Human KLF6 ORF Mammalian Expression Plasmid, N-Myc Tag

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Human KLF6 ORF mammalian expression plasmid, N-Myc tag Catalog Number: HG12365-NM General Information Plasmid Resuspension protocol Gene : Kruppel-like factor 6 1. Centrifuge at 5,000×g for 5 min. Official Symbol : KLF6 2. Carefully open the tube and add 100 l of sterile water to Synonym : GBF; ZF9; BCD1; CBA1; CPBP; PAC1; dissolve the DNA. ST12; COPEB 3. Close the tube and incubate for 10 minutes at room Source : Human temperature. cDNA Size: 852bp 4. Briefly vortex the tube and then do a quick spin to RefSeq : NM_001300.5 concentrate the liquid at the bottom. Speed is less than Description 5000×g. Lot : Please refer to the label on the tube 5. Store the plasmid at -20 ℃. Vector : pCMV3-N-Myc Shipping carrier : Each tube contains approximately 10 μg of lyophilized plasmid. The plasmid is ready for: Storage : • Restriction enzyme digestion The lyophilized plasmid can be stored at ambient temperature • PCR amplification for three months. • E. coli transformation Quality control : • DNA sequencing The plasmid is confirmed by full-length sequencing with primers in the sequencing primer list. E.coli strains for transformation (recommended Sequencing primer list : but not limited) pCMV3-F: 5’ CAGGTGTCCACTCCCAGGTCCAAG 3’ Most commercially available competent cells are appropriate for pcDNA3-R : 5’ GGCAACTAGAAGGCACAGTCGAGG 3’ the plasmid, e.g. TOP10, DH5α and TOP10F´. Or Forward T7 : 5’ TAATACGACTCACTATAGGG 3’ ReverseBGH : 5’ TAGAAGGCACAGTCGAGG 3’ pCMV3-F and pcDNA3-R are designed by Sino Biological Inc. Customers can order the primer pair from any oligonucleotide supplier. Manufactured By Sino Biological Inc., FOR RESEARCH USE ONLY. NOT FOR USE IN HUMANS. Fax :+86-10-51029969 Tel:+86- 400-890-9989 http://www.sinobiological.com Human KLF6 ORF mammalian expression plasmid, N-Myc tag Catalog Number: HG12365-NM Vector Information All of the pCMV vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements: •Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells. • Hygromycin resistance gene for selection of mammalian cell lines. • A Kozak consensus sequence to enhance mammalian expression. Manufactured By Sino Biological Inc., FOR RESEARCH USE ONLY. NOT FOR USE IN HUMANS. Fax :+86-10-51029969 Tel:+86- 400-890-9989 http://www.sinobiological.com.
Recommended publications
  • Amplitude Modulation of Androgen Signaling by C-MYC

    Amplitude Modulation of Androgen Signaling by C-MYC

    Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press Amplitude modulation of androgen signaling by c-MYC Min Ni,1,2 Yiwen Chen,3,4 Teng Fei,1,2 Dan Li,1,2 Elgene Lim,1,2 X. Shirley Liu,3,4,5 and Myles Brown1,2,5 1Division of Molecular and Cellular Oncology, Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, Massachusetts 02215, USA; 2Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, Massachusetts 02215, USA; 3Department of Biostatistics and Computational Biology, Dana-Farber Cancer Institute, Boston, Massachusetts 02215, USA; 4Harvard School of Public Health, Boston, Massachusetts 02215, USA Androgen-stimulated growth of the molecular apocrine breast cancer subtype is mediated by an androgen receptor (AR)-regulated transcriptional program. However, the molecular details of this AR-centered regulatory network and the roles of other transcription factors that cooperate with AR in the network remain elusive. Here we report a positive feed-forward loop that enhances breast cancer growth involving AR, AR coregulators, and downstream target genes. In the absence of an androgen signal, TCF7L2 interacts with FOXA1 at AR-binding sites and represses the basal expression of AR target genes, including MYC. Direct AR regulation of MYC cooperates with AR-mediated activation of HER2/HER3 signaling. HER2/HER3 signaling increases the transcriptional activity of MYC through phosphorylation of MAD1, leading to increased levels of MYC/MAX heterodimers. MYC in turn reinforces the transcriptional activation of androgen-responsive genes. These results reveal a novel regulatory network in molecular apocrine breast cancers regulated by androgen and AR in which MYC plays a central role as both a key target and a cooperating transcription factor to drive oncogenic growth.
  • KLF6 Depletion Promotes NF-Κb Signaling in Glioblastoma

    KLF6 Depletion Promotes NF-Κb Signaling in Glioblastoma

    OPEN Oncogene (2017) 36, 3562–3575 www.nature.com/onc ORIGINAL ARTICLE KLF6 depletion promotes NF-κB signaling in glioblastoma AP Masilamani1,2, R Ferrarese1,2, E Kling1,2, NK Thudi3, H Kim4, DM Scholtens5, F Dai1,2, M Hadler1,2, T Unterkircher1,2, L Platania1,2, A Weyerbrock1,2, M Prinz6,7, GY Gillespie8, GR Harsh IV9, M Bredel3,10 and MS Carro1,2,10 Dysregulation of the NF-κB transcription factor occurs in many cancer types. Krüppel-like family of transcription factors (KLFs) regulate the expression of genes involved in cell proliferation, differentiation and survival. Here, we report a new mechanism of NF- κB activation in glioblastoma through depletion of the KLF6 tumor suppressor. We show that KLF6 transactivates multiple genes negatively controlling the NF-κB pathway and consequently reduces NF-κB nuclear localization and downregulates NF-κB targets. Reconstitution of KLF6 attenuates their malignant phenotype and induces neural-like differentiation and senescence, consistent with NF-κB pathway inhibition. KLF6 is heterozygously deleted in 74.5% of the analyzed glioblastomas and predicts unfavorable patient prognosis suggesting that haploinsufficiency is a clinically relevant means of evading KLF6-dependent regulation of NF-κB. Together, our study identifies a new mechanism by which KLF6 regulates NF-κB signaling, and how this mechanism is circumvented in glioblastoma through KLF6 loss. Oncogene (2017) 36, 3562–3575; doi:10.1038/onc.2016.507; published online 6 February 2017 INTRODUCTION coding region have been controversial.16,18–22 KLF6 has been The NF-κB transcription factor family is oncogenic through proposed to perform its tumor suppression function by promoting suppression of programmed cell death, and promotion of tumor G1 cell cycle arrest mainly through cyclin-dependent kinase 15 growth and invasion.1 In tumors, NF-κB can be activated by inhibitor 1A (CDKN1A) promoter transactivation.
  • KLF6-SV1 Overexpression Accelerates Human and Mouse Prostate Cancer Progression and Metastasis

    KLF6-SV1 Overexpression Accelerates Human and Mouse Prostate Cancer Progression and Metastasis

    KLF6-SV1 overexpression accelerates human and mouse prostate cancer progression and metastasis Goutham Narla, … , Mark A. Rubin, John A. Martignetti J Clin Invest. 2008;118(8):2711-2721. https://doi.org/10.1172/JCI34780. Research Article Oncology Metastatic prostate cancer (PCa) is one of the leading causes of death from cancer in men. The molecular mechanisms underlying the transition from localized tumor to hormone-refractory metastatic PCa remain largely unknown, and their identification is key for predicting prognosis and targeted therapy. Here we demonstrated that increased expression of a splice variant of the Kruppel-like factor 6 (KLF6) tumor suppressor gene, known as KLF6-SV1, in tumors from men after prostatectomy predicted markedly poorer survival and disease recurrence profiles. Analysis of tumor samples revealed that KLF6-SV1 levels were specifically upregulated in hormone-refractory metastatic PCa. In 2 complementary mouse models of metastatic PCa, KLF6-SV1–overexpressing PCa cells were shown by in vivo and ex vivo bioluminescent imaging to metastasize more rapidly and to disseminate to lymph nodes, bone, and brain more often. Interestingly, while KLF6-SV1 overexpression increased metastasis, it did not affect localized tumor growth. KLF6-SV1 inhibition using RNAi induced spontaneous apoptosis in cultured PCa cell lines and suppressed tumor growth in mice. Together, these findings demonstrate that KLF6-SV1 expression levels in PCa tumors at the time of diagnosis can predict the metastatic behavior of the tumor; thus, KLF-SV1 may represent a novel therapeutic target. Find the latest version: https://jci.me/34780/pdf Research article KLF6-SV1 overexpression accelerates human and mouse prostate cancer progression and metastasis Goutham Narla,1,2 Analisa DiFeo,1 Yolanda Fernandez,1 Saravana Dhanasekaran,3 Fei Huang,1 Jaya Sangodkar,1,2 Eldad Hod,2 Devin Leake,4 Scott L.
  • Expression Is a New Potential Biomarker for Adverse

    Expression Is a New Potential Biomarker for Adverse

    www.nature.com/scientificreports OPEN Decreased MYC‑associated factor X (MAX) expression is a new potential biomarker for adverse prognosis in anaplastic large cell lymphoma Takahisa Yamashita1, Morihiro Higashi1, Shuji Momose1, Akiko Adachi2, Toshiki Watanabe3, Yuka Tanaka4, Michihide Tokuhira4, Masahiro Kizaki4 & Jun‑ichi Tamaru1* MYC-associated factor X (MAX) is a protein in the basic helix‑loop‑helix leucine zipper family, which is ubiquitously and constitutively expressed in various normal tissues and tumors. MAX protein mediates various cellular functions such as proliferation, diferentiation, and apoptosis through the MYC-MAX protein complex. Recently, it has been reported that MYC regulates the proliferation of anaplastic large cell lymphoma. However, the expression and function of MAX in anaplastic large cell lymphoma remain to be elucidated. We herein investigated MAX expression in anaplastic large cell lymphoma (ALCL) and peripheral T-cell lymphoma, not otherwise specifed (PTCL-NOS) and found 11 of 37 patients (30%) with ALCL lacked MAX expression, whereas 15 of 15 patients (100%) with PTCL-NOS expressed MAX protein. ALCL patients lacking MAX expression had a signifcantly inferior prognosis compared with patients having MAX expression. Moreover, patients without MAX expression signifcantly had histological non-common variants, which were mainly detected in aggressive ALCL cases. Immunohistochemical analysis showed that MAX expression was related to the expression of MYC and cytotoxic molecules. These fndings demonstrate that lack of MAX expression is a potential poor prognostic biomarker in ALCL and a candidate marker for diferential diagnosis of ALCL and PTCL‑noS. Anaplastic large cell lymphoma (ALCL) is an aggressive mature T-cell lymphoma that usually expresses the lymphocyte activation marker CD30 and ofen lacks expression of T-cell antigens, such as CD3, CD5, and CD71.
  • AP-1 in Cell Proliferation and Survival

    AP-1 in Cell Proliferation and Survival

    Oncogene (2001) 20, 2390 ± 2400 ã 2001 Nature Publishing Group All rights reserved 0950 ± 9232/01 $15.00 www.nature.com/onc AP-1 in cell proliferation and survival Eitan Shaulian1 and Michael Karin*,1 1Laboratory of Gene Regulation and Signal Transduction, Department of Pharmacology, University of California San Diego, 9500 Gilman Drive, La Jolla, California, CA 92093-0636, USA A plethora of physiological and pathological stimuli extensively discussed previously (Angel and Karin, induce and activate a group of DNA binding proteins 1991; Karin, 1995). that form AP-1 dimers. These proteins include the Jun, The mammalian AP-1 proteins are homodimers and Fos and ATF subgroups of transcription factors. Recent heterodimers composed of basic region-leucine zipper studies using cells and mice de®cient in individual AP-1 (bZIP) proteins that belong to the Jun (c-Jun, JunB proteins have begun to shed light on their physiological and JunD), Fos (c-Fos, FosB, Fra-1 and Fra-2), Jun functions in the control of cell proliferation, neoplastic dimerization partners (JDP1 and JDP2) and the closely transformation and apoptosis. Above all such studies related activating transcription factors (ATF2, LRF1/ have identi®ed some of the target genes that mediate the ATF3 and B-ATF) subfamilies (reviewed by (Angel eects of AP-1 proteins on cell proliferation and death. and Karin, 1991; Aronheim et al., 1997; Karin et al., There is evidence that AP-1 proteins, mostly those that 1997; Liebermann et al., 1998; Wisdom, 1999). In belong to the Jun group, control cell life and death addition, some of the Maf proteins (v-Maf, c-Maf and through their ability to regulate the expression and Nrl) can heterodimerize with c-Jun or c-Fos (Nishiza- function of cell cycle regulators such as Cyclin D1, p53, wa et al., 1989; Swaroop et al., 1992), whereas other p21cip1/waf1, p19ARF and p16.
  • Physical Interaction of the Retinoblastoma Protein with Human D Cyclins

    Physical Interaction of the Retinoblastoma Protein with Human D Cyclins

    Cell, Vol. 73, 499-511, May 7, 1993, Copyright 0 1993 by Cell Press Physical Interaction of the Retinoblastoma Protein with Human D Cyclins Steven F. Dowdy,* Philip W. Hinds,’ Kenway Louie,’ into Rb- tumor cells by microinjection, viral infection, or Steven I. Reed,t Andrew Arnold,* transfection can lead to the growth arrest of these recipient and Robert A. Weinberg” cells (Huang et al., 1988; Goodrich et al., 1991; Templeton *The Whitehead Institute for Biomedical Research et al., 1991; Hinds et al., 1992). and Department of Biology Oncoproteins specified by the SV40, adenovirus, and Massachusetts Institute of Technology papilloma DNA tumor viruses have been shown to associ- Cambridge, Massachusetts 02142 ate with pRb in virus-transformed cells (Whyte et al., 1988; tThe Scripps Research Institute DeCaprio et al., 1988; Dyson et al., 1989). Oncoprotein Department of Molecular Biology binding of pRb is presumed to lead to its sequestration 10666 North Torrey Pines Road and functional inactivation. Conserved region II mutants La Jolla, California 92037 of adenovirus ElA, SV40 large T antigen, human papil- *Endocrine Unit loma E7 viral oncoproteins that have lost their ability to and Massachusetts General Hospital Cancer Center bind pflb, and other pRb-related proteins exhibit signifi- Massachusetts General Hospital cantly reduced transforming potential (Moran et al., 1986; and Harvard Medical School Lillie et al., 1987; Cherington et al., 1988; DeCaprio et al., Boston, Massachusetts 02114 1988; Moran, 1988; Smith and Ziff, 1988; Whyte et al., 1989). This suggests that binding of pRb and related pro- teins by these oncoproteins is critical to their transforming abilities.
  • Genetic and Genomic Analysis Modeling of Germline C-MYC Overexpression and Cancer Susceptibility

    Genetic and Genomic Analysis Modeling of Germline C-MYC Overexpression and Cancer Susceptibility

    Genetic and genomic analysis modeling of germline c-MYC overexpression and cancer susceptibility Xavier Solé1, Pilar Hernández1, Miguel López de Heredia2,3, Lluís Armengol4, Benjamín Rodríguez-Santiago5,6, Laia Gómez1, Christopher A. Maxwell1, Fernando Aguiló7, Enric Condom8, Jesús Abril2, Luis Pérez-Jurado5,6,9, Xavier Estivill4, Virginia Nunes2,3,10, Gabriel Capellá1, Stephen B. Gruber11, 1 1 Víctor Moreno* and Miguel Angel Pujana* Address: 1Bioinformatics and Biostatistics Unit, and Translational Research Laboratory, Catalan Institute of Oncology, IDIBELL, L’Hospitalet, Barcelona, Spain; 2Medical and Molecular Genetics Center, IDIBELL, L’Hospitalet, Barcelona, Spain; 3CIBERER-U730, L’Hospitalet, Barcelona, Spain; 4Genes and Disease Program, Center for Genomic Regulation, Barcelona, Spain; 5Genetics Unit, Department of Experimental and Health Sciences, Universitat Pompeu Fabra, Barcelona, Spain; 6CIBERER-U735, Barcelona, Spain; 7Department of Urology, Bellvitge Hospital University, IDIBELL, L’Hospitalet, Barcelona, Spain; 8Department of Pathology, Bellvitge Hospital University, IDIBELL, L’Hospitalet, Barcelona, Spain; 9Program in Molecular Medicine and Genetics, Vall d’Hebron University Hospital, Barcelona, Spain; 10Genetic Unit, Department of Physiology II, University of Barcelona, Barcelona, Spain; and 11Departments of Epidemiology, Internal Medicine and Human Genetics, University of Michigan, Ann Arbor, Michigan, USA. Email: Xavier Solé - [email protected]; Pilar Hernández - [email protected]; Miguel López de Heredia
  • (AR) and C-Myc for the Treatment of Prostate Cancer

    (AR) and C-Myc for the Treatment of Prostate Cancer

    Abstract # 3991 Novel small molecule inhibitor of p300/CBP down-regulates androgen receptor (AR) CellCentric and c-Myc for the treatment of prostate cancer and beyond Neil Pegg1, Jenny Worthington2, Barbara Young3, Amy Prosser3, Luke Gaughan4, Gary Spencer5, Tim Somervaille5, Julie Burns6, Margaret Knowles6, Nigel Brooks1. 1CellCentric Ltd, Cambridge UK; 2Axis Bioservices, Coleraine, UK; 3Sygnature Discovery, Nottingham UK; 4Northern Institute for Cancer Research, Newcastle, UK; 5CRUK Manchester Institute, Manchester, UK; 6The University of Leeds, UK 9. CCS1477 inhibits the proliferation of AML cells mediated by G1 cell cycle arrest Introduction 3. CCS1477 inhibits DHT and enzalutamide agonist activity at 6. Protein biomarkers are reduced in 22Rv1 tumour bearing animals treated Vehicle (DMSO) CCS1477 (100nM) AR F876L with CCS1477 for 7 and 28 days a) b) • Targeted degradation of androgen receptor (AR) and androgen G1 D receptor variants (AR-SV) remains an important therapeutic S GFP G2M GFP opportunity for patients with castration resistant prostate cancer. - - • E1A binding protein (p300) and CREB binding protein (CBP) are two geminin closely related histone acetyl transferase proteins that act as geminin translational co-activators of AR. Cdt1-RFP Cdt1-RFP • We have developed the clinical candidate, CCS1477, which is a potent, (a) Inhibition of proliferation of THP-1 cells after 48hrs incubation; (b) Fucci flow analysis of THP-1 cells following selective and orally active small molecule inhibitor of the bromodomain incubation with DMSO vehicle or CCS1477 (100nM) for 48 hrs . of p300/CBP and we report here its impact on AR, AR-SV and c-Myc expression and function. 10. CCS1477 inhibits the proliferation of patient derived primary AML cells and • We have also extended the evaluation of CCS1477 into other disease LNCaP-ARF876L cells stably-express ARF876L and demonstrate enhanced AR target gene expression in Western analysis of AR-FL, AR-SV, c-Myc in 22Rv1 tumours taken from a satellite group at day 7 of the study shown in Fig.
  • Blocking Myc to Treat Cancer: Reflecting on Two Decades of Omomyc

    Blocking Myc to Treat Cancer: Reflecting on Two Decades of Omomyc

    cells Review Blocking Myc to Treat Cancer: Reflecting on Two Decades of Omomyc Daniel Massó-Vallés 1 and Laura Soucek 1,2,3,4,* 1 Peptomyc S.L., Edifici Cellex, 08035 Barcelona, Spain; [email protected] 2 Vall d’Hebron Institute of Oncology (VHIO), Edifici Cellex, 08035 Barcelona, Spain 3 Institució Catalana de Recerca i Estudis Avançats (ICREA), 08010 Barcelona, Spain 4 Department of Biochemistry and Molecular Biology, Universitat Autònoma de Barcelona, 08193 Bellaterra, Spain * Correspondence: [email protected] Received: 2 March 2020; Accepted: 2 April 2020; Published: 4 April 2020 Abstract: First designed and published in 1998 as a laboratory tool to study Myc perturbation, Omomyc has come a long way in the past 22 years. This dominant negative has contributed to our understanding of Myc biology when expressed, first, in normal and cancer cells, and later in genetically-engineered mice, and has shown remarkable anti-cancer properties in a wide range of tumor types. The recently described therapeutic effect of purified Omomyc mini-protein—following the surprising discovery of its cell-penetrating capacity—constitutes a paradigm shift. Now, much more than a proof of concept, the most characterized Myc inhibitor to date is advancing in its drug development pipeline, pushing Myc inhibition into the clinic. Keywords: omomyc; Myc; cancer; Myc inhibition; mouse models; peptides; anticancer drugs; new therapeutics 1. Introduction 1.1. Myc The Myc family of proteins (from now on Myc) is composed of three basic helix–loop–helix leucine zipper (bHLHLZ) transcription factors: MYC, MYCL and MYCN, also known as c-Myc, L-Myc, and N-Myc [1], which are functionally redundant in some contexts [2].
  • The Leucine Zipper of C-Myc Is Required for Full Inhibition of Erythroleukemia Differentiation MICHAEL J

    The Leucine Zipper of C-Myc Is Required for Full Inhibition of Erythroleukemia Differentiation MICHAEL J

    MOLECULAR AND CELLULAR BIOLOGY, Oct. 1990, p. 5333-5339 Vol. 10, No. 10 0270-7306/90/105333-07$02.00/0 Copyright C) 1990, American Society for Microbiology The Leucine Zipper of c-Myc Is Required for Full Inhibition of Erythroleukemia Differentiation MICHAEL J. SMITH,1 DENISE C. CHARRON-PROCHOWNIK,2 AND EDWARD V. PROCHOWNIKl 3* Division of HematologylOncology, Department ofPediatrics,' The Committee on Cellular and Molecular Biology,3 and The School ofPublic Health,2 The University of Michigan School of Medicine, Ann Arbor, Michigan 48109 Received 23 October 1989/Accepted 30 June 1990 The leucine zipper motif has been observed in a number of proteins thought to function as eucaryotic transcription factors. Mutation of the leucine zipper interferes with protein dimerization and DNA binding. We examined the effect of point mutations in the leucine zipper of c-Myc on its ability to dimerize in vitro and to inhibit Friend murine erythroleukemia (F-MEL) differentiation. Glutaraldehyde cross-linking studies failed to provide evidence for homodimerization of in vitro-synthesized c-Myc protein, although it was readily demonstrated for c-Jun. Nevertheless, whereas transfected wild-type c-myc sequences strongly inhibited F-MEL differentiation, those with single or multiple mutations in the leucine zipper were only partially effective in this regard. Since the leucine zipper domain of c-Myc is essential for its cooperative effect in ras oncogene-mediated transformation, this study emphasizes the close relationship that exists between transfor- mation and hematopoietic commitment and differentiation. c-Myc may produce its effects on F-MEL differentiation through leucine zipper-mediated heterodimeric associations rather than homodimeric ones.
  • Sequence-Specific DNA Binding by Myc Proteins

    Sequence-Specific DNA Binding by Myc Proteins

    Proc. Nail. Acad. Sci. USA Vol. 88, pp. 4323-4327, May 1991 Biochemistry Sequence-specific DNA binding by Myc proteins (oncogene/basic motif/helix-loop-helix motif/leucine repeat/transcription factor) EUGEN KERKHOFF*, KLAUS BISTER*t, AND KARL-HEINZ KLEMPNAUER* *Institute of Biochemistry, Medical School, University of Cologne, D-5000 Cologne 41, Federal Republic of Germany; and tHans Spemann Laboratories, Max Planck Institute of Immunobiology, D-7800 Freiburg, Federal Republic of Germany Communicated by Peter K. Vogt, January 14, 1991 (receivedfor review November 16, 1990) ABSTRACT Myc proteins have a tripartite carboxyl- hybrid protein encoded by MC29 (1) had been shown to occur terminal domain containing specific amino acid sequence mo- in monomeric and dimeric forms in transformed avian cells tifs: a basic motif, a helix-oop-helix motif, and a leucine (14), and recombinant human c-Myc proteins were reported heptad repeat. Similar sequence motifs have been identified in to form higher-order oligomeric complexes (15). Further- several eukaryotic transcription factors and were shown to more, mutational analyses of recombinant and virally en- facilitate protein-DNA and protein-protein interactions. By coded avian Myc proteins have revealed that the Myc car- using recombinant v-Myc proteins obtained by bacterial boxyl-terminal domain is necessary and sufficient for protein expression offull-length or partially deleted avian v-myc alleles, dimerization and nonspecific in vitro DNA binding (16, 17). the functional relevance of these sequence motifs for Myc Recently, a human transcription factor (transcription factor protein oligomerization and for DNA binding was investigated. E3; TFE3) has been described that has a domain topography All recombinant v-Myc proteins that have retained the car- strikingly similar to that ofMyc (18).
  • Changes in C-Myc and C-Fos Expression in a Human Tumor Cell Line Following Exposure to Bifunctional Alkylating Agents1

    Changes in C-Myc and C-Fos Expression in a Human Tumor Cell Line Following Exposure to Bifunctional Alkylating Agents1

    (CANCER RESEARCH 50. 62-66. January 1. 1990] Changes in c-myc and c-fos Expression in a Human Tumor Cell Line following Exposure to Bifunctional Alkylating Agents1 Bernard W. Futscher and Leonard C. Erickson Section ofHematology•/'Oncology,Departments of Medicine [L. C. E./ and Pharmacology [B. H'. F., L. C. E.], Loyola University of Chicago, Stritch School of Medicine, Mayn-ood, Illinois 60153 ABSTRACT related with tumor response in patients with acute myelogenous leukemia or acute lymphocytic leukemia (8). These data suggest This study was initiated to determine if DNA-damaging chemothera- that drug effects on oncogene expression may serve as indicators peutic agents can suppress the expression of oncogenes. The effects of of prognosis in specific types of cancer (8). three structurally related bifunctional alkylating agents on the steady state mRNA levels of c-myc, c-fos, N-ras, and 0-actin in the human colon In this report, we have examined the effects of three struc carcinoma cell line Colo320HSR were examined. Colo320HSR has an turally related bifunctional alkylating agents on oncogene amplified c-myc oncogene, which is highly overexpressed, and is assumed expression in the colon carcinoma cell line Colo320HSR. to be one of the transforming genes of this cell line. Two concentrations Colo320HSR is a human colon tumor cell line of neuroecto- of mechlorethamine, i.-phenylalanine mustard, and 4-hydroperoxycyclo- dermal origin isolated from a patient prior to the onset of phosphamide, which produced 1 or 3 log cell kills were used to examine chemotherapy (9). Contained within the homogeneously stain the effects of drug exposure on the expression of specific genes.