1, 3]. In addition, meprins are at high concentrations in human urine in women with urinary tract infection [4]. The localization of meprins in brush borders of epithelial cells and immune cells indicate that meprins may play important roles in host defense and inflammatory responses. Meprin expression is highly regulated, in different species/strains and throughout development stages. For example, meprin α mRNA is present in the fetal mouse intestine and increases after birth, yet markedly decreased after weaning; while meprin β mRNA becomes the predominant isoform present in the mouse intestine after weaning [2]. Meprin expression in kidney differs in mouse strains as mentioned earlier [27]. The expression of meprins in human kidney is still not clear, yet it is reported to be active and the expression levels are variable [53] (Yura Thesis Dissertation, 2008).

α α α α α α α α α α β β β α α β β α

S--S S--S S--S S--S S--S S--S S--S S--S S--S S--S S--S S--S S--S S--S S--S S--S S--S S--S Plasma S--S

Membrane

Meprin B Heteromeric meprin A Homomeric meprin A

Figure 1.3 Meprin isoforms and oligomerization. There are three meprin isoforms. Meprin B (β2) is membrane-bound and is composed of meprin β subunits only. Heteromeric meprin A (α2β2 and α3β1) is also membrane-bound, but composed of both meprin α and β subunits. Homomeric meprin A (oligomers of α2 dimer) is secreted. The oligomerization status depends on protein concentration, activation status, salt concentration etc. The number of interacting subunits can be much higher than illustrated here in the figure (8 subunits), such as up to 100 subunits.

1.3.4 Activation and inhibition of meprins During biosynthesis and after post-translational processing, meprins are expressed as either transmembrane- or secreted proteins. Newly synthesized meprins contain a prosequence that keeps meprins catalytically inactive. Trypsin-like serine proteases, such as plasmin that is activated by fibroblasts-secreted proteases, will activate meprins in vivo [1, 54, 55]. To activate latent recombinant meprins in vitro, trypsin and meprins were incubated at a ratio of 1:20 (w/w, trypsin:meprin) at 37 oC for 30-60 min. Meprin activity can be assessed by using fluorogenic substrates [56]. Briefly, meprin A activity was assayed with a bradykinin analog BK+ (Abz-ARg-Pro-Pro-Gly-Phe/Ser-Pro-Phe-ARg- Lys(Dnp)-Gly-OH; while meprin B activity was assayed with orcokinin and cholecystokinin analog OCK+ (Abz-Met-Gly-Trp-Met/Asp-Glu-Ile-Asp-Lys(Dnp)-Ser- Gly-OH. As metalloproteases, meprin activity can be inhibited by metal chelators, such as EDTA. Meprins can also be inhibited by hydroxamic acid derivatives such as batimastat, galardin and Pro-Leu-Gly-hydroxamate, and by thiol-based compounds such as captopril [24]. To date, the only endogenous inhibitor reported for meprins is mannose binding lectin (MBL). MBL interacts with meprin through high mannose N-glycans and is purported to inhibit meprin activity [57]. MBL is usually found in serum and at inflammation sites, suggesting a role of regulating meprin activity during inflammation. The most potent exogenous meprin inhibitor is actinonin, which is a naturally occurring antibacterial hydroxamate. Actinonin is more potent inhibitor of meprin α than meprin β, with a Ki of 20 nM to human meprin α while a Ki of 1.7µM to meprin β [13, 24].

1.3.5 Meprin peptide bond and substrate specificities Both meprin α and β subunits are capable of hydrolyzing a wide range of substrates, including extracellular matrix proteins (ECM) such as laminins, collagen IV and gelatin. However, the peptide bond specificities of the meprin α and β subunits are strikingly different. Meprin α prefers small or hydrophobic residues at the P1 and P1’ sites, and proline is preferred at the P2’ site. For meprin β, acidic amino acids such as aspartic acid and glutamic acid are preferred amino acids at P1/P1’ sites (Figure 1.4) [13, 58, 59]. As the result, there are some substrates that can only be hydrolyzed by either

Scissile Bond N—P4—P3—P2—P1------P1’—P2’—P3’—P4’—C

Meprin α: Meprin β:

Figure 1.4 Meprin substrate specificities. On top shows the scissile bond subjected to proteolytic cleavage and the flanking amino acid positions. Lower figure is adapted from Sterchi et al (2008). showing the meprin substrate specificities. The size of the letters reflects the relative abundance of the respective single letter coded amino acid residues in substrate proteins at the P4 through P4’ position [13]. Meprin α prefers small or hydrophobic residues at the P1 and P1’ sites, while meprin β prefers acidic amino acids such as aspartic acid and glutamic acid at P1 and P1’ positions.

meprin α or meprin β. For example, bradykinin and substance P can only be degraded by meprin α, while orcokinin is one of the best substrates for meprin β [56, 60]. The different substrate specificities of meprin subunits may be due to their different active site residues. Meprin α has aromatic residues (tyrosine, phenylalanine and tryptophan) in the active site, while meprin β has basic residues (lysine and arginine) in the active site, which may form salt bridges with acidic residues in the substrate [61] Recent studies have expanded meprin substrates to include cytokines, chemokines and cell-cell interaction proteins. For example, meprin A has been reported to digest CCL3 (MIP-1α) and CCL5 (RANTES), while meprin B is able to degrade CCL25 (TECK) and active pro-IL18 by removing the propeptide [62, 63]. Of particular interest to the current study is the fact that meprins are capable of cleaving cell-cell interaction proteins. For example, meprin B has been reported to cleave E-cadherin at an extracellular site in epithelial cells. The cleavage leads to weakened cell-cell adhesions [64]. Other extracellular matrix-maintaining proteins, such as lysyl oxidase, is also reported to be cleaved by meprins [13, 65]. The ability of meprins to modulate cytokines, chemokines and cell-cell interactions implies that meprins play an essential role in inflammation.

1.3.6 Meprins in inflammation and metastasis Accumulating studies indicate the roles of meprins in inflammation and involvement in several chronic and acute diseases. In the kidney, meprins are involved with both chronic and acute kidney diseases. For example, meprin β has been reported to be the candidate gene for diabetic nephropathy in the Pima Indian population. Out of 19 single nucleotide polymorphisms (SNPs) in the MEP1B gene, there is one that results in one amino acid change in the C-terminus of cytoplasmic tail, which might affect trafficking of protein to the cell surface, thus enhance fibrosis incidence [66]. In an experimental model of acute renal failure, such as ischemia reperfusion, meprins are re- located from the epithelial cell surface into the cytoplasm, concomitant with enhanced tissue damage [67, 68]. Experiments using meprin knockout mice demonstrated that renal ischemia reperfusion damage of meprin β knockout (βKO) mice was much less severe than wild-type mice [69]. In another experimental model of acute disease, urinary tract infection, meprin A has been shown to enhance renal damage and bladder inflammation

after LPS challenge. Meprin α knockout (αKO) mice displayed lower blood urea nitrogen levels and decreased nitric oxide levels compared to wild-type mice. Meprin αKO mice also exhibited less bladder permeability and leukocyte infiltration than wild- type mice after LPS administration [4]. Taken together, these effects may be caused by the proteolytic activity of meprins on cytoskeletal proteins, basolateral membrane or cell- cell interaction complexes. Meprins are also involved in the chronic inflammation of intestine. Polymorphisms in the human MEP1A gene have been correlated with inflammatory bowel diseases (IBD) [70, 71]. In an experimental model of ulcerative colitis, meprin αKO mice were more susceptible to injury and inflammation than wild-type counterparts. The lamina propria expressed meprins may be involved in epithelial recovery during inflammation (Banerjee Dissertation, 2008); while the infiltrated leukocytes expressed meprins further adds to the proteolytic activities of meprins [72, 73]. As a result, the outcome of the chronic intestinal inflammation may be defined by the combined effects of meprins on multiple substrates, including ECM proteins, cell-cell adhesion proteins and cytokines. Meprins are also implicated in cancer and metastasis. Meprin α is expressed by multiple cancer cell lines, such as Caco-2 cells and MDA-MB-435 cells [74, 75]. Meprin β mRNA is also expressed in multiple cancer cell lines, such as MCF-7 and SK-BR-3 [76]. In addition, when MDA-MB-435 cells were treated with meprin α inhibitor actinonin, less invasion through matrigel was observed, indicating that meprin α has role in cell migration and invasion [75]. Meprin α is also expressed by colon cancer cells. In fact, the expressed meprin α is secreted from both the apical and basolateral membranes in those cells. Meprin α secreted to the basolateral membrane may degrade ECM proteins, and thus facilitate cell migration and metastasis [13, 74].

1.4 Epithelial barrier and leukocyte migration 1.4.1 Epithelial barrier functions Epithelium, such as the airway epithelium and intestinal epithelium, is the interface of internal tissues with the outside environment and forms a physiological barrier. The main functions of epithelial barriers are regulating the passage of ions, water

and various macromolecules through paracellular spaces and providing the first line of defense against exogenous pathogens. For example, epithelial barriers are able to interfere with virus access to receptors within the basolateral membrane, and thus prevent viral dissemination [77]. The integrity of an epithelial barrier can be quantified and measured by properties such as paracellular permeability to solutes and electrical resistance. Studies have demonstrated that the permeability of epithelium is closely related to the transmigration of neutrophilic granulocytes between epithelial cells [78]. Epithelial cells are attached to each other by cell-cell adhesions, including tight junction (TJs) proteins, adherens junction (AJs) proteins, gap junction proteins, and desmosomes [79, 80]. Tight junction proteins are of particular interest to the current study as they represent the most apical cell-cell adhesions in the epithelium. Tight junctions are essential for maintaining the epithelial barrier functions, enabling adjacent cell communications and influencing cell migration [81, 82]. Tight junctions are composed of a series of proteins, such as occludin and claudins, and are components of an interacting protein complex. Basolateral to TJs are adherens junctions. Adherens junctions, composed of series of proteins, including E-cadherin and catenin, are also important in maintaining intercellular contacts [83]. Together, the cell-cell junctions help to define the features of epithelium and to maintain the proper functioning of epithelial barrier.

1.4.2 Tight junctions and component proteins Tight junctions are composed of over 40 proteins to form a complex of interacting proteins and act in concert to regulate epithelial barrier properties. The TJs complexes usually contain transmembrane proteins, peripheral membrane proteins and the interacting cytoskeleton proteins (Figure 1.5). Adherens junctions is also showed in this figure.

The transmembrane tight junction proteins include occludin, claudin family members and junctional adhesion molecule [44]. Occludin, one of the first TJ proteins to be identified, has four transmembrane domains [84]. It has a cytoplasmic N-terminus, two extracellular loops, one intracellular loop and a cytoplasmic C-terminus. Occludin has 522 amino acids, and is well conserved in human, mouse, rat and dog [85]. Several

lines of evidence demonstrated that occludin contributes to barrier function. For example, knockdown of occludin by siRNA increased the epithelial permeability to small molecules [86]. This is consistent with a study showing that, by using synthetic peptides

Tight junctions

Figure 1.5 Tight junctions component proteins and Adherens junctions. Tight junctions represent the most apical cell-cell adhesions. Transmembrane tight junction proteins include occludin (orange color), claudin family members (green color) and junctional adhesion molecule (dark purple color). Scaffolding proteins include the zonula occludens (ZO) family members, such as ZO-1, ZO-2 and ZO-3 (pink color). Cytoskeletal proteins include actin (blue color). Adherens junctions locates beneath TJs to the basolateral side of cell. Component proteins include cadherins (yellow color), and catenins (dark green), which ssociate with both cadherins and cytoskeletal protein actin. TJs and AJs are complexes of interacting proteins and act in concert to regulate barrier properties.

corresponding to the second extracellular loop of occludin, epithelial barrier function was perturbed as shown by increased permeability to 3K and 40K dextran and decreased transepithelial electrical resistance (TER) . Occludin is also involved in tight junction protein trafficking. Phosphorylation at the C-terminus of occludin (e.g., Ser-490) in bovine retinal endothelial cells (BRECs) regulates occludin ubiquitination and tight junction protein trafficking [87]. In addition, occludin has also been shown to mediate leukocyte migration. Neutrophils, one of the first phagocytic immune cell types to accumulate at sites of inflammation, have been shown to migrate through a paracellular route. Expression of mutant occludin bearing mutations in the extracellular loops which increase the TER value can inhibit neutrophil migration across the Madine Darby Canine Kidney (MDCK) cell monolayers [88]. There are 24 claudin family members identified so far, with molecular masses ranging from 20 to 27 kDa. Similar to occludin, claudins also have four transmembrane domains, two extracellular loops, and cytoplasmic N- and C-termini. Claudins are the only junctional proteins known to express variably in different tissues [89]. For example, claudin-2, claudin-3 and claudin-4 are expressed in intestine/colon, bladder and kidney; while claudin-5 is known to be predominantly endothelial and is expressed in cells of the renal vasculature and blood-brain barrier [90-92]. The major physiological role of claudins is to determine the selectivity of paracellular transport, probably by forming paracellular pores that allow selective passage of small solutes and ions [93]. One feature of claudins is that they contain a PDZ (postsynaptic density 95, Disk large, Zona occludens-1) -binding motif in the C-terminus. The PDZ-binding motif allows the direct interactions of claudins with cytoplasmic scaffolding proteins, such as ZO-1, ZO-2, and ZO-3. The interaction with scaffolding proteins helps to associate transmembrane claudins with cytoplasmic cytoskeletal proteins such as actin [94, 95]. Another transmembrane component is JAM (Junctional Adhesion Molecule) protein family, including JAM-A, JAM-B and JAM-C. Unlike occludin or claudins, JAM proteins only have one transmembrane domain. The extraceullar N-terminus contains two Ig-like domains, which implicate roles for JAM proteins in the inflammatory response [96]. The cytoplasmic C-termini of JAM proteins also contain the PDZ-binding motif, which is associated with scaffolding proteins [97]. Several lines of evidence

demonstrated that JAM proteins are involved in epithelial barrier functioning and cell polarity [98, 99]. Recent studies also suggested that JAM-A and JAM-C are involved in monocyte transmigration across epithelial cells [100, 101]. Scaffolding proteins, such as zonula occludens (ZO) family members, bind to the transmembrane proteins and connect transmembrane proteins with cytoskeleton [101, 102]. ZO proteins are characterized by three PDZ domains, which mediate protein- protein interactions. ZO proteins are members of the membrane-associated guanylate kinase (MAGUK) family, which is involved in cell signaling pathways and proliferation [103, 104]. Thus, scaffolding proteins are also essential components at junctional sites. 1.4.3 Tight junctions and leukocyte migration Tight junctions are the most apical element of the junctional complex in epithelial and endothelial cells. As mentioned earlier, tight junctions form a barrier to paracellular movement of substances separating the apical and basolateral compartments in epithelial cell layers. Accumulating evidence further indicated that tight junctions mediate the transmigration of immune cells across epithelial or endothelial barriers. For example, occludin has been shown to mediate leukocytes migration. Expression of mutant occludin containing mutations in the extracellular loops can inhibit neutrophil migration across MDCK cell monolayer [88]. In addition, JAM-A and JAM-C are involved in netrophil and monocyte transmigration across epithelial cells [100, 101]. One possible molecular mechanism of how tight junctions mediate leukocyte migration is by dephosphorylation and dissociation of occludin from the tight junction complex [105]. Another possible mechanism for tight junction mediated migration involves the activity of proteinases expressed by immune cells. Ichiyasu et al. demonstrated that MMP-9-deficient dendritic cells have impaired migration through tracheal epithelial tight junctions [106]. Crisman et al. showed that leukocytes lacking meprin β are impaired in migration through ECM [73]. Sun et al. found that meprin α,β-deficient monocytes have decreased egression from bone marrow to peripheral blood [3].

1.5 Rationale for this work

The work conducted for this thesis includes investigations of the effects of meprin metalloproteases on epithelial barrier function and the consequences for monocyte migration. Meprins are highly expressed in the kidney, intestine, skin and by certain types of immune cells. Meprins are implicated in several inflammatory diseases and capable of degrading many proteins including ECM proteins and adherens junction proteins. In order to gain insight into the molecular mechanisms of meprins in immunity, MDCK cells were used to establish in vitro epithelial barriers. The hypothesis is that meprin isoforms weaken epithelial barrier function by cleaving tight junction proteins, and facilitate monocyte migration during inflammation. Two meprin isoforms, homomeric meprin A and meprin B, were studied for their effects on epithelial barrier function and the degradation of potential tight junction proteins. Along with the in vitro model, an in vivo epithelial system (ie. the bladder) was also used to study the effects of meprin A on barrier function. The insights gained from these experiments demonstrated that meprin A impairs epithelial barrier function by cleaving tight junction proteins. In addition, the consequences of meprin A activity on epithelial integrity impacts monocyte migration, which indicates the role of meprin A in immune cell infiltration during acute inflammatory responses. Further study using a mouse model of inflammatory bowel disease was conducted to investigate the role of immune-cell derived meprin A in immune cell infiltration during chronic inflammatory responses. These sets of experiments helped to elucidate the roles of different meprin isoforms, especially homomeric meprin A, in inflammation.

Chapter 2: Materials and Methods 2.1. Meprins 2.1.1 Meprin purification, activation, and activity assays Recombinant homomeric mouse meprin A and rat meprin B were purified from transformed human embryonic kidney (HEK) 293 cells (ATCC accession # CRL 1573) [107]. The murine meprin α construct, (amino acids 1-615, with a C-terminal 6x His tag) and the truncated rat meprin β construct (amino acids 1-648, with a C-terminal 6x His tag) were stably transfected into human embryonic kidney 293 (HEK 293) cells as previously described [56, 61]. The meprin-expressing HEK 293 cells were grown to confluency on 75mm plates (Gibco) with Dulbecco’s modified Eagle’s Medium (DMEM, Gibco) supplemented with 10% FBS and 100x antibiotics/antimyotics (Gibco) - 100 units/ml penicillin, 100 µg/ml streptomycin, and 0.25 µg/ml amphotericin B. Upon achieving confluency, the stably-transfected meprin-expressing HEK293 cells were switched to serum-free DMEM medium, which was collected after 48 to 72 h in order to purify the His-tagged meprin A and B proteins from the medium. The meprin-containing medium was then calibrated to 20 mM Tris, 150 mM NaCl, and 10 mM imidazole and subjected to nickel-affinity chromatography via a HisTrap™ chromatography column (GE Biosciences). The recombinant meprins in the media were eluted from the affinity column by imidazole titration (from 10 mM to 500 mM imidazole). The isolated meprins in the column fractions were pooled together and then buffer-exchanged into 20 mM Tris, 50 mM NaCl, pH 7.5 via Econo-Pac® 10 DG desalting columns (Bio-Rad). The latent forms of meprins were incubated with trypsin at a ratio of 1:20 (w/w, trypsin:meprin) for 30-60 min at 37 oC in 20 mM Tris, 150 mM NaCl, pH 7.5 to remove the prosequence thus activating the proteases. Trypsin was removed by filtration through G25 Sephadex resin before use. The separation is based on size difference. The smaller trypsin will be retained in the pores of Sephadex resin, while the larger meprins will elute first. To make a G25 column, a disposable 1 ml syringe was filled with a suspension of G25 Sephadex resin. The column was placed in a 15 ml polypropylene tube and centrifuged at 4300xg for 6 min at 4°C to pack the resin. The sample was added directly to the top of the resin, a microfuge tube was placed at the bottom of the syringe to capture the filtrate, and meprin was collected by centrifugation at 4300xg for 6 min at 4°C.

Residual trypsin that might be left with meprin could be further inhibited by 2-10 fold (w/w) of soybean trypsin inhibitor (STI) for 20 min at room temperature. Meprin protease activity was measured using a fluorogenic substrate assay [56, 61]. The substrates were designed based on the meprin A or meprin B preferred cleavage sites within peptides. Meprin A activity was assayed with BK+ (Abz-Arg-Pro-Pro-Gly- Phe/Ser-Pro-Phe-Arg-Lys(Dnp)-Gly-OH; excitation 320 nm, emission 417 nm) as substrate, while meprin B activity was assayed with OCK+ (Abz-Met-Gly-Trp-Met/Asp- Glu-Ile-Asp-Lys(Dnp)-Ser-Gly-OH; excitation 326, emission 418) as substrate. The 2- aminobenzoyl (Abz) fluorescence is quenched by the 2,4-dinitrophenyl (Dnp) group until cleavage separates them. The activity assay was performed at 5 s intervals for 50-60 s using the Time Scan method on the Hitachi F-2000 fluorimeter.

2.1.2 Meprin activity inhibition Meprins, like all metalloproteases, can be inhibited by metal chelators such as EDTA. The best meprin A inhibitor identified so far is actinonin, a peptide hydroxamate [108]. For example, actinonin inhibits human meprin A with a Ki of 20 nM and meprin B with a Ki of 1.7 μM [24]. However, meprins are not inhibited by tissue inhibitor of metalloproteases (TIMPs) or by inhibitors of the other protease classes [33].

2.2. Cell culture Madin Darby Canine Kidney (MDCK) cells (ATCC accession # CCL-34) were grown in minimum essential media (MEM) (Gibco) and supplemented with Earl’s salts,

L-glutamine, sodium bicarbonate, and 10% FBS (Atlas Biologicals) at 37°C and 5% CO2. The growth status of MDCK cells was monitored by microscopic examination. A confluent monolayer is defined as when one or more cells or groups of cells have multiplied to cover the surface of the culture (e.g., plate) completely but without overlaying each other.

2.3. Animal model 2.3.1 Generation and validation of meprin αKO mice

C57BL/6 meprin αKO and corresponding WT mice were used at 8-9 weeks of age for all experiments. All mice were maintained in the Pennsylvania State University College of Medicine (PSU-COM) Animal Facility and were allowed water and rodent chow ad libidum. The derivation of meprin αKO mice has been described by Banerjee et al. [109]. Briefly, the Mep1a gene was inactivated by homologous recombination with a targeting vector, Osdupdel-Mep1a, which inserted a 1.2 kb neomycin cassette with an in-frame stop codon into exon 7 (the catalytic domain of the protease). The construct was designed and developed by Dr Gail Matters (PSU-COM). The targeting vectors were electroporated into R1 mouse embryonic stem (ES) cells, and clones were screened by PCR. Electroporation, selection of targeted ES cells, and subsequent blastocyst injections were performed at the University of Michigan Transgenic Animal Facility. Chimeric mice were crossed with C57BL/6 mice to generate mixed background (C57BL/6 x 129/Sv) mice at the PSU-COM. Congenic meprin αKO mice were generated by crossing mixed background with C57BL/6 mice for 10 times as performed by Ge Jin, a technician in the Bond laboratory. Mouse tails samples were sent to Charles River to assess the level of genetic homogeneity. The results showed 99.07% homogeity. All animal protocols were approved by PSU- COM Institutional Animal Care and Use Committee.

2.3.2 Anesthesia Mice were anesthetized by isoflurane inhalation. For some experiments, ketamine/xylazine (100 mg/kg body weight ketamine; 10 mg/kg body weight xylazine) anesthesia was administered i.p. to the mice. To make up the working stock, 0.5 ml of 100 mg/ml ketamine and 0.25 ml of 20 mg/ml xylazine was added to 4.25 ml sterile PBS. A 0.5 cc U-100 insulin syringe (Beckton Dickinson) with a 28-gauge needle was used to i.p. administer 10 μl ketamine/xylazine per gram body weight.

2.3.3 Transurethral catheterization Transurethral catheterization was performed to instill exogenous reagents, such as meprins and sodium fluorescein, into the bladder. A 0.5 mm polyethylene catheter

(Intramedic PE 10) attached to the hub of a 50 μl Hamilton #705 syringe with 30 gauge blunt-tipped needle was used in catheterization.

2.3.4 Assessment of bladder permeability The protocol to determine bladder permeability was adapted from Eichel et al. [110]. Homomeric mouse meprin A was instilled into bladder via transurethral catheterization using a 0.5 mm polyethylene catheter (Intramedic PE 10) attached to the hub of a 50 μl Hamilton #705 syringe with 30 gauge blunt-tipped needle. After 2 h, 100 µl of 20 mg/ml sodium fluorescein (NaFl) was instilled into bladder via catheterization. After 15 min, blood samples were collected from the interior vena cava, and the plasma fluorescein concentrations were measured with a fluorescence spectrophotometer (F-2000, Hitachi) using a 0.1-100 μg/ml standard curve (excitation 494 nm, emission 516 nm).

2.4 Preparation of recombinant occludins 2.4.1 Recombinant occludin (49-290 amino acids) Recombinant human occludin was provided by Dr. Fang Tian (PSU-COM). Briefly, human occludin (49-290 amino acids, 28 kDa) was expressed and extracted from an E.coli system, and reconstituted on micelles formed by dodecylphosphocholine (DPC).

2.4.2 MBP conjugated occludin extracellular loops 2.4.2.1 Construction of occludin extracelluar loops expressing vectors pMTTH, a prokaryotic maltose binding protein (MBP) expression vector was obtained as a gift from Dr. Xingsheng Wang in Dr. Fang Tian laboratory (PSU-COM) [111]. The DNA sequences expressing occludin extracellular loop 1 and loop 2 were cloned from the human occludin gene joined by linker regions containing enterokinases (KpnI and EcoR I) cleavage sites, respectively. The thermal cycling parameters consisted of an initial denaturation step of 94 oC for 5 min, followed by 35 cycles of 94 oC for 30 s, 62oC for 30 s and 68 oC for 1 min, with a final extension at 68 oC for 2 min. Using the KpnI and EcoR I sites in pMTTH vector, the two loop fragments were ligated respectively into enterokinases cut vectors to generate MBP conjugated extracellular loops with an N-terminal histidine tag. The ligated vectors were transformed

into Escherichia coli (E.coli) DH5α strain, and the transformants were selected in the presence of Ampicillin on LB agar plates. The clones thus obtained were sequenced in the Core Sequencing Facility to confirm the DNA sequence of inserted extracellular loops.

2.4.2.2 Induction and purification of MBP-occludin extracellular loops Loops containing pMTTH vectors were transformed into E.coli BL21(DE3) competent cells and the transformants were selected in the presence of Ampicillin. The transformants were inoculated into LB broth with suitable antibiotic and grown to an optical density (O.D.) of 0.6-0.8 at 600nm, at which point expression of protein was induced by adding isopropyl β-D-1-thiogalactopyranoside (IPTG) to a final concentration of 1 mM. The culture was collected after 24 h incubation at 16oC. For a large scale purification of the protein, the culture was centrifuged at 10000 rpm for 25 min at 4 oC. Purification of the histidine tagged fusion protein was carried out using Ni-NTA column.

2.5. Assays 2.5.1 MDCK epithelial barrier set-up MDCK cells were cultured to form monolayers on inserted filters. For different assays, different treatments were applied (Figure 2). For example, in permeability assay, MDCK monolayers were treated with meprins for certain amount of time. After treatment, FITC-dextran was applied to the apical chamber of insert and the fluorescence in the basal chamber was measured after two-hour incubation.

Meprins FITC-dextran Monocytes

Filter

Figure 2. Diagram of ex vivo MDCK epithelial barrier set-up. MDCK cells were cultured on inserted filters to form monolayers. For different assays, different treatments were applied. For example, in transmigration assay, monocytes from wild-type or meprin αKO mice were added to the top chamber of the MDCK monolayers, while monocyte chemotactic protein-1 (MCP-1) was added to the bottom chamber. After incubation, migrated monocytes in the bottom chamber were collected and detected by flow cytometry analyses.

2.5.2 Immunocytochemistry and confocal microscopy of tight junction proteins MDCK cells were grown in 12-well plates on round glass coverslips for 3-4 days until they reached confluence. MEM was changed to serum-free MEM prior to treatment with meprin. Cells were treated with 4 μg/ml (47nM) active or latent recombinant meprin A or meprin B for 5 h. Immunocytochemistry was performed as described previously (Yura, R. 2008. Dissertation: Meprin metalloproteases modulate the host response to E.coli.). MDCK cells were fixed in 1% paraformaldehyde for 10 min, permeabilized with 0.2% Triton-X 100 for 10 min, and blocked in 10% goat serum with 0.1% Triton-X 100 for 1 h with shaking. Cells were incubated with monoclonal mouse anti-occludin (1:50 dilution) and anti-ZO-1 (1:4 dilution) antibodies (Zymed). After 5 washes in 0.1% Triton-X 100, monolayers were incubated with fluorescence-labeled secondary antibodies for 1 h and rinsed as indicated before. Coverslips were mounted on slides with Aquamount (Polysciences, Inc.) and examined using a confocal microscope (Leica TCS SP2 AOBS, Germany). Images were captured and merged with Adobe Photoshop (Adobe Systems).

2.5.3 Permeability assay MDCK cells were cultured on filters with 0.4-µm pores (Millipore) until reaching confluency. MEM medium was changed to serum-free MEM prior to treatment with meprin. Active or latent meprins (meprin A or meprin B) (47 nM) were added to the apical chamber of insets, and incubated at 37oC for the desired amount of time. After meprin treatment, the apical medium was replaced with fresh medium containing 10 or 15 µg/ml of fluorescein isothiocyanate (FITC)-dextran of 40 kDa or 10 kDa. After a 2-h incubation at 37oC, the basal medium was collected and the fluorescence of the permeated FITC-dextran was measured with a fluorescence spectrophotometer (F-2000,

Hitachi) at λex492 nm and λem 520 nm [112].

2.5.4 Transepithelial electrical resistance (TER) MDCK cells were cultured on filters with 0.4-µm pores (Transwell; Corning Costar) until reaching confluency. MEM medium was changed to serum-free MEM prior to treatment with meprin. Active or latent meprins were added to the apical chamber of

insets, and incubated at 37oC for various periods of time, 1, 3, 5, 7 and 9 h. After meprin treatment, the degree of resistance of tight junction to ions was assessed by measuring the TER using a voltohmmeter EVOM with a STX2 Electrode (World Precision Instruments) [113] . The formation of tight junctions determines the resistance of the epithelial barrier, while TER measures the opposition to the passage of an electric current. One the voltohmmeter electrodes was put into the medium of the upper chamber, while the other one was put into the medium of the lower chamber. The reading was recorded after a 20-s instrument stabilization period. Resistance is calculated based on the area of the culture insert.

2.5.5 Cell viability MDCK cells were incubated on 96-well plates (10,000 cells per well) at 37oC, 5%

CO2, for 24 h. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 0.5mg/ml ) was added to each well. MTT is a yellow tetrazole compound that is reduced to a purple formazan in the mitochondria of living cells. The reductive capacity of cultured cells has been used widely to measure growth and viability. After incubation for 4 h, MTT was removed and 200 µl dimethyl sulfoxide (DMSO) was added to each well. The plate was shaken briefly, and the plates read at A570nm.

2.5.6 Preparation of membrane-enriched fractions of MDCK cells Membrane-enriched fractions of MDCK cells were prepared by a protocol from Dr. David Antonetti (PSU-COM). Confluent stage MDCK cells were washed with ice-cold PBS, and scraped with 500 µl Buffer A (0.5 M sucrose, 2 M Tris, 0.5 M EDTA

(conditional), Protease inhibitor tablet [79], benzamidine, 10 mM Na3PO4, 0.5M NaF, 0.5M NaPyrophosphate). The suspension was homogenized with a Dounce homogenizer (six-strokes with pestel). The preparation was centrifuged at 39,000 rpm for 20 min at 4oC. The sediment was suspended in 2 ml of Buffer B (2 M Tris, 0.5 M EDTA (conditional), and homogenized again with pestel. The preparation was centrifuged at 39,000 rpm for 20 min at 4oC. The sediment was suspended in 500 µl of Stuart’s lysis buffer (with protease inhibitor tablet) and sonicated for 30 s, 3 times at 50% pulse [114].

2.5.7 Western blot analysis Protein samples were subjected to SDS-PAGE electrophoresis, and then transferred to nitrocellulose membranes using the semi-dry Trans-Blot SD (Bio-Rad). Membranes were blocked with 10% milk in TBS/0.1% Tween-20 (TBS-T). Membranes were incubated overnight with primary antibody in 5% milk in TBS-T, at 4°C with slight agitation. After three 10 min washes in TBS-T, membranes were incubated with a horseradish peroxidase-conjugated secondary antibody for 1 h in 5% milk in TBS-T. After three 10 min washes in TBS-T, Western blots were developed using West Pico or West Dura Substrates (Thermo Scientific).

2.5.8 Isolation of monocytes from mouse bone marrow Monocytes from wild-type and meprin αKO mice were collected from bone marrows, by using a Mouse Monocyte Enrichment kit (#19761, Stemcell). Briefly, non- monocyte cells are specifically labeled with a cocktail of biotinylated antibodies against cell surface antigens. Then the dextran-coated magnetic particles are added. Tetrameric Antibody Complexes [115] recognizes both dextran and biotin. As a result, the antibody- recognized cells are specifically linked with magnetic particles through TAC complex, and are separated from the monocytes (unlabeled) by the magnet [116, 117]. Particular procedures are as following. Bone marrow was flushed from mouse femurs and tibias and filtered to single cells. The mouse Enrichment Cocktail was added to single cell suspensions, mixed well and incubated for 15 min. The biotin selection cocktail was added, mixed well and incubated for 15 min. EasySep D Magnetic particles were added and then the tube was placed into the magnet and set aside for 5 min. The magnet and tube were inverted in one continuous motion to collect the desired fraction to a new tube. The magnetically labeled unwanted cells remain bound inside the original tube.

2.5.9 Transmigration of monocyte through MDCK monolayers MDCK cells were cultured on Transwell Permeable Supports (3 µm polyester membrane, Costar) until they reached confluence. Isolated monocytes were added to the top of MDCK monolayer, and 1.5 nM monocyte chemotactic protein-1 (MCP-1) was added to the bottom chamber. After incubating at 37oC for 3 h, the backside of supports

was flushed with trypsin and the cells in the bottom chamber collected by centrifugation at 1,500 rpm for 10 min. The suspended cells were labeled with fluorescence antibodies. The CD11b+/NK1.1-/Ly6g-/Ly6c+ monocyte subsets (inflammatory monocytes) were detected with a flowcytometer [118].

2.6 Statistical analysis and graphing software Microsoft Excel/ PRISM GraphPad software was used to plot figures and for data analysis. Results are expressed as means ± SE; a students t-test was used to calculate P values, and P value < 0.05 was considered as significantly different.

Chapter 3: Meprin A weakens epithelial barriers and facilitates monocyte migration

3.1 Meprin A impairs MDCK monolayer’s barrier function To evaluate the epithelial barrier function in response to a meprin A challenge, permeability of MDCK monolayers to FITC dextran and resistance to ionic flux (TER) were measured. For the FITC-dextran studies, MDCK cells were cultured on filters (0.4-µm pores) until they reached confluency. Active or latent meprin A (47 nM) was added to the apical chamber, and incubated at 37oC for 5 h. Then the apical medium was replaced with fresh medium containing 10 µg/ml of FITC-dextran (40 kDa) (Figure 3.1). Active meprin A treatment marginally increased monolayer permeability to FITC-dextran, however there was no statistically significant increase compared to cells incubated with medium only or those treated with latent meprin A. Accordingly, subsequent experiments used smaller FITC-dextran (10 kDa) (Figure 3.2). Active meprin A treatment for 5 h or longer significantly increased monolayer permeability, as compared to cells incubated with medium only or those treated with latent meprin A. To measure the transepithelial electrical resistance (TER) of MDCK cell monolayers in response to meprin treatment, active or latent meprin A was added to the apical chamber, and incubated for various amount of time. Active meprin A decreased the electrical resistance of MDCK monolayer, particularly after 9 h of incubation, as compared to cells incubated with medium only or those treated with latent meprin A (Figure 3.3). These data indicate that meprin A impaired epithelial barrier function of MDCK monolayers.

MDCK monolayer permeability to FITC-dextran (40 kDa)

0.12

l) µ

0.1

0.08 Control (untreated cells) 0.06 Latent meprin A dextran concentration (ng/ concentration dextran

- Active meprin A

FITC 0.04

0.02

Fig 3.1 MDCK monolayer permeability to FITC-dextran (40 kDa) was increased after exposure to active meprin A. MDCK cell monolayers were cultured on inserted filters. Active or latent meprin A (47 nM) were added to the apical chamber of inserts, and incubated at 37oC for 5 h. The control is MDCK cell monolayers incubated with medium only. After meprin treatment, apical medium was replaced with 10 µg/ml of FITC-dextran (40 kDa). After a 2-h incubation at 37oC, the basal medium was collected

and the fluorescence was measured by a spectrophotometer at λex492 nm and λem 520 nm. There were 2 experiments per group.

MDCK monolayer permeability to FITC-dextran (10 kDa)

0.6

* 0.55 0.5 ** l) µ 0.45

0.4

0.35 Control

0.3 Latent meprin A

0.25 Active Meprin A dextran concentration concentration (ng/ - dextran * 0.2

FITC 0.15 0.1

0.05

0 1 3 5 7 9 h

Fig 3.2 MDCK monolayer permeability to FITC-dextran (10 kDa) was significantly increased after exposure to active meprin A. MDCK cell monolayers were cultured on inserted filters. Active or latent meprin A (47 nM) were added to the apical chamber of inserts, and incubated at 37oC for 1, 3, 5, 7 and 9 h. The control is MDCK cell monolayers incubated with medium only. After meprin treatment, apical medium was replaced with 15 µg/ml of FITC-dextran (10 kDa). After a 2-h incubation at 37oC, the basal medium was collected and the fluorescence was measured by a spectrophotometer

at λex492 nm and λem 520 nm. There were 3 experiments per time point per group (* = P<0.05, ** = P<0.01).

Transepithelial Electrical Resistance 720

710

2 700 * X cm 690 Control Ohms Latent meprin A 680 Active meprin A

670

660

650 0 1 2 3 4 5 6 7 8 9 10 h

Fig 3.3 The transepithelial electrical resistance (TER) across MDCK monolayers was decreased after exposure to active meprin A. MDCK cell monolayers were cultured on inserted filters and then treated with 47 nM active or latent meprin A for 1, 3, 5, 7 and 9 h at 37oC. The control is MDCK cell monolayers incubated with medium only. Then transepithelial electrical resistance across the monolayer was measured by a voltohmmeter EVOM with a STX2 Electrode (World PrecisionInstruments). There were 3 experiments per time point (* =P<0.05).

3.2 Meprin A increases mouse bladder permeability The bladder wall serves as a good in vivo system to study the alterations in the integrity of the bladder epithelial lining in response to a meprin A challenge. The in vivo meprin A concentration may increase dramatically during inflammation. For example, urinary meprins are normally very low, however high concentrations are found in urine in women with urinary tract infection [4]. Preliminary studies in our lab showed that the concentration of soluble meprin A in the C57BL/6 mice urine is approximately 100 nM. In addition, the infiltrating leukocytes that accumulate at the inflammation sites such as mesenteric lymph nodes also express meprins [73]. Thus meprin A concentration in the bladder during inflammation could be in the high nanomolar or micromolar range. To mimic the in vivo condition under inflammation, excessive amount of meprin A (4.7 µM) was used to challenge the bladder here in this experiment and the bladder permeability was determined by measurement of sodium fluorescein (NaFl) leakage from the bladder into the serum. C57BL/6 mice were challenged with active meprin A, actinonin inactivated meprin A, actinonin or Tris buffer via transurethral catheterization. The reason for using actinonin-inactivated meprin as a negative control instead of latent meprin is that latent meprin might be activated by trypsin-like proteases in vivo. After 2 h, 100 µl of 20 mg/ml sodium fluorescein was instilled into the bladder via catheterization. After 15 min, blood samples were collected and the plasma fluorescein concentrations were measured. NaFl instilled into the bladder appeared in the blood. Active meprin A increased bladder permeability to sodium fluorescein, as compared to Tris buffer or actinonin-inactivated meprin A (Figure 3.4). The data indicate that active meprin A was able to impair the epithelial barrier in vivo.

Bladder Permeability to Sodium Fluorescein

8 Control (Tris buffer only)

Meprin A 6

Meprin A+ Actinonin Serum Fluorescence (ug/ml) Fluorescence Serum 4 Actinonin only

Bladder Treatments

Fig 3.4 The bladder permeability to sodium fluorescein was increased after exposure to active meprin A. C57BL/6 mice were anesthetized, then active, or actinonin- inactivated meprin A (4.7 µM), or actinonin (50 µM) was injected into bladder lumen via transurethral catheterization. Mice in control group were instilled with Tris buffer. After 2 h, 100 ml of 20 mg/ml sodium fluorescein was injected into bladder. After 15 min, blood samples were collected from the interior vena cava, and the plasma fluorescein

concentrations were measured at λex494 nm and λem 516nm. There were 3 experiments per group (* = p<0.05).

3.3 Impaired barrier function was not due to cell toxicity of meprin A To determine whether the impairment of epithelial barrier was due to cytotoxicity of meprin treatment, a cell viability assay was performed. MDCK cell viability was assessed upon MTT reduction by mitochondria and monitored by absorbance at 570 nm (Figure 3.5). Mitochondria function of cells treated with active meprin A was equivalent to untreated control cells. The results indicate that meprin A impairs epithelial barriers without concurrent cell death/impairment of mitochondrial reductive capacity.

MDCK mitochondrial function

150

125

100 0.5 h

2 h 75

% of Control) of % 5 h

50 12 h

0 6 23 47 115 230 Meprin A (nM)

Fig 3.5 Meprin A has no cytotoxicity on MDCK cells. MDCK cells were incubated on o 96-well plates (10,000 cells per well) at 37 C, 5% CO2. Various concentrations of meprin A (6, 23, 47, 115, 230 nM) were used to treat MDCK cells for 0.5, 2, 5 and 12 h. After meprin treatment, 100 µl MTT (0.5 mg/ml ) was added to each well. After incubation for 4 h, MTT was removed and 100 µl dimethyl sulfoxide (DMSO) was added to each well. The plate was shaken briefly, and the plates read at A570 nm to measure fluorescence. There were 4 experiments per group.

3.4 Meprin A disrupts TJs on MDCK monolayers Tight junctions (TJs) in epithelium are essential for maintaining barrier function; therefore, MDCK monolayers were treated with meprin A to assess whether tight junction integrity was disrupted. MDCK monolayers were challenged with 47 nM (4 µg/ml) of activated or latent recombinant mouse homomeric meprin A for 5 h. Monolayers were processed for immunofluorescence and stained for occludin and ZO-1. Preliminary experiments with shorter incubation times (1 h or 2 h) or with lower concentrations for longer incubation time (1 µg/ml or 2 µg/ml for up to 12 h) did not show much disruption of TJs, as compared to 47 nM (4 µg/ml) for 5 h (Yura, Thesis dissertation and personal communication). Thus the experiments here use 47 nM (4 µg/ml) to treat MDCK monolayers for 5 h. Three to five random fields of monolayers were observed by microscopy and showed similar disruptions of TJs; one representative field was captured and shown in Figures 3.6 and 3.7. The results showed that in untreated monolayers, immuno-staining for occludin was continuous at the cell borders (Figure 3.6 A). In monolayers treated with active meprin A, the tight junctions were disrupted as shown by discontinuous immuno-staining, while latent meprin A, which has minimal proteolytic activity, did not disrupt TJ staining of MDCK cells (Figure 3.6 B and C). The fluorescence signals of occludin were quantified by ImagJ (Figure 3.6 D). Disruption of TJs by active meprin A was also demonstrated by immunohistochemical staining of another tight junction protein ZO-1 (Figure 3.7). The fluorescence signals of ZO-1 were quantified by ImagJ (Figure 3.7 D). These observations indicate that meprin A disrupted TJ staining between MDCK cells. Several evidences showed that cleavage of only one of the tight junction proteins could lead to disruption or disassembly of TJ complexes [119, 120]. Thus, my hypothesis is that the observed disruption on MDCK monolayers are attributed to proteolytic cleavage of certain TJ proteins by active meprin A.

A. Control B. Active MeprinA C. Latent Meprin A

nuclei

occludin

D. Occludin-staining signal quantification 120 100

80 60

% Control 40 20 0 Active Meprin A treated Latent meprin A treated

Figure 3.6 Loss of occludin staining at MDCK cell surfaces after actvie meprin A treatment. MDCK cells were grown on glass coverslips until they reached confluency. Cells were treated with 47 nM active or latent meprin A for 5 h. Cells were fixed in

paraformaldehyde and permeabilized with Triton-X 100. Then incubated with monoclonal anti-occludin (1:50 dilution) antibody and with fluorescence-labeled secondary antibody. Images were examined by microscopy. The upper panel showed the nuclei stainings (blue) of different groups, and the lower panel showed the occludin stainings (green). In untreated monolayers (A) and monolayers treated with latent meprin A (C), immuno-staining for occludin was continuous at cell borders. In monolayers treated with active meprin A (B), the occludin immune-staining was disrupted (indicated by arrows). The fluorescence signals of occludin were quantified by software ImagJ (D). The percentages of active or latent meprin A treated signals were calculated by the ratios to untreated signal respectively.

A. Control B. Active Meprin C. Latent Meprin A A

nuclei

ZO-1

D. ZO-1 staining signal quantification 120 100

% Control 40

20 0 Active meprin A treated Latent meprin A treated

Figure 3.7 Loss of ZO-1 staining at MDCK cell surfaces after active meprin A treatment. MDCK cells were grown on glass coverslips until they reached confluency. Cells were treated with 47 nM active or latent meprin A for 5 h. Cells were fixed in

paraformaldehyde and permeabilized with Triton-X 100. Then incubated with monoclonal anti-ZO-1 (1:4 dilution) antibody and with fluorescence-labeled secondary antibody. Images were examined by microscopy. The upper panel showed the nuclei stainings (blue) of different groups, and the lower panel showed the ZO-1 stainings (green). In untreated monolayers (A) and monolayers treated with latent meprin A (C), immuno-staining for ZO-1 was continuous at cell borders. In monolayers treated with active meprin A (B), the ZO-1 immune-staining was disrupted (indicated by arrows). The fluorescence signals of ZO-1 were quantified by software ImagJ (D). The percentages of active or latent meprin A treated signals were calculated by the ratios to untreated signal respectively.

3.5 Occludin in MDCK monolayer is degraded by exogenous meprin A Based on the substrate preferences and specificities of meprins, a computational program (Prediction of Protease Specificity, PoPS) designed by Sarah Boyd of Monash University predicted that both meprin A and meprin B have cleavage sites on several tight junction proteins, including occludin and several claudins (Table 1) (Figure 3.8). For example, there are several predicted cleavage sites on occludin extracellular loop-1 by meprin A, such as G-Y (92-93), G-S (100-101), G-Y (103-104), G-G (107-108) etc. Several claudins including claudin-4, -5 and -8 are also predicted to be cleaved by meprins. Among the listed claudins, claudin-4 has been found expressed in kidney, bladder epithelium as well as in MDCK cells; in addition, overexpression of claudin-4 will increase the TER in MDCK cells [121, 122]. Thus, claudin-4 was chosen, together with occludin, to study the cleavage of tight junction proteins by meprins.

Tight junction proteins Predicted cleavage site(s) Occludin Extracellular, cytoplasm Claudin-2 Extracellular, cytoplasm Claudin-4 Extracellular, cytoplasm Claudin-5 Extracellular, cytoplasm Claudin-8 Extracellular, cytoplasm JAM-A Extracellular ZO-1 cytoplasm

Table 1. Computational prediction of meprins cleaving tight junction proteins. Meprin α prefers to cleave peptide bonds containing aromatic or small amino acid residues at the P1 and P1’ positions; Proline is preferred at P2’. Meprin β prefers acidic residues at the P1 and P1’ positions. Based on the substrates preferences, the PoPS program predicted several tight junction proteins to be substrates of meprins, including occludin and claudins. The predicted cleavage site(s) are in the extracellular or cytoplasmic regions or both.

Occludin Claudin-4 JAM-A

Predicted cleavage sites for meprin α; Predicted cleavage sites for meprin β.

Figure 3.8 Computational predictions by PoPS. The black arrow indicates the cleavage sites by meprin α in the extracellular region, while the yellow arrow indicates the cleavage sites by mepirn β in the extracellular region.

To test experimentally whether occludin is cleaved, MDCK monolayers were incubated with increasing concentrations of meprin A for 5 h. The intensity of occludin staining was decreased when cells were treated with increasing amounts of meprin A as detected by Western blot analysis. Figure 3.9 shows a representative image from three Western blots. The percentage of hydrolysis from measurements of the optical density of occludin bands was caluculated and averaged from these three blots (Table 2). These results confirmed that occludin in MDCK monolayers is degraded by exogenous meprin A.

Cells incubated with meprin A with latent meprin A

Control 4.7 nM 23 nM 47 nM 47 nM

Fig 3.9 Degradation of occludin in MDCK monolayers by meprin A. MDCK monolayers were incubated with exogenous active or latent meprin A (4.7 nM, 23 nM, and 47 nM) for 5 h. Occludin was detected by Western blot analysis using anti- occludin monoclonal antibody. The percentage of hydrolysis was quantified by the optical densities of occludin bands. The results indicated that occludin decreased significantly with increasing amounts of active meprin A.

Densitometry 160

140 * 120

100 * 80

% control % 60

0 4.7 nM 23 nM 47 nM latent

Experiment 1 Experiment 2 Experiment 3 Average

Band % of Band % of Band % of % of Control Density Control Density Control Density Control Control (untreated) 2.5 100 1.2 100 1.45 100 100

4.7 nM active meprinA 2.28 91 1.38 115 1.57 108 105

23 nM active meprin A 1.77 71 0.71 59 0.97 67 66

47 nM active meprin A 0.29 12 0.17 14 0.25 17 14

47 nM latent meprin A 3.87 155 1.77 148 1.9 131 144

Table 2. Densitometry of meprin A cleavage of occludin in MDCK monolayer. MDCK monolayers were incubated with increasing concentrations of meprin A (4.7 nM, 23 nM, 47 nM) for 5 h. The percentage of hydrolysis was quantified by the optical densities of occludin bands. The average percentages of band density over control are 66% and 14% with 23 nM and 47 nM active meprin A treatment, respectively. These results confirmed that occludin in MDCK monolayer is degraded by active meprin A (* = p<0.05).

3.6 Claudin-4 in MDCK monolayer is not degraded by exogenous meprin A To determine whether claudin-4 is cleaved by meprin A, MDCK monolayers were incubated with increasing concentrations of meprin A for 5 h. Western blot analysis did not show degradation of claudin-4 by meprin A (Figure 3.10). These results indicate that the meprin A cleaves only certain tight junction proteins, such as occludin.

3.7 Meprin A does not disrupt claudin-4 staining on MDCK monolayers To confirm further that claudin-4 on MDCK monolayers was not degraded by meprin A, MDCK monolayers were challenged with 47 nM of activated or latent recombinant mouse homomeric meprin A for 5 h, and stained for claudin-4 and occludin. In untreated monolayers or latent meprin A treated monolayers, immuno-staining for claudin-4 and occludin were continuous at the cell borders (Figure 3.11 A and C). In monolayers treated with active meprin A, the staining of occludin was disrupted as shown before, while the staining of claudin-4 was not disrupted by meprin A treatment (Figure 3.11 B). The fluorescence signals of occludin and claudin-4 were quantified by ImagJ (Figure 3.11 D). These observations support the contention that meprin A cleaves tight junction protein occludin, but not claudin-4, on MDCK monolayers.

Cells incubated with meprin A with latent meprin A

Control 4.7 nM 23 nM 47 nM 47 nM

Fig 3.10 Meprin A does not cleave claudin-4 in MDCK monolayers. MDCK monolayers were incubated with exogenous active or latent meprin A (4.7 nM, 23 nM, and 47 nM), for 5 h. The presence of claudin-4 was detected by Western blot analysis using anti-claudin 4 monoclonal antibody.

A. Control B. Active MeprinA C. Latent Meprin A

D. Occludin and claudin-4 staining signal quantification 120

100

60 Occludin 40 Claudin-4 % Control 20 0 Active meprin A treated Latent meprin A treated

Figure 3.11 Loss of occludin staining, but not claudin-4 staining, at MDCK cell

surfaces after actvie meprin A treatment. MDCK cells were grown on glass coverslips until they reached confluency. Cells were treated with 47 nM active or latent meprin A for 5 h. Cells were fixed and permeabilized as described earlier, then incubated with monoclonal anti-occludin and anti-claudin-4 antibodies. Images were examined by microscopy. The upper panel showed the nuclei stainings (blue), middle panel showed the occludin staining, while the lower panel showed the claudin-4 stainings (green). In untreated monolayers (A) and monolayers treated with latent meprin A (C), immunostaining for occludin and claudin-4 were continuous. In monolayers treated with active meprin A (B), the occludin immune-staining was disrupted (indicated by arrows), while the staining of claudin-4 was not dirsupted. The fluorescence signals of occludin and claudin-4 were quantified by software ImagJ (D). The percentages of active or latent meprin A treated signals were calculated by the ratios to untreated signal respectively.

3.8 Occludin in MDCK cell extracts is cleaved by meprin A To determine whether occludin in membrane fractions was cleaved by meprin A, the membrane-enriched fractions from MDCK cell lysates were incubated with active or latent meprin A. The results were analyzed by Western blot assay. Preliminary experiments showed that the disappearance of occludin in MDCK membrane fractions incubated with 47 nM active meprin A was rapid (within 30 min). therefore, 20 nM meprin A was used to show a more gradual degradation of occludin by meprin A over time. Figure 3.12 shows the representative image out from two Western blots. The cleavage of occludin was observed when treated with active meprin A, but not with latent meprin A nor EDTA-inhibited meprin A.The percentage of hydrolysis from measurements of the optical density of occludin bands was caluculated and averaged from these two blots (Table 3). These data provided further evidence that meprin A is able to cleave the tight junction protein occludin.

Membrane fraction incubated with 20 nM meprin A with 20 nM latent meprin A 1 h Control 10 min 30 min 1 h + EDTA 1 h

85 kDa –

65 kDa –

Fig 3.12 Cleavage of occludin in membrane-enriched fractions of MDCK cells by meprin A. Membrane enriched fractions of MDCK cells (80 mg) were incubated with 20 nM active or latent meprin A. Occludin was detected by Western blot analysis using an anti-occludin polyclonal antibody. The percentage of hydrolysis was quantified by the optical densities of occludin bands.

Densitometry 140

120

100

60 % Control 40

0 10 min 30 min 1 h w/EDTA, 1 h latent

Experiment 1 Experiment 2 Average

% of Control

Band % of Band % of Density Control Density Control Control (untreated) 3.97 100 1.64 100 100

20 nM active meprin A (10 min) 4.56 115 1.06 65 87

20 nM active meprin A (30 min) 2.92 74 0.47 29 51

20 nM active meprin A (1 h) 0.21 5 0.47 29 17

20 nM active meprin A (+EDTA, 1h) 1.66 42 2.43 148 97

20 nM latent meprin A (1 h) 2 50 1.04 63 57

Table 3. Densitometry of meprin A cleavage of occludin in MDCK membrane fractions. MDCK membrane fractions were incubated with 20 nM active or latent meprin A. The percentage of hydrolysis was quantified by the optical densities of occludin bands. These results confirmed that occludin in MDCK cell membrane fractions is degraded by active meprin A.

3.9 Claudin-4 in MDCK cell extracts is not degraded by meprin A To determine whether claudin-4 in MDCK cell extracts is cleaved by meprin A, MDCK membrane fractions is incubated with meprin A for indicated amount of time. Western blot analysis did not show degradation of claudin-4 by meprin A (Figure 3.13). These results indicate that the meprin A cleaves only certain tight junction proteins.

Fig 3.13 Meprin A does not cleave claudin-4 in MDCK membrane fractions. MDCK membrane fractions were incubated with exogenous active or latent or EDTA inhibited meprin A (47nM) for 5 h or 12 h. The presence of claudin-4 was detected by Western blot analysis using anti-claudin 4 monoclonal antibody.

3.10 Recombinant occludin is cleaved by meprin A To confirm that occludin is directly cleaved by meprin A, a sample of 2 µM recombinant occludin was incubated with 47 nM of active meprin A (Figure 3.14 A and B). Treatment of occludin with meprin A for 2 h and 4 h led to a decrease in the intensity of occludin staining as observed by Coomassie staining and Western blot analysis. A cleavage product (~22KDa) was observed with Coomassie blue staining, but not with Western blotting. The probable reason is that the cleavage product observed by Coomassie blue staining does not contain the His-tag. Based on the size of cleavage product and the location of His-tag on recombinant occludin, the possible cleavage site might be on the second extracellular loop of occludin. The percentage of hydrolysis was calculated from measurements of the optical density of occludin bands (Table 4 A and B). These results indicated that occludin is directly cleaved by meprin A.

Occludin incubated with 47 nM of meprin A With 47 nM Control latent meprin A 30 min 1 h 2 h 4 h 4 h

170 kDa - 130 kDa- 95 kDa - 72 kDa-

56 kDa-

43 kDa-

34 kDa - # 1

26 kDa-

# 2

17 kDa -

11 kDa-

Fig 3.14A Recombinant occludin is cleaved by homomeric meprin A (Coomassie stain). Recombinant occludin (arrow #1) (3 µg) was incubated with 47 nM active meprin A for 30 min, 1 h, 2 h and 4 h, or latent meprin A for 4 h. Samples were subjected to SDS-PAGE and stained with Coomassie blue. Treatment of occludin with meprin A for 2 and 4 h led to a decrease in the intensity of occludin staining. A cleavage product (~22 kDa) (arrow #2) was observed after 2 or 4 h incubation with meprin A.

Occludin incubated with 47 nM of meprin A With 47 nM Control latent meprin A 30 min 1 h 2 h 4 h 4 h

Fig 3.14B Recombinant occludin is cleaved by homomeric meprin A (Western blot assay). Recombinant occludin (3 µg) was incubated with 47 nM active meprin A for 30 min, 1 h, 2 h and 4 h, or latent meprin A for 4 h. After treatment, samples were boiled and subjected to SDS-PAGE. Occludin (arrow) was detected by Western blot analysis using polyclonal antibody. Treatment of occludin with meprin A for 2 and 4 h led to a decrease in the intensity of occludin staining. The polyclonal anti-His antibody did not detect any cleavage product possibly because the molecular size of the cleavage product(s) that contain the His-tag were too small to be detected on SDS-PAGE gel.

Substrate Cleavage product (28 kDa) (~22 kDa)

Band Density % of Control Band Density % of 2h-band Control (untreated) 0.77 100

47 nM active meprinA 0.78 101 (30 min) 47 nM active meprin A 0.78 101 (1 h) 47 nM active meprin A 0.8 104 0.06 100 (2 h) 47 nM active meprin A 0.59 77 0.1 168 (4 h) 47 nM latent meprin A 0.82 106 (4 h)

Table 4A. Densitometry of meprin A cleavage of recombinant occludin (Coomassie stain). Recombinant occludin was incubated with 47 nM active or latent meprin A. The percentage of hydrolysis was quantified by the optical densities of occludin bands. The percentage of hydrolysis was 33% with active meprin A treatment for 4 h. These results confirmed that recombinant occludin is degraded by active meprin A.

Substrate (28 kDa) Band Density % of Control Control (untreated) 3.2 100

47 nM active meprinA 3.5 109 (30 min) 47 nM active meprin A 3.59 112 (1 h) 47 nM active meprin A 2.22 69 (2 h) 47 nM active meprin A 1.85 52 (4 h) 47 nM latent meprin A 2.9 91 (4 h)

Table 4B. Densitometry of meprin A cleavage of recombinant occludin (Western blot assay). Recombinant occludin was incubated with 47 nM active or latent meprin A. The percentage of hydrolysis was quantified by the optical densities of occludin bands. The percentage of hydrolysis was 48% with active meprin A treatment for 4 h. These results confirmed that recombinant occludin in MDCK cell membrane fraction is degraded by active meprin A.

3.11 Meprin A regulates monocyte transmigration Migration of leukocytes into inflamed tissues and the subsequent activation of the adaptive immune system in downstream lymph nodes are imperative for mounting an effective immune response [123]. Meprins are expressed by certain populations of leukocytes and have been implicated in leukocyte migration. For example, Sun et al. found that meprin α,β-deficient monocytes have decreased egression from bone marrow to peripheral blood [3]. The underlying molecular mechanisms need to be elucidated.

My hypothesis is that high concentrations of meprin A impair epithelial barriers thus allows enhanced monocyte transmigration. The cleavage of occludin by meprin A and the subsequent loss of barrier function have been demonstrated in previoius sections. To test further whether leukocyte migration is enhanced by meprin A, bone marrow derived monocytes from wild-type and meprin αKO mice were isolated and cultured on MDCK monolayers. After co-culturing for 3 h, monocytes that transmigrated through the monolayer to the bottom chamber were collected. The monocytes were identified by fluoregenic antibodies (CD11b+/NK1.1-/Ly6g-/Ly6c+) as the infiltrating monocyte population, and were quantified by flowcytometry (Figure 3.15). The results showed that the migration of monocyte was driven by chemo-attractant, since when no MCP-1 present, neither genotype of monocytes transmigrated efficiently through MDCK monolayers. In the presence of both chemokine and MDCK monolayers, there were significantly fewer meprin αKO monocytes transmigrated through than wild-type monocytes. It also showed that the genotypic difference depends on the presence of MDCK monlayers, thus further confirm the hypothesis that meprin A’s effects on epithelial barrier lead to enhanced monocyte migration.

Fig 3.15 Meprin A regulates monocyte transmigration. The same number of monocyte cells isolated from wild-type and meprin αKO mice bone marrow were placed on the apical side of MDCK monolayers, with MCP-1 (1.5 nM) added to the bottom of the Transwell chamber (MDCK+MCP-1). For the controls, monocytes were placed on MDCK monolayers without MCP-1 in the bottom chamber (MDCK, no MCP-1), and on filter without MDCK monolayers but with MCP-1 in the bottom (no MDCK monolayer). After co-culturing at 37oC for 3 h, monocytes in the bottom chamber were collected and measured by flowcytometry for the CD11b+/NK1.1-/Ly6g- /Ly6c+ cells. Significantly fewer meprin αKO monocytes transmigrated through MDCK monolayers than wild-type monocytes. There were 3 experiments per group (*= p<0.05).

Chapter 4. Meprin A cleavage site(s) on occludin extracellular loops

4.1 Construction of recombinant maltose binding protein (MBP)-conjugated occludin extracelluar loops It is proposed that meprin A cleaves occludin at the second extracellular loop of occludin, based on computational predictions and the molecular size of an observed cleavage product as discussed in previous chapter (Figure 3.7 and Figure 3.11). In order to obtain purified occludin extracellular loops as substrate for further study of the proposition, the extracellular loop 1 and loop 2 were cloned and conjugated with a 42- kDa maltose binding protein (MBP), respectively (Figure 4.1). The histidine tagged soluble fusion proteins were expressed by E.coli and purified by a Ni-NTA column. The fusion proteins were identified by MS/MS analysis.

4.2 Occludin extracellular loops are cleaved by meprin A To investigate the cleavage of occludin extracellular loops by meprin A, 6 µM of MBP conjugated loop 1 and loop 2 were incubated respectively with meprin A for various periods of time. The controls contained buffer or latent meprin A in the incubation mixture. After incubation, samples were subjected to 10% SDS-PAGE electrophoresis and stained with Coomassie blue. Cleavage of occludin loop 1 was observed after active meprin A treatment, but not latent meprin A treatment (Figure 4.2). Similar results were observed in occludin loop 2. Active, but not latent meprin A is able to degrade the fusion protein (Figure 4.3). These results confirmed that there are specific cleavage sites of meprin A on the extracellular loops of occludin.

T7 promotor Lac operator NdeI …TAATACGACTCACTATAGG GGAATTGTGAGCGGATAACAATT…CATATG

MBP AAAATCGAAGAAGGTAAACTGGTAATCTGGATTAAC…CGTCAGACTGTCGA

MBP KpnI 6x His TGAAGCCCTGAAAGACGCGCAGACT GGTACC CACCACCACCACCACCAC

Stop Occludin loop-1 codon EcoR I T7 terminator AGAGGCTATG GAACTT… CAAGAGCA TGA GAATTC… TAGCATAA…TTG…

Figure 4.1 pMTTH cloning/expression region. The extracellular loop 1 and loop 2 were cloned and ligated respectively into pMTTH vectors, using the KpnI and EcoR I sites, to generate MBP conjugated extracellular loops with an 6Xhistidine tag (figure shows the sequence of loop-1 as an example).

# 1

# 2

Figure 4.2 Occludin extracellular loop 1 is cleaved by meprin A. MBP conjugated loop-1 (6 µM) was incubated with meprin A (47 nM) for 0 min, 5 min, 10 min, 30 min, 1 h and 4 h. The controls contained buffer or 47 nM latent meprin A in the incubation mixture for 4 h. After incubation, samples were subjected to SDS-PAGE electrophoresis and Coomassie blue staining. Cleavage of occludin loop 1 was observed after active meprin A treatment, but not latent meprin A treatment, as shown by decreased band intensity of loop 1 (arrow #1), and the accumulation of possible cleavage product (arrow #2).

# 1

# 2

Figure 4.3 Occludin extracellular loop 2 is cleaved by meprin A. MBP conjugated loop-2 (6 µM) was incubated with meprin A (47 nM) for 0 min, 5 min, 10 min, 30 min, 1 h and 4 h. The controls contained buffer or 47 nM latent meprin A in the incubation mixture for 4 h. After incubation, samples were subjected to SDS-PAGE electrophoresis and stained with Coomassie blue. Cleavage of occludin loop 2 was observed after active meprin A treatment, but not latent meprin A treatment, as shown by decreased band intensity of loop 2 (arrow #1), and the accumulation of possible cleavage product (arrow #2).

4.3 Determination of the occludin cleavage site(s) by Mass-spectrometric analysis To determine the cleavage site(s) of meprin A on occludin, the cleavage products of extracellular loop 1 and loop 2 were excised from SDS-PAGE gel. Samples were trypsin digested and subjected to analysis by C18 nanoflow followed by MS/MS analysis. Mass-spectrometric analysis was performed in the Core Facility of Penn State College of Medicine and Proteomics and Mass Spectrometry Core Facility of Cornell University. The amino acid sequence of the fragment was identified by further subjecting it to CID (collision induced dissociation) followed by MS/MS. Fragmentation in this process is induced by collision and the resulting ions are further analyzed. The masses of ions thus formed are determined and compared with the theoretical masses of ions predicted. These data allow for identification of consecutive ions and thereby the peptide fragment. For sample of loop 1, the most close to C-terminal detected peptide identified is GYGTSLLGG (high light in yellow color). This cleavage site corresponds to amino acid 100-101 G S in the full length occludin (Figure 4.4). This cleavage site is also one of the potential cleavage sites predicted by the computer program previously described in chapter 3.5. Samples of loop 2 were also analyzed by mass spectrometry, however there was no cleavage site determined due to the low amount of sample available.

1 MSSRPLESPP PYRPDEFKPN HYAPSNDIYG GEMHVRPMLS QPAYSFYPE

50 DEILHFYKWTS PPGVIRILSM LIIVMCIAIF ACVASTLAWD RGYGTSLLG

100 GSVGYPYGGSG FGSYGSGYGY GYGYGYGYGG YTDPRAAKGF MLAMAAFCF

150 IAALVIFVTSV IRSEMSRTRR YYLSVIIVSA ILGIMVFIAT IVYIMGVNP

200 TAQSSGSLYGS QIYALCNQFY TPAATGLYVD QYSYHYCVVD PQEAIAIVL

250 GFMIIVAFALI IFFAVKTRRK MDRYDKSNIL WDKEHIYDEQ PPNVEEWVK

300 NVSAGTQDVPS PPSDYVERVD SPMAYSSNGK VNDKRFYPES SYKSTPVPE

350 VVQELPLTSPV DDFRQPRYSS GGNFETPSKR APAKGRAGRS KRTEQDHYE

400 TDYTTGGESCD ELEEDWIREY PPITSDQQRQ LYKRNFDTGL QEYKSLQSE

450 LDEINKELSRL DKELDDYREE SEEYMAAADE YNRLKQVKGS ADYKSKKNH

500 C KQLKSKLSHI KKMVGDYDRQ KT

Figure 4.4 Protein sequence of occludin and the cleavage site determined by mass spectrometry analysis. The sequences of extracellular loop 1 (91-136) and loop 2 (197- 244) are underlined. Recombinant proteins of extracellular loop 1 and loop 2 were constructed and used to determine the cleavage site(s) by meprin A. Mass spectrometry analysis indicated that in sample loop 1, the most close to C-terminal detected peptide is GYGTSLLGG (high light in yellow color). Thus there is a cleavage site at 100-101 G S on the first extracellular loop (red arrow).

Chapter 5. Meprin B weakens epithelial barriers Meprin metalloproteases are composed of two subunits, meprin α and meprin β, and exist as different isoforms. Previous studies indicated that macrophages of meprin βKO mice have deficient movement through in vitro extracellular matrix systems compared to wild-type counterparts [73]. Meprin B has been shown to cleave adherens junction protein E-cadherin, which is also important in regulating epithelial barrier integrity [64]. Therefore, homomeric rat meprin B was studied to determine whether this meprin isoform affects epithelial barriers and tight junction proteins.

5.1 Meprin B impairs MDCK monolayer’s barrier function To evaluate the epithelial barrier function in response to meprin B, permeability of MDCK cell monolayers to 10kDa-FITC dextran and resistance to ionic flux (TER) were measured. The procedures used were as described for meprin A in Chapter 3. The results were similar to those with meprin A that active meprin B treatment increased MDCK monolayers’ permeability to FITC-dextran, as compared to untreated samples or those treated with latent meprin B. The statistic significance was reached after 9 h treatment with active meprin B (Figure 5.1). The transepithelial electrical resistance (TER) studies showed there was a tendency of active meprin B to decrease the electrical resistance of MDCK monolayer, as compared to untreated samples or those treated with latent meprin B (Figure 5.2). However, no statistically significant difference was observed between active meprin B treatment and control/latent treatment, even after 9 h of incubation. These data and the FITC-dextran data indicate that meprin B was less effective in impairing epithelial barrier function of MDCK monolayers, as shown by less increase of FITC-dextran and less decrease of TER, compared to meprin A.

MDCK monolayer permeability to FITC-dextran (10 kDa)

1.8 ______* 1.6

1.4

1.2

1 Control 0.8 Latent Meprin B

0.6 dextran concentration (ng/uL) concentration dextran

- Active Meprin B 0.4 FITC

0.2

0 1 5 9 h

Figure 5.1 MDCK monolayer permeability was increased after exposure to active meprin B. MDCK cell monolayers were cultured on inserted filters. Active or latent meprin B (47 nM) were added to the apical chamber of inserts, and incubated at 37oC for 1, 5 and 9 h. The control is MDCK cell monolayers incubated with medium only. After meprin treatment, the apical medium was replaced with 15 µg/ml of FITC-dextran (10 kDa). After a 2-h incubation at 37oC, the basal medium was collected and the

fluorescence was measured by a spectrophotometer at λex492 nm and λem 520 nm. There were 3 experiments per time point per each group (*=P<0.05). .

Figure 5.2 Homomeric meprin B does not significantly decrease transepithelial electrical resistance (TER). MDCK cell monolayers were cultured on inserted filter and then treated with 47 nM active or latent meprin A for 1, 3, 5, 7 and 9 h. The control is MDCK cell monolayers incubated with medium only. The transepithelial electrical resistance across the monolayer was measured by a voltohmmeter EVOM with a STX2 Electrode (World Precision Instruments). There were 3 experiments per time point per group.

5.2 Meprin B disrupts TJs on MDCK monolayers MDCK monolayers were treated with meprin B to assess the effects on tight junction integrity, and stained for the TJ protein ZO-1. Three random fields of monolayers were observed under microscope showing similar disruptions of ZO-1, and one representative field was captured and showed in Figure 5.3. In untreated monolayers, immuno-staining for ZO-1 was continuous at cell borders. In monolayers treated with active meprin B, the tight junctions were disrupted as shown by discontinuous immunostaining, while latent meprin B, which has minimal proteolytic activity, did not disrupt TJ of MDCK cells (Figure 5.3). The fluorescence signals of ZO-1 were quantified by ImagJ (Figure 5.3 D). These observations indicated that meprin B disrupted TJs between MDCK cells, and it is proposed these effects are attributed to proteolytic cleavage of certain TJ proteins.

5.3 Meprin B has little proteolytic activity on occludin in MDCK monolayer Based on the substrate preference and specificities of meprins, computational predictions (Prediction of Protease Specificity, PoPS) indicated that meprin B ought to be able to cleave several tight junction proteins, including occludin. To investigate experimentally the cleavage of occludin by meprin B, MDCK monolayers were incubated with meprin B, and samples were subjected to SDS-PAGE electrophoresis and Western blot analysis. Figure 5.4 shows a representative image from two Western blots. Decreased intensity of occludin staining was observed, but to a very limited extent. The percentage of hydrolysis from measurements of the optical density of occludin bands was caluculated and averaged from these two blots (Table 5). These results indicated that meprin B has less proteolytic activity on occludin in MDCK monolayers as compared to meprin A.

D. ZO-1 staining signal quantification 120

100

% Control 40

0 Active meprin B treated Latent meprin B treated Figure 5.3 Meprin B disrupted the immunostaining of ZO-1 on MDCK monolayer. MDCK cells were grown on glass coverslips until they reached confluency. Cells were

treated with 47 nM active or latent meprin B for 5 h. Cells were fixed in paraformaldehyde and permeabilized with Triton-X 100. Then incubated with monoclonal anti-ZO-1(1:4 dilution) antibody and with fluorescence-labeled secondary antibody. Images were examined with microscope. The upper panel showed the nuclei stainings (blue) of different groups, and the lower panel showed the ZO-1 stainings (green). In untreated monolayers (A) and monolayers treated with latent meprin B (C), immuno-staining for ZO-1 was continuous at cell borders. In monolayers treated with active meprin B (B), the ZO-1 immune-staining was disrupted (indicated by arrows). The fluorescence signals of ZO-1 were quantified by software ImagJ (D). The percentages of active or latent meprin B treated signals were calculated by the ratios to untreated signal respectively.

Figure 5.4 Meprin B does not cleave occludin in MDCK monolayers. MDCK monolayers were incubated with exogenous active or latent meprin B (4.7 nM, 23 nM, and 47 nM), for 5 h. Occludin was detected by Western blot analysis using anti-occludin polyclonal antibody. The percentage of hydrolysis was quantified by the optical densities of occludin bands. The results indicated that the intensity of occludin band did not decrease significantly with increasing amounts of active meprin B.

Densitometry 140

120

100

60 % Control

0 4.7 nM 23 nM 47 nM latent

Experiment 1 Experiment 2 Average

Band % of Band % of % of Control Density Control Density Control Control (untreated) 2.5 100 3.29 100 100

4.7 nM active meprinB 2.56 102 2.7 82 92

23 nM active meprin B 0.99 40 2.5 76 58

47 nM active meprin B 3.19 127 3.18 97 112

47 nM latent meprin B 2 80 3.13 95 90

Table 5. Densitometry of meprin B cleavage of occludin in MDCK monolayers. MDCK monolayers were incubated with increasing concentrations of meprin B (4.7 nM, 23 nM, 47 nM) for 5 h. The percentage of hydrolysis was quantified by the optical densities of occludin bands. The average percentages of band densities over control were 58 % (±21%) and 112% with 23 nM and 47 nM meprin B treatment respectively. These results indicated that meprin B has little proteolytic activity on occludin in MDCK monolayer.

5.4 Occludin in membrane fractions of MDCK cells is cleaved by meprin B To determine whether occludin in membrane fractions was cleaved by meprin B, the membrane-enriched fractions from MDCK cell lysates were incubated with active or latent meprin B. Preliminary experiments showed that the disappearance of occludin in MDCK membrane fractions incubated with higher concentrations of active meprin B (47 nM and 20 nM) was rapid. Therefore, 10 nM meprin B was used to show the gradual degradation of occludin by meprin B over time. Figure 5.5 shows the representative image out from two Western blots. The results showed the cleavage of occludin by active meprin B, but not with latent meprin B nor with EDTA-inhibited meprin B. The percentage of hydrolysis from measurements of the optical density of occludin bands was caluculated and averaged from these two blots (Table 6). These results indicate that occludin in the membrane-fractions has accessible cleavage site(s), whereas they are protected or inaccessible in the TJs of monolayers.

Figure 5.5 Cleavage of occludin in membrane-enriched fractions of MDCK cells by meprin B. Membrane enriched fraction of MDCK cells were incubated with 10 nM active or latent meprin B. Occludin was detected by Western blot assay using an anti- occludin polyclonal antibody. The percentage of hydrolysis was quantified by the optical densities of occludin bands.

Densitometry 250

200

150

% Control 100

0 10 min 30 min 1 h w/EDTA, 1 h latent

Experiment 1 Experiment 2 Average

Band % of Band % of % of Control Density Control Density Control Control (untreated) 1.38 100 3.37 100 100

10 nM active meprin B (10 min) 0.41 30 3.49 103 67

10 nM active meprin B (30 min) 0.1 7 2 59 33

10 nM active meprin B (1 h) 0.03 2 1 30 16

10 nM active meprin B (+EDTA, 1h) 2.72 197 5.98 177 187

10 nM latent meprin B (1 h) 0.8 58 4.8 142 100

Table 6. Densitometry of meprin B cleavage of occludin in MDCK membrane fraction. MDCK membrane fractions were incubated with 10 nM active or latent meprin B. The percentage of hydrolysis was quantified by the optical densities of occludin bands. The average percentage of hydrolysis increases gradually as shown by 33%, 67% and 84% with active meprin B treatments. These results confirmed that occludin in MDCK cell membrane fractions is degraded by active meprin B.

5.5 Claudin-4 in membrane fraction of MDCK cells is not degraded by meprin B Computational prediction indicated that other tight junction proteins might also be potential substrates for meprin B, for example claudin-4. To investigate the cleavage of claudin-4 by meprin B, MDCK membrane-enriched fractions were incubated with meprin B. Western blot analysis did not show degradation of claudin-4 by active meprin B (Figure 5.6). The results indicated that meprin B had little proteolytic activity on occludin and claudin-4 in MDCK monolayer, which could account for the lesser extent of impairment on epithelial barrier function as compared with meprin A.

Figure 5.6 Meprin B does not cleave claudin-4 in MDCK membrane fractions. MDCK monolayers were incubated with exogenous active meprin B (47 nM), for 5 h and 12 h, or with latent and EDTA inhibited meprin B for 12 h. The presence of claudin-4 was detected by Western blot analysis using anti-claudin-4 monoclonal antibody.

Chapter 6. General conclusions and discussion In this study, the hypothesis that the meprin metalloproteases relax epithelial integrity by degrading one or more key components of tight junctions has been tested. A consequence of this cleavage is that degraded/disrupted tight junctions allow monocytes and inflammatory molecules such as cytokines to gain access to sites of injury. During the course of this investigation, it has been demonstrated that meprin A degrades the tight junction protein occludin and that exposure to exogenous meprin A impairs the epithelial barrier function in a cell-based system. It has been further demonstrated with the bladder studies that the impairment of epithelium barrier by meprin A occurs in vivo as well. The effects of meprin A on monocytes migration through epithelial monolayers are also demonstrated by this study. Meprin A is often found in the same sites as other proteases such as meprin B and matrix metalloproteases. The biologic consequences of meprin A, therefore must be evaluated in the context of complementarity and antagonism with other concurrent proteolytic processes.

6.1 Meprins in inflammation: acute and chronic conditions It has been well documented that proteases participate in the progression of inflammatory responses, from early immune cell recruitment to the later tissue repair [17, 124] (Figure 6.1). For example, MMPs activate neutrophil chemoattractant, macrophage- derived latent transforming growth factor-α (TGF-α), to form a chemokine gradient and facilitate immune cell accumulation at inflammation sites [124]; while calpain proteases have been shown to play key roles in intestinal epithelia cell proliferation and migration during wound healing [125]. Thus, a balance of protease activity is essential to the proper functioning and outcome of inflammatory processes. MMPs perform multiple roles in the normal immune response such as defensin activation; however, excessive MMP activities may lead to increased blood brain barrier permeability and sustained activation of cytotoxic factors which in turn cause host morbidity and favor pathogen dissemination or persistence [126, 127].

Increased vascular ECM remodeling permeability

Cytokine release Cytokine activation/ Proteases in inactivation

Inflammatory Responses Angiogenesis Leukocyte migration

Tissue repair

Defensin activation

Figure 6.1 Proteases in disease and inflammation. Proteases, including meprins and MMPs, have been implicated in acute as well as chronic inflammatory diseases. They have been shown to modulate many important events in the progression, such as leukocyte migration and cytokine levels and activity.

Meprin metalloproteases have been implicated in inflammatory processes of both acute and chronic disease conditions. For example, the human MEP1A, the gene coding the meprin α subunit, has been identified as a susceptibility gene for inflammatory bowel disease [109]. Using the unique tool of meprin knockout mice developed by our laboratory, we performed in vivo experiments to address the roles of meprins in inflammation. In an acute urinary tract infection model, the host responses to an E.coli challenge in meprin αKO mice were less severe than in their wild-type counterparts [4]. In this model, meprin αKO mice had less bladder edema, less leukocyte infiltration and less bladder permeability than WT mice. LPS, the endotoxine from E.coli, is a potent inducer of cytokine production through toll-like receptor (TLR) mediated signaling pathways [128]. Intravesicular LPS challenge in meprin αKO and WT mice showed that serum cytokine levels of TNFα, IL-1β and MCP-1 were significantly lower in meprin αKO mice compared to WT counterparts. These results are consistent with the suggestion that the meprin αKO bladder epithelium retains more barrier function than WT counterparts, which might limit the transmigration of leukocytes. The function of meprin B in the acute UTI model was also studied. In contrast to the meprin αKO mice, meprin βKO and WT mice showed similar BUN (blood urine nitrogen) profiles, similar changes in body temperature and similar serum nitrate/nitrite levels. In addition, serum cytokine levels in meprin βKO mice were not significantly different from WT counterparts [4]. Both βKO and WT mice produce meprin A in the kidneys and by migratory leukocytes. Therefore these studies suggest that meprin A has a determinative and pro-inflammatory role in the host response to an acute urinary infection. In a model of sub-chronic bowel inflammation that mirrors ulcerative colitis (UC), meprin αKO mice were more susceptible to colitis than their wild-type (WT) counterparts when subjected to the dextran sodium sulfate (DSS) treatment. After 4 days of DSS treatment, meprin aKO mice showed greater intestinal tissue damage, exacerbated inflammation and mortality [109]. It is proposed that the underlying mechanism for the effects of meprins may involve the balance of cytokine levels and tissue repair. Meprins have been shown to both activate and inactivate cytokines in vitro and in vivo. For example, meprin A inactives RANTES (Regulated on Activation Normal T Cell

Expressed and Secreted), while meprin B activates IL-1β and IL-18 [62, 129]. In the meprin αKO mice, the intestinal villi and leukocytes still produce meprin B which can activate pro-IL-1β and IL-18. In addition, absence of meprin A may lead to the lack of inactivation of RANTES, Thus, several cytokines were observed to be elevated in meprin αKO mice upon DSS treatment, including IL-1β, IL-6 and RANTES [109]. In addition, loss of mucosal epithelial meprin A may impede the recovery process upon colitis induction (Banerjee, Thesis dissertation). Therefore, these studies suggest that meprin A has an anti-inflammatory role in chronic intestinal inflammation. Taken together, these studies shed light on the proposition that meprin A has a pro-inflammatory role in acute or initial stages of injury/inflammation, while it has a protective role in chronic inflammatory conditions. However, the underlying molecular mechanisms need to be elucidated.

6.2 Meprins cleave certain tight junction proteins In multicellular organisms epithelia and endothelia delineate the borders between different compartments. This demarcation relies on the establishment of cell-cell contacts, such as tight junctions (TJs), between adjacent cells to withstand mechanical stress and prevent paracellular flux [130]. TJs are maintained through a complex network of interacting proteins, such as Occludin, Zona occludens and E-cadherin. Occludin, one of the first TJ proteins to be identified has two extracellular loops [131]. Bamforth et al. demonstrated that murine epithelial cells with mutant occludin lacking the N-terminus and extracellular domains were unable to form strong tight junctions [132]. Recent studies indicate that certain proteases are able to cleave epithelial junctional proteins. For example, in prostate and breast cancer cells, matrilysin (MMP-7) and stromelysin (MMP- 3) have been shown to generate a soluble fragment of E-cadherin [133, 134]. Meprin B has also been shown to cleave E-cadherin in extracellular domains [64]. In this study, it is demonstrated for the first time that meprin A is able to cleave the TJ protein occludin in both membrane-enriched cell fractions and intact monolayers of MDCK cells. It was determined that the meprin A cleavage site was on the first extracellular loop of recombinant occludin. Occludin extracellular loops are essential for its biological functions. For example, the first loop is required for tight junction resealing

resulting from intercellular occludin interactions between adjacent cells [135]; while the second loop is required for occludin to localize to cell membrane and may affect colocolization with other TJ proteins such as ZO-1 [136]. In addition, occludin is also shown to be essential for epithelial phenotype. Forced expression of occludin in transformed epithelial cells rescues epithelial morphology and promotes reacquisition of the epithelial phenotype [137, 138]. A consequence of the cleavage of occludin by meprin A is that the intercellular adhesion between MDCK cells would be significantly weakened. This was confirmed and demonstrated by increased permeability to a fluorescent compound, decreased resistance to ion flux of MDCK monolayer and increased bladder permeability to sodium fluorescein in vivo. These results could also explain previous observations that meprin αKO mice exhibit decreased bladder permeability and less leukocyte infiltration in UTI [4]. This study also showed that although meprin B is able to cleave occludin in cell fractions, however it had little proteolytic activity on occludin in MDCK monolayers. One interpretation of these results is that the cleavage sites of occludin are not accessible in the conformation existing at the intercellular interfaces. Meprins are abundant proteases of intestinal epithelial cells, kidney, and mesenteric leukocytes. For example, meprins compose about 5% of total brush border membrane proteins in rodent kidneys. Soluble homomeric meprin A is abundantly expressed in intestinal and urinary tracts [139]. Preliminary experiments in our laboratory showed that the concentration of soluble meprin A in the urine is approximately 100 nM. This form of meprin A is partially active, and is probably activated by trypsin and/or trypsin-like enzymes in vivo [140]. In fact, trypsin-like enzymes are abundant in plasma and several types of leukocytes. It is likely that meprin at the site of inflammation can become activated readily [140, 141].

6.3 Meprins modulate epithelial barrier functions This thesis work demonstrated that meprin A and meprin B disrupted tight junctions on MDCK cell monolayers and impaired epithelial barrier functions. Cultured Madin-Darby canine kidney (MDCK) cells exposed to active homomeric meprin A showed decreased immunostaining for ZO-1 and occludin in the cellular tight junctions.

Homomeric rat meprin B also decreased the immunostaining for ZO-1 in the TJs of MDCK monolayers. MDCK cell monolayers incubated with active meprin A and meprin B, but not latent meprins, display decreased transepithelial electrical resistance and increased permeability to FITC-labeled dextran. These data indicated that both meprin A and meprin B were able to impair epithelial barrier functions of MDCK monolayers, however meprin A was more effective than meprin B. Notably, the permeability to FITC- dextran started to increase after 5 h of active meprin A-treatment, while the TER only decreased significantly after 9 h. One interpretation is that different TJ proteins regulate these two epithelial barrier functions. For example, claudins are usually considered to be the regulators of cation/anion exchange through epithelium while occludin is usually considered to be responsible for tightness of epithelium and paracellular transport/diffusion of small molecules [142-144]. Thus the observed difference between increased FITC-dextran permeability and decreased TER can be explained by the fact that meprin A cleaves occludin which regulates permeability to FITC-dextran, but not claudin-4 which is more responsible for ionic flux. The later decrease of TER might be a consequent disruption of TJs caused by occludin cleavage. As a matter of fact, the delay between permeability and TER was observed by previous studies as well. Golebiewski et al. (2011) showed that avian influenza virus infection to MDCK cells disrupted occludin on TJs, increased permeability to FITC-insulin starting at 3 h, while decreased TER 3 h later [145]. This is consistant with the proposistion that disruption of occludin may not affect permeability and TER at the same time. Since occludin has been shown to have a critical regulatory function by interacting with other junctional proteins including ZO-1 and actin [146], cleavage of occludin might lead to disruption of the junctional complex. In addition to that, previous studies in our laboratory showed that meprins are able to redistribute to cytosol under certain pathological conditions such as ischemia reperfusion, and degrade the cytoskeletal proteins actin and villin [147]. These findings together could be applied to explain the observations that the immunostaining of other junctional protein (e.g., ZO-1) was disrupted after meprin A treatment, despite the normally inaccessible locations of these intracellular proteins to meprins (Figure 6.2).

d a e

Figure 6.2 Meprins’ effects on junctional proteins and barrier function. (a) Exogenous meprin A cleaves occludin (orange) on extracellular loop. Meprin B has little proteolytic activity on occludin. (b) Neither meprin A nor meprin B cleaves claudin-4 (light green). Yet the effects on other claudin family members need to be studied. (c) E- cadherin (yellow), which associated with catenin (dark green circle), has been shown to be cleaved by meprin B in the extracellular region. The effects of meprin A and meprin B on transmembrane junctional proteins lead to disruption/ disassembly of junctional complexes, impaired barrier function and loosened intercellular contacts. (d) ZO-1 immunostaining was disrupted by exogenous meprin A and meprin B, probably because of disruption the junctional complex but not direct cleavage by meprins. (e) Actin and villin (blue) could be degraded by redistributed meprins.

6.4 Meprins facilitate leukocyte migration Studies have indicated that tight junctions are involved in leukocyte transmigration [148-150]. Certain proteases are able to cleave junctional proteins and facilitate leukocyte migration. For example, the cleaveage of occludin by metalloprotease and/or caspase and the cleavage of E-cadherin by caspase or metalloprotease, may facilitate the leukocytes transmigration through epithelial and endothelial barriers [120, 151, 152]. Meprin expression has been detected on several leukocytes, including monocytes, neutrophils, natural killer (NK) cells and macrophages. Depleting meprins in those leukocytes will diminish the dissemination of these cells from bone marrow to peripheral blood or the transmigration through ex vivo matrigel system [3, 73]. Preliminary experiments also detected meprin A activity (BK+ activity) on the WT monocytes. In this study, we demonstrated for the first time that meprin A expressed by monocytes enhances their transmigration ability through cellular monolayers. The results showed that fewer meprin αKO monocytes transmigrated through MDCK monolayers than wild-type monocytes. When there was no epithelial barrier (only filter), there was no difference between the transmigration efficiency of meprin αKO and wild-type monocytes. The results showed a decreased ability of monocytes to pass through cellular monolayers in the absence of meprin A. These results are consistant with the proposition that the ability of meprin A to cleave TJ proteins, such as occludin on epithelial cell, regulates leukocyte transmigration. Previous studies indicated that meprin B regulates macrophage migration through matrigel [73]. My thesis work demonstrated that cell-associated occludin is not a preferred substrate for meprin B. Meprin B has little proteolytic activity on the extracellular loops of occludin and occludin in MDCK monolayers. This study also showed that meprin B is able to only moderately impair epithelial barrier functions. Thus, molecular mechanisms other than cleaving occludin on TJs needs to be elucidated to explain meprin B facilitating leukocyte migration. One possibility is that meprin B cleaves E-cadherin, another junctional protein, to loosen cell adhesions. Other possible explanations might be meprin B degrades cytoskeletal proteins (e.g., actin) to disrupt cell morphology and loosen cell adhesions; or meprin B participating in modulation of

cytokine profile (e.g., IL-18) during inflammation, thus facilitates leukocyte migration to inflammation sites [63, 147].

6.5 Meprins modulate cytokine profiles in inflammation Cytokines are small cell signaling molecules that are secreted by numerous immune cells. The release, activation and degradation of cytokines is a highly organized cascade and determines the outcome of immune responses. Normally, the robust/acute host responses to exogenous stimuli includes the activation and release of a series of cytokines, especially pro-inflammatory cytokines such as IL-6, interferons and TNF-α [153, 154]. The resulting leukocyte accumulation in response to cytokines will lead to enhanced cellular immune and antibody release, and eventually resolve the immune responses. It has been proposed that the balance of meprin A and meprin B modulates cytokine activities in both acute and chronic inflammations. In acute renal infection, extensive production of pro-inflammatory mediators such as TNF-α, IL-1β, and IL-5 were observed (Yura, Thesis dissertation). TNFα, IL-1β, and MCP-1 levels were significantly lower in meprin αKO mice after LPS challenge in contrast to WT counterparts, indicating a pro-inflammatory role of meprin A by increasing cytokine levels. The ectodomain shedding of those pro-cytokines, is mediated by proteolytic cleavage by metalloproteases [155]. In the chronic colitis induction, IL-1β and IL-18 activities are enhanced by the presence of meprin B (Banerjee, Thesis dissertation). In fact, Banerjee et al. demonstrated that pro-IL-18 is activated by meprin B in vitro and in vivo [63]. However, the pro-inflammatory cytokine/chemokine RANTES is inactivated by meprin A, suggesting a protective role of meprin A in chronic inflammatory responses.

6.6 Meprins participation in wound healing and tissue repair Inflammation is a highly coordinated process that includes release and activation of cytokines, recruitment and mobilization of leukocytes and re-epithelialization/tissue repair. Interestingly, meprins have also been implicated in the tissue repair of chronic inflammation conditions. In fact, proteases such as MMPs, are able to modulate turnover of connective-tissue proteins and loosen cellular junctions thus facilitating re- epithelialization and tissue repair [17, 156]. For example, MMP-1 alters the migratory

substratum of type I collagen, from a high-affinity ligand for the α2β1-integrin to one of lower affinity. In this way, it drives the forward movement of the repairing cells to wound-bed matrix [157]. MMP-7 facilitates wound closure of injured lung epithelium ex vivo, presumably by the shedding the E-cadherin ectodomains, which would loosen cell– cell contacts, and thereby facilitating cell migration [15]. Preliminary wound healing studies in our laboratory demonstrated delayed healing in meprin A deficient mice (Yura, Thesis dissertation). The possible molecular mechanisms might be that, meprins facilitate migration/rolling of newly synthesized cells and remodeling of ECM to help restitution. Meprins alone or working in synergy with other proteases (e.g. MMPs) might also modulate the activity of a number of cell proliferation/growth factors and cytokines, such as EGF and IFN-γ, to promote restitution [158].

6.7 Closing In summary, this thesis work demonstrated that meprin A cleaves the tight junction protein occludin, impairs epithelial barriers and facilitates monocyte migration. The cleavage of this TJ protein may be the one of the major molecular mechanisms by which meprins influence inflammation. Thus I would propose that meprin A has a pro- inflammatory role in the initial stage of inflammation, while it has a protective role in chronic inflammatory conditions. Previous results from mouse models now can be explained accordingly: in acute inflammation (e.g. UTI), the absence of meprin A leads to less disruption of TJs. Cell adhesion is more intact, and thus there is less bladder permeability and leukocyte infiltration in meprin αKO mice than WT counterparts. On the other hand, in the chronic condition (e.g. IBD), less epithelial cell shedding and migration during tissue remodeling leads to delayed repair and more severe tissue damage in meprin αKO mice (Figure 6.3 A and B). In addition to that, we should also keep in mind that meprins are involved in modulating cytokine levels. The biologic consequences of the meprins are determined by a number of variables, including location within the body (ileum vs. colon), within the cell (micro villi vs. basolateral side of epithelial cell), and temporal regulation (migrating vs. stationary leukocytes). The cellular distribution and expression of the various isoforms of meprin have been shown to have a counterpoising modulation of pathogenesis. Thus, the coordinated actions of

meprin isoforms with other proteases help to shape the outcome of inflammation processes.

Bladder (WT) Lumen

NF-kB

Release of cytokines

IL -1β, MCP-1, TNF-α

0 h 6 h 12 h

Figure 6.3A Modulation of meprins in acute inflammation in wild-type mice. This figure shows a time course (0-12 h) of actions of meprins on mouse bladder epithelium during acute inflammation (e.g UTI). Meprins regulate the breakdown (lightning mark) of epithelial TJs and AJs (blue bars) and cytokine profile. Upon LPS challenge (pink dot), TLRs (e.g., TLR-4) were activated, leading to the activation of signaling pathways (e.g., MyD88, NF-κB) and the release of inflammatory cytokines, such as IL-1β and TNF-α. The cytokine gradient attracts leukoctyes to the inflammation site. The soluble form of meprin A (blue dot) in the urine which may be partially activated can degrade TJs protein (e.g., occludin) on the apical side of bladder cells. Meprins expressed by infiltrating leukocytes (heteromeric meprin A, yellow dot; homomeric meprin A, blue dot) will disrupt intercellular junctions further (e.g., E-cadherin of AJs). The loosened intercellular junctions and the meprin-mediated activation of certain pro-inflammatory cytokines facilitate the migration of leukoctyes to the sites of injury and elevate inflammation.

IL-1β IL-1β MCP-1 IL-1β MCP-1 TNF-α MCP-1 TNF-α TNF-α

WT αKO βKO inflammation inflammation inflammation

Figure 6.3B Comparison of acute inflammation in wild-type and KO mice. Meprin A has pro-inflammatory role in the acute inflammation, as shown by the ability to modulate cytokine levels and impair epithelium barriers. The impaired epithelium and high levels of pro-inflammatory cytokines facilitate leukoctyes infiltration and elevate inflammation in WT mice. The αKO mice have the least severe inflammation since only the meprin β subunit (light green) is expressed, thus the disruption of TJs by soluble meprin A was diminished. The limited disruption of TJs and the significantly lower cytokine levels (as shown in smaller font in figure) together lead to less leukocyte infiltration and less inflammation in meprin aKO mice. The meprin βKO mice have comparable TJs disruption and cytokine levels to WT mice, due to the activity of meprin A. The disruption of E-cadherin could be mediated by other proteases such as MMP-7. Thus the inflammation in meprin βKO mice is comparable to WT mice.

Appendix: Roles of meprin A in sub-chronic inflammation

A.1 Overview Previous studies using a mixed background (C57 BL/6 X 129/Sv) mouse model of inflammatory bowel diseases showed that meprin αKO mice were more susceptible than their wild-type counterparts when subjected to the dextran sodium sulfate (DSS) treatment. The meprin αKO mice exhibited greater intestinal tissue damage, elevated neutrophil infiltration, exacerbated inflammation and increased mortality [109]. Meprins may be expressed by infiltrating leuckocytes or expressed by intestinal epithelial cells, and loss of epithelial meprin A may impede the recovery process upon colitis induction (Banerjee, Thesis dissertation). The aims of following experiments were: (1) determine whether congenic mice (C57BL/6 background) have similar response to DSS treatment as mixed background mice previously exhibited; (2) determine whether meprin A from different sources (epithelium and bone marrow) influence the progression of experimental inflammatory bowel disease. Inflammatory bowel disease was induced by DSS in both mixed backgraound as well as on C57BL/6 congenic mice. The results indicated that mixed bacground meprin αKO mice are significantly more vulnerable to chemical (DSS) induced colitis compared to WT counterparts; while there was no statistically significant difference between congenic meprin αKO and WT mice after DSS treatment. To determine differenct sources of meprin A involved in this sub-inflammation response, reciprocal transfer between WT and the αKO mice using bone marrow transplantation was performed and colitis was induced by DSS in all chimera mice.

A.2 Methods A.2.1. Bone marrow transplantation Meprin αKO and WT mice on a C57BL/6 x 129/Sv mixed background were used in this study. Briefly, recipient mice were irradiated at 600rads from a Cobalt source to deplete endogenous bone marrow. The bone marrows isolated from donor mice were suspended in PBS. Each recipient mouse was injected iv with 10X106 bone marrow cells.

The recipient mice were then kept in sterile isolator bubble in PSU-COM Animal Facility, on antibiotic water for 2 weeks.

A.2.2. Induction of experimental Ulcerative Colitis Mice that survived the bone-marrow transplantation were used to induce an experimental model of inflammatory bowel diseases (ulcerative colitis) as described previously. In brief, mice were given with 3.5% dextran sodium sulfate (DSS) in drinking water for 4 days, and then were given water for 3 more days to induce colitis (Banerjee, Thesis dissertation) [109].

A.2.3. Measurement of weight loss and disease activity index Body weight, rectal bleeding and stool samples were measured and recorded daily. The weights of day (-1) and day 0 were averaged and considered as the starting weight. The average starting weight was used to compare the subsequent weight change over the period of the study. Stool formation and rectal bleeding was monitored over the period of study. Rectal bleeding was tested for blood by hemoccult blood slides (Beckman Coulter). The principle of the test is that oxidation of alpha-guaiaconic acid, present in the slides, by hydrogen peroxide will give a blue colored quinone compound. When blood is present in the fecal matter, the heme portion of hemoglobin shows peroxidase activity thereby forms a highly conjugated quinone compound that is blue in color (Banerjee, Thesis dissertation). The disease activity index (DAI) is based upon three parameters, weight loss, rectal bleeding and stool formation. The scoring was expressed on a scale of 0 to 4, indicating no disease and maximum disease activity respectively [159].

A.2.4. Myeloperoxidase assay Mice were sacrificed on day 7 by inhalation of isoflurane followed by cervical dislocation. The entire colon was removed using standard surgical procedures and measured for length. Myeloperoxidase (MPO) assays were performed as described previously (Yura, Thesis dissertation). Myeloperoxidase, the most abundant protein in neutrophils (also found in monocytes), is essential for oxygen-dependent bactericidal

system of polymorphonuclear leukocytes (PMNs) and is hence the hallmark of early stages of an acute inflammation [160]. The principle of the MPO assay is based on the unique ability of myeloperoxiase to catalyze a reaction between chloride and hydrogen peroxide (H2O2) to form hypochlorous acid [161]. In this experiment, mouse colons were homogenized in 20 mM potassium phosphate buffer (pH 7.4) and centrifuged at 20,000xg at 4°C for 20 min. The sediment was suspended in 50 mM potassium phosphate buffer (pH 6.0) containing 0.5% HTAB and 10 mM EDTA. The preparation was freeze-thawed three times after sonication, then incubated on ice for 20 min. The preparation was then centrifuged at 4,000xg for 15 min at 4°C and the supernatant fraction was collected. Fifty µl of lysate was added to 1.45ml of 50 mM Potassium phosphate buffer containing o-dianisidine dihydrochloride (0.167mg/ml) and H2O2 (0.0005%). The absorbance was measured at 460nm for 3 min. One MPO unit is defined as the amount of MPO that degrades 1 mmol of

H2O2 per min. Myeloperoxidase activity was plotted as MPO units/g colon tissue.

A.3 Results A.3.1 Mixed background meprin αKO showed greater weight loss after DSS treatment Mixed background mice were administrated with 3.5% dextran sodium sulfate (DSS) in the drinking water for 4 days, and then given water for 3 more days. Throughout the 7-day period of the study, body weight of each mouse was recorded. Weight loss, starting from day 4, was first noted in meprin αKO mice treated with DSS. From day 4 on, the αKO mice treated with DSS lost significantly more weight than WT counterparts (*=P < 0.05) every day (day 4, 5, 6 and 7) (Figure A1).

A.3.2 Congenic meprin αKO and wild-type mice lost similar percentage of weight after DSS treatment Similar methods were used to induce colitis in congenic mice as in mixed background mice. Both meprin αKO and wild-type mice treated with DSS started to loss weight on day 4. However, there was no statistic significance between genotypes (Figure A2).

3.5% DSS H2O 5

-5 *

WT control -10 * WT DSS

aKO control -15 aKO DSS * % % change weight -20

-25 * * 1 2 3 4 5 6 7 -30 Days

Figure A1. Mixed background meprin αKO mice showed greater weight loss after DSS challenge. Body weight loss in WT and meprin αKO mice was monitored over a 7- day period. DSS (3.5%) was administered in the drinking water for four days; then replaced with water. Controls for both genotypes received water only. The meprin αKO mice treated with DSS (rainbow bar) started to loose weight on day 4. Both WT (striped bar) and meprin αKO DSS groups showed significant weight loss by day 5. The meprin αKO DSS group lost a greater percent of body weight than the WT DSS group (*, P < 0.05).

3.5% DSS H2O 5

-5 WT Control

WT DSS -10 aKO Control % change Weight % aKO DSS

-15

-20

P= 0.09

-25 1 2 3 4 5 6 7 Days

Figure A2. Congenic meprin αKO and wild-type mice showed similar percentage of weight loss after DSS challenge. Body weight loss in WT and meprin αKO mice was monitored over a 7-day period. DSS (3.5%) was administered in the drinking water for four days; then replaced with water. Controls for both genotypes received water only. Both meprin αKO mice (rainbow bar) and WT (striped bar) mice treated with DSS started to loose weight on day 4. The meprin αKO DSS group lost similar percentage of body weight than the WT DSS group.

A.3.3 Bone marrow transplantation To characterize differenct sources of meprin A involved in this sub-inflammation response, reciprocal bone marrow transplantation was performed using Meprin αKO and WT C57BL/6 x 129/Sv mixed background mice. Briefly, recipient mice were irradiated to deplete endogenous immune cells. Bone marrow were isolated from donor mice and suspended in PBS. Each recipient mouse was injected with 10X106 bone marrow cells. There are four groups of bone marrow transplanted mice generated. Meprin αKO bone marrow transplanted into meprin wild-type mice was abbreviated as αKO to WT; other three groups are WT to αKO, WT to WT and αKO to αKO (Figure A3). After transplantation, mice were then kept in isolaters on oral antibiotic for 2 weeks. Only half of the chimeras (irradiated mice) survived: 40% of WT to αKO group, 46% of the αKO to αKO group, 56% of the WT to WT group and 70% of the αKO to WT group (Table 7). The trend for higher survival in the αKO to WT chimera might reflect restoration of meprin B cells or the absence of meprin A producing cells.

A.3.4 Meprin αKO recipient mice show greater weight loss after DSS challenge The mice surviving one-marrow transplantation were used in an experimental model of inflammatory bowel diseases (ulcerative colitis). Mice were administrated with 3.5% dextran sodium sulfate (DSS) in the drinking water for 4 days, and then given water for 3 more days. Throughout the 7-day period of the study, body weight of each mouse was recorded. Weight loss, starting from day 4, was noted in all groups treated with DSS. The WT to αKO mice, by day 5 had lost around 18% of their initial body weight (20.65 g to 16.82 g). In contrast, the αKO to WT mice had lost around 10% body weight by day 5 (25.94 g to 22.9 g). The difference in weight loss between the two groups was statistically significant (*=P < 0.05). By day 7, all groups had lost about 5 g or 22% of their initial body weight, and there was no statistical significance among groups (Table 8, Figure A4). These pilot results indicated that meprin αKO recipient mice with wild type bone marrow were more susceptible to DSS challenge. The lower starting weight of the WT to αKO mice might reflect exaggerated inflammation from the transplanted meprin A producing cells.

Irradiation

αKO bone marrow

WT recipient

WT bone marrow

WT recipient

αKO bone marrow

αKO recipient

WT bone marrow

αKO recipient

Figure A3. Bone marrow transplantation. Meprin αKO and WT C57BL/6 x 129/Sv mixed background mice were used. Briefly, recipient mice were irradiated at 600rads. Bone marrow were isolated from donor mice and suspended in PBS. Each recipient mouse was injected iv with 10X106 bone marrow cells. There are four groups of bone marrow transplantation mice generated. Meprin αKO bone marrow transplantation into meprin wild-type mice was abbreviated as αKO to WT, the other three groups are WT to WT, αKO to αKO and WT to αKO.

Groups Total number Number of death Survival Rate αKO to αKO 24 13 46 WT to αKO 15 9 40 WT to WT 16 7 56 αKO to WT 27 8 70

Table 7. Survival rate of bone marrow transplanted mice. There are four groups of bone marrow transplantation mice generated. Meprin αKO bone marrow transplantation into meprin wild-type mice was abbreviated as αKO to WT, while other three groups are WT to αKO, WT to WT and αKO to αKO. After bone marrow transplantation, mice were kept in bubble on antibiotic water for 2 weeks. The survival rate of each group was recorded. The survival rates were 40% (WT to αKO), 46% (αKO to αKO), 56% (WT to WT) and 70% (αKO to WT) respectively. The results indicated that the bone marrow transplantation causes high mortality.

Average Daily Body Weight (g) Groups Day 0 Day 1 Day 2 Day 3 Day 4 Day 5 Day 6 Day 7

αKO to WT 25.94 26.15 26.15 25.75 24.71 22.90 21.25 20.42

WT to WT 24.95 25.1 25.14 24.63 23.69 21.73 20.16 19.14

αKO to αKO 23.03 22.83 22.67 22.42 21.39 19.80 19.06 18.34

WT to αKO 20.65 20.70 20.54 20.01 18.75 18.82 16.05 15.95

Table 8. Average of daily body weight of bone marrow transplanted mice treated with DSS. There were 22 mice in the group of αKO to WT, 12 mice in the group of WT to WT, 15 mice in the group of αKO to αKO and 11 mice in the group of WT to αKO. The body weight of each mouse was recorded daily, and the average daily weight of each group was calculated.

Weight Loss (Combined)

5 3.5% DSS H2O

0 1 2 3 4 5 6 7

-5

-10 aKO to WT WT to WT aKO to aKO -15 * WT to aKO

%weight change %weight -20

* -25

-30 Days

Figure A4. Meprin αKO recipient mice show greater weight loss after DSS challenge. Four groups of bone marrow transplantation mice were challenged with 3.5% dextran sodium sulfate (DSS) for 4 days, and then given water for 3 more days. Throughout the 7-day period of the study, body weight of each mouse was recorded. Weight loss, starting from day 4, was noted in all groups. The WT to αKO mice, by day 5 had lost around 18% of their initial body weight. In contrast, the αKO to WT mice had lost around 10% body weight by day 5. The difference in weight loss between the two groups was statistically significant (*,P < 0.05). By day 7, all groups had lost about 22% of their initial body weight. Meprin αKO recipient mice with wild-type bone marrow tended to be more susceptible to DSS challenge (*=P<0.05).

A.3.5 Meprin WT to αKO chimeras have higher DAI scores after DSS challenge The disease activity index (DAI), comprising of weight loss, occult blood and stool formation, is often used as a quantitative measure of the degree of injury brought about by inflammation. The fecal matter of DSS-treated and control mice was monitored for occult blood to assess rectal bleeding. The DAI values were significantly higher for the WT to αKO mice group than for αKO to WT mice group from days 3 to 5 (Figure A3). While the DAI scores for all the DSS-treated groups reached about 4 by day 7, and no statistical significance was observed among groups. These results further confirmed that meprin αKO recipient mice with wild type bone marrow were more susceptible to DSS challenge.

Disease Activity Index

4.5 3.5% DSS H2O 4 * 3.5 3 * aKO to WT 2.5 * WT to WT 2 aKO to aKO WT to aKO

1.5 scoringDAI 1 0.5 0 1 2 3 4 5 6 7 Days

Figure A5. Meprin WT to αKO chimeras have higher DAI scores after DSS challenge. The disease activity index (DAI), comprising of weight loss, occult blood and formation, is a quantitative measure of the degree of injury by inflammation. The fecal matter of DSS-treated and control mice was monitored for occult blood to assess rectal bleeding. The DAI values were significantly higher for the WT to αKO mice group than for αKO to WT mice group from days 3 to 5 ( *=P<0.05).

A.3.6 Meprin αKO recipient-mice and WT recipient-mice have comparable levels of colon inflammation To assess the tissue damage caused by DSS-induced colitis, colon lengths over weight ratio were measured in all groups at day 7 (Figure A6). Colons from all the DSS- treated groups showed prominent shortening compared to their respective control populations (P < 0.05). Nevertheless, less colon shortening was found in the αKO recipient mice with WT bone marrow than WT to WT and αKO to WT groups (*,P < 0.05) (Figure A6). In order to assess further injury in the mice, inflammation of colon tissue was evaluated by myeloperoxidase (MPO) assay. Myeloperoxidase, the most abundant protein in neutrophils, is the hallmark of early stages of an inflammation. Colons of all groups of DSS-treatment groups showed significantly higher MPO activity

compared to H2O-treatment groups. However, there was no statistic significance among groups (Figure A7).

Colon Length/AVE Weight (Combined) * 0.45 * 0.4

0.35

0.3

0.25 H2O

0.2 DSS

length/weight 0.15

0.1

0.05

0 1 2 3 4 aKO to WT WT to WT aKO to aKO WT to aKO

Figure A6. Meprin αKO recipient mice have less colon shortening after DSS challenge. Colons from all the DSS-treated groups showed prominent shortening

compared to their respective control populations (P < 0.05). Nevertheless, there were significantly less shortening in the αKO recipient mice with WT bone marrow than WT to WT and αKO to WT groups (*=P<0.05).

MPO Activity 0.5 0.45 0.4 * 0.35

0.3 * * Control(H2O) 0.25 * DSS

MPO U/ug 0.2 0.15 0.1 0.05 0 aKO-WT WT-WT aKO-aKO WT-aKO

Figure A7. Meprin αKO recipient mice and WT recipient mice have comparable levels of colon inflammation. Inflammation of colon was evaluated by myeloperoxidase (MPO) assay. Myeloperoxidase, the most abundant protein in neutrophils, is the hallmark of early stages of an inflammation. Colons of all groups of DSS-treatment groups showed

significantly higher MPO activity compared to H2O-treatment groups (*=P<0.05). However, there was no statistic significance among different transplantation groups.

In summary, the data indicated that there were moderate differences in the DSS- induced pathogenesis that WT to αKO chimeras were most volunerable to DSS induced colitis. However due to the fact that the most vulnerable group was the group with the highest mortality rate (WT bone marrow to αKO recipient), the pathogenesis differences could be a consequence of injury associated with chimera formation. More careful manipulation and more stringient sterilization condition are needed to obtain high and similar survival rates among bone-marrow chimeras before any conclusions can be drawn from these experiments.

References 1. Bond, J.S., et al., Meprin metalloprotease expression and regulation in kidney, intestine, urinary tract infections and cancer. FEBS Lett, 2005. 579(15): p. 3317- 22. 2. Kumar, J.M. and J.S. Bond, Developmental expression of meprin metalloprotease subunits in ICR and C3H/He mouse kidney and intestine in the embryo, postnatally and after weaning. Biochim Biophys Acta, 2001. 1518(1-2): p. 106-14. 3. Sun, Q., H.J. Jin, and J.S. Bond, Disruption of the meprin alpha and beta genes in mice alters homeostasis of monocytes and natural killer cells. Exp Hematol, 2009. 37(3): p. 346-56. 4. Yura, R.E., et al., Meprin A metalloproteases enhance renal damage and bladder inflammation after LPS challenge. Am J Physiol Renal Physiol, 2009. 296(1): p. F135-44. 5. Lopez-Otin, C. and J.S. Bond, Proteases: multifunctional enzymes in life and disease. J Biol Chem, 2008. 283(45): p. 30433-7. 6. Koren, E. and S. Milkovic, 'Collagenase-like peptidase in human, rat and bull spermatozoa. J Reprod Fertil, 1973. 32(3): p. 349-56. 7. Kerr, J.F., A.H. Wyllie, and A.R. Currie, Apoptosis: a basic biological phenomenon with wide-ranging implications in tissue kinetics. Br J Cancer, 1972. 26(4): p. 239-57. 8. Seemuller, E., et al., Proteasome from Thermoplasma acidophilum: a threonine protease. Science, 1995. 268(5210): p. 579-82. 9. Bedford, J.M., Mammalian fertilization misread? Sperm penetration of the eutherian zona pellucida is unlikely to be a lytic event. Biol Reprod, 1998. 59(6): p. 1275-87. 10. Chang, C. and Z. Werb, The many faces of metalloproteases: cell growth, invasion, angiogenesis and metastasis. Trends Cell Biol, 2001. 11(11): p. S37-43. 11. Hockenbery, D., Defining apoptosis. Am J Pathol, 1995. 146(1): p. 16-9. 12. Yabuki, Y., et al., Identification of a glutamine residue essential for catalytic activity of aspergilloglutamic peptidase by site-directed mutagenesis. FEBS Lett, 2004. 569(1-3): p. 161-4. 13. Sterchi, E.E., W. Stocker, and J.S. Bond, Meprins, membrane-bound and secreted astacin metalloproteinases. Mol Aspects Med, 2008. 29(5): p. 309-28. 14. Ra, H.J. and W.C. Parks, Control of matrix metalloproteinase catalytic activity. Matrix Biol, 2007. 26(8): p. 587-96. 15. Bode, W., et al., The metzincin-superfamily of zinc-peptidases. Adv Exp Med Biol, 1996. 389: p. 1-11. 16. McCawley, L.J. and L.M. Matrisian, Matrix metalloproteinases: they're not just for matrix anymore! Curr Opin Cell Biol, 2001. 13(5): p. 534-40. 17. Parks, W.C., C.L. Wilson, and Y.S. Lopez-Boado, Matrix metalloproteinases as modulators of inflammation and innate immunity. Nat Rev Immunol, 2004. 4(8): p. 617-29. 18. Renckens, R., et al., Matrix metalloproteinase-9 deficiency impairs host defense against abdominal sepsis. J Immunol, 2006. 176(6): p. 3735-41.

19. Tsakadze, N.L., et al., Tumor necrosis factor-alpha-converting enzyme (TACE/ADAM-17) mediates the ectodomain cleavage of intercellular adhesion molecule-1 (ICAM-1). J Biol Chem, 2006. 281(6): p. 3157-64. 20. Bullard, K.M., et al., Impaired wound contraction in stromelysin-1-deficient mice. Ann Surg, 1999. 230(2): p. 260-5. 21. Liu, W., et al., Normobaric hyperoxia attenuates early blood-brain barrier disruption by inhibiting MMP-9-mediated occludin degradation in focal cerebral ischemia. J Neurochem, 2009. 108(3): p. 811-20. 22. McGuire, J.K., Q. Li, and W.C. Parks, Matrilysin (matrix metalloproteinase-7) mediates E-cadherin ectodomain shedding in injured lung epithelium. Am J Pathol, 2003. 162(6): p. 1831-43. 23. Beynon, R.J., J.D. Shannon, and J.S. Bond, Purification and characterization of a metallo-endoproteinase from mouse kidney. Biochem J, 1981. 199(3): p. 591-8. 24. Kruse, M.N., et al., Human meprin alpha and beta homo-oligomers: cleavage of basement membrane proteins and sensitivity to metalloprotease inhibitors. Biochem J, 2004. 378(Pt 2): p. 383-9. 25. Bond, J.S., J.D. Shannon, and R.J. Beynon, Certain mouse strains are deficient in a kidney brush-border metallo-endopeptidase activity. Biochem J, 1983. 209(1): p. 251-5. 26. Beynon, R.J. and J.S. Bond, Deficiency of a kidney metalloproteinase activity in inbred mouse strains. Science, 1983. 219(4590): p. 1351-3. 27. Butler, P.E. and J.S. Bond, A latent proteinase in mouse kidney membranes. Characterization and relationship to meprin. J Biol Chem, 1988. 263(26): p. 13419-26. 28. Gorbea, C.M., A.V. Flannery, and J.S. Bond, Homo- and heterotetrameric forms of the membrane-bound metalloendopeptidases meprin A and B. Arch Biochem Biophys, 1991. 290(2): p. 549-53. 29. Marchand, P., J. Tang, and J.S. Bond, Membrane association and oligomeric organization of the alpha and beta subunits of mouse meprin A. J Biol Chem, 1994. 269(21): p. 15388-93. 30. Bond, J.S., et al., Mep-1 gene controlling a kidney metalloendopeptidase is linked to the major histocompatibility complex in mice. Proc Natl Acad Sci U S A, 1984. 81(17): p. 5542-5. 31. Reckelhoff, J.F., et al., Proximity of the Mep-1 gene to H-2D on chromosome 17 in mice. Immunogenetics, 1985. 22(6): p. 617-23. 32. Reckelhoff, J.F., et al., Mep-1, the gene regulating meprin activity, maps between Pgk-2 and Ce-2 on mouse chromosome 17. Immunogenetics, 1988. 27(4): p. 298- 300. 33. Bond, J.S. and R.J. Beynon, The astacin family of metalloendopeptidases. Protein Sci, 1995. 4(7): p. 1247-61. 34. Maretzky, T., et al., ADAM10 mediates E-cadherin shedding and regulates epithelial cell-cell adhesion, migration, and beta-catenin translocation. Proc Natl Acad Sci U S A, 2005. 102(26): p. 9182-7. 35. Villa, J.P., et al., Meprin proteolytic complexes at the cell surface and in extracellular spaces. Biochem Soc Symp, 2003(70): p. 53-63.

100

36. Stocker, W., et al., Implications of the three-dimensional structure of astacin for the structure and function of the astacin family of zinc-endopeptidases. Eur J Biochem, 1993. 214(1): p. 215-31. 37. Beckmann, G. and P. Bork, An adhesive domain detected in functionally diverse receptors. Trends Biochem Sci, 1993. 18(2): p. 40-1. 38. Gebbink, M.F., et al., Cell surface expression of receptor protein tyrosine phosphatase RPTP mu is regulated by cell-cell contact. J Cell Biol, 1995. 131(1): p. 251-60. 39. Zapata, J.M., et al., A diverse family of proteins containing tumor necrosis factor receptor-associated factor domains. J Biol Chem, 2001. 276(26): p. 24242-52. 40. Cheng, G., et al., Involvement of CRAF1, a relative of TRAF, in CD40 signaling. Science, 1995. 267(5203): p. 1494-8. 41. Zapata, J.M., V. Martinez-Garcia, and S. Lefebvre, Phylogeny of the TRAF/MATH domain. Adv Exp Med Biol, 2007. 597: p. 1-24. 42. Ishmael, F.T., et al., Intersubunit and domain interactions of the meprin B metalloproteinase. Disulfide bonds and protein-protein interactions in the MAM and TRAF domains. J Biol Chem, 2005. 280(14): p. 13895-901. 43. Hintze, V., et al., The interaction of recombinant subdomains of the procollagen C-proteinase with procollagen I provides a quantitative explanation for functional differences between the two splice variants, mammalian tolloid and bone morphogenetic protein 1. Biochemistry, 2006. 45(21): p. 6741-8. 44. Sieron, A.L., et al., Structure and function of procollagen C-proteinase (mTolloid) domains determined by protease digestion, circular dichroism, binding to procollagen type I, and computer modeling. Biochemistry, 2000. 39(12): p. 3231- 9. 45. Hahn, D., et al., Phorbol 12-myristate 13-acetate-induced ectodomain shedding and phosphorylation of the human meprinbeta metalloprotease. J Biol Chem, 2003. 278(44): p. 42829-39. 46. Chevallier, S., et al., Identification of the cysteine residues implicated in the formation of alpha 2 and alpha/beta dimers of rat meprin. Biochem J, 1996. 317 ( Pt 3): p. 731-8. 47. Ishmael, F.T., et al., Multimeric structure of the secreted meprin A metalloproteinase and characterization of the functional protomer. J Biol Chem, 2001. 276(25): p. 23207-11. 48. Bertenshaw, G.P., M.T. Norcum, and J.S. Bond, Structure of homo- and hetero- oligomeric meprin metalloproteases. Dimers, tetramers, and high molecular mass multimers. J Biol Chem, 2003. 278(4): p. 2522-32. 49. Sterchi, E.E., J.R. Green, and M.J. Lentze, Non-pancreatic hydrolysis of N- benzoyl-l-tyrosyl-p-aminobenzoic acid (PABA-peptide) in the human small intestine. Clin Sci (Lond), 1982. 62(5): p. 557-60. 50. Craig, S.S., C. Mader, and J.S. Bond, Immunohistochemical localization of the metalloproteinase meprin in salivary glands of male and female mice. J Histochem Cytochem, 1991. 39(1): p. 123-9. 51. Becker-Pauly, C., et al., The alpha and beta subunits of the metalloprotease meprin are expressed in separate layers of human epidermis, revealing different

101

functions in keratinocyte proliferation and differentiation. J Invest Dermatol, 2007. 127(5): p. 1115-25. 52. Jefferson, T., et al., Metalloprotease Meprin {beta} Generates Nontoxic N- terminal Amyloid Precursor Protein Fragments in Vivo. J Biol Chem. 286(31): p. 27741-50. 53. Yamaguchi, T., et al., Purification of meprin from human kidney and its role in parathyroid hormone degradation. Biol Chem Hoppe Seyler, 1994. 375(12): p. 821-4. 54. Grunberg, J., et al., Expression of the alpha subunit of PABA peptide hydrolase (EC 3.4.24.18) in MDCK cells. Synthesis and secretion of an enzymatically inactive homodimer. FEBS Lett, 1993. 335(3): p. 376-9. 55. Rosmann, S., et al., Activation of human meprin-alpha in a cell culture model of colorectal cancer is triggered by the plasminogen-activating system. J Biol Chem, 2002. 277(43): p. 40650-8. 56. Bertenshaw, G.P., et al., Probing the active sites and mechanisms of rat metalloproteases meprin A and B. Biol Chem, 2002. 383(7-8): p. 1175-83. 57. Hirano, M., et al., Mannan-binding protein blocks the activation of metalloproteases meprin alpha and beta. J Immunol, 2005. 175(5): p. 3177-85. 58. Kenny, A.J. and J. Ingram, Proteins of the kidney microvillar membrane. Purification and properties of the phosphoramidon-insensitive endopeptidase ('endopeptidase-2') from rat kidney. Biochem J, 1987. 245(2): p. 515-24. 59. Bertenshaw, G.P., et al., Marked differences between metalloproteases meprin A and B in substrate and peptide bond specificity. J Biol Chem, 2001. 276(16): p. 13248-55. 60. Stocker, W., M. Ng, and D.S. Auld, Fluorescent oligopeptide substrates for kinetic characterization of the specificity of Astacus protease. Biochemistry, 1990. 29(45): p. 10418-25. 61. Villa, J.P., G.P. Bertenshaw, and J.S. Bond, Critical amino acids in the active site of meprin metalloproteinases for substrate and peptide bond specificity. J Biol Chem, 2003. 278(43): p. 42545-50. 62. Norman, L.P., et al., Expression of meprins in health and disease. Curr Top Dev Biol, 2003. 54: p. 145-66. 63. Banerjee, S. and J.S. Bond, Prointerleukin-18 is activated by meprin beta in vitro and in vivo in intestinal inflammation. J Biol Chem, 2008. 283(46): p. 31371-7. 64. Huguenin, M., et al., The metalloprotease meprinbeta processes E-cadherin and weakens intercellular adhesion. PLoS ONE, 2008. 3(5): p. e2153. 65. Ambort, D., et al., A novel 2D-based approach to the discovery of candidate substrates for the metalloendopeptidase meprin. Febs J, 2008. 275(18): p. 4490- 509. 66. Red Eagle, A.R., et al., Meprin beta metalloprotease gene polymorphisms associated with diabetic nephropathy in the Pima Indians. Hum Genet, 2005. 118(1): p. 12-22. 67. Kieran, N.E., et al., Modification of the transcriptomic response to renal ischemia/reperfusion injury by lipoxin analog. Kidney Int, 2003. 64(2): p. 480-92.

102

68. Carmago, S., S.V. Shah, and P.D. Walker, Meprin, a brush-border enzyme, plays an important role in hypoxic/ischemic acute renal tubular injury in rats. Kidney Int, 2002. 61(3): p. 959-66. 69. Bylander, J., et al., Targeted disruption of the meprin metalloproteinase beta gene protects against renal ischemia-reperfusion injury in mice. Am J Physiol Renal Physiol, 2008. 294(3): p. F480-90. 70. Hampe, J., et al., Linkage of inflammatory bowel disease to human chromosome 6p. Am J Hum Genet, 1999. 65(6): p. 1647-55. 71. Jiang, W., et al., Fine mapping of MEP1A, the gene encoding the alpha subunit of the metalloendopeptidase meprin, to human chromosome 6P21. Biochem Biophys Res Commun, 1995. 216(2): p. 630-5. 72. Lottaz, D., et al., Compartmentalised expression of meprin in small intestinal mucosa: enhanced expression in lamina propria in coeliac disease. Biol Chem, 2007. 388(3): p. 337-41. 73. Crisman, J.M., et al., Deletion of the mouse meprin beta metalloprotease gene diminishes the ability of leukocytes to disseminate through extracellular matrix. J Immunol, 2004. 172(7): p. 4510-9. 74. Lottaz, D., et al., Nonpolarized secretion of human meprin alpha in colorectal cancer generates an increased proteolytic potential in the stroma. Cancer Res, 1999. 59(5): p. 1127-33. 75. Matters, G.L., A. Manni, and J.S. Bond, Inhibitors of polyamine biosynthesis decrease the expression of the metalloproteases meprin alpha and MMP-7 in hormone-independent human breast cancer cells. Clin Exp Metastasis, 2005. 22(4): p. 331-9. 76. Matters, G.L. and J.S. Bond, Expression and regulation of the meprin beta gene in human cancer cells. Mol Carcinog, 1999. 25(3): p. 169-78. 77. Bergelson, J.M., Virus interactions with mucosal surfaces: alternative receptors, alternative pathways. Curr Opin Microbiol, 2003. 6(4): p. 386-91. 78. Shimono, M., et al., Biological characteristics of the junctional epithelium. J Electron Microsc (Tokyo), 2003. 52(6): p. 627-39. 79. Roche, W.R., et al., Cell adhesion molecules and the bronchial epithelium. Am Rev Respir Dis, 1993. 148(6 Pt 2): p. S79-82. 80. Vareille, M., et al., The airway epithelium: soldier in the fight against respiratory viruses. Clin Microbiol Rev. 24(1): p. 210-29. 81. Reibman, J., et al., Airway epithelial cells release MIP-3alpha/CCL20 in response to cytokines and ambient particulate matter. Am J Respir Cell Mol Biol, 2003. 28(6): p. 648-54. 82. Edens, H.A. and C.A. Parkos, Modulation of epithelial and endothelial paracellular permeability by leukocytes. Adv Drug Deliv Rev, 2000. 41(3): p. 315-28. 83. Baum, B. and M. Georgiou, Dynamics of adherens junctions in epithelial establishment, maintenance, and remodeling. J Cell Biol. 192(6): p. 907-17. 84. Furuse, M., et al., Occludin: a novel integral membrane protein localizing at tight junctions. J Cell Biol, 1993. 123(6 Pt 2): p. 1777-88.

103

85. Ando-Akatsuka, Y., et al., Interspecies diversity of the occludin sequence: cDNA cloning of human, mouse, dog, and rat-kangaroo homologues. J Cell Biol, 1996. 133(1): p. 43-7. 86. Phillips, B.E., et al., Occludin independently regulates permeability under hydrostatic pressure and cell division in retinal pigment epithelial cells. Invest Ophthalmol Vis Sci, 2008. 49(6): p. 2568-76. 87. Murakami, T., E.A. Felinski, and D.A. Antonetti, Occludin phosphorylation and ubiquitination regulate tight junction trafficking and vascular endothelial growth factor-induced permeability. J Biol Chem, 2009. 284(31): p. 21036-46. 88. Huber, D., M.S. Balda, and K. Matter, Occludin modulates transepithelial migration of neutrophils. J Biol Chem, 2000. 275(8): p. 5773-8. 89. Yoshida, Y., Y. Ban, and S. Kinoshita, Tight junction transmembrane protein claudin subtype expression and distribution in human corneal and conjunctival epithelium. Invest Ophthalmol Vis Sci, 2009. 50(5): p. 2103-8. 90. Morita, K., et al., Endothelial claudin: claudin-5/TMVCF constitutes tight junction strands in endothelial cells. J Cell Biol, 1999. 147(1): p. 185-94. 91. Prasad, S., et al., Inflammatory processes have differential effects on claudins 2, 3 and 4 in colonic epithelial cells. Lab Invest, 2005. 85(9): p. 1139-62. 92. Kiuchi-Saishin, Y., et al., Differential expression patterns of claudins, tight junction membrane proteins, in mouse nephron segments. J Am Soc Nephrol, 2002. 13(4): p. 875-86. 93. Claude, P., Morphological factors influencing transepithelial permeability: a model for the resistance of the zonula occludens. J Membr Biol, 1978. 39(2-3): p. 219-32. 94. Angelow, S., R. Ahlstrom, and A.S. Yu, Biology of claudins. Am J Physiol Renal Physiol, 2008. 295(4): p. F867-76. 95. Itoh, M., et al., Direct binding of three tight junction-associated MAGUKs, ZO-1, ZO-2, and ZO-3, with the COOH termini of claudins. J Cell Biol, 1999. 147(6): p. 1351-63. 96. Laukoetter, M.G., et al., JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med, 2007. 204(13): p. 3067-76. 97. Ebnet, K., et al., The cell polarity protein ASIP/PAR-3 directly associates with junctional adhesion molecule (JAM). Embo J, 2001. 20(14): p. 3738-48. 98. Martin-Padura, I., et al., Junctional adhesion molecule, a novel member of the immunoglobulin superfamily that distributes at intercellular junctions and modulates monocyte transmigration. J Cell Biol, 1998. 142(1): p. 117-27. 99. Liu, Y., et al., Human junction adhesion molecule regulates tight junction resealing in epithelia. J Cell Sci, 2000. 113 ( Pt 13): p. 2363-74. 100. Herold, S., et al., Alveolar epithelial cells direct monocyte transepithelial migration upon influenza virus infection: impact of chemokines and adhesion molecules. J Immunol, 2006. 177(3): p. 1817-24. 101. Chiba, H., et al., Transmembrane proteins of tight junctions. Biochim Biophys Acta, 2008. 1778(3): p. 588-600. 102. Anderson, J.M., et al., Zonula occludens (ZO)-1 and ZO-2: membrane-associated guanylate kinase homologues (MAGuKs) of the tight junction. Biochem Soc Trans, 1995. 23(3): p. 470-5.

104

103. Bauer, H., et al., The dual role of zonula occludens (ZO) proteins. J Biomed Biotechnol. 2010: p. 402593. 104. Shin, K., V.C. Fogg, and B. Margolis, Tight junctions and cell polarity. Annu Rev Cell Dev Biol, 2006. 22: p. 207-35. 105. Kim, J.Y., et al., Disruption of tight junctions during traversal of the respiratory epithelium by Burkholderia cenocepacia. Infect Immun, 2005. 73(11): p. 7107-12. 106. Ichiyasu, H., et al., Matrix metalloproteinase-9-deficient dendritic cells have impaired migration through tracheal epithelial tight junctions. Am J Respir Cell Mol Biol, 2004. 30(6): p. 761-70. 107. Bylander, J.E., et al., Human and mouse homo-oligomeric meprin A metalloendopeptidase: substrate and inhibitor specificities. Biol Chem, 2007. 388(11): p. 1163-72. 108. Wolz, R.L. and J.S. Bond, Meprins A and B. Methods Enzymol, 1995. 248: p. 325-45. 109. Banerjee, S., et al., MEP1A allele for meprin A metalloprotease is a susceptibility gene for inflammatory bowel disease. Mucosal Immunol, 2009. 2(3): p. 220-31. 110. Eichel, L., et al., Assessment of murine bladder permeability with fluorescein: validation with cyclophosphamide and protamine. Urology, 2001. 58(1): p. 113-8. 111. Wang, X., et al., Bacterial expression, purification, and model membrane reconstitution of the transmembrane and cytoplasmic domains of the human APP binding protein LR11/SorLA for NMR studies. Protein Expr Purif. 77(2): p. 224- 30. 112. Sonoda, N., et al., Clostridium perfringens enterotoxin fragment removes specific claudins from tight junction strands: Evidence for direct involvement of claudins in tight junction barrier. J Cell Biol, 1999. 147(1): p. 195-204. 113. Grant-Tschudy, K.S. and C.R. Wira, Hepatocyte growth factor regulation of uterine epithelial cell transepithelial resistance and tumor necrosis factor alpha release in culture. Biol Reprod, 2005. 72(4): p. 814-21. 114. Harhaj, N.S., et al., VEGF activation of protein kinase C stimulates occludin phosphorylation and contributes to endothelial permeability. Invest Ophthalmol Vis Sci, 2006. 47(11): p. 5106-15. 115. Lavelle, J., et al., Bladder permeability barrier: recovery from selective injury of surface epithelial cells. Am J Physiol Renal Physiol, 2002. 283(2): p. F242-53. 116. Stamatos, N.M., et al., LPS-induced cytokine production in human dendritic cells is regulated by sialidase activity. J Leukoc Biol. 88(6): p. 1227-39. 117. Wilcox, R.A., et al., Monocytes promote tumor cell survival in T-cell lymphoproliferative disorders and are impaired in their ability to differentiate into mature dendritic cells. Blood, 2009. 114(14): p. 2936-44. 118. Dunay, I.R., et al., Gr1(+) inflammatory monocytes are required for mucosal resistance to the pathogen Toxoplasma gondii. Immunity, 2008. 29(2): p. 306-17. 119. Lischper, M., et al., Metalloproteinase mediated occludin cleavage in the cerebral microcapillary endothelium under pathological conditions. Brain Res. 1326: p. 114-27. 120. Bojarski, C., et al., The specific fates of tight junction proteins in apoptotic epithelial cells. J Cell Sci, 2004. 117(Pt 10): p. 2097-107.

105

121. Van Itallie, C., C. Rahner, and J.M. Anderson, Regulated expression of claudin-4 decreases paracellular conductance through a selective decrease in sodium permeability. J Clin Invest, 2001. 107(10): p. 1319-27. 122. Acharya, P., et al., Distribution of the tight junction proteins ZO-1, occludin, and claudin-4, -8, and -12 in bladder epithelium. Am J Physiol Renal Physiol, 2004. 287(2): p. F305-18. 123. Thiemann, S. and L.G. Baum, The road less traveled: regulation of leukocyte migration across vascular and lymphatic endothelium by galectins. J Clin Immunol. 31(1): p. 2-9. 124. Nathan, C., Points of control in inflammation. Nature, 2002. 420(6917): p. 846-52. 125. Silver, K., et al., Non-steroidal anti-inflammatory drugs inhibit calpain activity and membrane localization of calpain 2 protease. Int J Biochem Cell Biol. 42(12): p. 2030-6. 126. Elkington, P.T., C.M. O'Kane, and J.S. Friedland, The paradox of matrix metalloproteinases in infectious disease. Clin Exp Immunol, 2005. 142(1): p. 12- 20. 127. Armaka, M., et al., Mesenchymal cell targeting by TNF as a common pathogenic principle in chronic inflammatory joint and intestinal diseases. J Exp Med, 2008. 205(2): p. 331-7. 128. Gribar, S.C., et al., No longer an innocent bystander: epithelial toll-like receptor signaling in the development of mucosal inflammation. Mol Med, 2008. 14(9-10): p. 645-59. 129. Danese, S. and A. Gasbarrini, Chemokines in inflammatory bowel disease. J Clin Pathol, 2005. 58(10): p. 1025-7. 130. Elias, B.C., et al., Phosphorylation of Tyr-398 and Tyr-402 in occludin prevents its interaction with ZO-1 and destabilizes its assembly at the tight junctions. J Biol Chem, 2009. 284(3): p. 1559-69. 131. Chun, J. and A. Prince, TLR2-induced calpain cleavage of epithelial junctional proteins facilitates leukocyte transmigration. Cell Host Microbe, 2009. 5(1): p. 47-58. 132. Bamforth, S.D., et al., A dominant mutant of occludin disrupts tight junction structure and function. J Cell Sci, 1999. 112 ( Pt 12): p. 1879-88. 133. Noe, V., et al., Release of an invasion promoter E-cadherin fragment by matrilysin and stromelysin-1. J Cell Sci, 2001. 114(Pt 1): p. 111-118. 134. Davies, G., W.G. Jiang, and M.D. Mason, Matrilysin mediates extracellular cleavage of E-cadherin from prostate cancer cells: a key mechanism in hepatocyte growth factor/scatter factor-induced cell-cell dissociation and in vitro invasion. Clin Cancer Res, 2001. 7(10): p. 3289-97. 135. Lacaz-Vieira, F., et al., Small synthetic peptides homologous to segments of the first external loop of occludin impair tight junction resealing. J Membr Biol, 1999. 168(3): p. 289-97. 136. Medina, R., et al., Occludin localization at the tight junction requires the second extracellular loop. J Membr Biol, 2000. 178(3): p. 235-47. 137. Wang, Z., et al., The second loop of occludin is required for suppression of Raf1- induced tumor growth. Oncogene, 2005. 24(27): p. 4412-20.

106

138. Chung, N.P., et al., A 22-amino acid synthetic peptide corresponding to the second extracellular loop of rat occludin perturbs the blood-testis barrier and disrupts spermatogenesis reversibly in vivo. Biol Reprod, 2001. 65(5): p. 1340-51. 139. Flannery, A.V., G.N. Dalzell, and R.J. Beynon, Proteolytic activity in mouse urine: relationship to the kidney metallo-endopeptidase, meprin. Biochim Biophys Acta, 1990. 1041(1): p. 64-70. 140. Beynon, R.J., S. Oliver, and D.H. Robertson, Characterization of the soluble, secreted form of urinary meprin. Biochem J, 1996. 315 ( Pt 2): p. 461-5. 141. Bergin, D.A., et al., Activation of the epidermal growth factor receptor (EGFR) by a novel metalloprotease pathway. J Biol Chem, 2008. 283(46): p. 31736-44. 142. Van Itallie, C.M., A.S. Fanning, and J.M. Anderson, Reversal of charge selectivity in cation or anion-selective epithelial lines by expression of different claudins. Am J Physiol Renal Physiol, 2003. 285(6): p. F1078-84. 143. Reyes, J.L., et al., The renal segmental distribution of claudins changes with development. Kidney Int, 2002. 62(2): p. 476-87. 144. Hirase, T., et al., Occludin as a possible determinant of tight junction permeability in endothelial cells. J Cell Sci, 1997. 110 ( Pt 14): p. 1603-13. 145. Golebiewski, L., et al., The avian influenza virus NS1 ESEV PDZ binding motif associates with Dlg1 and Scribble to disrupt cellular tight junctions. J Virol. 85(20): p. 10639-48. 146. Muller, S.L., et al., The tight junction protein occludin and the adherens junction protein alpha-catenin share a common interaction mechanism with ZO-1. J Biol Chem, 2005. 280(5): p. 3747-56. 147. Ongeri, E.M., et al., Villin and actin in the mouse kidney brush border membrane bind to and are degraded by meprins: This interaction contributes to injury in ischemia reperfusion. Am J Physiol Renal Physiol. 148. Ostermann, G., et al., JAM-1 is a ligand of the beta(2) integrin LFA-1 involved in transendothelial migration of leukocytes. Nat Immunol, 2002. 3(2): p. 151-8. 149. Huppert, J., et al., Cellular mechanisms of IL-17-induced blood-brain barrier disruption. Faseb J. 24(4): p. 1023-34. 150. Saitou, M., et al., Complex phenotype of mice lacking occludin, a component of tight junction strands. Mol Biol Cell, 2000. 11(12): p. 4131-42. 151. Reijerkerk, A., et al., Diapedesis of monocytes is associated with MMP-mediated occludin disappearance in brain endothelial cells. Faseb J, 2006. 20(14): p. 2550- 2. 152. Steinhusen, U., et al., Cleavage and shedding of E-cadherin after induction of apoptosis. J Biol Chem, 2001. 276(7): p. 4972-80. 153. Liu, Y.J., IPC: professional type 1 interferon-producing cells and plasmacytoid dendritic cell precursors. Annu Rev Immunol, 2005. 23: p. 275-306. 154. Kishimoto, T., et al., Interleukin-6 family of cytokines and gp130. Blood, 1995. 86(4): p. 1243-54. 155. Blanque, R., et al., Hypothermia as an indicator of the acute effects of lipopolysaccharides: comparison with serum levels of IL1 beta, IL6 and TNF alpha. Gen Pharmacol, 1996. 27(6): p. 973-7.

107

156. von Lampe, B., et al., Differential expression of matrix metalloproteinases and their tissue inhibitors in colon mucosa of patients with inflammatory bowel disease. Gut, 2000. 47(1): p. 63-73. 157. Pilcher, B.K., et al., The activity of collagenase-1 is required for keratinocyte migration on a type I collagen matrix. J Cell Biol, 1997. 137(6): p. 1445-57. 158. Podolsky, D.K., Healing the epithelium: solving the problem from two sides. J Gastroenterol, 1997. 32(1): p. 122-6. 159. Cooper, H.S., et al., Clinicopathologic study of dextran sulfate sodium experimental murine colitis. Lab Invest, 1993. 69(2): p. 238-49. 160. Bradley, P.P., et al., Measurement of cutaneous inflammation: estimation of neutrophil content with an enzyme marker. J Invest Dermatol, 1982. 78(3): p. 206-9. 161. Krawisz, J.E., P. Sharon, and W.F. Stenson, Quantitative assay for acute intestinal inflammation based on myeloperoxidase activity. Assessment of inflammation in rat and hamster models. Gastroenterology, 1984. 87(6): p. 1344- 50.

108

JIALING BAO Vitae Education 1999-2003 B.S. in Biotechnology, SICHUANG UNIVERSITY, Chengdu, China 2003-2006 M.S. in Microbiology FUDAN UNIVERSITY, Shanghai, China 2006-2012 Ph.D. candidate in Biochemistry and Molecular Biology PENNSYLVANIA STATE UNIVERSITY, COLLEGE OF MEDICINE, HERSHEY, PA, USA

Honors and Awards ASBMB Graduate students and postdocs Travel Award, 2010. Pennsylvania State University, Dean’s Travel Award, 2011. International Proteolysis Society Meeting, Travel Award, 2011

Publications • Jialing Bao, Gail Matters, S.Gaylen Bradley, Judith S.Bond. Meprin A weakens epithelial barrier function and facilitates monocyte migration (Manuscripts in Preparation). • BAO Jialing, LE Jun, TIAN Yeping, YANG Yanping, WANG Honghai. Protein Profiling of human Dendritic Cells Infected with Mycobacterium tuberculosis. 2005, ACTA MICROBIOLOGICA SINICA. • BAO Jialing, YANG Yanping, XIE Jianpin, WANG Honghai. Functions of Dendritic Cells during Mycobacterium tuberculosis Infecion. 2005, Science and Technology Review. • Yang Y, Zhang M, Zhang H, Lei J, Jin R, Xu S, Bao J, Zhang L, Wang H. Purification and characterization of mycobacterium tuberculosis indole-3-glycerol phosphate synthase. 2005, Biochemistry (Moscow). • Yang Y, Xu S, Zhang M, Jin R, Zhang L, Bao J, Wang H. Purification and characterization of a functionally active Mycobacterium tuberculosis pyrroline-5- carboxylate reductase. 2006, Protein Expr Purif.