Impacts of Climate Change and Population on Tropical Aquatic Resources 03 - 06 February 2011 Haramaya University

The Ethiopian Fisheries and Aquatic Sciences Association (EFASA)

Proceedings of the 3 rd Annual Conference on

Impacts of climate change and population on tropical aquatic resources 03 - 06 February 2011 Haramaya University

Editors: Brook Lemma and Abebe Getahun

Ministry of Science and Technology

~ i ~

Publisher’s page

Third international conference on: Impacts of climate change and population on tropical aquatic resources held at Haramaya University from 03 - 06 February 2011

Conference organized and the proceedings published by the Ethiopian Fisheries and Aquatic Sciences Association , EFASA , a legally accredited professional association, Addis Ababa in 2011

Website : www.ss.aau.edu.et/index.php/ efasa -home Email : [email protected]

Publisher’s note : Opinions in each paper or article included in these proceedings are opinions of the authors or speakers, and not of the publisher or EFASA.

ISBN :

Refer to articles in these proceedings as follows :

Zenebe Tadesse (2011): Diel feeding rhythm, ingestion rate and diet composition of Oreochromis niloticus L. in Lake Tana, Ethiopia. In: Impacts of climate change and population on tropical aquatic resources , proceedings of the Third International Conference of the Ethiopian Fisheries and Aquatic Sciences Association (EFASA), editors: Brook Lemma and Abebe Getahun. AAU Printing Press, Addis Ababa. pp. 59 – 66.

~ ii ~

Table of contents

Welcoming and introductory speech by Dr. Seyoum Mengistu, Vice President of EFASA 1

Opening Speech by Professor Belay Kassa, President of Haramaya University 6

The impact of climate change and population increase on Lakes Haramaya and Hora-Kilole, Ethiopia (1986 – 2006): Brook Lemma 9

Climate change challenges on fisheries and aquaculture: Dereje Tewabe 33

Climate change and wetland resources vulnerability: Impacts on livelihoods and opportunities for enhancing in Ethiopia: Lemma Abera Hirpo 50

Diel feeding rhythm, ingestion rate and diet composition of Oreochromis niloticus L. in Lake Tana, Ethiopia: Zenebe Tadesse 59

Development of small scale fish farming: for livelihood diversification in North Showa zone, Amhara Regional

~ iii ~

State: Yared Tigabu, Fasil Degefu, Aschalew Lakew and Gashaw Tesfaye 67

On station evaluation of fish offal fertilizer on Tomato and Onion: Alemu Lema and Abera Degebassa 84

Ecological assessment of Lake Hora, Ethiopia, using benthic and weed-bed fauna: Habiba Gashaw 99

Integrated fish-horticulture farm at Taltale in Debrelibanos, North Shoa Zone, Oromia, Ethiopia: Daba Tugie and Tokuma Nagisho 126

Fresh Water Fishes of Amhara Region: Belay Abdissa and Alayu Yalew 136

Fish species composition, abundance and production potential of Tendaho Reservoir in Afar Regional State, Ethiopia: Gashaw Tesfaye, Abebe Cheffo and Hussien Abegaz 164

Integration of fish culture with water harvesting ponds in Amhara Region: a means to supplement family food: Alayu Yalew 191

Technology Development and Dissemination Where There is No Cultural Practice: Lessons from On Farm Aquaculture Research in Amhara Region, North West

~ iv ~

Ethiopia: Berihun T. Adugna and Goraw Goshu 200

Atelomixis as a driving force of phytoplankton assemblages in an African-highland Lake Hayq, Ethiopia: Tadesse Fetahi, Michael Schagerl and Seyoum Mengistou 221

Preliminary survey of Kurit-Bahir Wetland, (management focus), Amhara Region, West Gojjam, Mecha Woreda, Ethiopia: Miheret Endalew Tegegnie 256

Detection of toxigenic cyanobacteria in Bahir Dar Gulf of Lake Tana–pilot study: Ilona Gagala, Goraw Goshu, Tomasz Jurczak, Yohannes Zerihun, Joanna Mankiewicz-Boczek and Maciej Zalewski 271

Lake Tana’s (Ethiopia ) endemic Labeobarbus spp. Flock: An uncertain future threatened by exploitation, land use and water resources developments: Brehan Mohammed, Martin de Graaf, Leo Nagelkerke, Wassie Anteneh, and Minwyelet Mingist 285

ANNEX : Program of the 3 rd Annual Conference of the Ethiopian Fisheries and Aquatic Sciences Association (EFASA) 298

~ v ~

Acknowledgements

The Ethiopian Fisheries and Aquatic Sciences would like to extend its gratitude to the sponsoring institutes, namely, Food and Agricultural Organization Sub-Regional Office for East Africa , Haramaya University , Ministry of Science and technology , Horn of Africa Regional Environment Center and Network and Addis Ababa University . These sponsoring institutes have enabled professionals in the field to meet and exchange current knowledge developed in the country and elsewhere; and created the platform where regional administrators (from Oromia and Harari), research officers, local fishermen, and school children selected from three high schools had the opportunity to listen and discuss on the interface of contemporary scenarios regarding the water, climate and population issues. The publication of these proceedings will also spread out the knowledge to those found all over Ethiopia and the global community that have stakes in the sustainable use of water. The day-to-day activities of organizing of the workshop was humbly undertaken by Eshete Dejen , Seyoum Mengistou , Abebe Getahun , Tesfaye Wudneh , Mesikir Tessema , Tadesse Fetahi , Zenebe Tadesse , Aschalew Lakew , Yared Tigabu , Gashaw Tesfaye , Akewak Geremew , Ashagrie Gibtan , Mengistu WoldeHana , Sintayehu Workineh , Tsehaynesh Lemma , Neway Andargie and Brook Lemma .

The editors Brook Lemma and Abebe Getahun

~ vi ~

P a g e | 1

Welcoming and introductory speech by Dr. Seyoum Mengistu Vice President of EFASA

I ask all of you to stand up for a minutes of silence in remembrance of our colleague and dedicated EFASA member, Ato Abera Degabussa, who passes away after a short illness on 22 Miazia 2001 E.C. Abera received his BSc from Ambo College and his MSc from, the former Soviet Union and was an ardent and dedicated researcher, with tangible contribution to the development of the Lake Langano and east Showa fisheries. The Zwai Fish Resource Research Center, of which he was a member, and EFASA miss him a lot and we extend our deepest condolences to his family and friends.

A minute of silence

Good morning everyone and welcome to the THIRD EFASSA annual conference which is being held in Haromaya University and in place which I also happen to know and cherish in childhood. I am extremely elated and sentimental about this occasion – coming home to roost after nearly half a century of absence, like the proverbial lost son. I started school in Harar Bethlehem School, not more than 20 kms from here, and I remember that we used to visit this university once in while back then. As a child I used to be fascinated by college education and the fantastic facilities that students used to enjoy then, Alemaya University was then funded by Oklahoma State University (USA). They use to dispense hot milk from taps, and although this is not possible now, I am still impressed by the visible strides that Haromaya University has achieved through improved campus infrastructure and the education environment. First and foremost, I would like to thank on behalf EFASA, the University for hosting us, and in particular, the President, Prof. Belay Kassa for his generous and gracious patronage and facilitating the realization of this conference here at HU. Dr. Brook Lemma, through his long association with HU (Being the acting executive at some time) also deserves special mention for making our conference here a resounding reality, at such short notice after EFASA decided to change its annual venue to Haromaya instead of Ambo University. We all realize how difficult it is to coordinate national meetings, and the close camaraderie between Dr. Brook and HU officials has been an uncommon blessing and a rare opportunity. Let me also take this opportunity to thank other HU officials who were crucial to make our venue here a reality, including, the 4 vice presidents (Dr. Tena Alamerew, Academic Vice President, Dr. Belayneh Legesse, Vice President for Business and Administration, and Dr. Kebede Wolde

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 2

Tsadik, the Vice President for Development and Community Engagement and Dr. Negussie Dechasa, Vice President for Research).

The local organizing committee at HU chaired by Ato Mengistu Woldehanna, Ato Shimellis and Ato Abiy deserve our special thanks for organizing everything so smoothly and efficiently in such a short time. It makes me feel that the efficiency I used to see at HU half a century ago is still here (even if the Americans I alluded to earlier had long left). HU is truly emerging as one of the most efficient and steadfast universities in our country, added to its status as one of the oldest college institutions also.

Let me briefly say a few thing about EFASA even though most of us know these issues quite well. Like any society/association, EFASA was borne out of the initiative of a few vanguard members about 4 years ago in2007, to be exact 12 founding members who were mainly professional in the Limnology, Fisheries Biology and Aquatic Ecology disciplines. In the past three yeas EFASA has managed to conduct one launching workshop and two national conferences at Zwai and Bahir Dar.

It also goes to the credit of EFASA that it was able to host the Pan-African Fish and Fisheries (PAFA) Conference at the ECA Conference Hall. This is one of the prominent professional associations on African fishes and fisheries that holds its conference once in five years. EFASA had the pleasure of hosting international scientists numbering over 250 coming from all continents of the world.

EFASA has published all its proceedings so that its main objective of disseminating knowledge is realased.

EFASA has got its financial accounts audited and is proud of the positive gains it made in terms of the balance it has in its bank accounts.

The membership of EFASA has increased to around 135 and enjoys the presence of more than half of these members at the conferences it organizes.

Very positive and active relations have been established with a good number of institutions that helped EFASA out while it organzed its conferences. The continued

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 3 contributions these institutions namely Food and Agriculture Regional Office for Eastern Africa at Addis Ababa, Haramaya University, BahirDar Capacity Building Project, Zwai Fisheries and Aquatic Sciences Research Center, Sebeta Fisheries and Aquatic Sciences Research Center, Ambo University, Addis Ababa Unversity, Horn of Africa Regional Environmental Centre and Network at AAU , and a few others.

Despite all the efforts EFASA has not yet secured an office on the campus of the College of Natural Sciences (CNS), AAU. The absence of this office has added a lot of burden on the regular work of EFASA office bearers. It is also difficult for EFASA to conduct its responsibilities in a more effective and efficient way. The word processing facilities it purchased are still occupying space in the office of Dr. Seyoum Mengistou, Vice President of EFASA.

This year’ conference has been possible thought the generous financial and technical support of the following sponsors, for which EFASA extends its heartfelt thanks and gratitude.

Haramaya University has provided EFASA bus that transported all its members from and back to Addis Ababa, accommodations, the conference hall, hospitality, and collegiality through its executive officials.

FAO Regional Office for Eastern Africa , and especially our EFASA EC member Dr. Eshete Dejen for the financial support which has enabled us to sponsor attendance of about 70 members of EFASA, The Ministry of Science and Technology , through continuous and sustained financial and moral support, Addis Ababa University through the good office of EFASA’s President for the financial and academic support to EFASA for all three years in running, Horn of Africa Regional Environmental Centre and Network has also generously financially supported EFASA in organizing its conferences.

This year’s them of our conference is “ Impacts of climate change and population on tropical aquatic resources ”. As you all know,climate changeis real and here to stay. Skepticism and denial will not allay our fears; instead the way to go forward is to devise strategies and actions to minimizeclimate changeimpacts on agriculture, forestry, water

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 4 resources, livelihoods and the biosphere at large.climate changeimpacts touch all components of our biosphere including air, land, water, ecosystems, livelihoods and the fabric of our very survival. The aquatic habitat harbors immense resources on whose basis the livelihoods iof fishers, coastal communities, fisheries, and other depend. The recent increase in the frequency of flooding, drought, water scarcity and resettlements (“CC refugees”) all pose serious questions about our future survival. Without the necessary steps undertaken to adapt to the changing scenarios, mankind in general and the aquatic biota and resource-dependent communities in particular will be hit hardest. Scientists and policy-makers and ambivalent about how to mitigateclimate changeimpacts and how to adapt human societies to the changes. The European Panel of Freshwater Scientists warned in 2009 that with a warming of 2-4 C, major and catastrophic changes in freshwater biodiversity and peoples’ livelihoods can be expected in Europe. Similar scenarios are anticipated globally. Thus it is timely and perhaps too late to put his issue at the forefront of discussion by all professionals in the aquatic sciences. It is no coincidence then ahat EFASA has chosen this year’s theme to focus onclimate changeimpacts on tropical aquatic resources and populations. We hope that at the end our conference, all of you will go back to your respective institutions and spread this concern around, so that we will all be prepared to storm the inevitable with knowledge and skill and will have imparted our professional duties with responsibility and pride.

The leading papers by participants from India will focus on a review of climate change impacts on fisheries and aquaculture. More papers in the first session will expand onclimate changechallenges on fisheries, aquaculture and wetland resources and examine such impacts on livelihoods and opportunities. The sessions after tea break including the afternoon sessions will dwell on various aspects of fisheries and aquatic science topics, based on researches done by EFASA members. At one of the objectives of our annual meetings is to acquaint each other on the status of research we are doing, this will be a good avenue to divulge and disseminate our research findings. We have opted to cram as many papers as possible to give ample chance to young EFASA members to share their experiences and learn from each other. I am now convinced that we should see more papers from senior professional in the future, as they should share their stored knowledge with the upcoming young scientists instead of being placid onlookers on the wayside.

In view of the tight and crammed schedule we have, I urge all speakers to stick to the

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 5 time allocated and all chairmen to strictly impose their authority when speakers enthusiastically overpass their limits. As you can see, each speaker is allotted 20 minutes, 15 minutes for the presentation and 5 minutes for discussion. Please stick to the 15 minute talk so as to leave some room for questions, as there is no time for discussion today.

Tomorrow’s program is largely business and excursions and although people say you should not mix business with pleasure, we make an exception. You can give your comments on anyone’s presentation during the excursion. We hope we will all have a fruitful scientific and professional interaction during our 2 days stay here at this wonderful campus of the HU

Thank you for your time and I better stop here as I may also overpass my time limit of 10 minutes.

I should now like to call upon Professor Belay Kassa, President of HU to give the opening speech.

Thank you!

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 6

Opening Speech by Professor Belay Kassa, President of Haramaya University

Mr. Chairperson Distinguished Guests Dear Colleagues Ladies and Gentlemen

On behalf of the Haramaya University community and myself, I would like to welcome you all to this momentous occasion. The 3 rd Annual Conference of the Ethiopian Fisheries and Aquatic Sciences Association (EFASA) that we attend today and in the coming two days will certainly remain long at the top of our list of special events in that it is for the third time that the University hosts a professional association annual conference on its premises.

For many of you this occasion is nothing but homecoming. For others, it is the moment to reconnect with old friends and visit the institution that pioneered agricultural education, research and extension activities in the country.

Ladies and Gentlemen;

I would like to let you know that it was with great pleasure that the University management accepted the request to host this third annual conference. I would like to take this opportunity to express our sincere thanks to the organizers of this Conference for having given us the honor of hosting this important conference. My colleagues and I strongly believe that your presence here speaks volumes about your nostalgia to the now defunct LAKE ALEMAYA and your high regard for our University.

I am completely aware that the drive for Addis Ababa to Haramaya Campus was not comfortable at all and I could guess that your heads were aching and your legs were paining during the entire journey. However I for one believe that it was worth it .

Ladies and Gentlemen;

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 7

The theme of this year’s conference, namely Impacts of Climate Change and Population on Tropical Aquatic Resources is a timely one precisely because in this increasingly globalized and interconnected world natural resources are depleted faster than they can be replenished. I hope you would agree with me in that the need to tackle a complex issue like climate change through adaptation and mitigation strategies would require the involvement of all stakeholders, including community members, civil societies, professional associations, academicians, government (s), non-governmental organizations and private sector. In this respect, the organization of this important conference and the participation of different stakeholders are moves in the right direction.

Ladies and Gentlemen;

The University community here believes that professional Associations like the Ethiopian Fisheries and Aquatic Sciences. Association (EFASA) could play a catalytic role in terms of creating public awareness, providing evidence-based advice to policy makers, undertaking research to tackle issues of strategic importance as well as contributing to the development and review of curricula of the institutions of higher education that are relevant and responsive to the country’s trained manpower needs both in quality and quantity. As you well know, since almost five years now, the public institutions of higher learning are required to adapt their curricula to meet national demand for competent and skilled manpower as well as to respond quickly enough to changes in the environment and to the demands expressed by the ever-diversifying clientele of higher education. Given this state of affairs, the Ethiopian Fisheries and Aquatic Sciences Association (EFASA) could play a key role in enriching and reviewing the curricula for the undergraduate and post-graduate programs in the public institutions of higher learning.

Ladies and Gentlemen;

I firmly believe that the Ethiopian Fisheries and Aquatic Sciences Association (EFASA) could play a leading role in organizing periodic discussions on issues related to Fisheries and Aquatic Sciences as well as climate change. In addition to exchanging ideas among professionals and creating public awareness, such types periodic discussions could provide opportunities for policy makers to interact with the professional and the general public. In this respect, the example set by the Ethiopian Economic Association is laudable.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 8

Ladies and Gentlemen;

I would like to wind up my opening speech by extending my heartfelt thanks to the executive committee members of the Ethiopian Fisheries and Aquatic Sciences Association (EFASA) for having given us the honor of hosting this annual conference. I would also like to thank members of the annual conference organizing committee (from inside and outside the university), for their patience, commitment, enthusiasm, and hard work beyond the call of duty. Without their hard work, devotion and perseverance, it would have been difficult, if not impossible, to organize this annual conference. Finally, yet importantly, I would like to express my sincere gratitude to all of you who have come all the way down the road to Haramaya campus to participate in this annual conference..

Ladies and Gentlemen;

It is on this note that I wish us fruitful deliberations in addressing the challenges that lie ahead of us over the coming three days. It is now my pleasure to declare this 3 rd annual conference officially open.

Thank you for you kind attention! Professor Belay Kassa, President of Haramaya University Haramaya Ethiopia 04 Febryary 2011

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 9

The impact of climate change and population increase on Lakes Haramaya and Hora-Kilole, Ethiopia (1986 – 2006)

Brook Lemma Zoological Science Program Unit, College of Natural Sciences and Department of Urban Planning and Biodiversity Conservation, the Ethiopian Institute of Architecture, Building Construction and City Development (EiABC), Addis Ababa University, P. O. Box 1913 Code 1110, Addis Ababa, [email protected]

Abstract: Lakes Haramaya and Hora-Kilole have been monitored over the last 20 years (1986 - 2006) for purposes of scientific interest and use of water and biological resources to supplement the demographically unabated human population increase with some life sustaining programs. In L. Haramaya area both the local population and government agencies (Haramaya and Harar municipalities, Haramaya University, etc.) collected water from the lake directly or indirectly by digging boreholes along its shores and using the lake as a terminal recipient of household wastes. This has eventually lead to the deterioration of the water quality and eventual complete transformation of the lake into a terrestrial environment by 2006. In L. Hora-Kilole area the local population had never intervened the lake ecosystem because of its high saline-alkaline nature that made the water unfit for human consumption, irrigation or animal watering. Instead, in 1988 an external agency, Ministry of Agriculture, Department of Infrastructure Development, Addis Ababa, constructed a weir dam across an adjacently flowing river to harvest water in the lake for dry season irrigation of the surrounding fields. This has transformed the lake into a highly dilute oligotrophic state with its water level rising to 29 m. By 2006, the lake water has returned to almost its original level of 2.6 m depth, but its original ecological significance has been totally lost. In conclusion, accounts are made as to what uncontrolled human interference could make to natural aquatic resources, investigates the consequences of water deficiency in a region that is highly impacted by climate change and population increase and lessons are drawn for future actions.

Key words : Lake Haramaya (Alemaya), Lake Hora-Kilole, Ethiopia, tropical lakes, climate change, population increase.

Introduction Lake Haramaya (known in the literature as Alemaya) is located in the Southeastern Ethiopian Plateau about 525 km away from Addis Ababa and Lake Hora-Kilole (also known as Kilole or Kilotes) is found in Central Ethiopia, southwards about 62 km from the

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 10 same city. These two lakes were subject of numerous studies in the past. The origins and limnological features of these two lakes were different, although they are presented here in a contrasting scenario.

Lake Haramaya is more of a catchment lake for an area of slightly more than 200 km 2 watershed (Shibru Tedla and Feseha Haile-Meskel 1981, Brook Lemma 1987, 1991). There were no streams or rivers that were flowing in or out of this lake, except the seasonal run off. An adjacent and northerly-located Lake Tinike (Kurro) overflows into Haramaya during the rainy seasons, as it is located on a slightly higher ground. The watershed of this lake is devoid of apparently all its natural vegetation and is highly populated, with the majority of the land being used for horticultural crops and a stimulant plant locally known as " khat " ( Catha edulis ) for export to neighboring Djibuti and Somali. Farmers in the watershed needed water for irrigation for about eight dry months of the year. Besides, the lake water was also pumped for municipal uses to a town by the same name of about 30 000 people and the nearby town of Harar, 20 km in the eastern direction with a population of about 150 000. The latter town is outside of the lake watershed, posing additional water budget deficit on the lake. Eventually the demand from Harar, the increasing water supply demand of the growing population in the watershed and climatic changes have led to extensive water budget deficit on the lake creating the scenario described below (see also Brook Lemma 1994a and b, 1995, 2002 and 2003).

Lake Hora-Kilile was a saline-alkaline lake known in the literature for its high salinity, proliferation of more or less a monoculture of Arthrospira fusiformis (syn. Spirulina platensis ) and flocks of spoonbills and lesser flamingos (Omer-Cooper 1930, Prosser, et al. 1968, Talling, et al. 1973, Wood, et al. 1976, Melack, 1981, Elizabeth Kebede, et al. 1986, Wood, et al. 1988, Green and Seyoum Mengistu 1991). Its water has never been used for human direct use, be it for irrigation or drinking water supply owing to its high salinity. However, its scientific value for studying salinity series and the consequent variations in ecological range of lakes made it an index of research, particularly in the study of African saline lakes along with Lakes Hora-Hado (Arenguade), Abijata (Abiata), Nakuru, Bogoria, Sonachi and many others. Since 1989, the Ministry of Agriculture envisaged using this lake as a reservoir by diverting an adjacently flowing River Mojo to collect or harvest water to irrigate the plains located south and westward from the lake (Brook Lemma 1994, 1995, 2002, 2003a and b, and Zinabu Gebre-Mariam 1994). This

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 11 diluted the water so much that all the life assemblages of the lake changed, bringing Lake Hora-Kilole to an ordinary freshwater system containing wide spectrum of algae, zooplankton and more than three different types of fish species which were not there before.

What these lakes have in common to deserve a parallel investigation is the impacts of population increase they were subject to without any consideration of the consequences that could follow and climate change. What is interesting and what should be kept in mind while going through this paper is that the impact man made on Lake Haramaya was excessive water withdrawal, while on Lake Hora-Kilole it was water addition in so short a time bringing about contrasting scenarios on these two lakes.

This long-term investigation was set out to follow up the various changes that occurred over the years as seen from limnological parameters, the consequent anthropogenic impacts on these two lakes, and the lessons that could be learned from the changes that occurred in these lakes.

Materials and Methods The study sites : Lake Haramaya is located in the southeastern Ethiopian Plateau margin bordering the Southern Afar, at 2000 m above sea-level, between 42 002'E and 9 025'N (Fig. 1). Lake Hora-Kilole is found in the Central Ethiopian Plateau at 1920 m above sea level, 39 05'E and 8 048'N (Fig. 2). The locations of these lakes at similar altitudes and their exposure to similar climatic changes in the tropics make them quite comparable for study.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 12

Figs. 1 and 2 : Left: Lake Haramaya and right: Lake Hora-Kilole research sites

Field, laboratory and desktop studies : Over the years, particularly at the beginning, regular monitoring of the physical, biological and chemical parameters of the two study lakes was conducted. These included depth measurements to monitor water level fluctuations, measurements of underwater light-climate variations using a Secchi disk of 20 cm diameter with black and white quarters, collection of water samples for phytoplankton identification and enumeration. The samples were taken with van Dorn water sampler of two liters capacity. The water samples were received in one-liter capacity opaque screw cap plastic bottles. The water to be used for phytoplankton identification and enumeration was immediately fixed with Lugol's potassium iodide solution.

Regular zooplankton sampling was made using plankton net with 55 μm mesh size net, which were received in plastic bottles of 50 ml capacity and immediately fixed with sugar-formalin solution. Some fishing was also conducted to identify the fish species thriving in both lakes. For the purpose, gill nets with 10 cm mesh size with sizes of 25 m long and 2.5 meters wide were used. Throughout the study period visually observable data were collected by taking color images of such changes. Meteorological data for the periods of report were collected from Haramaya University for Lake Haramaya and from Bishoftu Agricultural Research Center for Lake Hora-Kilole, Bishoftu. Throughout the period of observation, data generated from this study were presented at various national and international conferences and scientific articles were published. These activities have

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 13 helped to make information available to those who needed it and for collecting feedbacks for further constructive analysis.

Results and Discussion Lake Haramaya: Over the past 20 years L. Haramaya has been observed to shrink continuously. Some of the evidences in terms of morphomertric and physico-chemical changes are shown in Fig. 1 and Table 1. By 2004, the lake has altogether disappeared and turned into an ephemeral lake where some water percolates at the lowest spot of the original lake basin.

Human demographic and climatic changes have contributed to the transformation of L. Haramaya to an ephemeral lake. The increase in population in Harar town and in the lake watershed demanded high municipal water supply over the years that has never considered any water budget scheme. The farmers in the watershed were pumping water out of the lake twenty-four hours a day (Table 1). This was mainly to irrigate a commercial crop locally known as " khat " or scientifically, Catha edulis . Succulent leaves of this plant are chewed and the water extract swallowed as stimulant with the belief that it stimulates the brain to work harder, faster and longer. It is also exported to neighboring countries like Djibouti and Somalia. Farmers obtain quite satisfactory incomes as observed from the rate of conversion of food crop fields into " khat " fields.

Table 1. Changes in Lake Haramaya from 1986 to 2006. Parameters Upto 1987 1988 – 2000 After 2004 Altitude 2000 m asl 2000 m asl 2000 m asl

Surface area 4.72 km 2 2.17 km 2 Maximum depth 7.0 m 3.5 m Mean depth 3.13 m 1.33 m Total transformation Volume 0.15 km 3 0.005 km 3 from an aquatic Secchi depth 0.98 - 1.81 m 0.8 - 0.9 m to a terrestrial Water temperature 19.2 - 23.8 0C 19.0 - 24.0 0C

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 14

pH 7.4 - 8.8 8.0 - 9.2 environment

Dissolved oxygen 3.0 - 5.0 mgO 2L-1 6.0 - 10.0 mgO 2L-1

Conductivity 960 - 1180 mScm -1 990 - 1200 mScm -1

There is a marked increase of about 3 0C in the air temperature of the region between 1960 and 2006 (Fig. 3). The rainfall pattern over the years has not changed much except that it is highly erratic. However, when rainfall of the region is viewed in comparison with the increase in air temperature and the change in human demography, it is obvious that the lake was operating at water budget deficit.

Fig. 3. Meteorology of Lake Haramaya area, 1960 - 2006.

At the same time the household wastes dumped in the watershed and all that comes from Haramaya town are washed into the lake with torrential rains that are followed by runoff that brings into the lake high amounts of top soil and organic wastes (Fig. 5). These have greatly influenced the plankton community in favor of those species, particularly Peridinium spp., that proliferate on such food sources (Nakamoto 1975, Brook Lemma

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 15

1994) (Fig. 4). The zooplankton communities have gone in the direction of small cladocerans, copepods and mostly rotifers that are small-bodied, such as, Brachionus spp., Filinia spp. and Lecane spp. (Fig. 5).

As observed in many tropical lakes, these trends are sufficient indicators of lake water quality deterioration and progressive loss of the assimilative power of lakes of the organic and other wastes that come in by wind, runoff or direct dumping of wastes into the lake (Nakamoto 1975, Brook Lemma 1994).

Fig. 4 : Relations in phytoplankton biomass, Lake Haramaya, 1986 - 1999. C stands for Cosmarium sp. P for Peridinium sp., N for Navicula sp., M for Merismopedia sp.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 16

Fig. 5 : Relations in zooplankton biomass, Lake Haramaya, 1986- 1999. Ro stands for Rotifera, Co for Copepoda and Cl for Cladocera.

By conducting some fishing and by regularly observing the fish landings made by fishermen, it was found out that Oreochromis niloticus (Nile-tilapia) or locally known as Koroso ) and Clarias gariepinus (the African catfish or locally known as ambazza ) thrived in L. Haramaya. The gear the fishermen used (mostly beach seines) had no standard mesh sizes and all the nets observed were locally made without any consideration of their effect on fish populations. As a result the fishes caught were small in size much below the expected table-size and were operated from the shores, damaging brooding female and young fish populations. As the operation of water collectors, municipalities and irrigation schemes continued unabated, the lake size continued to decrease, fishermen had to follow the retreating water edge and the water below their boat continued to disappear (Fig. 6).

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 17

Fig. 6. Lake Haramaya: Gradual drying up by 2000. Today it has completely disappeared with grasses gradually covering the sediments.

Lake Hora-Kilole : On the contrary, the addition of water into L. Hora-Kilole has resulted in increasing the lake volume tremendously, despite an increase of about 5 0C air temperature between 1965 and 2006 (Figs. 2, 7, 8 and Table 2). The volume of the lake is not much affected by irrigation, as there was not much such activity. Most of the agricultural practices were focused on food crops that mainly depended on seasonal rains (Fig. 8). However, this anthropogenic effect has turned L. Hora-Kilole from a highly saline-alkaline hypertrophic lake into a highly diluted typical oligotrophic tropical freshwater system. The Phytoplankton community, which was almost exclusively dominated by Arthrospira fusiformis , the zooplankton community which was dominated by Paradiaptomus africanus (Syn. Lovenula africana ) and the flamingoes and spoonbills that thrived on these species of plankton completely disappeared as the essential preconditions of saline-alkaline nature of the lake was altered by the inflow from River Mojo. In place of A. fusiformis the lake became full of Peridinium sp., which thrived on organic matter entering the lake with the river water and runoff (Nakamoto 1975, Brook Lemma 1994) (Fig. 9 and Table 2). The zooplankton community was replaced by Daphnia barbata , Ceriodaphnia reticulata , Moina micrura dubia , Thermocyclops decipiens , Mesocyclops aequatorialis similis , Filinia spp., Brachionus spp., Leydigia acanthocercides, Keratella spp., Asplanchna sp. and Lecane (Monostyla) bulla .

Table 2. Changes in Lake Hora-Kilole by 1989 and 2006

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 18

Post 1989 – By 2006 (back to Parameters Before 1988 2000 ~1988 scenario) Altitude 1920 m asl 1920 m asl 1920 m asl

Surface area 0.77 km 2 1.18 km 2 ~ 0.77 km 2 Maximum depth 6.4 m 29.0 m 6.0 m Mean depth 2.6 m 1.69 m 2.6 m

Volume 0.002 km 3 0.023 km 3 0.002 km 3 Secchi depth 0.15 m 0.37 – 1.80 m 0.79 m

Water temperature 19.0 – 23.0 0C 19.3 – 24.0 0C 23.0 0C (surface) pH 9.6 7.4 – 9.2 8.98 1.0 – 6.0 3.4 – 10.6 -1 Dissolved oxygen 9.7 mgO 2L mgO 2L-1 mgO 2L-1 (surface)

Conductivity 5930 μScm -1 339 μScm -1 370 mScm -1

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 19

Fig. 7. Meteorology of Lake Hora-Kilole area, 1965 - 2006.

Fig. 8. Changes in zooplankton and phytoplankton biomass, Lake Hora-Kilole, 1990 1999. Ro stands for Rotifera, Co for Copepoda, Cl for Cladocera, C for Cosmarium , N for Nitzschia sp. S - Staurastrum sp., P for Peridinium sp.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 20

Along with the river water came into the lake at least four species of fish, namely, Oreochromis niloticus and three other Barbus spp. These phenomena brought the two lakes in close contrast, although the first, L. Haramaya, has now disappeared while the second, L. Hora-Kilole, turned into a typical tropical freshwater system (Figs. 9 and 10). Today the decrease in salinity has allowed the surrounding community to use the water for household use, animal watering, practice some fishing for sale in the closely located town of Bishoftu and practice small scale irrigated horticultural farming.

Fig. 9. Lake Hora-Kilole after 1989 as water from River Mojo enters lake through the diversion canal. Left : as seen from the canal and right : as seen from lake water surface or from boat.

Fig. 10. Lake Hora-Kilole at its highest water level during the "big" rains between 1989 and 2000.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 21

At Lake Hora-Kilole, between 2000 and 2003 about 0.002 km 3 (2 x 10 6 m3) water was lost and the lake has almost returned to its original surface area and maximum depth (Fig. 16 and Table 2). This change has not yet resulted in any appreciable chemical and biological changes. The salinity has remained low, the phytoplankton and zooplankton are still dominated by Peridinium spp. and Daphnia barbata , respectively, and the fish community continues to thrive allowing the fishing practice to continue. Then the troubling question was "Where has all this water gone in such a short time?" At this stage of the study it was imperative that the evolutionary history of the lake should be revisited. As a consequence the search for the reasons had to put into perspective the storage of 2 x 10 6 m3 of additional water by diverting River Mojo and that this water cannot be lost by evaporation alone in such a short time between 2000 and 2003. So, there should be another explanation for this unusual scenario at L. Hora-Kilole.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 22

Fig. 11. Locations of the Bishoftu Crater lakes: L1 - Hora-Arsedi, L2 - Bishoftu, L3 - Hora-Hado, L4 - Bishoftu-Guda, L5 - Hora-Kilole, L6 - Kuriftu and L7 - Cheleleka (swamp). The broken lines indicate the direction of underground water flow in favor of the terminal lake, Hora-Arsedi. The inset in the map of Ethiopia represents the enlarged part (Map from the Ethiopian Mapping

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 23

Agency, 1975). Looking back into the studies of Mohr (1961), Prosser et al. (1968), Darling et al. (1996), Seifu Kebede (1999), Tenalem ayenew (2004), Seifu Kebede et al. (2001) and Lamb (2001) it was evident that lakes are not separate hydrologic entities, but interlinked by surface and ground water, particularly those that are found in the same watershed. With regard to the case of Bishoftu Crater Lakes, it was found out that groundwater is the major supply of water in the Bishoftu crater lakes (Seifu, et al. 2001, Lamb 2001). This suggested that Lake Hora-Kilole which could only sustain water volume of about 0.002 km 3 throughout its evolutionary history given its geologic formation and the regional climatic conditions. Over the years between 1989 and 2003, the lake was faced with the addition of 2 x 10 6 m3 of water which must have very likely exerted an unnatural mass on the basement rock creating a continuous and enormous pressure on groundwater flow rate.

The next question was to study the locations the lakes occupy in the region and the topographic position of the crater lakes with respect to each other. From Fig. 11, one can learn that the lakes are arranged along transects AB, CD and EF. The topographic map shows that the locations occupied by L. Hora-Hado and L. Hora-Kilole are elevated up to 2,200 m asl. These two points close down in the direction of L. Hora-Arsedi to an elevation of 1860 m asl. From the surface topography one can see that the latter lake surrounded by Bishoftu town lies at the base of a valley which extends in north-south direction and along which the Addis Ababa - Adama (Nazareth) highway is constructed. Further study in the topographic positions of the Bishoftu Crater Lakes (Figs. 12 and 13) has revealed that Lake Hora-Arsedi is found at the lowest position of all the crater lakes.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 24

Fig. 12. Cross-section drawn along Line AB in Fig. 11 to show the topographic position of the Bishoftu Lakes: Lakes Hora-Hado, Bishoftu, Hora-Arsedi and Bishoftu-Guda. The broken arrows indicate the direction of groundwater flow.

Fig. 13. Cross-section drawn along Line CD in Fig. 11 to show the topographic position of the Bishoftu Lakes Lakes Hora-Arsedi and Kilole. The broken arrow indicates the direction of groundwater flow.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 25

This coincided with the study made by Seifu Kebede (1999), Seifu Kebede et al. (2001) who have used tracer isotopes to follow the pattern of groundwater in and outflow of the Bishoftu lakes. The studies clearly indicated that Lake Hora-Arsedi is the terminal lake of the region that receives groundwater inflows from the surrounding lakes. It was also an exciting phenomenon to notice the sudden increase in the volume of Lake Hora-Arsedi whose water column rose by more than two meters between 2000 and 2003. Apparently, most of the harvested water from L. Hora-Kilole percolated as underground inflow into L. Hora-Arsedi, either directly (Transect CD) or via L. Bishoftu-Guda (Transect EF). In other words, as the water harvesting continued at L. Hora-Kilole, the basement rock on which it lies could not any more bear this unnatural mass (the weight of the additional 2 x 10 6 m3 of water) and hence the basement rock eventually gave way to a sudden increase in the underground water flow rate. Currently, the footpath constructed by the late Emperor Haile Selassie along the water's edge of L. Hora-Arsedi and along which tourists had enjoyed hitchhiking has been submerged at most parts of the shore after 2003. The water chemistry and biological diversity of the Bishoftu Crater Lakes has become similar, as revealed in the studies done by Seifu Kebede (1999), Brook Lemma (2001, 2002, 2003a) and Zinabu GebreMariam (1994, 1998).

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 26

Conclusion Lakes Haramaya and Hora-Kilole have been exposed to contrasting human interventions, where in the first scenario man has removed water beyond the water budget of the lake could allow (Table 3).

Table 3. Estimated annual water budget of Lake Haramaya (Fekadu Yohannes 2003 cited from Ayalew Wondie 2010)

Water budget and loss per year Amount in m 3 Total water budget per year (rainfall and surface runoff from the 6,731,614 surrounding catchments)

Water losses Evaporation loss per year 2,630,515 Abstractions For domestic water supply to towns of Harar, Haramaya and Awadai 1,752,000 For irrigation by the local farmers 751,680 Mis cellaneous abstractions 1,728,080 Total abstractions per year 4,231,760

Total water loss per year (evaporation PLUS abstraction) 6,862,275 Water balance per year Total water budget MINUS total water loss -130,661

As a consequence the lake continued to decrease in volume with all the household waste coming into it from the town of Haramaya and the community in the watershed (Fig. 14). Eventually, however much undesirable, the inevitable happened and the lake has now totally disappeared and transformed into a terrestrial environment (Fig. 6). The space that was once covered by water is now taken up by a few species of less competent grasses, which will eventually and inevitably be replaced by more competent, diversified and perennial land plants. The ephemeral lake that is now seen during the "big" rains (July, August and September) does not match any of the purposes the human needs of the watershed and Harar Town require. What remains now is the human water

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 27 requirement load that needs immediate response to let business-as-usual kind of life for the community in and outside L. Haramaya watershed. This demand has lead people of the region to tap underground water where the lake was lying. Currently there are around ten large waterholes with water pumps that throw large volumes of water twenty-four hours a day to all the sectors that were using Lake Haramaya, except to the "Khat " farmers. In recent years people have to dig much deeper into the ground to get only a small percentage of the water supply they used to collect at ease and at a higher cost as compared with the past. Furthermore, conflicts on groundwater use have started to crop up between major groundwater users such as Harar Municipality, Haramaya University, Haramaya, Hamaressa and Aweday Towns. The latter two towns are located between Haramaya (the water source point) and Harar, the terminal water recipient town.

Fig. 14. Lake Haramaya: Left : Household wastes, including plastics entering lake with runoff in rainy seasons and right : liquid wastes (including from latrines) of Haramaya town directed into lake.

Lake Hora-Kilole faces complete alteration of its life assemblages and water chemistry. The high salinity condition before the dilution was the basis for the proliferation of Arthrospira fusiformis (Fig. 15).

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 28

Fig. 15. Lake Hora-Kilole before 1989, the diversion of River Mojo, flowing adjacent the lake at the upper edge of the image.

This particular phytoplankton species has disappeared before it could be exploited as a rich source of rare amino acids for making chocolates and in recent years used for sustaining HIV/AIDS patients. The Spirulina culture industry is now a worldwide business, which Ethiopia could have joined by harvesting Arthrospira fusiformis without any addition of fertilizers and simulation of the right environmental conditions, as all these were naturally available. It is also unfortunate that Ethiopia lost the revenue it could have obtained from tourists who could have visited thousands of flamingos and spoonbills at such a short distance that could have been done over a weekend from Addis Ababa. When Lake Hora-Kilole is seen from the scientific perspective, the importance of this lake as an index reference research material for scientific investigations on saline-alkaline lakes around the world has slipped away with the addition of water from River Mojo (Fig. 9 and 10).

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 29

Fig. 14. Lake Hora-Kilole after 1989 as water from River Mojo enters lake through the diversion canal. Left : as seen from the canal and right : as seen from lake water surface or from boat.

Incidentally it may be worth mentioning that a similar resource is being lost at Lake Abijata (Abiata) because of excessive water abstraction to produce soda ash and by diverting its inflows such as River Bulbulla for irrigation purposes. The major lessons that could be learned from these two contrasting water use scenarios are (i) Climatic changes rema*in a threat with the occurrence of increasing warming and recurrent droughts. This inevitably exerts a lot of pressure on fresh waters as observed in Lake Haramaya condition. (ii) Increasing human needs for fresh water with unplanned population growth in the tropics remain a threat to environmental degradation and misuse of freshwater systems. (iii) Planning and budgeting water use in relation to the water input budget of the respective aquatic system should be high on the agenda of tropical water use managers. (iv) Segregation of wastes into their respective types (metals, plastics, organic matters, etc.) and treatment of household and other wastes to environmentally friendly forms before putting them into aquatic systems should be most urgent instead of struggling for treatment of people who comedown with waterborne diseases. Prevention of diseases and protection of environment are much cheaper and easier processes than risking the productive age of citizens to diseases and death. (v) Exploitation of natural resources should be approached with the objectives of rational use for the sake of conservation, healthy and sustainable use of resources. The final question that may still remain would be what will be the fates of Lakes Hora- Arsedi and L. Hora-Kilole? This may depend on two conditions. Scenario one would be if

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 30 the inflow from R. Mojo is completely stopped from entering into L. Hora-Kilole, L. Hora- Arsedi will be receiving groundwater inflow as it used to receive it before 2000 and hence it would return to its original water level and water chemistry within a number of years. In such a case L. Hora-Kilole may continue to concentrate its water, mainly through evapo-transpiration and seepage, and very likely someday reverting to its original saline- alkaline and hypertrophic status. Scenario two would be if R. Mojo continues to flow into L. Hora-Kilole. In this case L. Hora-Arsedi will continue to receive groundwater inflow more than it used to experience before 2000. However, this inflow will not have the capacity of raising the volume as that large volume of inflow that took place between 2000 and 2003. The inflow rate would stabilize to an annual constant level, the lake would subside to a certain lower level than at present but not as low as the level it had before 2000.

Acknowledgements Field and laboratory equipment were purchased with grants of the International Foundation for Science, Stockholm, Sweden; Ministry of Agriculture, Addis Ababa and Haramaya University, Haramaya, provided logistics, space and Meteorological data of the region, Institute of Freshwater Ecology and Fisheries, Stechlin (Neuglobsow), Germany, assisted in data handling, Bishoftu Agricultural Research Center, EARO, supplied Meteorological data of the region, Dr. Dietrich Flössner, Jena, Germany, did the identification of zooplankton, Ato Mulugeta Assefa, Prof. Mesfin Abebe, Wo. Munira Abdo, Ato Habtamu Gessesse, Ato Abebaw Tezera facilitated the work and provided invaluable assistance especially in the initial few years and the organizers / sponsors of this conference created the platform for communication.

References Ayalew Wondie (2010): Current land use practices and possible management strategies in shore area wetland ecosystem of Lake Tana: Towards improving livelihoods, productivity and biodiversity conservation. In: Proceedings of the 2 nd National Conference of the Ethiopian Fisheries and Aquatic Sciences Association (EFASA on Management of shallow water bodies for improved productivity and peoples' livelihoods in Ethiopia ; February 20-21, 2010, Bahir Dar, Ethiopia. pp. 9-16. Brook Lemma (1994): Changes in the limnological behaviour of a tropical African explosion crater lake: L. Hora-Kilole, Ethiopia. Limnologica 24(1): 57 - 70.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 31

Brook Lemma (1995): seasonal limnological studies on Lake Alemaya: a tropical African lake, Ethiopia. Archiv für Hydrobiologie/Suppl. 107 (2): 263 - 285. Brook Lemma (2002): Contrasting effects of human activities on aquatic habitats and biodiversity of two Ethiopian lakes. Ethiop. J. Nat. Res. 4(1): 123 – 144Brook Lemma (2003): Ecological changes in two Ethiopian lakes caused by contrasting human intervention. Limnologica 33: 44 - 53. Darling, W. G., Berhanu Gizaw and Arusei, M. K. (1996): lake-groundwater relationships and fluid rock interaction in the African rift valley: Isotopic evidence. Journal of African Earth Sciences 22: 423 - 431. Lamb, H. F. (2001): Multi-proxy records of Holocene climate and vegetation changes from Ethiopian crater lakes. Biology and Environment: Proceedings of the Royal Irish Academy 101B(1-2): 35 - 46. Mohr, P. (1961): The geology, structure and origin of the Bishoftu explosion craters. Bulletin of the Geophysical Observatory, Addis Ababa 2: 65 - 101. Nakamoto, N. (1975): A freshwater red tide on a water reservoir. Jap. J. Limnol . 36 92 0 ; 55 - 64. Prosser, M. V., Wood, R. B. and Baxter, R. M. (1968): The Bishoftu Crater Lakes: A bathymetric and chemical study. Arch. Hydrobiol. 65(3): 309 - 324. Seifu Kebede (1999): hydrology and hydrochemistry of Bishoftu Crater Lakes (Ethiopia): Hydrogeological, hydrochemical and oxygen isotope modeling. MSc dissertation, Addis Ababa University, Faculty of Science, Department of Earth Sciences (unpublished thesis). 127 pp. Seifu Kebede, Tenalem Ayenew and Mohammed Umer (2001): Application of isotope and water balance approaches for the study of the hydrological regime of the Bishoftu Crater Lakes, Ethiopia. SINET: Ethiop. J. Sci . 24(2): 151 - 166. Talling, J. F. and Talling, I. B. (1965): The chemical composition of African lake waters. Int. Rev. Ges. Hydrobiologia 50: 421 - 463. Tenalem Ayenew (2001): Numerical groundwater flow modeling of the central main Ethiopian Rift lakes basin. SINET: Ethiop. J. Sci . 24(2): 167 - 184. Tenalem Ayenew (2003): Environmental isotope-based integrated hydrogeological study of some Ethiopian Rift lakes. Journal of Radioanalyrical and Nuclear Chemistry 257: (1): 11 - 16. Tenalem Ayenew (2004): Environmental implications of changes in the levels of lakes in the Ethiopian rift since 1970. Reg. Environ. Change 4: 192 - 204.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 32

Wood, R. B. and Talling, J. F. (1988): Chemical and algal relationship in a salinity series of Ethiopian inland waters. Hydrobiologia 158: 29 - 67. Zinabu GebreMariam (1994): Long term changes in indices of chemical and productive status of a group of tropical Ethiopian lakes with differing exposure to human influence. Arch. Hydrobiol . 132(1) 115 - 125. Zinabu GebreMariam (1998): Science in Africa - Emerging water management problems. In: Human interactions and water quality in the Horn of Africa, Ed.: J. Schoneboon. 1998 Symposium of the American Association for the Advancement of Science (AAAS), Philadelphia. Zinabu GebreMariam (2003): The water chemistry of the Ethiopian rift-valley lakes and their 142.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 33

Climate change challenges on fisheries and aquaculture

Dereje Tewabe Bahir-Dar Fisheries and Other Aquatic Life Research Center E-mail: [email protected] P.O.Box 794, Bahir-Dar, Ethiopia

Abstract : Climate change poses new challenges to the sustainability of fisheries and aquaculture systems, with serious implications for the 520 million people who depend on them for their livelihoods and the nearly 3 billion people for whom fish is an important source of animal protein (World Fish Center, 2007). Two-thirds of all reefs are in developing countries, and 500 million people in the tropics depend heavily on reefs for food, livelihoods, protection from natural disasters and other basic needs. For many coastal communities in reef areas, fishing activities are the sole source of income. Climate changes may affect fisheries and aquaculture directly by influencing fish stocks and the global supply of fish for consumption, or indirectly by influencing fish prices or the cost of goods and services required by fishers and fish farmers. Potential loss of species or shift in composition for capture fisheries and impacts on seed availability for aquaculture, changes in precipitation and water availability are major impacts of climate change. Climate change lowers water quality causing more disease and increased competition with other water users which altered and reduced freshwater supplies with greater risk of drought. Fishing communities that depend on inland fisheries resources are likely to be particularly vulnerable to climate change. Higher inland water temperatures may reduce the availability of wild fish stocks by harming water quality, worsening dry season mortality, bringing new predators and pathogens, and changing the abundance of food available to fishery species.

Key words/phrases : Abundance, Composition, Fish stocks, Planktivorous, and Precipitation

Introduction Climate change is projected to impact broadly across ecosystems, societies and economies, increasing pressure on all livelihoods and food supplies, including those in the fisheries and aquaculture sector. There is an urgent need to better understand where climate change is most likely to reduce livelihood options for fishers and where there is therefore the greatest need to invest in alternative rural and urban enterprises.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 34

The International Food Policy Research Institute (IFPRI) (2010) examines scenarios, results and policy options to promote sustainable food production in an era of climate change. The report suggests that the negative impacts of climate change on food security could be mitigated by improved agricultural productivity, broad economic growth and robust international trade to counter regional food shortages (FAO, 2005). Fish is the main source of animal protein for a billion people worldwide. As well as providing a valuable protein complement to the starchy diet common among the global poor, fish is an important source of essential vitamins and fatty acids. Some 200 million people and their dependants worldwide, most of them in developing countries, live by fishing and aquaculture. Fish provides an important source of cash income for many poor households and is a widely traded food commodity. In addition to stimulating local market economies fish can be an important source of foreign exchange. Fishing is frequently integral to mixed livelihood strategies, in which people take advantage of seasonal stock availability or resort to fishing when other forms of food production and income generation fall short.

Two-thirds of all reefs are in developing countries, and 500 million people in the tropics depend heavily on reefs for food, livelihoods, protection from natural disasters and other basic needs. People living in the coastal zone are often poor and landless, with limited access to services, and hence vulnerable to impacts on natural resources (Allison et. al ., 2006). For many coastal communities in reef areas, fishing activities are the sole source of income. Higher sea temperature is a major cause of coral bleaching and damage to reef ecosystems around the globe (NEPAD, 2005). The bleaching event of 1998, driven by El Niño, a global coupled ocean-atmosphere phenomenon that changes the location and timing of ocean currents and causes important inter-annual variability in sea surface temperature, killed an estimated 6 % of the world’s coral. Studies suggest that 60 % of coral reefs could be lost by 2030 and that increased acidification of oceans from higher levels of atmospheric carbon dioxide may be a contributing factor.

Changing sea temperature and current flows will likely bring shifts in the distribution of marine fish stocks, with some areas benefiting while others lose. Research in this area typically focuses on higher-value commercial species. While investigating potential impacts on species important to poorer fishers is worthwhile, predictions will always be uncertain, which argues for a strong research focus on helping fishers become more able to cope with external shocks. Fishers need to reduce their reliance on a narrow resource

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 35 base by learning to exploit a broader range of species and diversify their sources of income.

Rising sea level Mean sea level is predicted to rise between 0 and 90 centimeters during this century, with most predictions in the range of 30-50 centimeters. This will likely damage or destroy many coastal ecosystems such as mangroves and salt marshes, which are essential to maintaining wild fish stocks, as well as supplying seed to aquaculture. Mangroves and other coastal vegetation buffer the shore from storm surges that can damage fish ponds and other coastal infrastructure and may become more frequent and intense under climate change. United Nations environmental protection (UNEP) estimates the annual ecosystem value of mangroves at US$200,000-US$900,000 per square kilometer. A number of studies have identified possible adaptation strategies for mangrove systems and the people that use them.

Inland temperature changes Higher inland water temperatures may reduce the availability of wild fish stocks by harming water quality, worsening dry season mortality, bringing new predators and pathogens, and changing the abundance of food available to fishery species. In Lake Tanganyika, which supplies 25- 0 % of animal protein for the countries that surround it, mixing of surface and deep water layers has become reduced over the last century as a result of higher temperatures. This has limited the nutrients available to plankton and thereby reduced yield in planktivorous fish by an estimated 30 %. The identification and promotion of aquaculture species and techniques that are suitable to changing environments and resources may offer new uses for land that has become unsuitable for existing livelihoods strategies and will enable aquaculturists to adapt to change. In cooler zones aquaculture may benefit from faster growth rates and longer growing seasons as a result of rising ambient temperatures.

Changes in precipitation and water availability Increasing seasonal and annual variability in precipitation and resulting flood and drought extremes are likely to be the most significant drivers of change in inland aquaculture and fisheries. Bangladesh, one of the world’s least developed nations, relies on fisheries for around 80 % of its national animal protein intake. Under the scenario of 2-6 ˚C global warming, precipitation is forecast to decline in Bangladesh during the dry season and

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 36 increase during the wet season, expanding flood-prone areas by 23-39 % (Vera, et al ., 2006). While a relationship exists between greater flooding extent and higher production in many floodplain fisheries, potential benefits may be offset by a range of factors, including reduced spawning success of river fishes as a result of higher wet season river flows, reduced fish survival in lower dry season flows, and loss of habitat to new hydraulic engineering projects and other human responses. In shallow African lakes such as Mweru WaNtipa, Chilwa/ Chiuta and Liambezi, water level is the most important factor determining stock size, and catch rates that could decline when the lake levels are low. Understanding how fisheries interact with other economic sectors and how fisher folk have adapted to variability, for example through mixed livelihood strategies and the absence of barriers to entering fisheries, may usefully guide responses to future climate variation and trends (Allison, et al ., 2006).

Reduced annual and dry season rainfall and changes in the duration of the growing season, are likely to have implications for aquaculture and create greater potential for conflict with other agricultural, industrial and domestic users in water - scarce areas. These impacts are likely to be felt most strongly by the poorest aquaculturists, whose typically smaller ponds retain less water, dry up faster, and are therefore more likely to suffer shortened growing seasons, reduced harvests and a narrower choice of species for culture. However aquaculture may also provide opportunities for improving water productivity in areas of worsening water scarcity. Schemes that integrate pond aquaculture with traditional crops in Malawi have successfully reduced farmers’ vulnerability to drought, provided a source of high-quality protein to supplement crops, and boosted overall production and profit. In terms of water use efficiency, systems that reuse water from aquaculture compare very favorably with terrestrial crop and livestock production.

Climate Change Challenges Facing Fisheries and Aquaculture The Intergovernmental Panel on Climate Change projects that atmospheric temperatures will rise by 1.8-4.0 °C globally by 2100 (Williams, et. al ., 2007). This warming will be accompanied by rising sea temperatures, changing sea levels, increasing ocean acidification, altered rainfall patterns and river flows, and higher incidence of extreme weather events. The productivity, distribution and seasonality of fisheries, and the quality and availability of the habitats that support them, are sensitive to these climate change effects. In addition, many fishery-dependent communities and aquaculture

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 37 operations are in regions highly exposed to climate change. Researchers and policymakers now recognize that the climate change impacts on coastal and riparian environments, and on the fisheries they support, will bring new challenges to these systems and to the people who depend on them. Coping with these challenges will require adaptation measures planned at multiple scales. Climate change stresses will compound existing pressure on fisheries and aquaculture and threaten their capacity to provide food and livelihoods. Worldwide, fish products provide 15 % or more of the protein consumed by nearly 3 billion people and support the livelihoods of 520 million people, many of them women (Science Daily, 2009, World Fish Center 2008).

Many capture fisheries worldwide have declined sharply in recent decades or have already collapsed from overfishing, and major fishing grounds are concentrated in zones threatened by pollution, the mismanagement of freshwater, and habitat and coastal zone modification. Aquaculture needs to expand sustainably to fill supply shortfalls as demand for fish for human consumption continues to rise — but, even more than fisheries; aquaculture is concentrated in areas with intense competition for environmental services. Sustaining fisheries in the face of these challenges, and ensuring that they contribute to development as effectively as possible, has been more difficult. Similarly, realizing the potential of aquaculture will require careful attention to climate change impacts and the constraints and opportunities they bring. Understanding these linkages between climate change, livelihoods and food security is critical for designing policies and management strategies for fisheries and aquaculture in the communities, nations and regions that depend on them. Doing so effectively will require sustained investment in research that informs policy, resource management and development. Key research questions and work being pursued by the World Fish Center to address them is summarized below in four areas: (1) diagnosing vulnerability to climate change, (2) understanding current coping mechanisms and adaptive responses, (3) contributing to mitigation, and (4) building the capacity to respond and adapt (World Fish Centre, 2007).

Climate change poses new challenges to the sustainability of fisheries and aquaculture systems, with serious implications for the 520 million people who depend on them for their livelihoods and the nearly 3 billion people for whom fish is an important source of animal protein, says the World Fish Centre. To help meet these challenges, climate change research at the WorldFish Center aims to work with partners to focus climate change responses where they are most needed by assessing and mapping the

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 38 vulnerability of fishery- and aquaculture-dependent people and regions to the impacts of climate change; reduce people’s vulnerability to these impacts by identifying appropriate adaptation strategies; contribute to climate change mitigation by identifying ways to reduce greenhouse gas emissions and sequester carbon in aquatic production systems; and build local, national and regional capacity to implement adaptation and mitigation strategies for fisheries and aquaculture by informing policy processes.

Climate change impacts on fisheries and aquaculture Climate changes may affect fisheries and aquaculture directly by influencing fish stocks and the global supply of fish for consumption, or indirectly by influencing fish prices or the cost of goods and services required by fishers and fish farmers. Changes in sea surface temperature more frequent harmful algal blooms; less dissolved oxygen; increased incidence of disease and parasites; altered local ecosystems with changes in competitors, predators and invasive species; Changes in plankton composition. For aquaculture, changes in infrastructure and operating costs from worsened infestations of fouling organisms, pests, nuisance species and/or predators. For capture fisheries, impacts on the abundance and species composition of fish stocks. In most African Lakes, which supplies more of animal protein for the countries that surround it, mixing of surface and deep water layers has become reduced over the last century as a result of higher temperatures. This has limited the nutrients available to plankton and thereby reduced yield in planktivorous fish (Voigt, 2003).

Enhanced primary productivity may lead to potential benefits for aquaculture and fisheries which can be offset by changes in species composition. Other effects could be changes in timing and success of migrations, spawning and peak abundance, as well as in sex ratios, potential losses of species or shift in composition in capture fisheries; impacts on seed availability for aquaculture also changes in the location and size of suitable habitat range for particular species. Exposure to climate change effects may cause rise in sea levels and reduced recruitment of fishery species. Climate change motivated waves damage fishery infrastructure, coral reefs or cause floods and upsurge of storms. El Niño- Southern Oscillations may change location and timing of ocean currents and upwellings alter nutrient supply to surface waters and, consequently, affecting patterns of primary productivity (IPCC, 2007).

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 39

Climate change affects the distribution and productivity of open sea fisheries. Changed ocean temperature and bleached coral reduces productivity of reef fisheries. Altered rainfall patterns bring flood and drought. Rising sea level loss of land reduced area available for aquaculture. Loss of freshwater fisheries, changes to estuary systems impacted on shifts in species abundance, distribution and composition of fish stocks and aquaculture seed. Salt water infusion into groundwater damage freshwater systems, capture fisheries and reduced freshwater availability for aquaculture and a shift to brackish water species. Loss of coastal ecosystems such as mangrove forests reduced recruitment and stocks for capture fisheries and seed for aquaculture. Worsened exposure to waves and storm surges and risk that inland aquaculture and fisheries become inundated. Higher inland water temperatures increased stratification and reduced mixing of water in lakes, reducing primary productivity and ultimately food supplies for fish species. Raised metabolic rates increase feeding rates and growth if water quality, dissolved oxygen levels, and food supply are adequate, otherwise possibly reducing feeding and growth.

Potential for enhanced primary productivity possibly enhanced fish stocks for capture fisheries or else reduced growth where the food supply does not increase sufficiently in line with temperature. Shift in the location and size of the potential range for a given species will result in potential loss of species and alteration of species composition for capture fisheries. Reduced water quality, especially in terms of dissolved oxygen; changes in the range and abundance of pathogens, predators and competitors; Invasive species introduced, altered stocks and species composition in capture fisheries; for aquaculture, altered culture species and possibly worsened losses to disease (and so higher operating costs) and possibly higher capital costs for aeration equipment or deeper ponds. This also changes in timing and success of migrations, spawning and peak abundance. Changes in precipitation and water availability, changes in fish migration and recruitment patterns. Again impacts on altered abundance and composition of wild stock as a result impacts on water and seed availability for aquaculture. Lower water quality causing more disease and increased competition with other water users this altered and reduced freshwater supplies with greater risk of drought which ends up with higher costs of maintaining pond water levels and stock loss consequently reduced production capacity. Conflict with other water users and change of culture species occurred. Changes in lake and river levels and the overall extent and movement patterns of surface water altered

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 40 distribution, composition and abundance of fish stocks as a result fishers forced to migrate more and expend more effort.

Fish provide essential nutrition and income to an ever-growing number of people around the world, especially where other food and employment resources are limited. Many fishers and aqua culturists are poor and ill-prepared to adapt to change, making them vulnerable to impacts on fish resources. Fisheries and aquaculture are threatened by changes in temperature and, in freshwater ecosystems, precipitation. Storms may become more frequent and extreme, imperiling habitats, stocks, infrastructure and livelihoods.

Wider implications of the impacts of climate variation on fisheries Many artisanal fishers are extremely poor. Even in cases where they earn more than other rural people, fishers are often socially and politically marginalized and can afford only limited access to healthcare, education and other public services. Social and political marginalization leaves many small-scale and migrant fishers with little capacity to adapt, and makes them highly vulnerable to climate impacts affecting the natural capital they heavily depend on for their livelihoods. Heightened migration to cope with and exploit climate-driven fluctuations in production may worsen a range of cultural, social and health problems (Allison, et. al ., 2006). HIV/AIDS is prevalent in many fishing communities and this problem will worsen as climate change forces increased migration and social dislocation. As declining catches worsen poverty and food shortages, desperate people become less risk averse. Transactional sex, in which women fish traders around Lake Victoria, for example, trade sex for fish will become an increasingly important vector for the transmission of HIV/AIDS (World Fish Centre, 2007).

Recent stern review on the Economics of Climate Change states, “For fisheries, information on the likely impacts of climate change is very limited.” Efforts to increase understanding of how and why climate change may affect aquaculture and fisheries should emphasize developing strategies by which fisheries, and perhaps more significantly aquaculture, can play a part in our wider adaptation to the challenges of climate change. However, the inherent unpredictability of climate change and the links that entwine fishery and aquaculture livelihoods with other livelihood strategies and economic sectors make unraveling the exact mechanisms of climate impacts hugely complex. This argues for placing a very strong focus on building general adaptive capa

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 41 city that can help the world’s poor fishing and aquaculture communities cope with new challenges, both foreseen and not.

Extreme events and worsening risk Extreme events such as cyclones and their associated storm surges and inland flooding can have serious impacts on fisheries, and particularly aquaculture, through damage or loss of stock, facilities and infrastructure. Institutional responses such as constructing artificial flood defenses and maintaining natural ones can provide protection that is significant but incomplete. Poor communities in exposed areas are unlikely to be able to build substantial defenses, so the most realistic and economic strategy will be to increase resilience. In Bangladesh and other countries where floods are common, short culture periods and minimal capital investment in aquaculture help reduce stock loss and associated cost. Building greater adaptive capacity will entail approaches, such as mixed livelihood strategies and access to credit, by which aquaculturists can cope financially with sudden losses of investment and income. Other considerations for coping strategies in high-risk areas include monitoring and assessing risk and promoting aquaculture species, fish strains, and techniques that maximize production and profit during successful cycles.

Diagnosing Vulnerability to Climate Change The vulnerability of fishery- and aquaculture-dependent communities and regions to climate change is complex, reflecting a combination of three key factors: the exposure of a particular system to climate change, the degree of sensitivity to climate impacts, and the adaptive capacity of the group or society experiencing those impacts. Vulnerability varies greatly across production systems, households, communities, nations and regions. It is influenced by changing demographics, the degree of market globalization and emerging agricultural development policy. Poor and marginalized groups, including women, are likely to be the most vulnerable because climate change will likely exacerbate the unequal access to natural resources, productive assets, information and technology that already exists (Wright, 2009). Developing policies and strategies to address climate change impacts on fisheries and aquaculture depends on identifying vulnerable places and people and understanding what drives their vulnerability. This requires vulnerability assessment at multiple scales and taking into account multiple interacting drivers. Key questions that need to be addressed include the following (World Fish Centre, 2007).

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 42

1.1 What is the nature and extent of vulnerability among fishery- and aquaculture- dependent communities and regions to specific climate-related threats? 1.2 How do other drivers of change influence vulnerability to climate change?

Out puts of research to answer these questions will be vulnerability maps that identify ‘hotspots’ and most affected people. These maps can be used to guide investments in adaptation. Understanding climate vulnerability in the context of other drivers helps to prioritize climate-related actions and inform programs to mainstream climate change responses in other development policy and planning activities. Two thirds of the nations most vulnerable to climate change are in Africa, where fish provides more than half of the animal protein consumed in some countries (UNEP, 2006). Inland and coastal waters are highly sensitive to climatic variation, and adaptive capacity is low.

Understanding Current Coping Mechanisms and Adaptive Responses Policies enabling adaptation to climate change can be guided by an understanding of the complex ways in which fisheries and aquaculture have responded to past climate variability as well as other ‘shocks’. Examining the responses of fishing communities to natural disasters, in particular the responses of women and the poor, can aid understanding of which measures may reduce vulnerability and enhance resilience in the face of future climate impacts. Key research questions that need to be addressed include the following (Williams, 2008). 2.1 To what extent do current successful responses to climate variability confer resilience to future climate change? 2.2 What are the known limits to adaptation based on analysis of adaptation failures following natural disasters or multiple stresses? 2.3 Under what conditions do short-term coping mechanisms undermine long-term adaptive capacity? Research addressing these questions will provide governments, communities and their development partners with a summary of the lessons that fishers and fish-farmers have learnt from past responses to climate variability and other disasters and ‘shocks’.

Contributing to Mitigation Agriculture contributes 10-12 % of global greenhouse gas emissions, with aquaculture contributing a small but unknown fraction of that. Fishing burns 1.2 % of the fossil fuel used globally each year (Tyedmers et al ., 2005). While the potential benefit of investing

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 43 in fishing energy efficiency and emission reduction is minor, the sector does provide opportunities to improve livelihoods and environmental and resource management in ways that mitigate climate change. Market instruments for financing mitigation, such as the Clean Development Mechanism and voluntary carbon markets, may be used to fund work that contributes to the development of sustainable fisheries and aquaculture.

Mitigation strategies for fisheries include promoting the use of fuel-efficient fishing vessels and methods, removing such disincentives to energy efficiency as fuel subsidies, and reducing overcapacity in global fishing fleets, as there are too many boats burning too much fuel to chase too few fish. Aquaculture technologies that reduce energy consumption and optimize the potential for carbon sequestration provide opportunities for mitigation. Similarly, conserving and restoring mangroves sequesters carbon, protects coastlines, and enhances fisheries and livelihoods. Opportunities for funding adaptation through novel schemes that also contribute to mitigation, such as the Reduced Emissions from Deforestation and Degradation scheme for mangroves, should be promoted. In pursuing these mitigation opportunities, key research questions include the following: 3.1 How can fisheries and aquaculture contribute to reducing greenhouse gas sources and emissions? 3.2 What are the opportunities for using aquatic production systems as carbon sinks? 3.3 To what extent can mitigation strategies enhance the sustainability of fisheries and aquaculture? 3.4 What effects, good and bad, will mitigation strategies adopted in other sectors likely have on fisheries and aquaculture? Research on the potential for fisheries and aquaculture to contribute to mitigation will provide governments, communities and their partners with a range of options for funding adaptation activities, as most mitigation initiatives are linked to markets or global funds. Reducing the carbon footprint of fisheries and aquaculture, as well as making a small contribution to halting climate change, can set an example to other food sectors in commitment to environmentally sustainable production.

Strategies for coping with climate change Fish can provide opportunities to adapt to climate change by, for example, integrating aquaculture and agriculture, which can help farmers cope with drought while boosting profits and household nutrition. Fisheries management must move from seeking to maximize yield to increasing adaptive capacity. Fish can alleviate poverty and may serve

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 44 as a vital safety net for people with limited livelihood alternatives and extreme vulnerability to changes in their environment. Fishing communities that depend on inland fisheries resources are likely to be particularly vulnerable to climate change. Globally, aquaculture has expanded at an average annual rate of 8.9 % since 1970, making it the fastest growing food production sector. Today, aquaculture provides around half of the fish for human consumption, and must continue to grow because limited — and in many cases declining — capture fisheries will be unable to meet demands from a g rowing population. Integrating aquaculture with agriculture by, for example, raising fish in rice fields or using agricultural waste to fertilize ponds, can provide significant nutritional and economic benefits from available land and resources.

Draft targets for 2020 The so-called “strategic plan” with 20 targets for 2020 is also still under negotiation. To the frustration of for instance the European Union, draft texts that were approved at the last convention on biological diversities (CBD) meetings in Nairobi are again opened up again for changes. Main issues were as follows (UN Biodiversity Convention, 2010)

Species loss A target has been formulated to prevent the loss of endangered species and to improve the conservation status of threatened species. This clear goal now needs to be translated into clear accountable actions for individual countries to truly stop the loss in biological diversity.

Ecosystem loss The level of ambition to reduce the loss of ecosystems is still under negotiation. It is though clear that this target will mainly aim to address the conversion of ecosystems not their degradation. This is a sad outcome as many areas suffer from heavy degradation due, for example to over-harvesting of harvesting wood, overgrazing or drainage. Many areas, although still classified as for example wetland, or forest have lost most of their natural values. In many cases restoration is feasible and worthwhile. The incentive to reduce these stresses is minimal as long as the target just focuses on absolute loss only.

Protected areas The discussion on how much of terrestrial, inland or marine areas should be protected is still ongoing. The agreed formulation is not to only count protected areas, but also all

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 45

‘area based conservation measures’. The risk with this formulation is that any area with a minimal level of conservation could count for this target – and yet still progressively degrade.

Climate change A clear and potentially ambitious target has been agreed on restoring 15 % of all degraded areas to enhance their role in terms of climate resillience and carbon strorage. Dependent on the definition of the word ‘degraded’, this target could help the efforts to restore for instance degraded mangrove forests or the deforested peatswamps in Southeast Asia.

Water and biodiversity Still negotiations are taking place on the role of biodiversity and ecosystems for water provision and regulation; and on water for biodiversity. Wetlands International “Water and biodiversity is a sensitive issue as many countries see water as a national matter. Many do not want to touch the sensitive international dimension of transboundary water such as the impact of the loss of upland marshes and lakes for countries downstream”.

A draft text on ecosystem services mentions the role of ecosystems for water. It is a small step to get water on the agenda of the Convention. The complete picture on the final and approved targets will remain unclear till the end of the convention meeting. Even then, important rounds of negotiations will follow to make the abstract targets measurable, with clear commitments for individual countries (UN Biodiversity Convention, 2010). Wetlands International: “ Ambitious, approved targets on biodiversity are crucial to commit countries to actions for saving biodiversity. Biodiversity loss at this moment is now posing risks to society through reduced services such as food and water security ”. According to the Intergovernmental Panel on Climate Change (IPCC), science now allows to estimate greenhouse gas emissions from wetlands. This breakthrough was presented there by the IPCC at the UN climate conference (UNFCCC) in Cancun (Mexico). This conclusion is crucial for allowing countries to reduce their emissions through rewetting drained wetlands (IPCC, 2010). During the UNFCCC COP 15 in Copenhagen, the Global Partnership on Climate, Fisheries and Aquaculture (PaCFA) hosted a side event at the European Environment Agency on “Fisheries, aquaculture and aquatic systems in a changing climate”. The event, organized by the European Bureau for Conservation and Development, a member of PaCFAA, made a deeper look at the implications of climate

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 46 change on the sustainability of fisheries and aquaculture and its impacts on food and livelihood security. . Building the Capacity to Respond and Adapt Reducing vulnerability in fisheries and aquaculture urgently requires the application of adaptation and mitigation options at appropriate scales. Their effectiveness depends on building community and national capacity to respond to changes and on mainstreaming climate change adaptation in policies regarding natural resource management and development. A broad range of activities are required, ranging from building climate monitoring and forecasting capacity, to applying forecasts to aid disaster prevention, and to develop capacity for policy implementation and technological innovation to address adaption in aquaculture systems. By directly managing fish production, aquaculture has the potential to improve adaptive capacity and enhance resilience to climate change in vulnerable communities, compensating for variability and decline in capture fisheries exacerbated by climate change (Handisyde et. al ., 2006). However, aquaculture depends heavily on fishmeal feeds derived from small, wild-caught pelagic fish and on wild-caught larvae for seed. The stocks of both are sensitive to climate change. Adaptation strategies must include a search for fishmeal substitutes and ways to culture species in hatcheries that previously depended on wild seed. Developing the capacity of national innovation systems in aquaculture will both aid the sectors’ adaptation to climate change and keep it competitive in the context of changing markets.

Building adaptive capacity to respond to climate change also involves strengthening the ability of the fishers and fish farmers to respond to current climate threats. Indeed, some areas where aquaculture and fisheries are the most productive and contribute the most to poverty reduction and food security are also the areas most prone to natural disasters caused by extreme weather events and sea level rise. Because these events are forecast to increase in frequency and severity in many parts of the world, and sea level rise is projected to accelerate, it is vital to work with disaster relief agencies and affected communities to develop processes for disaster preparedness and post-disaster rehabilitation of fisheries and aquaculture. Finally, institutions need support to improve their capacity to facilitate the mainstreaming of climate change adaptation into broader fishery and rural development policy. Understanding and addressing the disproportionate effect of climate change on vulnerable groups will be especially important. Towards these goals, fisheries and aquaculture management and research

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 47 institutions need to engage in global, regional and national policy for that shape thinking and investment in climate change adaptation. In considering these issues, key research questions that need to be addressed include the following: 4.1 How can lessons from individual, household, enterprise and community adaptive responses around the world be effectively shared and applied to build resilience to climate change from the bottom up? 4.2 What policy processes nationally, regionally and globally do fishery and aquaculture agencies need to engage with to finance and implement adaptation? 4.3 How can climate change adaptation and disaster risk management be effectively incorporated into fishery and aquaculture development and management planning? Research outputs will provide strategies for building adaptive capacity that can be used by governments, communities, or firms to inform their responses to climate change and other drivers. By identifying key policy processes, stakeholders in the fishery and aquaculture sector will have a clearer picture of how to go about getting both technical and financial support for adaptation. By learning from other experiences with mainstreaming, sectoral policies will be more effectively ‘climate-proofed’ and governments will be better able to work with their aquatic resource-dependent citizens to secure the development benefits of fisheries and aquaculture into the future.

Conclusion Climate change is inevitably a challenge for fisheries and aquaculture. Through rigorous research on impacts, mitigation and adaptation, combined with practical actions locally, nationally, regionally and globally, World Fish aims to provide new knowledge to inform solutions. High-quality research that involves resource users, builds strong partnerships and harnesses political will is crucial for making fisheries and aquaculture systems more resilient to the challenge of global climate change and securing a bright future for the people that depend upon them. Greater climate variability and uncertainty complicate the task of identifying impact pathways and areas of vulnerability, requiring research to devise and pursue coping strategies and improve the adaptability of fishers and aqua culturists.

References Allison, E.H., Adger, N.W., Badjeck, M-C, Brown, K, Conway, D, Dulvy, N. K, Halls, A, Perry, A, and Reynolds, J. D. 2006. Effects of climate change on the sustainability of capture and

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 48 enhancement fisheries important to the poor: Analysis of the vulnerability and adaptability of fisherfolk living in poverty. Department for International Development (UK) project, number: R4778J. www.fmsp.org.uk FAO. 2005. Responsible fish trade and food security, J. Kurien (eds.) FAO Fisheries Technical Paper No. 456. Rome Handisyde, N.T., Ross, L.G., Badjeck, M-C and Allison, E.H. 2006. The effects of climate change on world aquaculture: A global perspective. Online available IFPRI, 2010. Food security, farming, and climate change to 2050 IPCC, 2010. New science allows addressing peatland emissions in UNFCCC, Cancum, Mexico. IPCC, 2007. Intergovernmental Panel on Climate Change: Special Report on Emissions Scenarios. NEPAD (2005). NEPAD Action Plan for the development of African fisheries and aquaculture Science Daily, 2009 . A new report, Fisheries and Aquaculture Face Multiple Risks from Climate Change published by the Food and Agriculture Organization (FAO) of the United Nations, predicts "an ocean of change" for fishers and fish farmers. UN Biodiversity Convention, 2010. Time is running out! The aim to agree on ambitious global targets for the coming decade will be challenging; success is uncertain. The pace of the negotiations is slow. The UN Biodiversity Convention in Japan, Nagoya, 25 October 2010. UNEP (2006). New Report Underlines Africa’s Vulnerability to Climate Change. United Nations Environmental protection Williams, S.E., Shoo, L.P., Isaac, J., Hoffman, A., Langham, G., 2008. Towards an integrated framework for assessing the vulnerability of species to climate change. PLoS Biology 6, e325. doi:10.1371/journal.pbio.0060325 Williams, J.W., Jackson, S., Kutzbach, J., 2007. Projected distributions of novel and disappearing climates by 2100 AD. Proceedings of the National Academy of Sciences United States of America 104, 5738–5742. Wright, S.J., Muller-Landau, H., Schipper, J., 2009. The future of tropical species on a warmer planet. Conservation Biology 6, 1418–1426 WorldFish Centre, 2008. Healthy service delivery and other HIV/AIDS related interventions in the fisheries sector in Sub-Saharan Africa. A literature review, August, 2008

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 49

WorldFish Centre, 2007. Global vulnerability of fisheries systems to climate change, ISSUES, Brief /1701, Penang, Malaysia Vera, C., Silvestri, G., Liebmann, B., Gonzalez, P., 2006. Climate change scenarios for seasonal precipitation in South America from IPCC-AR4 models. Geophysical Research Letters 33, L13707. doi:10.1029/2006GL025759 Voigt, W., 2003. Trophic levels are differentially sensitive to climate. Ecology. 84 , 2444– 2453

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 50

Climate change and wetland resources vulnerability: Impacts on livelihoods and opportunities for enhancing in Ethiopia

Lemma Abera Hirpo Zwai Fishery Research Center, P.O.Box 229, Zwai. E-mail: [email protected]

Abstract: It has been considered that the impacts of climate change are likely to be considerable in tropical regions. Developing countries are generally considered more vulnerable to the effects of climate change than more developed countries. This has been attributed to a low capacity to adapt in the developing countries. Wetlands provide an important source of cash income for many poor households of the country. However, climate affecting certain components of the hydrological cycle, especially precipitation and runoff, a change in climate can alter the spatial and temporal availability of wetland resources. Hence, the issue of appropriate management is an urgent need to address if the contribution of wetland resources as different purposes to the country. This can be done either by the government or by the communities themselves or by both.

Key words: Climate change, Opportunity, wetlands, Ethiopia

Introduction Climate change is environmental change, but given that human societies are affected directly and indirectly by the climate system and given that human activities are driving climate change it is fundamentally a human problem. Climate change cuts across boundaries (Gorner, 2005). The impacts of climate change are expected to seriously affect the livelihoods, health, and educational opportunities of people living in poverty, as well as their chances of survival, both locally in specific areas and globally in general.

By affecting certain components of the hydrological cycle, especially precipitation and runoff, a change in climate can alter the spatial and temporal availability of wetland resources. Increasing variability alone would enhance the probability of both flood and drought (William, 1988). The climatic impact on the water regime may also exacerbate other environmental and social effects of wetland management. For instance, reduced river runoff can concentrate the effects of pollutants or exacerbate the spread of waterborne disease. Climate fluctuations can also affect the use of agricultural land associated with irrigation systems. Climate change greatly complicates the design, operation, and management of water-use systems (Gleick & Shiklomanov, 1989).

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 51

Most Ethiopian wetlands are in the vicinity of fast growing cities surrounded by agricultural land, and exposed to water quality changes as a result of land use and modification, irrigation (Zinabu, 1998). Diversion of some tributaries for irrigation purposes and flushing from deforested or heavily grazed catchment may have contributed to the decrease in the water level and increase in the concentrations of ions in the water resources. This seems to be particularly likely for Lake Abijata, Zwai and Koka reservoir where human activity has been intensive in the catchment area (Zinabu, 1998). Due to this the resource is expected to decline as long as possible measures are not undertaken.

The impact of climate change on wetland resources is so integrated into different sectors, such as agriculture, health, urbanization, fisheries, and so forth that it has motivated many to conduct studies using different approaches and come up with a variety of results. Therefore, quantitative estimates of hydrologic effects of climate change are essential for understanding and solving the potential wetland resource management problems associated with water supply for domestic and industrial water use, power generation, and agriculture as well as for future water resource planning, reservoir design and management, and protection of the natural environment. Hence, the objective of this paper is therefore; to explain the socio-economic aspects of climate changes in terms of aquatic resource development; to annotate what happens to the aquatic life in different ecosystems as the climate changes; to develop a better understanding of the impact of climate change on the wetland resource; to draw important conclusion and forward sound national initiatives required to rescue the aquatic resource from impacts of climate change

Wetlands What are Wetlands? The Ramsar Convention on Wetlands defines wetlands as “Areas of marsh, fen, peat land or water, whether natural or artificial, permanent or temporary, with water that is static or flowing, fresh, brackish or salt, including areas of marine water the depth of which at low tide does not exceed six meters”. The Ramsar Convention classifies wetlands into three main categories. These are marine (coastal wetlands not influenced by rivers, e.g. shorelines and coastal reefs), inland wetlands (lakes, ponds, etc) and human-made wetlands (dams, reservoirs etc). Again based on their physical, chemical and biological characteristics there are more than 40 sub types.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 52

Functions and services of wetlands Wetlands in the country have ample amounts of socioeconomic and environmental importance to the local as well as national economy. Functioning wetlands provide a range of under-appreciated benefits and services for people's livelihoods and well-being, including food, fiber, water purification and cultural values, as well as water supply. Wetland ecosystems also provide fundamental ecological functions including groundwater recharge, storm protection, flood mitigation, shoreline stabilization, erosion control, and retention of carbon, nutrients, sediments and pollutants as well as providing habitats for flora and fauna. Wetlands also produce goods that have a significant economic value such as timber, peat, wildlife resources and tourism opportunities

Wetlands also used by the local community for livestock feeding. Since, most wetlands of the country are being used for a variety of developmental activities including hydroelectric power and some others again service as soda ash extraction like Lake Abijata.

Current senario of wetlands The growing population had leaded the natural vegetation around freshwater to be transformed into agricultural land for instance Lake Zwai. Irrigation from the water bodies, high temperature and utilization of inlet river for irrigation are suggested reasons for reduction of wetland levels.

Hence, wetlands are the most threatened ecosystems on the planet as well as in Ethiopia. This is due to rapid wetland degradation (E.g. Lakes Haromaya, Abijata, etc), continuous disruption of the natural processes through anthropogenic and others factors. These includes; wetland drainage for agriculture, urban expansion, over grazing in the wetlands (year round and overstocking), growing distractive plants - e.g. Eucalyptus, over exploitation of wetland resources like water, fishery, reeds/ cheffe , etc, Double cropping - is a disruption of ecological functions, Brick making and sand extraction.

1. Major anthropogenic impacts Anthropogenic climate change in Ethiopia is thus already affecting aquatic ecosystems and the human societies that depend on them. The human impacts in on the wetlands are linked to many social and economical activities by numerous stakeholders found within

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 53 the wetlands. These impacts include improper water utilization, distraction of wetland side vegetation, improper wetland resource utilization.

1.1. Improper water utilization Overuse of the watershed together with climate change shift caused heavy erosion and silt accumulation in lakes and irrigation and power dams with the result that the water volume has been decreasing so fast. Basin lakes like Lake Tana, Rift valley and L. Alemaya have the most vulnerable water bodies to this phenomenon and for that matter the last (the only source of water supply to nearby urban centers) has already dried up. Hydropower generating dams are experiencing similar threats of decreasing water level. Due to reduced levels of precipitation and watershed destruction, the volume of major rivers and perennial streams is on the decrease.

Small and large scale agricultural investors are engaged in irrigation based investments that consume large quantity of water. In addition to this they are more intensive in using agricultural inputs specially that of pesticides, which may pollute the water body having long term effect on the aquatic biota.

1.2. Distraction of shore line vegetation Some shore parts of wetlands are dominated by vegetations which represent habitat of great ecological importance. These areas form buffers that help in water quality regulation. It protect growing fish (fry and fingerling) inhabiting the shore area from their enemies and reduce disturbance and destruction caused by beach seine, It can supply fish feed by generating zoo and phytoplankton from the decomposing organic materials and defecates of birds lading on it, However, Some parts of wetland vegetation in some area is getting depleted due to over grazing, mowing for roof cover, furniture making and fire wood and so on. Hence, degradation of the shoreline caused by hurricanes and storms, as a consequence of climate change, drastically reduces the fisheries potentials of such localities by destroying in-shore habitat and spawning grounds for many fish species.

1.3. Improper wetland resource utilization Hence, Fish production has become a victim of this decline in wetland levels. The decline damages the breeding grounds of fish species that spawn in shallower parts of the lake. These effects are magnified in shallow water bodies like Zwai and Koka where a higher rate of water level fluctuation has been observed. (Zinabu, 1998). Fishing activity was

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 54 practiced both legally and illegally, but in Lake Abijata the observation at the site and response from the local community indicated that the current water chemistry related to the decrement in water level associated with the terminality of the lake has induced in phase out of the fishery in the lake.

Fishing gear operation in the country mainly was undertaken by beach seine, gillnet and long line. The major problem regarding beach seine utilization was is that the fishermen usually tend to minimize the stretched mesh size of the code end leading to harvest of juvenile fish. In general, open access characteristic of the resources increases the number of users, which in turn leads to aquatic resource depletion (Felegeselam, 2003).

Climate change and impacts on wetlands Pathways impact of climate change on fisheries: Climate change can impact fisheries through multiple path-ways. Changes in water temperature, precipitation and other variables, such as wind velocity, wave action and flooding, can bring about significant ecological and biological changes to freshwater ecosystems functions. Extreme weather events may also disrupt fishing operations and land-based infrastructure, while fluctuations of fishery production and other natural resources can have an impact on livelihoods strategies and outcomes of fishing communities.

Some of the pathways identified in the report of Allison et al ., 2005 are impacts of:

(i) Water temperature change on aquatic ecology: shifting range of fish species, change in inland water currents affecting upwelling zone fisheries and disruption to fish reproductive patterns and migratory routes. An increase in mean temperature may also affect the dissolved oxygen concentrations in the layer of water below the thermocline (hypolimnion) in two ways: increased metabolism of fish and other organisms in a slightly warmer hypolimnion will lead to the faster depletion of the limited oxygen supply, and lake overturn, the primary means of replenishing hypolimnetic dissolved oxygen, will occur less frequently (Fick et al ., 2005).

(ii) Precipitation and evapotranspiration change on hydrology of inland waters: river flows and flood timing and extent change, affecting fish reproduction, growth and mortality, as well as other elements of wetland-based.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 55

Climate change and the fisheries sector

In most part of the country fisherfolk (fishers, fish processors, traders and ancillary workers) and their dependents live in areas vulnerable to human-induced climate change, or depend for a major part of their livelihood on resources whose distribution and productivity are known to be influenced by climate variation (Badjek, 2009). However, relationships between the biophysical impacts of climate change and the livelihood vulnerability of poor fishing communities have seldom been investigated. Information has been lacking on the areas and people that are likely to be most vulnerable to climate- induced changes in the fisheries. This information is required for the effective prioritisation of development interventions to reduce vulnerability to the impacts of adverse climate change on fisherfolk living in poverty. The fisheries sector makes important contributions to local development in, lakeshore, floodplain areas, through employment and multiplier effects. Maintaining or enhancing the benefits of fisheries in the context of a changing climate regime is an important development challenge.

Wetlands and Food security Ethiopia is a country beset by each of the most serious issues currently challenging the world at large. Rising food prices threaten to unhinge progress in the government’s Food Security Programme; climate change seems likely to increase the visitation of draught which is a major cause of widespread poverty in Ethiopia (Shiberu Tedela, 2009).

Maximization of yield has highest priority in developing countries with expanding populations and increasing food requirements. Ethiopia is no exception in this regard and the main objectives of the government were increased production to the estimated maximum sustainable yield (MSY) and job creation (Abdurhman Kelil, 2002). Hence, prior to 1992 the Central Government formulated polices for the management of inland water fisheries for the contribution of food security of the country and based on this fact and with the high rate of population growth and the progressive shortage of livestock products, the situation is now changing and the demand for fish is growing very fast. Hence, these days both the government and non-government organizations have paid attention to the realization of this untapped fishery resources.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 56

In addition to fishery resources wetlands also plays a critical role in the survival of many communities across the country, particularly in semi-arid areas where, during dry periods, they are an important source of water for domestic use and the production of crops. In most parts of the world, rural communities suffer from seasonal variations in food supply and the “hungry season” is a key feature of life for many millions of people. This food shortage is often addressed by the drainage of wetlands or the use of areas with seepage water or a high water table to produce food crops in the dry season. Such crops can make a dramatic impact upon the availability of food in the hungry season, and even though the production is small, its value is great.

Challenges and opportunities Wetland Policy and Institutional gaps: MoARD strategies - Encourage drainage and wetland cultivation; Ministry of Health - Encourages the filling up or drainage of wetlands to eradicate communicable or water borne diseases such as malaria; The Ministry of Mines - Allows the miner to use, among other things, water resources in the area of lease; Ministry of Water Resources - Encourages preventing the formation of the new wetlands by using appropriate mechanisms, Avoid formation of waterlogged areas and Conducting appropriate drainage works on all wetlands (Water Sector Strategy (2001), Page 12; Article 4.1.1). Capacity limitations as well as population growth and individual approach of stakeholders (inadequate cooperation among stakeholders) are considered as a challenge due to aggravate to increasing demand for land and water.

The country has three principal resources: land, water and labour that need to be brought together and made productive. The development of these resources offers the only feasible opportunity for effective development and poverty reduction. In addition the FDRE Constitution Article 92, PASDEP (Plan for Accelerated and Sustained Development to End Poverty), Water Resources Management and environment policies, National stakeholders (Federal, Regional), International /regional Partners and Conditions.

Conclusion Wetlands provide globally significant social, economic and environmental benefits. Important wetland functions include water storage, groundwater recharge, storm protection, flood mitigation, shoreline stabilization, erosion control, and retention of

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 57 carbon, nutrients, sediments and pollutants. Wetlands also produce goods that have a significant economic value such as clean water, fisheries, timber, peat, wildlife resources and tourism opportunities. This food shortage is often addressed by the drainage of wetlands or the use of areas with seepage water or a high water table to produce food crops in the dry season.

Aquatic organisms influenced by changes in circulation, ventilation, and stratification through changes in temperature, light, and nutrient supply. Alterations of any of these drivers may lead to changes in species abundance and composition, possibly leading to large-scale regime shifts and species migrations. Such changes will affect aquatic organisms higher up on the food chain in ways that are not yet fully understood.

Human pressure is high in most part of the country and natural vegetation is disappearing rapidly. Anthropogenic pressure has resulted in open canopy vegetation which is floristically poor. Hence, High population increases over the limited area resulted in the indiscriminate forest clearing overgrazing around the wetlands. The absence of soil conservation practice accelerated siltation process in most wetlands. Hence, the issue of appropriate management is an urgent need to address if the contribution of wetland resources as a source of food, income and employment for the majority of the population around the wetland areas in particular and in the country in general. This can be done either by the government or by the communities themselves or by both. Generally, to alleviate those constrains and there by strengthen the contribution of the resources to the national economy, we need to follow the following guiding principles for sustainable wetland Management. These are taking account of the inter relations between wetlands and other ecosystems, Integrating conservation and development, Wetland management should maintain a high diversity of users.

References Abdurhman Kelil (2002). Users’ attitudes toward Fisheries management on Lake Ziway, Ethiopia. PP1-54 M.Sc. Thesis, Norwegian college of Fishery Science, University of Tromso, Norway. Allison E.H., Adger W.N., Badjeck M.C., Brown K., Conway D., Dulvy NK. (2005). Effects of climate change on the sustainability of capture and enhancement fisheries important to the poor: analysis of the vulnerability and adaptability of fisherfolk

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 58

living in poverty. Fisheries Management Science Programme project no. R4778J, MRAG, London. Badjeck C. (2009). Impacts of climate variability and change on fishery-based livelihoods. Marine Policy. www.elsevier.com/locate/marpol Gorner, Anna. 2005. Non climatic lake level change in ethiopia. [internate Online] Felegeselam, Yohanes. 2003. Management of Lake Ziway Fishery In Ethiopia. Department of Economics, Department of Economics. Norwey: University of Tromsø, 2003. p. 65, A thesis submitted in partial fulfilment for the Master of Science in International Fisheries Management. Fick, A.A., Myrick, C..A. Hansen. L.J.. (2005). Potential impacts of global climate change on freshwater fisheries. A report for WWF, Gland, Switzerland. Gleick P, Shiklomanov IA (1989) The impact of climate change for water resources. Second meeting of IPCCWG-2, WMO/UNEP, Geneva Shiberu Tedela (2009). Proceedings of the First Annual Conference of EFASA Held at Zwai Fisheries Resources Research Center Zwai, Ethiopia William E.R (1988) Assessing the social implication of climate fluctuations, a guide to climate impact studies. Department of Geography and National Hazards Center, University of Colorado Boulder Zinabu, G.M. 1998. Human interaction and water quality in the horn of Africa. [book auth.] J. Schoneboom. Philadelphia,Pennsylvania : the symposium at the American Association for the Advancement of Science (AAAS), 1998, pp. 47-61. Annual meeting.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 59

Diel feeding rhythm, ingestion rate and diet composition of Oreochromis niloticus L. in Lake Tana, Ethiopia

Zenebe Tadesse National Fisheries and other Aquatic Life Research Center (NFALRC), P. O. Box 64, Sebeta, Ethiopia. Email:[email protected]

Abstract: The diurnal feeding rhythm and ingestion rate of Oreochromis niloticus L. in Lake Tana was studied based on fish samples collected over 24 hours at an interval of four hours using trawl net. The results of the study showed that O. niloticus feeds during the day time and the stomachs were nearly full between 14:00 and 18:00 hr. Based on stomach fullness and rate of gastric evacuation it was estimated that the fish ingests about 3.5% of its body weight at an average temperature of 21 oC in Lake Tana. Microscopic examination of stomach contents revealed that the diet of adult O. niloticus was composed of a mixture of algae, detritus, mud and zooplankton. Texturally the diet of the fish appeared muddy and reddish indicating the detritus origin of the food from the lake bottom. The most common algae include the diatoms of the genera Aulacoseria , Navicula and Synedra , the blue greens Microcystis and Chroococcus and the greens Pediastrum and Scenedesmus . Among the zooplankton genera of rotifers, cladocerans and copepods were also in the stomach. Quantitatively the diatoms and blue greens and detritus were important in the diet of O. niloticus in Lake Tana.

Key words: Oreochromis niloticus, diel feeding rhythm, ingestion rate, phytoplankton, zooplankton, detritus, Lake Tana.

Introduction Tilapias are among the most diversified inland fishes in tropical waters of Africa and elsewhere in the world (Balarin and Hatton, 1979 ). Similarly, the tilapia Oreochromis niloticus (= Tilapia nilotica ) is found widely spread in most lakes and rivers of Ethiopia (Shibru Tedla, 1973). This fish is commercially the most important species in the country and accounts for about 60% of the commercial fishery (LFDP, 1996). Because of its adaptability to wide environmental conditions and elasticity in feeding habits O. niloticus has been used primarily in the aquaculture industry (FAO, 2007).

Previous studies based on examination of stomach contents have shown that adult

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 60

O.niloticus is an herbivorous fish feeding on phytoplankton and detritus of plant origin. Among algae Cyanobacteria, green algae and the diatoms were found to be important food items of O. niloticus in most Rift Valley Lakes studied in Ethiopia (Getachew Teferra, 1987,1989, 1993; Zenebe Tadesse, 1988, Yirgaw Teferi, 1997). However, the proportion of each group in the diet varies a great deal depending on season and lake type. O. niloticus juveniles, on the other hand, are omnivores and feed on a mixture of algae, zooplankton and insects (Tudorancea et al., 1988).

Tilapia species are known to show a diel feeding rhythm and some species are day time feeders (Moriarty and Moriarty, 1973; Bourn, 1974; Akintude, 1982) whereas the others feed actively in the night (Whyte, 1975). Based on their feeding rhythm and rate of gastric evacuation Moriarty and Moriarty (1973) have estimated the daily consumption of O.niloticus in Lake George. Following the method of Moriarity and Moriarty (1973) several investigators have estimated the daily ingestion rate of O. niloticus from Ethiopian Rift Valley Lakes, Ziway, Awassa and Chamo (Getachew, 1987, Getachew Teferra & Zenebe Tadesse, 1997, Yirgaw Teferri, 1997). Estimated values reported by these authors varied a great deal between the studied lakes.

Lake Tana is the largest and covers nearly 50% of the total lakes area in Ethiopia. The fish fauna of this lake is more diversified as compared to other lakes in Ethiopia. Particularly, the Barbus flock of this lake are unique and recent studies have shown the presence of 14 morphotypes, out of which six are reportedly new species (Nagelkerke, 1997).

In addition to Barbus and Clarias spp, Lake Tana harbours a substantial stock of O.niloticus accounting for about 30% of the total lake fishery (LFDP, 1996). Despite its economic importance very little is known about the biology of this fish (Zenebe Tadesse, 1997). In this study an attempt was made to assess the diet composition and daily ingestion rate of O.niloticus based on stomach samples collected for over 24hrs from Lake Tana.

Materials and methods Diel feeding rhythm: Fish samples were collected every 4 hrs for a period of 24 hrs in July, 1993 using trawl nets with a code end of 40 mm stretched mesh. After each trawling 30-40 fish samples were considered for routine measurements. Total length (TL) and total weight (TW) were measured to the nearest 0.1cm and 0.1 g respectively. After

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 61 dissection the stomach of each fish was isolated and weighed to the nearest 0.1g. The stomach was then washed of its content and weighed. The difference in weight between the full and washed stomach gave the wet weight of the stomach contents.

Daily food consumption was estimated based on two parameters: daily feeding periodicity and rate of gastric evacuation. Percent stomach fullness (%SF= stomach content x 100 divided by body weight) was plotted against time of the day. The slope of the regression line for the decrease in the stomach fullness was used to represent rate of gasric evacuation (Bajkov, 1935; Lauzanne, 1978).

Diet composition: A total of 36 fish with full stomachs were selected to study the diet composition. After dissection, the stomachs were isolated and their contents transferred into plastic bags containing 5% formalin. The major food items were microscopically identified to the lowest possible taxa using various sources (Prescott, 1980; komareck, 1989). The relative importance and contribution of the various food item to the fish diet was determined using frequency of occurrence (Windwell and Bowen, 1978; Wootton, 1998). Relative abundance of major food iems were visually rated under the microscope.

Results The feeding pattern of O.niloticus in lake Tana was found to show a diel rhythm. The amount of food in the stomach increased from 6hr to 18:00hr peaking between 14:00 and 18:00 hr. It then declined in the evening and nearly all stomachs were empty between 24:00 and 4:00 hr. in midnight. This shows that O.niloticus in Lake Tana is a day time feeder and the ingestion rate increased sharply in the afternoon after 14:00 hr. Based on the rate of gastric evacuation, The daily ingestion rate of O. niloticus in Lake Tana was estimated to be about 3.5% of the fish wet weight per day at 21 oC.

Microscopic examination of the stomach contents has shown that the diet of O. niloticus in Lake Tana was composed of phytoplankton, detritus and mud. Different genera of algae belonging to the blue greens, green algae and diatoms were identified in the diet. Among the algae the centric diatoms of the genera Aulacoseira , Navicula , Nitzschia were numerically the most important group followed by the centric blue greens of the genera Microcystis and Chroococcus spp. The green algae belonging to the genera Scenedesmus and Pediastrum also constituted the diet. The contribution of detritus and mud was quite high. The brownish color and rough texture of the food indicate the detritus origin

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 62 and mud composition of the food from the lake bottom. Among zooplanktons, some genera of rotifers, cladoceran and copepods were also encountered occasionally.

Discussion Diel feeding rhythm and ingestion rate: As shown in Fig. 1 The rate of stomach fullness increases beginning 4 hr in the morning reached the peak at 14 hr. then after the stomach fullness declined progressively. This indicates that the fish stars feeding in the morning and nearly all stomachs were full in late after noon. Thus, O. niloticus in Lake Tana is a day time feeder and stops feeding in the night. This result agrees well with earlier studies reported for the same species in Lake Ziway (Zenebe Tadesse and Getachew Teferra, 1998).

Several factors including pH, water temperature and level of oxygen have been suggested that favor day time feeding in Tilapia (Getachew Teferra, 1993; Zenebe Tadesse and Getachew Teferra, 1998). In Lake Tana the high water temperature during the day time triggers the swimming activity and feeding rate of the fish. Moreover frequent mixing of the lake and photosynthesis by the phytoplankton facilitates availability of oxygen which in turn increases the movement and feeding rate of the fish.

Based on the rate of gastric evacuation, the daily ingestion rate of O. niloticus in Lake Tana was estimated to be about 3.5% of the wet body weight of the fish. This value was much lower than earlier reports for the same species from Lake Ziway (7.6% of wet body weight), Lake Awassa (11.7% of the wet body weight per day) and Lake Chamo (4.4% of the wet body weight per day) (Getachew Teferra, 1989, 1993; Zenebe Tadesse and Getachew Teferra, 1998) (Table 1). The relatively low ingestion rate of the fish in Lake Tana may be explained by the trophic of the lake. Lake Tana is an oligo-mesotrophic lake and the available algal biomass may be low when compared with productive Rift Valley Lakes Awassa. Ziway and Chamo (Elizabeth Kebede, 1996). Moreover, the sampling coincided with the fish peak spawning in July which lowers the feeding rate of O. niloticus in Lake Tana (Zenebe Tadesse, 1997).

Diet composition: Microscopic examination of stomach contents have shown that the diet of adult O. niloticus in Lake Tana consists of phytoplankton, detritus, mud and zooplankton and agrees well with previous studies reported for the same species from the Rift Valley Lakes Ziway (Getachew Teferra, 1987; Zenebe Tadess and Geatchew

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 63

Teferra, 1998); Langeno (Zenebe Tdesse, 1999) Awasssa (Getachew Teferra 1987,1989) and Chamo (Getachew Tefrra, 1993; Yirgaw Teferi, et al., 2000). However, the composition and relative importance of major phytoplankton groups varies considerably between lakes and season. In the present study diatoms predominately makeup the diet of Lake Tana fish in contrast with that of Lake Ziway and Chamo which were mainly the blue green algae (Cyanobacteria) (Getachew Teferra 1987, 1993). Whereas in Lake Awassa the green alga of the genus Botryococcus as well as the blue greens were important food items (Getachew Teferra, 1989). This difference in the composition and relative abundance of phytoplankton in the fish diet may be attributed to the type and biomass of algae available in each lake. Since O. niloticus is a microphagous fish, it indiscriminately filters and feed on suspended seston available in the lake.

Detritus of plant origin, mud and sand were common in O. niloticus diet in Lake Tana. The rough texture and toughness of the fish diet showed the dominance of mud and sand in most stomachs examined. In most cases detritus and mud made up the bulk of the fish diet. This shows that the fish feeds on materials either suspended or settled at the lake bottom. Moreover, since Lake Tana is an oligo-mesotrophic lake, the biomass of suspended phytoplankton may be low. Thus, the fish tends to feed on settled particles accumulated at the bottom. Because Lake Tana is a polymictic shallow lake, settled particles from the lake bottom can be available for the fishin the upper water column of the lake. Frequent mixing distributes oxygen through out the water column and will enable the fish to feed at all depth in the lake including the water sediment interface. The dominance of detritus and mud in the diet of O. niloticus has been reported for the same species in Lake Langeno (Zenebe Tadesse, 1999).

It is clear that the nutritive value of phytoplankton is superior to either detritus or mud. Moreover Tilapia are known to digest the blue green algae assisted by the high acidity of their stomach that lyse the wall of the algae. However the proportion of algae in the diet of O. niloticus is low compared with detritus and mud. Thus the low content of digestible protein and total organic matter in the diet of O. niloticus in most part of the year may be attributed to dominance of detritus and mud in the fish diet (Getachew Teferra at al., 2000). Thus the poor condition and allometric growth of the fish (b=2.75) may be attributed to the low quantity of food ingested by the fish (Zenebe Tadesse, 1997). Similarly, poor body condition of O. niloticus has been reported from Lake Langeno caused by the low nutrient content of the diet (Zenebe Tadesse, 1999).

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 64

In conclusion, O. niloticus in Lake Tana is a day time feeder and stops feeding in the night. The daily ingestion rate of the fish was estimated to be about 3.5% its wet body weight. The diet of O. niloticus in Lake Tana is composed of phytoplankton, detritus, mud and zooplankton. Detritus and made up the bulk of the fish diet.

Acknowledgments I am very grateful to my colleagues of the Bahir Dar University in particular Tesfaye Abera, Solomon Libsu and Getnet Bekele for their assistance during sample collection. I also thank Ato Mihret Endalew, staff of fishery research Center, Bahir Dar for sending me additional stomach samples. The financial support was provided by the Research and Publication Office of the Addis Ababa University.

References Akintude, E.A. (1982). Feeding rhythm in relation to changing patterns of pH in the gut of Sarotherodon galilaeus (Artedi) of Lake Kianja, Nigeria. Hydrobiologia 97: 179 - 184. Bajkov, A.D. (1935). How to estimate the daily food consumption of fish under natural condition. Trans. Amer. Fish. Soc. 65: 288 - 289. Balarin, J.D. and Hatton, J. (1979). Tilapia: Aguide to their Biology and Culture in Africa. University of Sterling, Scotland, 142 pp. Bourn, D.M. (1974). The feeding of three commercially important fish species in Lake Chilawa, Malawi. Afr. J. Trop. Hydrobiol. Fish. 3: 135 - 145. Elizabeth Kebede (1996). Phytoplankton in a salinity-alkalinity series of lakes in the Ethiopian Rift Valley. Ph. D. dissertation, Uppsala University, Uppsala. Fagade, S.O. (1970). The food and feeding habits of Tilapia species in the Lagos Lagoon. J.Fish Biol. 3: 151-156. FAO (2007). Food and Agricultural Organization Technical Report Series. Getahcew Teferra (1987). Food, nutrition and digestive efficiency in Oreochromis niloticus L. (Pisces: Cichlidae) in Lake Awassa, Ethiopia. Unpubl. Ph.D. dissertation, University of Waterloo. Geatchew Teferra (1989). Stomach pH, feeding rhythm and ingestion rate in Oreochromis niloticus L. (Pisces: Cichlidae) in Lake Awasa, Ethiopia. Hydrobiologia 174: 43 - 48. Getachew Teferra (1993). The composition and nutritional status of the diet of Oreochromis niloticus in Lake chamo, Ethiopia. J. Fish Biol. 42: 865-874.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 65

Getachew Teferra and Fernando, C.H. (1989). The food habits of an herbivorous fish (Oreochromis niloticus Linn). in Lake Awassa, Ethiopia. Hydrobiologia 174: 195- 200. Harbott, B.J. (1975). Preliminary observation on the feeding of Tilapia nilotica in Lake Rudolph. Afr. J. Trop. Hydrobiol. Fish. 4: 27 - 35. Komarek, J.1989. Modern approach to the classification system of Cyanophytes 4- Nostocales. Arch. fur Hydrobil. Suppl. 82: 247-345. Lauzzane, L. (1978). Etude quantitative de l’alimentation de Sarotherodon galilaeus (Pisces: Cichlidae) du lac Tchad. Cah. ORSTOM, Ser. Hydrobiol. 12: 71 - 81. LFDP 1996. Lake Fisheries and Development Project Fisheries Statistical bulletin, No 2, FRDD,MOA. 1-35 pp. Moriarty, D.J.W.(1973). The physiology of digestion of blue-green algae in the cichlid fish Tilapia nilotica . J. Zool. Lond. 171 : 25-39. Moriarty, D.J.W. & Moriarty, D.J.W. (1973). Quantitative estimation of the daily ingestion of phytoplankton by Tilapia nilotica and Haplochromis nigripinnis in Lake George, Uganda. J. Zool. 171: 15-23. Prescott, G.W. (1970). How to know the fresh water algae. W.M.C. Brown. Dubuque. Iowa. 848 pp. Shibru Tedla (1973). Freshwater Fishes of Ethiopia. Haile Selassie I University, Addis Ababa 101 pp. Tudorancea, C., Fernando, C.H. and Paggi, J.C. (1988). Food and feeding ecology of Oreochrmis niloticus (LINNAEUS, 1758) jueniles in Lake Awassa (Ethiopia). Arch. fur Hydrobiol. Suppl. 79: 267-289. Whyte, S.A. (1975). Distribution, trophic relationship and breeding habits of the fish populations in a tropical lake basin (Lake Bosumtwi, Ghana). J. Zool. Lond. 176: 25 -26. Yirgaw Teferri (1997). The condition factor, feeding and reproductive biology of Oreochromis niloticus Linn. (Pisces: Cichlidae) in Lake Chamo, Ethiopia. Unpublished M. Sc. thesis, Addis Ababa University, 81 pp. Zenebe Tadesse (1988). Studies on some aspects of the biology of Oreochromis niloticus L. (Pisces: Cichlidae) in Lake Ziway, Ethiopia, Unpublished M.Sc. thesis, Addis Ababa University, Addis Ababa 78pp. Zenebe Tadesse (1997). Breeding season, fecundity, length-weight relationship and condition factor of Oreochromis niloticus L. (Pisce: Cichlidae) in Lake Tana, Ethiopia. SINET: Ethiop. J. Sci. 20: 31 - 47.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 66

Zenebe Tadesse (1999). The nutritional status and digestibility of Oreochromis niloticus L. diet in Lake Langeno, Ethiopia. Hydrobiologia 417: 97 - 106. Zenebe Tadesse and Getachw Teferra (1998) Diel feeding rhythm and assimilation efficiency of Oreochromis niloticus L. (Piscea: Cichlidae) In Lake Ziway, Ethiopia. Verh. Internat. Verein. Limnol. 26: 2324 - 2328.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 67

Development of small scale fish farming: for livelihood diversification in North Showa zone, Amhara Regional State.

Yared Tigabu 1*, Fasil Degefu 1, Aschalew Lakew 1 and Gashaw Tesfaye 1 1Ethiopian Institute of Agricultural Research – National Fisheries and Other Aquatic life Research Center, P. O. Box: 64, Sebeta, Ethiopia. E-mail: [email protected] , *Author to whom all Correspondence should be addressed.

Absract: Aquaculture is the rational cultivation of aquatic organizms in a confined water area where the practice of both agriculture and animal husbandry are applicable. The predominant type of aquaculture activity in Ethiopia is the culture based fishery that involve enhancement of the natural fish biomass in multipurpose small water bodies. The other types of fish culture practices, such as pond, cage and integrated aquaculture-agriculture farming systems using the preferred fish species are recently emerging. Therefore, present study aims at identifying the potential small water bodies which are suitable for aquaculture development and initiate fish culture practices in the zone so as to improve the livelihood of the society. The study was conducted from September 2004 to August 2008 in Northern Showa Zone, Amhara region and covered three administrative woredas including Basona Worana, Kewet and Efratana Gdem. Both secondary and primary data were used in this study. The study included survey of existing water bodies, water sample collection and laboratory analysis, fish stocking and monitoring of fish growth. Fingerlings of Nile tilapia and tilapia zilli were stocked with a stocking density of 2 fish/ m2and harvested 182 kg fish after eight months. By using the pond water and mud the local farmers achieved producing vegetables and seeds of trees which gave them revenue of 1500 birr in one season from 250 m 2 area plot of land. Through integration of fish farming with agriculture the farmers has got an improvement in all indictors of sustainability including net income, resource management and number of cultured and utilized commodity. The study result also indicates that properly designed rural aquaculture technology can help to achieve social development, environmental sustainability and improve livelihoods of the society.

Key words : aquaculture; cage culture; fish species; integration; pond; stocking

Introduction Aquaculture is the rational cultivation of aquatic organizms in a confined water area where the practice of both agriculture and animal husbandry are applicable. The soil and

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 68 water management aspect of fish culture practice involves application of organic (manures) and inorganic fertilizers for the production of microscopic plants, the phytoplankton, which makes it basically similar to agriculture while fish husbandry such as feeding, breeding and health care is more or less similar to a livestock farming system (FAO, 1992).

Agriculture plays an over whelming role in the national economy of Ethiopia by providing livelihood for about 85% of the rural population. The sector provides 70% of the raw materials to agro-industries and contributes 90% to the national foreign currency earnings (MoA, 2001). Therefore, most development efforts should primarily be aimed at increasing the income of the rural people so as to ensure food security and meet basic needs of farmers. As a result, the government of Ethiopia adopted the Agriculture Led Industrialization (ADLI) Strategy which aims at improving agriculture and rural centered economic growth.

Aquaculture in Ethiopia remains a promising potential than an actual practice despite the fact that the country’s physical, environmental and socio-economic conditions support its development. The predominant type of aquaculture activity in the country is the culture based fishery which is a form of extensive aquaculture conducted in small water bodies (reservoirs). These water bodies would not be able to support a subsistence fishery due to a lack of adequate natural recruitment of suitable species. So, it relies entirely on the natural productivity of the water body for growth, and artificial stocking for recruitment. Man made water bodies, not built for fishery/aquaculture purposes but often built for irrigation or hydropower generation can be used for this purpose. The other types of fish culture practices such as pond culture, cage culture and integrated aquaculture- agriculture farming systems using the desired type of species are recently emerging. The basic principle of integrated agriculture-aquaculture system (IAA) is to grow fish in water bodies that are closely integrated in to the resource flows of all the diverse activities on a farm. The aim is to convert agricultural waste and manure into high quality fish protein and use the nutrients generated in the ponds as fertilizers for growing plants which reduce the need for off-farm inputs using on-farm resources through recycling (ICLARM, 2000). Research findings also revealed that fish can be used as effective biological control for weed and pest management and reduce the use and effect of chemicals to the environment.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 69

In Ethiopia, despite its economic importance and huge untapped potential, the fishery sector remains less developed in many cases. The role of fishery and aquaculture in reducing poverty and alleviating food insecurity at household level is enormous. Fish and fish products are very important source of protein and fat (poly unsaturated fatty acids) which has a very high degree of digestibility and wide variety of vitamins including vitamins A and D and minerals such as phosphorus, magnesium, selenium, iodine. However, most of the Ethiopian diets are dominated by carbohydrates derived from cereals, which have low protein and thus, eating fish along with cereals can certainly eliminate the protein deficiency diseases that presently affecting many people. Apparently, the socioeconomic importance of small scale fisheries in reducing malnutrition by supplying high quality animal protein and generating cash income for the rural communities are recently well recognized and attempts are being made to promote and develop the subsector both at farmers and commercial levels.

The demand for fish especially in major cities including the capital Addis Ababa has been raised sharply. The high population growth rates and demographic shifts towards urbanization suggest that demand for fish will continue rising. Current per caput fish production for the national population is as low as 280 grams per year. The current fish production is estimated at 15000 tons. Despite this, taking only the population factor into account, national per caput demand for fish per person is estimated at one kilo (MoA, 2002). This is equivalent to over 80,000 tons of fish every year. The gap between supply and demand could be filled by introducing improved aquaculture technologies. Fish stocking after a through scientific study is very important to improve the supply of fish in areas where supplies are limited. In Ethiopia, the first fish stocking took place in 1925 (Bazzi, 1955, cited by Shibru and et., al , 1981) and tilapia and carp species are the most transferred and introduced fish species in the country.

The Amhara development association (ADA), Bureau of Agriculture and Rural Development and different NGO’s are actively involved in the establishment of reservoirs and small water bodies for irrigation agriculture development. Such reservoirs, in addition to their importance for irrigation could also provide potential for aquaculture development. Therefore, fish production from these water bodies is a supplementary product that can be reaped from the water resource development programs of the region in particular and the country at large.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 70

Although many of these waiter bodies have been stocked by the National Fisheries and Other Aquatic Life Research Center a decade ago, the status of those stoked water bodies and their socio-economic benefits are not well known. Thus, the present study aims at assessing the status of stocked water bodies, identify the potential ones for future development and to asses the success/ failure of aquaculture research and development practices in North Showa Zone, Amhara Regional State.

Materials and methods Survey of water bodies: A survey was carried out from September 2004 to August 2005 in Northern Showa Zone, Amhara Regional State and covered three administrative Woredas (Basona Worana, Kewet and Efratana Gdem). Both secondary and primary data were used and secondary data was collected from various sources through the reviewing of existing information, including reports and documents from the regions and federal agricultural offices. Semi-structured questionnaires were used with key informants from the communities, government agencies and nongovernmental organizations (NGOs).

Water sample collection and analysis: Physico-chemical variables were recorded from 10 cm below the surface water. Accordingly, dissolved oxygen (DO), pH, specific conductivity and water temperature were measured in-situ using a multi-probe (Model HQ40d, HACH Instruments). Water transparency (vertical visibility) was estimated using a standard Secchi disc of 20 cm diameter and calculated as the average depth at which the Secchi disc disappeared when lowered, and at which it reappeared when raised (Boyd, 1990). Water temperature was measured using a thermometer at 0.5 meter depth interval. Water samples for estimation of the relative abundance of the different taxonomic groups of the phytoplankton and zooplankton community were collected with plankton net of 30 and 100 µm mesh size respectively. The samples were immediately preserved in 5% formalin until the samples examined in laboratory. The samples were examined with a compound microscope and the identification of phytoplankton to the genus or the species level was made using different identification keys including those of Whitford and Schumacher (1973), Talling (1987) and Willen (1991).

Fish stocking to water bodies and data analysis: After studying the suitability of the water bodies for fish culture, stocking of fish to reservoirs and ponds was held from October 2005 to September 2006. The stocked fish species in reservoirs were Nile tilapia (Oreochromis niloticus ), tilapia zilli (Tilapia zilli ), common carp (Cyprinus carpi o) and

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 71 crucian carp ( Carassius carassius ). The sources of the fish were Koka and Gefersa reservoirs and Sebeta National Fisheries and other Aquatic Life Research Center. The average weight of stocked Oreochromis niloticus and Tilapia zilli were 12g while, the average weight of stocked Cyprinus carpi o and Carassius carassius were 20g.

Fingerlings of Nile tilapia ( Oreochromis niloticus ) and tilapia zilli (Tilapia zilli ) collected from Sebeta hatchery ponds were stocked at a stocking density of 2 fish m -2 to the ponds and 100 fish per cage in cages. The initial weight, length and number of the stocks were recorded for all cages and ponds. Fifty percent of fish from cage and ponds were sampled randomly using a seine net every month until the end of the culture period. The fish length and weight were measured to the nearest 0.1cm and 1g respectively. Body weights were measured using electronic balance and total length was measured using measuring board. At the end of the experiment, the fish were harvested and counted, and the weight and length of all the fish were measured. Growth performances of fish were also determined and calculated as described by Sveier, et., al . (2000) as follows:

Final weight (g) − Initial weight (g) Daily Growth Rate (DGR) in g/day = Culturing days

Pond and Cage preparation and management: Before the experiment, ponds were drained and renovated, aquatic vegetation removed and frog and macro-fauna eradicated. All ponds were treated with lime (Caco 3) at a rate of 250 kg/ha and filled with water seven days before fertilization. 1200 kg per hectar of decomposed compost of cattle manure and plant material were applied to all ponds one week before stocking. 12 kg of compost filled in a jute sack, for every 100 m 2 pond size, were hanging at the water inlet side of the pond. The compost was changing monthly. Tilapia species with a stocking density 2 fish per m 2 were stocked in the ponds. Feed from wheat bran and oil seed cake was offered to the fish at 2% of the body weight. Feeding rates per pond were adjusted monthly after weighting a minimum of 50% of the fish stocked. The cage was made up of a net wall fixed with a nylon plastering material along the edge length wise and a plastic tube that serves as float and sink of the cage. The total area of the top part of the cage was 1.6 m by 1.6 m and tapers to 1.2 m by 1.2 m at the bottom. The lower tube contains holes that allows entry of water and makes the tube to sink while the upper tube is sealed water proof for floating the cage. The cage was easily folded and transported by

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 72 one or two persons easily. A typical plot consisted of the pier or walk way (made up of wood) to which the cages are attached and fixed. The numbers of cages attached to the pier was nine and 100 fingerlings of Nile tilapia (Oreochromis niloticus ) were stocked on each cage. Fish in the cage were feed wheat bran and oil seed cake at 5% of the body weight. Feeding rates per cage were adjusted monthly after weighting a minimum of 50% of the fish stocked. After eight months the fish were harvested and sold in the market.

Results and discussion The two aquaculture technologies were disseminated in different Woredas of North Showa Zone. These are culture-based fishery and integrated pond aquaculture- agriculture farming system. In addition, Cage culture technology was also introduced in Efratana Gidem Woreda. By doing so, it was possible to increase productivity of the water resource and diversity of production for local community.

Efratana Gidem Woreda: In this Woreda, two kebeles (Yemlo and Mulo) were selected and both technologies mentioned above were introduced to the local communities. Yemlo kebele is located at an altitude of 1585 m. a. s. l. which is 283 Km away from Addis Ababa. In this kebele integrated agriculture- aquaculture farming system in pond culture and cage culture were introduced. Three small ponds with an area of 130, 140 and 250 m2 were constructed by the save the children, NGO, in 1985 (Field Report, 2001). The ponds were constructed for the then Yimlo farmer’s producer cooperative. The source of the water for all ponds is a nearby spring where very high quality water emerges and irrigates the adjacent farm lands. Fingerlings of Nile tilapia and tilapia zilli were stocked with a stocking density of 2 fish/ m 2and harvested 182 kg fish after eight months. By using the pond water and mud the local farmers achieved producing vegetables and seeds of trees which gave them revenue of 1500 birr in one season from 250 m 2 area plot of land. From the ponds they sold 182 kg of fish in eight months. Through integration of fish farming with agriculture the farmers has got an improvement in all indictors of sustainability including net income, resource management and number of cultured and utilized commodity. The overall horticulture production increase, fish and vegetables enrich the household diet and provide income generation. This integrated farming system is known as integrated agriculture- aquaculture farming system (IAA). It is a system in which physical and biological resources on a farm are integrated in order to give a higher production than would be generated by the individual farming sub systems independently.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 73

Experience of different countries also has shown that in IAA farming system in Zomba district, Southern Malawi, where IAA farming system is practiced, IAA farms produce almost six times the value generated by the typical small farmer. The integrated pond- vegetable garden of IAA farms generated 72% of the household income. On a per unit area basis, the vegetable/ pond resource system generated almost US$ 14/100 m 2/yr compared to $1-2 for the crop and home stead (Brummet and Noble, 1995).

In this kebele (Yemlo) there was a large but incomplete earthen pond with an area of 7500 m 2. The farmers’ cooperative owns the pond and has done no attempt to complete and utilize the pond. After discussion with the representative of the Woreda agricultural office and members of cooperatives, the National Fisheries and other Aquatic Life Research Center designed the structure and completed the pond and made ready for fish culture. We stocked some 15000 fingerlings of Nile tilapia and Tilapia zilli . The stocked fish successfully adapted the area and fish production started after a year. When a project entitled “Integrating BOMOSA cage fish farming system in reservoirs, ponds and temporary water bodies in Eastern Africa” was launched in 2007, the site was selected as integral part of the project and started cage culture in 2008.

Fish growth: The growth of Nile tilapia in pond and cage culture was studied in Yemlo Kebele. The survival rates in ponds were better than cage system. Other growth paramers including daily growth rate and total harvest (yield) is given in Table 1.

The other kebele selected for dissemination of the fish farming technologies in the same Woreda is Mulo kebele. It is located in an altitude of 1550m a. s. l, which is 280Km from Addis Ababa. Here culture based fishery is introduced. According to information obtained from the Woreda Bureau of agriculture the area where the Mulo reservoir created was selected for dam construction in 1990 for irrigation purpose. However, the dam construction was aborted after excavating of a huge area of land for water collection which then created the current wetland which is known as locally Mulo reservoir. Spring water and flood during rainy season are the major source of water to the reservoir. A visual estimate of the surface area of the water at the time of survey would be 30 hectares. The area at the end of the wet season could extend up to 60 hectares according to some key informants. In 2005, the research center stocked 20,000 fingerlings of O.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 74

Table 1: Growth performance of Nile tilapia raised under cage and Integrated pond culture condition for 240 days . Cage Integrated Parameters Initial Final Initial Final Mean Weight (g) 38.43 ± 0.57 220.43 ± 0.53 38.12 ± 0.38 208.71± 0.32 Mean length (cm) 12.7 ± 0.6 21.0± 0.1 12.6± 0.2 20.5± 0.4 Daily growth rate (g d -1) 1.04 0.87 Total weight gain (kg/cage) 22.43 Total net yield (kg area -1 y-1) 38.45 Survival rate (%) 82 90 Weight of feed (kg) 164,351 156,472 Stocking density 1100 fish/cage 2 fish/m 2 niloticus and T. zilli . The stocked fish species are successfully adapted the area. During our experimental trial O. niloticus and T. zilli, size ranging from 12 to 38 cm, were caught. The weight of O. niloticus and T. zilli caught in our trial sampling varied from 20 g to 320 g. Some farmers are already started fishing by using locally made hooks. Currently, the Woreda bureau of agriculture is working on to organize and train unemployment youths and make them beneficiary from the resource.

The fish farming practice in this Woreda proven the importance of diversification of agricultural activities, as it contributed towards income generation and food security at household level. Integration of aquaculture with agriculture promoted better utilization of available land and water resources. For land limited farmers’ intensification of land use could be the most important strategy to increase agricultural production. It is a good entry point for diversification of income generating activities and stabilizes the livelihood of poor and improves their nutritional status. Farmers who started fish farming benefited from direct contribution of fish through having food for home consumption in addition to cash income from the sales of fish. In this study, the beneficiaries witnessed that their children have got better nutritional status than others counter parts in the area.

Basona Worana Woreda: In this Woreda, four sites (Bakelo kebele, ILRI campus (Debrebrhan), Ataklti kebele and Anguamesk) were assessed. Bakelo Kebele is located at an altitude of 2810m a. s. l and 142Km away from Addis Ababa. There are three

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 75 completed earthen ponds in this kebele. The first one is the one which is located in seed multiplication center of the Woreda bureau of agriculture, which is used for irrigation of plots. The pond has an area of 150 m 2. Integrated fish farming was introduced and stocked 300 fingerlings of common carp (Cyprinus carpi o) and crucian carp ( Carassius carassius ). The other two ponds are farmers owned ponds which are constructed by the farmers themselves. Each pond has an area of 100 m 2 and stocked 400 fish in both ponds. Another three ponds were under construction in this kebele. All constructed ponds are intended for fish farming purpose and they are part of the Woreda’s plan for aquaculture development.

International Livestock Research Institute (ILRI) campus located in Debre Brihan town at an altitude of 2760m a. s. l and 122 km away from Addis Ababa. There are three earthen ponds in ILRI campus and here also integrated agriculture- aquaculture farming system was introduced. The ponds were apparently constructed for water utility purposes like for water conservation and drinking water supply for animals. The three ponds have an area of 2000, 2500 and 3500 m 2. We were informed by the local people and some 3000 fingerlings of common carp were stocked in 1991. We have conducted experimental fishing by seine net and caught a total of only 45 fish with a weight range of 50 – 62 g from two ponds. We restocked additional 1800 fingerlings of common carp in October 2006.

Ataklti kebele is the third kebele in this Woreda. It is located at an altitude of 2770m a. s. l and 133Km away from Addis Ababa. Here unlike the other two sites, culture based fishery was introduced. Staffs of the Woreda agricultural bureau informed that Washa- wenze dam has an area of about 10 hectares, and a water holding capacity of 560,000 cubic meter water. There is a small river flowing down in to the dam but the major source of water is flood during the rainy season. The preliminary survey report by the region agricultural bureau (BoA, 2001) stated that the dam was built in 1987 by NGO, the Lutheran World Federation, for irrigation purpose. Four fish species: Common carp, Crucian carp, Nile tilapia and Golden carp were stocked in 1988 (MoA, 1989). Members of the then farmers association were trained and fish production was initiated afterwards. The harvested fish has been sold (marketed) to Debre Brihan town until the breakdown of the cooperative in 1993. In 2006, we have conducted experimental fishing using different mesh size four gillnets and one beach seine and were able to caught only 68 fish with a three days consecutive trial. According to the information from the local

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 76 people, a lot of fish has been washed away through the water outlet of the dam. The water outlet pipe locker is broken and the water level in the dam is decreasing from day to day. Immediate action should be taken to maintain the outlet system. During experimental trial common carp and crucian carp , ranging in size from 25 to 45 cm (fork length) were caught. The weight of common carp and crucian carp caught in our trial sampling varied from 248 g to 1850 g. We restocked additional 4200 fingerlings of common carp in October 2006.

Angua-mesk is the forth kebele in this Woreda where culture based fishery was introduced. It is located at an altitude 2750 m. a. s. l and 148 Km away from Addis Ababa. The then regional commission for Sustainable Agriculture and Environmental Rehabilitation Office (SAERAR) built this dam in this area. The dam has an area of 100 hectare and it has a maximum depth of 9 m. The construction was completed in 2005. In addition to the prime objective for irrigation scheme, the reservoir has huge potential for fish production using culture based fishery without incurring much cost for culture operation. Therefore, production of fish by undertaking fish stocking in this water body is a secondary advantage that can be reaped from the reservoir. The reservoir is feed by small river called River Debit but the major source of water is flood during the rainy season. In 2007, the center stocked 8000 fingerlings of tilapia species and 38 adult fish of common carp species.

Physico-chemical parameters: The values of physicochemical parameters like water temperature, pH, DO and Conductivity of five selected areas of North Showa zone are given in Table 2. Among the sites, the pH of water bodies in Yemlo and Mulo kebele is higher than the other sites.

Phytoplankton community: Four phytoplankton groups were identified during the sampling periods (Table 3): Chlorophyta, Bacillariophyceae, Cyanobacteria, and Dinophyta. The highest taxa number was observed in the Chlorophyta (7 genera) followed by Cyanobacteria (3) and Bacillariophyceae (2) whilst Dinophyta was only represented by one genera. The most frequently observed taxa in the ponds and reservoir were Melosira sp . followed by Pediastrum simplex. Generally the species composition was more or less similar throughout the ponds during the sampling periods.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 77

Table 2: Physico-chemical parameters in five sites during the sampling periods in North Shoa Sites Parameters Angua ILRI Mulo Yemlo Washa Mesk (campus) Water Temperature ( oc) 15.37 25.30 23.76 15.81 16.24 pH 8.34 9.22 9.08 7.89 8.16 Conductivity (µs/cm) 231 278 283 168 174 DO (mg/l) 8.13 9.80 9.45 8.37 8.06 Secchi depth (cm) 58 49 53 56 61 Euphotic depth (cm) 174 157 159 168 183 Altitude (m) 2750 1550 1585 2770 2770

Table 3: List of phytoplankton identified from five sampling sites in North Shoa

Phytoplankton group Species Chlorophyceae (Green algae) Staurastrum sp. Chlamydomonas sp. 1 Chlorella sp. 3 Scenedesmus quadriquada 2 . Pediastrum simplex 2 Pediastrum duplex 2 Pediastrum biwae 2 Bacillariophyceae (Diatoms) Melosira 1 Synedra sp. Cyanophyceae (Cyanobacteria) Anabae na sp. 1 Anabaenopsis sp. Microcystis sp. 1 Dinophyta Peridinium sp. 3 1Dominant 2Most dominant 3Rare occurrence

Zooplankton Abundance and species composition: Zooplankton from the fish ponds and reservoir included a total of 12 taxa with Rotifers being the richest group comprising 7

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 78 taxa distributed in 4 genera (Table 4). Cladocerans were represented by 2 taxa (2 genera) and copepods by 3 taxa (2 genera). During the sampling periods, Rotifers contributed most to the total abundance followed by copepods and cladocerans.

The central highland plateau agro-ecology of the zone (Basona Worana and Gerakeya woredas) which have an altitude of more than 2500m a. s. l could be appropriate for all year round farm of cold water species including trout and carp. These areas benefits from a high water runoff which authorize rain fed or stream diversion supplied ponds. The low land agro-ecology of the zone (Kewet and Efratana Gdem woredas) offer ideal temperature for warm water species such as tilapia and cat fish. Spring waters and rivers are the major source of water supply to the ponds in these areas

Table 4: Zooplankton taxa identified from five sampling sites in North Shoa

Copepods Cladocerans Rotif ers Copepoda sp. Ceriodaphnia sp. Brachionus calycyflorus Nauplii 1 Daphnia pulex Brachionus caudatus 1 Meso Cyclops Polyarthra vulgaris 2 Brachionus angularis Asplanchina sp. Keratella sp. 1 Keratella tropica 1Dominant species 2Rare occurrence

We have stocked more than 30200 fingerlings of tilapia and 10500 carp species to different parts of the zone. Farmers and unemployed youths who are organized in cooperative, started fishing activities and became beneficiaries from fish farming in Efratana Gdem woreda, Yimlo and Mulo kebele. In the near future hundreds of farmers will be beneficiaries from stocked water bodies both from highland and low land agro ecology areas of the zone. The lists of potential small water bodies and recommended interventions are given in Table 5.

Major constraints that have contributed to the slow development of aquaculture in the zone include inadequate knowledge of how to raise and manage the fish, limited supply

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 79 of high quality fish seed, lack of cheap and high quality diets, lack of co-ordination between offices dealing with water utilization, weak linkage between research and extension, geographic location of fish farming potential areas, and inadequate extension services. Another major problem for cage culture is the lack of locally made and thus affordable equipment.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 80

Table 5: Identified water bodies for fish culture where all were taken by farmers as positive and of high interest areas for sustainable farming.

Name of Area developed Activities implemented Action to be taken Potential cultural type locality Yimlo 4 ponds (130, 140, Fishing is started Follow up closely IAA and cage 250 and 7500 m 2) Mulo Reservoir (30 ha) Fish stocked & fishing is Organize farmers and follow IAA and culture based capture partially started up closely fishery Washa- Reservoir (10 ha) Fish stocked and fishing was Reorganize farmers and Cage, IAA & culture based capture wonz started reinitiate fishing fishery Anguamesk Reservoir (100 ha) Fish stocked Organize farmers and Cage, IAA & culture based capture maintenance fishery ILRI campus 3 ponds (2000, 2500 Fish stocked Organize farmers and follow Cage and IAA ponds & 3500 m 2) up closely Bakelo 5ponds (100 m 2 each) Fish stocked Organize farmers and follow Cage and IAA up closely Keyet Pond (100 m 2) advice to farmers and Stocking and training IAA extension agents Wsha Pond (500 m 2) advice to farmers and Stocking and training IAA wshigne extension agents Kewet Jowha and robit river advice to farmers and Promoting pond construction IAA extension agents

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 81

Summary of lessons learnt: • Fish farming can make significant contribution to nutrition, food security and livelihoods in rural areas. • There are wide opportunities for the farmers to integrate fish culture with other farming system. • Key stakeholders (farmers, researchers, extension agents etc.) should participate at all stage of the process. • Research results obtained by farmers’ research group (FRG) on farmers owned farm or in the locality are better adopted. • A farming systems approach should hold promise for the development of low cost aquaculture for rural farmers.

Conclusion The zone has both highland and low land agro-ecologies. Their temperature characteristics give possibility to produce both cold and warm water fish species. As the zone has a great potential for aquaculture development attention should be given to these small water bodies as a source of increased fish supplies and for the benefit of rural communities living in the vicinity of these water bodies. Those water bodies are suitable for different fish culture techniques such as cage, culture based capture fishery and integrated agriculture-aquaculture system. The study indicates rural aquaculture can help achieve social development and environmental sustainability. The lessons learnt from this study will help to guide future research and development strategy. The nature of aquaculture and its positive social and environmental attributes make it an attractive entry point to improve the livelihoods of the poor in rural development programs. These include its exceptional nutritional characteristics to alleviate under nutrition, relatively high value and marketability to generate income, and the prospects it offers of agricultural diversification through construction of ponds and reservoirs. There is a need to raise awareness of the large potential contribution of fish culture to all stake holders including the community,

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 82 agricultural officers and policy makers. Only then would its potential to contribute to food security and poverty alleviation can be realized.

Acknowledgements We are very grateful for staff of Efratana Gidem Woreda Bureau of Agriculture and Rural Development particularly to Mr. Legesse Endayilalu and Mr. Abayneh Tiruneh for their unreserved support during the field work. We are also indebted to Mr. Tegene Seifu, a staff member of North Showa zone bureau of agriculture for his valuable support during the survey of the water bodies.

References BoA (Bureau of Agriculture) (2001). Field Report . Bureau of Agriculture, North Showa zone, Debrebrhan, Ethiopia. Boyd C. (1990). Water quality in ponds for Aquaculture . Alabama Agriculture Experiment Station, Auburn University, Alabama, USA. FAO (Food and Agricultural Organization) (1992). Fish culture in undrainable ponds. A manual for extension. FAO Fisheries Technical Paper 325 :239p. ICLARM (2000). Focus For Research. February 2000 vol. 3, NO. 1. MoA (Ministry of Agriculture) (1989). Annual Report of Ministry of Agriculture . Addis Ababa, Ethiopia. MoA (Ministry of Agriculture) (2001). Annual Report of Ministry of Agriculture . Addis Ababa, Ethiopia.. MoA (Ministry of Agriculture) (2002). Fish utilization and marketing in Ethiopia . Ministry of Agriculture of Ethiopia. Addis Ababa. Shibru Tedla and Fisseha Haile Meskel (1981). Introduction and transplantation of fresh water fish species in Ethiopia. SINET: Ethiop. J. Sci . 4(2): 69-72. Sveier H., Raae A. & Lied E. (2000). Growth and protein turnover in Atlantic salmon ( Salmo salra L.,), the effect of dietary protein level and protein particle size. Aquaculture 185 : 101-120.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 83

Talling J. (1987). The phytoplankton of Lake Victoria (East Africa). Archive fur Hydrobiologie . 25: 229-256 Welcomme R.L. (1988). International Introductions of Inland Aquatic Species. Rome: FAO Fisheries Technical Paper 294, 318pp. Whitford L. & Schumacher G. (1973). A Manual of Fresh water Algae . Sparks press, Raleigh. NC, USA, 323pp. Willen E. (1991). Planktonic diatoms-an ecological review. Algological studies . 62: 205-215.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 84

On station evaluation of fish offal fertilizer on Tomato and Onion

Alemu Lema 1 and Abera Degebassa 2 1,2 Zeway Fisheries Resources Research Center Zeway, Ethiopia P.O. Box 229; [email protected]

Abstract: Fish offal fertilizers are excellent sources of nutrition for soils and plants as fish contain the full spectrum of nutrients found in the planets waters. Plants rapidly respond to and grow vigorously when regularly fertilized with fish fertilizers. The effects of inorganic fertilizer, fish offal fertilizer and manure on the marketable yield and other parameter for tomato Malka shola variety (Lycopersicon esculentum), and Adama red (Allium cepa) were examined using randomized complete block design with three replication at Zeway Fisheries Resources Research Center. The result shown that there is significant difference (P < 0.05) in tomato height at first harvesting with the maximum height 80.33± 3.97cm for T 2 (tomato treated with fish offal fertilizer) and marketable yield in quintals with the maximum yield 721.21 ± 48.10 Quintals per hectare. The maximum numbers of marketable fruits per plots were collected from plots treated with fish offal fertilizer during the 7 th harvesting. There is no significance difference (P > 0.05) in bulb size, bulb diameter and marketable yield for Adama Red. There is significant difference (P < 0.05) in Bulb weight for Adama red Onion with the maximum Bulb weight was 112.51±16.40 g recorded from plots treated with inorganic fertilizers. There is no significance difference in (P> 0.05) unmarketable yield in both vegetables. Fish offal fertilizer prepared from the waste materials of fish can provide readily absorbed nutrient for growth and supply nutrient to plant in balanced form. Plants fertilized with fish offal fertilizer grew worse than those fertilized with chemical fertilize at earlier stages. Fish offal fertilizer boost the production at the later age and can be used as an alternative chemical fertilizer for tomato.

Key words: Fish offal fertilizers, Inorganic fertilize, Manure, Onion and Tomato

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 85

Introduction The use of fish as fertilizers dates back to at least the era of the pyramids in Egypt where farmers and homesteaders utilized the carcass and liquids from fish harvested from the Nile to provide important fertility to their crops. More recently North American Indians in the 16 th century were observed placing whole fish into the soil beneath crops of corn and squash (Eco nutrients, inc). The early agriculturalist learned that all types of fish provided excellent results when used as fertilizers for their crops. Farmers all over the world have and continue to use fish as important source of fertilizer. Historically fish was used both whole as caught as well as the portions left over from processing the catch. Today the majority of fish fertilizers are produced from otherwise waste fish and processing by products of ocean and fresh water fish harvesting. Modern fish fertilizers effectively recycle fertility otherwise would be wasted and disposed in landfills.

The N-P-K percentage of Fish offal fertilizer is 10-6-2 (Gaskell M, 1999). Nitrogen, phosphorus and potassium are the major plants nutrients. Fish fertilizers are excellent sources of nutrition for soils and plants as fish contain the full spectrum of nutrients found in the planets waters. Plants rapidly respond to and grow vigorously when regularly fertilized with fish fertilizers. Fish fertilizers contain significant quantities of protein Nitrogen as well as a healthy balance of all 18 nutrients known to be significant for crops growth . All of these mineral nutrients are in protein chelated forms, which are usable by the crops and additionally are resistant to loss from leaching. Fish also contains more than 60 other trace minerals (Harris R, 1994) which have positive effects on soil biology and crop health. Fish fertilizer is suitable for all fruits, flowers and vegetables with foliar or soil application and stimulates organic activities in the soil, releasing nutrients to encourage natural health growth, rapid break down of crop residue, increased biological activities nutrient release in the soil, less pest and soil diseases through balanced soil biology , improved efficiency of other fertilizer. Compared to synthetic fertilizer, organic fertilizer contains relatively low concentration of actual

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 86 nutrients, but they perform important functions which the synthetic do not. They improve the physical structure of soil which allows more air to get into plants roots. They increase bacterial and fungal activity in the soil. Organically derived fertilizers do not leach from the soil making them less likely to contribute to water pollution than synthetic fertilizers (Econutrients, inc). So, greater effort is needed to promote less polluting fertilizer and the use of alternative source of fertilizer is indispensable. The objective of the study was to compare growth response and yield of tomato and onion cultivated using fish offal fertilizer, inorganic fertilizer and manure.

Materials and methods Description of study area: The field experiment was conducted at Zeway Fisheries Resources Research Center, 160km south of Addis Ababa starting from January 2009 to July 2009 under irrigation condition. The center is located at an altitude of 1636 meter above sea level. The average rainfall of the area is about 688mm and its maximum and minimum temperature is 27 0c and 14 0c respectively.

Preparation of fish offal fertilizers: Fish offal, fish visceral, head, trimmings and intestine of Nile Tilapia ( Oreochromis niloticus ) was purchased from Fish production and Marketing Enterprises of Zeway. The offal was cooked in 50kg cooking capacity barrel. Cooked product was left over night to settle in the barrel to separate the oil, water and solid components. Press liquor is pressed out from press cake by pressing. The press cake was spread on the laminated tin and dried in open air for 3- 5 days based on the weather condition (Abera Degebessa et al, 2008 ). Generally the procedure followed was; cooking, pressing, drying, finally the dried press cake was ground at Debrezeit Agricultural Research center.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 87

Fig. 1. Fish offal fertilizer prepared from Oreochromis niloticus

Preparation of Nursery: Appropriate seed variety of Malka shola (Lycopersicon esculentum ), and Adama Red (Allium cepa ) were collected from Adami Tullu and Melkasa Agricultural research centers based on their market demand and suitability for the contiguous environment. Seedlings were prepared on nursery bed of 1m x 5m and every 15cm intervals seed was thinly dropped using line. 75gm of DAP, was added for those nursery that latter treated with inorganic fertilizer.

Nursery transplantation: Transplantation was done after 35 days of sowing for tomato and 56 days of sowing for onion. The prepared tomato nurseries were transplanted to 3m x 4m = 12m 2 plot consisting of 3 rows 1m apart, with 39 plants per plot and spaced 0.3m apart in the row. The spacing between plots in adjacent replication was 1m. Adama Red nurseries were transplanted to 2m x 3m = 6m 2 area. Fish offal fertilizer was added to its respective plot of two weeks prior to transplantation to facilitate the rate of decomposition and watering was done soon. The nursery was planted

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 88 according to the recommended spacing that is, 40cm x 20cm x 8cm for Adama red and 100cm x 30cm for Melka shola tomato.

Agronomic practices: Standard agronomic practices such as fertilization, weeding, cultivation, staking for tomato and plant protection measures were applied during the crop period. The Vegetables were cultivated three times with 2kg (10-6-2) and 1Kg of ground fish offal fertilizer per pilot of tomato and onion respectively for pilot treated with fish offal fertilizer and 0.24 kg DAP and 0.12 kg Urea per pilot for pilot treated with inorganic fertilizer based on recommendation of Adami Tullu Agricultural Research center for both vegetables and 10kg (0.25-0.15-0.25) and 5 Kg of unfermented (fresh) manure was applied for pilot treated with manure. The amounts of fish offal fertilizer and cow manure added were based on recommendation of their nutrient contents. The plants were sprayed with chemicals like Selecron, Thionex, Ridomil, Coside and Mencozeb to control leaf disease and insect pests. watering was done three times per week until the plants were established then twice per week.

Experimental design: The experiment was conducted using randomized complete block design (RCBD) using three treatments namely inorganic fertilizer, Fish offal fertilizer and Manure replicated three times on 3m x 4m for tomato and 2m x 3m for Adama red onion. Each treatment of tomato plots contained 39 plants of tomato plants in triple rows; only three plants from the central two consecutive rows totally 6 plants from 1.8 m 2 area was used for data collection and yield was converted into hectare or 10,000 m 2. Likewise 12 bulbs of plants red from two consecutive rows with an area of 0.288m 2 Adama was used for data collection and yield was extrapolated for hectare.

Data collection: The heights of plants were measured from the ground level to the highest point at blooming stage using meter. The numbers of cluster

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 89 per plant were totally counted at physiological maturity or first harvesting. Ten clusters were randomly selected from a single plant and the numbers of fruits per cluster were counted. Weight of marketable and unmarketable fruits was measured using sensitive balance. Harvesting was carried out every four days for seven harvesting stage. The total fruit yield, marketable fruit yield and fruit number per plot were determined immediately after each harvest. Similarly, the data for Adama Red like bulb size and bulb diameter were measured using caliper and bulb weight, marketable and unmarketable yield was measured using sensitive balance during harvesting.

Statistical analysis: Data were subjected to General Linear Model of Statistical Analysis system (SAS). Means were compared using analysis of variance (ANOVA), and Least Significant Difference at P ≤ 0.05 was used to separate the means where significance differences were detected between the treatments. The results were expressed as Mean ± Standard error.

Results Malka shola ( Lycopersicon esculentum ): From Table 1 tomato heights at 1 st harvesting were significantly different at P< 0.05 with the highest height 80.3±3.9 cm was obtained from tomato treated with fish offal. From table 1 marketable yield in quintals per hectare were significantly different at P< 0.05 with the maximum marketable yield in quintals per hectare is 721.1±48.1 from plots treated with fish offal fertilizer. Even though there is no significance difference between plots treated with inorganic fertilizer and fish offal fertilizer with regards to marketable yield quintals per hectare at least there is 77.7 quintals variation between the two exists. The number of cluster per plant and unmarketable is not affected by the treatment but numbers of fruit per cluster is affected by treatment with highest value 3.55±0.1.

The maximum weight of marketable fruits (9.9 kg) was collected from 5.4m 2 at single harvesting was collected from plots treated with inorganic fertilizers

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 90 at 2 nd harvesting and the minimum weight of marketable fruits (1.06kg) collected from 5.4m 2 at single harvesting was from plots treated with manure at 6 th harvesting. The total marketable fruit harvested throughout the harvesting stage from 5.4 m 2 is 36.6834kg for plots treated with inorganic fertilizer, 42.5065 kg for plots treated with fish offal fertilizer and 23.9381 kg for plots treated with manure.

Table 1: Effects of inorganic fertilizer, fish offal fertilizer and manure fertilization on plant height, Number of cluster per plant, Number of fruit per cluster marketable and Unmarketable yield of Tomato variety; Malka Shola. (NOTE: The maximum number of marketable fruit per plot was 163 fruits collected from plots treated with fish offal at 7 th harvesting. Plots treated with fish offal fertilizer were showed delayed in maturity and was green at 7 th harvesting while tomato treated with inorganic fertilizer and manure were completely dried. The smallest numbers (31) of marketable fruits were recorded from plots treated with manure during 6 th harvesting). No. of No. of Plant fruits per Marketable Unmarketabl Total yield Ts cluster height cluster yield (Q/ha) e yield (Q/ha) per plant (cm) (NFPC) (Q/ha) (NCPP) a a a a a a T1 80.2±1.6 30.1±8.7 3.3±0.1 643.4±133.3 82.02±14.29 725.5±121.2 a a a a a a T2 80.3±3.9 29.0±2.7 3.5±0.1 721.1±48.1 105.9±31.0 826.8±43.9 b a b b a b T3 72.0±3.2 25.4±3.3 3.0±0.2 417.8±17.3 86.2±29.6 504.7±15.9 CV 6.938% 34.471% 8.31% 27.37% 44.62% 20.819% LSD 7.04 12.6 0.32 212.8 53.3 186.8 a in the same column with different letters are significantly different (P<0.05): Ts : treatmernts: T1 indicates Inorganic fertilizer treatment; T2 indicates fish offal fertilizer treatment; T3 indicates manure fertilize treatment; CV indicates coefficient of variation; LSD indicates least significant difference

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 91

Fig. 2. The number of marketable and unmarketable fruits collected from eighteen tomato plants at different harvesting stage from three plots with the same treatment (1.8m 2 x 3 = 5.4m 2)

Fig. 3. Weight of marketable and unmarketable fruit collected from eighteen

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 92 tomato plants at different harvesting stage from three plots with the same treatment (1.8m 2 x 3= 5.4m 2) The highest average fruit weight was recorded at 1 st harvesting of tomato treated with fish offal fertilizer which is 75.91 gram per fruit. The minimum average fruit weight (33.65g) was recorded from plots treated with inorganic fertilizer at 7 th harvesting. The average weight of fruit was decreased as harvesting stage proceeded for all treatments. Even though the averages weight of fruits was decreased as harvesting stage proceeded for all treatments, the average weight of fruits treated with fish offal fertilizer shows slightly constant weight as compared to other treatments.

Fig. 4. Average weight of fruits in gram collected from six plants with an area of 1.8 m 2

Adama Red ( Allium cepa ) result: From Table 2 there is no significance (P>0.05) in Bulb size, bulb diameter, marketable and Unmarketable yield of

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 93 onion treated with three different fertilizer. There is significance (P<0.05) difference in bulb weight. The maximum bulb weight in gram (112.51±16.4) was recorded from plots treated with inorganic fertilizer and the minimum bulb weight (88.24±8.816) was recorded from plots treated with manure. Even though there is no significance difference in marketable yield among the three fertilizers, highest marketable yield (391.53±48.12) per hectare was extrapolated from plots treated with fish offal fertilizer. Even if there is no significance difference (p< 0.05) in unmarketable yield the lowest unmarketable yield was extrapolated from plots treated with fish offal.

Table 2 : Effects of inorganic fertilizer, fish offal fertilizer and manure fertilization on Bulb size, Bulb diameter, marketable yield and Unmarketable yield of Onion variety; Adama Red

Bulb Marketable Unmarketable Bulb size Bulb weight Ts diameter yield yield (cm) (gm) ( cm) (q/ha) (q/ha)

a a a a a T1 5.35±0.39 5.74±0.25 112.51±16.40 364.91±42.31 197.78±97.78 a a b a a T2 5.01±0.13 5.46±0.20 89.6±9.82 391.53±48.12 56.47±2.76 a a b a a T3 5.10±0.33 5.35±0.33 88.24±8.81 315.44±22.62 125.90±41.23 CV 6.53% 6.77% 14.49% 17.15% 19.53% LSD 0.4 0.4 18.3 80.2 151.7 b In the same column with different letters are significantly different (P <

0.05); Ts : Treatments: T1 indicates Inorganic fertilizer treatment; T2 indicates fish offal fertilizer treatment; T3 indicates manure fertilize treatment

Discussions Tomato ( Lycopersicon esculentum ): The height of tomato at first harvesting was affected by the application of the three fertilizers. Tomato heights at 1 st harvesting were significantly different at P< 0.05 with the highest length were obtained from tomato treated with fish offal. This result supports the report of (Irshad Iubana et .al , 2006) the highest Mung bean and Okra was obtained from plants treated with fish fertilizers as compared to NPK and

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 94

Urea fertilizers. Fish fertilizer is a good soil conditioner and is great to use in vegetable plots because it will help in root development. Fish fertilizer help to provide complex arrays of nutrients and minerals as proven by results done in poor soil that were lacking many nutrients and minerals. Fish offal fertilizer is a natural organic fertilizer that was traditionally used by gardeners and farmers before the advent of inorganic fertilizers. Fish offal fertilizer contains important trace elements, which makes it a complete plant food. Fish offal fertilizer provides plenty of phosphorous and organic nitrogen. Studies done on peas, radishes, tomatoes, corn, straw berry, lettuce, soybeans, peppers, and others demonstrated the growth producing potential of fish fertilizer (Aung, 1984).

The lowest amounts of yield was collected from plots treated with manure is due to the slow availability of the nutrients from the manure and immobilization of Nitrogen (Tuklu Erkossa) readily released during first season. Manure has relatively little phosphate (Shankara N et .al, 2005 ). At 1 st harvesting the numbers of marketable fruits collected from plots treated with fish offal fertilizer were small as compared to plots treated with inorganic fertilizer. The tomato plants treated with fish offal fertilizer showed progressive increment in the number of marketable fruit. The number and weight of marketable fruits collected from plots treated with fish offal fertilizer was gradually increased from 1 st harvesting to 7 th harvesting in relative to plots treated with inorganic fertilizer or manure. Also the tomato plants treated with fish offal fertilizer at 7th harvesting were still green as others were completely dried at this stage. This condition is complemented by (Aung, 1984) fish fertilizer promote plant growth, retards senescence, delays flowering and fruiting in tomatoes. This could be a very important management tool to extend the time a single variety would be available for picking and marketing (Aung, 1984). Fish fertilizer releases Nitrogen slowly into the soil. This help to sustain production at peak levels for weeks rather than a few days, as with chemical fertilizer. Fish fertilizer reduces over production of buds on fruits trees (Aung, 1984). At the early growth stage,

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 95 tomato yield was lower but turned higher at later growth stages, compared with the chemically fertilized tomato. This might be due to the low nutrient availability at the beginning, which limited the plant growth. Nutrients in chemical fertilizers are immediately available when applied to the soil but the sustainability is low. The nutrients may leach out together with the irrigation water at the early growth stages. On the contrary, organic materials sustain the nutrients for longer time than chemical fertilizers. Specifically, the nitrogen in the fish fertilizer encourages lots of leaves and branches, which help support the tomato plant's large root system and bountiful crop (Seleshanko, K, 2010). Fish offal fertilizers provide an excellent source of nutrition for plants and the soil. When fish offal fertilizers are used, the plant receives a controlled level of nitrogen, a vital element necessary for the production of chlorophyll and maintaining the health of the plant. Too much nitrogen, which can be a side effect of chemical fertilizers, can overwhelm the plant and cause it to be more vulnerable to weather fluctuations, insects and diseases. It is well known that synthetic nitrogen fertilizers ‘volatilize’ into the atmosphere, not only being lost to plant availability, but contributing to greenhouse gases. Runoff of excess synthetic fertilizers to the water table, aquifers, streams, rivers and our oceans are other negative side effects (Great pacific Bioproducts LTD, 2010).

Onion ( Allium cepa ): The lowest bulb diameter, bulb weight and marketable yield were obtained from Adama red treated with manure (T 3). The low bulb weight 88.24±8.816 g obtained from manure plots could be due to the gradual decomposition of manure by soil microbes; shallow root vegetables hence require quickly available nutrients and the slow release of its nutrient content (Abbey, L et .al , 2004). High nutrient availability is important during bulbification; in this phase a high K: N ratio is required. Fertilizer should be applied close to the surface to be within reach of the shallow root system. Onions have a small root system that limits their ability to acquire nutrients from the soil (Horneck , 2004). Inorganic fertilizer, rich in phosphate will improve bulb enlargement and yields. The maximum bulb weight

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 96

(112.51±16.4) was recorded from plots treated with inorganic fertilizer where as the minimum bulb weight (88.24±8.816) was recorded from plots treated with manure. This situation can be justified as inorganic fertilizer quickly available to the plant it supply the nutrient in excessive way and manure it takes long time to supply appropriate nutrient for bulb development. The maximum marketable yield per hectare in quintals (391.53±48.12) was extrapolated from plots treated with fish offal fertilizer this due to fish fertilizer is complete and supply nutrient to plant in balanced from. Even though there is not significance difference in Unmarketable yield there is high unmarketable yield plots treated with inorganic fertilizer is due to over fertilization with high nitrogen supply leads to double bulb (Olson et al, 2010 ).

Conclusions and recommendations The escalating price of chemical fertilizer makes it necessary to develop and recommend organic fertilizer in order to meet the ever increasing demand for food, especially in the developing world. Apparently from the current study one can conclude that fish fertilizer prepared from the waste materials of fish can provide readily absorbed nutrient required for growth and other physiological activities of Tomato and onion. The yield harvested from tomato and onion treated with fish offal fertilizer is as comparable as that of chemical fertilizer as a result it can substitute chemical fertilizer and used as an alternative for Tomato and Onion under the similar condition to this experiment. Fish offal fertilizer like other organic fertilizer it is environmental friendly that cannot leach readily and stay long in the soil hence do not pollute the aquatic ecosystems and boost the production at the later age. Plants fertilized with fish offal fertilize grew worse than those fertilized with chemical fertilizers at earlier stages. Therefore, the growers should take some measures to make the nutrients in fish offal fertilizer available before plants begin to grow. The uses of waste materials as fertilizer get rid of pollution hence it is important to use as fertilizer. The use of fish offal fertilizer for different crop, application time and amounts should be studied.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 97

Acknowledgement The author wishes to acknowledge Oromia Agricultural Research Institute for funding and researcher group of Zeway Fisheries Resources Research Center like Tilahun Geneti, Tokuma Negisho and Feyisa Girma that shown dedication to record the data during the whole harvesting time. Last, but not least I would like to thank Teshome Abdisa and Geremew Awas the Horticulture team of Adami Tullu Agricultural research center in assisting and analyzing the data.

References Abbey, L. and Kanton, R.A.L. (2004). Fertilizer type, but not time of cessation of irrigation, affect onion development and yield in a sem-arid region. Journal of vegetable crop production, 9:2, 41-48. Abdur, R. (1993). Effects of fertilizer rates and times of application on the yield of tomato. ARC training, Bangladesh. Abera Degebassa, Siyoum Badiye and Yared Tigabu. (2008). The effect of fish meal processing on feed quality of livestock, Zeway Ethiopia. Aung, L.H. (1984). The Growth responses of crop plants to fish soluble nutrients fertilization. Virginia Polytechnic institute and Univeristy, Blacksbarg, Virginia, Bulletin 84-9. 80pp. Gaskell, M. (1999). Efficient use of organic fertilizer sources. Organic farming Research foundations. University of California cooperative Extension. Great pacific Bioproducts LTD. ( 2010). Why use fish fertilizer. Harris R. (1994). Organic liquid fish manual. Horneck, D.A. (2004). Nutrient management for Onions in Pacific Northwest. Better crops/ vol.88 (2004, No. 1). http://www.Econutrients, Inc. Irshad Iubana, S. D and Javed Z. (2006). Effects of different dosages of nursery fertilizes in the control of root rot of Okra and Mung bean. Pak.J.Bot, 38(1):217-223, 2006. Olson, S.M, Stall, W.M and Peres N.A, Webb S.E (2010). Onion, Leek, and Chive Production in Florida. In: vegetable production handbook for

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 98

florida, pp 167-178. (Olson, S.M and Santos, B, eds.). University of Florida's North Florida Research and Education Center, Quinc Saleem, M. J and Abdul, G. (2003). Screening of local varieties of onion for bulb formation. International Journal of Agriculture and Biology. Seleshanko, K. (2010). Fish emulsion and tomatoes. Shankara Naika, Joep van Lidt de Jeude, Marja de Goffau, Martin Hilmi, Barbara van Dam. (2005). Cultivation of tomato production, processing and marketing. Agromisa Foundation and CTA, Wageningen, 2005. Teklu Erkossa, Karl, S and Getechew Tabor. Integration of organic and inorganic fertilizers; Effect on vegetables productivity. Znidarcic, D, Stanislav, T, and Emil, Z. (2003). Impacts of various growing methods on tomato ( Lycopersicon esculentum Mill. ) yield and sensory quality. Zb. Bioteh. Fak. Univ. Ljublj. Kmet. 81-102. October 2003.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 99

Ecological assessment of Lake Hora, Ethiopia, using benthic and weed-bed fauna

Habiba Gashaw Addis Ababa University, Department of Biology, [email protected]

Absrtact: The purpose of this project was ecological assessment of Lake Hora using benthic and weed-bed fauna. Samples of benthic and weed-bed were collected monthly from September 2009 to March 2010 at 3 sampling stations (A, B, C), with a standard Ekman grab. Station A is in front of Ras Hotel, Station B is place of Irecha and station C was to the south crater of the lake. The result obtained showed that the weed-bed has sandy loam texture and the profundal has loamy soil. Generally, total organic matter content of station C was lower than A and B (with an average of 8.3g, 20.8g, and 18.0g, respectively). The benthic and weed-bed fauna of Lake Hora included a total of 6958 specimens within 27 taxa belonging principally to Copepod (2812) and Chironomidae (1460) and Ecdyonuridae (735). A high number of organisms were observed mainly at stations B and A (3198 and 2342 respectively). The correlation result indicates that oxygen showed strong relation to benthic and weed bed fauna distribution and abundance. There were high number of individuals, taxa diversity, evenness and grate number of rare taxa of benthic and weed-bed fauna at stations A and B, but these stations were affected by the community around the lake area for different reasons (for example washing closes, boat parking and others). The Family Biotic Index result for all the sampling stations was 7.55, according to Hilsenhoff Family Biotic Index this value is indicating likely severe organic pollution and very poor water quality throughout the study lake.

Key words: benthic, fauna, specimens, stations, weed-bed

Introduction Background and Justification: Urbanization and human settlement in close proximity to the Ethiopian lakes are among the greatest potential causes of changes in water quality and quantity. The drastic changes introduced into one of the Bishoftu crater lakes (Kilole) best exemplify this phenomenon (Prosser et al. , 1968). Most of the fast-growing cities, like Zwai, Awassa, and

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 100

Arbaminch, are in the neighborhood of the rift-valley lakes, and the Bishoftu crater lakes are in the vicinity of the flourishing city of Debre-Zeit.

Diversion of the inflows for irrigation purposes and flushing from deforested and heavily grazed catchment may also have contributed to the decrease in the water level and the increase in the concentrations of ions (Zinabu Gebre- Mariam and Elias Dadebo, 1989). Although the changes in salinity can take place due to evapotranspiration and/or solute inputs, the intensity of the human activity in their catchments must have contributed to the contrasting trends in their salinity.

At the present day, most of the biological method for lake monitoring is based on their trophic level definition through analyses of nutrient concentrations and/or pelagic primary producers or through analyses of consumer communities (Oligochaeta, Diptera Chironomidae, and Fishes) whose characteristics are then considered as a trophic level result (Saether, 1979; Wiederholm 1980). Measurement of ecosystem health using functional attributes of benthic invertebrates is generally in the development stage in Africa and Ethiopia. Benthic and weed-bed invertebrates for ecological assessment of water bodies: Bioassessment involves the use of indicators, indicator species or indicator communities. The indices consist of a collection of metrics that summarize information from population, community, and ecosystem levels into a single number through bioassessment. Generally benthic and weed bed invertebrates, fish, and/or algae are used. The organisms associated with the lake bottom (also called benthic organisms) are referred to collectively as benthos. There are advantages and disadvantages to each method of taxa used (Rosenberg and Resh, 1993).

Advantages of benthic and weed-bed fauna for ecological assessment: According to Plafkin et al. (1989), Barbour et al. (1999) and SWCSMH (2006) the advantages of using benthic and weed bed fauna for bio-assessment

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 101 purpose are: • Benthic and weed-bed fauna generally have limited mobility. Thus they are indicators of localized environmental conditions. • A biologist experienced in benthic and weed-bed fauna identification will be able to determine relatively quickly whether the environment has been degraded by identifying changes in the benthic community structure of the water resource. • Benthic and weed-bed fauna are the primary food source for recreationally and commercially important fish. An impact on benthic and weed-bed fauna impacts the food web and designated uses of the water resource. • Benthic invertebrates show considerable spatial variation with lake depth, across habitats, and across lakes. • Benthic and weed-bed fauna respond to short-term environmental disturbances and degraded conditions can be detected through taxa identification. • Long term effects of stress can be seen through changes in community structure

Lake morphometry affects community structure of both macrophytes and benthic and weed-bed fauna (Rasmussen, 1988). While the terminology related to physical structure of lakes is large and varies to some extent (Ruttner, 1953; Hutchinson, 1957; Wetzel, 2001). Generally, the benthic zone of lakes can be divided along the depth profile into the littoral, sub-littoral and profundal zones. The littoral zone is defined as the nearshore lake bottom areas where emerged macrophytes grow. The sub-littoral zone is defined as the bottom area covered by submerged macrophyte or algal vegetation. The lake bottom area extending deeper is called profundal zone, which consists of exposed fine sediment free of vegetation. It would be expected that nutrient enrichment affects those zones in different ways. (Naumann, 1921; Lenz, 1925; Lundbeck, 1936; Brundin, 1956; Saether, 1979). In contrast, hydromorphological alterations will affect most strongly the

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 102 littoral zone, but the sub-littoral to a much lower extent. The profundal is probably hardly affected.

Disadvantages of using benthic and weed-bed fauna for ecological assessment: According to Plafkin et al. (1989) and Barbour et al . (1999) the disadvantages of using benthic and weed bed fauna for bio-assessment purpose are: • The distribution and abundance of benthic and weed-bed fauna may be affected by factors in addition to the perturbation. • The distribution and abundance of benthic and weed-bed fauna vary seasonally. • Benthic and weed-bed fauna do not respond to all impacts. • Drifting may bring benthic and weed-bed fauna into waters in which they would not normally occur. Knowledge of drifting behavior of certain species can alleviate this disadvantage. • Certain groups are difficult to identify to the species level.

Status of using biomonitoring program in Ethiopia: The use of macroinvertebrate characteristics for assessment and monitoring of lake conditions is less common. However, a South Africa Scoring System for rapid bioassessment of water quality in rivers is being used in a National Biomonitoring Programme in South Africa (Dallas, 1997). In Ethiopia also Baye Sitotaw (2006) has done research on the Assessment of Benthic- Macroinvertabrate structure in relation to Environmental Degradation in some Ethiopian Rivers. So far some studies have been conducted on the lakes of Ethiopia, for example; Tilahun Kibret and Harrison (1989) assessed Lake Awasa using benthic and weed bed fauna. However no study was done in crater lakes of Ethiopia using macroinvertabrates as an assessment method. The purpose of this project was, therefore, to do ecological assessment of Lake Hora using benthic and weed-bed fauna.

The general objective of this study was to assess ecological quality of Lake

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 103

Hora using the distribution, composition and abundance of benthic fauna in relation to the type of bottom sediment organic pollution and vegetation. This work specifically focused on: • Determining the relations of benthic and weed bed fauna to the physicochemical limnology of the lake. • Assessing the distribution of benthic fauna in relation to aquatic macrophytes, sediment texture and total organic matter. • Assessing ecological integrity of the lake using Hilsenhoff Family Biotic Index (H-FBI) and diversity indices.

Materials and methods Description of the Study Area: Lake Hora is a small (1.03 Km 2) lake and It is a double crater with a maximum depth (in meters) of 38 (North crater) and 31 (South crater) and a mean depth of 17.5 m (Figure 1). Like all the other volcanic crater lakes in this area, Hora is a closed system, surrounded by very steep and rocky hills and cliffs. Mohr (1961), estimated the age of Lake Hora along with other Bishoftu crater lakes as early Holocene (≈ 7000 years). The catchment of the lake is formed from volcanic rocks of basalt, rhyolite and tuff. Some morphometric and physico-chemical features of the present study lake are given in Table 1.

Previous limnological studies on Lake Hora described bathymetry (Prosser et al., 1968), water chemistry (Prosser et al., 1968; Wood et al . 1984; Zinabu Gebre-Mariam et al . 2002), thermal stratification and mixing (Baxter and Wood, 1965; Wood et al. 1976), chlorophyll “a” and phytoplankton (Wood and Talling, 1988), community structure of Rotifera and taxonomic composition and grazing by zooplankton (Tamiru Gebre, 2006).

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 104

Fig. 1: Lake Hora with sampling sites (enlarged image) and other related lakes.

The sample stations selected for this study were: In front of Ras hotel (station A), around Irecha place (Traditional celebration of Oromo culture) (station B) and Hora ilmo the South crater of the lake (station C). These sites were chosen to represent the littoral and profundal zones of the lake and also sites that were impacted by human activities (A and B) and station C was

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 105 relatively free from human influence.

Table 1: Some limnological features of Lake Hora [Source: Chemical data from Baxter (2002) and Morphometric data from Prosser, et al., (1968)].

Parameters Measured values

Surface area (Km 2) 1.03 Maximum depth (m) 38 Mean Depth (m) 17.5 Volume (km 3) 0.018 Conductivity (µS cm -1) 2350 Salinity (g l -1) 2.57 Alkalinity (meq l -1) 26.5 pH 9.2 -1 NO 3-N (μg l ) 10 – 20* -1 PO 4–P (μg l ) 16.86 - 69.50* -1 SiO 2 (mg l ) 17.48 to 46.96* Sum of cations (meq l -1) 29.5 Sum of an ions (meq l -1 ) 32.9 Na + (meq l -1) 23.9 Cl - (meq l -1) 5.7 Chlorophyll ” a”(µg l-1) 19.1 - 47.6*

The immediate surroundings of the lake are semi-urban in character, with many planted and invasive exotic species (e.g. Eucalyptus, Casuarina, Schinus and Optunia spp ). The region around the lake is characterized by moderate rainfall, varying around about 850 mm per annum. The temperature of its surface water was frequently found to be about 22 0C with a maximum of 24.5 0C and minimum of 19.2 0C, while the bottom temperature was almost constant (19.2 0C-19.4 0C) (Wood et al., 1976). The phytoplankton community is dominated by the colonial cyanobacterium

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 106

Microcystis aeruginosa (Kütz,) (Wood and Tallinig, 1988). The zooplankton community of Lake Hora includes the rotifers Asplanchna sieboldi Leydig , Brachionus calyciflorus Pallas , and B. dimidiatus Bryce , B. urceolaris Müller and Hexarthra jenkinae de Beauchamp (Tamiru Gebre, 2006). The Lake supports a piscifauna, which is exclusively composed of Tilapia ( Oreocromis niloticus Linnaeus) although not much fishing is done (Baxter and Wood, 1965).

Benthic and Weed bed Fauna Sampling Processing and Identification: Samples of benthic and weed-bed were collected monthly from September 2009 to March 2010 at 3 sampling stations (A, B, C). Station A and B has wide macrophyte zone and weed bed area with littoral and sublittoral zones as compared to station C. Station C has sloppy hillside not accessible for human interference and less nutrient input from the catchments.

Stations A and B were faced with human disturbance and station C was free from human interaction. Because station A is in front of Ras Hotel, local people use it for entertainment (refreshment), fishing and boat parking purposes. Station B is place of Irecha (place of traditional Oromo people celebration). Stations (A and B) were not free from human interference and the lake gets nutrients from these two stations. Samples were taken from each station and date at 3 depths (0-1m, 1-3m, 3-5m). However station C was very steep and had no sublittoral zone, so this site was sampled only at 2 sampling depths (0-1m, 4-11m). Samples were taken with 3 replicates at each sampling point. Weed-bed samples were taken using hand net. Bottom samples and benthic fauna were sampled with a standard Ekman grab, (15cm x 15cm) area and sub sampling method was used. Samples were transferred to the plastic bags and preserved immediately in 5% formalin and then washed in a nitex net with 0.20mm mesh. Larger organisms were picked out and sorted in a white enamel dish; smaller ones were counted in a small plexiglass dish under a dissecting microscope. A compound microscope was used for detailed identification.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 107

The benthic and weed bed fauna was identified in the laboratory to the family level using different keys from literature (Michael, 2006). Macrophytes of the three stations were identified at Addis Ababa University National Herbarium.

Biological parameters Species richness: The species richness (S) is simply the number of species present in an ecosystem. This index makes no use of relative abundances. The number of species per sample is a measure of richness. The more species present in a sample, the 'richer' the sample. Species richness as a measure on its own takes no account of the number of individuals of each species present.

Simpson's Index of Diversity (D): Also known as species diversity index is one of a number of diversity indices, used to measure diversity. It takes into account the number of species present, as well as the relative abundance of each species. “D” therefore ranges from 0 to 1, with 0 representing infinite diversity and 1 representing no diversity. The formula for the Simpson index is:

Where: S= is the number of species ni= the total number of organisms of a particular species N = the total number of organisms of all species

Shannon Weaver Index: Shannon index is a measure of community structure defined by the relationship between the number of distinct taxa and their relative abundance. The higher the number the greater the diversity (Shannon and Weaver, 1963).

Hs=∑Ni/NLog 2Ni/N

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 108

Where: Hs = Shannon weaver index N = total number of individual in the sample Ni = the number of individuals of species in the sample.

Evenness index: Evenness is a measure of the relative abundance of the different species making up the richness of an area. As species richness and evenness increase, so diversity increases. When there are similar proportions of all subspecies or species equally present in the habitat then evenness is one but when the abundances are very dissimilar (some rare and some common species) then the value increases. Pielou’s index measures how evenly the species are distributed in a sample community. It is expressed as:

J = Hs/Hmax

Where: J = diversity evenness H = Diversity Index (Shannon weaver)

Hmax = Log 2S

Hilsenhoff Family Biotic Index (H-FBI) : The Hilsenhoff Family Biotic Index (H- FBI) indicates organic and nutrient pollution and provides an estimate of water quality for each site using established pollution tolerance values for each taxon. Tolerance values range from 0 to 10 for families, taxa assigned a 0 or 1, on a scale from 0-10, were considered to be intolerant taxa. The formula for calculating the Family Biotic Index is:

FBI = Σ(x i*t i)/(n)

Where, xi is number of individuals within a taxon, t i is tolerance value of a taxon and n is total number of organisms in the sample.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 109

Table 2: Evaluation of water quality using the family-level biotic index (Hilsenhoff, 1988 )

Family Biotic Index Water Quality Degree of Organic Pollution 0.00-3.75 Excellent Organic pollution unlikely 3.76 -4.25 Very good Possible slight organic pollution 4.26 -5.00 Good Some organic pollution probable 5.01 -5.75 Fair Fairly substantial pollution likely 5.76 -6.50 Fairly poor Substantial pollution likely 6.51 -7.25 Poor Very substantial pollution likely 7.26 -10.00 Very poor Severe organic pollut ion likely

Physicochemical parameters: In situ measurements of temperature and dissolved oxygen were made in the field with oxygen-temperature probe (model Co-411) on each sampling date.

Organic matter determination of the sediment: Sediment samples were taken from the littoral, sublittoral and profundal zones of the 2 stations (A and B) and only littoral and profundal zones of C for the determination of organic matter at each station in February and March. Total organic matter in the sediment was determined by drying the mud in a drying oven at 80°C to constant weight; and then incinerated the dried samples in a muffle furnace at 500°C. The organic matter content of the samples was determined by loss of weight on ignition.

Sediment texture identification: To determine soil texture of Lake Hora, sediment samples were taken from the littoral, sublittoral and profundal zones of the 3 stations using Ekman grab. Samples were transferred to the plastic bags without preservation and analysis was done at the National Soil Testing Center in Addis Ababa. The sediment texture (grain size) was determined according to Bouyoucos hydrometer method. A hydrometer measures the density in (g/l) of the suspension at the hydrometer's center of

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 110 buoyancy Bouyoucos (1936).

Data Analysis: Data collected for the environmental parameters and benthic macroinvertebrates were subjected to statistical analysis using Analysis of variance (ANOVA) and correlation to determine variations at stations and seasons and correlations between different factors and macroinvertebrates.

Results and discussion Biological Parameters Macrophytes: Typha latifolia and Schoenoplectus carymbosus were present in some areas in the shore sites of stations A and B. Station C was low in vegetation and only Oxytenanthera abyssinica was observed . Table 3 shows macrophytes of Lake Hora. There were fluctuation of water level in the lake and macrophytes were reduced during dry season and sublittoral macrophytes were totally absent during March. Water level fluctuation was also shown to reduce the diversity, or alter the composition of littoral habitats (Baxter, 1977; Hellsten et al., 1996), and affected the littoral food chain through the loss of macrophytes as a food resource (Hill et al., 1998; Wilcox & Meeker, 1991).

Table 3: Distribution of macrophytes in Lake Hora: “p” stands for present, and “a” for absent

Stations List of taxa A B C Typhaceae, Typha latifolia p p a Cyperaceae, Schoenoplectus carymbosus p p a Poacceae, Oxytenanthera abyssini ca a a p

Distribution of benthic and weed-bed fauna in Relation to stations’ water depth and sediments: Benthic and weed-bed fauna of Lake Hora included a total of 6958 specimens within 27 taxa belonging principally to Copepod

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 111

(2812), Chironomidae (1460) and Ecdyonuridae (735). A high number of organisms were observed mainly at stations B and A (3198 and 2342 respectively) and lower taxa numbers were observed at station C (1419), where there was low content of total organic matter, concentration of dissolved oxygen and cooler temperature, although this fact may be related to low macrophyte zonation and its sloppy geographical setting. Taxa richness at the stations ranged from 15 (station, C) to 21 (station, B). Among the 28 families collected, 12 were common and the rest 16 were rare. The bathymetric distribution of taxa showed higher species richness in the weed- bed (0-2m) and it decreased as depth increased. In general, distribution and abundance of macroinvertabrates increase with substrate stability and the presence of organic detritus in stations of A and B.

Figure 2 shows recorded taxa common for the three stations. Most of the rare families were collected from stations A and B. Family Cyclopidae has recorded high number at stations B and C. At station A Chironomidae was the highest in number. Nertidae, Mesovelidae and Enchytraeidae were small in number at the three stations (A, B and C respectively). Stations A and B show similarity in their recorded families and 16 families were present in both of these stations.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 112

Fig. 2. Common families for the three stations

Benthic Fauna: 11 families were collected from the benthic sediment and these had a mean total of 288 individuals. Table 4 lists the fauna of the bottom mud down to a depth of 3-11m the Ekman grab brought up a community consisting mainly of Lymnidae, Chironomidae and Lumbriculidae. Lymnidae were about 42.7% of this, most of them were Myxas glitunosa and a small number of Lymnaea ovata . The Chironomids were about 31.6% and Lumbriculidae were about 14.8% of the total benthic fauna.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 113

Table 4: Benthic Fauna of Lake Hora (*indicates their total abundance is less than 5)

Mean N o. Taxa list Standard Deviation % Total (n=5) Odonata (damselflies and dragonflies) Lestidae 1 +1.2 <0 .1 Hemiptera Notonectidae * +0.8 <0.1 Mesovilidae 4 +8 1.4 Diptera (trueflies) Chironomidae 92 +109.27 31.6 Syphyridae 3 +5.2 1.03 Anisoptera Coruliidae * +0.4 <0.1 Gastropod (snails) Lymnidae 124 +83.18 42.7 Neritidae 18 +14.65 6.24 Ancylid ae * +0.4 <0.1 Oligochaeta Enchytraeidae 3 +2.7 1.03 Lumbriculidae 43 +43.55 14.80 Mean 288 +269.37 100

Weedbed fauna: 5522 organisms were identified from 25 families from the hand net samples making a mean of 1099 organisms per sample with standard error of 1325.68 (Table 5). Crustacean mainly Copepoda, were quantitatively predominant in all stations, followed by Chironomidae and Ecdyonuridae. Copepoda reached very high abundance at all stations B, A, C (1632, 647, 493, respectively) dominant species were Cyclops sp. typical Cyclopods of weed-bed zone.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 114

Table 5. Weedbed fauna of Lake Hora (*stands for their total abundance is less than 5 and the symbol “ ?” stands for not confirmed

Mean N o. Standard Taxa list % Total (n=5) Deviation Cladocera (w ater fleas) Chydoridae 72 +132.91 6.48 Copepod Cyclopoidae 554 +685.19 49.86 Calanoidae 8 +9.81 0.72 Ephemeroptera (mayflies) Ecdyonuridae 147 +132.38 13.23 Ephemeridae * +0.4 <0.1 Odonata (damselflies and dragonflies) Coenagriidae * +0.4 <0.1 Lestidae 2 +3.27 0.18 Plecoptera Isoperlidae 4 +8.8 0.36 Teniopterygidae, 49 +57.99 4.41 Hemiptera Notonectidae 51 +43.89 4.56 Mesoveliidae 4 +9.24 0.36 Trichoptera (caddisflies) Rhyacophillidae * +0.4 <0.1 Hydroptilidae * +0.4 <0.1 Coleoptera (beetles) Dytiscidae 1 +1.6 <0.1 Lycidae * +0.8 <0.1 Diptera (trueflies) Chironomidae 200 +226.33 18

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 115

Mean N o. Standard Taxa list % Total (n=5) Deviation Syphyridae 1 +2 <0.1 Stratiomyidae * +0.4 <0.1 Corethrellidae? * +0.4 <0.1 Anisoptera Gampidae? * +0.4 <0.1 Coruliidae * +0.4 <0.1 Gastropod (snails) Neritidae 1 +1.9 <0.1 Arachinda Argyronetidae? * +0.4 <0.1 Oligochaeta Enchytraeidae 5 +3.48 0.45 Lumbriculidae 1 +2.4 <0.1 Mean 1099 +1325.688 100

Ecological integrity of Lake Hora in relation to diversity indices and Hilsenhoff Family Biotic Index Spatial diversity: Species-richness remained 15 at station C, only reaching 20 at station A and 21 at station B. It is clear that benthic and weed bed fauna richness are considerably higher at stations B and A, and this is believed to reflect the higher content of total organic matter at station B and A, coupled with quantitative increases in the levels of organic inputs.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 116

Number of 20 Families Shannon 15 diversity index Evenness 10 Parametrs

5 Simpson Diversity Index

0 ABC Stations

Fig. 3. Spatial diversity indices of the three stations

Seasonal diversity: As figure 5 indicates, family richness was high in September (21) but it was reduced in March (9) and it varied between these months. Equitability of the recorded families was high in December but it was lower in October. There were high number of benthic and weed-bed organisms in October (3835) and their number were reduced in March (638).

100

Richness 10

Shannon–Weaver index Evenness 1

Diversity paramerts r ber o bruary March Oct ecembe Fe September D 0.1 Month

Fig. 4. Monthly diversity indices.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 117

Hilsenhoff Family Biotic Index: Table 6 below provides the FBI values of the 3 stations and as this table indicates that stations A and B were much poorer than that of station C. As a whole, the H-FBI value for all of the sampling stations was 7.55, indicating likely severe organic pollution and very poor water quality throughout the study area. The increasing H-FBI values found within the study area are a result of the increasing pollution tolerant Chironomids and their higher tolerance values.

Table 6. Hilsenhoff Family Biotic Index values of the three stations (A, B and C).

Stations H-FBI A 7.60 B 7.63 C 7.4 3

Correlation between macroinvertebrates and physicochemical parameters: Correlation between macroinvertebrates and temperature and total organic matter was insignificant (P>0.5). The correlation result (Table 7) indicates that oxygen showed strong relation to benthic and weed bed fauna distribution and abundence.

Table 7. Correlations of macroinvertebrates to oxygen, temperature and total organic matter. Disolvedo=disolved oxygen, Organicm=organic matter, Macroinv.=macroinvertebrates, Temp.=temprature.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 118

Physicochemical Parameters Temperature: Surface water temperature of the lake varied between stations from 21.3 0C (February) at station C to 26 0C (March) at station A and from 20 0C (February) at station B to 25.8 0C (September) at profundal waters of station A. Temperature of the lake decreased when we go deep from the littoral zone but sometimes higher temperature was recorded such as that for 25.8 0C September 2009 at station B of the profundal zone.

30 25 20 Station A September 15 February

celsius) 10 5 0 Temperature (degree (degree Temperature 0-1m 1-3m 3-5m

30 25 20 September 15 Station B February

celsius) 10 5 0 Temperature (degree (degree Temperature 0-1m 1-3m 3-5m

26 24 Station C September 22 February 20 Temperature

(degreecelsius) 18 0-1m 4-10m Depth (m)

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 119

Fig. 5. Temperature variations of September and February at A, B and C.

Dissolved Oxygen: There was high concentration of dissolved oxygen (16.7mg/l) (October) in the weed-bed and 15.3mg/l in the profundal. Concentration of dissolved oxygen decreased in December in the weed-bed and profundal (3.21mg/l and 3mg/l, respectively).

15 Station A October 10 December (m g/l) 5

0 0-1m 1-3m 3-5m Concentration of oxygen

15 Station B 10

0 0-1m 3-5m 3-5m Concentration of oxygen (mg/l) of oxygen Concentration

10 8 6 Station C 4 2 oxygen (mg/l)

concentration of 0 0-1m 4-11m Depth (m)

Fig. 6. Concentration of oxygen in mg/l at three stations (A, B, C) of Lake Hora.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 120

As compared to stations A and B, station C was cooler in its water temperature but its dissolved oxygen content was not higher except in September. The concentration of oxygen was higher in October and lower in December, and it showed similarity during September, February and March. Fig. 7 shows concentration of dissolved oxygen at three stations of the lake on selected months of October and December. So the concentration of dissolved oxygen in Lake Hora was good indicator for macroinertebrate distribution and abundance (Fig. 7 is missing for technical reasons).

Organic matter determination of the sediment: Analysis of sediment samples taken at various depths in Lake Hora show that the organic matter at the weed-bed ranged from 2.3% (March) of station C to 31% (March) at station B and at the profundal it ranged from 3.3% (March) at station C and 23% (March) of station A. Result of this study indicates that total organic matter content of the 3 stations increased from littoral to the profundal zone of the lake but sometimes higher organic matter content were recorded such as that for 23.5% during October, 2009 at station C of the profundal zone. And it showed monthly reduction from October to March with few exceptions of the three stations. Generally total organic matter content of station C was lower than A and B.

Sediment texture determination: The result obtained showed that sand dominated across the weed bed which revealed sandy loam texture. The profundal of the lake was loam soil. A loam soil is a mixture of sand, silt and clay that exhibits the properties of that separate in about equal proportions (Brady and Weil, 1999). Loam soils often contain a good amount of organic matter.

Table 8. Sediment texture of Lake Hora Depth (m) Sand % Silt % Clay % Class 0-3 75 14 11 Sandy loam 4-11 47 38 15 Loam

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 121

Conclusion It has been shown that there are a number of hydromorphological and physicochemical alterations that may impair ecological status of lakes. As benthic invertebrates are much less mobile than fish, and exhibit a much higher dependence on littoral habitat types, shoreline developments would be expected to have considerably more severe impacts on invertebrate communities.

Associated to the weed-bed, Copepoda, Chironomidae and Ecdyonuridae were quantitatively dominant in all stations and the profundal zone of the lake was dominated by Lymnidae, Chironomidae and Lumbriculidae.

The benthic and weed bed fauna analysis of the 3 stations sampled showed that there was a difference in the distribution, diversity and abundance of benthic and weed bed invertebrates and these were much higher at stations A and B. The Family Biotic Index result indicates that the water quality at stations A and B, was of poor quality than that of station C, and also the whole lake water quality was very poor with an average H-FBI value of 7.55. The benthic and weed bed community identified within Lake Hora included invertebrates from 27 families, and generally resembled species commonly associated with polluted water or stressed environmental conditions (stations A and B). All sampling stations were dominated by Cyclopidae and Chironomidae with a number of pollution tolerant forms present.

In Lake Hora, there were high number of individuals, taxa diversity, evenness and great number of rare taxa of benthic and weed bed fauna were recorded at stations of A and B and this were human influenced areas affected by the community around the lake area, used by different purposes (for example washing clothes, boat parking and others) these activities could; influence the benthos at stations A and B. However low density and abundance of macroinvertabrates at station C could be due to: 1. Low organic matter load at station C which was free of human

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 122

interactions, 2. Steep and slope geographical setting of the profundal and its catchment; and 3. Low vegetation cover

Recomendations The extent to which Lake Hora ecosystem was affected should be assessed, preferentially using benthic and weed-bed invertebrates, as these are not much mobile than fish.

In general there is a need for further investigation of the benthic and weed bed fauna indicator value for lake-types (including consideration of indicator variability) of benthic and weed-bed fauna communities from different lake zones (littoral, sublittoral and profundal) and to understand their sensitivity to various pressures. Result of this study indicates poor water quality of the lake, so further investigation should be done with large number of sampling stations.

Recreational use of lake shores has – to our knowledge – never been examined regarding its effects on littoral macroinvertebrates. In the future, functional measures of ecosystem health, such as chronic measures of toxicity or stress, should be incorporated into any assessment process in addition to using benthos for bioassessment purpose. Further investigation is needed to understand the distribution of littoral invertebrates and their relationship to nutrients and hydromorphological modifications.

Lake Hora is impacted by human activity and has poor biological integrity. Further ecological deterioration should be prevented through proper management plans and mitigation actions. Use of benthic and weed bed fauna as bioindicators can assist in bio-assessments of intensive and extensive sampling can be done.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 123

References Barnard & Biggs (1988). MacroinvertEbrates in the catchment streams of Lake Naivasha, Kenya. Rev. Hydrobiol . Trop . 21 :127-133. Barbour, M.T. Gerritsen, J. Snyder, B.D. and Stribling J.B. (1999). Revision to rapid bioassessment protocols for use in streams and rivers: periphyton, benthic macroinvertebrates and fish. 2nd edition. EPA 841-B-99-002. US Environmental Protection Agency: Office of Water, Washington DC. Baxter, R.M. (1977). Environmental effects of dams and impoundments. Annual Review of Ecology and Systematics. 8: 255-283. Baxter, R. (2002). Lake morphometry and chemistry. In: Ethiopian Rift Valley lakes , Tudorancea, C. and Taylor, W.D. (eds.), pp. 45-60, Backhuys Publishers. Leiden, The Netherlands . Baxter, R. and Wood, R. (1965). Studies on stratification in the Bishoftu crater lakes. J. Appl. Ecol ., 2: 416. Baye Sitotaw (2006). Macroinvertebrate assemblage structure in relation to and use types and pollution in some Ethiopian rivers. M.Sc. Thesis, School of Graduate Studies, Addis Ababa University, Addis Ababa. Bouyoucos, G.J. (1936). Directions for Making Mechanical Analysis of Soils by the Hydrometer Method. Soil Sci. 42pp Brady, N.C and Weil, R.R. (1999). The nature and properties of soils. Prentice Hall, New Jersey Brundin (1956). The Chironomidae: biology and ecology of non-biting midges pp 48. Dallas, H.F. (1997). A preliminary evaluation of aspects of SASS (South Africa Scoring System) for rapid bioassessment of water quality in rivers. S. Afr. J. Aquat. Sci. 23 : 79 94. Hellsten, S. Marttunen, M. Palomaki, R. Riihimaki, J. & Alasaarela, E. (1996). Towards an ecologically based regulation practice in Finnish hydroelectric lakes. Regulated Rivers-Research & Management. 12 : 535-545. Hill, N.M. Keddy, P.A. and Wisheu, I.C. (1998). A hydrological model for

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 124

predicting the effects of dams on the shoreline vegetation of lakes and reservoirs. Environmental Management . 22 : 723-736. Hilsenhoff, W.L. (1988). Rapid bioassesment of organic pollution with a family level biothic index. J. North Am. Benthol. Soc. 7(1): 65-68 Hutchinson, G.E. (1957). A Treatise on Limnology, I. Geography, Physics and Chemistry. John Wiley and Sons, New York. Lenz, F. (1925). Chironomiden und Seetypenlehre. Die Naturwissenschaften 13 : 5-10 Lundbeck, (1936). Untersuchungen über die Bodenbesiedlung der Alpenrandseen. Arch. Hydrobiol . 10: 207-358. Michael, R. (2006). Freshwater Macroinvertebrates from Streams in Western Washington and Western Oregon. A laminate field guide. Mohr, P.A. (1961). The geology, structure and origin of the Bishoftu explosion craters, Shoa, Ethiopia. Bull. Geophys. Obs., Addis Ababa, 2: 65-101. Naumann (1921). Einige Grundlinien der regionalen liminologie. Lunds Univ. Arsskr. N.F. 17 :1-21 Plafkin, J.L. Barbour, M. T. Porter, K.D. Gross, S.K. and Hughes, R.M. (1989). Rapid bioassessment protocols for use in streams and rivers: benthic macroinvertebrates and fish. EPA/444/4-89-001. U.S. Environmental Protection Agency, Office of Water, Washington. Prosser, M., Wood, R. and Baxter, R. (1968). The Bishoftu Cater Lakes: a bathymetric and chemical study. Arch. fur hydrobiol., 65 :309-324. Rosenberg D. M. and Resh V. H. (Eds) (1993). Freshwater biomonitoring and benthic macroinvertebrates. Chapman & Hall, London and New York. Rasmussen, J. B. (1988). Littoral zoobenthic biomass in lakes, and its relationship to physical, chemical and trophic factors’. – Canadian Journal of Fisheries and Aquatic Science. 45 :1436-1447. Ruttner, F. (1953). Fundamentals of Limnology. University of Toronto Press. pp295. Saether, O. A. (1979). Chironomid communities as water quality indicators. Holarct. Ecol. 2: 65-74. Shannon, D. E. and Weaver, W. (1963). The Mathematical Theory of

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 125

Communication. Urbana, Illinois: University of Illinois Press. Soil & Water Conservation Society of Metro Halifax (SWCSMH ) (2006). Freshwater Benthic Ecology and Aquatic Entomology review paper. Tamiru Gebre, (2006). Zooplankton Community Grazing Rates Study on the Natural Phytoplankton Assemblages in Lake Arsedi (Betemengist). M.Sc. Thesis, School of Graduate Studies, Addis Ababa University, Addis Ababa. Tilahun Kibret and Harrison, D. (1989). The benthic and wed-bed faunas of Lake Awasa (Rift Valley, Ethiopia). Hydrobiologia .174 , 1-15. Wetzel, R. G. (2001). Limnology : Lakes and rivers ecosystems, 3 rd ed. Academic press, San Diago, San Francisco, New York. Wilcox, D. A. & Meeker, J. E. (1991). Disturbance effects on aquatic vegetation in regulated and unregulated lakes in northern Minnesota. Canadian Journal of Botany . 69 : 1542-1551. Wiederholm, T. (1980). Use of benthos in lake monitoring. Journal of the Water Pollution Control Federation. 52 :537-547 Wood, R., Baxter, R. and Prosser, M. (1984). Seasonal and comparative aspects of chemical stratification in some tropical crater lakes, Ethiopia. Freshwat. Biol., 14 : 551-573. Wood, R. B., Prosser, M. V. and Baxter, R. M. (1976). The seasonal pattern of thermal characteristics of four Bishoftu cater lakes, Ethiopia. Freshwat. Biol., .6 : 519-530. Wood, R. B. and Talling, J. F. (1988). Chemical and algal relationships in a salinity-series of Ethiopian inland waters. Hydrobiologia , 15 :29-67 Zinabu Gebre-Mariam, Elizabeth Kebede-Westhead and Zerihun Desta (2002). Long-term changes in chemical features of waters of seven Ethiopian Rift Valley lakes. Hydrobiologia , 477 : 81-91. Zinabu Gebre-Mariam and Elias Dadebo (1989). Water resources and fisheries management in the Ethiopian rift valley lakes SINET: Ethiop.J.Sc .12 (2): 95-109.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 126

Integrated fish-horticulture farm at Taltale in Debrelibanos, North Shoa Zone, Oromia, Ethiopia

Daba Tugie 1 and Tokuma Nagisho 2 Zeway Fisheries Resources Research Center, P.O.Box 229; [email protected]

Abstract: This experiment was conducted from December 2009 to June 2010 to investigate the integrated fish-horticulture farm (Cyprinus carpio species with Brassica oleracea and Allium cepa) production system at Taltale. Fingerlings with an average weight of 20 g were stocked at the density of 1.9fish/m 2 in unfertilized earthen pond of surface area of 750m 2. The average depth of the pond water was 45 cm throughout the experimental period. The fish were fed a compound of 50% wheat barn and 50%noug cake at 5% of their body weight twice a day for 6 months. The final weight of the fish was ranged from 21 to 129.5 g, with the mean of 52.93±2.04g. The mean daily weight gain and specific growth rate were 0.18 ± 0.01 g day -1 and 1.94% respectively. The fish food conversion ratio was 9.153±0.003. Daily weight gain of the fish might be affected genetic and other external factors such as low temperature, low water depth, high turbidity, low oxygen content and low availability of nature feed. Brassica oleracea (Gurage Cabbage) and Allium cepa( Bombay Red Onion) vegetables farming was conducted simultaneously with fish raising for 3 and 4 months respectively under the same condition without fertilizer applications. Brassica oleracea yield obtained from experimental treatment T1, irrigated with direct river water was estimated to128q/ha while the yield of T2, irrigated with water from fish pond was estimated to 182q/ha. Brassica oleracea yield obtained from T2 had high significant difference (P < 0.05) with the treatment T1. Similarly, Allium cepa yield obtained from treatment T1, irrigated with direct river water was estimated to 197.2q/ha while yield of T2, irrigated with water from the fish pond estimated to 224.3q/ha. Statistically, no significant difference (P > 0.05) of Allium cepa yield between the two treatments. To conclude that, as the study result revealed the fish growth performance was not satisfactory.

Keywords: Allium cepa, Brassica oleracea, Cyprinus carpio, Fingerling, Taltale

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 127

Introduction Integrated horticulture-fish production system is for maximizing productivity and income per acreage of land and economic efficiency of small holders’ farmers. In many of the integration processes, fish production remained as the most important activity (Mukherjee T.K., 1995). Where the other agricultural sector integrated with fish farm, is diversifying farmers’ income, job opportunity for family, meet future protein, carbohydrate and vitamins demand. Fish raising pond water depth of 1.5 m should not be less than 1 m in the deeper areas throughout the rearing period (Tokrisna R., 1995).

Cyprinus carpio (Common carp) is a widely cultured fresh water fish in the world. It is hardy fish species and thus resistant to most diseases. The temperature range is from 1 to 40 0C while the fish starts growing at water temperature above 13 0C and reproduces at 18 0C (CTA, 1996). The optimum temperature for Common carp is from 20-25 oC (Chakroff M. 1977). The fish growth rate is high in tropics where can reach a weight of 400 to 500 g in 6 months and 1.0- 1.5 Kg in one year(CTA.,1996; Chakroff M. 1977). For its growth, oxygen content of the water should not decreased from 3-4mg l -1 and the feed conversion increased where oxygen concentration decrease so and oxygen concentration should not drop below 3mg/l (Huisman 1997). Cyprinus carpio prefer clear water but very adaptable. Individuals disturb benthos and increases turbidity; regarded as pest fish in North America cited in (LA. 2007). Adult carp are omnivorous benthic feeders predominantly food items for adults include organic detritus, midge larvae and pupae, small crustacean, small snails, and freshwater clams (USA Fish Web site) and LA (2007).

Allium cepa is one of the most popular vegetable in the world. Bombay Red onion is grown seasonal for bulb production and annuals for seed production. In Ethiopia Allium cepa grow between 500-2400 m altitude but the best growing/ the optimum is between 700-1800 m with the optimal

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 128 temperature of 18- 24 0C. It matures for bulb up to 120 days (Lemma et.al . 1993).

Brassica oleracea is native in the wild in western Europe, Mediterranean and temperate regional Asia while cultivated species are grown world wide and is remarkable for containing more important agricultural or horticultural crops (Brassica, 2010). Brassica oleracea (Gurage Cabbage) Acephala group is one of the preferred horticultural crop with high demand, widely cultivated in mid rift Valley area.

The aim of the study was to investigate the integrated fish-horticulture farm production system in high altitude agro-ecology above 2,300m.

Materials and Methods Description of the Study Area: Taltale pond is found on the border of Debretsige town in Taltale Peasant Association, Debrelibanos district North Shoa, Oromia regional state. The pond is far away from capital city Addis Ababa to the north direction on 87 Km near the road Addis to BahirDar. The district is located in high altitude agro-ecology with the altitude range of 1500 to 2700 m where Taltale pond is at 2,425m. Annual rainfall was ranged from 800 to 1200 mm and the annual mean temperature is 21 0C. Agricultural type of the area is mixed, that agronomy and livestock. There found four known Monasteries, such as Debrelibanos monastery which attractive for christens tourist. Taltale pond is constructed in 1987/1988 with the surface area of (30m X 25m)=750 m 2 and 1.80m deep. The water depth of the pond filled to the range of 40-55 cm with an average of 45 cm during fish raising period. At least half of the pond depth from 45-80 cm depth at the average of 65 cm filled by long period silt/mud deposition. The depth of the water was limited due to space occupation of large amount of silt deposition.

Preparation, sampling and production activities: The assigned earthen pond with 750 m 2 area was drained and the existed fish were removed from and

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 129 the pond was treated with quick lime 200 kg/ha for buffering and disinfection without the application of fertilizer. The pond was filled with water to an average of 45 cm gradually and after three weeks 1400 Cyprinus carpio fingerlings with an average weight of 20 g were collected from Koka reservoir and stocked at the rate of 1.9fish/m 2.

Fish were fed a compound feed of 50% Wheat barn and 50% Noug cake at 5% of their body weight twice a day( from 9.00 to 10.00 AM. and from 4.00 to 5.30 PM) for 180 days. The feed rate adjusted every month on the bases of fish samples weight analysis. For data collection small mesh size beach seine was used to catch the fish. After the fish caught transfer to buckets of 2/3 volume filled with water. By using scoop net taking the fish and measure individual total length (TL) to minimum mm using measuring board and measured total weight(TW) to 0.01 g using sensitive balance every month for 6 months.

Horticulture production: The selected plot/land ploughed/cultivated and prepared for vegetable farms on suitable site for irrigation. The area of land allocated for each treatment was based on vegetable types. 1m x 5m = 5m 2 and for cabbage 2m x 5m = 10m 2. Each treatment has three replications.

Allium cepa (Bombay Red onion) and Brassica oleracea (Gurage Cabbage) seedlings were transplanted according to their recommendation set for each crop. Allium cepa (Bombay Red onion) cultivation was also conducted without fertilizer application simultaneously with fish for 120 days. The space between plants was ranged from 3-4 cm.

Brassica oleracea (Gurage Cabbage) belonging to Acephala group was cultivated in two treatments(T1 plots were irrigated by direct river water and T2 by fish pond water) and carried out for 90 experimental days without fertilizer applications. Transplanting of vegetables were conducted after 2

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 130 months of fish stocking time and carried out simultaneously with fish raising period.

Horticulture production data collection: Horticulture data was collected only during the harvesting days of each crop. During the data collection sub- samples have taken from each plot respecting border effect. • Allium cepa (Bombay Red onion) samples have taken when it matured to harvest from three plots for each treatment in 120 days. Sample plot area 3 X1m X 1m= 3m 2. During this activity the stand count/number of plants on each line and plot, bulb length (cm), bulb diameter (cm) and bulb weight(g) were measured and recorded. • Brassica oleracea (Gurage Cabbage) samples were collected from three plots for each treatment in 90 days. Sample plot area with replications 3 X 2m X 2m = 12m 2 During samples collection stem length in cm, number of matured leaves on each plant, individual leaf length(cm), leaf width(cm) and weight(g) were measured and recorded.

Fish data Analysis: Fish data were analyzed from collected samples started from the beginning of the activities. These are fish initial stocked weight(g), total weight(g), final weight(g) and supplementary feed in % body weight provided and the following parameters were summarized using appropriate formulas. Specific growth rate (SGR) in weight is which defined as the percent increase in body weight per day.

Horticultural data: Allium cepa (Bombay Red onion) data and Brassica oleracea (Gurage Cabbage) data were analyzed using single ANOVA factor.

Result and discussion T o study fish-horticulture integrated farm production system, 1400 Cyprinus carpio (Common carp) fingerlings were stocked in December 12/2009 in unfertilized earthen pond. After a 6 months growth period, the attained final weight of the fish was ranged from 21 - 129.5 g with an average of

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 131

52.93±2.04 g and the fish mean daily growth rate(DGR) was 0.18±0.01 g/ day. Specific growth rate(SGR) and relative growth rate(RGR) were 1.94% day -1 fish -1 and 164.7% respectively. The analyzed mean food conversion ratio was 9.15±0.003.

Contrary to the present study, different results from different authors in not similar conditions have reported on similar species Common carp growth performance and final weight of the fish. Ali E Abdelghany & Mohammed H Ahmad(2002) have reported that Common carp in polyculture without supplementary feed has attained 1.41g day -1 daily weight gain and reached 200.4 g final weight in 19 weeks. Within this experiment fish with supplementary feed were score daily weight gain of 4.04g/day and final weight of 581.8g. That Common carp polyculture was conducted in Sharkia, Egypt in fertilized earthen ponds of 1.25 m deep with minimum water level of 1m. The second report from CTA (1996) was described the growth performance and production of Common carp in fertilized pond condition with supplementary feed. With stocking density of 2fish/m 2 the growth performance of fish is that high in the tropics where the fish can reach a weight of 400 to 500 g in 6 months and a 1.0 to 1.5 Kg fish in one year (CTA,1996).

In this present study, the fish growth rate was not satisfactory when compare to different similar papers mentioned above, specially the daily growth rate and final weight of the fish were very low probably due to fish genetic factor, temperature, water turbidity, feed and other environmental conditions. Brassica oleracea (Gurage Cabbage) Allium cepa (Bombay Red onion) were integrated and conducted simultaneously with fish rearing. The horticulture yields obtained were analyzed separately.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 132

Table. 1. Brassica oleracea (Gurage Cabbage) yield

No. Horticulture Treatment Average yield Estimated P-value type from plots yield(q/ha) 1 Brassica T1 5.13 128.35 oleracea ±0.01kg/4m 2 0.0004 2 Brassica T2 7.28±0.05kg/4m2 181.93 oleracea

The yield obtained from T1 and T2 experimental plots were separately analyzed and extrapolated to the yield per hectare (Table.1). The difference in yield of Brassica oleracea (Gurage Cabbage) of T1 and T2 was highly significant at (P< 0.05). The yield obtained from the plots irrigated by water from fish pond was calculated to be 181.93q/ha, which was about 42% higher than the yield of T1.

Table.2 . Brassica oleracea (Gurage Cabbage) Acephala group plants and yield conditions

Plant length No. of leaf Blade/leaf Blade/leaf Leaf weight (g) (cm) length (cm) width (cm) Treatment Treatment Average standAverage count per 4m per count Rage Avg Range Avg. Range Avg. Range Avg. Range Avg. T1 22 23 -39 26.8 4-5 4.6 21 -30.5 25.5 21 -30.5 27.3 24.5 - 53 82.9 T2 24 25 -39 32.4 4-6 5 21 -29 25.4 22 -37 27.9 31.8 - 62.9 95.2

Here, Brassica oleracea individual Plant parameters such as stand count, plant length, leaf number, blade/leaf length, blade/leaf width and leaf weight were contribute for yield differences of plants (Table.2).

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 133

Table.3. Allium cepa (Bombay Red onion) yield No. Horticulture Treatment Average yield from plots Estimated yield P-value type (q/ha) 3 Allium cepa T1 1.98± 0.5kg/1m 2 197.50 4 Allium cepa T2 2.24± 0.24kg/1m 2 224.30 0.3610

The marketable Allium cepa (Bombay Red onion) onion bulb yield of both treatments (T1 and T2) with their replications were extrapolated to bulb yield per hectare. Even if the yield of T2 was greater by 26.8 quintals/ha, statistically there is no significant differences (P>0.05) of yield between the two treatments (Table.3). In all treatment plots, bulbs of unmarketable size were not observed. Statistically, there is no significant difference (P>0.05) between bulb diameter and bulb weight of both treatments.

According to Lamma Desalegne and Shimeles Aklilu (2003) report, Bombay Red onion with bulb size 85-90 g produced in Nazreth, Bako and Holeta 173.2; 162.1; and 23-171q/ha respectively from cultivars. At Melkasa Research Center on station similar researchers have reported that larger onion bulb yield obtained ranging from 250-300 q/ha. Comparing the present study result with previous ones, though the altitude of the study area (2425m.a.s.l.) was beyond the maximum recommended altitude range for onion (500-2400 m.a.s.l.), a good result was obtained at this higher altitude. Crops in all the treatments were grown without fertilizer application. Higher yield obtained in this experiment was achieved by minimizing the space between plants to 3-4 cm (from recommended space of 10 - 20 cm) with all the bulbs at marketable size.

Table.4. Allium cepa (Bombay Red onion) yield conditions

Average stand Bulb length (cm) Bulb diameter (cm) Bulb weight (g) Treatment 2 count/1m Range Avg Range Avg Range Avg T1 51 2.5 -3.8 3.8 2.7 -6.0 4.14 14.5 -66.7 38.21 T2 54.5 2.7 -3.9 3.14 2.7 -5.8 4.16 20.0 -65.2 41.45

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 134

The parameters such as stand count, bulb length, bulb diameter and bulb weight of the plant had a great role for yield variations between treatments (Table.4).

Acknowledgements We are grateful to staff members of Zeway Fisheries Resource Research Center for their assistance during the experiment conducted. Also we wish to thank Debrelibanos district agriculture and rural development office for their cooperation, specially, Ato Tewodros the staff. We thank Oromia Agricultural Research Institute for financing this study.

References AB E Abdelghany & Mohammed H Ahmad, (2002). Effects of feeding rates on growth and production of Nile tilapia, Common carp and Silver carp polycultured in fertilized ponds. Sharkia, Egypt. Allen, A. W. (1979). Cyprinus carpio (Linnaeus), Common carp. pp. 152 in D. S. Lee, et al. Atlas of North American Freshwater Fishes. N. C. State Mus. Nat. Hist., Raleigh, i-r+854 pp. Brassica (2010). Brassica-wikipedia, the free encylopedia. Web site. Chakroff M. (1977). Freshwater Fish Pond Culture and Management. Technical paper. Washington,DC. CTA(1996). Small-scale Freshwater Fish Farming. Technical paper. Huisman (1997). Introduction Fish Culture & Fisheries. Wageningen Agricultural University. LA(2007). The scoop from Aqualand on Cyprinus carpio . Lemma Desalegne and Shimeles Aklilu (1993). Research Experiences in Onion Production Research Report No.55. Mukherjee T.K.(1995). Integrated Crop-Livestock-Fish Production Systems for Maximizing Productivity and Economic Efficiency of Small Holders’ Farms. Royal Academy of Overseas Sciences, Brussels. Ross, S. T. 2001. The Inland Fishes of Mississippi. University Press of Mississippi 624 pp

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 135

Saleem, M. J and Abdul Ghaffoor. (2003). Screening of local varieties of onion for bulb formation. International Journal of Agriculture and Biology. Tokrisna R., (1995). Integration of Agriculture, Livestock and Fish Farming in Thailand. Royal Academy of Overseas Sciences (Brussels) pp. 245- 263(1995). USA Fish Web site (2002, ….,2010)

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 136

Freshwater fishes of the Amhara Region, Ethiopia

Belay Abdissa and Alayu Yalew Bahir Dar Fisheries and Other Aquatic Life Research Center [email protected]

Abstract: The fresh water fishes of Amhara region were documented based on the research work done up to now by the Bahir dar Fishery & Other Aquatic Life Research Center (BFALRC) and its national & international collaborative organizations such as Addis Ababa University School of graduate, Wageningen University and Joint Ethio-Russian Biological Expedition (JERBE). A total of 19 natural & man-made water bodies covered by this paper these are 8 lakes, 16 Rivers and 3 man-made dam with in the region. Most of the fish species in the region were riverine and lake dwellers which account 27 and 23 where as the rest 14 distributed among dam and combination of lake & river and lake & dam. Concerning the fish type of the region 20 endemic, 38 indigenous and 6 exotic species were recorded.

Key words : Amhara Region, Dam, Fresh water fish, Lake, River

Introduction Ethiopia’s ecological diversity and climatic variation is to a large extent explained by its highly variable topography. It has a surface area of 1,223,600 sq. km. More than 60 percent of the country lies above 1,000 m, with extensive plains over 2,000 m. Elevations range from 120 m below sea level in the Dallol depression (Kobar sink), south of Massawa, to over 4,620 m above sea level at Mount Ras Dashen, north of Lake Tana. (Fishbase, 2003).These altitudinal extremes mean that Ethiopia is a country of enormous habitat diversity. Ethiopia, with its different geological formations and climatic conditions, is endowed with considerable water resources and wetland ecosystems, including river basins, major lakes, many swamps, floodplains and man-made reservoirs. Ethiopia is often referred to as the ‘water tower of northeast Africa’ (Leykun Abunie, 2003).

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 137

The first information about Ethiopian fishes probably appeared in the narrative of the Portuguese Embassy sent to Ethiopia in 1520 (Backingham and Huntingford, as cited in Golubtsov and Mina, 2003). Research on fresh water fish in Ethiopia started in the late 18 th century. The first explorer was Rüppell. In the 19 th century, Boulenger undertook extensive work on African fish diversity, including on Ethiopian species (Abebe Getahun, 2007). In 1973, Shibru Tedla published a manuscript on the fresh water fishes of Ethiopia. It was the first fundamental work by an Ethiopian author, as well as the fist and only complete review of the Ethiopian Ichthyofauna up to that time (Golubtsov and Mina, 2003). In 1981, Shibru Tedla and Fiseha Haile-Meskel presented a review of fishes that had been introduced into the Ethiopian inland waters (Golubtsov and Mina, 2003).

In the late 1980s and 1990s, the fresh water biology group of the Joint Ethio- Soviet Biological expedition (JESBE), now known by the name Joint Ethio- Russian Biological Expedition (JERBE) contributed to the study of native fishes. Recently, some aspects of the diversity and conservation of the fresh water fishes of Ethiopia have been studied and reviewed by Abebe Getahun and Stiassny (Abebe Getahun, 2007).

The fresh water fish fauna of Ethiopia is a mixture of Nilo-Sudanic, East African and endemic forms (JERBE, 1995; Abebe Getahun and Stiassny, 1998; Abebe Getahun, 2007). The Nilo-Sudanic forms are represented by many representative species. For example, the genera Alestes, Bagrus, Citharinus, Hydrocynus, Hyperopisus, Labeo, Malapterurus, Mormyrus, Polypterus and Protopterus are some of the representatives from Baro Akobo, Omo-Gibe and Abay Basins. The Nilo-Sudanic forms are related to West African forms and are believed to occur here due to past connection of the Nile to Central and West African river systems. The highland East African forms are found in the northern rift valley lakes (Lake Awassa, Ziwai and Langano and Highland lakes (Lakes Haiq and Tana). The genera include Barbus , Clarias, Garra , Oreochromis and Varicorinus . They are related to fishes of Eastern and

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 138

Southern Africa and Arabian Peninsula (Skelton et al ., 1991). The family Cyprinidae dominates the fish fauna of the Ethiopian highlands (Tudorancea et al ., 1999). It consists of 36 species (Abebe Getahun, 2007) of fish of which 23 are endemic (Golubtsov and Mina, 2003; Abebe Getahun, 2007). Most of the endemic species occur exclusively in Lake Tana.

Ethiopian fresh water bodies are estimated to be 7000 km length of flowing (rivers and streams) and 7400 km 2 of standing waters (Wood & Talling, 1988). The water bodies of the country are categorized under three main drainage systems, which are again divided into sub-drainage systems or watersheds (Shibru Tedla, 1973).Among these drainage most of the Amhara Region Rivers found in the first main drainage system of the western drainage system, which includes the watersheds of the Blue-Nile (Abay), Tekeze and the Awash River watersheds. (Abebe Getahun & Stiassney, 1998).

The rivers in the Tekeze basin (e.g. Rivers Angereb,Sanja,Zarima, Genda Wuha,Shinfa, Ayima, Tekeze and Guang) drain the northwestern parts of the western highlands of the country, north of Lake Tana (MWR, 1998). All the rivers in the western drainage system flow west to the White Nile in the Sudan.

In the second system of the Rift Valley internal drainage system, composed of the Awash River system, the Borkna River and Mille found and drain into the Awash River (Fig.1 & 3).

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 139

Mille

Fig. 1. A map showing major drainage basins of Ethiopia (Source: Golubtsov and Mina, 2003)

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 140

There are highland lakes in the region of which are crater in nature. Of these, Lake Tana is the largest containing half of the total freshwater of the country by volume. It is located in the northwest highlands of the country (de Graaf et al , 2000). Other very high mountain lakes include the Lakes Hayq (Crater Lake), Ardebo,Gulbo, Maibar, Tirba and Zengana in the northern highlands of the Amhara region.

The Amhara region fish species found within the Abay, Tekeze & Awash Basins and some of the highland lakes and man made reservoir. Unfortunately there is no complete list and distribution of the diversity of fish fauna of the region. Because of logistic constraints to make holistic identification study on the fish fauna of the region, different researcher work on different water bodies ( Rivers & Lakes) separately at different period. Since they reported it independently, there is an information gap to get complete list (data) of fish species within the region. So as to fill such information gap there is a need to make complete list of species and distribution on already identified fish species and explored natural and man made water bodies. Therefore this paper forwarded with the objective to enumerate and update all the fresh water fish species of the Amhara region identified by different researchers on selected waterbodies for the reasons of diversity and conservation.

Materials and methods Study Area: The Rivers included in this paper were found with in the Abay, Tekeze and Awash drainage basins (Fig1). The Abbay (Blue Nile) and the Tekeze basins are the major drainage systems in the western part of the country. They drain the south western and the northwestern parts of the western highlands of Ethiopia (Abebe Getahun and Stiassny, 1998). The second system is the Rift Valley internal drainage system, composed of the Awash River system, the Rift Lakes region, and the Omo River system. The Awash River, which forms a closed basin, drains the Ethiopian Rift Valley and flows northeast to the Afar Depression and finally dissipates into swamps

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 141 and Lake Abe at the Ethio-Djibouti border (Fig1). There are also highland lakes of which Lake Tana is the largest that contains half of the country’s freshwater by area. It is located in the North West highlands of Ethiopia (de Graaf et al, 2000). Lakes Hayq (Lego) (Crater Lake), Ardibo, Maibar, Gulbo, Bahir Giorgis, Tirba and Zengana are all highland lakes located in the Amhara region.

South Wollo Lakes Hayk, Ardibo, Maybar and Gulbo are the four major lakes located in Northern part of Ethiopia. L.Hayk found at 11º11.9‘37.3”N latitude and 39º 41’ 12.3” E longitude with an altitude of 1830m, Ardibo located 11º10‘26.9”N latitude and 39º 45’ 19.2” E longitude, Maybar 10º59‘13.7”N latitude and 39º 39’ 10.9” E with an altitude of 2463m and L.Gulbo . The first two lakes cover almost 99% of the lakes total area and 90 % of the potential. (LFDP, 1995).

Lake Bahirgiorgis is situated at 10°: 57': 37.1" N, 38°: 09': 04.9" E in East Gojjam Administrative Zone, Goncha and Siso Enesa wereda. Lake Bahiragiorgis has an estimated area of 81.75 hectares, and a mean depth of 18 m.

Lake Zenegena and Tirba are found in Awi Zone. In addition to these, there are three reservoir included in the study these are Geray (West Gojjam), Zana and Angereb (North Gonder) reservoir. The first two are constructed for irrigation purpose by Sustainable Agricultural & Environmental Rehabilitation Commission in Amhara Regional State (CO-SAERAR) through blocking the course of stream. Geray dam is situated at 10°40'2.6"N, 37° 17'9.3"E in West Gojjam Administrative zone, Jabitahinan Woreda at an altitude of 1800m above sea level. Zana reservoir found in the North Gonder administrative zone of Eastern Belesa woreda where as Angereb reservoir found in Gonder town .It was constructed by Ministry of Water Resources for potable water source for Gonder town.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 142

The Blue Nile River Basin is located in the western part of Ethiopia between 7º45‘N - 12º 46‘N latitude and 34º 05’E - 39º 45’ E longitude. The basin has an estimated area of 199.812 km 2. About 46% of the basin area falls into the Amhara State, 32% falls into Oromia and the rest of about 22% into the Binishangul- Gumuz State. The basin covers about 17.5% of Ethiopia’s land area (BCEOM phase3, part1, 1998)(Fig.2).

Fig. 2. Map of the Abbay drainage basin with respect to other basins

Beshilo River is one of the six categories of the Nile basin and it is situated in the upper Blue Nile basin (fig.1 & 2). The river originates from the upper land areas of Wello and its large Catchments (13,242 km 2) lies in Wadela Delanta province (now Tenta and Delanta Dawnt districts). The headwaters of the Beshilo River catchments are highly dominated by steep mountainous parts with rugged topography and dissected features (MOWR, 1998, 1999).

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 143

Fig. 3. Map of the Awash Basin’s sub-catchments Showing Mille and Borkena Rivers (After Wehner, 2001)

Dura and Ardi Rivers are found in Awi Zone (formerly Metekel province), Guangua district. The town is 505 km far north–west from Addis Ababa. Dura and Ardi Rivers, originate from the high lands of Gojam ( Awi Zone). They are low order rivers. They get water from flood inflow during rainy season and some small springs. They lack flood plain up to their junction at Mentawuha (Moges, 2007). The two rivers are known by the bigger river name, Dura. The name Dura River stands for both the rivers after join at Mentawuha and until they reach the Blue Nile (Gilgel Abbay). Both rivers belong to the little Abbay (Blue Nile) basin (PDRE, 1988).

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 144

River Gendwuha, Guang, Shinfa, Ayima, Zarima, Angereb and Sanja found in Tekeze basin. Angereb and Sanja are found in Tach Armacho Wereda, North Gondar Administrative zone in the Tekeze drainage basin between 13º 09’ 38.2” N latitude and 37 º 14’ 25.9” E longitudes and 13º 06’ 50.1” N latitude and 37 º 16’ 03.1” E longitudes respectively. Both rivers lie along the road to Humera highway. The Angereb river basin is about 13,300 km 2 excluding tributaries, which enter the Atbara beyond the Sudanese border (MWR, 1998). Angereb River originates at the foot of Ras Dashen Mountain west of Dabat town whereas River Sanja, one of the tributaries of Angereb River, springs near Gondar town in west and confluences with the Angereb at about 81 km north of the city of Gondar (Personal communication with local people). The length from the upper reach down to the international boundary is 220 km for the Angereb River (MWR, 1998).

Zarima River located 140 km from Gondar town at the foot of Mt. Dashen. Simen Mountains are not only sources of biodiversity and livelihoods but they are important water catchments too from which many rivers emerge and join Tekeze River. The river system is generally characterized by long and rapid narrow water fall at the sources relatively with low volume of water. Rivers and streams emerged from Simen that forms the major part of Tekeze Basin are Belegez, Ansia, Jinbar, Angora, Loma, Mesheha, Zarima, Inzo, Anesia, Buya and Beyeda are few of them. The rivers and streams are important sources of fresh water both for drinking and agriculture in downstream areas. After they join Tekeze they are used to generate hydropower (recently) at the foot of Simen Mountains and extensive irrigation both in Sudan and Egypt (Gete Zeleke, 2010). Anesia and Inzo are main tributaries of Zarima River.

Awash River basin has a catchments area of 112,696 km 2. The Awash River originates from Central West part of Ethiopia, flowing 1200 km long, and provides a number of benefits to Ethiopia. Relatively, the most utilized river

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 145 basin and the only river entirely in the country, Awash covers parts of the Amhara, Oromia, Afar, Somali regional states, and Dire Dawa, and Addis Ababa City administrative states of the country (Fig3). The river basin has a lowest elevation of 210 m and a highest of 4195 m. The total mean annual flow from the river basin is estimated to be 4.9 Billion M3 (MoWR, 1999). Awash basin has three main catchments, upper Awash, middle Awash and lower Awash.

Borkena and Mille Rivers are found in lower Awash with an area of 3212 km2 and 5803 km 2, respectively (Fig.3). Borkena and Jara are main tributaries of Borkena River. Mille, Genale, Wekele and Tekre are major tributaries of Mille River (Wehner, 2001). Borkena River is located at latitude of 11º.650 N and longitude of 39.650 E where as Mille River lies at latitude of 11.630 N and longitude of 39.80 E in Awash basin. Borkena River has three sub- basins: Dessie, Kombelcha and Chefa (Taddesse Ketema, 1980). Mille River has two basins upper and lower Mille. Both Borkena and Mille originate from south Wollo, Borkena from Kutaber and Mille from Ambasel and Tehulederie district of South Wollo (SWA, 2006). Mille River which is found in South Wollo is a perennial river that joins Awash, and is sustained by groundwater over the dry season.

This paper is contribution of the research work done by the Bahir Dar Fisheries and Other Aquatic Life Research Center (BFALRC) and other collaborative organization both Ethiopian and foreign. Addis Ababa University graduate studies & Bahir Dar University graduate studies from national higher education institute and Wageningen University and Joint Ethio Russian Biological Expedition (JERBE) from international institutes and also examination of literature and specimen collection.

Using the Riverine fish species identification and potential survey report, both master and doctoral thesis, specimen collection of BFALRC, graduate students, JERBE and the fish base database, all the enumeration and list were

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 146 done. The photo collection was made by the author 1direct involvement on the survey and from different source (persons & fish base). To make photographing digital camera with the following model were used: Canon EOS 350D, Casio QV-4000, Sony C220Z, hp photosmart 43X, Sony DSC- W12 and to make the picture good Adobe photo shop CS4 version9 and Corel photo paint X3 version13 were used.

Results At least 9 fish orders, 17 fish families with 28 genera and 64 species are known to occur in the natural (Rivers and Lakes) and man made water bodies of Amhara Region (Table 1 & Table 2).

Table 1. Number of genera and species in families and orders of fish known to occur in the natural and man made water bodies of Amhara region, Ethiopia.

No . Order Family Genera Species 1 Osteoglo ssiformes Osteoglossidae 1 1

2 Mormyriformes Mormyridae 1 4 3 Characiformes Characidae 1 1 Alestiidae 2 3 Citharinidae 1 1 4 Balitoridae 1 1 Cypriniformes Cyprinidae 8 35 5 Cyprinodontiformes Poeciliidae 1 1 Bagrid ae 2 4 Clariidae 2 2 6 Siluriformes Malapteruridae 1 1 Mochokidae 1 2 Schilbeidae 1 1 Centropomidae 1 1 7 Perciformes Cichlidae 2 4

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 147

8 Salmoniformes Salmonidae 1 1 9 Esociformes Esocidae 1 1 Total 9 17 28 64

Below is given list of scientific and recommended common names of fish species known to occur in the Abbay, Tekeze and Awash drainage and the highland lake and artificial reservoir of Amhara Region, Ethiopia. Authority and date are separated by a comma according to the International Code of Zoological (1985) nomenclature. Exotic fish species are designated by asterisk (*).Fish species with uncertain occurrence are designated by a question mark (?). Endemic fish species are designated by an (@).

Order : Osteoglossiformes Family : Osteoglossidae Species: Heterotis niloticus (Cuvier, 1829)- Heterotis; Distribution: Tekeze drainage Ayima River (Dereje 2008); Order: Mormyriformes; Family: Mormyridae - snoutfishes Species: Mormyrops anguilloides (Linnaeus 1758) - cornish Jack (roof-bottelneus), Distribution: Tekeze drainage Shinfa River (Teferi & Seid 2000). Species: Mormyrus kannume (Forsskal 1775) - elephant-snout fish; Distribution: Abbay drainage Beles River (Zeleke 2007) Tekeze drainages Gendawuha, Shinfa, (Teferi & Seid 2000) Ayima, Guang, (Dereje 2008). Sanja ( Belay 2006); Angereb River (Genenew 2006). Species: Mormyrus caschive (Linnaeus, 1758) ; Distribution: Tekeze drainages Shinfa River (Dereje 2008). Species: Mormyrus hasselquistii (Valenciennes, 1846); Distribution: Tekeze drainages Genda Wuha; Guang River (Dereje 2008); Order: Characiformes

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 148

Family: Alestiidae Species: Alestes baremoze (de Joannis, 1835)- Silversides Distribution: Tekeze drainages Shinfa; Ayima River (Dereje 2008). Species: Brycinus macrolepidotus (Valenciennes, 1850)- True big-scale tetra. Distribution: Abbay drainage Beles River (Zeleke 2005); Tekeze drainages Genda wuha; Guang; Ayima River (Dereje 2008). Species: Brycinus nurse (Rűppell, 1832) – Nurse tetra. Distribution: Abbay drainage Beles River (Zeleke 2005); Tekeze drainages Shinfa (Teferi & Seid 2000); Ayima River (Dereje 2008). Family: Characidae - Characins Species: Hydrocynus forskahlii (Cuvier, 1819) Distribution: Abbay drainage Beles River (Zeleke 2005); Tekeze drainages Shinfa; Genda wuha (Teferi & Seid 2000;Belay 2002); Guang; Ayima River (Dereje 2008). Family: Citharinidae Species: Citharinus latus (Műller & Troschel, 1845) Distribution: Tekeze drainages Ayima River (Dereje 2008). Order: Cypriniformes Family: Balitoridae – River loaches Species: Nemacheilus abyssinicus @ (Boulenger, 1902)- Distribution: Lake Tana, Abbay River (Dgebuadze et al. 1994; Nagelkerke 1997). Species: Labeobarbus acutirostris @ (Bini, 1940) – Long snout Distribution: Lake Tana (Nagelkerke & Sibbing, 1997) Species: Labeobarbus brevicephalus @ (Nagelkerke & Sibbing, 1997) Distribution: Lake Tana (Nagelkerke & Sibbing, 1997) EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 149

Species: Labeobarbus crassibarbis @ (Nagelkerke & Sibbing, 1997) – Shot head Distribution: Lake Tana (Nagelkerke & Sibbing, 1997) Species: Labeobarbus dainellii @ (Bini, 1940) – Big head Distribution: Lake Tana (Nagelkerke & Sibbing, 1997) Species: Labeobarbus gorgorensis @ (Bini, 1940)- Carp like Distribution: Lake Tana (Nagelkerke & Sibbing, 1997) Species: Labeobarbus gorguari @ (Rűppell, 1836) – Black hunch Distribution: Lake Tana (Nagelkerke & Sibbing, 1997) Species: Barbus humilis (Boulenger, 1902) Distribution: Lake Tana (Nagelkerke & Sibbing, 1997) Abbay drainage Ardi River (Zeleke 2007) Species: Labeobarbus intermedius intermedius (Rűppell, 1836) - Intermedius Distribution: Lake Tana (Nagelkerke & Sibbing, 1997); Awash drainage Borkna River; Mille River (Assefa Tessema, 2010); Abbay drainage Ardi,Dura,Beles,Gelgel Beles, Beshilo River (Zeleke 2007) (Moges 2007); Tekeze drainages Shinfa Genda wuha(Teferi & Seid 2000); Sanja, Zarima ( Belay 2006); Angereb River (Genenew 2006); Guang, Ayima River (Dereje 2008). Species: Labeobarbus longissimus @ (Nagelkerke & Sibbing, 1997) – Big mouth mini-eye Distribution: Lake Tana (Nagelkerke & Sibbing, 1997) Species: Labeobarbus macrophtalmus (Bini, 1940)- Big eye Distribution: Lake Tana (Nagelkerke & Sibbing, 1997) Species: Labeobarbus megastoma @ (Nagelkerke & Sibbing, 1997) – Big mouth small eye Distribution: Lake Tana (Nagelkerke & Sibbing, 1997) Species: Labeobarbus nedgia (Rűppell, 1836)- Lip Distribution: Lake Tana (Nagelkerke & Sibbing, 1997); Awash EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 150

drainage Borkna River; Mille River (Assefa Tessema, 2010); Abbay drainage Ardi,Dura,Beles,Gelgel Beles, Beshilo River (Zeleke 2007) (Moges 2007); Tekeze drainages Shinfa Genda wuha(Teferi & Seid 2000); Sanja, Zarima ( Belay 2006); Angereb River (Genenew 2006); Guang, Ayima River (Dereje 2008). Species: Labeobarbus osseensis @ (Nagelkerke & Sibbing, 2000) Distribution: Lake Tana (Nagelkerke & Sibbing, 2000) Species: Barbus paludinosus (Peters, 1852) - Straightfin barb Distribution: Lake Tana (Nagelkerke & Sibbing, 1997); Abbay drainage Ardi River (Zeleke 2005) Species: Labeobarbus platydorsus @ (Nagelkerke & Sibbing, 1997) – White hunch Distribution: Lake Tana (Nagelkerke & Sibbing, 1997) Species: Barbus pleurogramma (Boulenger, 1902) Distribution: Lake Tana (Nagelkerke & Sibbing, 1997) Species: Labeobarbus surkis @ (Rűppell, 1836) - Zurki Distribution: Lake Tana (Nagelkerke & Sibbing, 1997) Species: Barbus tanapelagius @ ( de Graaf, Dejen, Sibbing & Osse, 2000) Distribution: Lake Tana ( de Graaf, Dejen, Sibbing & Osse, 2000) Labeobarbus truttiformis @ (Nagelkerke & Sibbing, 1997) – Trout like Distribution: Lake Tana (Nagelkerke & Sibbing, 1997) Species: Labeobarbus tsanensis @ (Nagelkerke & Sibbing, 1997)- Tsanensis Distribution: Lake Tana (Nagelkerke & Sibbing, 1997) Species: Labeobarbus degenii (Boulenger, 1901) Distribution: Lake Tana (Nagelkerke & Sibbing, 1997) Abbay drainage Beles River (Zeleke 2007); Beshilo River (Moges 2007); Tekeze drainages Shinfa Genda wuha EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 151

Guang, Ayima River (Dereje 2008). Species: Carassius cuvieri (Temminck & Schlegel, 1846)- Japanese (White) crucian carp Distribution: Geray reservoir (Belay, 2006a) Species: Cyprinus carpio carpio (Linnaeus 1758) - Common carp Distribution: Lake Ardibo, Lake Lugo, Lake Guolbo, Lake May bar (Belay, 2006b), Geray reservoir, Lake Zengena (Belay, 2006a), Lake Bahir Giorgis, Lake Tirba introduced for culture. Species: Garra dembecha (Abebe Getahun 2000) Distribution: Lake Tana (Abebe Getahun 2000); Awash drainage Borkna River; Mille River (Assefa Tessema, 2010); Abbay drainage Ardi River (Zeleke 2007) Species: Garra dembeensis (Ruppell 1836) - Dembea stone lapper Distribution: Lake Tana (Abebe Getahun 2000). Species: Gara regressus (Stiassny and Getahun (2007) Distribution: Lake Tana (Abebe Getahun 2000) Species: Garra tana (Abebe Getahun 2000) Distribution: Lake Tana (Abebe Getahun 2000) Species: Barbus bynni (Forsskål, 1775) Distribution: Abbay drainage Beles River (Zeleke 2007); Tekeze drainages Shinfa, Genda wuha, Guang, Ayima River (Dereje, 2008). Species: Labeo coubie (Rűppell, 1832)- Distribution: Abbay drainage Beles River (Zeleke 2007) Species: Labeo cylindricus (Peters 1852) - red eye labeo Distribution: Abbay drainage Beles River (Zeleke 2007) Species: Labeo horie ( Heckel, 1846- 49) Distribution: Abbay drainage Beles River (Zeleke 2007); Awash EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 152

drainage Borkna River; Mille River (Assefa Tessema, 2010) Species: Labeo forskalii (Rűppell, 1835) Distribution: Abbay drainage Beles River (Zeleke 2007) Tekeze drainages Gendawuha, Shinfa, (Teferi & Seid 2000); Sanja ( Belay 2006); Angereb River (Genenew 2006); Ayima, Guang, (Dereje 2008). Species: Labeo niloticus (Forsskål, 1775) Distribution: Abbay drainage Beles River (Zeleke 2007) Tekeze drainages Sanja ( Belay 2006); Angereb River (Genenew 2006); Gendawuha, Shinfa, Ayima, Guang, (Dereje 2008). Species: Raiamas loati ( Boulenger, 1901) Distribution: Abbay drainage Beles River (Zeleke 2007); Beshilo River (Moges 2007). Species: Varicorhinus beso (Rűppell, 1836)- Bezo Distribution: L. Tana (Nagelkerke & Sibbing, 1997 ), Angereb reservoir (Belay & Seid, 2002), Zana reservoir (Belay & Seid 2001) Tekeze drainages Sanja ( Belay, 2006); Angereb River (Genenew 2006); Abbay drainage Gelgel Beles, Ardi, Dura, Beshilo River (Zeleke 2007); (Moges 2007); Awash drainage Borkna River; Mille River (Assefa Tessema, 2010). Order: Siluriformes Family: Claroteidae Species: Auchenoglanis biscutatus ( Geoffroy Saint- Hilaire, 1809) Distribution: Tekeze drainage Ayima River (Dereje, 2008). Species: Auchenoglanis occidentalis (Valenciennes, 1840) Distribution: Tekeze drainages Shinfa, (Teferi & Seid 2000), (Belay 2006). EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 153

Family: Bagridae Species: Bagrus bajad (Forsskål, 1775) Distribution: Abbay drainage Beles River (Zeleke 2007); Beshilo River (Moges 2007); Tekeze drainages Shinfa, Genda wuha, Guang, River (Dereje, 2008). Species: Bagrus docmak (Forsskål, 1775) Distribution: Abbay drainage Beles River (Zeleke 2007); Beshilo River (Moges 2007); Tekeze drainages Sanja ( Belay 2006); Angereb River (Genenew 2006);Shinfa, Genda wuha (Teferi & Seid 2000),Guang, River (Dereje, 2008). Family: Clariidae Species: Clarias gariepinus ( Burchell, 1822) - sharptooth catfish Distribution: Lake Tana(Nagelkerke & Sibbing, 1997 ); Lake Gulbo; L. Bahir Giorgis; L.Ardibo; L.Lugo (Belay, 2006b); Abbay drainage Beles River (Zeleke 2007); Beshilo River (Moges 2007); Tekeze drainages Sanja ( Belay 2006); Angereb River (Genenew 2006);Shinfa, Genda wuha,Ayima, River (Dereje, 2008). Species: Heterobranchus longifilis (Valenciennes, 1840) Distribution: Abbay drainage Beles River (Zeleke 2007); Beshilo River (Moges 2007); Tekeze drainages Sanja, Zarima (Belay, 2006); Angereb River (Genenew, 2006) Shinfa, Guang,Ayima, River (Dereje, 2008). Family : Malapteruridae Species: Malapterurus electricus (Gmelin, 1789) Distribution: Tekeze drainages Guang River,Dereje, 2008). Family: Mochokidae Species: Synodontis schall (Bloch & Schneider, 1801) Distribution: Abbay drainage Beles River (Zeleke 2007); Beshilo River (Moges 2007); Tekeze drainages Sanja ( Belay, 2006); Angereb River (Genenew 2006) Shinfa, EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 154

Genda wuha (Teferi & Seid 2000); Guang,Ayima, River (Dereje, 2008). Species: Synodontis serratus (Rűppell, 1829) Distribution: Abbay drainage Beles River (Zeleke 2007); Tekeze drainages Shinfa, Genda wuha, Guang, Ayima, River (Dereje, 2008). Family: Schilbeidae Species: Schilbe intermedius (Rűppell, 1832) Distribution: Tekeze drainages Shinfa River (Teferi & Seid 2000), (Belay, 2006). Order : Perciformes Family: Centropomidae Species: Lates niloticus (Linnaeus, 1758) Distribution: Tekeze drainage Ayima, River (Dereje, 2008). Family: Cichlidae Species: Oreochromis niloticus niloticus (Linnaeus, 1758) Distribution: Lake Tana; Lake Lugo; Bahir Giorgis; Lake Guolbo; Geray reservoir (Belay, 2006b); Abbay drainage Beles, Gelgel Beles River (Zeleke 2007); Beshilo River (Moges 2007); Tekeze drainages Sanja ( Belay, 2006); Angereb River (Genenew 2006); Genda wuha (Teferi & Seid 2000); Guang, Shinfa, ,Ayima, River (Dereje, 2008). Species: Oreochromis niloticus tana (Seyoum & Kornfield, 1992)? Distribution: Restricted to Lake Tana (Seyoum & Kornfield, 1992)? Species: Tilapia rendalii ( Boulenger, 1896) ?- Redbreast tilapia Distribution: Geray reservoir (Belay, 2006a) Species: Tilapia zilii (Gervais, 1896) - Redbelly tilapia Distribution: Geray reservoir, Zengena, (Belay, 2006a), Bahiragiorgis, Tirba EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 155

Order: Salmoniformes Family: Salmonidae Species: Oncorhynchus mykiss ( Walbaum, 1792)- Rainbow trout Distribution: Abbay drainage Beresa River, Chacha (Abebe Tadesse pers. Commn.) Order: Esociformes Family: Esocidae Species: Esox lucius (Linnaeus, 1758)- Northern pike Distribution: Lake Tana (Shibru & Fisseha, 1981)? Order: Cyprinodontiformes Family: Poeciliidae Species: Gambusia holbrooki (Girard, 1859), Eastern mosquitofish Distribution: Lake Tana (Shibru & Fisseha, 1981)

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) Page 156

Discussion The most numerous fish species occurring in the Amhara region belong to the family Cyprinidae (35), followed by the families Bagridae (4), Mormyndae (4), Cichlidae (4) and Alestiidae (3) (Table 1 & 2).

Out of the seven fish order found in the Amhara region the cyprinidae fish families account 56% species which are entirely indigenous with the exception of two exotic species of Carassius cuvieri (Temminck & Schlegel, 1846) and Cyprinus carpio (Linnaeus 1758) were exotic introduced for the purpose of culture.The first introduced only in the Geray reservoir where as the second species introduced in most of the highland lake with the exception of L. Tana and Gulbo. Where as the two artificial reservoirs Angereb and Zana entirely posses V.beso species indigenous to the water bodies before dam construction.

Considering the endemicity cyprinidae contribute a total of 18 (90%) endemic species out of 20 endemic species which occurs in the region. These are the 15 (75%) species of the Lake Tana’s large hexaploid(Krysanov & Golubtsov, 1993) cyprinids which is assigned by the genus Labeobarbus (labeobarbs)following Skelton (2002) and Berrebi & Tsigenopoulos (2003), one small Barbus species i.e., B.tanapelagius, two Garra species of G. regressus and G. Tana and from the family Balitoridae Nemacheilus abyssinicus and the family cichlidae sub species Oreochromis niloticus tana (Seyoum & Kornfield, 1992). Most of the endemic species occur exclusively in Lake Tana only the Nemacheilus abyssinicus occur in other parts of the country such as Gojeb River, tributary of the Omo River (Fishbase, 2003).

There are about seven exotic fish species occurs in the region. Five of the species ( T.zillii , T.rendali , C.carpio , E.lucius , C.cuvieri ) were introduced for the purpose of culture and two of which were introduced for recreation purposes of sports fishing O.mykiss and G.holbrooki introduced for mosquito control. P a g e | 157

With the exception of one man made water bodies (Geray reservoir) almost all the exotic fish species were introduced in the natural water bodies of the region (7 lakes, 2 rivers).Out of the seven introduced fish species only E.lucius & G.holbrooki which were introduced in L.Tana were not known their establishment status where as the rest fish species established their population at the respective water bodies.

In this study some exotic fish species name are changed. For example, the crucian carp, Carassius cuvieri (Temminck & Schlegel, 1846) , is usually listed in most of the literature under its synonym Carassius carassius (Linnaeus, 1758) (Fish base, 2003). But when we consider the common English name Japanese (White) crucian carp with the physical feature, color and comparison of name given to other fish sample taken from L.Ziway & L.Langano by the JERBE group (Personal comminucation with Dr. Golubtsov) including the Amharic name given to this fish species “Bilcha” (Fishbase, 2003) also reflect its color so we took the name Carassius cuvieri (Temminck & Schlegel, 1846) (Darkov et al , 2005).

The other name is Tilapia rendalii ( Boulenger, 1896) over Tilapia zilii (Gervais, 1848) because of the taxonomic characterstics (caudal fin truncate, upper half spotted / lower half-red (or yellow); with tilapia spot on soft dorsal rays often persists; anterior vertical portion of body colored red; 8- 10 gill rakers) exhibited by the species named “ Tilapia zilii ” are not put us in a position to take the name rather the absence of T.zilli typical characterstics (vertical bars on body; caudal rounded- subtrancate; 8-11 gill rakers) on fish in question. There might be the other species T. zilii also introduced with the T.rendalii this will need further refinement on the introduced fish species.

The general distribution of the Ichthiofauna of the Amhara Region (Table 2) shows a greater diversity of fish species recorded in the Abbay drainage than Tekeze basin when we consider the Lake Tana together with Abbay basin EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 158

(Table3).When we consider the number of family possession Tekeze basin richer than any of the basin. The Awash basin is the least in species diversity (Table 3).

Table 3. Fish species composition of some natural and man made water bodies of the Amhara region

No. of No. of No. Drainages, lakes No. of No. of No. of No. of endemic exotic and reservoirs Orders families genera spp. spp. spp. 1 Abbay 5 6 14 26 1 2 Tekeze 6 14 19 28 3 Awash 1 1 3 5 4 L.Tana 3 4 7 29 20 5 L.Zengena 2 2 3 3 2 6 L. Tirba 2 2 2 2 2 7 L. Bahirgiorgis 2 2 2 2 2 8 L.Haiq 3 3 4 4 2 9 L.Ardibo 2 2 2 2 1 10 L. Maybar 1 1 1 1 1 11 L. Gulbo 2 2 2 2 12 Geray reservoir 2 2 5 5 3 13 Angereb reservoir 1 1 1 1 14 Zana reservoir 1 1 1 1

Conclusion The scientific and recommended common names and the number of orders (9), families (28), genera (46) and species (62) recorded are considered the most accurate and up to date for natural and man made water bodies of the Amhara region. We have used the term "at least" in the results because the exact number is uncertain. There is no clear complete list and description of the diversity of fauna of Ethiopia. Many of the drainage basins especially the rivers are not exhaustively explored (Abebe Getahun, 2002). The results agree with the above suggestion because of the way every researcher engaged on the taxonomic identification especially on the riverine fish fauna of the Amhara region face some difficulties to get to the

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 159 fishing site, in selecting representative sampling site due to inaccessibility and remoteness of the area and lack of appropriate fishing gear to get all fish fauna inhabiting the river even small size fish species.

The taxonomic identification and the status of some introduced fish species in the natural and man made water bodies of the region also need some attention and further refinement on their ambiguity of species name.

Relatively a large number of small, medium and even some large rivers have not been well studied and exploited (Abebe Getahun, 2003, 2005). Therefore, further study on these Rivers is a time demanding phenomenon the same is true to the Amhara region. Further taxonomic investigations on the water bodies of the Amhara region fish species are highly recommended, but there is a shortage of BFALRC researchers capable of carrying out fish collection and curation. More researchers from research and higher education Institutes need to gain taxonomic as well as systemic expertise through training and research.

There is a great need to carry out taxonomic studies of natural & man made water bodies fish species of the Amhara Region for the following reasons: to fill the literature gap; to fulfill an obligation to satisfy needs for biodiversity and conservation in respect to climate change; and to develop the theme associated with understanding the ecology of species introduction. Finally, the fish species should be entered into a regional (or Ethiopian) diversity database to show the uniqueness of the fauna.

References Abebe Getahun (2007). An overview of the diversity and conservation status of the Ethiopian freshwater fish fauna. J. Afrotropical Zoology special Issue: 87-96. Abebe Getahun (2005). An over view of the diversity and conservation status of the Ethiopian fresh water fish fauna. In: proceeding of the Pan- EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 160

African Fish andFisheries Society , Cotonoue, Benin, Nov. 2003. Abebe Getahun (2003). The Nile Basin: Reverine Fish and Fisheries. Department of Biology, Addis Ababa University, Ethiopia. Pp. 25 Abebe Getahun (2002).The Nile basin: Riverine fish and Fisheries, Department of Biology AddisAbeba University, Ethiopia .19pp. Abebe Getahun and Stiassny M. L. J. (1998 ). The freshwater biodiversity crisis: the case of the Ethiopian fish fauna. SINET: Ethiopian Journal of Science 21: 207–230. Abebe Getahun (2000). The systematic studies of the African species of the genus Garra (Pisces: Cyprinidae). A dissertation submitted to the Graduate Faculty in Biology in partial fulfillment of the requirements for the degree of philosophy, the City University of New York. Pp. 478. Assefa Tessema (2010). Diversity, Relative Abundance and Biology of Fishes in Borkena and Mille Rivers, Awash Basin, Ethiopia. M.sc Thesis , Bahir Dar University, Ethiopia. BCEOM (1998). ARBIDMP Project Water Resource Studies, part 1, main report, phase 3, Addis Ababa, Ethiopia. Belay Abdissa, (2006). Cheklist of the Riverine Fishes of North-West High Land Ethiopia. published in the Proceedings of 16tth Annual Conference and Workshop of the Biological Society of Ethiopia on Biology Education and Research in Ethiopia: Status and beneficiaries, Addis Ababa, February 2006. Belay Abdissa and Seid Mohamed, 2002. A survey of ichthyofauna of Angereb reservoir in Gondar town . Field Report. (unpublished). Belay Abdissa and Seid Mohamed, 2002. A survey of ichthyofauna of Zana reservoir in North Gondar zone . Field Report. (unpublished). Belay Abdissa, 2006a. Geray Reservoir & Lake Zengena Exploratory fishery program , in East Gojjam and Awi zone . Field Report. (unpublished). Belay Abdissa, 2006b. A survey of ichthyofauna of South Wello Lakes (L.Hayq, Ardibo, Maybar & Gulbo) . Field Report. (unpublished). Darkov,A.,Golubtsov,A. and Zenebe Tadesse (2005). Cyprinid fishes of the EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 161

Ethiopian Rift Valley poster. de Graaf, M., Eshete Dejen, Sibbing, F. A. and Osse, J. W. M.(2000). The Barbus tanapelagius , new species from Lake Tana (Ethiopia) its morphology and ecology. Environ. Biol. Fishes , 59:1– 9. Dereje Tewabe (2008).Diversity Relative abundance and Biology of fishes in Gendwuha, Guang, Shinfa and Ayima Rivers, North Gonder Ethiopia. M.sc Thesis , Addis Ababa University, Ethiopia. FishBase (2003). Ethiopia- Overview of all fish fauna Genanaw Tesfaye (2006). Diversity, relative abundance and biology of fishes in Angereb and Sanja Rivers, Tekeze basin, Ethiopia. MSc. Thesis. Addis Ababa University, Ethiopia. 90 pp. Gete Zeleke (2010). A Study on Mountain Externalities in Ethiopia. (Final Report), Addis Ababa, Ethiopia. Golubtsov, A. S. and Mina, M. V. (2003). Fish species diversity in the main drainage systems of Ethiopia: current state of knowledge and research perspectives. Ethiop. J. Natu. Reso . 2003. 5: 281–318. Joint Ethio-Russian Biological Expedition (JERBE) (1995). An artificial key for fish species of the Gambella Region (The White Nile in the limits of Ethiopia) . Addis Ababa, Ethiopia. 45 pp. Krysanov and Golubtsov, 1993. Karyotpes of the three Garra species From Ethiopia. J. Fish Biol., 42: 465-467 Lake Fisheries Development Project (LFDP) (1995). Fisheries statistical Bulletin No 1. MOA and EEC. Leykun Abunie (2003). The distribution and status of Ethiopian wetlands: an overview. In: Abebe, Y. D. and Geheb, K. (Eds), (2003). Wetlands of Ethiopia. Proceedings of a seminar on the resources and status of Ethiopia's wetlands , VI + 116 pp. Ministry of Watr Resources (MWR), (1998). Tekeze River basin integrated master plan project . Sectoral Report V0l – NR 6 Fisheries. 20 pages. Ministry of Water Resources (MoWR)(1999). Water Resource Management Policy (WRMP), Addis Ababa: Ethiopia. Moges Beletew, (2007).Diversity, Relative abundance and Biology of fishes in EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 162

some rivers, and cestode parasites of African catfish (C.gariepinus) in some lakes of Ethiopia. Nagelkerke, L.A.J, (1997). The barbs of Lake Tana, Ethiopia: morphological diversity and its implications for taxonomy, trophic resource partitioning and fisheries . PhD thesis, Agricultural University Wageningen, The Netherlands. PDRE. (1988). People’s Democratic Republic of Ethiopia Ministry of Agriculture. Metekel Cattle Improvement Ranch. Addis Ababa, Ethiopia. Pp. 68. Seyoum, S. and Kornfield. I., (1992). Taxonomic notes on the Oreochromis niloticus sub-species complex (Pisces, Cichlidae ) with a description of a new sub-species. Can. J. Zool ., 70: 2161 – 2165. Shibru Tedla, (1973). Freshwater Fishes of Ethiopia . Haile Selassie I University, Dept. of Biology, Addis Ababa, Ethiopia, PP. 101. Shibru Tedla and Fisseha H/Meskal, 1981. Introduction and transplantation of Freshwater fish species in Ethiopia. SINET: Ethiop. J. Sci. , 4: 69 – 72. Skelton, P. H., Tweddle, D. and Jackson. P. B. N. (1991). Cyprinids of Africa, PP. 211 – 239, In : Winfields, J. J. and Nelson, J. S. (eds), Cyprinid fishes, Systematic, biology and exploitation , Chapman and Hall, London, 667 pp. Stiassny, M. L. J. and Abebe Getahun (2007). An overview of labeonin relationships and the phylogenetic placement of the Afro-Asian genus Garra Hamilton, 1922 (Teleostei: Cyprinidae), with the description of five new species of Garra from Ethiopia, and a key to all African species. Zool. J. Linnean Society 150 : 41–83. South Wollo Atlas (SWA) (2006). Bureau of Finance and Economic Development, September, Bahir Dar Tadesse Ketema (1980). Hydrology of Borkena river basin Wollo Ethiopia.Thesis.Master of sciences in Geology .Addis Ababa University. Teferi Mekonnen and Seid Muhammed (2002). Riverine fishery survey on EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 163

Shinfa and Gendawuha Rivers, in Metema Woreda, North Gondar Zone. Unpublished field Report. Fisheries resource research and training sub-center, Gorgora. Tudorancea, C., Zinabu Gebre Mariam and Elias Dadebo (1999). Limnology in Ethiopia. In : Wetzel, R.G. and Gopal, B. (eds) Limnology in developing countries. International Association for Limnology , 2: 63- 118. Wehner, C, E., (2001). Testing the modeling system TALSIM for the Upper and Middle Awash Basin in Ethiopia, M.sc Thesis. Darmstadt University of Technology Institute for Hydraulics and Water Resources Engineering Section for Hydrology and Water Management in cooperation wit Addis Ababa University Faculty of Technology Department of Civil Engineering. Wood, R. B. & Talling, J. F., (1988). Chemical and algal relationships and salinity series of Ethiopian inland waters. Hydrobiologia , 158: 29 – 67.8 Zeleke Berie (2007). Diversity, relative abundance and biology of fishes in Beles and Gelgel Beles Rivers, Abay basin Ethiopia, M.sc Thesis , Addis Ababa University, Ethiopia .108pp

Acknowledgments We would like to express our deep gratitude to Dr. Feodor N. Shikil from Joint Ethio-Russian Biological Expedition (JERBE III) and Ato Tesfaye Melak from Bahir Dar University for their support in providing us different fish species photograph for the preparation of the poster. We want to thank Ato Abebe Tadesse from Debre Brhan University who gave us the latest information on the fish species of Rainbow trout ( Oncorhynchus mykiss ( Walbaum, 1792) existence in the River Beresa at North Shoa.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 164

Fish species composition, abundance and production potential of Tendaho Reservoir in Afar Regional State, Ethiopia

Gashaw Tesfaye 2*, Abebe Cheffo 1 and Hussien Abegaz 2 1Ethiopian Institute of Agricultural Research – National Fisheries and other Aquatic Life Research Center, P. O. Box: 64, Sebeta, Ethiopia. E-mail: [email protected] 2Ministry of Agriculture and Rural Development – Extension Directorate, P. O. Box: 62 347, Addis Ababa, Ethiopia. *Author to whom all correspondence should be addressed.

Abstract: Fish is a healthy and often a traditional food resource in the rural areas of many developing countries. However, providing it to a growing population is becoming a challenge for most developing nations including Ethiopia. So, strategies that are less resource intensive, relatively easy to transfer and adapt technically have to be developed. The Ethiopian government has been implementing many multifaceted water resource development projects primarily for hydropower generation and irrigation agriculture, which also creates an opportunity to boost fish production in food insecure areas like Afar. Thus, this study aims at assessing the existing fish species, estimating the production potential of the reservoir and recommend possible intervention measures to start operation. The study was conducted from January to February 2010 and includes literature review and field assessment. Fish samples were collected using gill nets of different mesh size and a total of 340 fish specimens were collected. Length and weight of fresh fish samples were measured to the nearest 0.1cm and 0.1g, respectively. The production potential was estimated based on different empirical models. Electrical conductivity, dissolved oxygen (DO), pH and water temperature were measured in situ with a digital multiline universal meter. The reservoir as part of River Awash is expected to have the fish species found in the basin. However, during the survey, only four commercially important fish species were identified in the reservoir, namely:

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 165

Oreochromis niloticus, Clarias gariepinus , Cyprinus carpio and Barbus intermedius . These species are successfully colonized the reservoir and are able to form different size classes indicating the species are well adapted to the lentic environment. The estimated potential yield ranges from 938 to 1759 t/year and an average of 1345 t/year. This potential could support about 170 to 340 fishers and an average of 255 fishermen having about 2 gillnets with 10cm stretched mesh size per fisher. Thus, interventions including organizing fishers cooperative, facilitating access to credit and gear supplies, capacity building through training and extension, infrastructure support, fish consumption promotion, resource monitoring and management and aquaculture development both in the reservoir and associated irrigation cannels are recommended. Generally, the reservoir has an excellent potential to improve the livelihoods of societies in the region.

Keywords: Afar regional state; Ethiopia; fish species; Production Potential; Tendaho reservoir

Introduction Most developing countries in Asia, South America and Africa have recognized reservoir fisheries as an effective way of increasing the supply of fish as food in rural areas, at an affordable price. Reservoir fisheries also provide additional income to rural farmers, thereby contributing to poverty alleviation. Reservoir fisheries have added advantages in that, unlike the more conventional aquaculture practices, they are less resource intensive and need less technical skills at farmers’ level. These fisheries are also an effective secondary user of water resources in rural areas. Recognizing the importance of reservoir fisheries, the Ministry of Agriculture and Rural Development (MoARD) and the Sebeta Fish Culture Station now called the National Fisheries and other Aquatic Life Research Center (NFALRC) of the Ethiopian Institute of Agricultural Research (EIAR) have been made a huge effort for the development of fisheries in reservoirs and lakes such as Koka, Fincha, Melka Wakena, Small Abaya, Ashengae and several others could be mentioned as success stories.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 166

The ongoing Afar region agricultural development program has enabled construction of Tendaho reservoir primarily for irrigation purpose. The reservoir has a large network of irrigation canals and planned to irrigate 60,000 ha of land. This water development program could be taken as an opportunity for fisheries development in the region. For the development of fisheries in Tendaho reservoir, assessing the suitability of the reservoir environment to fish production, the existing biological resource of the reservoir and the socio-economic aspect and market condition of the Tendaho Dam and Irrigation Development Project (TDIDP) area are very indispensable mainly for the benefit and improving the livelihoods of the displaced people of the Afar community.

Thus, the survey aimed at assessing the availability of fish species, if any the composition and abundance, and recommend appropriate fish species for stocking if necessary, estimate the potential fish yield expected from the reservoir and recommend management guidelines for sustainable utilization of the fish resources and thereby improve the livelihoods of the society and increase its contribution to achieving food security and economic growth of the Afar region in particular and the country at large.

Materials and methods Description of the region: The Afar Regional State is located in the North Eastern part of the country bordering with Tigray region and Eriteria in the North, Oromiya region in the South, Somali region in the South East, Amhara region in the South west, Tigray region in the North west and with Djibouti republic in the East, respectively. According to BoFED (2006) report the region has an area of 95,265.67 km 2 and organized in 5 administrative zones (named in numbers) and 29 Woredas (Fig. 1). The population size of the region is 1,411,092; of this 86.6% reside in rural and 13.4% urban area (CSA, 2008). The region is classified as lowland area with an irregular drainage system and depression. Altitude ranges from about 120 below sea level to 1300 m above sea level (a. s. l.). 35.5% of the region has an elevation less EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 167 than 400m a. s. l., whereas 51.4% has an elevation between 400 to 900m a. s. l. and 13.1% has an elevation above 900 m a. s. l. (BoFED, 2006). The region is also characterized by black lava formations, smoking volcanic cones, hot springs and sulfur fields. Denakil Desert is centered on the Denakil Depression, a large triangular basin that drops to 120 m below sea level, and is bounded on the north by the Denakil Alps, a range of hills separating the desert from the Red Sea. The main road from the Ethiopian interior to the Red Sea ports of Djibouti and Aseb passes along the desert's southern fringe. The Denakil Desert is one of the hottest places on earth, with average daytime temperatures around 27°C (81°F) and highest typically reaching 50°C (122°F). The region receives an average annual rainfall of less than 200 mm.

Livestock is the base of livelihoods for the Afar people. It is a source of income, food and transportation and means of social security. Goat, sheep, cattle and camel are the main domestic animals. Due to the shortage of rainfall, in the dry season, the pastoralists forced to move their animals to far distance looking for water and grazing land. Generally, crop production is negligible in the economy, although grain purchased from livestock sales and exchange is an important component of the diet.

Water bodies comprising all rivers, lakes and hot springs in the region account for about 1% of the total area coverage. In other words, this water bodies cover a total of 82,140 hectares of land, and are used for agriculture, salt extraction and drinking purposes (BoFED, 2006). In recent years, the Tendaho reservoir increases the total surface area of the region by 17.1% making the total surface area of the water bodies about 99,140ha. The surface water resources of the Afar region consist of twelve lakes (Annex 1), a large number of perennial rivers that include Awash, Mille, Woarrna, Indelu, Demale, Mashugala, Kebena, Kesem, Gelechalu, Awadal, Bulka, Alaa, Awura, Gulina, Azu, O'onla, Borkena, Dewie and Telalak and numerous seasonal rivers (including Logia, Giraru, Weranso, Flcha, Yaraa, Duba, Uwa, Genu, Bekeru, Yalo, Welee, Megale, Aballa, Asit, Gebela, Gewis, Busidima, EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 168

Anderkelo and Gebitabu). While all the perennial rivers have a potential for irrigation, some of them like Awash, Dewie and Telalak are also suitable for hydroelectric power generation (LERLUP, 2001).

Dji

Am So

Orom Fig. 1 : Map of the Afar region with the arrow indicating the location of the same in Ethiopia

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 169

Description of the specific study area: The Tendaho reservoir is located in the northern part of the Ethiopian Rift Valley at the lower reaches of the Awash Basin. It is constructed mainly for the purpose of irrigation to sugar cane plantation. It is situated (11 o40'.786''N; 040 o57'.486''E) between Dubti and Mille district at an altitude of 402m a. s. l., which is about 580km east of the capital city Addis Ababa. It is fed by River Awash, one of the longest perennial rivers originating from the highlands of Ethiopia. The reservoir has considerably a large surface area of 170 km 2 and having the maximum and mean depth reaches to 53m and 11m, respectively. The reservoir also has a large network of canals and provides irrigation to 60,000 ha. The main canal has 22m bed width, 72km long and 2.5m depth which feeds to several hundred kilometers of secondary and tertiary canals. The region experiences arid and semilar climate with evapo-transpiration exceeding the rainfall, thus incurring rainfall deficit. The mean annual rainfall of Tendaho area is about 200 mm. The mean annual air temperature was found to be 29 oC. The hottest months are from May to July and the coldest months are from November to January. The warmer climate could be taken as an advantage in terms of high photosynthesis rate and biomass production. The Secchi depth of the newly constructed reservoir was found to be 65cm. The morphometric, physical and chemical, and metrological features of the reservoir are given in Table 1.

Table 1. The morphometric, physico-chemical, and metrological features of Tendaho reservoir

Parameters Value Latitude 11 o40'.786''N Longitude 040 o57'.486''E Altitude (m a. s. l) 402 Area (Km 2) a 170 Maximum length (Km) a 38.7

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 170

Parameters Value Maximum depth (m) a 53 Mean depth (m) — calculated from 11 r/ship b/n area & volume Volume (billion m 3) a 1.86 Current water level (m) 35 Cond. (µS/cm) 569 DO (mg/l) 7.82 O2 Saturation (%) 100.8 pH 8.4 Secchi disk 65 Wa ter Temperature ( oC) 25.1 a Air temp : mean annual max. 37 mean annual min. 20.8 a Average annual rainfall (mm) 200 a Relative Humidity (%) : monthly mean 32 (June) monthly 97 (March ) max. “a” indicates the information have taken from the Environmental assessment of Tendaho Irrigation project

Data collection: The study was conducted during January-February 2010. The methodologies employed were review of TDIDP documents and other existing pertinent literatures, field assessment, consultation and exchange of information, ideas and opinion with relevant institutions and individuals. Physicochemical parameters such electrical conductivity, dissolved oxygen (DO) content, oxygen saturation, pH and water temperature were measured in situ with a digital multiline universal meter. Water transparency was also measured with a standard Secchi disc. Fish samples were collected using gill nets of different mesh size (60mm, 80mm, 100mm and 120mm). A total of 340 fish specimens were collected and length (Fork length for cyprinid EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 171 species and total length for the other groups of fish) and total weight of fresh fish samples were measured to the nearest 0.1cm and 0.1g, respectively. Data analysis: Descriptive statistics as well as different mathematical models were used. For estimating the potential fish yield different models which have been used in Asian and African reservoirs were applied including the following:

Henderson and Welcomme (1974) were probably the first to try to derive a yield model specifically for African lakes and reservoirs. Their original data set of 17 moderately to heavily exploited lakes and reservoirs were used and the model has been subsequently used by many other authors.

0.4681 Model 1: Y = 14.3136 ⋅ MEI (Henderson & Welcome, 1974), where; Y is the yield in kg/ha/year.

MEI is the Morpho-Edaphic Index calculated as follows: conductivi ty( µS/cm) MEI = Mean depth in m

Marshall (1984) reported that total production of a lake or reservoir is evidently directly related to its area. The bigger the water body, the higher total production we may expect. This model was also derived from data on 17 heavily exploited African lakes and reservoirs.

Model 2: ln(Y t)=3.57+0.76⋅ ln ( A 0 ) (Marshall, 1984)

Crul (1992) also developed a model with the same concept as model 2 but it was only derived from a much bigger data set. It includes 46 lakes and 25 reservoirs all situated in Africa. It is the most up to date.

0.92 2 Model 3: Y t = 8.32 ⋅ A0 (R = 0.93) (Crul, 1992); where; Yt is EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 172

the total yield in tons per year and Ao is the lake area in square kilometers

In addition to these models, different experiences from Asian reservoirs were also taking in to consideration. For instance, Oglesby (1985) estimates the average fish yield in tropical lowland lakes and reservoirs at about 80kg/ha per year. Sreenivasan and Thayaparan (1983) predicted the fish yield for Victoria reservoir in Seri Lanka would be 75kg/ha per year but De Silva (1988) estimated 70kg/ha per year for the same Reservoir Victoria.

Results and discussion Most of the Ethiopian Rift valley lakes are productive, containing indigenous population of edible fish and supporting a variety of aquatic and terrestrial wild life (Zinabu G/Mariam, 2002). Some of these lakes are being used for commercial fisheries, irrigation, recreation, and some industrial purposes. The Tendaho reservoir, which is the lower part of River Awash and northern Rift Valley, is also home for various biological resources including fish, crocodiles and different bird species. Fish species composition and abundance: According to Golubtsov and Mina (2003) the Ethiopian Rift valley are home for about 30 different species of fish fauna (Table 2). However, the distribution of fish diversity within the Rift Valley is extremely uneven. The Awash River Basin alone comprises 11 fish species (Table 3), which is about 37% of the fish fauna in the Ethiopian Rift valley and the southern Ethiopian Rift valley (Lake Abaya and Chamo) comprises the highest diversity of fish fauna, 20 fish species (Golubtsov et al., 2002; Golubtsov and Mina, 2003). There are two endemic fish species (Garra m akiensis and Varicorhinus beso) in the Awash system alone but if we consider the Afar region as a whole, the number of endemic fish species will rise to four making the number of fish species in the region about 13 and 30% of these species are endemic. The other two endemic fish species found in the region are the Cichlidae Danakilia franchettii & Cyprinodontidae Labias stiassnyae from Lake Afdera EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 173

(Abebe and Stiassny, 1998; Golubtsov and Mina et al ., 2002). The same authors also believed that the number of endemic species may increase when the taxonomic status of some Barbus and Garra species will be further studied like what has been done in Lake Tana, a highland lake with endemic “species flock” of Labeobarbus .

However, in our sampling from the newly constructed Tendaho Reservoir, we found only four commercially important fish species. These are the tilapia (Oreochromis niloticus) , catfish ( Clarias gariepinus) , common Carp ( Cyprinus carpio) and Barbus intermedius (Fig. 2). Among the four species, common carp comprises only 2% both in number and total biomass. Although tilapia and catfish comprises equal percentage in number, catfish dominates the total biomass of the catch (70%) (Fig. 3).

Table 2: The Fish diversity of Ethiopian Rift valley lakes (Golubtsov and Mina, 2003) Number Family genera species Mormyridae – elephant snout fish 3 3 Characidae - tiger fish 1 1 Cyprinidae - carp 5 13-16 Bagridae - bagrid catfish 1 1 Schibeidae - schilbeid catfish 1 1 Clariidae – air breathing catfish 1 2 Mochokidae - Squeaker 1 1 Cyprinodontidae – Tooth carps, 2 3 killifishes 1 1 Centropomidae - Nile perch 2 2 Cichlidae - Cichlids Total 18 28 -31

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 174

Table 3: The Fish diversity of Awash River basin (Golubtsov et al ., 2002; Golubtsov and Mina, 2003)

No. Family Species 1 Cyprinidae Barbus intermedius Barbus paludinosus Cyprinus carpio Garra makiensis (endemic sp ecies) Garra cf. hirticeps Garra cf. quadrimaculata Varicorhinus beso (endemic sp ecies) 2 Claridae Clarias gariepinus 3 Cyprinodontidae Aplocheilichthys antinorii Lebias dispar 4 Cichlidae Oreochromis niloticus Total: 4 families 11 species

Fig. 2 : Catch composition in a) numbers and b) total biomass

Size Structure: The smallest, maximum and mean weights observed were 51.2, 447.5 and 131.8g for tilapia; 65.5, 2179.5 and 492.5g for carp; 132.5,

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 175

3355.5 and 928.6g for catfish, and 33.9, 1070.4 and 244.4g for Barbus species, respectively. These species successfully colonize the reservoir and are able to form different size classes indicating the species are well adapted the lentic (lake or reservoir) environment (Fig. 4). But when we see the size structure of the fish species caught in the reservoir, 76% of the tilapias are below 20cm and 67% are below its mean length (17.8cm) which indicates that tilapia has either high predation pressure by catfish or it needs sometime to grow up and reach above the average size of maturity known for the species in the Rift Valley lakes so as to sustain the stock and also reach acceptable size by consumers. As predator C. gariepinus mainly feeds on fish, O. niloticus constitute the bulk of its food item (Willoughby and Tweddle, 1978; Spataru et al ., 1987). We also found C. gariepinus feeding on O. niloticus in Tendaho reservoir during our experimental fishing (Fig. 5 ). The mean size of the fish species caught in the reservoir is given in Table 4.

Table 4: The scientific, common and local name, and mean size (cm) of the species caught in the reservoir

Length (cm) Common Local Mean + Species name name Min. Max. standard error Oreochromis Tilapia Qoroso 13 28 17.8 + 0.41 niloticus Cyprinus carpio Carp Duba 15 50 25.0 + 5.10 Clar ias gariepinus Catfish Ambaza 27 71 47.5 + 1.01 Barbus Barbus Bilcha 14 41 24.4 + 0.58 intermedius

Fig. 3: F ish species caught during the experimental fishing in Tendaho reservoir.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 176

Til Comm Ca Ba

Fig. 4: Length frequency distribution of a) Barbus; b) Catfish and c) Tilapia in Tendaho Reservoir

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 177

Fig. 5 : Picture showing one of the feeding behaviors of catfish: a) Tilapia in the stomach of catfish and b) Catfish feeding gilled tilapia

Fish production potential: Tendaho dam and irrigation development project provide an excellent fish production potential for the Afar region in particular and the country at large. It is located in a climatic zone favorable for development of both capture and culture-based fisheries (a form of extensive aquaculture). There is almost year round warm and sunny weather which keeps the water warm and making it very suitable for warm water fish species like tilapia, catfish and common carp which are already introduced to the reservoir through the Awash River system.

The different mathematical models used for estimating the potential fish yield of the reservoir gave different values ranging from 55 kg/ha/year to 103 kg/ha/year with an average of 79 kg/ha/year, which is equivalent to 938 to 1759t/year and an average of 1345t/year, respectively for the whole reservoir (Table 5). Therefore, until enough catch and effort data will be generated from the commercial catch for several years or experimental fishing data is collected for reasonable time period, the average estimate of the above empirical models could be taken as an estimate of the potential EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 178 fish yield for Tendaho reservoir.

Table 5 : Estimated annual fish production potential of Tendaho reservoir Yield Total yield Model MEI (kg/ha/year) (t/year) Model 1 51.72 91 1547 Model 2 103 1759 Model 3 55 938 Oglesby (1985) 80 1360* Sreenivasan and 75 1275* Thayaparan (1983) De Silva (1988) 70 1190* Average 79 1345 *The estimated total yield per year were obtained based on the assumption that the yield in kg/ha/year given by the authors in the table also holds true for Tendaho reservoir as the estimates were made for lowland reservoirs situated about 370m a. s. l.

In fisheries science catch per unit effort (CPUE) serves as an indirect measure of total biomass. Biomass is a function of both number and weight of fish. The result showed that the number of fish caught per fishing net decreases as the mesh size increases but the CPUE of experimental fishing using gillnets of different stretched mesh size increases with the mesh size (Fig. 6). This indicates that the reservoir hosts large size unexploited fishes (mainly catfish) which could be gilled by the largest mesh size.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 179

Fig. 6. Catch per unit effort (CPUE) of different mesh size gillnets

According to the well known and widely used Schaefer production model, the maximum sustainable yield (MSY) or sometimes also called optimum yield occurs at the half of the unexploited biomass level (virgin stock). Moreover, Welcomme (1983) reported that the optimum yields of African lakes and reservoirs are attained with fishermen densities equivalent to 1–2 fishermen/km². Accordingly, the Tendaho reservoir could accommodate a number of fishermen ranging from 170 to 340 and an average of 255fishermen. If the fishermen set their net for 240 days per year (assuming the fishermen fished only 20 days per month with only 2 nets per day), the total annual optimum yield for instance for 10cm stretched mesh size net will be:

MSY = CPUE X number of days operated X number of nets per fishers X number of fishermen = 11 kg/net /day * 240 days /year * 2 nets /fishermen * 255 fishermen = 1346400 kg/year = 1346.4 t/year , which is very similar to the average estimated EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 180

yield by different models above (1345t/year) Using smaller mesh size gillnets like 6cm is not only reducing the total harvestable fish in the reservoir as indicated in Table 6 but also negatively affects the fish population by reducing the next spawning biomass and thereby the next recruitment meaning first it leads to growth over fishing and then to recruitment over fishing. Growth over fishing means the fish are caught before they can grow to a sufficiently large size to substantially contribute to the biomass. In short, many young fishes are being harvested. Whereas recruitment over fishing means that much of the spawning stock biomass (adult fishes) are being harvested.

Table 6. The CPUE (Kg/net/day) and the estimated total annual yield (t/year) for different mesh size gillnet. Mesh size CPUE 50% of CP UE Yield or MSY (cm) (kg/net/day) (kg/net/day) * (t/year) 6 12 6 734.4 8 19 9.5 1162.8 10 22 11 1346.4 12 24 12 1468.8 * CPUE used to calculate MSY as it is believed to occur at the half of the virgin stock or biomass based on Schaefer’s model.

Opportunities of the reservoir fisheries: The newly constructed reservoir could offer several opportunities to support the Afar society especially to the displaced people of youth and women due to the reservoir formation. The potential contribution of the Tendaho reservoir fisheries to the achievement of regional development objectives includes, o Nutrition and food security o Source of sustainable income o Improve the health status of the society o Create employment opportunity

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 181

o Alleviation of poverty o Reduction/substitution of imported canned fish o Economic growth for private sector including hotels and restaurants

In addition, the future fishing villages’ offers homogeneous and less dispersed pastoral communities which are ideal for social mobilization for poverty alleviation programs which is now the main target of the TDIDP and regional government. Further more, the Reservoir fisheries require minimal initial investment and provides quick returns compared to other economic activities. Access to microfinance facilities, which have received strong internal and external support, will therefore promote rapid development of fisheries, especially for the benefit of women and youth. It does not also require sophisticated skills and knowledge for the entry and coping up with operation at small scale level. The regional pastoral extension program can rigorously conduct an extension service and provide training to the communities.

Production and marketing constraints: The major constraints that were identified by the stakeholders (the producers, consumers and hotel owners) who are involved in the survey are the following: o Lack of proper fishing gears, all of them use hook for fishing o Poor post harvest handling and lack of proper fish processing and storage facilities o Low price of fish as a result of low bargaining power of producers o Lack of awareness o Lack of transportation facilities o Poor culture of eating fish in Afar community o Unavailability of boat in the area o Lack of permanent fish market places (shops)

Proposed interventions for the reservoir fishery development: The reservoir was started filling water in June 2008. Even now, it has only two EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 182 third of its full capacity. At this stage, the ecosystem is not well stabilized. With this situation, the initial step will be start pilot fishing with formation of few fishermen groups. Then it can be increased to the level at which the resource can support. Therefore, among others the following are identified as priority development interventions:

Awareness Creation and capacity building: Awareness needs to be created among pastorals, consumers, and other stakeholders about the important values and contributions of developing the fisheries. This ultimately promotes demand for use of modern fishing techniques and fish consumption in the target areas. Local administration, tribe leaders and elders have more recognition by the community than government bodies in Afar Region similar to the other pastoral community. Therefore, to ensure the acceptance of the project by the community creation of awareness among the community with special emphasis to clan leaders is considered as an indispensable and top-level mitigation measure. The other important approach to do this is to integrate fisheries extension with the general agricultural extension, public health education, and home economics. This is considered very essential as the fishery development program will help for the existing pastoral nomadic society as source of income, high quality food and employment. This will require training for the local community.

The Regional BoPARD has no extension staffs who have adequate knowledge or skill to deal with the various and complex issues of the river and reservoir fisheries in the area. It is necessary to recruit trained fishery and limnology professional to work as an extension worker at various levels. Pastoral individuals who are interested to engage in fishing require knowledge and skills about the improved technologies and practices they will apply. Particularly training on fishing techniques, net making, setting & hauling, handling of fish before and after landing, and processing of fish to different forms, and preparation of fish dish or recipes will be important.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 183

Organizing fishermen association: Modern fishing is by its very nature a group activity. Working in association or group provides ground for collective responsibility for protecting the fish stocks, and for building trust (collateral) for credit access, and bargaining power in buying and selling fishery inputs and outputs in bulk quantities and at favorable prices.

Facilitation of gear supplies and access to credit: Scarcity of fishing gears is a national problem. It will be extremely difficult to access in new fishery areas unless supported by government or other development partners. The introduction of modern fishing gears should be accompanied with training of local people/users.

Access to local credit facilities should be arranged for pastoral/fishermen who want to use recommended gears. Gears to be introduced and used by fishermen through credit be rewarding so that fisheries development can be sustainable. A revolving fund for fisheries development may be availed through government or project or NGO development assistance.

Infrastructure support: The reservoir requires providing with small-scale facilities at their strategic landing sites. Landing facilities may include simple jetty, access road connecting the landing with feeder roads, simple shed to protect the caught fish from solar heat pending transfer/first sale. These infrastructures will facilitate fish handling marketing and distribution of fish products.

Promoting entrepreneurship in fish trade: Fish caught in small quantities can directly be sold to consumers by the individual fishermen themselves. However, in the case of bulk catch, there arises a need to promote and support traders to receive fish from fishermen and distribute to various consumption centers. Such entrepreneurship can be possibly formed through credit and training supports.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 184

Resource monitoring and management: In order to sustain the benefits from reservoir fisheries their development need to be regulated at optimum level. This can be possible by introducing and enforcing an effective fisheries management regime. The Tendaho reservoir is located at lower altitude and due to its high water temperatures; it will normally be high productive than those located in upper stream. During the initial years this new reservoir may contain less fish. But, later on when immigration of fish into reservoir starts through the new canals connecting it with other rivers, more fish species will be introduced and stocked. Finally, the fish fauna in the reservoir might be different from the initial ones. Fishing in reservoir will be predominantly capture-based activity. Fisheries resources regulation should be implemented for optimum yield and sustainability of resources, which need be backed by biological reasoning and based on economic considerations.

Stock enhancement: As it is mentioned above the tilapia fish, which is the most preferred species in Ethiopia, is very low in total biomass (10%) compared to its predator catfish (70%). The population structure of tilapia also showed that the catch is dominated by small size fishes or young fishes. Hence, it might be necessary to enhance the tilapia species by stocking the reservoir to boost production. This could help to replace the off take of tilapia by catfish and thereby increase the production of both tilapia and catfish. Supplemental stocking is usually indicated when low production levels and low yields of favored fish species are seen to be due to insufficient recruitment to the fishable population. Moreover, more countries have usually reported stocking in reservoirs as a successful management measures for both recreational (managed for fish size) and commercial (usually managed for biomass) fisheries (Quiros, 1999). Das (2003) also reported that reservoir management using fish stock enhancement results in significant increases in fish yield in Indian reservoirs.

Undertaking Applied Researches: Fortunately, the Afar Region Research Institutes already opened and there is a possibility to incorporate the Fishery EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 185 research in the Livestock research process. The new approach research for development and management of the fishery should be applied. It should be concentrated on identification of the interlinking complex ecosystem of existing rivers with proposed irrigation canal and reservoir. Above all, the impact of dam and irrigation canal on upper and lower streams, before and after impoundment on fishery should be given priority. In addition, more robust production estimates for sustainable management based on structural and production models should be done.

Conclusion The survey showed that the reservoir has four commercially important fish species namely; O. niloticus, C. gariepinus, C. carpio and B. intermedius . The species seems successfully colonized the lentic environment as it has been evidenced by having different size classes. The warmer climate of the area could be taken as an advantage in terms of high photosynthesis rate and biomass production. Based on the applied empirical models, the fish production potential of the reservoir is found to be in the range of 938 to 1756t/year and an average of 1345t/year. These potential could support about 170 to 340 fishermen and an average of 255 fishermen having about 2 gillnets with 10cm stretched mesh size having 100m long and 3m wide each. Now, it is possible to start fishing with small groups of fishermen until the reservoir fully stabilizes and then, gradually increase the level of effort (number of fishermen and fishing gears) to the level that the resource can support.

Therefore, it is possible to conclude that the newly constructed reservoir could offer several opportunities to the Afar society. The potential contribution of the Tendaho reservoir fisheries to the achievement of regional development objectives includes it serves as a source of nutrition and food, sustainable income, improve the health status of the society, create employment opportunity, alleviation of poverty, reduction/substitution of imported canned fish and economic growth for EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 186 private sector including hotels and restaurants. Furthermore, the Reservoir fisheries require minimal initial investment and provides quick returns compared to other economic activities. It does not also require sophisticated skills and knowledge for the entry and coping up with operation at small scale level. Finally, the recommended development intervention measures should be given strong attention for the success of the intended fishery development program of the region.

Acknowledgements We are very much indebted for the Improving Productivity and Market Success (IPMS) of the Ethiopian Farmers Project of the International Livestock Research Institute (ILRI) for the financial support of the survey. We are also very much grateful to the Extension directorate of the Ministry of Agriculture and the National Fisheries and other Aquatic Life Research Center of EIAR for providing logistics for the study. We also would like to extend our gratitude to Mr. Michael Hailu - Head, Socioeconomic Study, Training Cooperative Organizing and Marketing Department of the Tendaho Dam and Irrigation Development project and Mr. Abriham Berihea –Head, Tendaho Dam and Irrigation Development Project for providing the required information and documents. Mr. Chane Gebeyehu- Afar Region Equitable Development Coordinator from the Ministry of Federal Affaires also thanked for his assistance to successfully complete the survey and others whose names are not mentioned here but annexed in the list of contacted persons are all acknowledged for all the support you gave us. Without your unreserved support this study wouldn’t be possible.

References BoFED (Bureau of Finance and Economic Development) (2006). Regional Atlas of Afar Region. Senera, Afar. Cambray, J.A. (1983). The feeding habit of minnows of genus Barbus (Pisces, Cyprinidae) in Africa, with special reference to Barbus anoplus Weber. J. Limno. Soc. Sth. Afr. 9:1-22. EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 187

Crul, R.C.M. (1992). ModeLs for estimating potential fish yields of African inland waters. CIFA Occasional Paper No. 16. Rome, FAO. 22 p. Central Statistical Agency (CSA) (2008). Summary and Statistics Report of 2007 Population and Housing Census. Federal Democratic Republic of Ethiopia Population Census Commission. December, 2008, Addis Ababa, Ethiopia. Das, B. P. (2003). The use of irrigation systems for sustainable fish production in India. PP. 47-58. Petr, T. (ed.) Fisheries in irrigation systems of arid Asia. FAO fisheries Technical Paper. No. 430. Rome, FAO. 2003. 150p. De Silva, S. S. (1988). Reservoirs of Seri Lanka and their Fisheries. FAO, Rome, Italy. Fisheries Technical Paper 298, 128Pp. Elias Dadebo (2000). Reproductive biology and feeding habits of the Catfish Clarias gariepinus (Burchell)(Pisces: Claridae) in Lake Awassa, Ethiopia. SINET:Ethio. J. Sci., 23(2): 231-246. FAO (2003). Fisheries in irrigation system of arid area. FAO Fisheries Technical Paper No. 430, Rome, 150p. FAO (1989). Solar drying of fish and paddy. FAO Environment and Energy paper No.10, Rome FAO (2002). Fishery Statistics. Aquaculture production. 90(2). Getachew Teferra and Fernando, C. (1989). The food of an herbivorous fish (Oreochromis niloticus Linn) in Lake Awassa Ethiopia. Hydrobiologia 178: 195- 200. Golubtsov, A.S., Dgebuadze, Yu.Yu. and Mina M.V. (2002). Fishes of the Ethiopian Rift valley. In: Ethiopian Rift Valley Lakes, Pp.167-256 (Tudorancea, C. and Taylor, W.D., eds), Backhuys publishes, Leiden, Holland. Henderson, H.F. and R.L. Welcomme (1974). The relationship of yield to Morpho-Edaphic-Index and number of fishermen in African inland fisheries. CIFA Occs.Pap. , 1: 19pp. Rome, FAO Kassahun Assaminew (2005). Distribution, abundance and feeding biology of fish species in Koka reservoir and the associated Awash River floodplain, Ethiopia. UNESCO-IHE Institute for Water Education, EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 188

Delft, the Netherlands. M.Sc Thesis. Pp.119 LERLUP (2001). Land Evaluation for the proposed Regional Land Use Plan, April 2001. LFDP (1994). Lake Fisheries Development project, Phase II. Preliminary estimation of the maximum sustainable yields of the lakes covered by the lake fisheries development project. 1994. Matthes, H. (1963). A comparitive study of the feeding mechanisms of some African Cyprinida (pisces, Cypriniformes). Bjdragen totde Dierkunde, Amsterdam 33:1-35. MoARD (2009). Annual Report. Oglesby, R. T. (1985). Management in the lacustrine fisheries in the tropics. Fisheries, 10 (2), 16 – 19. Quiros, R. (1999). The Relationship between fish yield and stocking density in reserviors from tropical and temperate regions. International Institute of Ecology, Brazilian Academy of Sciences and Backhuys Publishers. Theoretical Reservior Ecology and its Applications, 67-83. Shelton, W.L. 2002. Tilapia culture in the 21st century. p.1-20. In: Guerrero, R.D. III and M.R. Guerrero-del Castillo (eds.). Proceedings of the International Forum on Tilapia Farming in the 21 st Century (Tilapia Forum 2002), 184p. Philippine Fisheries Association Inc. Los, Banos, Laguna, Philippines. Sibbing, F.A. (1991). Food capture and oral processing. In: Winfield, I.J.and Nelson, J. S (Eds) Cyprinid Fishes, systematics, Biology and Exploition. Chapman & Hall, London 377-412 pp. Spataru, P., Viveen, W.J.A.R. and Gophen, M. (1987). Food compostion of Clarias gariepinus (C.lazera)(Cypriniformes, Clariidae) in Lake Kinnest (Iserael). Hydrobiol. 144:77-82. Sreenivasan, A., and Thayaparan, K. (1983). Fisheries development in the Mahaweli River systems. Journal of Inland Fisheries , Seri Lanka, 2. 34 – 49. Tudorancea, C. Fernando, C. H. and Paggi, J.C. (1988). Food and feeding ecology of Oreochromis niloticus (L) juveniles in Lake Awassa, EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 189

Ethiopia. Arch. Hyddrobiologia . (suppl.) 79 : 267-289. Viveen, W.J.A.R. Richter, C.J.J. and Van Oordt, B.A. (1986). Practical manual for the culture of the African catfish (Clarias gariepinus). University of Utrecht, Hague. 121 pp. Welcome, H (1984), River basins. FAO Fisheries Technical Paper. Willoughby, N. G. and Tweddle, D.(1978). The ecology of the catfish Clarias gariepinus and Clarias ngamensis in the Shire Valley, Malawi.J.Zool. Lond. 186:507-534.Yirgaw Teferi, Demeke Ademassu and seyoum Mengistu, (2000). The food and feeding habit of Oreochromis niloticus in Lake Chamo, Ethiopia. SINET: Ethiop.J. Sci., 23(1): 1-12. Zenebe Tadesse (1999). The nutritional status and digestibility of Oreochromis niloticus L. diet in Lake Lagano, Ethiopia. Hydrobiologia 416: 97-106. Zinabu G. Mariam (2002). The Ethiopian Rift Valley lakes: Major threats and strategies for conservation. In: Ethiopian Rift Valley Lakes , Pp.259 – 271(Tudorancea, C. and Taylor, W.D., eds), Backhuys publishes, Leiden, Holland.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) Page 190

Annex : The location, altitude, morphometric features and salinity of lakes in the Afar region (Gasse, 1987; LERLUP, 2001) (a refers the area belong to Ethiopia alone). Max. Surface area Mean Salinity No. Lakes Location Altitude (m) depth (Km 2) depth (m) (gl -1) (m) 14° 01' N; 40° 24" E; 310km from 1 Assale -100 55 40 - 276.5 Serdo 13° 57' N; 40° 30' E; 380km from 2 Dalol (Humigebet ) - 30 - - - Serdo 13° 16' N; 40° 55 E; 230 km from 3 Afdera -103 140 b 160 b - 158 Logia via Serdo 11° 10' N; 40° 45' E; 350 160 4 Abe 235 c 37 8.6 end of R. Awash 113 a 11° 33' N; 40° 40' E ; 0.663 5 Gamari 339 70 - - 40 km east of Asayita 11° 33' N; 40° 41'E; b/n L. Gemeri 6 Afambo 339 30 - - & L. Abe 11° 22' N; 40° 36' E; b/n L. 7 Adobed - 24 - - - Gemeri & L. Abe 11° 25' N; 40 o 39' E; b/n L. 8 Suwata - 7 - - - Adobed & L. Afambo 10 ° 13' N; 40° 30' E; 9 Yardi (Diaribet) 562 75 - - Salty water ~35 km to the west of Gewani 10° 08' N; 40° 31' E; 10 Dalay 561 4.1 - - Salty water b/n L. Yardi & Awash River 9° 44' N; 40° 23' E; 11 Hertale 600 11 - - Salty water 10 km west of Meteka village 9° 33' N; 40 o 12' E; 12 Laido 105 km from Awash station- - 3.5 - - Salty water North-west of Ambara Page 191

Integration of fish culture with water harvesting ponds in Amhara Region: a means to supplement family food

Alayu Yalew Bahir Dar Fishery and Aquatic Life Research Center (BFALRC). P. O. Box 549, Bahir Dar. Ethiopia; E-mail: [email protected]

Abstract: The activities of the capture fisheries sector, coupled with improper management has led to over fishing of most terrestrial waters. Therefore more attention has been given to fish farming (aquaculture) in the developing countries. Currently aquaculture produces over 30% of the fish consumed through out the World; percentage that is set to increase to over 50% by the year 2030. A research was conducted in 2009/10 to integrate fish farming with backyard vegetable production to supplement family food source. Nile tilapia (O. niloticus) fish fingerlings have been stocked in concrete water harvesting ponds constructed by the Sustainable Water Harvesting and Institutional strengthening in Amhara (SWHISA) project in East Gojjam South Wollo zones of the region. The concrete ponds did have two different kinds of shapes; circular and rectangular. A total of 9 farmers (3 circular and 6 rectangular) from the two zones had been selected. Each pond did have the capacity to store a volume of 90 to 200 m 3 water. About 800 Nile tilapia fish (cichlid) fingerlings, 10 to 70 grams in size, have been stocked. The total number of fish stocked in each pond varied from 30 to 210. The experimental fish were supplemented (at a rate of 5% to biomass of the fish) with mixed meal from bran, oilcake and fish milling. Fish sample was taken every two months to evaluate their growth performance through time. The ponds had been supervised and managed regularly to keep the water at its optimum quality required for fish growth in a growout pond. The growth of fishes differed depending on place (altitude), structure, fish size and the pond water temperature fluctuations. The fish in circular shaped concrete ponds failed to grow very well, but 95% of the fish stocked in the rectangular ponds grown faster. Bigger fingerlings (70 grams) stocked at rectangular shaped ponds reached the recommended table size (150 grams and more) within 6 months of time. But those with smaller and medium size (below 40 grams) could not attain the expected size during the experimental time (7 months). The result of this

P a g e | 192 research trial assured the possibility of integrating fish farming with backyard agricultural production in water harvesting practices to sustain the livelihood and availability of additional food for the family.

Keywords : aquaculture, altitude, integrate, livelihood, shape.

Introduction Water is a universal need and is considered as a limiting factor for human and other organisms’ life. Despite the water source available in nature (whether stagnant or running), it is possible to trap water infiltrated from rain. Water harvesting is practice of collecting and storing water in ponds from different sources for beneficial use. It is the way to help insure adequate water supplies for household, agriculture, fish culture and other uses available to farms and communities. Those designed for livestock watering and irrigation must be built near the use they serve and also contain adequate water (Helfrich and Pardue, 1997). Ponds constructed for fish and wildlife production or recreation are designed and constructed for (1) easy access, (2) adequate volume and, (3) water level manipulation. Farm ponds can be designed and built to serve multiple purposes with advanced planning. Pond fish culture is the most popular method of growing tilapia. One advantage is that the fish are able to utilize natural foods (Rakocy et al, 2005) and farmers can receive higher net returns from fish farming integrated with crop cultivation using the harvested water. Even small ponds can contribute to farm income or reduce family spending as fish are sold, bartered or eaten.

The various types of aquaculture form a critical component within agricultural and farming systems development that can contribute to the alleviation of food insecurity, malnutrition and poverty reduction through the provision of food of high nutritional value, income and employment generation, decreased risk of production, improved access to water, sustainable resource management and increased farm sustainability (Little and Edwards, 2003). Aquaculture, especially integrated one, is sustainable because it makes use of locally available materials. Integration with other forms of agriculture diversifies farm productivity; provide opportunities for

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 193 intensified production with more efficient allocation of land, water, labor, equipment and other limited capital than enterprises which run independently. Fish culture integrated with garden irrigation, livestock watering and various domestic uses are all possible.

Production cost of fish, if the ponds are constructed once, is lower when compared with poultry, beef and pork. According to Rakocy et al (2005) approximately 22 kg of fish per year can be produced in an acre of pond. Fish convert food in to flesh efficiently as they are essentially weightless in water, and thus expend little energy for locomotion or maintain a normal upright position. They are cold blooded animals and do not expend energy to maintain a relatively high body temperature as other warm blooded ones. Thus, the amount of energy required to produce one kg of fish is much less than the amount required producing an equal weight of terrestrial animal.

Tilapia are extremely tough fish that can thrive in poor quality water on low- cost feeds (Bronson, 2005). They exhibit maximum growth rates at temperatures between 25 and 30°C (Bocek, 2003), making them more likely to become established and invasive in tropical climates. Nile tilapia ( O. niloticus ) is the least cold tolerant of the farmed tilapia and prefers tropical to subtropical climates. Nile tilapia ( Oreochromis niloticus ) is the most predominant species of tilapia in aquaculture (Gupta and Acosta 2004); and well adapted to artificial culture environments, gain weight quickly at optimum conditions and reproduce on the farm without special management or infrastructure. Nile tilapias ( O. niloticus ) reach sexual maturity at about 5 to 6 months (Gupta and Acosta 2004). The usual fingerling size supplied for grow-out ponds is mostly 1- 3 gram. Growth rate is very rapid during fingerling stages. During these stages they have different biological characteristics from adults, especially in terms of feeding habits, growth and habitat preferences, the growth rate declines as the fish gets older.

If the natural productivity of a pond is increased through fertilization or manuring significant production of tilapia can be obtained without

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 194 supplemental feeds. To maximize fish production, manure should be added daily to the pond in amounts that do not reduce dissolved oxygen (DO) to harmful levels as it decays. The ponds were fertilized by using organic fertilizers mostly from livestock sources at a rate of 10 kg for cattle, equine and sheep/goat manure and 6-8 kg for chicken in a 100 m² ponds every week. The maximum rate was determined on the quality of manure, oxygen supply in the pond and water temperature. The rate of manuring should be increased gradually as the fish grow (Rakocy and McGinty, 2005). Lime was applied at a rate of 1500 kg/ha to neutralize the pond water and promote the growth and multiplication of important planktons for fish.

The community in many areas basically lacks water for drinking and irrigation. The livestock animals yield is getting lower to the extent that couldn’t meet the protein requirement of the household. Alternative protein sources should be sought and fish could potentially be integrated with the water harvested in structures. Fish culture using these structures may be the best option among the possible integrations.

The general objective of this study was to demonstrate the integration of fish production on water harvesting pond used to supplement family food. The specific objectives were (i) to see the growth performance of Nile Tilapia in time and (ii) to quantify the amount of fish to be produced by the family in a pond,

Materials and methods The project was done in two zones of the Amhara region; namely East Gojjam and South Wollo. Six ponds among the other ones constructed by SWHISA were selected and stocked with target species of fish; three ponds from Goncha Siso Enesie and the other three from Wore-Illu. NileTilapia male fingerlings reared from on-station ponds were stocked to the ponds. Fish containing plastic sheets, bucket, oxygen cylinder, seine net, scoop-nets, gill nets, different chemicals, measuring board, sensitive balance, probing kits, microscope and chemicals were used. Mixed fish feed from different

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 195 locally available sources were used. The farmers were preparing and applying animal manure so as to fertilize the pond water.

Water parameter readings were taken before and after fish stocking is performed. Lime was applied at a rate of 1500 kg/ha. The fish were kept for 7 months from September till March.

The fish were supplemented with mixed feed of oil cake, bran and fish millings at a rate of 3:3:1 for the first three months where the fingerlings are expected to grow faster. Feeding rates adjusted on a monthly basis by estimating the fish biomass in the pond. To determine the fish biomass, fish fingerling samples were caught and weighed. The average weight of fish in the sample was multiplied by the number of fish stocked and alive.

Nile Tilapia fingerlings of different sizes, 10 - 20, 21 - 40 and 41 - 70 grams were used to test the growth performance and demonstrate the integration of tilapia fish in water harvesting ponds. The ratio of small, medium and big sized fingerling was 1:1:1 and the stocking density was 2 fishes in one square meter. The total number of fish fingerlings stocked in all experimental ponds was 600. Measurement has been made, every two months, on the biological and physical parameters of pond water using probes and kits as well as growth of fish using measuring board and balance. During sampling, as it is very difficult to count the whole fish stocked in the pond and compare with the original population, 20% of the fish was taken randomly for sampling (weight and length measurements). The experiment was conducted for 7 months in 2009/10 (September to March) and all the fish in a pond were harvested at the end of the experimental time.

Results and discussions The Effectiveness of the pond water for fish: Rectangular shaped concrete ponds were very good; rich in plankton, easy to add supplemental feed, easy to manage the fish, to fertilize the pond water and take samples of water and fish compared to circular ones. The rectangular pond has got fertilized within short period of time and the plankton species number, abundance

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 196 and distribution was better than circular ones. This is mainly due to the larger surface area of the pond water exposed to sunlight which in turn helps an active photosynthetic activity to take place.

There has not been a record of over fertilization of pond water in all areas. But, in a pond from East Gojjam, the level of water has dropped to 40 cm during the 4 th month after stocking and consequences the temperature fluctuation to occur. The pond water temperature seen raised and dropped so frequently from the optimum level for Nile Tilapia. It has dropped even to lethal level (below 2 0C) and all fish died within a day.

Once the farmers add manure (cow dung), the pond has got fertilized and become rich in plankton. Circular ponds with limited entrance of sunlight have got very low plankton biomass. The population of phytoplankton and zooplankton in rectangular ponds was much greater than circular ponds (Fig.1) indicating the suitability of rectangular ponds for fish production. Among the phytoplankton, moina were the dominant species and their number varied in between 37 and 80/ml, with an average of 67/ml of water. The average population of phytoplankton in circular ponds was 26/ml of water. The zooplankton diversity and population was higher also in rectangular wider ponds than circular ones.

Figure 1 Zooplankton biomass. ( 1 = Mytilia, 2 = Keratella, 3 = Cyclopoid, 4 = Filinia, 5 = Diaphanosoma, 6 = Nuplia, 7 = Branchionus, 8 = Diffuligia, 9 = Lepadela, 10 = Asplanchna and 11 = Moina) (Fig. 1: Missing on technical grounds)

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 197

Biomass of phytoplankton Rectangular Circular 100

40 Biomass (No./ml) 20

0 Mel Cos Ped Act Ela Sce Type of plankton

Fig. 2. Biomass of phytoplankton genera. (Mel = Melosira, Cos = Cosmarium, Ped = Pediastrum, Act = Actinastrum, Ela = Elakatathrix, and Sce = Scenedesmus)

The fish growth: More than 97% of the total fish stocked in a pond adapt and reached for harvest. There was no pronounced dissolved oxygen (DO) depletion.The total number of fish stocked (fish biomass) in the different ponds varied depending on the size of the pond. Those water harvesting ponds having 100 m 2 area has received 200 fishes of different size.

Nile Tilapia fishes stocked in one circular pond at East Gojjam zone could not adapt because of the lower water temperature happened in the area. In the remaining eight ponds fish were growing continuously. The biggest size of fish recorded at the end of the experimental time was 180 grams. The weight of a fish measured during total harvesting varied between 72 grams and 180 grams. The overall average weight of a fish attained at end of the 7 th month was 138 grams, including those fish stocked at their smaller size (10 grams).

Fish produced in ponds: An integration of fish farming with water harvesting ponds brought a new product to the farm family, edible fish. The total fish

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 198 produced in a pond varied in between 5 and 21 kg depending on the size and shape of the pond. Rectangular shaped ones were suitable for management and best for fish growth so that enabled individual farmers to harvest an average of 16 kg of Nile Tilapia fish in a 100m 2. Farmers could only produce 10 kg of fish in a circular pond having the same size. Bigger ponds (100 m 2) gave higher production 320gm/m 2 rate compared to smaller ones, and the total produce in this ponds reached 16kg.

Conclusion and recommendations In all the ponds, fish were successfully grown and possible to have a harvest at the 7 th month. All size of pond can produce fish, but rectangular ponds seen very suitable. According to this study, it is important for the farm family to stock different sized fingerlings, starting from 70g, so that continuous and earlier harvest is possible.

Fish introduction in water harvesting ponds is recommendable in food unsecured areas of the region especially because people in these areas are suffering by scarcity of protein as well as malnutrion is common phenomenon. Training should be given to the farm family towards pond water and fish management as well as fish handling, processing and feeding as the technology and fish will be new for the family.

References Bocek, R. (2003). Water harvesting and aquaculture for rural development. International centre for aquaculture and aquatic environments. Swing hall, Auburn University, Alabama. USA. Bronson H. (2005). Aquaculture Plan Florida Aquaculture Plan 2005-2006. Florida department of Agriculture and consumer services, Division of aquaculture. Florida, USA). Gupta M. and Acosta B. (2004). A review of global tilapia farming practices. Aquaculture Helfrich L. and Pardue G. (1997). Pond Construction: Some Practical Considerations.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 199

Little D. and Edwards P. (2003). Integrated livestock-fish farming systems. Inland water resources and aquaculture service. Animal production service Food and Agriculture Organization of the United Nations, Rome. Rakocy and McGinty, 2005. Pond culture of Tilapia. Published by Southern Regional Agricultural Center and the Texas Aquaculture Extension Service. USA. Asia Magazine IX (1).Virginia cooperative extension Fisheries and Wild life.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 200

Technology development and dissemination where there is no cultural practice: Lessons from on-farm aquaculture research in Amhara Region, North West Ethiopia

Berihun T. Adugna and Goraw Goshu College of Agriculture and Environmental Sciences, Bahir Dar University, Bahir Dar, Ethiopia; e-mail: [email protected] ; [email protected]

Abstract: Presence of cultural practices has an implication in the facilitation of technologies adoption. The decision making process of farmers involves a range of factors that are taken into account. Semi-intensive aquaculture practice started in 2005 in three administrative zones in Amhara region of Ethiopia. To assess the efficiency of new practices employed in Ethiopian aquaculture, an evaluation survey was undertaken in September 2009. Beneficiaries, key informants and groups of various levels were interviewed. It has been found that aquaculture ponds were different in source of water, structure, age, original purpose, level of integration and type of fish stocked. Farming households integrated aquaculture with different livestock and crop subsystems from the backward and forward side and increased the flow of nutrients. Farming households that have started harvesting benefited by satisfying their portion of protein demand and improve their income. However, the practice has been constrained by challenges related to natural and institutional circumstances and farmers’ awareness. Thus, aquaculture will potentially expand by integrating farming subsystems by additional options of framers’ research extension group approach; provision of gillnets, appropriate species related with altitudinal differences and monosex for the control of overstocking; capacity building of the research and extension system and proper follow up and assessment of the practice draws different lessons for similar technologies dissemination.

Key words: semi intensive; subsystem integration; fish stocking.

Introduction Integration, within the framework of agricultural production systems, can be defined as the linking of components of farming systems to each other to achieve synergisms in which an output from one component, which may

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 201 otherwise have been wasted, becomes and input to another component resulting in a great efficiency of output of desired products from the same land/ water area (Edwards 1998). One of the possible practices for integration in agriculture is aquaculture. In broad, aquaculture is the farming of aquatic organisms including fish, molluscs, crustaceans and aquatic plants. Farming implies some sort of intervention in the rearing process to enhance production, such as regular stocking, feeding, protection from predators, etc (Kathryn et al . 2004). Aquaculture can be classified to extensive, semi- intensive and intensive aquaculture based on production systems (UNESCO- IHE 2006). Especially, the former two types have important contribution in development of rural areas. Aquaculture can not only provide source of nutritionally healthy and affordable protein but simultaneously can create another important opportunities to poor families through creation of employment and additional income (FAO 2006).

Ethiopia is one of the oldest nations in the world and oldest independent country in Africa. It is the second most populous country in Sub-Saharan Africa having 79.4.2 million inhabitants in 2009 (CSA, 2010) and projected size of 129.8 million people by 2020 (Lasonen et al. 2005). Ethiopia is one of the least developing countries. Nearly 44 % of Ethiopia’s population lives below the national poverty line (UNDP 2005). About 85 % of Ethiopia’s population is rural. The agricultural sector in Ethiopia contributing nearly half of GDP, employs 85 % of the population, and is largely rainfed (MoFED 2006). Hence, the country’s growth is highly dependent on the performance of this sector.

Gorden et al. (2007) has estimated aggregate demand growth for fish in Ethiopia to be 44 % over ten years. The current increasing market demand for fish protein in Ethiopia can be satisfied only when the capture fishery is supplemented by aquaculture that provides relatively cheaper animal protein (Ashagrie et al. 2008). The increasing practice as a result of growing demand also opens alternative livelihood opportunity for various production and market participants at different stage and level of intervention. As a result, aquaculture has been promoted in the Amhara administrative region

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 202 of Ethiopia in the recent years to satisfy portion of the animal protein demand and to open alternative income generation opportunity as stated earlier. While different production systems and technologies have developed, they should be verified and evaluated by the beneficiaries before their larger dissemination to readjust limitations and meet expectations with appropriate “know-how” (Ngomane 2003).

Therefore, this paper presents socioeconomic assessment of integrated aquaculture practice tested in the Amhara region with special emphasis on production efficiency and applicability for common practice.

Materials and methods Study area: Amhara region is one of the regions situated in North West of Ethiopia. It covers an area of 170 150 km 2, which is 11% of the total area of the country (Amhara Development Association 2009). It is situated from 9 0 to 13 0 45’ N and from 36 0 to 40 030’ E. It is bounded by Tigray in the North, Oromia in the South, Afar in the East and Benshangul and Sudan in the West. Its altitudes range from about 600 m to 4260 m above sea level and these lowest and highest altitudes are both in North Gondar administrative zone (Abay 2001)

Data type, source and method of collection and analysis: This study was conducted by Amhara Region Agricultural Research Institute (ARARI) – Bahir Dar Fishery and Other Aquatic Life Research Center (BFLARC). The general reconnaissance survey on socioeconomic assessment of aquaculture using rapid rural appraisal techniques including interviews of current (communities presently involved in aquaculture practice) and potential (communities not involved in aquaculture practice) stakeholders using a checklist of questions, group discussions and inspections of aquaculture ponds was held in September 2009. The data collected includes the type and characteristics of ponds and participant households; management, challenges and return of the aquaculture practice; perception of neighboring community members; type of institutions and their service in the development and dissemination of the practice; and suggestions. From the total of twelve districts from West

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 203

Gojjam, East Gojjam and Agew Awi administrative zones in Amhara administrative region (Fig. 1) where aquaculture settled in the previous years, about eighteen ponds located in six purposively selected districts supposed to represent the practice in the study area have been visited. Aquaculture development has suitable water conditions in all three surveyed administrative areas, with Agew Awi zone having the richest water resources. Along with review of relevant literatures different governmental and non-governmental organization had been contacted.

Fig. 1 . The study area (West Gojjam, East Gojjam and Agew Awi Zones of Amhara Region)

Results Background of aquaculture development in the Amhara administrative region: Generally, the main agricultural activity of the community is mixed farming system of crop and livestock husbandry typical to other parts of the Amhara region. Protein from livestock source in general and meat consumption in particular is low. Such socio-economic situation is highly favorable for alternative animal protein production like aquaculture.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 204

Aquaculture in Ethiopia primarily started around Sebeta as an extensive practice in the 1970s by taking fingerlings from rift valley lakes. This extensive aquaculture practice has been also adopted in Amhara region around 2004 by stocking constructed dams with fingerlings from Sebeta and lakes in Wollo. Similar semi-intensive type of aquaculture started in 2005 by BFLARC in the East and West Gojjam administrative zones and followed by the Agew Awi zone. Following this initiative, Bureau of Agricultural and Rural Development and some non-governmental organizations expand the practice in some areas such as the South Wollo zone. This extension service includes training on aquaculture, provision of fishing gears and fingerlings, and monitoring farmers’ on farm practice. Major fish species used for aquaculture were O.niloticus and C. carpio . Aquaculture package has also been developed with six major steps (Fig. 2). These are selection of appropriate fish species, construction of aquaculture pond, water supply, fertilization of the pond, stocking and monitoring of the farmers’ practice (unpubl. BFLARC 2004).

Fig. 2. Steps of aquaculture implementation in Amhara region, Ethiopia (Authors’ representation of BFLARC, 2004)

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 205

Household characteristics: Aquaculture ponds were owned by individual households and government offices (Agriculture and rural development offices). About 44.4 % of the visited ponds were owned by individual farmers and the rest by government bodies. These households were found to be all men-headed households with significant contribution of family members in aquaculture management. Except some individual households at the Debre Elias district of the East Gojjam zone, most of them were situated in rural areas. Most of the participants were early adopters of other agricultural extension services and some of them were having an award at regional or national level for their success in promoting their livelihood.

Type of aquaculture ponds: As stated earlier, semi intensive aquaculture practice in the study area started in 2005 by BFLARC followed by Agricultural and Rural development offices using government budget or supported by non-governmental organizations, but most of the ponds were constructed in 2006/07.

The aquaculture ponds differed in source of water, size, depth, age and original purpose of construction, water losses controlling mechanism (use of geo membrane), source and level of pond water fertilization, site of construction, number of ponds at each site, level of integration and species of fish stocked. All ponds were drainable and most of them were stocked with O. niloticus, rectangular in pond shape and surface water in source. Nearly half of the ponds were individually owned and most of them were earthen ponds. While most of the ponds owned by the government were geomembrane lined (Table I).

This survey revealed that there were two major ways for constructing ponds. Most of the ponds were constructed for practicing aquaculture. However, there are some ponds which were also water harvesting structures or naturally formed grounds adopted with some modification. Aquaculture ponds were constructed usually around homestead for better follow-up and more efficient labor allocation for transpiration of inputs for composting and

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 206 fertilization, especially in the rainy season. Individual households rarely construct ponds on farmlands. Sources of water for ponds were found to be either subsurface flow of groundwater or surface flow of water using canals from rivers and springs. Almost all constructed ponds have rectangular shape with an estimated depth of 1 m to 1.5 m and size ranging from 20 to 500 square meters. In addition, only some research center managed ponds had sealed bottoms with geomembrane to control water percolation to the ground, since the soil type of most ponds are vertsol, which are known to have less water retention or holding capacity.

The fish type stocked to the ponds was mainly mixed sex Oreochromis niloticus . The parent stock was from Geray reservoir for East Gojjam ponds and from Lake Tana for Agew Awi and West Gojjam based on the principle ‘the same watershed the same species’. Farming households fertilize the pond either using well prepared compost from animal and crop products and mud, or simple cow dung in a period ranging from a week to two or three months. The maximum number of ponds was two at individual farming household level and four to institutions.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) Page 207

Table I. Major pond’s characteristics in the surveyed districts (Survey result)

No. of Source of District Owner Shape Fish stocked Bottom seal ponds water Enemay 2 Individual Rectangular O. niloticus Subsurface Earthen pond Enemay 1 Individual Rectangular O.niloticus Subsurface Earthen pond Gozamen 2 Individual Rectangular O.niloticus Surface Earthen pond C. carpio Machakel 2 Agri. office Rectangular O.niloticus Surface 1 Earthen pond and 1 concrete pond Machakel 1 Individual Rectangular O.niloticus Surface Earthen pond D/Elias 2 Individual Rectangular O.niloticus Surface Earthen pond Guangua 4 Agricultural 3 rectangular O. niloticus Surface 1 earthen pond and 3 office and 1 circular geomembrane lined ponds South 4 Agri.office 3 rectangular O.niloticus Surface 1 earthen pond and 3 Achefer and 1 circular geomembrane lined ponds Page 208

Discussion Aquaculture and subsystem integration: Edwards (1998) has defined integration as the linking of components of farming systems to each other to achieve synergisms in which an output from one component of the system becomes an input to another component resulting in a great efficiency of output of desired products from same land or water body. It is classified into two - physical integration and linking sub systems through resource flows. Aquaculture practice in the study area is the latter type and has evolved into three subsystem integration levels with identified two major directions of subsystem integrations. The aquaculture ponds are considered central points for different subsystems integration analysis. There are some agricultural practices that provide input or support for the aquaculture ponds related to different farming subsystems. This situation is called backward subsystem integration, which includes the following practices:

Compost preparation for aquaculture was using dung from livestock and it depicts backward integration of livestock subsystem. Application of grasses, weeds and non marketable residual of horticultural crops by farming households for feeding fishes and preparing compost can be considered as backward integration of aquaculture with the crop subsystem. Trees plantation on the borders of ponds stabilize ground of the pond and control the pond from floods, and are also used for direct feeding of fishes and for compost preparation. Commonly planted border tree was Susbania spp , and this can be considered as backward integration of aquaculture with the agroforestry subsystem.

On the other hand, there are other practices that use outputs or explicit P a g e | 209 and implicit advantages of the aquaculture pond and border plantations for different purpose. This is referred to as forward subsystem integration. In addition to supporting households with additional protein and income, forward subsystem integration also includes the following practices:

Irrigating horticultural crops and nurseries: - aquaculture pond water was used for fertigation of land for irrigated horticultural crops and tree seedling nurseries, which improves nutrient composition of the soil by fertilization. Livestock feed:- trees like Susbania spp planted on the border of aquaculture ponds used for livestock feed by cut and carry system. Fence and fuel wood: - farming households cut the border trees also for fuel wood and fence. By doing this, farmers allow the copies to regenerate and overcome the shading effect of trees on ponds. Use of the water for cattle watering, washing of clothes and even for drinking

These subsystem integrations, however, were not exclusive and a subsystem can integrate from both sides. Based on the above types and intensity of integration, there can be three levels of integration in aquaculture practice of the Amhara region (Fig. 3):

Lower level subsystem integration: - this is backward system of integration of aquaculture ponds with the livestock and crop subsystem by fish feeding and pond fertilizing compost preparation only. Medium level subsystem integration: - This is the more dominant type and it includes backward integration of the previous and forward integration of aquaculture with irrigation of crops.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 210

Higher level subsystem integration: On top of the above, this has further integrated aquaculture with animal fattening and dairy farming. Some farming households has reached this level of integration.

Fig. 3. Integration level of subsystems with aquaculture in Amhara region, Ethiopia (Authors’ representation of survey result)

Consumption and marketing: The main objectives of farmers in developing aquaculture production were to supply households with

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 211 valuable animal protein or provide income from additional crops. Due to lack of local tradition in fishing and fish consumption, farmers’ families were trained on management of aquaculture ponds and fish processing both for internal and external purpose. Even though some participant households did not start harvesting fish, mainly due to earlier evaluation before maturity and some management problems, most of them started consuming cultured fish. Average household consumption was 4 to 6 fishes per week or two weeks.

Some farmers started providing fish to nearby town hotels, restaurants and residents, local level employed workers such as development agents and teachers and rural households in some cases. For example, one of the respondents in Enemay district of East Gojjam administrative responded that average price per fish ranged from 3.5 to 6 Ethiopian Birr. As a result, his average income from aquaculture products sold at Debre Markos and Amanuel towns in the East Gojjam administrative zone reached 250 to 400 Ethiopian Birr 3 per month. But there is no consistent production in each month. The GDP per capita of the region in the year 2005 was 812.1 Ethiopian Birr (BoFED 2010). Based on consideration of the ten years GDP per capita growth, 1.4 %, GDP per capita of the region in the year 2009 can be estimated to be 858.5 Ethiopian Birr. Thus, this indicates the considerable contribution of the practice in improving household income. However, the price of fish was not more than 3.5 Ethiopian Birr per fish during the study period in inaccessible areas like Debre Elias district of East Gojjam.

Farming households costs of aquaculture production include food left- overs and compost for fertilization. They have sold fish either by number

3 One USD equals to 12 Ethiopian Birr by mid 2010.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 212 or weight (kg). The other type of revenue of aquaculture leaders was selling fingerlings to new pond facilities in the same or different districts facilitated by research and extension agents. Average price was 1 to 1.5 Ethiopian Birr per fingerling. The main success factors or performance determinants of aquaculture ponds were proper understanding and follow-up of the individual households and family members, frequency of follow-up by research or extension institutions, appropriateness of agro-ecology and presence of cultural practice of the community on fishery.

Fig. 4. Farmers on field day visiting aquaculture pond of Meku at Enemay district of East Gojjam, Ethiopia (Photograph by Sida-Amhara Rural Development Program, 2006)

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 213

Challenges: Aquaculture and subsystem integration in the practice in the Amhara region is facing the following major challenges related to the natural and institutional factors and farmers’ awareness and management. • Stock control: - when stocking with fingerlings of early maturing species with both sexes present in the stock, like the commonly practiced culture of Oreochromis niloticus, which has non-seasonal continuous breeding. As a result, growth retardation or increased mortality due to overstocking was observed. • Control of weeds, pests and predators: - such animals as frogs constrain aquaculture practice in the study area. Fore example, a pond at Yewela kebele of Machekel district in the East Gojjam Zone was out of fish when this survey was held due to the frog removal action. Some farmers reported that they were also facing problems with piscivorous birds, which was most frequent from November to May. • Unsuitable weather condition for the stocked fish species type: - even though most of the farmers do not recognize the problem, some experienced the negative impact of the incidence of frost usually in October and November. However, farmers like have tried to warm the micro climate by burning fuel wood at the border following advice they got from the extension agent. • Silt formation and sedimentation: - even though, this was not necessarily caused by natural action only, the problem due to more difficult control of flood and management of aquaculture pond border occurred. • Fishing gears unavailability and quality problem: - the main source of fishing net for the community has been Bahir Dar Fishermen Cooperative – No 1. District agricultural and rural development

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 214

offices did not provide fishing gears to all farmers. In addition, some farming households have complained that the mesh size of the gillnet provided was too large to catch fish from ponds. • Lack of proper know-how: - sometimes support provided by the research centers and agricultural and rural development offices was not sufficient due to lack of budget and human resource constraints. • Marketing problems: - there was a marketing problem especially in remote districts and in localities without cultural fishing practice. • Relative low concern of the region: - surveyed region is first that started semi-intensive aquaculture. However, the extension service with appropriate allocation of budget and human resource assignment was still lower relative to other regions starting to adopt the practice latter. • Incomplete awareness of farmers: - farming households were not aware of all the management aspects of aquaculture and there has also been incomplete transfer to other participating family members. • Inappropriate management practices: - some farming households used malaria protection net as fishing gillnet. But, weather the net has been free from chemicals or not is in doubt. In addition, it resulted in missing fingerlings due to mass capturing. Some farmers store fishing nets in inappropriate places, as result the net was destroyed by rats making harvesting the ponds impossible.

Opportunities: The following are major opportunities for the expansion of integrated aquaculture in the Amhara Region.

• Agro-ecology: - the altitude, temperature, soil and other agro- ecological components of different areas of the region are appropriate for aquaculture.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 215

• Farming subsystem: - the farming system of the Amhara region is dominated by mixed farming system of crop and livestock subsystems, which can be integrated with aquaculture. • Fishery tradition: - the presence of cultural fishing practice is important for easy transfer of aquaculture. Therefore, the presence of a number of lakes and rivers and fishing cultural practice in these water bodies is important for aquaculture expansion in the region. • Availability of nursery sites: - in each districts of the Amhara region there are a number of nursery sites. These nursery sites usually have water sources and assigned agricultural extension agents, prepare compost and they are centers of know-how demonstrations. Therefore, they are appropriate to raise stocking material, provide training of aquaculture pond construction and good aquaculture practice, and they are important for the development and extension of aquaculture in general. Especially, they can be centers for hatchery and nursery aquaculture ponds for certain surrounding localities. • Presence of fishery legislation. • Aquaculture development strategy recently developed and commissioned to the government

Conclusion and recommendations The development of extensive aquaculture in Ethiopia to semi-intensive aquaculture has been developed in the Amhara region and this recent practice has significant contribution to the livelihood development of the participants by numerous benefits achieved from aquaculture, like fish consumption and marketing, and derived benefit from the backward and forward side integrated crop, livestock and agro forestry subsystems. In addition, the general socioeconomic assessment of aquaculture practice in Amhara region has the following implications for other similar

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 216 research, development and extension activities:

• Extension and cultural practice of technology: - even though, there has been cultural practice of fishery activity in some parts of the study area and the Amhara region in general, there was no traditional practice of aquaculture. Therefore, the approaches and feedbacks in this regard are important for other similar technologies lacking cultural practice at grassroots level. • Step by step strategy: - the region started from extensive aquaculture and promotes itself to semi-intensive aquaculture with a manageable smaller size pond at farming household level and one relatively preferred fish species, Oreochromis niloticus , which is both tolerant species both to the environmental conditions and handling, and which has flesh of high quality. • Starting by early adopters of other agricultural technologies: - the dissemination of aquaculture practice was started by early adopters of other technologies or farmers that were successful with introducing other agricultural technologies, who were playing a role of risk taker, socially acceptable and regionally or nationally awarded for their efforts. • Integration with processing and marketing subsystems: - a number of technology extension activities lack consideration of post-production output management aspects of technology like handling, processing, consumption and marketing. But, the integrated aquaculture practice in the Amhara region tries to fill the gap in the post- production processing of fish by training family members and linking the beneficiaries with potential markets. • Gender consideration: - family members have their own contribution to decisions and adoption of technological practices. Women in the integrated aquaculture practice were participated in the fertilization

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 217

of ponds, irrigation and selling horticultural crops, and processing fish. Therefore, training of women in extension process has an implication in other research and development activities.

The following are major recommendations derived from this study for the expansion of aquaculture, better integration with other subsystems, improvement of household livelihood and increased contribution of the sector to the national development:

• Screening of indigenous fish species for aquaculture; • Research on adaptive alternative fish feed development; • Determination of fish size for consumption among different species; • Selection and provision of more tolerant and productive fish species for different altitudes and agro-ecologies rather than blanket recommendation and provision of Oreochromis niloticus ; • Increasing integration of traditional production subsystems with aquaculture; • Provision of appropriate fishing gears for fish pond harvesting; • Encouraging farmers to invest in aquaculture by supplementary feeding of fish together with pond fertilization to increase aquaculture productivity; • Provision of mono-sex fingerling to farmers to control overstocking; • Know-how provision to achieve best practice in semi-intensive aquaculture; • Assignment of facilities for fingerlings transportation; • Development, adoption and provision of data collection formats or sheets for recording events and transactions for proper and easier monitoring and evaluation;

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 218

• Increasing concern for fishery by assigning sufficient personnel at regional, zonal and district level including in districts without current fishing cultural practice; • Capacity-building of Bahir Dar Fishery and Other Aquatic Life Research Center and training of concerned experts in the extension system; • Organizing Farmers’ Research and Extension Group (FREG) for communal grassroots level monitoring, evaluation technology development and possible establishment of communal nursery and hatchery sites to have advantage of economic of scale.

References Abay, K. 2001 Wetland distribution in Amhara Region, their importance and current threats, Paper presented on wetland awareness creation and activity identification workshop, Bahir Dar, Ethiopia. Pp. 13-16. Ashagrie G., Abebe G., Seyoum M. 2008. Effect of stocking density on the growth performance and yield of Nile tilapia [Oreochromis niloticus (L., 1758)] in a cage culture system in Lake Kuriftu, Ethiopia, Aquaculture Research , 1(11). Amhara Development Association 2009. Amhara region and its peoples. http://www.telecom.net.et/~ada/amhara.htm BFLARC 2004. Fish resource development, use, management and aquaculture package manual , Bahir Dar Fishery and Other Aquatic Life Research Center, Bahir Dar, Ethiopia (Unpubl.). BoFED 2010. Development Indicators of Amhara Region 2008/09, Bureau of Finance and Economic Development of Amhara Region, Bahir Dar, Ethiopia http://www.amharabofed.gov.et/publications.html CSA. 2010. National Statistics of the year 2009, Central Statistical authority of Ethiopia, Addis Ababa, Ethiopia

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 219

Edwards, P. 1998. A system approach for the promotion of integrated aquaculture. Aquaculture Economics and Management , 2(1), pp. 1-12. Gordon, A., Sewmehon, D., Melaku, T. 2007. Marketing systems for fish from Lake Tana, Ethiopia: Opportunities for improved marketing and livelihoods. IPMS (Improving Productivity and Market Success) of Ethiopian farmers project Working Paper 2. ILRI (International Livestock Research Institute), Nairobi, Kenya. Kathryn W., Brendan O., Zdravka T. 2004. At a Crossroads: Will Aquaculture Fulfill the Promise of the Blue Revolution? A SeaWeb Aquaculture Clearinghouse report. http://www.seaweb.org/ resources/documents/reports_crossroads.pdf Lasonen, J., Kemppainen, R., Raheem, K. 2005, Education and Training in Ethiopia: An Evaluation of Approaching EFA Goal . Institute for Educational Research, Working Papers 23, University of Jyvaskyla, Finland MoFED. 2006. A Plan for Accelerated and Sustained Development to End Poverty (PASDEP) (2005/06-2009/10) , 1(main text) Ministry of Finance and Economic Development, Addis Ababa, Ethiopia http: //planipolis.iiep.unesco.org/upload/Ethiopia/Ethiopia_PASDEP_2 005_2010.pdf Ngomane, T. 2003. The evaluation of extension process and practices in relations to small holder farming in South Africa . Paper presented on the fourth international Crop Science Congress in December 1-3, 2003, South Africa. Poynton, S.L. 2006. Regional review on aquaculture development. 2. Near East and North Africa – 2005. FAO Fisheries Circular No. 1017/2, FIRI/C1017/2, FAO Fisheries Department, Food and Agriculture Organization of the United Nations, Rome. ftp://ftp.fao.org/docrep/fao/009/a0635e/a0635e00.pdf .

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 220

UNDP. 2005. Linking the National Poverty Reduction Strategy to the MDGs: a case study of Ethiopia . United Nations Development Programme. http://www.et.undp.org UNESCO-IHE. 2006. Integrated Wetland Production System. Institute of Water Education, Lecture notes in IHE (Unpubl.).

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 221

Atelomixis as a driving force of phytoplankton assemblages in an African-highland Lake Hayq, Ethiopia

Tadesse Fetahi 1,2* , Michael Schagerl 2, Seyoum Mengistou 1 1 Addis Ababa University, Department of Biology, P.O. Box 1176, Addis Ababa, Ethiopia 2 Vienna University, Department of Limnology, Althanstraße 14, A-1090 Vienna, Austria *corresponding author; email: [email protected]

Abstract: The trophic status of Lake Hayq, Ethiopia, changed from oligotrophic condition to a stable eutrophic status some 20 years ago. As a tropical-highland lake, the diel thermocline developed during day time could be destroyed at night due to nocturnal cooling as the average difference between minimum and maximum temperatures was very large. However, the deeper seasonal chemocline remained stable, restricting the mixing depth within the epilimnion.

The lake is moderately deep lake (Z max = 88 m), but the phytoplankton biomass was dominated by relatively heavy phytoplankton diatoms. Therefore, we hypothesized that the physical variable (in particular partial atelomixis sensu Barbosa & Padisăk) is a determinant factor that drives the phytoplankton assemblages of Lake Hayq. To address this question, primary production and phytoplankton biomass, zooplankton abundance, nutrients and physicochemical variables were measured on a monthly basis from October 2007 to October 2008 at two stations. Moreover, historical records were analyzed and compared with actual data. The overall mean concentration of dissolved inorganic nitrogen was 305 µg L -1, with ammonium being the primary form. Similarly, SRP was 22 µg L -1; TP 58 µg L -1 and Si 3.7 mg L -1. In the 1940-ies only diatoms were reported; however, algal groups and taxa numbers in the present study have increased. Out of 40 phytoplankton taxa identified, chlorophytes and diatoms contributed 77%, but the biomass was dominated by diatoms with Fragilaria , Navicula and Synedra ulna as the most abundant functional groups.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 222

CCA indicated that the chlorophytes were associated with nutrients and rainfall, and the diatoms with silica and zooplankton. An overall mean phytoplankton fresh biomass of 1.10 mm 3 L-1, mean Chlorophyll a (Chl a) of 12.9 mg m -3 and -2 -1 gross primary production of 7.12 g O 2 m d gave Lake Hayq an intermediate position compared to other tropical lakes. Chl a was influenced by rainfall, temperature and light supply. The dominance of comparatively heavy diatom assemblages could be explained through partial atelomixis, which maintains the sinking diatoms within the euphotic depth via regular re-suspension. The phytoplankton functional association and succession exhibited in the lake fits the classification scheme developed by Reynolds et al. and can be useful to describe the quality of the water in the region.

Keywords: Lake Hayq; limnology; nutrients; phytoplankton; trophy.

Introduction Tropical limnology in Africa predominantly began in the second half of the twentieth century largely due to short-term expeditions (Talling & Lemoalle, 1998). Compared to temperate systems, however, African inland waters have been studied only scarcely, with a few exceptions (Ganf, 1975; Hecky & Fee, 1981; Talling, 1957; Talling, 1965; Vareschi, 1982). This is particularly true of Ethiopian highland lakes even though rift valley lakes have been relatively better studied (Kebede & Belay, 1994; Kifle & Belay, 1990; Lemma, 1994).

In this study, we investigated the deep Lake Hayq located in the highlands of Ethiopia, which was one of the earlier visited lakes in Africa (Cannicci & Almagia, 1947; Vatova, 1940; Zanon, 1941). The latter described the lake as ‘limpida e verdastra’, which means ‘clear and greenish water’. Baxter & Golobitsch (1970), after about 30 years, also described it as ‘an unusual clear-water lake’ with a Secchi depth of 9 m, very low algal biomass (< 1 mg m -3 Chlorophyll a = Chl a) and oxic

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 223 conditions down to 40 m depth. Nevertheless some years later, Kebede et al. (1992) reported the remarkable changes of the lake into a eutrophic status, with water transparency of only around 1.2 m, Chl a concentrations between 13 and 23 µg L -1 and the absence of oxygen below 15 m. Based on their snap-shot survey, Kebede et al. (1992) proposed two hypotheses for the trophic change of the lake: (i) an increased nutrient to volume ratio and (ii) the introduction of Tilapia (Oreochromis niloticus Linnaeus 1758 ) in the late 1970-ies. Phytoplankton growth and biomass can be regulated by availability of resources (Zhang et al., 2007) and/or through top-down control (Spencer & King, 1984), while its relative importance can be determined by the trophic status (Elser & Goldman, 1991).

A change in trophic status could impact not only the phytoplankton biomass (Kebede et al., 1992), but also its food quality, which in turn affects the transfer efficiency (e.g. fatty acids) and alters the food web structure along the trophic levels (Muller-Navarra et al., 2004). The latter authors have documented that the more nutritious ω3-High Unsaturated Fatty Acid (HUFA) were higher in oligotrophic lakes compared to eutrophic ones that could affect the growth and performance of zooplankton. Fish kill and a decrease in species richness and diversity were also associated with eutrophication (Dodds, 2002). In the case of Lake Hayq, Tilapia was found to be superior in lipid quality to other tropical fish species (Zenebe et al., 1998a, b). The authors related their finding to the diet content of the fish, in particular to diatoms that dominated the phytoplankton biomass of the lake (Kebede et al., 1992). Intriguingly, a later survey revealed that the same fish species of Lake Hayq contained a lower fatty acid quality than the one found in other lake (Tadesse, 2010). These findings suggested that the study of seasonal

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 224 phytoplankton assemblages and pelagic production are fundamental to understand the energy flux and trophic interactions in the ecosystem.

Phytoplankton assemblages reflect autecological aspects of preference and tolerance, as phytoplankton species have developed morphological and physiological adaptive strategies for surviving in different environments (Reynolds, 1997; Reynolds, 2006). Accordingly, use of phytoplankton assemblages for monitoring the ecological status of lakes has been recommended (Reynolds, 2006; Betănia et al., 2008). The assemblages (and intuitively their succession) can be structured by physical, chemical or biological variables. Of physical factors, atelomixis – stratification and de-stratification taking place within 24 h -- has been employed to characterize the phytoplankton assemblages of tropical deep water bodies (Lewis, 1973; Reynolds, 1997; Barbosa & Padisăk, 2002), and its ecological significance was discussed by Barbosa & Padisăk (2002). Partial atelomixis – diurnal mixing restricted to the epilimnion sensu Barbosa & Padisăk (2002), in particular, was found to be a driving force of phytoplankton assemblage in tropical and subtropical water bodies (Lewis, 1978; Lewis, 1986; Tavera & Martinez-Almeida, 2005; Betănia et al., 2008). For instance, the dominance of relatively heavy, non-buoyant and non-motile planktonic desmids in South American tropical lakes and reservoirs were explained through partial atelomixis (Barbosa & Padisăk, 2002; Tavera & Martinez-Almeida, 2005; Betănia et al., 2008). Even though recent studies have demonstrated the importance of atelomixis to explain the dominance of heavy phytoplankton assemblage in tropical lakes and reservoirs, it has been applied rarely for tropical-African water bodies.

This study was designed to investigate the current status of the phytoplankton composition, primary production, and biomass of Lake

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 225

Hayq. We also measured other limnological variables including the major nutrients and water chemistry. This is the first spatial and seasonal study for Lake Hayq since no previous planned research was conducted, predominantly due to its remote location. We discussed the phytoplankton community composition in comparison with historical taxonomic lists and also characterized the major functional groups sensu Reynolds et al. (2002) and Padisăk et al. (2009). Lake Hayq is relatively deep lake (Z max = 88 m), dominated by diatoms with pronounced chemical stratification (Baxter & Golobitsch, 1970; Kebede et al., 1992). Therefore, we hypothesized that the physical variable (in particular the unique partial atelomixis) is a determinant factor that drives the phytoplankton assemblages of Lake Hayq.

Material and methods Study area: Lake Hayq (11 o15’ N, 39 o57’ E) is located some 440 km north of Addis Ababa, the capital of Ethiopia, at an altitude of 2,030 m a.s.l. (Fig. 1).

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 226

Fig. 1. The map of Lake Hayq together with sampling stations (dots: SS- Shore Station and OS- Open Station) (redrawn from Demlie, 2007). The study area is categorized as sub-humid tropical with an annual rainfall of 1173 mm and a mean air temperature of 18.2 oC (National Meteorological Service Agency). Based on rainfall data since 1963, the major rainy season is from July to September. During the present study, there was no rainfall from December to March, which is considered as dry season (Fig. 2). Until some 20 years before, Lake Hayq was connected to the nearby Lake Hardibo (11 014’N, 39 046’E; altitude 2150 m a.s.l.) through the Ankwarka River. However, at present these lakes are terminal and there is no known surface outlet due to the irrigation scheme upstream. Lake Hayq is a deep, steeply shelving lake, with a maximum depth of 88 m recorded in 1938 (Table 1).

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 227

Table 1. Morphometry of Lake Hayq (from Baxter and Golobitsh, 1970)

Variables Values Max. Len gth (north -south) 6.7 km Max.Width 6.0 km Shoreline 21.7 km Surface Area 23.2 km 2 Max. Depth 88.2 m Mean Depth 37.37 m Volume 0.867 km 3

It is a freshwater lake with a salinity of 0.828 g L -1 (Zinabu et al., 2002). Predominant cations and anions are magnesium and carbonate/ bicarbonate, respectively (Table 2). The fishes that inhabit Lake Hayq are Oreochromis niloticus (Nile Tilapia), Clarias gariepinus Burchell 1822 (African catfish), Cyprinus carpio (common carp) and Garra dembecha Getahun and Stiassny 2007. The last two fish species were introduced in Lake Hardibo most likely in 1980, and eventually reached Lake Hayq due to the connecting river (Tizazu, personal communication). Tilapia is also a stocked fish (Kebede et al., 1992) putting catfish as the only indigenous fish species (Baxter & Golobitsh, 1970).

Fig. 2 Air temperature (mean, maximum and minimum) and rainfall data near Lake Hayq during the sampling period from Oct. 2007 to Oct. 2008. (Data from National Meteorological Services Agency) (Fig. 2: Missing for technical reasons).

The dominant zooplankton species are Mesocyclops aequatorialis Van de Velde 1984, Thermocyclops ethiopiensis Kiefer 1934, Ceriodaphnia reticulata Jurine, Daphnia magna Straus 1820, Diaphanosoma excisum

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 228

Sars and the common rotifers includes Euchlanis parva Rousselet 1892, Keratella tropica Apstein, Polyarthra sp. (Fetahi et al., submitted-b). The land uses in the catchments include agriculture (on steep land) and livestock grazing.

Sampling protocol and analytical methods: Routine sampling and in situ measurements were carried out on a monthly basis between October 2007 and October 2008 at shore station (SS) and open-water station (OS) with a mean depth of 18 m and 78 m, respectively. Temperature, conductivity, pH and dissolved oxygen were measured in situ using a portable all-in-one meter (Model HQ 40d Multi Hach Lange). Water transparency was estimated using a standard Secchi disc of 30 cm in diameter. Light penetration was measured with a portable light meter

(Skye 200, Skye Instrument). The vertical light extinction coefficient (K d, -1 m ) was computed using direct light irradiance measurements (K d= (lnI o- lnI z)/Z)), where I surface light irradiance, I z light irradiance at a certain depth and Z depth. Euphotic depth (Z eu ), the depth at which 1% incident irradiance available, was determined using Z eu = 4.6/ K d. Water for physico-chemical variables including Chl a, organic matter and algal nutrients was sampled at the surface and at 2, 5, 10, and 15 m at SS, and the same measurements were undertaken at OS (surface, 5, 10, 20, 30, 40, 50 and 60 m depth). Samples were transferred and stored under ice until analyses were made at Addis Ababa University, Ethiopia. Total alkalinity was determined from the unfiltered water sample through titration with 0.1 N HCl with bromocresol green/methyl red used as end point indicator (Wetzel & Likens, 1991). Water samples were filtered through Whatman GF/C filter paper and the filtrate was used for the determination of dissolved inorganic nutrients. Soluble reactive phosphorus (SRP) was determined spectrophotometrically using the + Ascorbic Acid method, ammonium (NH 4 -N) was analyzed with the Indo-

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 229 phenol Blue method and nitrate (NO 3-N) was analyzed using the Sodium- salicylate method (APHA, 1995). Nitrite (NO 2-N) determination was carried out using the reaction between sulfanilamide and N-naphthyl-(1)-

ethylendiamin-dihydrochloride. The reactive silica (SiO 2) was measured using Molybdosilicate method (APHA, 1995). To determine total phosphorus (TP), unfiltered water samples were digested using potassium-peroxodisulphate, autoclaved at 120 oC for 50 minutes and measured following the standard SRP procedure (APHA, 1995).

For Chl a, water samples were filtered onto duplicate Whatman GF/C glass-fiber filters and the filters were deep-frozen overnight to facilitate extraction. Then the filters were homogenized and extracted in 90% acetone for 12 h. Chl a was determined spectrophotometrically after centrifugation at 665 nm without phaeopigments correction (Talling & Driver, 1963). To determine dry mass (DM), defined volumes of water sample were filtered using combusted- pre-weighed filters (Whatman GF/C) and dried at 95 oC. Ash mass (AM = inorganic content) was determined by combusting the dry mass in a muffle furnace for 2 hours at a temperature of 450 ± 50 oC. Organic matter (OM) was calculated by OM = DM - AM . For phytoplankton biovolume analysis, integrated water samples were taken down to depths of 20 m and immediately fixed with Lugol´s solution. Algal abundance per unit water volume was estimated by the Utermöhl method using an inverted microscope (Nikon Diaphot) equipped with phase contrast device at 400x magnification. The volume of individual taxa was estimated by applying equivalent geometric shapes to cell forms by direct measurement of the cell dimensions (Sun & Liu, 2003; Hillebrand et al., 1999; Wetzel & Likens, 1991). The cell biovolume was converted into biomass by using a conversion factor of 1 (Wetzel & Likens, 1991). In parallel, net samples were collected using 30 µm mesh size from 20 m depth to surface. Phytoplankton taxa were

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 230 examined under a Zeiss (Imager.A1) microscope and identified using identification keys including Krammer & Lange-Bertalot (2007 a,b; 2008), Komărek & Anagnostidis (1999, 2005), Ettl (1983), Ettl and Gărtner (1988), Popovsky & Pfiester (1990). The dominant phytoplankton taxa were sorted into functional groups proposed by Reynolds et al. (2002) and Padisăk et al. (2009).

Primary productivity was measured at the open water station using light- dark bottle technique (Wetzel & Likens, 1991). The Winkler bottles (125 ml) were filled with integrated water samples and exposed at eight depths: at surface, 0.5 m, 1 m, 2.5 m, 5 m, 10 m, 15 m and 20 m. Dark bottles were kept in lightproof dark-bags and the top of the bottles was wrapped in aluminum foil. After 4-5 hours of incubation, the bottles were retrieved and immediately fixed with Winkler’s reagents, then acidified, well-mixed and the whole content titrated with sodium thiosulfate (0.01 N). Gross and net photosynthetic rates and respiration were calculated employing the formula given in Wetzel & Likens (1991). -2 -1 The daily areal gross primary production (∑∑A, g O 2 m d ) was calculated by multiplying the hourly average by 10 h photoperiod. The trophic status of Lake Hayq was assessed using the trophic status index (TSI) of Carlson (1977), which is calculated based on Secchi disk transparency (TSI (SDT) = 60 – 14.41 ln (SDT)); Chl a concentration (TSI (Chl a)= 9.81 ln (Chl a) + 30.6) and total phosphorus amount (TSI (TP)= 14.42 ln (TP) + 4.15). A TSI < 30 is commonly considered as indicative of oligotrophic condition, between 50 and 70 the water body is eutrophic and values > 70 indicate hypereutrophic condition (Wetzel, 2001). Zooplankton sampling was carried out on monthly basis at SS and OS between October 2007 and October 2008. To determine numerical abundance, samples were vertically hauled from 10 m to the surface at both stations with a 30 µm mesh townet. The samples were immediately

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 231 preserved with sugar-formalin to a final concentration of approximately 4 %. The concentrated original sample of 250 mL was mixed homogeneously and a 25 mL subsample was taken with a wide mouth pipette (Wetzel & Likens, 2001), then poured into a gridded glass chamber, settled overnight and counted. Bacteria were also enumerated on a monthly basis using DAPI staining and fluorescence microscopy (Wetzel & Likens 1991).

Data analysis: T-test was used to analyze the spatial distribution pattern of limnological variables in Lake Hayq. Regression analyses were employed to model the dependent variable based on the predictors. We also used Kendall's τ correlation to check the variability of phytoplankton community composition over the sampling period. Principal Component Analysis (PCA) with Varimax rotation was run, followed by multiple regression analysis to assess the relationship between Chl a and significant environmental variables. SPSS software package version 16 was used in all statistical analyses. Relationships between phytoplankton taxa and significant environmental variables were analysed using a constrained Canonical Correspondence Analysis (CCA, CANOCO for Windows 4.5). CCA was chosen since the value of the longest lengths of gradient was 4.3, which signifies unimodal species response (Leps & Smilauer, 2003). The significance of environmental variables to explain the variance of species data in CCA was tested using Monte Carlo simulations with default unrestricted permutations. Variables were considered to be significant when P < 0.05. Graphs were presented using Sigmaplot version 11.

Results Lake Hayq is a slightly alkaline system with a mean (± SE) total alkalinity of 9.88 ± 0.18 meq L -1 and a pH of 9.00 ± 0.02, with invariably similar

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 232 patterns at both stations (Table 2). Electrical conductivity also fluctuated little with a mean (± SE) value of 910 ± 3 µS cm -1. The maximum dissolved oxygen (DO) recorded was 8.42 mg L -1 (121.7 % saturation) in April 2008 (Fig. 3). On the top 10 m, a minimum DO concentration (< 3 mg L -1) was observed in January 2008, which coincided with mixing time. The DO concentration below 20 m depth was constantly < 1 mg L -1 exhibiting that the greater part of the lake column was anoxic. The depth-time temperature of Lake Hayq revealed thermal stratification during the day time, and a period of total mixing was observed during dry season (which resulted in massive fish kill) (Fig. 3).

The turnover (de-stratification) was observed as a result of lower ambient temperatures and surface water cooling (Fig. 2). The mean difference (17.5 oC) between minimum and maximum daily air temperature was greater than annual variation (7.4 oC), indicating the pattern of stratification and de-stratification on a daily basis (atelomixis) (Lewis, 1973; Barbosa & Padisăk, 2002). The vertical extinction coefficient varied between 0.41-2.28 m -1, Secchi-disc readings (0.84-6.34 m) were shallow during dry period (Fig. 4), and coincided with mixing and high Chl a concentration. Average concentration of NO 3-N was about 42 -1 -1 µg L , NO 2-N values never exceeded 10 µg L but NH 4-N was notably higher than the two nitrogen forms (257.17 µg L -1, Table 2, Fig. 5).

Table 2. Mean (±SE) algal nutrients and physicochemical variables of Lake Hayq (*One time sample (June 2008), analyzed in Isotope Hydrology Laboratory, Addis Ababa University, Ethiopia, a significant difference at P<0.05)

Variable OS SS

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 233

TP (µg L-1) 67.14 ± 5.31 49.06 ± 5.99 SRP (µg L -1) 29.41 ± 3.84 14.2 ± 3.07 -1 NO 3-N (µg L ) 41.83 ± 7.23 41.32 ± 8.2 -1 NO 2-N (µg L ) 4.59 ± 1.31 8.39 ± 3.51 -1 a a NH 4-N (µg L ) 342.33 ± 36.98 172 ± 29.28 -1 SiO 2 (mg L ) 3.7 ± 0.36 2.8 ± 0.33 Alkalinity (me q L -1) 9.78 ± 0.15 9.98 ± 0.21 Conductivity (µS cm -1) 907.9 ± 2.5 912 ± 3 Secchi depth (m) 2.8 ± 0.52 2.7 ± 0.49 Euphotic depth (m) 4.95 ± 0.81 pH 9.06 ± 0.02 9.07 ± 0.02 *Na + (mgL -1) 61.2 *K + (mgL -1) 4.2 *Mg 2+ (mgL -1) 97.8 *Ca 2+ (m gL -1) 1.02 *F - (mgL -1) 1 *Cl - (mgL -1) 35.8 2- -1 *SO 4 (mgL ) 2.8 2- -1 *CO 3 (mgL ) 24 - -1 *HCO 3 (mgL ) 292.8

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 234

o DO (mg L -1 ) Temperature ( C) 0 22 25 6 8 23 24 25 4 2 4 6 4 6 8 21 22 23 2 4 21 24 23 10 4 0 6 21 22 0 2 02 2 22 21 22 20 0 21 22 21 30 0 22 21 21 21 21 22 21 Depth (m) 21 21 40 21 21 21 50 21 21 22 21 21 21 60 P Dry PreR Rainy P Dry P P PreR Rainy

Fig. 3 Depth-time profiles of Dissolved Oxygen (mg L -1) and temperature (oC) at OS station in Lake Hayq between Oct. 2007 and Oct. 2008 (P = post rainy season; Rainy = rainy season; PreR = pre-rainy season; dry = dry season)

Table 3 Principal Component Analysis based on 6 variables; factor loadings > 0.8 are bold. Value in bracket shows the variance of data explained by components.

Parameters ‘Bottom -up/top - Seasonality Light supply down (20%) (18.3%) (48.2%)’ SRP 0.818 0.321 -0.061

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 235

Parameters ‘Bottom -up/top - Seasonality Light supply down (20%) (18.3%) (48.2%)’

NH 4-N 0.911 0.212 0.191 Zooplankton -0.875 -0.021 0.180 abundance Rainfall 0.245 0.860 0.234 Temperature 0.130 0.915 -0.207 Extinction -0.046 -0.005 0.977 coefficient

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 236

Fig. 4 Temporal variations of Secchi disc depth () and vertical extinction -1 coefficient (K d, m ) of Lake Hayq at OS between Oct. 2007 and Oct. 2008. Following the development of thermal stratification, the concentration of nutrients progressively increased with depth down to the hypolimnion, which was anoxic all year long (Figs. 3, 5), indicating chemical stratification. PCA with environmental data as input variables resulted in a significant model including three principal components (PCs), which explained 87% of the total variation in the data set (Table 3). The first PC is strongly correlated with nutrients and grazing pressure referring to ‘bottom-up/top-down’ effect, whereas the second PC associated with rainfall and temperature indicating the influence of “seasonality”. The third PC implied light supply.

0 200 200 100 30 a 200 200 100 b 30 60 c 0 0 200 60 60 15 30 10 0100300 300 300 30 15 15 15 15 400 100 30 60 15 30 60 30 200 400 300 500 200 30 15 15 30 20 400 300 60 6030 30 30 300 30 45 30 400 60 15 30 30 100 400 500 90 30 60 30 300200 30 60 60 400 400 600 60 6030 30 45 500 500 700 45 15 45 600 90 60 30 45 3015 60 60 40 600 400400 30 45 60 120 3030 60 60 30 500400 60 90 60 45 15 60 50 400 15090 30 60 60 30 30 30 30 45 300 300400 500 600 700 150 12060 60 75 200 800 15 45 45 60 -15 0 45 0 Depth (m) d 60 75 3 3 3 3 2 40 60 45 30 45 e4 4 10 f 25 35 5 5 30 1520 2530 20 10 75 2 5 2 1510 5 45 4 10 20 25 60 45 30 45 4 5 5 15 30 5 2 5 5 20 6075 75 60 75 60 3 4 3 10 75 75 75 4 4 10 30 90 90 5 4 66 60 30 45 75 5 5 75 105 5 5 5 5 5 90 90 120 4 4 6 10590 7 6 10 10 40 135120 75 75 90 90 43 5 6 5 5 5 90 8 5 150 75 50 165 90 75 75 105 4 5 6 5 105 105 120 7 6 5 4 6 10 10 135120 90 43 5 5 5 60 P Dry PreR Rainy P P Dry PreR Rainy P P Dry PreR Rainy P Fig. 5 Depth-time contour plots showing the seasonal and vertical variation of algal nutrients ( a- NH4-N (µg L -1), b- NO3-N (µg L -1), c- SRP (µg

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 237

L-1), d- TP (µg L -1), e- Silicon (mg L -1), f- Chl a (mg m -3) at OS station in Lake Hayq (P = post rainy season; Rainy =rainy season; PreR = pre-rainy season; dry = dry season)

A total of 40 phytoplankton taxa were identified and some of them are new reports to the lake (Table 4). Chlorophytes contributed about 47% to the total phytoplankton abundance, followed by diatoms contributing around 30%. Cyanoprokaryota and the ‘Other group’ (those which have fewer numbers of taxa are categorized under “Other group”; Table 4) contributed 11% each. Kendall’s τ correlation coefficient indicated that there were major community composition changes during the sampling period (Fig. 6).

Table 5 Annual phytoplankton assemblage based on the functional classification of Reynolds et al. (2002) and Padisak et al. (2009) for Lake Hayq sampled from October 2007 to October 2008.

Sampling period Codon Representative taxa October 2007 NA, Lo, J Cosmarium, Peridinium, Tetradron December – June P, MP, D Fragilaria, Navicula, Synedra March W1 Eug lena gracilis July Lo Merismopedia August - September F, W1 Oocystis, Phacus October 2008 NA, Y , F Cosmarium, Cryptomonas, Oocystis

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 238

1.0 0.8 0.6 0.4 0.2 0.0 -0.2 Phytoplankton community indexcommunity Phytoplankton

2 0 1 0 1 1 1 1 0 0 0 1 9 8 0 9 2 2 3 1 6 9 6 0 ...... Fig. 6. Phytoplankton.1 1 0 community0 .0 .0 0 assemblage0 0 0 .0 rank1 on successive 0 2 1 2 3 4 5 6 7 8 9 0 . . . sampling date based.0 on0 Kendall’s.0 .0 .0 τ correlation.0 0 .0 . 0coef.0 ficient.0 0 7 7 8 8 8 8 8 8 8 8 8 8 Based on the dominant phytoplankton biomass (> 5% to the total biomass), the 12 taxonomic list was placed into 7 functional groups (Table 5). The overall mean biomass was 1.1 mm 3 L-1, primarily dominated by Fragilaria (P) , Navicula (MP) and Synedra (D) from December 2007 to June 2008 (Fig. 7) . However, the highest value (14.84 mm 3L-1) obtained in March 2008 could be related to a bloom of Euglena gracilis (W1) Lwoff 1932. The biovolume peak in July was mainly caused by the cyanoprokaryote Merismopedia (Lo), which was replaced by chlorophyte Oocystis (F) in August —September, and Cosmarium (NA) in October 2008. Out of 17 environmental variables considered, manual “forward selection” procedure of CCA resulted in six significant variables (Table 6, Fig. 8).

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 239

Table 4 Phytoplankton species composition of Lake Hayq

Cyanoprocaryota Chlorophyta Bacillariophyceae ‘Others group’ Anabena sp. Ankistrodesmus Achnanthes* Cryprophyta Microcystis flos- falcatus* Aulacoseira* Cryptomonas* aquae Botryococcus braunii* Cocconeis* M. aerugenosa Chodatella cingula Cyclotella comensis* Merismopedia Chodatella subsalsa Cymbella* Dinophyta Spirulina Coelastrum Epithemia (Division astroideum Fragilaria Pyrrophyta) Cosmarium sp.1* Gomphonema Peridinium Cosmarium sp.2* Navicula Kirchnerilla* Nitzschia Division Oocystis N. elegantula Euglenophyta Pediastrum simplex* Surirella robusta Euglena Pediastrum sturmii* S. subsalsa gracilis* Scenedesmus sp* Synedra ulna Phacus sp.* Staurastrum bullardii* S. quadicuspidatum* S. uplandicum* Synura uvella Tetraedron minimum The asterisks* indicate the taxa that were identified for the first time.

The first two axes accounted for 71% of the variance in the phytoplankton-environment relationship (Table 6). The first axis was correlated with total alkalinity, and the second axis with NH 4-N, SRP, SiO 2, rainfall and zooplankton. Euglena occurrence correlated positively and strongly with total alkalinity. Phacus (W1) , Cryptomonas (Y), and

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 240

Merismopedia (Lo) coincided positively with rainfall, SRP and NH 4-N. Synedra, Navicula and Fragilaria were positively related to SiO 2 and zooplankton, and negatively to SRP, NH 4-N and rainfall (Table 6).

Fig. 7 (a) The contributions of algal groups to the total phytoplankton in chronological order since 1940s (data combined from Baxter and Golobitsch 1970; Kebede et al. 1992), and (b) temporal variations in the biomass of the major phytoplankton functional groups in Lake Hayq during Oct. 2007 to Oct. 2008 Chl a is concentrated in the top 10 m depth with mean value of 12.9 mg m -3 and a maximum of 45 mg m -3 measured in March 2008. Mean Chl a concentration of the euphotic zone per unit area was 56 mg m -2. A multiple regression analysis explained 87.7% of the Chl a variations, for which PC-‘seasonality’ (P=0.00) and PC- light supply (P=0.013) contributed significantly [(LogChl a= 0.988-(0.319* “seasonality”)+(0.128* “light”); r 2=0.877, P<0.01, n=12].

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 241

1.0 Rainfall Phacus NH4+ SRP Cry Meri TAlkal Ooc Chl Eug Cos Tetra Syned Nav Peri SiO2 Fra Zoopl -1.0 -1.0 1.0 Fig. 8 Bi-plot of the Canonical Correspondence Analysis (CCA) for phytoplankton taxa (diamonds) and environmental variables (arrows; Cry-Cryptomonads, Meri-Merismopodia, Ooc-Oocystis, Chl-Chlorella, Cos-Cosmarium, Tetra-Tetradron, Syned-Synedra, Nav-Navicula, Fra- Fragilaria, Peri-Peridinium, Zoopl- zooplankton, TAlkal- total alkalinity)

A high and significant linear relationship between Chl a and phytoplankton biovolume was calculated (Biovolume [mm 3 L-1] = -1.790 + (0.541 * Chl a[ µg L-1]). The overall mean gross primary productivity -3 -1 (GPP) was 162.42 mg O 2 m h (Fig. 9). The maximum GPP at light- -3 -1 -3 -1 saturation (A max , mg O 2 m h ) was 600 mg O 2 m h recorded in June 2008. The mean ratio between A max and Chl a, the specific light saturated rate of primary production or photosynthetic capacity (P max , mgO 2 (mg Chl a -1) h -1), was 21.3. The mean GPP per unit area (∑∑A) was 7.12 g m -2 -1 -3 -1 d . Net photosynthetic (NPP) rates ranged from 4.8 to 262 mg O 2 m h constituting about 60% of the GPP.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 242

Table 6 Summary statistics of CCA.

Axes 1 2 3 4 Eigenvalues: 0. 751 0. 425 0. 232 0. 128 Species -environment correlations 0.9 96 0. 947 0.807 0. 904 Cumulative percentage variance of species data: 35.9 56.2 67.3 73.4 of species -environ relation: 45.4 71.0 85.1 92.8 Sum of all eigenvalues 2.09 Sum of all canonical eigenvalues 1.66

0 400 240 160 240 80 240 480480 320 400 400 80 80 160 240 160 320 160 80 80 5 320 320320 240 240 240 80 80 160

10 80 80160 80 240 160 320 160 80 80 Depth(m)

240 15 160 80 80 80 160 80

20 P PreR Rainy P Dry -3 -1 Fig. 9 Isopleth of in situ GPP (mg O 2 m h ) for OS of Lake Hayq. Abbreviations are same as in Fig. 3

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 243

Discussion Whereas pH and total alkalinity have remained within the same range during the last half a century (c.f. Baxter & Golobitsch, 1970), electrical conductivity has shown a gradual increase over the last 5 decades. In the late 1960-ies, conductivity was reported as 790 µS cm -1 (Baxter & Golobitsch, 1970) followed by 869 µS cm -1 (Demlie, 2000) and 910 µS cm - 1 (this study). The concentration of total ions is expected to have increased due to evaporation, biological turn-over and interactions with the sediments (Payne, 1986). However, the lake is still fresh water placed under Tallings’ classification II (Talling & Talling, 1965) and has never been saline in its history (Lamb et al., 2007). One justification could be the discharge of the Ankwarka River, which formerly fed the lake with dilute water of about 460 µS cm -1 (Baxter & Golobitsh, 1970). However, its inflow at present has terminated due to up-stream irrigation. Nevertheless, a recent study revealed a subterranean inflow of freshwater springs and possible solute seepage-out through large faults (Demlie et al., 2007), which would remain a plausible explanation for its freshness. The clinograde oxygen profile typical of eutrophic lakes (Wetzel, 2001) showed constantly <1 mg L -1 below 20 m depth (Fig. 3). Minimum DO at surface was observed during January 2008, which was related to the entire mixing from surface to bottom. In the late 1960-ies, Baxter & Golobitsch (1970) measured good oxygen supply up to 40 m depth. However, the vertical DO layer has been reduced since at least the last 2 decades (Fig. 3), as Kebede et al. (1992) reported a shallow DO layer of only 15 m depth. Lake Hayq is categorized as eutrophic water body based on total phosphorus (TSI = 63) and Chl a (TSI= 55.7) concentration. The mean Chl a concentration was 12.9 mg m -3, giving Lake Hayq an intermediate position when compared with other tropical

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 244 lakes (Table 6). Besides, Chl a per unit area within the euphotic depth (56 mg m -2) was also greater than in other Ethiopian rift valley lakes Zway

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) Page 245

Table 7. Comparison of phytoplankton GPP and Chl a of Lake Hayq with other tropical lakes

Chl a (mg Amax (mg Amax /Chl a ∑∑A (g O 2 -3 -3 -1 -2 -1 Lake m ) O2 m h ) mg O 2 (mg Chl m d ) References a)-1 h-1 Hayq, Ethiopia 12.9 274.7 21.3 7.12 The present study George, Uganda 60 1322.6 22 13.9 Ganf 1975 Lanao, 3 103.2 34.4 5.5 Lewis 1974 Philipppines Nakuru, Kenya 160 3193.5 20 1.6 Vareschi 1982 Nakuru, Kenya 646 -- 5-10.8 10 Oduor, Schagerl 2007 Tana, Ethiopia 4.5 -- -- 2.43 Wondie et al. 2007 Tanganyika, 1.2 21.9 18.3 2.6 Hecky, Kling 1981 Kenya Victoria, Uganda 3 90.3 30.1 9 Talling 1965 Zway, Ethiopia 39.2 977.4 24.9 3.4 Tilahun, Ahlgren 2009 Page 246

(20.9 mg m -2), Awasa (54.2 mg m -2) and Chamo (31.3 mg m -2), which are considered as eutrophic (Tilahun & Ahlgren, 2009).

The growth of phytoplankton can be limited by the availability of nutrients when light and temperature are adequate and loss rates are not excessive (Hecky & Kilham, 1988). In many lakes, P and sometimes N depletion limit phytoplankton growth (Dodds, 2002). The mean SRP (22 µg L -1) and TP (58 µg L-1) are in the intermediate range to other tropical lakes (Oduor & Schagerl, 2007; Tilahun & Ahlgren, 2009) and do not indicate any P limitation. Even though Baxter & Golobitsh (1970) had measured higher SRP concentrations of about 96 µg L -1, they described Lake Hayq as oligotrophic based on Chl a amount (< 1 mg m -3), which indicated heavy zooplankton grazing pressure on phytoplankton since Lake Hayq was without pelagic planktivorous fish, and consequently the proportion of efficient filter-feeder cladocerans (Diaphanosoma and Daphnia magna ) were abundant at that time (Kebede et al. 1992). During the present study, SRP was low in March 2008 which could be interpreted as high nutrient uptake as high phytoplankton biomass was recorded at the same time (reflected also in the high TP concentrations; Fig.

5). Similarly, the concentration of NH 4-N was remarkably high, but this appears typical to some tropical lakes (Talling & Lemoalle, 1998; Tilahun & Ahlgren, 2009). This can be explained by high year-round temperatures and related microbial activities (in Lake Hayq, we found mean bacteria concentrations of 4*10 6 cells mL -1). Besides, nutrient remineralization due to zooplankton could be large since we observed high zooplankton densities in Lake Hayq (Fetahi et al., submitted-b). Zooplankton primarily excretes P as dissolved phosphorus and nitrogen as ammonium, which are readily available for photoautotrophs (Lampert & Sommer, 1997). The number and type of the algal taxa seems to have increased in the last six decades with chlorophytes as the abundant taxa in the present study (Fig. 7). Some of the taxa identified in the present study are new reports for the lake including Cosmarium, Cryptomonas, Cyclotella, and Euglena (Table 4). Even P a g e | 247 though chlorophytes were high in abundance, the biomass was mainly dominated by diatoms (52.3%) from December 2007 through June 2008 with Fragilaria (D), Navicula (MP) and Synedra ulna (D) as the most abundant functional groups. The dominance of diatoms was also reported by the earlier visitors of the lake (Kebede et al., 1992; Zanon, 1942), where the latter identified exclusively diatoms (Fig. 7). Such dominance of heavy taxa could be explained through the special stratification and mixing pattern, partial atelomixis , which favors the sinking species to remain within the euphotic depth. Even though the night-time mixing (due to nocturnal cooling, Fig. 2) can destroy a diel thermocline, the deeper seasonal thermocline/chemocline remained stable (Baxter & Golobitsh, 1970; Talling and Lemoalle, 1998), restricting mixing within the epilimnion that would be partial or incomplete atelomixis sensu Barbosa & Padisăk (2002). It has been demonstrated as an essential factor for selecting the relatively heavy and non-motile desmids in tropical and subtropical water bodies (Barbosa & Padisăk, 2002;Tavera & Martinez-Almeida, 2005; Betănia et al., 2008). Probably, partial atelomixis is also a driving factor that governs the periodicity of diatoms (and also desmids) in the phytoplankton assemblage of Lake Hayq. In the present study, community shifts were pronounced at two inflection points in March and June 2008 (Fig. 5). The first shift was due to an abrupt change from diatoms to Euglena gracilis (W1) and the latter was because of compositional replacement from the dominant diatoms to Cyanoprocaryota (primarily Merismopedia (Lo)) which in turn was replaced by Chlorophyta Oocystis (F). The habitat of assemblage W1 indicates organic turbidity (Reynolds et al. 2002; Padisăk et al., 2009), which is evident in Lake Hayq as high organic matter (> 5 mg L -1) was recorded and shallow water transparency was observed on the same month (Fig. 4). The latter compositional changes could be related to the grazing pressure on diatoms by herbivorous zooplankton (large-sized Daphnia magna ), which were quite abundant during this time (Fetahi et al., submitted-b) and also reflected in phytoplankton biomass (Fig. 5-f). Such shifts by grazing pressure already have been documented in

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 248 enclosures (Weers & Zaret, 1975). Additionally, the development of stratification and reduction of Si in the epilimnion (Fig. 5) might have contributed to the changes, as was also reported elsewhere (Zhang et al., 2007). Chl a concentration had a temporal fluctuation with the maximum values recorded in March 2008, when minimal grazing pressure from herbivorous cladocerans and Tilapia was reported (Fetahi et al., submitted-b). However based on PCA analysis, the primary factors that regulate Chl a variation was PC-rainfall, PC-temperature and PC-light supply, which are associated with the seasonality of the region (Table 3). In actual fact, relatively high mean Chl a (21.7 mg m -3) were recorded during dry season and low (4.3 mg m -3) during major rainy season. CCA analysis indicated that Euglena

occurrence is strongly correlated with total alkalinity (Fig. 8) , which can be associated with the preference of the species to high CO 2 and low light conditions (Kitaya et al., 2005; Clegg et al., 2007) (Fig. 4). The association of diatoms with silica is indicative of their demand for growth (Lampert & Sommer, 1997). The positive correlation of diatoms with zooplankton could be related to ‘beneficial predation’ (Christensen, Walters & Pauly, 2005), the direct grazing pressure on prey is outweighed by indirect positive effect such as the high nutrient remineralization in the lake.

The mean volumetric rate of light-saturated GPP (A max ) in Lake Hayq was 275 -3 -1 mg O 2 m h , which was greater than values for large tropical lakes such as Tanganyika and Victoria (Table 6). Mean areal GPP within the euphotic depth -2 -1 (∑∑A) was 7.12 g O 2 m d , which is closer to maximum rates of temperate -2 -1 lakes (9.7 g O 2 m d ) (Talling, 1965). However, it is far below the maximum -2 -1 photosynthetic rates (25-30 g O 2 m d ) observed in some tropical water bodies (Table 6). In Lake Hayq, nutrients particularly nitrogen could be a limiting factor for algal growth as has been shown in several tropical lakes (Lewis, 1996; Talling & Lemoalle, 1998). Downing & McCauley (1992) observed N limitation significantly more frequent in lakes with TP > 30 µg L -1, and Lake Hayq with TP> 60 µg L -1 could be N-limited. Furthermore, the nutrient ratio (C:

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 249

N: P =100: 14: 1) also pointed to N-limitation. A major reason for N-limitation in tropical lakes is high denitrification that reduces nitrate- (or nitrite-) nitrogen to biologically unavailable atmospheric N 2 (Lewis, 2002). The ratio of ∑∑A to ∑Chl a of Lake Hayq was 0.13, which was equivalent to several other African freshwater lakes, but higher compared to temperate ones (Lemoalle, 1981).

All studies before the introduction of Tilapia placed Lake Hayq as typical oligotrophic water body (Zanon, 1941; Baxter & Golobitsch, 1970) in terms of algal biomass and productivity. During the current study, Lake Hayq is categorized as a eutrophic system employing various limnological parameters, and hence the trophic change reported by Kebede et al. (1992) was not short- lived. Interestingly, the nutrient concentrations such as SRP (96 µg L -1) and -1 NH 4-N (300 µg L ) were very high when the lake was reported as oligotrophic (Baxter & Golobitsch, 1970), discounting the nutrient to volume ratio hypothesis. In contrast, the proportion of large-sized cladocerans in particular Daphnia and Diaphanosoma were abundant before the introduction of Tilapia (Kebede et al. 1992). Furthermore, during the present study high Tilapia biomass (10.8 ton km -2) was specifically feed on cladocerans (Worie, 2009; Fetahi et al. submitted). We therefore assume that Tilapia primarily caused the trophic change via a cascading effect through the food web interactions. In former times, growth of phytoplankton might have been controlled by zooplankton since the lake was without pelagic planktivorous fish. The stocking of Tilapia probably reduced the number of zooplankton, relieving phytoplankton from grazing pressure, which eventually resulted in eutrophication. In the present study, following a massive planktivorous fish kill, large-sized Daphnia magna appeared for the first time since the study was launched, and grazed down phytoplankton biomass (Fetahi et al., submitted- b). This phenomenon indicated that the presence of large-sized cladocerans in the lake is evident in the absence of planktivorous fish. Large-sized cladocerans are important filter feeders and largely responsible for clear water

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 250

(Scheffer, 1998). Therefore, with this seasonal study, we support Kebede et al. (1992) that the stocked fish was most probably the major cause for the shift of the trophic status of Lake Hayq from oligotrophic towards eutrophic. Fetahi et al. (2011) also arrived at the same conclusion based on their food web analysis using Ecopath with Ecosim as an ecological tool (Christensen et al. 2005, freely available at www.ecopath.org ).

In conclusion, the phytoplankton biomass was dominated by diatoms followed by chlorophytes, the latter being numerically abundant. Partial atelomixis could be a possible cause for the dominance of comparatively heavy phytoplankton functional groups (diatoms and desmids) in this relatively deep, tropical and highland lake. The phytoplankton assemblages exhibited the condition of the lake and can be used to describe the quality of the water in the region. Photosynthetic and biomass per euphotic depth values were high indicating phytoplankton primary production was the primary carbon source of the lake. Based on biotic and abiotic limnological variables, Lake Hayq is categorized under eutrophic status, which most likely resulted from food web interactions as a result of the stocked planktivorous fish species.

Acknowledgements We thank Dr. Demeke Kifle for his kind support of laboratory materials. We also thank Menbere Simegn for her unreserved assistance during limnological analysis. This work was supported by the Austrian Exchange Service OeAD; Addis Ababa University, Graduate Study, Ethiopia; and Vienna University, Austria.

References APHA, 1995. Standard methods for the Examination of Water and Wastewater. 19 th edn. American Public Health Association, Washington, DC, USA

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 251

Baxter, R. M. & D. L. Golobitsch, 1970. A note on the limnology of Lake Hayq, Ethiopia. Limnology and Oceanography 15:144-148. Cannicci, G. & F. Almagia, 1947. Notizie sulla “Facies” planctonica di alcuni laghi della Fossa Galla. Boll Pesca Piscicolt Idrobiol 2:54-77. Carlson, R. E., 1977. A trophic state index for lakes. Limnology and Oceanography 22:361-369 Christensen, V., C. J. Walters & D. Pauly, 2005. Ecopath with Ecosim: a users’ guide. Fisheries Centre University of British Columbia Vancouver, Canada. Clegg, M. R., S. C. Maberly & R. I. Jones, 2007. Behavioral response as a predictor of seasonal depth distribution and vertical niche separation in freshwater phytoplanktonic flagellates. Limnology and Oceanography 52:441-455. Demlie, M., 2000. Hydrology, Hydrogeology and Hydrochemistry of the Lakes System Hayq-Ardibo, Northern Ethiopia. MSc Thesis, Addis Ababa University, 135 pp. Demlie, M., T. Ayenew & S. Wohnlich, 2007. Comprehensive hydrological and hydrogeological study of topographically closed lakes in highland Ethiopia: The case of Hayq and Ardibo. Journal of Hydrology 339:145- 158. Dodds, W. K., 2002. Freshwater Ecology: Concepts and environmental applications. Academic Press, San Diego, 569 pp. Downing, J. A. & E. McCauley, 1992. The nitrogen: phosphorus relationship in lakes. Limnology and Oceanography 37:936-945. Ettl, H., 1983. Freshwater Flora of central Europe: Chlorophyta I. Gustav Fischer Verlag, New York, 807 pp. Ettl, H., & Gărtner, 1988. Freshwater Flora of central Europe: Chlorophyta II. Gustav Fischer Verlag, New York, 436 pp. Elser, J. J. & C. R. Goldman, 1991. Zooplankton effects on phytoplankton in lakes of contrasting trophic status. Limnology and Oceanography 36:64-90.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 252

Ganf, G. G., 1975. Photosynthetic production and irradiance-photosynthesis relationships of the phytoplankton from a shallow equatorial lake (Lake George, Uganda). Oecologia 18:165 183. Getachew, T., 1993. The composition and nutritional status of the diet of Oreochromis niloticus in Lake Chamo, Ethiopia. Journal of Fish Biology 42:865-874 Hecky, R. E. & E. J. Fee, 1981. Primary production and rates of algal growth in Lake Tanganyika. Limnology and Oceanography 26(3):532-547. Hecky, R. E. & P. Kilham, 1988. Nutrient limitation of phytoplankton in freshwater and marine environments: a review of recent evidence on the effects of enrichment. Limnology and Oceanography 33:796-822. Hillebrand, H., C. Durselen, D. Kirschtel, U. Pollingher & T. Zohary, 1999. Biovolume calculation for pelagic and benthic microalgae. Journal of Phycology 35:403-424. Kebede, E. & A. Belay, 1994. Species composition and phytoplankton biomass in a tropical African lake (Lake Awasa, Ethiopia). Hydrobiologia 288:13- 32. Kebede, E., T. Getachew, W. D. Taylor & G-M. Zinabu, 1992. Eutrophication of Lake Hayq in the Ethiopian Highlands. Journal of Plankton Research 14:1473-1482. Kifle, D. & A. Belay, 1990. Seasonal variation in phytoplankton primary production in relation to light and nutrients in Lake Awasa, Ethiopia. Hydrobiologia 196:217-227. Komărek, J. & K. Anagnostidis, 1999. Freshwater Flora of central Europe: Cyanoprokaryota 19/1. Gustav Fischer Verlag Jena, 548 pp. Komărek, J. & K. Anagnostidis, 2005. Freshwater Flora of central Europe: Cyanoprokaryota 19/2. Elsevier GmbH, Mŭnchen 759 pp. Krammer, K. & Lange-Bertalot, 2007a. Freshwater Flora of central Europe: Bacillariophyceae 2/1. Spektrum Akademischer Verlag, 876 pp. Krammer, K. & Lange-Bertalot, 2007b. Freshwater Flora of central Europe: Bacillariophyceae 2/3. Spektrum Akademischer Verlag, 598 pp.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 253

Krammer K. & Lange-Bertalot, 2008. Freshwater Flora of central Europe: Bacillariophyceae 2/2. Spektrum Akademischer Verlag, 610 pp. Lamb H. F., M. J. Leng, R. J. Telford, T. Ayenew & M. Umer, 2007. Oxygen and carbon isotope composition of authigenic carbonate from an Ethiopian lake: a climate record of the last 2000 years. The Holocene , 17 (4): 517-526. Lampert, W. & U. Sommer, 1997. Limnoecology: The ecology of lakes and streams. Oxford University Press, New York, 382 pp. Lemma, B., 1994. Changes in the limnological behavior of a tropical African explosion crater lake, L. Hora-Kilole, Ethiopia. Limnologica 24:57-70. Lemoalle, J., 1981. Photosynthetic production and phytoplankton in the euphotic zone of some African and temperate lakes. Revue d'Hydrobiolgie Tropicale 14:31-37. Leps J. & P. Smilauer, 2003. Multivariate analysis of ecological data using CANOCO. Cambridge University Press, UK, 269 pp.

Lewis. W. M. J R, 1996. Tropical lakes: how latitude makes a difference. In: Schiemer F, Boland KT (eds) Perspectives in Tropical Limnology, 43-64. SPB Academic Publishers, Amsterdam, the Netherlands.

Lewis, W. M. J R, 2002. Causes for the high frequency of nitrogen limitation in tropical lakes. Verhandlungen Internationale Vereinigung für Theoretische und Angewandte Limnologie 28:210-213. Müller-Navarra, D. C., M. T. Brett, S. Park, S. Chandra, A. P. Ballantyne, E. Zorita & C. R. Goldman, 2004. Unsaturated fatty acid content in seston and tropho-dynamic coupling in lakes. Nature 427:69-72. Oduor, S. O. & M. Schagerl, 2007. Phytoplankton primary productivity characteristics in response to phytosynthetically active radiation in three Kenyan Rift Valley saline-alkaline lakes. Journal of Plankton Research 29:1041-1050. Pankhurst, R. K. P. (ed) 1967. The Ethiopian royal chronicles. Oxford Univ Press, 210 pp.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 254

Payne, A. I., 1986. The ecology of tropical lakes and rivers. John Wiley and Sons, New York, 301 pp. Popovsky, J. & L. A. Pfiester, 1990. Freshwater Flora of central Europe: Dinophyceae (Dinoflagellida). Gustav Fischer Verlag, Stuttgart, 272 pp. Scheffer, M., 1998. Ecology of shallow lakes. Chapman and Hall, London, 357 pp. Spencer, C. N. & D. L. King, 1984. Role of fish in regulation of plant and animal communities in eutrophic ponds. Canadian Journal of Fisheries and Aquatic Sciences 41:1851-1855. Sun, J. & D. Liu, 2003. Geometric models for calculating cell biovolume and surface area of phytoplankton. Journal of Plankton Research 25:1331- 1346. Fetahi, T., S. Mengistou & M. Schagerl, submitted-b. Zooplankton Community Structure and Ecology of Tropical-highland Lake, Lake Hayq, Ethiopia. Fetahi, T., M. Schagerl, S. Mengistou, S. Libralato, submitted-c. Food web structure and trophic interactions of a tropical highland lake, Ethiopia. Tadesse, Z., 1988. Studies on some aspects of the biology of Oreochromis niloticus (L) (Pisces: Cichlidae) in Lake Zway, Ethiopia. MSc thesis, Addis Ababa University, Addis Ababa Tadesse, Z., 2010. Diet composition impacts the fatty acid contents of Nile Tilapia, Oreochromis niloticus L., in Ethiopian highland lakes. Verh Internat Verein Limnol 30:1363-1368. Talling, J. F., 1957. Some observations on the stratifications of Lake Victoria. Limnology and Oceanography 3:213-221. Talling, J. F., 1965. The photosynthetic activity of phytoplankton in East African lakes. Internationale Revue Der Gesamten Hydrobiologie 50:1-32. Talling, J. F. & D. Driver, 1963. Some problems in the estimation of chlorophyll a in phytoplankton. Proceedings of a Conference on Primary Productivity Measurements, Marine and Freshwater. US Atomic Energy Commission, TID 7633, 142-146 pp. Talling, J. F. & J. Lemoalle, 1998. Ecological dynamics of tropical inland waters. Cambridge University Press, UK, 441 pp.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 255

Talling, J. F. & Talling, I. B., 1965. The chemical composition of African lake water. Internationale Revue Der Gesamten Hydrobiologie 50:421-463. Tilahun, G. & G. Ahlgren, 2009. Seasonal variations in phytoplankton biomass and primary production in the Ethiopian Rift Valley lakes Ziway, Awasa and Chamo-The basis of fish production. Limnologica dio:10.1016/j.limno.2009.10.005. Vareschi, E., 1982. The ecology of Lake Nakuru (Kenya). III. Abiotic factors and primary production. Oecologia 55:81-101. Vatova, A., 1940. Notizie idrografiche e biologiche sui Laghi dell’A. O. I. Thalassia 4:1-25. Weers, T. E. & T. M. Zaret, 1975. Grazing effects on nanoplankton in Gatun Lake, Panama. Int Ver. Theor. Angew. Limnol. Verh. 19:1480-1483. Wetzel, R. G., 2001. Limnology: Lake and River Ecosystems, 3rd edn. Academic Press, San Diego, 1006 pp. Wetzel, R. G. & G. E. Likens, 1991. Limnological analyses, 2nd edn. Springer, New York, 391 pp. Zanon, V., 1941. Diatomee dei Laghi Galla ( A.O.I. ). Atti Accad. Classe Sci. Fis., Mat., Nat., 12:431- 568. Zenebe, T., G. Ahlgren & M. Boberg, 1998a. Fatty acid content of some freshwater fish of commercial importance from tropical lakes in the Ethiopian Rift Valley. Journal of Fish Biology 53:987-1005. Zenebe, T., G. Ahlgren, I-B. Gustafsson & M. Boberg, 1998b. Fatty acid and lipid contents of Oreochromis niloticus L. in Ethiopian lakes-dietary effects of phytoplankton. Ecology of Freshwater Fish 7:146-158. Zhang, X., P. Xie, F. Chen, S. Li & J. Qin 2007. Driving forces shaping phytoplankton assemblages in two subtropical plateau lakes with contrasting trophic status. Freshwater Biology 52:1463-1475. Zinabu, G-M., L. J. Chapman & C. A. Chapman, 2002. Conductivity as a predictor of a total cations and salinity in Ethiopian lakes and rivers: revisiting earlier models. Limnologica 32:21-26.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 256

Preliminary survey of Kurit-Bahir Wetland, (management focus), Amhara Region, West Gojjam, Mecha Woreda, Ethiopia

Miheret Endalew Tegegnie Amhara Region Agricultural Research Institute, Bahir Dar Fish and Other Aquatic Life Research Center, P. O. BOX, 794. Bahir Dar, Ethiopia, [email protected]

Abstract: Kurit-Bahir is a wetland located in Amhara National Regional State, West Gojjam Administrative zone, Mecha Woreda bordering Midere Genet, Tatek Geberie and Kurt Bahir kebeles. The Wetland covers 333 hectares with mean depth of 2.0 meters. The local community benefits grazing and watering for livestock, irrigated agriculture and fishery. The wetland water level fluctuates in wet and dry seasons. The water level is high during the wet season and outflows to Koga River/dam through seasonal Small River. During the dry season the water level decreases and disconnected from the Koga river system (field observation, and pers, communication). The vegetation coverage of the wetland differs in lower and in the upper catchments. The upper watershed is highly degraded due to agricultural activity and settlement and the lower watershed is covered with natural shrubs. The wetland has been shrunk from time to time due to population pressure. The local community expressed that part of the wetland called Denbar, has lost the macrophyte due to recession agriculture and settlement pressure impacting the natural filtering capacity of the wetland to reduce sediment and nutrient loads entering the wetland contributing to loss of ecosystem services. The wetland ecosystem lacks basic baseline information on its ecological, social, biodiversity and economic values. Based on this gap a preliminary survey on the wetland was carried out in November 2009. Questionnaire survey, Field observation and local community interview for indigenous knowledge were considered. The collected data was analysed. The objectives of the survey were (1) to collect basic baseline information, (2) to create public awareness on the wetland situation, (3) to establish an intervention mechanism to sustain its ecosystem services. The preliminary survey indicated that the wetland shrinkage was

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 257 aggravated from time to time due to farmland shortage and human population pressure. The focus group discussion community elders witnessed that, part of the wetland shrunk and lost its littoral zone macrophyte completely. The prevailing open access situation has induced further encroachment calling for sustainable management of ecological, social, biodiversity and economic values based on knowledge and experience on environment, land use planning, extension services and research to restore and sustain the wetland resources.

Key words: biodiversity, conservation, hydrology, macrophyte, wetland function, wetland intrusion

Introduction Kurit-Bahir is a wetland located in Amhara National Regional State, West Gojjam Administrative zone, Mecha Woreda bordering Midere Genet, Tatek Geberie and Kurt Bahir kebeles ( Fig. 1 ). The Wetland covers 333 hectares with mean depth of 2.0 meters. The watershed vegetation coverage differs in southern and the northern area, the southern area being devoid of the natural cover due to agricultural activity practiced heavily and the northern area covered with natural shrubs due to non - agricultural activity practiced.

Wetlands are ecosystems whose formation, processes and characteristics are determined by water. Wetlands are transit areas between land and water where water plays dominant role to saturate soils permanently or seasonally. The saturation time, amount and source of water determines the kind of wetland being permanent or seasonal. Wetland functions are processes or series of processes that take place within a wetland and expressed in terms of water storage, nutrients transformation, host diversity of biota, and provide value for surrounding ecosystems and for local communities’ livelihood.

The wetlands functions are influenced by climatic change, quantity and quality of water entering the wetland, and encroachment and disturbances within the wetland and the watershed ecosystem. Wetlands are best known for their

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 258 habitat functions, which are the functions that benefit wildlife as part of the physical environment in which plants and animals live (Lapedes, 1976) and wetlands are among the most productive habitats in the world (Tiner, 1989).

The unique role of wetland ecosystems in food production, pollution control, water quality improvement, flood and erosion reduction, and recharge of groundwater supplies was understood and appreciated in the last three and four decades. Wetlands provide recreational, educational and scientific research opportunities. Human population pressure and progress trudges on converting wetlands to agricultural production, urban development and other uses without the tradeoffs of the natural functions.

The best way to guarantee the protection of wetlands is to understand how the important values of wetlands serve mankind . "While wetland functions are natural processes of wetlands that continue regardless of their perceived value to humans, the value people place on those functions in many cases is the primary factor determining whether a wetland remains intact or is converted for some other use" (National Audubon Society, 1993) . In addition, values assigned to wetland functions may change over time as society's perceptions and priorities change. The values that benefit society as a whole tend to change slowly while values assigned by individuals or small groups are arbitrary, and most are subject to rapid and frequent change. The society has to resolve conflicts regarding the management/ preservation of wetlands and their functions choosing among wetland functions that benefit to society and that sustain the wetland itself and its services. The wetland functions have value at internal, local, regional and global levels. Wetlands are now thought to have a significant effect on air quality, which is influenced by the nitrogen, sulfur, methane, and carbon cycles. In addition, migrating birds are dependent upon wetlands as they travel.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 259

Wetland assessment methods have been developed to assign values for wetland functions that benefit the environmental quality and society and these wetland function values are spring boards to step towards the protection of wetlands. An evaluation system provides the basis for comparing wetland services and mitigation measures for unavoidable wetland losses calling for stand-alone policies and strategies that have been diffused in different sector policies and strategies such as water, agriculture, land use and environmental protection as typical example for Ethiopian wetlands.

Materials and methods Study Area: Kurit-Bahir is a wetland located in Amhara National Regional State, West Gojjam Administrative zone, Mecha Woreda bordering Midere Genet, Tatek Geberie and Kurt Bahir kebeles ( Fig. 1 ). The Wetland covers 333 hectares with mean depth of 2.0 meters. The watershed vegetation coverage differs in southern and the northern area, the southern area being devoid of the natural cover due to agricultural activity practiced heavily and the northern area covered with natural shrubs due to non - agricultural activity practiced.

Data collection and Analysis: Desk survey was deployed through questionnaire targeting to collect secondary data in the watershed kebeles. The data collection was carried out in three Kurt Bahir watershed kebeles and the data includes land use pattern, livestock and human population, land cover, crop patterns, topography and soil type in these kebeles. The local community's indigenous knowledge was consulted. Other supportive secondary data were collected from Mecha Woreda Agriculture and Rural Development Office. Field observation on major human impacted activities major ecological changes observed for the last two and three decades was considered. Mecha Woreda Office of Agriculture and Rural development experts were contacted and consulted. GIS was used for mapping to ease communication among the stakeholders. Libraries of the Amhara Regional

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 260

Agricultural Research Institute and Bahir Dar Fish and Other Aquatic Life Research Center were searched for relevant literature.

The Kurt Bahir wetland ecosystem lacks basic baseline information on its ecological, social, biodiversity and economic values. Based on this gap a preliminary survey on the wetland was carried out in November 2009. The collected data was analysed. The objectives of the survey were (1) to collect basic baseline information, (2) to raise public awareness on the wetland situation, (3) to propose an intervention mechanism to sustain its ecosystem services.

Results The average annual rainfall trend in the watershed is about 1250mm and is concentrated from June-October and the average annual temperature is about 25 degree-Celsius ( Table 2 ). The topography of Kurt Bahir watershed ( Table 3 .) consists 64. 34% plain, 29 % rigid and 6.67 % valley. The topography varies greatly on the peripherals of south and north sides of the watershed. It is generally flat on the east and west side of the wetland. Undulating slopes exist on the outer eastern and southern. In areas with flat topography, stream flow is relatively slow, and floodwaters tend to spread out into adjacent lands such the Denbar floodplain around the wetland.

The undulating slopes and soils types ( Table 3 .) facilitate the natural erosion and landslide problems that exist in the eastern and southern high lands. The soils of the watershed consist 75 % red, 3.33 % brown and 21.67 % black. The undulating slopes increase rain water runoff rates, which can increase erosion and sediment in the wetland, and deposit sediments in down streams.

The Agro-Ecological Zone ( Table 3 ) of the wetland watershed consists of the traditional category Kola 7.33 %, Dega 1.67% and 91 % Woina Dega . The land use pattern ( Table 1 ) consists of 67.32 % farmland, 12.07% forest and bushes,

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 261

11.23% grazing, 6% construction, 6.81% water body and others. The major crops grown in the wetland watershed are ( Table 5 & 6 ) cereals (80.11%), pulses (13.71%), oilseeds (6.08%), spices (2%) and vegetables, root crops and fruits 2 %). The Kurt Bahir watershed has 43671 livestock population ( Table 7 ) in number (29.6% cattle, 5.6% equine, 26.6% sheep and goat, 11.3% apery and 33.7% poultry). The grazing situation ( Table 8 ) consists (61.34% open and 38 % controlled) grazing and the feed (supply 64.4 % and 35.6 % deficit) is not in balance with livestock population. The human population of Kurt Bahir watershed ( Table 4 ) is around 20890 living in rural area. The critical problems observed on the wetland and in the watershed are vegetation degradation, wetland hardening, pressurized grazing and expansion of Irrigation.

Discussion The Millennium Ecosystem Assessment states that wetlands are one of the ecosystems most under threat. This is mainly due to the expansion of agricultural land demand and poor management of land use. Population growth and economic development have increased demand for food and natural resources mostly impacting wetland conversion for agriculture, urban development and industrial use. Traditionally wetlands are considered as wastelands in their natural state without considering their valuable services for environmental quality and society.

They are often converted completely to other uses that change the services they provide ecologically, economically and socio-culturally. Wetland watershed degradation is another issue that occurs outside wetlands that impact upon them. Degraded wetland watershed suffers from excessive runoff which may lead to gulley formation in wetlands resulting reduced infiltration of water into the watershed and reduced water storage for slow release into the wetland to maintain dry season water supply.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 262

The Kurt Bahir wetland has shrunk and is highly degraded and poorly protected due to lack of integrated watershed management resulting in natural resources degradation. The wetland is encroached from time to time, for agricultural activities losing its natural filtration and buffering capacity enhancing the silt load that has come from the watershed. When we consider the wetland situation of Kurt Bahir the overall water quality information is patchy that requires future reconsideration. Kurt Bahir has no systematic monitoring and control of point and non point sources of pollution from farm lands, grazing lands, domestic and runoff in the watershed.

The sediment load in Kurt Bahir can influence the wetland ecosystem by increasing turbidity and reduce water transparency and productivity contributing to aging and changes in the morphology of the wetland. The observable problem in the wetland of Kurt Bahir is the removal of macrophyte and wetland shrinkage that reduces the bio-filtering role and habitat degradation for its biota. The Kurt Bahir basin wide problem includes soil Erosion particularly on the southern, eastern and western part of the basin where agricultural activity and deforestation is dominant when compared to the northern part covered with shrubs and bushes. Poor land use and clearing of forests in the wetland basin induces sedimentation that can reduce the water storage capacity of the wetland. The experiences learnt from serious lake problems happened in Lakes of Ethiopia and Africa is good examples to take preventive and mitigative measures before things went to irreversible situation in the wetland of Kurt Bahir.

Previous studies confirm that, the major sources for nutrient overload causing cultural euthrophication in Ethiopian lakes emerge from natural runoff, inorganic fertilizer and manure runoff from the farming system, soil erosion from poor land use and poor watershed management (Alem, 1993a; Miheret, 1997; Zinabu GM, 2002; Miheret and Tollner, 2009). There are several natural lakes in Ethiopia disappeared and nearing to disappear (Brook, 2003; Tamiru et

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 263 al ., 2007, Miheret et al, 2011 unpub). Lake Alamaya, Lake Kilole and Lake Gudera as well as man-made dams that are completely or nearly silted up as a result of over abstraction, poor land use and sedimentation can be mentioned for indication purposes.

From the African perspective, the situation is also critical (UNEP, 2005). The Climate change impacted as global warming predicted to cause changes in precipitation and runoff, and changes in the thermodynamic and ecological balance of wetlands. This global observable fact problem may not be seen as the major affecting factor when compared to the very day to day observable affecting factors that emerge with in the wetland and the wetland watershed. Kurit Bahir and its basin are a fragile and a complex ecosystem under growing stress and nearing to disappearance unless and otherwise timely measures are not taken to mitigate the prevailing encroachment towards the wetland particularly on the eastern part called Denbar . Sustainable management of Kurt Bahir wetland basin for its ecological, social, biodiversity and economic values requires attention from its stakeholders. According to (Lisa, Salvatore 2007) the integration of the above mentioned values and thoughts is highly significant to holistic management of watershed resources. Participatory management approach and use of indigenous knowledge and experience of the stakeholders in extension services, research and management is the priority measure for Kurt Bahir resources management to sustain its ecosystem services for the present and the next generations.

The wetland issues of Ethiopia stated at a national level in other existing natural resource management policies and strategies such as in water resources development, forestry development, land use, agricultural and rural development and environmental protection are diffused and overpowered by these broader objectives of the sectors imposing the inadequacy to protect, conserve and manage to sustain the existing ecosystem functions and values of our wetlands. Advocacy for a stand-alone, unique wetland policy drawing

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 264 considerable attention to wetland issues particularly by legislators and the public articulated with clear goals, objectives and clear responsibilities of the Government, requiring different approaches to their management and conservation, and not being masked under other sectoral management objectives is highly demandable.

Acknowledgements I acknowledge the Mecha Woreda Agriculture and Rural Development Office and its experts, fishery, natural resource and Tatek Geberie, Midere Genet and Kurt Bahir localities Development Agents for their help in field studies. I would also like to thank local communities and technical staff for their support and engagement.

References Alem, M., 1993a. Overview of the fishery sector in Ethiopia. FAO Fisheries development Planning and resource management: Ethiopia. Proceedings of the national seminar on fisheries policy and strategy 22-25 June 1993. Addis Ababa .FI:TCP/ETH/1357 PP 45-53 Brook, L., 2003. Ecological changes in two Ethiopian lakes caused by contrasting human intervention, http://www.science direct.com/scince/journal/ Limnologica - Ecology and Management of Inland Waters, Volume 33, Issue 1, Pages 44-53 Lapedes, D.N., ed., 1976, McGraw-Hill dictionary of scientific and technical terms: New York, McGraw- Hill Book Company, 1634 p. Lisa, H., Salvatore, A., 2007. Integrating the social sciences into ecohydrology: facilitating an interdisciplinary approach to solve issues surrounding water, environment and people. Ecohydrology & Hydrobiology volume 7, No. 1, pp 3-9 Miheret, E., 1997. Assessment of Policy and Development Plan Issues related to Ethiopian Fisheries M.Sc. thesis, University of Hull, 105pp

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 265

Miheret, E., Tollner, E.W. 2009. Assessment Of Major Threats Of Lake Tana And Strategies For Integrated Water Use Management, Proceedings of the First Annual Conference of Ethiopian Fisheries and Aquatic Sciences Association, Ethiopia, Ziway February 15-16, 2009, pp 174- 191 National Audubon Society, 1993, Saving wetlands-A citizens guide for action in the Mid-Atlantic region: Camp Hill, Pa., National Audubon Society, 130 p. Tamiru, A., Wagari, F., Dagnachew L.., 2007. Impact of water overexploitation on highland lakes of eastern Ethiopia. Environ Geol 52 :147–154 Tiner, R.W., 1989, Wetlands of Rhode Island: Newton Corner, Mass., U.S. Fish and Wildlife Service, National Wetlands Inventory, 71 p., appendix. UNEP, 2005. The Atlas of African Lakes, 11th World Lake Conference 31 October 2005, Nairobi, Kenya Zinabu, GM., 2002. The Ethiopian Rift Valley Lakes: Major Threats and strategies for Conservation. In: C. Tudorancea and W.D. Taylor (Eds) Ethiopian Rift Valley Lakes,

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 266

Mecha Woreda Kurt Bahir Wetland Raw Data Table 1. Land use pattern

Natural Kebele Area Cultivated Aforestion Bushes Graizing Constrution Wetland Others forest Kurt Bahir 2504 1567 172 38 562 93 64 111 Tatek Geberie 2602 1688 45 200 127 137 45 360 ? Midere Genet 2026 1546 91 129 59 102 45 190 106 Total sum 7132 4801 136 501 224 801 183 254 217 % 67.32 1.91 7.02 3.14 11.23 2.57 3.77 3.04

Table 2. Climate

Max. Mini. Aver. Max. Kebele rainfall rainfall rainfall tem Min. Aver. Kurt Bahir 1400 1200 1300 25 16 18 Tatek Geberie 1200 1000 1200 25 15 18 Midere Genet 1200 1000 1200 25 16 18

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 267

Table 3. Topography, Soil type and Traditional AEZ

Topography % Soil type % Traditional AEZ Plain Rigid Valley Red Brown Black Kebele % % % soil soil soil kola dega w/dega Kurt Bahir 98 2 95 5 7 93 Tatek Geberie 75 20 5 75 5 20 15 85 Midere Genet 20 65 15 55 5 40 5 95 193 87 20 225 10 65 22 5 273 % 64.34 29 6.67 75 3.33 21.67 7.33 1.67 91

Table 4. Human population, Land Tenure and Elevation

H. population Tenure Elevation Kebele RURpop Totpop Max. Min. Aver. Max. Min. Aver. Kurt Bahir 7910 7910 3 1.6 0.25 x x x Tatek Geberie 6828 6828 2 1.25 0.5 Midere Genet 6152 6152 2.5 1.5 0.25 2600 2300 2200 20890 20890 7.5 4.35 1

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 268

Table 5. Crops and Pulses

Cereals Pulses Kebele Faba Teff Barley Wheat Sorgum Maize Chickpea Beans bean Kurt Bahir 152 230 65 310 610 125 8 Tatek 123 125 25 329 744 25 Geberie Midere 137 68 150 320 680 490 32 33 Genet Total 412 423 240 959 2034 640 40 33 % 9.81 8.14 4.62 18.44 39.12 12.31 0.770 0.63

Table 6. Oilseeds, Spices and vegetables and horticulture

Vegetables and Oil seeds Spices Water bodies horticulture Kebele Nug Telba Pepper Garlic Onion Potato Horticulture Springs Dams wetland (Ha) (Ha) (Ha) (Ha) (Ha) (Ha) (Ha) Kurt 41 6 8 7 5 2000 72 Bahir Tatek 204 25 45 4 3 45 0.625 1500 360 Geberie

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 269

Vegetables and Oil seeds Spices Water bodies horticulture Kebele Nug Telba Pepper Garlic Onion Potato Horticulture Springs Dams wetland (Ha) (Ha) (Ha) (Ha) (Ha) (Ha) (Ha) Midere 28 12 25 8 2 25 13 2000 81 432 Genet Total 273 43 78 19 5 70 18.625 5500 81 432 % 5.25 0.83 1.5 0.36 0.07 1.35 0.36

Table 7. Livestock population

Kebele Cattle Equine Sheep Goats Apery Poultery Kurt Bahir 4349 695 5140 650 554 3677 Tatek Geberie 4992 979 3500 850 1800 2010 Midere Genet 3600 790 2994 448 603 6040 Total 12941 2464 11634 1948 2957 11727 % 29.6 5.6 26.6 4.5 6.8 26.9

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 270

Table 8. Livestock feed Grazing Type Feed adequacy Ha % (kg) Communal Kebele Open Controlled Demand Supply Deficit graizing Kurt Bahir 562 75 25 8032281 5176900 2855381 Tatek Geberie 137 65 35 80000 50000 30000 Midere Genet 250 44 54 Total 949 184 114 8112281 5226900 2885381 % 61.34 38 64.4 35.6

Table 9. Wetland and services and critical problems Special wetland services for house hold heads Critical problems of Kurt Bahir wetland Ceremonial Kebele Drinking Sanitation Thatching vegetation wetland pressurized Irrigation water use of reeds degradation hardening grazing sedges Kurt Bahir 134 134 238 Tatek Geberie 335 2935 4563 935 Midere Genet 46 102 46 Total 469 3115 4903 981

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 271

Detection of toxigenic cyanobacteria in Bahir Dar Gulf of Lake Tana – pilot study

Ilona Gagala 1,2 , Goraw Goshu 3* , Tomasz Jurczak 2, Yohannes Zerihun 4, Joanna Mankiewicz-Boczek 1,2 and Maciej Zalewski 1,2 1International Institute of the Polish Academy of Sciences – European Regional Centre of Ecohydrology u/a UNESCO, Tylna 3, 90-364 Lodz, Poland 2Department of Applied Ecology, University of Lodz, Banacha 12/16, 90-237 Lodz, Poland 3College of Agriculture and Environmental Sciences, Bahir Dar University (BDU), Bahir Dar, Ethiopia 4 4Ministry of Water and Energy Resources, Addis Ababa, Ethiopia

Abstract: Cyanobacterial blooms pose a serious threat for water supply systems, recreation and for agriculture. Blue-green algae can produce different types of toxins including hepato-, neuro-, cyto- and dermatotoxins, which can cause various health problems as allergic responses, diarrhoeas, acute gastroenteritis, liver and kidney damages etc. Therefore, the necessity to carry out monitoring to enable appropriate identification of health risk is indispensable and underlined by world health organization (WHO). Based on the obtained results from Polish-Ethiopian projects the preliminary data of seasonal hepatotoxic cyanobacteria occurrence in Bahir Dar bay, Tana Lake was elaborated. The presence of toxigenic blooms of microcystin-producing cyanobacteria with determination of microcystins concentration was measured in sample from November 2009 (dry season) and in four samples from June and August 2010 (rainy season). The Microcystis genera responsible for production of cyanobacterial hepatotoxins - microcystins occurred in dry and rainy seasons. The genetic analysis of mcyE gene indicated the presence of toxigenic (potentially toxic) cyanobacteria in both seasons, with maximum in November. The highest concentration of microcystins above 1 µg/l, the limit value for drinking water

*Correspondence - Goraw Goshu, BDU, P.O. Box 1701 E-mail:[email protected] Tel:0910-862033/0918-779851

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 272 suggested by WHO, occurred in November. Moreover, the concentration of chlorophyll a (50.46 µg/l) in sample from November indicated an intensive eutrophication of southern Gulf of Tana Lake in dry season. Preliminary results indicate the need to continue regular monitoring of Tana Lake in order to determine the total threat to the environment and human health from hazardous cyanobacterial blooms. Further studies will also enable the development of a complete system for monitoring this lake with the possibility of extension studies to other sampling points, taking into account the various sources of pollution affecting the process of eutrophication, and consequently the development of toxic blooms.

Key words: ELISA, mcyE gene, Microcystis, tropical Lake

Introduction Cyanobacteria are a remarkably widespread and successful group colonizing fresh, brackish and marine waters, and terrestrial environments including extreme habitats such as Antarctic lakes and hot springs (Ward et al, 1998; Hitzfeld etal, 2000). Many species of cyanobacteria are able to produce a wide range of noxious products or toxins and these toxins are grouped according to their toxicological properties in to four categories: hepatotoxins, neurotoxins, cytotoxins and skin irritants (dermatotoxins). Microcystins, included to the hepatotoxins, are the most widely distributed cyanotoxins that have been implicated in animal and human poisoning by causing liver damage through the inhibition of protein phosphates types 1 and 2A (Humpage and Falconer, 1999).

Lake Tana provides multiple purposes and the local community uses the water for recreation, bathing, cattle watering, irrigation and even drinking purposes. The presence of mats of cyanobacteria in southern gulf of Lake Tana where it has received domestic and municipal wastes may present public health risks through dermal contact with cyanobacteria and their toxins or accidental ingestion of contaminated waters during different activities. It has been reported that the people especially the fishers exhibited eye and skin irritation after contact with the lake water containing cyanobacterial mats and the

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 273 cyanobacteria and or their toxins might be a cause of these symptoms, although no study on toxin production.

In the study of threats to the environment and human health from cyanobacterial blooms, the traditional monitoring based on: 1) assessment of physico-chemical parameters of water favorable for the development of blue- green algae, 2 ) analysis of phytoplankton species composition and estimation of the concentration of chlorophyll a, and 3) assessment of the concentration of selected cyanotoxins, usually is applied (Jurczak et al, 2004; Mankiewicz et al, 2005, Mankiewicz-Boczek et al, 2006a; Izydorczyk et al, 2008).

Currently, biomass and composition of phytoplankton is determined by different microscopic methods, and the most commonly used technique is Utermöhl sedimentation method. However, no matter which of the microscopic method is used, the biomass determination is always time- consuming. It should be also noted that the identification of individual species requires expertise in taxonomy. Therefore, the concentration of chlorophyll a may be a good indicator of phytoplankton biomass, and is often a major component of trophic state indices. However, the actual measurement of chlorophyll a does not allow the identification of specific groups of phytoplankton including cyanobacteria.

Therefore, since few years, a highly sensitive and efficient molecular quality monitoring is used more and more frequently for monitoring of cyanobacterial blooms, which allows to, first, the early detection of cyanobacteria (eg., detection of 16S rRNA gene) and, secondly, the determination of their toxigenic (potentially toxic) strains based on the presence of chosen genes from mcy gene cluster for detection of microcystins-producing cyanobacteria (Mankiewicz-Boczek et al 2006a,b; 2009).

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 274

In the present project, traditional monitoring of cyanobacteria was performed for first identification of threat in Tana Lake. Additionally, new mcyE primers for the detection of mcyE gene involved in the synthesis of cyanobacterial hepatotoxins - microcystins, in order to early warning of toxigenic (potentially toxic) strains, were developed in collaboration with the Institute of the Medical Biology PAS in Lodz, Poland.

Materials and methods Water sampling: Water was taken from Bahir Dar Gulf, over which lies the town of Bahir Dar numbering 186.000 inhabitants (data from 2006). Samples were taken in the dry season (1 sample, 11.21.2009) and in the rainy season (4 samples, 16.06 and 30.06 and 15.08 and 30.08.2010). For analysis, the surface samples were taken.

Selection of the bay in the vicinity of Bahir Dar city was dictated by the fact that sewage from urban catchment are flowing directly to the Tana Lake. The sewage from numerous point and surface sources serve as a source of nutrients, including nitrogen and phosphorus, promoting the process of eutrophication, and consequently the formation of cyanobacterial blooms.

Analysis of physicochemical and biological parameters of water: During sampling the following physico-chemical parameters were determined:- measurement of the water temperature;- measurement of pH and conductivity in the integrated samples.

Analysis of chemical composition was conducted using an ion chromatograph Dionex ICS-1000, which allows qualitative and quantitative analysis of anions and cations. By using the analytical column Ion Pac AS14A an analysis of inorganic anions such as nitrites, phosphates and nitrates was conducted. Analysis was also made for the total nitrogen (HACH method no. 10072 - persulphate digestion using the test vials N’Tube) and phosphorus by pressure mineralization with Oxisolve ® reagent using ascorbic acid method.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 275

Chlorophyll a was determined by dye extraction with acetone. Specific volume of sample was filtered through a Whatman glass filter GF/C. Chlorophyll was extracted from glassfibre filters with acetone in covered tubes for 24 hours at 4°C without light. Extinction of the extract was measured at a wavelength of 664 nm and 750 nm on a spectrophotometer Spectronic Genesys 2 and then acidified with 0.1 N HCl for the degradation of chlorophyll to pheophytin.

Phytoplankton analysis: For the determination of phytoplankton species composition, abundance and phytoplankton biomass, the samples were preserved with Lugol’s solution. Microscopic analysis of phytoplankton species composition was performed using a microscope ECLIPSE FL-400 NIKON. Morphological analysis of the collected material was done on the basis of the work performed by Starmach (1966), Komárek (1991), Komárek and Anagnostidis (1999).

Analysis of the presence of mcyE gene: To obtain material for cyanobacterial DNA analysis, 100 ml of water from each sampling was filtered through a sterile filter with a diameter of 0.45 µm. Filters were placed in a lysis buffer composed of 40 mM EDTA, 400 mM NaCl, 0.75 M sucrose and 50 mM Tris-HCl (pH 8.3) in sterile tubes and stored at (- 20°C) until DNA extraction. DNA from the cells of cyanobacteria was isolated by the standard method of extraction with hot phenol. The study was conducted to identify mcyE gene (405 bp) involved in the synthesis of microcystins using PCR (polymerase chain reaction). For gene amplification primers: mcyE f1 (5’gggacgaaaagataatcaagttaagg’3) and mcyE r1 (5’ataggatgtttagagagaattttttccc’3) were used. The reaction mixture (20 µl) was: DNA (1 µl), reaction buffer (2 µl), 3 mM

MgCl 2, 0.25 mM dNTP, 0.25 µM of each primer, 1U Taq polymerase (Qiagen) and 0.1 mg/ml BSA. The amplified gene fragment mcyE , was analyzed on 1.5% agarose gel stained with ethidium bromide, using a marker ΦX174-HaeIII (Finnzymes). Visualization and documentation of results was performed using a camera UVIDOC, Kava. Ska.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 276

Microcystins concentration analysis ELISA ( enzyme-linked immunosorbent assay ): ELISA test is a colorimetric method which allows quantitative analysis of microcystins and nodularins in nonconcentrated water samples. ELISA is available in the form of ready test kits (Microcystins QuantiTube EnviroGard® Test Kit and EnviroLogix® Microcystin QuantiPlate ™ Kit). On the basis of MC-LR standards, it is possible to evaluate the total concentration of microcystins in nonconcentrated water samples as equivalents of MC-LR, with a detection limit of 0.2 mg/l (EnviroGard) and 0.16 mg/l (EnviroLogix). The total test range is from 0.2 - 4 mg/l (EnviroGard) and 0.16 - 2.5 micrograms/l (EnviroLogix) of microcystins in the sample.

Quantitative and qualitative microcystins analysis-DAD HPLC (high performance liquid chromatography with diode array detection): High performance liquid chromatography method with solid phase extraction (SPE) allows the determination of low concentrations of toxins, even in the presence of large amounts of pollutants. In addition, use of diode-array detector (DAD), allows efficient identification of microcystins on the basis of not only the retention times consistent standards, but also their characteristic absorption spectra, and thus eliminates the other factions. Currently it is one of the basic methods for detection, separation and determination of the concentration of dissolved in water and cell-bound microcystins (cyanobacterial hepatotoxins). Content of microcystins in the cells of cyanobacteria (cell-bound) collected from Lake Tana was analyzed in suspension remaining on the filter.

Whatman GF/C filters with previously filtered suspension was extracted in 75% methanol and treated with ultrasonication using XL 2020 ultrasonicator (Misonix Inc. USA). The samples were then centrifuged, evaporated and again dissolved in 1 ml 75% methanol. The samples prior to analysis by HPLC was subjected to filtration using a GHP Acrodisc syringe filters, 0.45 µm (Pall), and then treated with a chromatographic column for the quantitative and

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 277 qualitative determination of microcystins by liquid chromatography with diode array detection DAD using Hewlett Packard liquid chromatograph (1100), according to Jurczak et al. (2004). Qualitative analysis of microcystins was performed based on the retention times of individual components consistent with the retention times of standards analyzed: microcystin-LR,- YR,-RR and characteristic UV spectra of microcystins. Quantitative analysis of the substances identified as microcystins was based on the calibration curve drawn for the peak area of microcystin-LR, with a detection limit of 0.01 µg/l. For the method calibration from microcystins quantification, microcystins standards were purchased from Calbiochem, USA.

Results and discussion The physico-chemical and biological parameters: Formation of cyanobacterial blooms is dependent on environmental parameters affecting the process of eutrophication, which include: water temperature (18-25°C), pH (6-9), the availability of nutrients, their concentrations and the ratio (TN> 1.5 mg/l; TP>0.1 mg/L; TN/TP = 15/1; DN>1.5 mg/l; DP>0.06 mg/l) and the concentration of chlorophyll a (Chll a > 25 µg/l). Therefore, the first step in assessing of the occurrence of cyanobacteria in Tana Lake was to determine the physico-chemical and biological parameters of water. On the basis of five measurements taken during the dry season (2009) and rainy season (2010) it seems that the most important chemical parameter that can affect the formation of blooms of cyanobacteria was total phosphorus (TP), with maximum value in November 2009 (dry season) was 0.27 mg/l (Table 1). For other parameters, values conducive to the development of cyanobacteria were temperature (24-26ºC), pH (8-9) or TN/TP ratio (≤ 10, with exception of 15.08.2010).

Another relevant biological parameter seems to be a concentration of chlorophyll a, because its maximum value, as well as the value of TP and the biomass of cyanobacteria including hepatotoxic species Microcystis aeruginosa , were recorded in November 2009 (Table 2). In the case of

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 278

samples collected during the wet season, the concentration of chlorophyll a ranged from 4.49 µg/l to 10.07 µg/l which resulted in the further analysis in also much lower biomass of cyanobacteria (Table 2).

Table 1. Physico-chemical parameters of Tana Lake water.

N/P Sampling Temp. pH Con. PO 3- NO - NO - NH DN TN TP 4 3 2 3 ratio date 0C µs mg/l mg/l mg/l mg/l mg/l mg/l mg/l 21.11.2009 n.a. n.a. n.a. 0.02 0.35 0.01 0.05 0.41 0.60 0.27 2.22

16.06.2010 25.00 8.15 150 0.03 0.13 0.00 0.00 0.13 0.70 0.07 10.00 30.06.2010 26.00 8.04 140 0.01 0.11 0.00 0.03 0.14 0.60 0.07 8.57 15.08.2010 24.30 8.76 147 0.02 0.17 0.00 0.00 0.17 1.90 0.07 27.14 30.08.2010 23.80 8.10 160 0.03 0.11 0.00 0.01 0.13 1.00 0.11 9.09 DN – diluted nitrogen’s forms; n.a. – not analyzed (no data).

The occurrence of cyanobacteria and their toxigenic strains: In the dry season in 2009, as already mentioned, the highest biomass of cyanobacteria (188.18 mg/l) was observed, with domination of Microcystis aeruginosa (Table 2). During the rainy season the amount of cyanobacteria was very small and ranged from 0.01 mg/l to 4.98 mg/l. In the case of samples taken in June (2010, rainy season), microscopic analysis showed the presence of Microcystis wesenbergii that usually does not produce cyanobacterial hepatotoxins - microcystins, or creates populations, dominated by non-toxic strains of cyanobacteria. The M. aeruginosa , widely regarded as a highly hepatotoxic, appeared again in August (Table 2).

Performed genetic analysis (detection of gene mcyE ) for the presence of toxigenic strains responsible for the production of microcystins, have confirmed the ability of cyanobacteria, found in Tana Lake, for the production of the above mentioned hepatotoxins (Table 2, Fig. 1). Toxigenic (potentially toxic) cyanobacteria also appeared in June, during the rainy season (2010) when the dominant species was M. wesenbergii. Sensitive PCR method

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 279 enabled their detection although the total biomass of cyanobacteria was low with a value of 0.01 mg/l, where according to microscopic analysis, there were no cyanobacteria capable of microcystins production. The obtained results show the important role of genetic analysis in the early detection of toxigenic cyanobacteria, which at a later stage are able to produce microcystins (see August 2010).

Fig. 1. The detection of mcyE gene (405 bp), involved in the biosynthesis of microcystins, in samples taken from Tana Lake (Bahir Dar gulf, near the town of Bahir Dar, Ethiopia). M - DNA marker φX174-HaeIII Digest; K - negative control; * - mcyE gene present. Additionally, the sample from Gumara estuary was also analyzed, and showed the presence of toxigenic cyanobacteria. (Fig. 1: Missing for technical reasons).

The presence of cyanobacterial hepatotoxins – microcystins: The presence of microcystins in Tana Lake in the first stage was determined using the ELISA screening assay, in which significant concentrations of microcystins (1.34 µg/l), exceeding the limit value for drinking water (1 µg/l), suggested by World Health Organization (WHO, 2006), was detected in the dry season (November 2009). In samples collected during the rainy season there was a small amount of microcystins (0.23 µg/l) (Table 2).

Further quantitative and qualitative analysis of microcystins using analytical HPLC confirmed high hepatotoxins concentration in a sample taken during the dry season (2009), where this value (2.65 µg/l) also confirmed exceeding the first stage of a threat to recreation (≥ 2 µg/l) according to WHO guidelines (2003). During the rainy season, using HPLC technique, even trace amounts of microcystins were not detected, but probably it was caused by improper storage and long transport of samples from Ethiopia to Poland.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 280

Table 2. Toxic cyanobacteria found in Tana Lake. n.d. - not detected, possibly results were caused by the difficult conditions for storage and transport of samples; n.d.* - not detected, the result could be caused by very small amounts of cyanobacteria, including toxigenic strains.

Cyanob Microcystin Chll Gene Microcystin Micro Samplin Cyanobacterial acterial s producing a mcyE s [µg/l] cystin g date species biomass cyanobacte ELISA s ria [µg/l] HPLC mg/l mg/l µg/l (405 Total MC- MC- MC-LR Oth bp) RR YR er 21.11.20 Microcystis 188.18 187.69 50.4 + 1.34 0.74 n.d. 0.85 1.06 09 aeruginosa, 6 Microcystis wesenbergii 16.06.20 Microcystis 0.01 0.00 4.49 + 0.60 n.d. n.d. n.d. n.d. 10 wesenbergii 30.06.20 Microcystis 0.02 0.00 9.93 n.d.* 0.04 n.d. n.d. n.d. n.d. 10 wesenbergii 15.08.20 Microcystis 4.98 4.03 10.0 + 0.04 n.d. n.d. n.d. n.d. 10 aeruginosa 7 Microcystis wesenbergii Pseudoanabeana sp. 30.08.20 Microcystis 0.6 0.56 8.54 + 0.23 n.d. n.d. n.d. n.d. 10 aeruginosa Microcystis wesenbergii

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 281

Conclusions 1. Toxigenic (potentially toxic) cyanobacteria were detected in Tana Lake on the basis of the new primers designed for mcyE gene. 2. The highest biomass of cyanobacteria (188.18 mg/l), with domination of Microcystis aeruginosa , and the highest concentration of microcystins (2.65 µg/l) were detected in the dry season, in November 2009. 3. The concentration of microcystins in the dry season exceeded the limit value for drinking water (WHO, 2006) and indicated the first alarm level of risk for recreational activities (WHO, 2003). 4. Amount of total phosphorus appears to be an important parameter for the creation of the harmful algal blooms in Tana Lake. 5. The mcyE gene can be recommended as a marker for early detection of toxic cyanobacteria in Tana Lake.

Goals for the future In the next project it is planned to continue study in the Gulf of Bihar Dar and to extend monitoring to the next point, which will be Gumara estuary. Both points of research differ in terms of potential contaminants which are favorable for the process of eutrophication: Bahir Dar - surface and point pollution from urban catchment and Gumara River - surface pollution from agricultural catchment. Source and type of pollutants and hydromorphology terrain can affect the decisive parameters for the formation of blooms and the production of microcystins.

The continuation of studies on additional samples, especially in the dry season, is essential for the preparation of statistical analysis for the prediction of environmental parameters conducive to the formation of toxic cyanobacterial blooms in order to further develop methods to reduce algal blooms, and thus reduce the risk to human health and increase the quality of water. According to the first and second principle of Ecohydrology, identification of cause-effect relationship, together with studies aimed at

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 282 comparative analysis of the typology, hydrochemistry, composition and toxicity of phytoplankton of the lakes / reservoirs are fundamental to developing a strategy for reversal of eutrophication and in consequence elimination of cyanobacterial threat (Zalewski, 2002, 2010).

Moreover, based on past experience, it is required on the Etjhiopian side for home use to optimize fully of the methodology for monitoring of the risk from toxic cyanobacteria responsible for production of microcystins, including the preparation of standard operating procedures for the proposed study.

Acknowledgements The authors would like to acknowledge prof. Maciej Zalewski, Director of European Regional Centre of Ecohydrology u/a UNESCO, Poland and Mr. Yohannes Zerihun, Coordinator for Abbay Basin Irrigation and Drainage Study and Design projects, Ministry of Water and Energy Resources of Ethiopia for initiating and bridge the scientific cooperation between the Ethiopian and Polish scientists. This study was carried out within the project: 1018/2009 and 994/2010 “Ecohydrology – a transdisciplinary science for integrated water resources and sustainable development in Ethiopia” financed by Ministry for Foreign Affairs of Republic of Poland.

References Hitzfeld ,B.C., Hoger,S.J.,Dietrich,D.R.,2000.Cyanobacterial toxins ;removal during drinking water treatment ,and human risk aessessment .Environ.Health perspect.108,113-122. Humpage,A.R., Falconer,I.R., 1999.MCYST-LR and Liver tumor promotion:effects on cytokinesis,ploidy,and apoptosis in cultured hepatocytes.Environ.Toxicol.14,61-76 Izydorczyk, K., Jurczak, T., Wojtal-Frankiewicz, A., Skowron, A., Mankiewicz- Boczek, J., Tarczyńska, M. 2008. Influence of abiotic and biotic factors on microcystins content in Microcystis aeruginosa cells in a eutrophic temperate reservoir. J.Plankton Res. 30, 393-400.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 283

Jurczak, T., Tarczyńska, M., Karlsson, K. and Meriluoto, J. 2004. Characterization and diversity of cyanobacterial hepatotoxins (microcystins) in blooms from Polish freshwaters identified by liquid chromatography-electrospray ionisation mass spectrometry. Chromatographia , 59, 571–578. Komárek, J. 1991. A review of water-bloom forming Microcystis species, with regard to population from Japan. Arch, Hydrobiol (Suppl)./ Algol. Stud . 73, 115–127. Komárek, J., Anagnostidis, K. 1999. Cyanoprokaryota. [W:] H. Ettl, G. Gardner, H. Heynig and D. Mollenheuer, Editors, 1: Chroococcales. Süsswasserflora von Mitteleurope, Gustav Fischer, 225–236. Mankiewicz, J., Komarkova, J., Izydorczyk, K., Jurczak, T., Tarczyńska, M., Zalewski, M. 2005. Hepatotoxic cyanobacterial blooms In the lakes of Northern Poland. Environ. Toxicol. 20, 499-506. Mankiewicz-Boczek, J., Izydorczyk, K., Jurczak, T. 2006a. Risk assessment of toxic cyanobacteria in polish water bodies. In: Kungolos, A.G., Brebbia, C.A., Samaras C.P., Popov, V. [Eds] Environmental toxicology WITPress, Series Volume: 10, Southampton, Boston. pp. 49-58. Mankiewicz-Boczek, J., Izydorczyk, K., Romanowska-Duda, Z., Jurczak, T., Stefaniak, K., Kokocinski, M. 2006b. Detection and monitoring toxigenicity of cyanobacteria by application of molecular methods. Environ. Toxicol . 21, 380-387. Mankiewicz-Boczek, J., Gągała, I., Kokocinski, M., Jurczak, T., Stefaniak, K. 2009. Perennial Toxigenic Planktothrix agardhii Bloom In Selected Lakes of Western Poland. Environ. Toxicol . DOI: 10.1002/tox.20524. Starmach K., 1966. Cyanophyta, Glaucophyta. [W:] Flora słodkowodna Polski. Red. K. Starmach. PWN Warszawa, Tom. 2. Ward ,D.M.,Ferris,M.J., Nold,S.c., Bateson, M.M., 1998.A natural view of microbial biodiversity with in hot spring cyanobactetrial mat communities .Microbiol.Mol.Biol.Rev.62,1353-1370.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 284

WHO, 2003. Algae and cyanobacteria in fresh water. [In:]: Guidelines For Safe Recreational Water Environments. Coordinator: Jamie Bartram, Geneva, Switzerland, pp. 149-151. WHO, 2006. WHO Guidelines for Drinking Water Quality, Incorporating First Addendum Third edition. Recommendations vol. 1 , World Health 697 Organization, Geneva, Switzerland, pp. 407–408. Zalewski, M. 2002. Ecohydrology – the use of ecological and hydrological processes for sustainable management of water resources. Hydrol. Sci. J. , 47(5), 825-834. Zalewski M. 2010. Ecohydrology for compensation of Global Change. Braz. J. Biol. 70(3), 689-695.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 285

Lake Tana’s (Ethiopia ) endemic Labeobarbus spp. Flock: An uncertain future threatened by exploitation, land use and water resources developments

Brehan Mohammed 1,2 , Martin de Graaf 3, Leo Nagelkerke 4, Wassie Anteneh 2,Minwyelet Mingist 1 1Department of Fisheries, Wetlands and Wildlife Management, College of Agriculture and Environmental Sciences, Bahir Dar University, P.O.BOX 79 Bahir Dar, Ethiopia. 2 Bahir Dar Fisheries and Aquatic Life Research Center, P.O Box 794 Bahir Dar, Ethiopia. 3IMARES Wageningen University and Research Centers, P.O. Box 68, 1970 AB IJmuiden, The Netherlands. Email: [email protected] 4Aquaculture and Fisheries Group, Wageningen Institute of Animal Sciences (WIAS), Wageningen University, Marijkeweg 40, 6709 PG Wageningen, The Netherlands. Email: leo.nagelkerke @wur.nl

Abstract: The main objective of this paper is to assess the stock status of the commercially important fish species for sustainable use of the resource in Lake Tana. The study conducted from July 1, 2010 to June 2011 and is expected to determine abundance and size trend of the three commercially important fish stocks (Oreochromis niloticus, Clarias gariepinus and Labeobarbus) as compared to the last decades and determine the current status of the fishery and fish stocks. The same approach and methodology will be used to monitor the fisheries as described in Wudneh (1998) and de Graaf et al. (2006) for the three commercially important fish species. The status of Lake Tana’s fish stocks, especially the unique species flock of Labeobarbus species flock, will be discussed with regard to changes in fishing effort, hydrological engineering projects and climate change.

Preliminary results of the ongoing study appear to indicate a (further) decline of Lake Tana’s fish stocks. Between August and November 2010 a large part of the fishery ceased due to expected low catches. CPUE data seem to show a further decline of the Labeobarbus stocks since the dramatic collapse during the 1990s.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 286

Key words: Stock, CPUE, Labeobarbus, Oreochromis niloticus, Clarias gariepinus

Introduction Three fish families occur in Lake Tana. The Cichlidae and Clariidae are represented by only one species each, Oreochromis niloticus Linnaeus 1766 and Clarias gariepinus Burchell 1822 respectively. In contrast to the headwater lakes of the White Nile where haplochromine cichlids dominate, the fish fauna of Lake Tana is dominated by the cyprinid fishes represented by four genera, i.e. Varicorhinus (one species V. beso Rüppell 1836), Labeobarbus, Barbus and Garra .

Despite the overwhelming abundance of cyprinid fishes throughout the world’s fresh water systems, the Labeobarbus species (Fig. 1) of Lake Tana form, as far as we know, the only remaining intact species flock of large cyprinid fishes (Nagelkerke et al ., 1994), since the one in Lake Lanao in the Philippines, has practically disappeared due to anthropogenic activities (Kornfield and Carpenter 1984).

The susceptibility of large African cyprinids to overexploitation has been proven repeatedly in the previous century, as attested by the collapse of Labeo mesops fisheries in Lake Malawi (Skelton et al., 1991), Labeo victorianus and Barbus altianus in Lake Victoria (Ogutu-Ohwayo, 1990; and Labeo altivelis in Lake Mweru (Gordon, 2003). Their reproductive strategy, involving the formation of easily targeted spawning aggregations, makes these large African cyprinids vulnerable to fishing activities.

Increased fishing pressure after the introduction of a commercial motorized gillnet fishery in the late 1980 was the most likely cause of the drastic decrease in abundance by ca. 75% of the migratory riverine spawning Labeobarbus species and the collapse of juvenile Labeobarbus (between 5-18

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 287 cm Fork length by 90%) during the 1990s (de Graaf et al. 2004; de Graaf et al. 2006).

The last time the fish stocks in Lake Tana were properly monitored and assessed has nearly been a decade ago. Assessing the stock status of commercially important fish species should be done on regular basis for providing base line information, better management and sustainable use of the resources. Therefore, this study was initiated aiming to assess the current status of the fisheries and the most commercially important fish stocks, i.e. C. gariepinus , O. niloticus and Labeobarbus spp.

This paper, presents the preliminary results of the current fisheries monitoring program in Lake Tana. We compare Labeobarbus CPUE and length frequency data with previous studies (Wudneh 1998; de Graaf et al., 2006) and briefly discuss the threats of increased fishing pressure, land use and water development projects on the future of Lake Tana’s endemic Labeobarbus species flock.

Materials and methods Lake Tana is the largest lake in Ethiopia with an area of about 3200 km2 and is situated in the north-western highlands at an altitude of about 1800 m (Serruya and Pollingher, 1983. The Lake is believed to have originated two million years ago by volcanic blocking of the Blue Nile River (Mohr, 1962) and it is the headwater of the Blue Nile River. It is shallow lake with an average depth of 8 m and maximum depth of 14 m and it is turbid, well-mixed and has no thermocline (Serruya and Pollingher, 1983 ).

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 288

Fig. 1. Lake Tana’s endemic Labeobarbus species flock

Between July and December 2010, total weight or number of Labeobarbus spp caught by motorised boats and sold to the Fish Production and Marketing Enterprise(19 boats) and Bahar Dar Tana Hulegeb Number One Fisheries Co- operative(THFC with around 42 boats) and (17 boats) were recorded daily. When recording the total catch of single individual motorised boat, additional data on number of gillnets used, mesh size (cm stretched mesh), fishing location and unsold fish being discarded or used for own consumption were collected by interviewing the fishermen.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 289

Data on length frequency and species composition of Labeobarbus were collected monthly. During the first week of each month for three consecutive days, 200 Labeobarbs were identified to species level and the fork-length (FL) was measured to the nearest 1.0 cm. Identification of species was done based on the description and identification key given by Nagelkerke and Sibbing (2000). Overall, the current study use the same approach and methodology as described in Wudneh (1998) and de Graaf et al. (2006).

Results and discussion Changes in Lake Tana’s Labeobarbs fisheries: Due to the low catches of the main target species, O. niloticus or Nile Tilapia, most fishermen ceased fishing completely during the months September and October while only limited fishing occurred in August and November. In the few months that fishing occurred the Labeobarbus CPUE had dropped to an alarming 6 kg/trip (Fig. 2) in comparison with 28 kg/trip in 2001 and 63 kg/trip in 1991–1993 (63 kg/trip).

The average size of the Labeobarbus landed by the commercial fisheries between 2001 and 2010 (Fig. 2) did not seem to have changed, indicating no change in the mesh used by the commercial, motorized gillnet fishery . Already in 2001, the reed boat fishermen used a smaller mesh size as is clearly indicated by the smaller size of the landed Labeobarbus (Fig. 2).

The main question is now whether the absolute dramatic decline in Labeobarbus CPUE in commercial gillnet fisheries between 2001 and 2010 is an true indicate of a further (and almost complete) collapse of the Labeobarbus stocks or merely indicates a change in catchability. Unfortunately, in previous studies (de Graaf et al. 2004, 2006), fisheries CPUE appeared to be a good indicator of stock size as both changes in fisheries CPUE and CPUE of fisheries independent monitoring programs were highly similar. Also no that much change in number and size of gear had been

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 290 observed between 2001 and 2010. Whether or not fishing sites have changed to such an extent that it can explain the large changes in CPUE seemed unlikely but cannot be ruled out at this point of the study.

Future of Lake Tana’s Labeobarbus spp. flock: In sharp contrast to Oreochromis niloticus and Clarias gariepinus , the Labeobarbus species are predicted to be by far the most susceptible to fisheries as the labeobarbs are: (a) long-lived (Wudneh, 1998), (b) form spawning aggregations (Nagelkerke and Sibbing, 1996; Palstra et al. 2004; de Graaf et al., 2005), and (c) are predominantly ecologically highly specialised endemics (Sibbing and Nagelkerke, 2001; de Graaf et al. 2008). The main threats to the survival of Lake Tana’s Labeobarbus species flock are illustrated in Figure 4.

Unregulated and uncontrolled fisheries: The drastic and rapid consequences of an unregulated gillnet fishery on spawning aggregations of large African cyprinid fishes has become painfully clear with the collapses of Labeo mesops fisheries in lake Malawi (Skelton et al., 1991), Labeo victorianus and Barbus altianalis fisheries in Lake Victoria (Cadwalladr 1965; Ogutu-Ohwayo, 1990; Ochumba and Manyala, 1992) and the virtual disappearance of Labeo altivelis from the Mweru-Luapula system within a period of 20 years (Gordon, 2003).

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 291

Fig. 2: Temporal variation in Labeobarbus CPUE of the commercial gillnet fishery during: (Upper) 1991-1993, Middle) 2001 and (Lowerc) 2010 (preliminary data July-December 2010). Dotted lines indicate overall mean, error bars indicate 95% confidence intervals. Graphs 1991-1993 and 2001 redrawn from de Graaf et al. 2006. ALL y-axis are: CPUE (kg/trip)

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 292

25 Labeobarbus COMMERCIAL 2000 n=5796 20

0 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 2 2 2 2 2 2 2 2 2 2 3 3 3 3 3 3 3 3 3 3 4 4 4 4 4 4 25 Labeobarbus COMMERCIAL 2010 n=1858 20

0 Frequency (%) 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 2 2 2 2 2 2 2 2 2 2 3 3 3 3 3 3 3 3 3 3 4 4 4 4 4 4 25 Labeobarbus REEDBOAT 2000 n=572 20 avg=29.5

0 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 2 2 2 2 2 2 2 2 2 2 3 3 3 3 3 3 3 3 3 3 4 4 4 4 4 4 Fork Length (cm)

Fig. 3. Length frequency distribution of the Labeobarbus landed by the commercial motorized gillnet fishery in (Upper) 2010 (this study) and (Middle) 2000 (de Graaf, unpublished data) and by the traditional reed boat fishery in (Lower) 2000 (de Graaf, unpublished data).

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 293

In the past no management plan has been developed because of, (1) lack of federal fisheries legislation, (2) lack of data on the characteristics of both the fish stocks spawning period, and of the commercial gillnet fishery, and (3) lack of knowledge dissemination, i.e. information is published in English in international scientific journals, hence less accessible for local experts, civil servants and policy makers. However, these issues have been resolved as fisheries legislation has been in place since 2003 and a large amount of fish and fisheries information is available in both English and Amharic (de Graaf et al. 2006).. The implementation of fisheries regulations is of utmost importance to gain control of fisheries developments in and around Lake Tana. A recent survey indicated that the number of motorized boats (Fig.4) on Lake Tana may have increased from 5 to 50-100 between 2000 and 2010 while the number of reed boat fishermen has possibly risen from 400 to 1500 during the same period.

Land use and erosion: Erosion of river banks (Fig. 4) due to poor land management practices, causes further pressure on the reproductive success of riverine spawning Labeobarbs. The removal of natural vegetation or wetlands (shrubs and trees) along the river banks and the use of land right up to the river bank for agriculture purposes have led to increased erosion and sedimentation. The sedimentation load could have detrimental consequences for developing fish larvae and eggs as riverine spawning labeobarbs require clear, fast flowing, highly oxygenated streams with rocky substrate to successfully reproduce.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 294

Figure 4. Past, present and future threats to Lake Tana’s Labeobarbus species flock (Up left) increased fishing pressure and (Up right) planned release of water into the spawning grounds (figure from Alemayehu et al., 2009). Below: Lake Tana and feeder rivers.

Water resource developments: A possible final blow to the survival of riverine spawning Labeobarbus species are the planned irrigation dams in most of the rivers (Fig. 4) and the expected negative effects on Lake Tana’s water level of the Tana-Beles hydropower station (McCartney et al. 2010). The location of the irrigation dam that is currently under construction in the Ribb River is in the middle of the Labeobarbus spawning grounds. An irrigation dam (Getahun et al. 2008) cause a) the loss of spawning habitat upstream from the dam, b) reduced flow over the dam during the spawning season will prevent sufficient inundation of spawning areas downstream from the dam preventing successful reproduction, and c) reduced flow over the dam will prevent the sufficient inundation of flood plains near the river mouth, negatively affecting fish (also including O. niloticus nursery grounds) and farmers.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 295

For the conservation of the Lake Tana ecosystem, continuous monitoring of the catches of traditional and modern fisheries, and conducting regular fishery-independent sampling programs, are of utmost importance to determine the condition of the stocks and to evaluate the consequences of implemented regulations and potentially devastating developments like the construction of irrigation dams in spawning rivers. An integrated (hydrology, environment, livelihoods) management plan and research programme for the Lake Tana basin is urgently required to prevent the collapse of an important fishery and the extinction of the only known cyprinid species flock in the world.

References Alemayehu T., McCartney M., Kebede, S. 2009 Simulation of Water Resource Development and Environmental Flows in the Lake Tana Sub basin. In: Awulachew, S. B.; Erkossa, T.; Smakhtin, V.; Fernando, A. (Comp.). 2009. Improved water and land management in the Ethiopian highlands: Its impact on downstream stakeholders dependent on the Blue Nile. Intermediate Results Dissemination Workshop held at the International Livestock Research Institute (ILRI), Addis Ababa, Ethiopia, 5-6 February 2009 . Summary report, abstracts of papers with proceedings on CD- ROM. Colombo, Sri Lanka: International Water Management Institute . doi:10.3910/2009.201 Cadwalladr, D.D., 1965. The decline in Labeo Victorianus Boulenger (Pisces: Cyprinidae) fishery of Lake Victoria and an associated deterioration in some indigenous fishing methods in the Nzoia River, Kenya. East African Agricultural and Forestry Journal 30: 249-256. De Graaf M, Dejen E, Osse JWM, Sibbing FA (2008) Adaptive radiation of Lake Tana’s (Ethiopia) Labeobarbus species flock (Pisces; Cyprinidae). Marine and Freshwater Research, 59, 391-407. De Graaf, M., E.D. Nentwich, J.W.M. Osse & F.A. Sibbing, 2005. Lacustrine spawning: is this a new reproductive strategy among ‘large’ African cyprinid fishes? Journal of Fish Biology 66: 1214-1236.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 296

De Graaf, M., M.A.M. Machiels, T. Wudneh & F.A. Sibbing, 2004. Declining stocks of Lake Tana’s endemic Barbus species flock (Pisces; Cyprinidae): natural variation or human impact? Biological Conservation 116: 277- 287. De Graaf, M., P.A.M. van Zwieten, M.A.M. Machiels, E. Lemma, T. Wudneh, E. Dejen, & F.A. Sibbing, 2006. Vulnerability to a small-scale commercial fishery of Lake Tana’s (Ethiopia) endemic Labeobarbus compared with African catfish and Nile tilapia: An example of recruitment overfishing? Fisheries Research 82: 304-318. Getahun A, Dejen E, Wassie A. 2008. Fishery studies of Ribb River, Lake Tana Basin, Ethiopia. Final Report E1573, Vol. 2. Gordon, D.M., 2003. Technological change and economies of scale in the history of Mweru-Luapula’s fishery (Zambia and Democratic Republic of the Congo). In: Jul-Larsen, E., J. Kolding, R. Overå, J. Raakjær Nielsen & P.A.M. van Zwieten (eds), Management, co-management or no- management? Major dilemmas in southern African freshwater fisheries, FAO Fisheries Technical Paper 426/2. Rome, FAO, pp.164-178 Kornfield, I., Carpenter, K.E., 1984. Cyprinids of Lake Lanao, Philippines: taxonomic validity, evolutionary rates and speciation scenarios. In: Echelle, A.A., Kornfield, I. (Eds.) Evolution of fish species flocks. Orono Press, Maine, pp. 69-83 Lamb, H.F., Bates, C.R., Coombes, P.V., Marshall, M.H., Umer, M., Davies, S.J., Dejen, E., 2007. Late Pleistocene desiccation of Lake Tana, source of the Blue Nile. Quat. Sci. Rev. 26, 287–299. McCartney, M.; Alemayehu, T.; Shiferaw, A.; Awulachew, S. B. 2010. Evaluation of currentand future water resources development in the Lake Tana Basin, Ethiopia. Colombo, Sri Lanka: International Water Management Institute. 39p. (IWMI Research Report 134). doi:10.3910/2010. 204 Nagelkerke, L.A.J. & F.A. Sibbing, 1996. Reproductive segregation among the large barbs (Barbus intermedius complex) of Lake Tana, Ethiopia. An

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 297

example of intralacustrine speciation? Journal of Fish Biology 49: 1244- 1266. Nagelkerke, L.A.J., F.A. Sibbing, J.G.M. van den Boogaart, E.H.R.R. Lammens & J.W.M. Osse (1994) The barbs (Barbus spp.) of Lake Tana: a forgotten species flock? Environmental Biology of Fishes 39: 1-22. Nagelkerke, L.A.J., Sibbing, F.A., 2000. The large barbs ( Barbus spp., Cyprinidae, Teleostei) of Lake Tana (Ethiopia), with a description of a new species, Barbus osseensis . Nether. J. Zool. 50, 179–214. Ochumba, P.B.O. & J.O. Manyala, 1992. Distribution of fishes along the Sondu- Miriu River of Lake Victoria, Kenya with special reference to upstream migration, biology and yield. Aquaculture and Fisheries Management 23: 701-719. Ogutu-Ohwayo, R., 1990. The decline of the native fishes of Lakes Victoria and Kyoga (East Africa) and the impact of introduced species, especially the Nile perch, Lates niloticus and the Nile tilapia, Oreochromis niloticus. Environmental Biology of Fishes 27: 81-96. Palstra, A. P., de Graaf, M., Sibbing, F. A., 2004. Riverine spawning and reproductive segregation in a lacustrine species flock, facilitated by homing? Anim. Biol. 54(4), 393-415. Serruya, C. and Pollingher, U. 1983. Lakes of the warm belt. pp 1-569. London, Cambridge University Press. Sibbing, F.A. & L.A.J. Nagelkerke, 2001. Resource partitioning by Lake Tana barbs predicted from fish morphometrics and prey characteristics. Reviews in Fish Biology and Fisheries10: 393-437. Skelton, P.H., Tweddle, D., Jackson, P., 1991. Cyprinids of Africa. In Winfield, I.J. & J.S. Nelson (eds.), Cyprinid Fishes, Systematics, Biology and Exploitation. Chapman & Hall, London, 211-233. Wudneh, T., 1998. Biology and management of fish stocks in Bahir Dar Gulf, Lake Tana, Ethiopia. Ph.D. thesis, Wageningen Agricultural University, Wageningen, The Netherlands.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 298

ANNEX Program of the 3 rd Annual Conference of the Ethiopian Fisheries and Aquatic Sciences Association (EFASA) Impacts of climate change and population on tropical aquatic resources February 3-6, 2011 Haramaya University

February 04, 2011 (Friday): Morning Session Time Speakers Title Responsible* 8:00 -8:20 AM Registration - Ato. Ashagrie Gibtan Ato. Akewak Geremew 8:20 -8:30 Dr. Seyoum Mengestou, Welcome/Introductory EFASA V/president Remarks 8:30 -8:40 AM Prof. Belay Kassa, HU Opening speech Dr. Seyoum Mengistou president 8:40 -8:50 AM Dr. Brook Lemma Keynote Address Dr. Se youm Mengistou 8:50 -9:10 AM Institutional profile Haramaya University Dr. Seyoum Mengistou

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 299

9:10 -9:30 AM Gashaw Tilahun Review On Impacts Of Dr. Seyoum Mengistou Global Warming And Climatic Change On Fisheries And Aquaculture. 9:30 -9:50 AM Dere je Tewabe Climate Change Challenges Dr. Seyoum Mengistou On Fisheries And Aquaculture

9:50 -10:10 AM Climate Change And Dr. Seyoum Mengist ou Lemma Abera Wetland Resources Vulnerability: Impacts On Livelihoods And Opportunities For Enhancing In Ethiopia. 10:10 -10:30 am Tea break 10:30 -10:50 AM Fawole, Femi John Climate Change And Dr. Misikire Tessema Fisheries In Africa: Issues And Challenges 10:50 -11:10 AM Zenebe Tadesse Diel Feeding Rhythm, Dr. Misikire Tessema Ingestion Rate And Diet

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 300

Composition Of Oreochromis Niloticus L. In Lake Tana, Ethiopia 11:10 -11:30 AM Yared Tigabu Development Of Small Dr. Misikire Tessema Scale Fish Farming: As A Means For Livelihood Diversification In Northern Showa Zone, Amhara Regional State. 11:30 -11:50 AM Ale mu Lema and On Station Evaluation Of Dr. Misikire Tessema Abera Degebassa Fish Offal's Fertilizer On Tomato And Onion 11:50 -12:10 AM Habiba Gashaw Ecological Assessment Of Dr. Misikire Tessema Lake Hora Using Benthic And Weed-Bed Fauna 12:10 -12:30 AM Da ba Tugie and Integrated Fish - Dr. Misikire Tessema Tokuma Nagisho Horticulture Farm In Debretsige, North Shoa Zone, Ethiopia

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 301

Lunch 2:00 -2:20 PM Belay Abdissa & Fresh Water Fishes Of Amhara Region Dr. Abebe Getahun Alayu Yalew 2:20 -2:40 PM Gashaw Tesfaye Fish Species Composition, Abundance Dr. Abebe Getahun et al. And Production Potential Of Tendaho Reservoir In Afar Regional State, Ethiopia 2:40 -3:00 PM Alayu Yalew Integration Of Fish Culture With Water Dr. Abebe Getahun Harvesting Ponds In Amhara Region: A Means To Supplement Family Livelihood 3:00 -3:20 PM BERIHUN Tefera Technology Development And Dr. Abe be Getahun and Dissemination Where There Is No GORAW Goshu Cultural Practice: Lessons From On Farm Aquaculture Research In Amhara Region, North West Ethiopia Tea break 3:40 -4:00 PM Tarekgne Phytoplankton Composition And Dr. Zenebe Tadesse Wondmagegne et Abundance Of Shesher And al. Wolala Wetlands: Fogera Floodplain,

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 302

Ethiopia 4:00 -4:20 PM Tadesse Fetahi et Atelomixis As A Driving Force Af Dr. Zenebe Tadesse al. Phytoplankton Assemblages In An African-Highland Lake Hayq, Ethiopia 4:20 -4:35 PM Miheret Endalew Preliminary Survey Of Kurit Bahir Dr. Zenebe Tadesse Tegegnie Wetland, Management Focus. Amhara Region, West Gojjam, Mecha Woreda, Ethiopia. 4:35 -4:50 Ilona Gagala et al Detection Of Toxigenic Cyanobacteria Dr. Zenebe Tadesse In Bahirdar Gulf Of Lake Tana – Pilot Study (Ecology) 4:50 -5:05 Gashaw Tesfaye Fish species composition, abundance Dr. Zenebe Tadesse et al and production potential of Tendaho Reservoir in Afar Regional State, Ethiopia.

EFASA: Impacts of climate change and population on tropical aquatic resources (2011) P a g e | 303

Saturday 5, 2011: Time Speaker Title Responsible 9:00 -9:10 AM Dr. Brook Lemma Business session 9:10 -9:20 AM 9:20 -11:00 AM 11:00 -11:30 Tea break 11:30 -12:30 AM General discussion and the way forward and closing remarks

Lunch 2:00 -4:00 PM Workshop - Excursion Ashagrie G. participants Akewak G. 7:00 PM Reception

EFASA: Impacts of climate change and population on tropical aquatic resources (2011)