THETWO TONTTITUNTIUMUS 20180201929A1 DOLOMITIN ( 19) United States (12 ) Patent Application Publication (10 ) Pub. No. : US 2018/ 0201929 A1 Butler et al . (43 ) Pub . Date : Jul. 19 , 2018

( 54 ) INSULIN - LIKE GROWTH FACTOR BINDING filed on Dec . 18 , 2015 , provisional application No . PROTEIN , ACID LABILE SUBUNIT ( IGFALS ) 62 /316 ,726 , filed on Apr. 1 , 2016 . AND INSULIN -LIKE GROWTH FACTOR 1 ( IGF - 1 ) IRNA COMPOSITIONS AND METHODS OF USE THEREOF Publication Classification (71 ) Applicant: Alnylam Pharmaceuticals , Inc ., (51 ) Int. CI. Cambridge , MA (US ) C12N 15 / 113 ( 2006 . 01 ) A61P 5 /06 (2006 .01 ) ( 72 ) Inventors: James Butler , Lynnfield , MA (US ) ; (52 ) U . S . CI. Kevin Fitzgerald , Brookline , MA (US ) ; CPC ...... C12N 15 / 113 (2013 . 01 ); A61P 5 / 06 Gregory Hinkle , Plymouth , MA (US ) ; ( 2018 .01 ) ; C12N 2310 / 14 ( 2013 .01 ) ; C12N Brian Bettencourt , Groton , MA (US ) ; 2310 /3515 ( 2013 .01 ) ; CI2N 2310 / 322 Huilei Xu , Boston , MA (US ) (2013 . 01 ) ; C12N 2310 /315 (2013 . 01 ) ; C12N (21 ) Appl. No .: 15 /743 , 349 2310 / 321 ( 2013 . 01 ) (22 ) PCT Filed : Jul. 8, 2016 (57 ) ABSTRACT ( 86 ) PCT No. : PCT/ US16 /41440 The present invention relates to RNAi agents , e . g ., double stranded RNAi agents , targeting the insulin - like growth $ 371 (c )( 1 ), factor binding protein , acid labile subunit (IGFALS ) gene or ( 2 ) Date : Jan . 10 , 2018 the insulin - like growth factor 1 ( IGF - 1 ) gene , methods of Related U . S . Application Data using such double stranded RNAi agents to inhibit expres ( 60 ) Provisional application No . 62 / 191, 008 , filed on Jul. sion of an IGFALS gene or an IGF - 1 gene , and methods of 10 , 2015 , provisional application No . 62 / 269, 401, treating subjects having an IGF system -associated disorder. Patent Application Publication Jul. 19 , 2018 US 2018 / 0201929 A1

FIG.1 Lysosomes GrepsIGFBPs IGF-2R RAS RAF ??? ERK ELK1 SOS GRB2 Proliferation Shc IGF-2 Apoptosis IGF-1 BCL-2 IGF BAD Foxo1,3a Proliferation IRS2p85)01100( P13K ???? os27Foxo IGFBP,Comune GSK-3B(p27 IGFBPsi ( Glucose metabolism TSCZTSC Proteinsynthesisandgrowth buvoMan PDK1>Thr308@atThr3 MTORC2-Ser473®TTY mTORC1 03.S6K1PD4EB- CCRMolecularPathways PDK1 US 2018 /0201929 A1 Jul. 19 , 2018

INSULIN -LIKE GROWTH FACTOR BINDING mone receptor antagonist, which is administered by daily PROTEIN , ACID LABILE SUBUNIT (IGFALS ) subcutaneous injection . Radiotherapy , which suffers from AND INSULIN - LIKE GROWTH FACTOR 1 low efficacy and high side effects, is used as a last resort . ( IGF- 1 ) IRNA COMPOSITIONS AND [0005 ]. The insulin - like growth factor system is also asso METHODS OF USE THEREOF ciated with abnormal growth in cancer and metastasis (see , e . g . , Samani et al . , Endocrine Rev . , 2007 ) . The IGF system RELATED APPLICATION has become a target for anticancer agents , both as primary [0001 ] This application is related to U . S . Provisional Pat and adjunctive therapy. ent Application No . 62 / 191 ,008 , filed on Jul. 10 , 2015 ; [0006 ] Currently, treatments for acromegaly and cancer do 62 /269 ,401 , filed on Dec . 18 , 2015 ; and 62 /316 ,726 , filed on not fully meet patient needs. Therefore , there is a need for Apr. 1 , 2016 . The entire contents of each of the foregoing therapies for subjects suffering from acromegaly or cancer. applications are hereby incorporated herein by reference . SUMMARY OF THE INVENTION SEQUENCE LISTING [0007 ] The present invention provides iRNA compositions which affect the RNA - induced silencing complex (RISC ) [0002 ] The instant application contains a Sequence Listing mediated cleavage of RNA transcripts of an insulin - like which has been submitted electronically in ASCII format growth factor binding protein , acid labile subunit ( IGFALS ) and is hereby incorporated by reference in its entirety . The gene or an insulin - like growth factor - 1 ( IGF - 1 ) gene . The ASCII copy , created on Jul. 7 , 2016 , is named 121301 IGFALS gene or IGF - 1 gene may be within a cell, e . g ., a cell 03920 _ SL .txt and is 1 , 164 , 878 bytes in size . within a subject, such as a human . [0008 ] In an aspect, the invention provides a double BACKGROUND OF THE INVENTION stranded ribonucleic acid interference ( dsRNA ) agent for [ 0003] Acromegaly is a progressive and life threatening inhibiting expression of insulin - like growth factor binding disease resulting from growth hormone hypersecretion from protein , acid labile subunit ( IGFALS ) , wherein the double a benign pituitary tumor, leading to approximately a 10 year stranded dsRNA agent comprises a sense strand and an reduction in lifespan and a reduced quality of life. Acro antisense strand , wherein the sense strand comprises at least megaly is associated with cardiovascular disease including 15 contiguous nucleotides differing by no more than 3 hypertension and cardiac hypertrophy, cerebrovascular dis nucleotides from the nucleotide sequence of SEQ ID NO : 1 ease including stroke, metabolic disease including diabetes , and the antisense strand comprises at least 15 contiguous and respiratory disease including sleep apnea . Mortality nucleotides differing by no more than 3 nucleotides from the rates in acromegaly are correlated with growth hormone and nucleotide sequence of SEQ ID NO : 2 . IGF - 1 levels , with increased growth hormone concentrations [0009 ] In certain embodiments , the sense strands and being associated with shorter life spans (Holdaway et al. , antisense strands comprise sequences selected from any one JCEM , 2004 ) . The clinical features most commonly associ of the sequences in any one of Tables 3 , 5 , 6 , 8 , 12 , or 14 . ated with acromegaly are acral enlargement, maxofacial [0010 ] In an aspect, the invention provides a double changes , excessive sweating, athralgias, headache, hypogo stranded ribonucleic acid interference ( dsRNAi, agent for nadal symptoms, visual deficit, fatigue, weight gain , and inhibiting expression of insulin - like growth factor - 1 ( IGF galactorrhea . Such symptoms may be associated with any of 1 ) , wherein the double stranded RNAi agent comprises a a number of diseases or conditions and , thus , diagnosis of sense strand and an antisense strand , wherein the sense acromegaly often does not occur until several years after the strand comprises at least 15 contiguous nucleotides differing initiation of growth hormone hypersecretion . Definitive by no more than 3 nucleotides from the nucleotide sequence diagnosis of acromeagly includes detection of an increased of SEQ ID NO : 11 or 13 and the antisense strand comprises level of insulin - like growth factor- 1 ( IGF- 1 ) and growth at least 15 contiguous nucleotides differing by no more than hormone elevation in an oral glucose tolerance test , con 3 nucleotides from the nucleotide sequence of SEQ ID NO : firmed by detection of a GH - hypersecreting pituitary tumor , 12 or 14 . typically by MRI. ( The diagnostic criteria for acromegaly [0011 ] In certain embodiments , the sense strands and are provided in the American Association of Clinical Endo antisense strands comprise sequences selected from any one crinologists Medical Guidelines for Clinical Practice for the of the sequences in any one of Tables 9, 11, 15 , 17 , 18 , or Diagnosis and Treatment of Acromegaly - 2011 Update 20 . (Katznelson et al. , Endocr. Pract. 17 (Suppl . 4 ) ) . [0012 ] In an aspect , the invention provides a double [0004 ) Current treatment options for acromegaly are stranded ribonucleic acid interference ( dsRNAi) agent for insufficient for many patients . Surgical removal of the inhibiting expression of insulin - like growth factor binding pituitary adenoma by transsphenoidal surgery results in a protein , acid labile subunit ( IGFALS ), wherein the double cure for about 50 -60 % of patients . Subjects for whom stranded RNAi comprises a sense strand and an antisense surgical intervention is not possible or does not result in a strand , the antisense strand comprising a region of comple cure are treated with first- line pharmacological therapy mentarity which comprises at least 15 contiguous nucleo which includes dopamine agonists or sustained -release tides differing by no more than 3 nucleotides from any one somatostatin analogs (SSAs ) . This therapy results in good of the antisense sequences listed in any one of Tables 3 , 5 , control for the disease for about 70 % of these patients for 6 , 8 , 12 , or 14 . whom surgery cannot provide a cure . The use of SSAs, [ 0013 ] In an aspect, the invention provides a double however , is limited to subjects expressing a somatostatin stranded ribonucleic acid interference (dsRNAI ) agent for receptor on their tumor. Subjects whose disease cannot be inhibiting expression of insulin - like growth factor 1 ( IGF - 1 ) controlled by the first -line pharmacological therapy are wherein the double stranded RNAi comprises a sense strand treated with SOMAVERT® ( pegvisomant) , a growth hor and an antisense strand , the antisense strand comprising a US 2018 /0201929 A1 Jul. 19 , 2018 region of complementarity which comprises at least 15 SEQ ID NO : 1 , and , in certain embodiments , the antisense contiguous nucleotides differing by no more than 3 nucleo strand comprises at least 15 contiguous nucleotides differing tides from any one of the antisense sequences listed in any by no more than 3 nucleotides from the corresponding one of Tables 9 , 11, 15 , 17 , 18 , or 20 . position of the nucleotide sequence of SEQ ID NO : 2 such [0014 ] In certain embodiments , the double stranded RNAi that the antisense strand is complementary to the at least 15 comprises at least one modified nucleotide . In some embodi contiguous nucleotides differing by no more than 3 nucleo ments , substantially all of the nucleotides of the sense strand tides in the sense strand . are modified nucleotides . In some embodiments, substan [0018 ] Accordingly , in certain embodiments , the present tially all of the nucleotides of the antisense strand are invention provides double stranded RNAi agents for inhib modified nucleotides . In some embodiments , all of the iting expression of insulin - like growth factor 1 ( IGF - 1 ), nucleotides of the sense strand and all of the nucleotides of which comprise a sense strand and an antisense strand the antisense strand comprise a modification . forming a double stranded region , wherein the sense strand [ 0015 ] In an aspect, the invention provides a double comprises at least 15 contiguous nucleotides differing by no stranded RNAi agent for inhibiting expression of insulin more than 3 nucleotides from nucleotides 330 - 369, 342 - 369 , like growth factor binding protein , acid labile subunit ( IG 432 - 490 , 432 - 482 , 436 -462 , 534 - 559 , 330 - 350 , 342 - 362 , FALS ), wherein the double stranded RNAi agent comprises 348 - 368, 349 - 369, 432 -452 , 435 - 455 , 436 - 456 , 438 -458 , a sense strand and an antisense strand forming a double 440 - 460 , 441 -461 , 442 -462 , 449- 469 , 455 - 475 , 460 -480 , stranded region , wherein the sense strand comprises at least 461 - 481, 462 -482 , 464 - 484 , 470 -490 , 484 - 501, 534 - 554 , 15 contiguous nucleotides differing by no more than 3 536 -556 , 538 -558 , 539 - 559 , 542 - 562 , 548 - 568 , 577 -597 , nucleotides from the nucleotide sequence of SEQ ID NO : 1 582 -602 , or 640 -660 of the nucleotide sequence of SEQ ID and the antisense strand comprises at least 15 contiguous NO : 11 , and the antisense strand comprises at least 15 nucleotides differing by no more than 3 nucleotides from the contiguous nucleotides differing by no more than 3 nucleo nucleotide sequence of SEQ ID NO : 2 , wherein substantially tides from the corresponding position of the nucleotide all of the nucleotides of the sense strand and substantially all sequence of SEQ ID NO : 12 such that the antisense strand of the nucleotides of the antisense strand are modified is complementary to the at least 15 contiguous nucleotides nucleotides , and wherein the double stranded RNAi agent differing by no more than 3 nucleotides in the sense strand . comprises a ligand , e .g ., the sense strand of the double 10019 ] In certain embodiments , the present invention pro stranded RNAi agent is conjugated to a ligand , e . g . , a ligand vides double stranded RNAi agents for inhibiting expression is attached at the 3 '- terminus of the sense strand . of insulin -like growth factor 1 ( IGF - 1 ), which comprise a [0016 ] In an aspect, the invention provides a double sense strand and an antisense strand forming a double stranded ribonucleic acid (RNAI ) agent for inhibiting stranded region , wherein the sense strand comprises at least expression of insulin - like growth factor 1 ( IGF- 1 ) , wherein 15 contiguous nucleotides differing by no more than 3 the double stranded RNAi agent comprises a sense strand nucleotides from nucleotides 6 - 90 , 127 - 145 , 185 - 238 , 247 and an antisense strand forming a double stranded region , 265 , 277 - 295 , 389 -417 , 430 -480 , 543 - 561, 654 -690 , 750 wherein the sense strand comprises at least 15 contiguous 768 , 774 - 870 , 894 - 930 , 1007 - 1029 , 1075 - 1126 , 1144 - 1162 , nucleotides differing by no more than 3 nucleotides from the 1197 - 1215 , 1232- 1250 , 1293 - 1311 , 1334 - 1352 , 1388 - 1458 , nucleotide sequence of SEQ ID NO : 11 or 13 and the 1463 - 1490 , 1511 - 1529 , 1599 - 1617 , 1643 - 1661, 1690 - 1727 , antisense strand comprises at least 15 contiguous nucleo 1793 - 1825 , 1843 - 1861, 2057 - 2075 , 2090 -2130 , 2192 - 2228 , tides differing by no more than 3 nucleotides from the 2310 - 2332 , 2357 - 2375 , 2521 - 2539, 2566 -2588 , 2648 - 2684 , nucleotide sequence of SEQ ID NO : 12 or 14 , wherein 2793 - 2811 , 2962 -2980 , 3120 -3142 , 3208 - 3233 , 3269 - 3287 , substantially all of the nucleotides of the sense strand and 3417 - 3435 , 3449 - 3467 , 3575 - 3603, 3686 - 3704 , 3721 - 3739 , substantially all of the nucleotides of the antisense strand are 3806 -3824 , 3939 - 3957 , 3982 -4018 , 4081 - 4037 , 4154 - 4172 , modified nucleotides , and wherein the sense strand is con 4271 - 4289 , 4319 - 4377 , 4436 - 4478 , 4484 -4502 , 4523 -4545 , jugated to a ligand attached at the 3 '- terminus. 4566 - 4584 , 4610 -4660 , 4686 -4717 , 4734 - 4769 , 4780 -4798 , [0017 ] Accordingly , in certain embodiments , the present 4815 -4843 , 4884 -4902 , 4911 - 4929 , 5004 - 5034 , 5050 - 5068 , invention provides double stranded RNAi agents for inhib 5171 - 5256 , 5311 - 5364 , 5409- 5430 , 5551 -5588 , 5609 - 5638 , iting expression of IGFALS , which comprise a sense strand 5694 - 5712 , 5715 - 5758 , 5790 - 5808 , 5906 - 5928 , 5934 - 5952, and an antisense strand forming a double stranded region , 6323 -6345 , 6399 -6417 , 6461 -6497 , 6510 - 6535 , 6584 - 6612 , wherein the sense strand comprises at least 15 contiguous 6629 -6647 , 6661- 6683 , 6726 -6789 , 6796 -6824 , 6826 -6851 , nucleotides differing by no more than 3 nucleotides from 6858 -6905 , 6910 - 6927 , 7004 - 7022 , 7035 -7130 , 7144 -7162 , nucleotides 11 -62 , 24 -62 , 79 - 117 , 79 - 130 , 155 - 173 , 194 7175 - 7241, and 7252 -7270 of the nucleotide sequence of 216 , 194 - 229, 211- 229 , 232 - 293, 254 -272 , 310 - 328, 310 SEQ ID NO : 13 , and the antisense strand comprises at least 349, 324 - 345 , 331 -349 , 353 - 371 , 353 - 394 , 376 - 394 , 407 15 contiguous nucleotides differing by no more than 3 425 , 439 -449 , 431- 470 , 484 -515 , 497 - 515 , 541 -580 , 547 nucleotides from the corresponding position of the nucleo 568 , 596 -647 , 616 -634 , 673 -691 , 694 - 712 , 694 -734 , 777 tide sequence of SEQ ID NO : 14 such that the antisense 799 , 781- 799 , 825 - 843 , 825 - 855 , 869- 922 , 958 - 976 , 958 strand is complementary to the at least 15 contiguous 988 , 1064 - 1085 , 1064 - 1096 , 1067 - 1085 , 1067 - 1096 , 1100 nucleotides differing by no more than 3 nucleotides in the 1141, 1111 - 1129 , 1145 - 1163 , 1145 - 1186 , 1159 - 1186 , 1168 sense strand . 1196 , 1168 - 1214 , 1193 - 1214 , 1266 - 1307 , 1321 - 1339 , 1342 10020 ] In certain embodiments, the sense strand comprises 1373 , 1375 - 1406 , 1432 - 1450 , 1454 - 1472 , 1519 - 1537 , 1519 at least 15 contiguous nucleotides differing by no more than 1559 , 1534 - 1555, 1541- 1559 , 1606 - 1624 , 1606 - 1637 , 1613 3 nucleotides from nucleotides 342 - 369, 432 -462 , 330 - 350 , 1635 , 1672- 1690 , 1672 - 1712 , 1749- 1779 , 1783 - 1801 , 1805 342 - 362, 348 - 368 , 349- 369 , 432 - 452 , 435 - 455 , 436 - 456 , 1823 , 1806 - 1829 , 1871 - 1889 , 1871- 1919 , 1949 - 1977 , 1993 438 -458 , 440 -460 , 442 -462 , 470 -490 , 481 -501 , 536 -556 , or 2011, 2013 - 2042 , 2048 - 2077 , 2048 - 2088 , or 2052 - 2084 of 539 - 559 of the nucleotide sequence of SEQ ID NO : 11 and US 2018 /0201929 A1 Jul. 19 , 2018 the antisense strand comprises at least 15 contiguous nucleo - (0023 ] In certain embodiments , the present invention also tides differing by no more than 3 nucleotides from the provides double stranded RNAiagents for inhibiting expres corresponding position of the nucleotide sequence of SEQ sion of IGFALS , which comprise a sense strand and an ID NO : 12 such that the antisense strand is complementary antisense strand forming a double stranded region , wherein to the at least 15 contiguous nucleotides differing by no more the sense strand comprises at least 15 contiguous nucleotides than 3 nucleotides in the sense strand . In certain embodi from nucleotides 11- 62 , 24 -62 , 79 - 117 , 79 - 130 , 155 - 173 , ments , the sense strand comprises at least 15 contiguous 194 - 216 , 194 - 229 , 211 - 229, 232 - 293 , 254 - 272 , 310 - 328 . nucleotides differing by no more than 3 nucleotides from 310 - 349 , 324 -345 , 331 - 349 , 353 - 371 , 353 - 394 , 376 - 394 , nucleotides 340 - 369 , 430 -490 , 430 - 482 , 434 - 460 , 532 - 559 , 407 -425 , 439 -449 , 431 -470 , 484 - 515 , 497 - 515 , 541 -580 , 328 - 350 , 340 -362 , 346 - 368, 347 - 369 , 430 - 452 , 433 -455 , 547 - 568 , 596 -647 , 616 -634 , 673 -691 , 694 -712 , 694 -734 , 434 - 456 , 436 - 458 , 438 -460 , 439- 461 , 440 - 462 , 447 -469 , 777 - 799 , 781 - 799, 825 - 843 , 825 - 855 , 869- 922 , 958 - 976 , 453 - 475 , 458 - 480 , 459 -481 , 460 -482 , 461 -483 , 462 - 484 , 958 - 988 , 1064 - 1085 , 1064 - 1096 , 1067 - 1085 , 1067 - 1096 , 468 - 490 , 479 -501 , 532 - 554 , 534 -556 , 536 - 558 , 537 -559 , 1100 - 1141 , 1111 - 1129 , 1145 - 1163 , 1145 - 1186 , 1159 - 1186 , 540 - 562, 546 - 568 , 575 - 597 , 580 -602 , or 638 -660 of the 1168 - 1196 , 1168 - 1214 , 1193 - 1214 , 1266 - 1307 , 1321 - 1339 , nucleotide sequence of SEQ ID NO : 11 , for example nucleo 1342 - 1373 , 1375 - 1406 , 1432 - 1450 , 1454 - 1472 , 1519 - 1537 , tides 342 - 369 , 432 - 462 , 330 -350 , 342 -362 , 348 -368 , 349 1519 - 1559 , 1534 - 1555 , 1541 - 1559, 1606 - 1624 , 1606 - 1637 , 369, 432 - 452 , 435 - 455 , 436 - 456 , 438 - 458 , 440 - 460 , 442 1613 - 1635 , 1672 - 1690 , 1672 - 1712 , 1749 - 1779 , 1783 - 1801 . 462 , 470 - 490 , 481 - 501 , 536 -556 , or 539 - 559 of the 1805 - 1823 , 1806 - 1829 , 1871 - 1889 , 1871- 1919 , 1949 - 1977 , nucleotide sequence of SEQ ID NO : 11, and the antisense 1993 -2011 , 2013 - 2042 , 2048 -2077 , 2048 -2088 , or 2052 strand comprises at least 15 contiguous nucleotides differing 2084 of the nucleotide sequence of SEQ ID NO : 1 , and the by no more than 3 nucleotides from the corresponding antisense strand comprises at least 15 contiguous nucleo position of the nucleotide sequence of SEQ ID NO : 12 such tides from the corresponding position of the nucleotide that the antisense strand is complementary to the at least 15 sequence of SEQ ID NO : 2 such that the antisense strand is contiguous nucleotides differing by no more than 3 nucleo complementary to the at least 15 contiguous nucleotides in tides in the sense strand . the sense strand . [0021 ] In certain embodiments , the sense strand comprises [0024 ] In certain embodiments , the present invention pro at least 15 contiguous nucleotides differing by no more than vides double stranded ribonucleic acid (RNAI ) agent for 3 nucleotides from nucleotides 6 - 90 , 127 - 145 , 185 - 238 , inhibiting expression of insulin - like growth factor 1 ( IGF- 1 ) , 247 - 265 , 277 - 295 , 389 -417 , 430 - 480 , 543 - 561 , 654 -690 , which comprise a sense strand and an antisense strand 750 - 768, 774 - 870 , 894 - 930 , 1007 - 1029 , 1075 - 1126 , 1144 forming a double stranded region , wherein the sense strand 1162, 1197 - 1215 , 1232 - 1250 , 1293 - 1311, 1334 - 1352 , 1388 comprises at least 15 contiguous nucleotides selected from 1458 , 1463 - 1490 , 1511 - 1529 , 1599 - 1617 , 1643 - 1661 , 1690 the group consisting of nucleotides 330 - 369, 342 - 369, 432 1727 , 1793 - 1825 , 1843 - 1861, 2057 - 2075 , 2090 -2130 , 2192 490 , 432 -482 , 436 - 462, 534 -559 , 330 - 350 , 342 - 362 , 348 2228 , 2310 - 2332 , 2357 -2375 , 2521 - 2539 , 2566 - 2588 , 2648 368 , 349 - 369, 432 -452 , 435 -455 , 436 - 456 , 438 - 458 , 440 2684 , 2793 - 2811 , 2962 - 2980 , 3120 - 3142 , 3208 - 3233 , 3269 460 , 441 -461 , 442 - 462 , 449 -469 , 455 - 475 , 460 - 480 , 461 3287 , 3417 - 3435 , 3449 - 3467, 3575 - 3603 , 3686 - 3704 , 3721 481 , 462 - 482 , 464 -484 , 470 -490 , 484 - 501, 534 -554 , 536 3739 , 3806 - 3824 , 3939 - 3957 , 3982- 4018 , 4081 - 4037 , 4154 556 , 538 - 558 , 539 - 559 , 542 - 562 , 548 - 568 , 577 -597 , 582 4172 , 4271 - 4289, 4319 - 4377 , 4436 - 4478 , 4484 - 4502 , 4523 602, or 640 -660 of the nucleotide sequence of SEQ ID NO : 4545 , 4566 - 4584 , 4610 - 4660 , 4686 - 4717 , 4734 - 4769, 4780 11 and the antisense strand comprises at least 15 contiguous 4798 , 4815 -4843 , 4884 -4902 , 4911 - 4929 , 5004 - 5034 , 5050 nucleotides from the corresponding position of the nucleo 5068 , 5171 - 5256 , 5311 - 5364, 5409 - 5430 , 5551 - 5588 , 5609 tide sequence of SEQ ID NO : 12 such that the antisense 5638 , 5694 - 5712 , 5715 -5758 , 5790 - 5808 , 5906 - 5928 , 5934 strand is complementary to the at least 15 contiguous 5952 ,6323 -6345 , 6399 -6417 , 6461 -6497 , 6510 -6535 , 6584 nucleotides in the sense strand . 6612 , 6629 - 6647 , 6661- 6683 , 6726 -6789 , 6796 -6824 , 6826 [0025 ] In certain embodiments , the present invention pro 6851, 6858 -6905 , 6910 -6927 , 7004 - 7022 , 7035 -7130 , 7144 vides double stranded RNAi agents for inhibiting expression 7162 , 7175 - 7241, or 7252 - 7270 of the nucleotide sequence of insulin - like growth factor 1 ( IGF- 1 ) , which comprise a of SEQ ID NO : 13 , and the antisense strand comprises at sense strand and an antisense strand forming a double least 15 contiguous nucleotides differing by no more than 3 stranded region , wherein the sense strand comprises at least nucleotides from the corresponding position of the nucleo 15 contiguous nucleotides differing by no more than 3 tide sequence of SER ID NO : 14 such that the antisense nucleotides from nucleotides 6 - 90 , 127 - 145 , 185 - 238 , 247 strand is complementary to the at least 15 contiguous 265 , 277 - 295 , 389 -417 , 430 -480 , 543 - 561, 654 -690 , 750 nucleotides differing by no more than 3 nucleotides in the 768 , 774 - 870 , 894 - 930 , 1007 - 1029 , 1075 - 1126 , 1144 - 1162 , sense strand . 1197 - 1215 , 1232 - 1250 , 1293 - 1311 , 1334 - 1352 , 1388 - 1458 , [ 0022 ] In certain embodiments , substantially all of the 1463 - 1490 , 1511 - 1529 , 1599 - 1617 , 1643 - 1661, 1690 - 1727 , nucleotides of the sense strand are modified . In certain 1793 - 1825 , 1843 - 1861, 2057 - 2075 , 2090 - 2130 , 2192 - 2228 , embodiments , substantially all of the nucleotides of the 2310 - 2332 , 2357 - 2375 , 2521 - 2539 , 2566 - 2588 , 2648 - 2684 , antisense strand are modified nucleotides . In certain embodi 2793 - 2811 , 2962 - 2980 , 3120 - 3142 , 3208 - 3233 , 3269- 3287 , ments , substantially all of the nucleotides of both strands are 3417 -3435 , 3449 - 3467, 3575 - 3603, 3686 - 3704 , 3721- 3739 , modified . Further, in certain embodiments , the double 3806 - 3824 , 3939 - 3957, 3982 - 4018 , 4081 - 4037 , 4154 - 4172, stranded RNAi agent comprises a ligand , e . g . , the double 4271 - 4289 , 4319 - 4377 , 4436 - 4478 , 4484 - 4502 , 4523 - 4545 , stranded RNAi agent is conjugated to at least one ligand , 4566 -4584 , 4610 - 4660 , 4686 - 4717 , 4734 - 4769 , 4780 - 4798 , wherein the ligand is one or more GalNAc derivatives 4815 - 4843 , 4884 -4902 , 4911 -4929 , 5004 - 5034 , 5050 -5068 , attached through a monovalent , a bivalent or a trivalent 5171 - 5256 , 5311 -5364 , 5409 - 5430 , 5551- 5588 , 5609 - 5638 , branched linker . 5694 - 5712 , 5715 - 5758 , 5790 - 5808 , 5906 - 5928 , 5934 - 5952, US 2018 /0201929 A1 Jul. 19 , 2018

6323 -6345 , 6399 -6417 , 6461- 6497 , 6510 -6535 , 6584 -6612 , 7252 -7270 of the nucleotide sequence of SEQ ID NO : 13 , 6629 -6647 , 6661- 6683 , 6726 -6789 , 6796 -6824 , 6826 -6851 , and the antisense strand comprises at least 15 contiguous 6858 -6905 , 6910 -6927 , 7004 - 7022 , 7035 - 7130 , 7144 - 7162 , nucleotides from the corresponding position of the nucleo 7175 -7241 , and 7252 -7270 of the nucleotide sequence of tide sequence of SEQ ID NO : 14 such that the antisense SEQ ID NO : 13, and the antisense strand comprises at least strand is complementary to the at least 15 contiguous 15 contiguous nucleotides differing by no more than 3 nucleotides in the sense strand . nucleotides from the corresponding position of the nucleo 10029 ]. In certain embodiments , substantially all of the tide sequence of SEQ ID NO : 14 such that the antisense nucleotides of the sense strand are modified nucleotides . In strand is complementary to the at least 15 contiguous certain embodiments , substantially all of the nucleotides of nucleotides differing by no more than 3 nucleotides in the the antisense strand are modified nucleotides . In certain sense strand . embodiments , substantially all of the nucleotides of both [0026 ] In certain embodiments , the agents comprise a strands are modified . In preferred embodiments , the double sense strand and an antisense strand forming a double stranded RNAi agent comprises a ligand , e. g . , the double stranded region , wherein the sense strand comprises at least stranded RNAi agent is conjugated to at least one ligand , 15 contiguous nucleotides selected from the group of wherein the ligand is one or more GalNAc derivatives nucleotides 342 - 369, 432 - 462 , 330 - 350 , 342 - 362, 348 - 368 , attached through a monovalent, a bivalent or a trivalent 349 - 369, 432 - 452 , 435 -455 , 436 - 456 , 438 - 458 , 440 - 460 , branched linker. 442 -462 , 470 -490 , 481 - 501, 536 -556 , or 539 -559 of the [0030 ] In certain embodiments , the sense strand and the nucleotide sequence of SEQ ID NO : 11 and the antisense antisense strand comprise a region of complementarity strand comprises at least 15 contiguous nucleotides from the which comprises at least 15 contiguous nucleotides differing corresponding position of the nucleotide sequence of SEQ by no more than 3 nucleotides from any one of the antisense ID NO : 12 such that the antisense strand is complementary sequences listed in any one of Tables 3 , 5 , 6 , 8 , 12 , or 14 for to the at least 15 contiguous nucleotides in the sense strand . IGFALS or any one of Tables 9 , 11, 15 , 17 , 18 , or 20 for [0027 ] In certain embodiments , the agents comprise a IGF - 1 . sense strand and an antisense strand forming a double [0031 ] For example , in certain embodiments , the sense stranded region , wherein the sense strand comprises at least strand and the antisense strand comprise a region of comple 15 contiguous nucleotides selected from the group of mentarity which comprises at least 15 contiguous nucleo nucleotides 340 - 369, 430 - 490 , 430 - 482 , 434 - 460 , 532 -559 , tides differing by no more than 3 nucleotides from any one 328 - 350 , 340 - 362 , 346 - 368 , 347 - 369, 430 - 452 , 433 -455 , of the antisense nucleotide sequences selected from the 434 - 456 , 436 - 458 , 438 -460 , 439- 461 , 440 - 462 , 447 - 469 , group of the antisense nucleotide sequence of duplexes 453 -475 , 458 -480 , 459 - 481 , 460 - 482 , 461 - 483 , 462 -484 , targeted to IGF selected from the group AD - 66722 , 468 - 490 , 479 -501 , 532 - 554 , 534 -556 , 536 - 558 , 537 -559 , AD -66748 , AD -66746 , AD - 66747 , AD -66733 , AD -66752 , 540 - 562, 546 - 568 , 575 - 597 , 580 -602 , or 638 -660 of the AD -66739 , AD -66738 , AD -66725 , AD -66740 , AD -66750 , nucleotide sequence of SEQ ID NO : 11 , for example nucleo AD - 66729 , AD - 66745 , AD - 66749 , AD - 66720 , AD - 66724 . tides 342 -369 , 432 -462 , 330 - 350 , 342 - 362, 348 - 368 , 349 AD -66726 , AD -66766 , AD -66761 , AD -66755 , AD -66751 , 369, 432 -452 , 435 -455 , 436 - 456 , 438 -458 , 440 -460 , 442 AD - 66719 , AD - 66727 , AD - 66744 , AD - 66760 , AD - 66753 , 462 , 470 -490 , 481 -501 , 536 -556 , or 539 - 559 of the AD -66721 , AD -66716 , AD - 66743 , or AD -66728 , nucleotide sequence of SEQ ID NO : 11 , and the antisense AD -77150 , AD - 77158 , AD - 74963, AD -77138 , AD - 75740 , strand comprises at least 15 contiguous nucleotides from the AD - 74968 , AD - 74965 , AD - 75766 , AD - 75761, AD - 75137 , corresponding position of the nucleotide sequence of SEQ AD -74979 , AD - 74966 , AD -75750 , AD -77126 , AD -74971 , ID NO : 12 such that the antisense strand is complementary AD - 74982 , AD -77144 , AD - 77149, AD - 75751 , AD - 75111 . to the at least 15 contiguous nucleotides in the sense strand . AD - 77147 , AD - 74964 , AD - 74983, AD - 75765 , AD - 74970 , [0028 ] In certain embodiments , the agents comprise a AD - 75749, AD -77168 , AD - 77127 , AD - 75748 , AD -75779 , sense strand and an antisense strand forming a double AD - 75145 , AD - 74975 , AD - 77151 , AD - 75170 , AD - 75741. stranded region , wherein the sense strand comprises at least AD - 75162 , AD - 74985 , AD - 75759 , AD - 75218 , AD -74981 , 15 contiguous nucleotides selected from the group of AD -75155 , AD - 74978 , AD - 77153 , AD -75157 , AD - 75123 , nucleotides 6 - 90 , 127 - 145 , 185 - 238 , 247 - 265 , 277 - 295 , 389 . AD -75184 , AD - 77160 , AD -75125 , AD -75229 , AD -77165 , 417 , 430 - 480 , 543 - 561, 654 -690 , 750 -768 , 774 -870 , 894 AD -75112 , AD - 75206 , AD - 75769, AD -75174 , AD - 75225 , 930 , 1007 - 1029 , 1075 - 1126 , 1144 - 1162 , 1197 - 1215 , 1232 AD - 75792 , AD - 75115 , AD - 74986 , AD - 77171 , AD -75131 , 1250 , 1293 - 1311 , 1334 - 1352, 1388 - 1458 , 1463 - 1490 , 1511 AD -77128 , AD - 75179 , AD -75792 , AD -77124 , AD -75191 , 1529 , 1599 - 1617 , 1643 - 1661 , 1690 - 1727 , 1793 - 1825 , 1843 AD - 75774 , AD - 75114 , AD - 74973 , AD - 77156 , AD - 75120 , 1861, 2057 - 2075 , 2090 - 2130 , 2192 - 2228 , 2310 - 2332 , 2357 AD -75130 , AD - 74967 , AD -75231 , AD - 74987 , AD -77140 , 2375 , 2521 - 2539 , 2566 -2588 , 2648 - 2684 , 2793 - 2811 , 2962 AD - 74969 , AD - 75000 , AD - 75791, AD - 75143 , AD - 77120 , 2980 , 3120 - 3142, 3208 - 3233 , 3269- 3287 , 3417 - 3435 , 3449 AD -77142 , AD - 75217 , AD -75234 , AD -75173 , AD - 75232 , 3467 , 3575 - 3603, 3686 - 3704 , 3721 - 3739 , 3806 - 3824 , 3939 AD - 75188 , AD - 75135 , AD - 75018 , AD - 77122 , AD -75009 , 3957 , 3982 - 4018 , 4081 - 4037 , 4154 -4172 , 4271 - 4289 , 4319 AD - 75121, AD - 75791 , AD - 77135 , AD - 75214 , AD -74994 , 4377 , 4436 - 4478 , 4484 -4502 , 4523 - 4545 , 4566 -4584 , 4610 AD -75139 , AD - 75166 , AD - 75020 , AD - 77159 , AD - 75236 , 4660 , 4686 - 4717 , 4734 -4769 , 4780 - 4798 , 4815 - 4843 , 4884 AD -77123 , AD - 77133 , AD - 74972, AD -75223 , AD - 75148 , 4902 , 4911 -4929 , 5004 - 5034 , 5050 - 5068 , 5171 - 5256 , 5311 AD - 75124 , AD - 75185 , AD - 75150 , AD - 74976 , AD -74980 , 5364 , 5409 - 5430 , 5551 - 5588 , 5609 - 5638 , 5694 - 5712 , 5715 AD - 75212 , AD - 75239, AD -75221 , AD - 75118 , AD - 75793 , 5758 , 5790 - 5808 , 5906 -5928 , 5934 - 5952 , 6323 -6345 , 6399 AD - 75023 , AD -75164 , AD - 74997 , AD -74984 , AD - 75011 , 6417 , 6461- 6497 , 6510 -6535 , 6584 -6612 , 6629 -6647 , 6661 AD -75203 , AD -77161 , AD - 75033 , AD -75177 , AD - 75795 , 6683 , 6726 -6789 , 6796 -6824 , 6826 -6851 , 6858 -6905 , 6910 AD -77146 , AD -75793 , AD - 75788 , AD - 75079 , AD -75152 , 6927 , 7004 - 7022 , 7035 - 7130 , 7144 - 7162 , 7175 - 7241, or AD - 77121 , AD - 75237 , AD - 75014 , AD - 75755 , AD -75028 , US 2018 /0201929 A1 Jul. 19 , 2018

AD -75091 , AD - 75110 , AD -75230 , AD - 75029, AD - 75099 , nucleotide, a constrained ethyl nucleotide, an abasic nucleo AD - 77130 , AD - 75224 , AD - 75142 , AD - 75760 , AD - 75795 , tide , a 2 - amino -modified nucleotide , a 2 - O -allyl - modified AD -77136 , AD -75032 , AD - 75757 , AD - 75017 , AD -75151 , nucleotide , 2 - C -alkyl - modified nucleotide , 2 -hydroxly AD - 75122 , AD - 75002 , AD - 75021, AD - 75005 , AD - 75088 , modified nucleotide, a 2' -methoxyethyl modified nucleotide , AD - 75153, AD -75208 , AD -74977 , AD -75069 , AD -75107 , a 2 -O - alkyl- modified nucleotide , a morpholino nucleotide, AD -74990 , AD - 75061, AD - 75083 , AD -75116 , AD - 75169 , a phosphoramidate , a non -natural base comprising nucleo AD - 75058 , AD -74991 , AD - 75041 , AD - 77131 , AD - 75772 , tide, a tetrahydropyran modified nucleotide , a 1, 5 -anhydro AD - 77169, AD - 75133 , AD - 75222 , AD -75007 , AD - 75101 , hexitol modified nucleotide, a cyclohexenyl modified AD - 77137 , AD - 75090 , AD - 77148 , AD -75008 , AD - 77134 , AD -74999 , AD - 75048 , AD -75095 , AD - 74974 , AD - 75788 , nucleotide, a nucleotide comprising a phosphorothioate AD -75057 , AD -75113 , AD -77172 , AD - 75016 , AD -75186 , group , a nucleotide comprising a methylphosphonate group , AD - 75205 , AD - 75238 , or AD - 75146 ; for example duplexes a nucleotide comprising a 5 '- phosphate , and a nucleotide AD -66722 , AD -66748 , AD -66746 , AD -66747 , AD -66733 , comprising a 5 - phosphate mimic . In another embodiment, AD - 66752 , AD -66739 , AD - 66738 , AD - 66725 , AD -66740 , the modified nucleotides comprise a short sequence of AD -66750 , AD -66729 , or AD -66745 . In certain embodi 3 '- terminal deoxy - thymine nucleotides (dT ). ments, nucleotide sequences selected from the group [0035 ] In certain embodiments , substantially all of the duplexes targeted to IGF selected from the group AD -66722 , nucleotides of the sense strand are modified . In certain AD -66748 , AD - 66746 , AD -66747 , AD -66733 , AD -66752 , embodiments , substantially all of the nucleotides of the AD - 66739, AD -66738 , AD - 66725 , AD - 66740 , AD -66750 , AD - 66729 , and AD -66745 . In certain embodiments , the antisense strand are modified . In certain embodiments , sub sense strand and the antisense strand comprise a region of stantially all of the nucleotides of both the sense strand and complementarity which comprises at least 15 contiguous the antisense strand are modified . nucleotides of any one of the sense and antisense nucleotide [ 0036 ] In certain embodiments , the duplex comprises a sequences of the foregoing duplexes . modified antisense nucleotide sequence targeted to IGFALS [ 0032] In certain embodiments , the sense strand and the provided in Table 5 , 8 , or 14 , or targeted to IGF - 1 in Table antisense strand comprise a region of complementarity 11 , 17 , or 20 . In certain embodiments , the duplex comprises which comprises at least 15 contiguous nucleotides differing a modified sense strand nucleotide sequence targeted to by no more than 3 nucleotides from any one of the antisense sequences of the duplexes targeted to IGFALS selected from IGFALS provided in Table 5 , 8 , or 14 , or targeted to IGF - 1 the group AD -62728 , AD -62734 , AD -68111 , AD -68709 , in Table 11, 17 , or 20 . In certain embodiments , the duplex AD -68712 , AD -68715 , AD -68716 , AD -68717 , AD -68719 , comprises the modified sense strand nucleotide sequence AD -68720 , AD - 68722 , AD -68725 , AD -68726 , AD -68730 , and the modified antisense strand nucleotide of any one of AD - 68731 , AD -73782 , AD - 73773 , AD - 73765 , AD - 73946 , the duplexes targeted to IGFALS provided in Table 5 , 8 , or AD -73947 , AD - 73858 , AD -73797 , AD -73808 , AD - 73906 , 14 , or targeted to IGF - 1 in Table 11, 17 , or 20 . AD - 73912 , AD -73848 , AD - 73836 , AD - 73818 , AD - 73786 , [0037 ] In certain embodiments , the region of complemen AD -73862 , AD - 73795 , AD - 73766 , AD -73930 , AD - 73825 , tarity between the antisense strand and the target is at least AD - 73924 , AD -73802 , AD - 73767, AD - 73771 , AD - 73777 , 17 nucleotides in length . For example, the region of comple AD - 73793 , AD - 73898 , AD - 73784 , AD - 73882 , AD - 73803 , mentarity between the antisense strand and the target is 19 AD -73772 , AD - 73907 , AD - 73948 , AD -73890 , AD - 73883 , to 21 nucleotides in length , for example , the region of AD -73770 , AD -73867 , AD -73931 , AD -73932 , AD -73787 , complementarity is 21 nucleotides in length . In preferred AD -73791 , AD - 73880 , AD -73914 , AD - 73849 , AD -73863 , AD - 73920 , AD -73944 , AD - 73841 , AD - 73785 , AD - 73804 , embodiments , each strand is no more than 30 nucleotides in AD - 73823 , AD -73885 , AD - 73788 , AD - 73865 , AD -73941 , length . AD - 73859 , AD - 73913 , AD - 73892 , AD - 73837 , AD - 73842 , [ 0038 ] In some embodiments , at least one strand com AD - 73840 , AD - 73813 , AD -73796 , AD -73875 , AD -73900 , prises a 3 ' overhang of at least 1 nucleotide , e . g . , at least one AD -73922 , AD - 73861, AD -73816 , AD -73764 , AD - 73868 , strand comprises a 3 ' overhang of at least 2 nucleotides , e . g . , AD - 73812 , AD - 73826 , AD - 73938 , AD - 73843 , AD - 73817 , 2 , 3 , 4 , 5 , 6 , 7 , 9 , 10 , 11, 12 , 13 , 14 , or 15 nucleotides . In AD - 73943 , AD - 73827 , AD - 73937 , AD -73877 , AD - 73833 , other embodiments , at least one strand of the RNAi agent AD -73807 , AD - 73819 , AD - 73886 , AD -73919 , AD - 73800 , comprises a 5 ' overhang of at least 1 nucleotide. In certain AD - 76171, AD -76173 , AD - 76203 , AD -76210 , AD -76172 , embodiments , at least one strand comprises a 5 ' overhang of AD - 76175 , AD - 76209 , AD - 76174 , AD - 76208 , AD - 76186 , at least 2 nucleotides , e . g ., 2 , 3 , 4 , 5 , 6 , 7 , 9 , 10 , 11 , 12 , 13 , AD - 76177 , AD -76199 , AD -76197 , or AD - 76212 . 14 , or 15 nucleotides . In still other embodiments , both the 3' (0033 ] In certain embodiments , substantially all of the and the 5 ' end of one strand of the RNAi agent comprise an nucleotides of the sense strand are modified nucleotides . In overhang of at least 1 nucleotide . In other embodiment , at certain embodiments , substantially all of the nucleotides of least one strand comprises a 3 ' overhang of at least 2 the antisense strand are modified nucleotides . In certain nucleotides . embodiments , substantially all of the nucleotides of both 100391. In many embodiments, the double stranded RNAi strands are modified . agent further comprises a ligand . The ligand may be one or 10034 ] In one embodiment, at least one of the modified more GalNAc attached to the RNAi agent through a mon nucleotides is selected from the group consisting of a ovalent, a bivalent, or a trivalent branched linker. The ligand deoxy -nucleotide , a 3 ' - terminal deoxy - thymine (dT ) nucleo may be conjugated to the 3 ' end of the sense strand of the tide , a 2 - O -methyl modified nucleotide , a 2 - fluoro modified double stranded RNAi agent. The ligand can be an N -acetyl nucleotide , a 2 ' - deoxy -modified nucleotide , a locked nucleo galactosamine (GalNAc ) derivative including, but not lim tide , an unlocked nucleotide , a conformationally restricted ited to USUS 20022018 /0201929 2001 A1 o Jul. 19 , 2018 HO OH

HON AcHN

HO OH

?? KunywanyAcHN HO OH HO NH AcHN

[0040 ] In various embodiments , the ligand is attached to or 6 , of GalNAc, each independently attached to a plurality the 5 ' end of the sense strand of the double stranded RNAi agent, the 3 ' end of the antisense strand of the double of nucleotides of the double stranded RNAi agent through a stranded RNAi agent, or the 5 ' end of the antisense strand of plurality of monovalent linkers . the double stranded RNAi agent. 10041 ] In some embodiments , the double stranded RNAi (0042 ] In certain embodiments , the dsRNAi is agent con agents of the invention comprise a plurality , e . g ., 2 , 3 , 4 , 5 , jugated to the ligand as shown in the following schematic : US 2018 /0201929 A1 Jul. 19 , 2018

0 0 X ? = - X )

HO OH HOAACHN arty HO COM IZ ZI ZI HowACHN daryti grafin HO OH HotACHN BangetIZ US 2018 /0201929 A1 Jul. 19 , 2018 and , wherein X is O or S . In one embodiment, the X is 0 . [0049 ] In another embodiment, formula (III ) is repre [0043 ] In certain embodiments , the ligand is a cholesterol. sented by formula ( IIIb ) : [0044 ] In certain embodiments, the region of complemen sense: 5' ng- Na - YYY- NU- ZZZ - Na- n3 ' tarity comprises any one of the antisense sequences targeted to IGFALS provided in Table 3 , 5 , 6 , 8 , 12 , or 14 or targeted antisense: 3' n - Ng- Y ' Y ' Y '- N - Z' Z 'Z '- No - 1 , 5 ' ( IIIb ) to IGF - 1 in Table 9 , 11, 15, 17 , 18 , or 20 . In another embodiment, the region of complementarity consists of any [ 0050 ] wherein each N , and N ' independently represents one of the antisense sequences of targeted to IGFALS an oligonucleotide sequence comprising 1 -5 modified provided in Table 3 , 5 , 6 , 8 , 12 , or 14 or targeted to IGF - 1 nucleotides. in Table 9 , 11, 15 , 17 , 18 , or 20 . [ 0051 ] Alternatively , formula ( III) can be represented by [0045 ] In another aspect, the invention provides a double formula ( IIIc ) : stranded RNAiagent for inhibiting expression of IGFALS or sense : 5 'ng - Na- XXX - N YYY- Na- ng3 IGF- 1 , wherein the double stranded RNAi agent comprises a sense strand complementary to an antisense strand , antisense : 3 'n , - NQ - X 'X 'X '- N - Y ' Y ' Y '- No - 1 , 5 ' ( IIIC ) wherein the antisense strand comprises a region comple mentary to part of an mRNA encoding IGFALS or IGF - 1 , [0052 ] wherein each N , and N , ' independently represents wherein each strand is about 14 to about 30 nucleotides in an oligonucleotide sequence comprising 1 - 5 modified length , wherein the double stranded RNAi agent is repre nucleotides . sented by formula ( III ) : [0053 ] Further, formula ( III ) can be represented by for sense : 5 'n , - Na- ( XXX ), - Ny - YYY -NG - ( ZZZ ); - Na - 1 , 3' mula ( IIId ): antisense: 3' n, ' - N - ( X®X®X ') ; - N ,' - Y ' Y 'Y ' -N ,' - ( Z 'Z 'Z ') sense : 5 'n , -No - XXX -N - YYY- Ny - ZZZ - N - , 3 ' - N . -n ,' 5 ' (III ) antisense : 3' n , - N - X 'X 'X '- N - Y 'Y ' - Ny - Z' Z' Z ' - N - [0046 ] wherein : i, j, k , and 1 are each independently 0 or 125" ( IIID ) 1 ; p , p ', q , and q ' are each independently 0 -6 ; each N , and Na independently represents an oligonucleotide sequence com [ 0054 ] wherein each N , and N ' independently represents prising 0 - 25 nucleotides which are either modified or an oligonucleotide sequence comprising 1 - 5 modified unmodified or combinations thereof, each sequence com nucleotides and each N , and Na' independently represents an prising at least two differently modified nucleotides ; each N , oligonucleotide sequence comprising 2 - 10 modified nucleo and N ' independently represents an oligonucleotide tides . sequence comprising 0 - 10 nucleotides which are either [0055 ] In certain embodiment , the double stranded region modified or unmodified or combinations thereof; each n , , is 15 -30 nucleotide pairs in length . For example , the double n ,' , nq, and n ,' , each of which may or may not be present, independently represents an overhang nucleotide ; XXX , stranded region can be 17 -23 nucleotide pairs in length . The YYY , ZZZ , X ' X ' X ', Y ' Y ' Y ' , and Z ' Z ' Z ' each independently double stranded region can be 17 -25 nucleotide pairs in represent onemotif of three identical modifications on three length . The double stranded region can be 23 - 27 nucleotide consecutive nucleotides ; modifications on N , differ from the pairs in length . The double stranded region can be 19- 21 modification on Y and modifications on N , ' differ from the nucleotide pairs in length . The double stranded region can be modification on Y '; and wherein the double stranded RNAi 21 - 23 nucleotide pairs in length . agent comprises a ligand , e. g ., the sense strand is conjugated [ 0056 ] In certain embodiments , each strand has 15 - 30 to at least one ligand . nucleotides . In other embodiments , each strand has 19- 30 [0047 ] In certain embodiments , i is 0 ; j is 0 ; i is 1 ; j is 1 ; nucleotides . both i and j are 0 ; or both i and j are 1 . In another [ 0057 ] Modifications on the nucleotides are selected from embodiment, k is 0 ; 1 is 0 ; k is 1 ; 1 is 1 ; both k and 1 are 0 ; the group including, but not limited to , LNA , HNA , CENA , or both k and 1 are 1 . In another embodiment, XXX is complementary to X 'X ' X ', YYY is complementary to 2' - methoxyethyl , 2 '- O - alkyl , 2 - O -allyl , 2 - C — allyl , Y ' Y ' Y ', and ZZZ is complementary to Z 'Z 'Z '. In another 2 '- fluoro , 2 ' -deoxy , 2 - hydroxyl , and combinations thereof. embodiment, the YYY motif occurs at or near the cleavage In another embodiment, the modifications on the nucleotides site of the sense strand . In another embodiment, the Y ' Y ' Y are 2 - O -methyl or 2 - fluoro modifications . motif occurs at the 11, 12 and 13 positions of the antisense [0058 ] In many embodiments , the double stranded RNAi strand from the 5 '- end . In one embodiment, the Y ' is 2 - O agent further comprises a ligand . The ligand may be one or methyl. more GalNAc attached to the RNAi agent through a mon [0048 ] For example , formula ( III) can be represented by ovalent, a bivalent, or a trivalent branched linker. The ligand formula ( IIIa ) : may be conjugated to the 3 ' end of the sense strand of the double stranded RNAi agent. The ligand can be an N -acetyl sense : 5 'n ,- Ne - YYY- N ,- 1 3 ' galactosamine (GalNAc ) derivative including , but not lim antisense : 3' n , -Ne - Y ' Y' Y '- Na - 14 . 5 " (IIIa ) . ited to LSUS 280281292018 /0201929 A1 Jul. 19 , 2018

HO OH

HO SinghyAcHN HO OH

HO AcHN yhan HO OH HO N IZ AcHN

[0059 ] In various embodiments , the ligand is attached to or 6 , of GalNAc, each independently attached to a plurality the 5 ' end of the sense strand of the double stranded RNAi agent, the 3 ' end of the antisense strand of the double of nucleotides of the double stranded RNAi agent through a stranded RNAi agent, or the 5' end of the antisense strand of plurality of monovalent linkers . the double stranded RNAi agent . [0060 ] In some embodiments , the double stranded RNAi [ 0061 ] An exemplary structure of a dsRNAi agent conju agents of the invention comprise a plurality, e. g ., 2 , 3 , 4 , 5 , gated to the ligand is shown in the following schematic : US 2018 /0201929 A1 Jul. 19 , 2018 01

* * * * * * * * * * * * * * * * * * * * * * * * * % . Y Qwert ** * * * -.71 OH HO 0 :00 tomTOHNH?g oolympisao HO HOOH ! SG

-'.7 taongTOHNHV mga sa pulang mbayaran OH TOH O NHOY - US 2018 /0201929 A1 Jul. 19 , 2018 11

[0062 ] In certain embodiments , the ligand can be a cho sequence comprising 0 - 10 nucleotides which are either lesterol. modified or unmodified or combinations thereof; each no , [0063 ] In certain embodiments , the double stranded RNAi ng' , ng , and n , ', each of which may or may not be present agent further comprises at least one phosphorothioate or independently represents an overhang nucleotide ; XXX , methylphosphonate internucleotide linkage . For example YYY , ZZZ , X ' X ' X ', Y ' Y ' Y ', and Z ' Z ' Z ' each independently the phosphorothioate or methylphosphonate internucleotide represent one motif of three identical modifications on three linkage can be at the 3 ' - terminus of one strand , i. e ., the sense consecutive nucleotides , and wherein the modifications are strand or the antisense strand ; or at the ends of both strands , 2 ' - O -methyl or 2 ' - fluoro modifications ; modifications on N , the sense strand and the antisense strand . differ from the modification on Y and modifications on N ' [0064 ] In certain embodiments , the phosphorothioate or differ from the modification on Y '; and wherein the double methylphosphonate internucleotide linkage is at the 5 ' - ter stranded RNAi agent comprises a ligand , e . g ., the double minus of one strand , i. e . , the sense strand or the antisense stranded RNAi agent is conjugated to at least one ligand , strand ; or at the ends of both strands , the sense strand and the wherein the ligand is one or more GalNAc derivatives antisense strand . attached through a monovalent, a bivalent or a trivalent [ 0065 ] In certain embodiments, the phosphorothioate or branched linker . methylphosphonate internucleotide linkage is at the both the [0073 ] In an aspect, the invention provides a double 5 ' - and 3 ' - terminus of one strand , i . e . , the sense strand or the stranded RNAiagent for inhibiting expression of IGFALS or antisense strand ; or at the ends of both strands , the sense IGF- 1 in a cell, wherein the double stranded RNAi agent strand and the antisense strand . comprises a sense strand complementary to an antisense [ 0066 In certain embodiments, the base pair at the 1 strand , wherein the antisense strand comprises a region position of the 5 ' - end of the antisense strand of the duplex is complementary to part of an mRNA encoding IGFALS or an AU base pair . IGF - 1 , wherein each strand is about 14 to about 30 nucleo [0067 ] In certain embodiments , the Y nucleotides contain tides in length , wherein the double stranded RNAi agent is a 2 ' - fluoro modification . In another embodiment, the Y ' represented by formula ( III ) : nucleotides contain a 2 - O -methyl modification . In another embodiment, p '> 0 . In some embodiments , p = 2 . In some sense : 5 'n , - N - (XXX ) -Ny - YYY -N -( ZZZ ) ,- No - 1 , 3' embodiments , q = 0 , p = 0 , q = 0 , and p ' overhang nucleotides antisens X ' X ' ) ; - N - Y ' Y ' Y ' - N - ( Z Z are complementary to the target mRNA . In some embodi Na - n ,' 5 ' ( III ) ments , q = 0 , p = 0 , q = 0 , and p overhang nucleotides are [ 0074 ] wherein : i , j , k , and 1 are each independently 0 or non - complementary to the target mRNA . 1 ; each no, ng, and n , ', each of which may or may not be 10068 ] In certain embodiments, the sense strand has a total present, independently represents an overhang nucleotide; of 21 nucleotides and the antisense strand has a total of 23 [0075 ] p , q, and q ' are each independently 0 - 6 ; n , ' > 0 and nucleotides . at least one n ,' is linked to a neighboring nucleotide via a [0069 ] In certain embodiments , at least one n ,' is linked to phosphorothioate linkage; each N , and Na' independently a neighboring nucleotide via a phosphorothioate linkage . In represents an oligonucleotide sequence comprising 0 - 25 other embodiments , all n , ' are linked to neighboring nucleo nucleotides which are either modified or unmodified or tides via phosphorothioate linkages . combinations thereof, each sequence comprising at least two [0070 ] In certain embodiments , the dsRNAi agent is differently modified nucleotides; each N , and N , ' indepen selected from the group of any one of the double stranded dently represents an oligonucleotide sequence comprising RNAi agents targeted to IGFALS provided in Table 3, 5 , 6 , 0 - 10 nucleotides which are either modified or unmodified or 8 , 12 , or 14 , or targeted to IGF - 1 in Table 9 , 11, 15 , 17 , 18 , combinations thereof; XXX , YYY, ZZZ , X ' X ' X ', Y ' Y ' Y ' , and or 20 . In certain embodiments , all of the nucleotides of the Z ' Z ' Z ' each independently represent one motif of three sense strand and all of the nucleotides of the antisense strand identical modifications on three consecutive nucleotides , comprise a modification . and wherein the modifications are 2 ' - O -methyl or 2 - fluoro [0071 ] In an aspect, the invention provides a double modifications ; modifications on N , differ from the modifi stranded RNAi agent for inhibiting expression of IGFALS or cation on Y and modifications on N ' differ from the modi IGF- 1 in a cell , wherein the double stranded RNAi agent fication on Y ' ; and wherein the double stranded RNAi agent comprises a sense strand complementary to an antisense comprises a ligand , e . g . , the double stranded RNAi agent is strand , wherein the antisense strand comprises a region conjugated to at least one ligand , wherein the ligand is one complementary to part of an mRNA encoding IGFALS or or more GalNAc derivatives attached through a monovalent, IGF - 1 , wherein each strand is about 14 to about 30 nucleo a bivalent or a trivalent branched linker. tides in length , wherein the double stranded RNAi agent is 10076 ]. In certain embodiments , the invention provides a d represented by formula ( III ) : double stranded ribonucleic acid ( RNAi) agent for inhibiting sense : 5 'n , - Na- ( XXX ), - Ny - YYY -N -( ZZZ ); - NQ - 1 , 3' expression of IGFALS or IGF - 1 , wherein the double stranded RNAi agent comprises a sense strand complemen antisense : 3' n ,' - N2 - ( X X 'X ') x - N ,' - Y ' Y ' Y ' - N , '- ( Z 'Z 'Z ') tary to an antisense strand , wherein the antisense strand Na- n ,' 5' (III ) comprises a region complementary to part of an mRNA [ 0072 ] wherein i, j, k , and 1 are each independently 0 or 1 ; encoding IGFALS or IGF - 1 , wherein each strand is about 14 p , p ', q , and q ' are each independently 0 - 6 ; each N ., and N . '. to about 30 nucleotides in length , wherein the double independently represents an oligonucleotide sequence com stranded RNAi agent is represented by formula (III ) : prising 0 - 25 nucleotides which are either modified or unmodified or combinations thereof, each sequence com sense : 5' n , - Na -( XXX ) , - Ny - YYY- N ,- ( ZZZ) ; - Na- 143 ' prising at least two differently modified nucleotides ; each N , antisense UN - 14 X ' X ') - N , - Y ' Y ' Y ' - N , - ( Z ' Z ' Z ') and No' independently represents an oligonucleotide -- Na -n ,' 5 ' ( III) US 2018 /0201929 A1 Jul. 19 , 2018

[ 0077 ] wherein i, j , k , and I are each independently 0 or 1 ; IGFALS of IGF - 1, wherein each strand is about 14 to about each np, ng, and n ,' , each of which may or may not be 30 nucleotides in length , wherein the double stranded RNAi present, independently represents an overhang nucleotide; p , agent is represented by formula ( III) : q , and q' are each independently 0 -6 ; n ,' > 0 and at least one n ' is linked to a neighboring nucleotide via a phosphoro sense: 5 'ng - Na- XXX) - NE- YYY- N -( ZZZ ) - Na - ng3 thioate linkage; each N , and Na' independently represents an antisense : 3 'n , ' - N '- ( X 'X 'X ') x- N ,' - Y ' Y ' Y '- N ,' - ( Z 'Z ' Z ') oligonucleotide sequence comprising 0 - 25 nucleotides -- Na -n , '5 ' (III ) which are either modified or unmodified or combinations [0081 ] wherein i, j , k , and 1 are each independently 0 or 1 ; thereof, each sequence comprising at least two differently each no , no, and n , ', each of which may or may not be modified nucleotides ; each N , and N ,' independently repre present, independently represents an overhang nucleotide ; p , sents an oligonucleotide sequence comprising 0 - 10 nucleo q , and q ' are each independently 0 - 6 ; n , ' > 0 and at least one tides which are either modified or unmodified or combina n , ' is linked to a neighboring nucleotide via a phosphoro tions thereof; XXX , YYY , ZZZ , X ' X ' X ' , Y ' Y ' Y ', and Z ' Z ' Z ' thioate linkage ; each N , and Na' independently represents an each independently represent one motif of three identical oligonucleotide sequence comprising 0 - 25 nucleotides modifications on three consecutive nucleotides , and wherein which are either modified or unmodified or combinations the modifications are 2 - O -methyl or 2 - fluoro modifications; thereof, each sequence comprising at least two differently modifications on N , differ from the modification on Y and modified nucleotides ; each N , and N ' independently repre modifications on N ' differ from the modification on Y ' ; and sents an oligonucleotide sequence comprising 0 - 10 nucleo wherein the double stranded RNAi agent is conjugated to at tides which are either modified or unmodified or combina least one ligand , wherein the ligand is one or more GalNAC tions thereof; XXX , YYY, ZZZ , X ' X ' X ' , Y ' Y ' Y ' , and Z ' Z ' Z ' derivatives attached through a monovalent, a bivalent or a each independently represent one motif of three identical trivalent linker. modifications on three consecutive nucleotides, and wherein [0078 ] In an aspect, the invention provides a double the modifications are 2 - O -methyl or 2 ' - fluoro modifications ; stranded RNAi agent for inhibiting expression of IGFALS or modifications on N , differ from the modification on Y and IGF - 1 , wherein the double stranded RNAi agent comprises modifications on No' differ from the modification on Y ' ; a sense strand complementary to an antisense strand , wherein the sense strand comprises at least one phosphoro wherein the antisense strand comprises a region comple thioate linkage ; and wherein the double stranded RNAi mentary to part of an mRNA encoding IGFALS or IGF- 1 , agent comprises a ligand , e . g . , the double stranded RNAi wherein each strand is about 14 to about 30 nucleotides in agent is conjugated to at least one ligand , wherein the ligand length , wherein the double stranded RNAi agent is repre is one or more GalNAc derivatives attached through a sented by formula ( 111) : monovalent, a bivalent or a trivalent branched linker. sense : 5 'n , - N . ( XXX ); - Ny- YYY- N -( ZZZ ); - No- 1 , 3 ' [0082 ] In an aspect, the invention provides a double stranded RNAiagent for inhibiting expression of IGFALS or antisense : 3' n, ' - N . -( X 'X 'X ') x -N , '- Y 'Y ' Y' - N , '- ( Z 'Z 'Z ') IGF - 1 in a cell, wherein the double stranded RNAi agent -Na - n , '5 ' (III ) comprises a sense strand complementary to an antisense [0079 ] wherein i, j, k , and 1 are each independently 0 or 1 ; strand, wherein the antisense strand comprises a region each ny, ng, and n ,' , each of which may or may not be complementary to part of an mRNA encoding IGFALS or present, independently represents an overhang nucleotide ; p , IGF - 1 , wherein each strand is about 14 to about 30 nucleo q , and q ' are each independently 0 - 6 ; n , ' > 0 and at least one tides in length , wherein the double stranded RNAi agent is n , ' is linked to a neighboring nucleotide via a phosphoro represented by formula ( III ) : thioate linkage ; each N , and N ' independently represents an oligonucleotide sequence comprising 0 -25 nucleotides sense : 5 'n , -N .- YYY- No - 1 3' which are either modified or unmodified or combinations thereof, each sequence comprising at least two differently antisense : 3' n , ' - N . - Y' Y 'Y '- No - 12, 5 ' ( IIIa ). modified nucleotides ; each N , and N ' independently repre [ 0083 ] wherein each no, ng, and n ,' , each of which may or sents an oligonucleotide sequence comprising 0 - 10 nucleo may not be present, independently represents an overhang tides which are either modified or unmodified or combina nucleotide ; p , q , and q' are each independently 0 -6 ; n, '> 0 and tions thereof; XXX , YYY, ZZZ , X 'X ' X ', Y 'Y ' Y ', and Z ' Z ' Z ' at least one n , ' is linked to a neighboring nucleotide via a each independently represent one motif of three identical phosphorothioate linkage; each Na and Na' independently modifications on three consecutive nucleotides , and wherein represents an oligonucleotide sequence comprising 0 - 25 the modifications are 2 - O -methyl or 2 - fluoro modifications ; nucleotides which are either modified or unmodified or modifications on N , differ from the modification on Y and combinations thereof, each sequence comprising at least two modifications on No' differ from the modification on Y ' ; differently modified nucleotides ; YYY and Y ' Y ' Y ' each wherein the double stranded RNAi agent comprises a ligand , independently represent one motif of three identical modi e . g ., the double stranded RNAi agent is conjugated to at least fications on three consecutive nucleotides , and wherein the one ligand , wherein the ligand is one or more GalNAc modifications are 2 - O -methyl or 2 - fluoro modifications ; derivatives attached through a monovalent, a bivalent or a wherein the sense strand comprises at least one phosphoro trivalent branched linker. thioate linkage ; wherein the double stranded RNAi agent [0080 ] In an aspect, the invention provides a double comprises a ligand , e . g . , the double stranded RNAi agent is stranded RNAi agent capable of inhibiting the expression of conjugated to at least one ligand , wherein the ligand is one IGFALS or IGF- 1 in a cell, wherein the double stranded or more GalNAc derivatives attached through a monovalent, RNAi agent comprises a sense strand complementary to an a bivalent or a trivalent branched linker. antisense strand , wherein the antisense strand comprises a [0084 In an aspect, the invention provides a double region complementary to part of an mRNA encoding stranded ribonucleic acid (RNAi ) agent for inhibiting US 2018 /0201929 A1 Jul. 19 , 2018 13 expression of IGFALS , wherein the double stranded RNAi nucleotides in length . In certain embodiments , the region of agent comprises a sense strand and an antisense strand complementarity is 19 to 23 nucleotides in length . forming a double stranded region , wherein the sense strand [0090 ] In an aspect, the invention provides a cell com comprises at least 15 contiguous nucleotides differing by no prising a vector as described herein . more than 3 nucleotides from the nucleotide sequence of [0091 ] In an aspect, the invention provides a pharmaceu SEQ ID NO : 1 and the antisense strand comprises at least 15 tical composition for inhibiting expression of an IGFALS or contiguous nucleotides differing by no more than 3 nucleo IGF - 1 gene , comprising a double stranded RNAi agent of tides from the nucleotide sequence of SEQ ID NO : 2 , the invention . In one embodiment, the RNAi agent is wherein substantially all of the nucleotides of the sense administered in an unbuffered solution . In certain embodi strand comprise a modification selected from a 2 - O -methyl ments, the unbuffered solution is saline or water. In other modification and a 2 - fluoro modification , wherein the sense embodiments , the RNAi agent is administered with a buffer strand comprises two phosphorothioate internucleotide link solution . In such embodiments , the buffer solution can ages at the 5 ' -terminus , wherein substantially all of the comprise acetate, citrate , prolamine , carbonate, or phos nucleotides of the antisense strand comprise a modification phate , or any combination thereof. For example , the buffer selected from a 2 ' - O -methyl modification and a 2 - fluoro solution can be phosphate buffered saline (PBS ). modification , wherein the antisense strand comprises two 10092 ]. In an aspect, the invention provides a pharmaceu phosphorothioate internucleotide linkages at the 5 ' - terminus tical composition comprising the double stranded RNAi and two phosphorothioate internucleotide linkages at the agent of the invention and a lipid formulation . In certain 3 ' - terminus, and wherein the sense strand is conjugated to embodiments , the lipid formulation comprises a LNP. In one or more GalNAc derivatives attached through a mon certain embodiments , the lipid formulation comprises MC3 . ovalent, a bivalent or a trivalent linker at the 3 ' - terminus. [0093 ] In an aspect, the invention provides a method of [0085 ] In an aspect, the invention provides a double inhibiting IGFALS or IGF - 1 expression in a cell, the method stranded ribonucleic acid (RNAi ) agent for inhibiting comprising ( a ) contacting the cell with the double stranded expression of insulin - like growth factor 1 ( IGF- 1 ) , wherein RNAi agent of the invention or a pharmaceutical composi the double stranded RNAi agent comprises a sense strand tion of the invention ; and (b ) maintaining the cell produced and an antisense strand forming a double stranded region , in step ( a ) for a time sufficient to obtain degradation of the wherein the sense strand comprises at least 15 contiguous mRNA transcript of an IGFALS or IGF - 1 gene , thereby nucleotides differing by no more than 3 nucleotides from the inhibiting expression of the IGFALS or IGF - 1 gene in the nucleotide sequence of SEQ ID NO : 11 or 13 and the cell . In certain embodiments , the cell is within a subject , for antisense strand comprises at least 15 contiguous nucleo example , a human subject, for example a female human or tides differing by no more than 3 nucleotides from the a male human . In preferred embodiments , IGFALS or IGF- 1 nucleotide sequence of SEQ ID NO : 12 or 14 , wherein expression is inhibited by at least 30 % , 40 % , 50 % , 60 % , substantially all of the nucleotides of the sense strand 70 % , 80 % , 90 % , or 95 % , or to below the threshold of comprise a modification selected from a 2 - O -methyl modi detection of the assay method used . Preferably the expres fication and a 2 '- fluoro modification , wherein the sense sion is inhibited by at least 50 % . In some embodiments of strand comprises two phosphorothioate internucleotide link the methods of the invention , expression of an IGF - 1 gene ages at the 5 ' - terminus, wherein substantially all of the is inhibited by at least 30 % , 40 % , 50 % , 60 % , 70 % , 80 % , nucleotides of the antisense strand comprise a modification 90 % , or 95 % of the difference between the elevated level selected from a 2 - O - methyl modification and a 2 '- fluoro associated with the disease and a normal level in an appro modification , wherein the antisense strand comprises two priate control subject . Preferably the elevated level is inhib phosphorothioate internucleotide linkages at the 5 ' -terminus ited by at least 50 % . and two phosphorothioate internucleotide linkages at the [0094 ] In an aspect , the invention provides a method of 3 ' - terminus , and wherein the sense strand is conjugated to treating a subject having a disease or disorder that would one or more GalNAc derivatives attached through a mon benefit from reduction in IGFALS or IGF - 1 expression , such ovalent, a bivalent or a trivalent linker at the 3 ' -terminus . as an IGF system -associated disease or disorder , the method [0086 In certain embodiments , all of the nucleotides of comprising administering to the subject a therapeutically the sense strand and all of the nucleotides of the antisense effective amount of a double stranded RNAi agent of the strand are modified nucleotides . In certain embodiments , invention or a pharmaceutical composition of the invention , each strand has 19 - 30 nucleotides . thereby treating the subject. 10087 ) In certain embodiments , substantially all of the [0095 ] In an aspect, the invention provides a method of nucleotides of the sense strand are modified . In certain preventing at least one symptom in a subject having a embodiments , substantially all of the nucleotides of the disease or disorder that would benefit from reduction in antisense strand are modified . In certain embodiments , sub IGFALS or IGF- 1 expression , such as an IGF system stantially all of the nucleotides of both the sense strand and associated disease or disorder , the method comprising the antisense strand are modified . administering to the subject a prophylactically effective [ 0088 ] In an aspect , the invention provides a cell contain amount of a double stranded RNAi agent of the invention or ing the dsRNAi agent as described herein . a pharmaceutical composition of the invention , thereby [ 0089 ] In an aspect, the invention provides a vector encod preventing at least one symptom in the subject having a ing at least one strand of a dsRNAiagent , wherein the RNAi disorder that would benefit from reduction in IGFALS or agent comprises a region of complementarity to at least a IGF - 1 expression . part of an mRNA encoding IGFALS or IGF- 1 , wherein the [0096 ] In certain embodiments , the administration of the RNAi is 30 base pairs or less in length , and wherein the double stranded RNAi to the subject causes a decrease in the RNAi agent targets the mRNA for cleavage . In certain IGF- 1 signaling pathway . In certain embodiments , the embodiments , the region of complementarity is at least 15 administration of the double stranded RNAi causes a US 2018 /0201929 A1 Jul. 19 , 2018 14 decrease in the level of IGF - 1 or IGFALS in the subject , e . g ., reduction of tumor burden using RECIST criteria can be serum levels of IGF - 1 or IGFALS in the subject. used as a surrogate marker for a reduction of IGF - 1 expres [0097 ] In certain embodiments , the IGF system - associated sion or activity . disease is acromegaly . In certain embodiments, the IGF system -associated disease is gigantism . In another embodi BRIEF DESCRIPTION OF THE DRAWINGS ment, the IGF system - associated disease is cancer. In certain [0107 ] FIG . 1 is a schematic showing various aspects of embodiments , the cancer is metastatic cancer. the IGF - 1 signaling pathways . [0098 ] In certain embodiments , the invention further com prises administering an inhibitor of growth hormone to a DETAILED DESCRIPTION OF THE subject with an IGF system - associated disease . INVENTION [0099 ] In certain embodiments , the invention further com [0108 ] The present invention provides iRNA compositions prises administering an inhibitor of the IGF pathway sig which effect the RNA - induced silencing complex (RISC ) naling to a subject with an IGF system -associated disease . mediated cleavage of RNA transcripts of an Insulin - like [0100 ] In certain embodiments , wherein the IGF system Growth Factor Binding Protein , Acid Labile Subunit ( IG associated disease is acromegaly or gigantism , the subject is FALS ) or Insulin - like Growth Factor 1 ( IGF- 1 ) gene. The further treated for acromegaly or gigantism . In certain gene may be within a cell, e . g ., a cell within a subject, such embodiments , the treatment for acromegaly or gigantism as a human . The use of these iRNAs enables the targeted includes surgery. In certain embodiments , the treatment for degradation ofmRNAs of the corresponding gene ( IGFALS acromegaly or gigantism includes radiation . In certain or IGF- 1 gene ) in mammals . embodiments , the treatment for acromegaly or gigantism 0109 ] The iRNAs of the invention have been designed to includes administration of a therapeutic agent. target a human IGFALS or a human IGF - 1 gene , including [0101 ] In certain embodiments , wherein the IGF system portions of the gene that are conserved in the IGFALS or associated disease is cancer, the subject is further treated for IGF - 1 othologs of other mammalian species. Without cancer . In certain embodiments , the treatment for cancer intending to be limited by theory , it is believed that a includes surgery . In certain embodiments , the treatment for combination or sub - combination of the foregoing properties cancer includes radiation . In certain embodiments , the treat and the specific target sites or the specific modifications in ment for cancer includes administration of a chemothera these iRNAs confer to the iRNAs of the invention improved peutic agent. efficacy , stability , potency , durability , and safety . [0102 ] In various embodiments , the dsRNAi agent is [0110 ] Accordingly , the present invention also provides administered at a dose of about 0 .01 mg/ kg to about 10 methods for treating a subject having a disorder that would mg/ kg or about 0 . 5 mg/ kg to about 50 mg/ kg . In some benefit from inhibiting or reducing the expression of an embodiments , the dsRNAi agent is administered at a dose of IGFALS or IGF - 1 gene , e . g . , an IGF system -associated about 10 mg/ kg to about 30 mg/ kg . In certain embodiments, disease , such as acromegaly or cancer, such as a cancer in the dsRNAi agent is administered at a dose selected from 0 .5 which the tumor expresses IGF - 1 , using iRNA compositions mg/ kg 1 mg /kg , 1 .5 mg/ kg, 3 mg/ kg , 5 mg/ kg , 10 mg/ kg , and which effect the RNA - induced silencing complex (RISC ) 30 mg/ kg . In certain embodiments , the dsRNAi agent is mediated cleavage of RNA transcripts of an IGFALS or an administered about once per week , once per month , once IGF - 1 gene . every other two months , or once a quarter ( i. e ., once every [0111 ] Very low dosages of the iRNAs of the invention , in three months ) at a dose of about 0 . 1 mg/ kg to about 5 . 0 particular , can specifically and efficiently mediate RNA mg/ kg . interference (RNAi ) , resulting in significant inhibition of [0103 ] In certain embodiments , the double stranded RNAi expression of the corresponding target gene ( IGFALS or agent is administered to the subject once a week . In certain IGF - 1gene ). embodiments , the dsRNAi agent is administered to the [0112 ] The iRNAs of the invention include an RNA strand subject once a month . In certain embodiments , the dsRNAi ( the antisense strand ) having a region which is about 30 agent is administered once per quarter (i . e . , every three nucleotides or less in length , e . g . , 15 - 30 , 15 - 29 , 15 -28 , months ) . 15 - 27 , 15 -26 , 15 - 25 , 15 - 24 , 15 - 23 , 15 - 22 , 15 - 21, 15 - 20 , [ 0104 ] In some embodiment, the dsRNAi agent is admin 15 - 19 , 15 - 18 , 15 - 17 , 18 - 30 , 18 - 29 , 18 - 28 , 18 - 27 , 18 - 26 , istered to the subject subcutaneously . 18 - 25 , 18 - 24 , 18 -23 , 18 - 22 , 18 - 21, 18 -20 , 19 - 30 , 19 - 29 , 10105 ] In various embodiments , the methods of the inven 19 - 28 , 19 - 27 , 19 - 26 , 19 - 25 , 19 - 24 , 19 - 23 , 19 - 22 , 19 - 21 . tion further comprise determining the level of IGF - 1 in the 19- 20 , 20 - 30 , 20 - 29 , 20 - 28 , 20 - 27 , 20 - 26 , 20 - 25 , 20 - 24 , subject. In certain embodiments , a decrease in the level of 20 - 23 , 20 - 22 , 20 - 21, 21 - 30 , 21 - 29 , 21 - 28 , 21 - 27 , 21 - 26 , expression or activity of the IGF - 1 signaling pathway indi 21 - 25 , 21- 24 , 21 - 23 , or 21 - 22 nucleotides in length , which cates that the IGF system - associated disease is being treated . region is substantially complementary to at least part of an [0106 ] In various embodiments , a surrogate marker of mRNA transcript of an IGFALS or IGF - 1 gene . IGF - 1 expression is measured . In certain embodiments , a [0113 ] In certain embodiments , the iRNAs of the inven change , preferably a clinically relevant change in the sur tion include an RNA strand ( the antisense strand ) which can rogate marker indicating effective treatment of diseases include longer lengths , for example up to 66 nucleotides , associated with an elevated IGF- level are detected , e. g ., e . g . , 36 - 66 , 26 - 36 , 25 - 36 , 31 -60 , 22 -43 , 27 - 53 nucleotides in decreased serum IGF. In the treatment of acromegaly , a length with a region of at least 19 contiguous nucleotides clinically relevant change in one or more signs or symptoms that is substantially complementary to at least a part of an associated with acromegaly as provided below can be used mRNA transcript of an IGFALS or an IGF- 1 gene . as a surrogate marker for a reduction in IGF - 1 expression . In 0114 ] In some embodiments , the iRNA agents for use in the treatment of cancer , a demonstration of stabilization or the methods of the invention include an RNA strand ( the US 2018 /0201929 A1 Jul. 19 , 2018 15 antisense strand ) which can be up to 66 nucleotides in example , the number of nucleotides in a nucleic acid mol length , e . g . , 36 -66 , 26 - 36 , 25 - 36 , 31 -60 , 22 -43 , 27 - 53 ecule must be an integer. For example , " at least 18 nucleo nucleotides in length , with a region of at least 19 contiguous tides of a 21 nucleotide nucleic acid molecule ” means that nucleotides that is substantially complementary to at least a 18 , 19 , 20 , or 21 nucleotides have the indicated property . part of an mRNA transcript of an IGFALS or an IGF - 1 gene . When at least is present before a series of numbers or a In some embodiments , such iRNA agents having longer range , it is understood that “ at least ” can modify each of the length antisense strands preferably include a second RNA numbers in the series or range. strand ( the sense strand ) of 20 -60 nucleotides in length [0123 ] As used herein , " no more than ” or “ less than ” is wherein the sense and antisense strands form a duplex of understood as the value adjacent to the phrase and logical 18 - 30 contiguous nucleotides . lower values or intergers , as logical from context , to zero . 0115 ] Using in vitro and in vivo assays , the present For example , a duplex with an overhang of “ no more than inventors have demonstrated that iRNAs targeting an 2 nucleotides” has a 2 , 1 , or 0 nucleotide overhang. When IGFALS gene or an or IGF - 1 gene can mediate RNAi, " no more than ” is present before a series of numbers or a resulting in significant inhibition of expression of IGFALS range , it is understood that “ no more than ” can modify each or IGF - 1 , as well as reducing signaling through the IGF - 1 of the numbers in the series or range . pathway which will decrease one or more of the symptoms associated with an IGF system - associated disease , such as [0124 ] As used herein , ranges include both the upper and acromegaly or cancer. Thus , methods and compositions lower limit. including these iRNAs are useful for treating a subject (0125 ] In the event of a conflict between a sequence and having an IGF system - associated disease , such as acro its indicated site on a transcript or other sequence, the megaly or cancer . The methods and compositions herein are nucleotide sequence recited in the specification takes pre useful for reducing the level of IGFALS or IGF - 1 in a cedence. subject, e . g ., serum or liver IGF- 1 in a subject, especially in [0126 ] Various embodiments of the invention can be com a subject with acromegaly or a tumor, such as an IGF- 1 bined as determined appropriate by one of skill in the art . expressing tumor . 01271 As used herein , “ insulin -like growth factor binding [0116 ] The following detailed description discloses how to protein , acid labile subunit” or “ IGFALS ” is a serum protein make and use compositions containing iRNAs to inhibit the that binds insulin - like growth factors, increasing their half expression of an IGFALS gene or an IGF gene as well as life and their vascular localization . Production of the compositions , uses, and methods for treating subjects having encoded protein , predominantly in the liver, which contains diseases and disorders that would benefit from reduction of twenty leucine -rich repeats , is stimulated by growth hor the expression of an IGFALS gene or an IGF gene . mone . Defects in this gene are a cause of acid - labile subunit deficiency, which manifests itself in delayed and slow I. Definitions puberty . Three transcript variants encoding two different [0117 ] In order that the present invention may be more isoforms have been found for this gene. The gene can also readily understood , certain terms are first defined . In addi be known as ALS or ACLSD . Further information on tion , it should be noted that whenever a value or range of IGFALS is provided , for example in the NCBI Gene data values of a parameter are recited , it is intended that values base at www .ncbi . nlm .nih . gov / gene /3483 ( which is incor and ranges intermediate to the recited values are also porated herein by reference as of the date of filing this intended to be part of this invention . application ). [0118 ] The articles “ a ” and “ an ” are used herein to refer to [0128 ] As used herein , " insulin - like growth factor binding one or to more than one (i . e . , to at least one ) of the protein , acid labile subunit , ” used interchangeably with the grammatical object of the article . By way of example , " an term “ IGFALS, ” refers to the naturally occurring gene that element ” means one element or more than one element, e . g . , encodes an IGF - 1 binding protein . The amino acid and a plurality of elements . complete coding sequences of the reference sequence of the [0119 ] The term “ including " is used herein to mean , and is human IGFALS gene may be found in , for example , Gen used interchangeably with , the phrase " including but not Bank Accession No . GI: 225579150 (RefSeq Accession No. limited to ” . NM _ 004970 . 2 ; SEQ ID NO : 1 ; SEQ ID NO : 2 ) , GenBank 10120 ] The term “ or ” is used herein to mean , and is used Accession No . GI:225579151 (RefSeq Accession No . interchangeably with , the term “ and/ or , " unless context NM _ 001146006 . 1 ; SEQ ID NO : 9 and 10 ) . Mammalian clearly indicates otherwise . For example , " sense strand or orthologs of the human IGFALS gene may be found in , for antisense strand ” is understood as " sense strand or antisense example , GI: 142388344 (RefSeq Accession No . strand or sense strand and antisense strand . ” NM _ 008340 . 3 , mouse ; SEQ ID NO : 3 and SEQ ID NO : 4 ) ; [0121 ] The term “ about is used herein to mean within the GI: 71896591 (RefSeq Accession No. NM _ 053329 . 2 , rat; typical ranges of tolerances in the art . For example , " about” SEQ ID NO : 5 and SEQ ID NO : 6 ) ; GenBank Accession Nos . can be understood as about 2 standard deviations from the GI:544514850 (RefSeq Accession No . XM _ 005590898 . 1 , mean . In certain embodiments , aboutmeans + 10 % . In certain cynomolgus monkey ; SEQ ID NO :7 and SEQ ID NO :8 ). embodiments , about means - 5 % . When about is present [0129 ] A number of naturally occurring SNPs are known before a series of numbers or a range , it is understood that and can be found , for example , in the SNP database at the “ about ” can modify each of the numbers in the series or NCBI at www . ncbi. nlm .nih . gov / SNP / snp _ ref. cgi ? lo range . cusId = 3483 (which is incorporated herein by reference as of [0122 ] The term “ at least” prior to a number or series of the date of filing this application ) which lists SNPs in human numbers is understood to include the number adjacent to the IGFALS . In preferred embodiments , such naturally occur term “ at least” , and all subsequent numbers or integers that ring variants are included within the scope of the IGFALS could logically be included , as clear from context. For gene sequence . US 2018 /0201929 A1 Jul. 19 , 2018 16

[0130 ] Additional examples of IGFALS mRNA sequences length . For example , the target sequence can be from about are readily available using publicly available databases, e . g . , 15 - 30 nucleotides, 15 - 29 , 15 - 28 , 15 - 27 , 15 -26 , 15 - 25 , GenBank , UniProt, and OMIM . 15 - 24 , 15 - 23 , 15 - 22 , 15 - 21, 15 - 20 , 15 - 19 , 15 - 18 , 15 - 17 , [0131 ] “ Insulin - like growth factor 1 ” or “ IGF- 1 " , also 18 - 30 , 18 -29 , 18 - 28 , 18 -27 , 18 - 26 , 18 - 25 , 18 - 24 , 18 - 23 , known as MGF, encodes a protein similar to insulin in 18 - 22 , 18 -21 , 18 - 20 , 19 - 30 , 19 - 29 , 19 - 28 , 19 - 27 , 19 - 26 , function and structure and is a member of a family of 19- 25, 19 - 24 , 19 - 23 , 19 - 22 , 19 -21 , 19 - 20 , 20 - 30 , 20 -29 , proteins involved in mediating growth and development. 20 - 28 , 20 - 27 , 20 - 26 , 20 - 25 , 20 - 24 , 20 - 23 , 20 - 22 , 20 - 21 , The encoded protein is processed from a precursor, bound by 21 -30 , 21- 29, 21 - 28 , 21- 27 , 21- 26 , 21 -25 , 21 -24 , 21 -23 , or a specific receptor, and secreted . Defects in this gene are a 21 -22 nucleotides in length . In some embodiments , the cause of insulin - like growth factor I deficiency . Alternative target sequence is about 19 to about 30 nucleotides in length . splicing results in multiple transcript variants encoding In other embodiments, the target sequence is about 19 to different isoforms that may undergo similar processing to about 25 nucleotides in length . In still other embodiments , generate mature protein . Further information on IGF - 1 is the target sequence is about 19 to about 23 nucleotides in provided , for example, in the NCBI Gene database at length . In some embodiments , the target sequence is about www .ncbi . nlm . nih . gov / gene / 3479 (which is incorporated 21 to about 23 nucleotides in length . Ranges and lengths herein by reference as of the date of filing this application ) . intermediate to the above recited ranges and lengths are also 10132 ] As used herein , “ insulin - like growth factor 1 ” is contemplated to be part of the invention . used interchangeably with the term “ IGF - 1 ” ( and optionally [0137 ] As used herein , the term “ strand comprising a any of the other recognized names listed above ) refers to the sequence ” refers to an oligonucleotide comprising a chain of naturally occurring gene that encodes an insulin - like growth nucleotides that is described by the sequence referred to factor 1 protein . The amino acid and complete coding using the standard nucleotide nomenclature . sequences of the reference sequence of the human IGF- 1 [ 0138 ] “ G ,” “ C ” “ A , ” “ T ,” and “ U ” each generally stand gene , transcript variant 1 , mRNA , may be found in , for for a nucleotide that contains guanine , cytosine, adenine , example , GenBank Accession No. GI: 930588898 (RefSeq thymidine , and uracil as a base , respectively . However, it Accession No. NM 001111283 . 2 ; SEQ ID NO : 11 ; SEQ ID will be understood that the term “ ribonucleotide " or NO : 12 ) ; human IGF - 1 gene , transcript variant 4 , mRNA , “ nucleotide ” can also refer to a modified nucleotide , as may be found at GenBank Accession No . GI: 930616505 further detailed below , or a surrogate replacement moiety (RefSeq Accession No. NM _ 000618 . 4 ; SEQ ID NO : 13 and ( see, e . g ., Table 2 ). The skilled person is well aware that SEQ ID NO : 14 ) ; and human IGF - 1 , transcript variant 2 , guanine , cytosine , adenine , and uracil can be replaced by mRNA , may be found at GenBank Accession No. GI: other moieties without substantially altering the base pairing 163659900 (RefSeq Accession No. NM _ 001111284 . 1 ; SEQ properties of an oligonucleotide comprising a nucleotide ID NO : 15 and 16 . Mammalian orthologs of the human bearing such replacement moiety . For example , without IGF - 1 gene may be found in , for example , GI: 930155588 limitation , a nucleotide comprising inosine as its base can (RefSeq Accession No . NM _ 010512 . 5 , mouseIGF - 1 ; SEQ base pair with nucleotides containing adenine, cytosine, or ID NO : 17 and SEQ ID NO : 18 ) ; GI: 126722710 (RefSeq uracil . Hence , nucleotides containing uracil , guanine , or Accession No. NM _ 001082478 . 1 , rat; SEQ ID NO : 19 and adenine can be replaced in the nucleotide sequences of SEQ ID NO :20 ) ; GenBank Accession Nos. GI: 544472486 dsRNA featured in the invention by a nucleotide containing, (RefSeq Accession No. XM _ 005572040 . 1 , cynomolgus for example , inosine . In another example , adenine and monkey ; SEQ ID NO : 21 and SEQ ID NO : 22 ) . Multiple cytosine anywhere in the oligonucleotide can be replaced sequence variants for each of the species are known . with guanine and uracil, respectively to form G - U Wobble [0133 ] A number of naturally occurring SNPs are known base pairing with the target mRNA . Sequences containing and can be found , for example , in the SNP database at the such replacement moieties are suitable for the compositions NCBI at www . ncbi. nlm . nih . gov /SNP / snp _ ref. cgi ? lo and methods featured in the invention . cusId = 3479 (which is incorporated herein by reference as of [0139 ] The terms “ RNA ,” “RNAi agent, ” and “ iRNA the date of filing this application ) which lists SNPs in human agent, ” “ RNA interference agent” as used interchangeably IGF - 1 . In preferred embodiments, such naturally occurring herein , refer to an agent that contains RNA as that term is variants are included within the scope of the IGF - 1 gene defined herein , and which mediates the targeted cleavage of sequence . an RNA transcript via an RNA - induced silencing complex [0134 ] Additional examples of IGF - 1 mRNA sequences (RISC ) pathway. iRNA directs the sequence - specific degra are readily available using publicly available databases, e . g ., dation of mRNA through a process known as RNA inter GenBank , UniProt, and OMIM . ference (RNAI ) . The iRNA modulates, e . g . , inhibits , the [0135 ] As used herein , “ target sequence ” refers to a con expression of the target gene, e. g ., an IGFALS gene or an tiguous portion of the nucleotide sequence of an mRNA IGF - 1 gene , in a cell, e . g . , a cell within a subject, such as a molecule formed during the transcription of an IGFALS mammalian subject. gene or an IGF - 1gene , including mRNA that is a product of [0140 ] In one embodiment, an RNAi agent of the inven RNA processing of a primary transcription product . The tion includes a single stranded RNAi that interacts with a target portion of the sequence will be at least long enough to target RNA sequence , e . g . , an IGFALS or IGF - 1 target serve as a substrate for iRNA - directed cleavage at or near mRNA sequence , to direct the cleavage of the target RNA . that portion of the nucleotide sequence of an mRNA mol Without wishing to be bound by theory it is believed that ecule formed during the transcription of an IGFALS gene or long double stranded RNA introduced into cells is broken an IGF - 1gene gene . In one embodiment, the target sequence down into double - stranded short interfering RNAs ( siRNAs ) is within the protein coding region of IGFALS or IGF- 1 . comprising a sense strand and an antisense strand by a Type [0136 ] The target sequence may be from about 9 - 36 III endonuclease known as Dicer (Sharp et al. (2001 ) Genes nucleotides in length , e. g ., about 15 - 30 nucleotides in Dev. 15 : 485 ). Dicer , a ribonuclease - III -like enzyme, pro US 2018 /0201929 A1 Jul. 19 , 2018 17 cesses these dsRNA into 19 - 23 base pair short interfering [0145 ] The duplex region may be of any length that RNAs with characteristic two base 3 ' overhangs (Bernstein , permits specific degradation of a desired target RNA through et al ., (2001 ) Nature 409 : 363) . These siRNAs are then a RISC pathway , and may range from about 9 to 36 base incorporated into an RNA - induced silencing complex pairs in length , e . g ., about 15 - 30 base pairs in length , for (RISC ) where one or more helicases unwind the siRNA example , about 9 , 10 , 11, 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , duplex , enabling the complementary antisense strand to 21, 22, 23, 24 , 25 , 26 , 27 , 28 , 29 , 30 , 31, 32, 33, 34 , 35 , or guide target recognition (Nykanen , et al. , ( 2001) Cell 107 : 36 base pairs in length , such as about 15 - 30 , 15 - 29 , 15 - 28 , 309) . Upon binding to the appropriate target mRNA , one or 15 - 27 , 15 - 26 , 15 - 25 , 15 - 24 , 15 - 23 , 15 - 22 , 15 - 21, 15 - 20 , more endonucleases within the RISC cleave the target to 15 - 19 , 15 - 18 , 15 - 17 , 18 - 30 , 18 - 29, 18 -28 , 18 - 27 , 18 - 26 , induce silencing (Elbashir , et al . , ( 2001) Genes Dev. 15 : 188 ) . 18 - 25 , 18 -24 , 18 - 23 , 18 -22 , 18 -21 , 18 - 20 , 19 - 30 , 19 - 29 , Thus , in one aspect the invention relates to a single stranded 19 - 28 , 19 - 27 , 19 - 26 , 19 - 25 , 19 - 24 , 19 - 23 , 19 - 22 , 19 - 21 , RNA ( SSRNA ) ( the antisense strand of an siRNA duplex ) 19 - 20 , 20 - 30 , 20 - 29 , 20 - 28 , 20 - 27 , 20 - 26 , 20 - 25 , 20 - 24 , generated within a cell and which promotes the formation of 20 - 23 , 20 -22 , 20 - 21, 21 -30 , 21 - 29 , 21 - 28 , 21- 27 , 21 - 26 , a RISC complex to effect silencing of the target gene , i. e ., an 21- 25 , 21 - 24 , 21- 23 , or 21 -22 base pairs in length . Ranges IGFALS or IGF- 1 gene. Accordingly , the term “ siRNA ” is and lengths intermediate to the above recited ranges and also used herein to refer to an RNAi as described above . lengths are also contemplated to be part of the invention . [0141 ] In another embodiment, the RNAi agent may be a [014 ] The two strands forming the duplex structure may single -stranded RNA that is introduced into a cell or organ - be different portions of one larger RNA molecule , or they ism to inhibit a targetmRNA . Single- stranded RNAi agents may be separate RNA molecules. Where the two strands are bind to the RISC endonuclease , Argonaute 2 , which then part of one larger molecule , and therefore are connected by cleaves the target mRNA . The single - stranded siRNAs are an uninterrupted chain of nucleotides between the 3 ' - end of generally 15 - 30 nucleotides and are chemically modified . one strand and the 5 ' - end of the respective other strand The design and testing of single -stranded RNAs are forming the duplex structure , the connecting RNA chain is described in U . S . Pat. No. 8 , 101 , 348 and in Lima et al. , referred to as a “ hairpin loop . ” A hairpin loop can comprise (2012 ) Cell 150 :883 - 894 , the entire contents of each of at least one unpaired nucleotide . In some embodiments , the which are hereby incorporated herein by reference. Any of hairpin loop can comprise at least 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , the antisense nucleotide sequences described herein may be 20 , 23 or more unpaired nucleotides . In some embodiments , used as a single - stranded siRNA as described herein or as the hairpin loop can be 10 or fewer nucleotides . In some chemically modified by the methods described in Lima et embodiments , the hairpin loop can be 8 or fewer unpaired al ., ( 2012 ) Cell 150: 883 - 894 . nucleotides. In some embodiments , the hairpin loop can be [0142 ] In certain embodiments , an “ iRNA ” for use in the 4 - 10 unpaired nucleotides . In some embodiments , the hair compositions , uses , and methods of the invention is a double pin loop can be 4 - 8 nucleotides . stranded RNA and is referred to herein as a “ double stranded [0147 ] Where the two substantially complementary RNAi agent, " " double stranded RNA ( dsRNA ) molecule, " strands of a dsRNA are comprised by separate RNA mol “ dsRNA agent, ” or “ dsRNA” . The term “ dsRNA ” , refers to ecules , those molecules need not, but can be covalently a complex of ribonucleic acid molecules , having a duplex connected . Where the two strands are connected covalently structure comprising two anti- parallel and substantially by means other than an uninterrupted chain of nucleotides complementary nucleic acid strands , referred to as having between the 3 ' - end of one strand and the 5 '- end of the “ sense ” and “ antisense ” orientations with respect to a target respective other strand forming the duplex structure , the RNA , i . e ., an IGFALS gene or an IGF - 1 gene . In some connecting structure is referred to as a “ linker. ” The RNA embodiments of the invention , a double stranded RNA strands may have the same or a different number of nucleo (dsRNA ) triggers the degradation of a target RNA , e . g . , an tides . The maximum number of base pairs is the number of mRNA , through a post- transcriptional gene -silencing nucleotides in the shortest strand of the dsRNA minus any mechanism referred to herein as RNA interference or RNAi. overhangs that are present in the duplex . In addition to the 10143 ] In general, the majority of nucleotides of each duplex structure , an RNAi may comprise one or more strand of a dsRNA molecule are ribonucleotides , but as nucleotide overhangs . In one embodiment of the RNAi described in detail herein , each or both strands can also agent, at least one strand comprises a 3 ' overhang of at least include one or more non - ribonucleotides , e . g . , a deoxyribo 1 nucleotide . In another embodiment, at least one strand nucleotide or a modified nucleotide . In addition , as used in comprises a 3 ' overhang of at least 2 nucleotides , e . g ., 2 , 3 , this specification , an “ iRNA ” may include ribonucleotides 4 , 5 , 6 , 7 , 9 , 10 , 11 , 12 , 13 , 14 , or 15 nucleotides . In other with chemical modifications ; an iRNA may include substan embodiments , at least one strand of the RNAi agent com tial modifications at multiple nucleotides . prises a 5 ' overhang of at least 1 nucleotide . In certain [0144 ] As used herein , the term “ modified nucleotide” embodiments , at least one strand comprises a 5 ' overhang of refers to a nucleotide having, independently , a modified at least 2 nucleotides, e . g . , 2 , 3 , 4 , 5 , 6 , 7 , 9 , 10 , 11, 12 , 13 , sugar moiety , a modified internucleotide linkage , or modi 14 , or 15 nucleotides . In still other embodiments , both the 3 fied nucleobase , or any combination thereof. Thus , the term and the 5 ' end of one strand of the RNAi agent comprise an modified nucleotide encompasses substitutions , additions or overhang of at least 1 nucleotide. removal of, e . g . , a functional group or atom , to internucleo [0148 ] In certain embodiments , an iRNA agent of the side linkages , sugar moieties, or nucleobases. The modifi invention is a dsRNA , each strand of which comprises 19 - 23 cations suitable for use in the agents of the invention include nucleotides , that interacts with a target RNA sequence , e . g . , all types of modifications disclosed herein or known in the an IGFALS gene or an IGF - 1 gene . Without wishing to be art . Any such modifications , as used in a siRNA type bound by theory , long double stranded RNA introduced into molecule, are encompassed by “ iRNA ” or “ RNAi agent" for cells is broken down into siRNA by a Type III endonuclease the purposes of this specification and claims. known as Dicer ( Sharp et al. (2001 ) Genes Dev. 15 :485 ). US 2018 /0201929 A1 Jul. 19, 2018

Dicer, a ribonuclease - III - like enzyme, processes the dsRNA 1 -30 nucleotides, 2 -30 nucleotides , 10 -30 nucleotides , or into 19 -23 base pair short interfering RNAs with character 10 - 15 nucleotides in length . In certain embodiments , an istic two base 3 ' overhangs ( Bernstein , et al ., (2001 ) Nature extended overhang is on the sense strand of the duplex . In 409 : 363 ) . The siRNAs are then incorporated into an RNA certain embodiments , an extended overhang is present on induced silencing complex (RISC ) where one or more the 3 'end of the sense strand of the duplex . In certain helicases unwind the siRNA duplex , enabling the comple embodiments, an extended overhang is present on the 5 'end mentary antisense strand to guide target recognition (Ny of the sense strand of the duplex . In certain embodiments, an kanen , et al. , ( 2001 ) Cell 107 :309 ) . Upon binding to the extended overhang is on the antisense strand of the duplex . appropriate target mRNA, one or more endonucleases In certain embodiments , an extended overhang is present on within the RISC cleave the target to induce silencing ( El the 3 'end of the antisense strand of the duplex . In certain bashir , et al. , ( 2001) Genes Dev. 15: 188 ) . embodiments , an extended overhang is present on the 5' end [0149 ] In some embodiments , an iRNA of the invention is of the antisense strand of the duplex . In certain embodi a dsRNA of 24 -30 nucleotides, or possibly even longer , e .g ., ments , one or more of the nucleotides in the overhang is 25 - 35 , 27 - 53 , or 27 - 49 nucleotides , that interacts with a replaced with a nucleoside thiophosphate . target RNA sequence , e . g ., an IGFALS target mRNA 0152 ] “ Blunt” or “ blunt end ” means that there are no sequence or an IGF - 1 target mRNA sequence , to direct the unpaired nucleotides at that end of the double stranded cleavage of the target RNA . Without wishing to be bound by RNAi agent, i .e . , no nucleotide overhang. A “ blunt ended ” theory , long double stranded RNA introduced into cells is double stranded RNAi agent is double stranded over its broken down into siRNA by a Type III endonuclease known entire length , i. e ., no nucleotide overhang at either end of the as Dicer ( Sharp et al. ( 2001 ) Genes Dev. 15 :485 ) . Dicer , a molecule . The RNAi agents of the invention include RNAi ribonuclease- III - like enzyme, processes the dsRNA into agents with no nucleotide overhang at one end ( i. e ., agents 19 - 23 base pair short interfering RNAs with characteristic with one overhang and one blunt end ) or with no nucleotide two base 3' overhangs (Bernstein , et al ., ( 2001) Nature overhangs at either end. 409: 363 ) . The siRNAs are then incorporated into an RNA [0153 ] The term “ antisense strand ” or “ guide strand” induced silencing complex (RISC ) where one or more refers to the strand of an iRNA , e .g ., a dsRNA , which helicases unwind the siRNA duplex , enabling the comple includes a region that is substantially complementary to a mentary antisense strand to guide target recognition (Ny target sequence , e . g ., an IGFALS or IGF - 1 mRNA . As used kanen , et al. , (2001 ) Cell 107 : 309 ) . Upon binding to the herein , the term “ region of complementarity ” refers to the appropriate target mRNA , one or more endonucleases region on the antisense strand that is substantially comple within the RISC cleave the target to induce silencing ( El mentary to a sequence, for example a target sequence , e . g ., bashir, et al. , ( 2001) Genes Dev. 15 : 188 ) . an IGFALS or IGF- 1 nucleotide sequence , as defined herein . [0150 ] As used herein , the term “ nucleotide overhang ” Where the region of complementarity is not fully comple refers to at least one unpaired nucleotide that protrudes from mentary to the target sequence, themismatches can be in the the duplex structure of a double stranded iRNA . For internal or terminal regions of the molecule . Generally , the example , when a 3 ' - end of one strand of a dsRNA extends most tolerated mismatches are in the terminal regions , e . g . , beyond the 5 ' - end of the other strand , or vice versa , there is within 5 , 4 , 3 , 2 , or 1 nucleotides of the 5 '- or 3 ' -end of the a nucleotide overhang . A dsRNA can comprise an overhang iRNA. In some embodiments , a double stranded RNAiagent of at least one nucleotide ; alternatively the overhang can of the invention includes a nucleotide mismatch in the comprise at least two nucleotides, at least three nucleotides , antisense strand . In some embodiments , a double stranded at least four nucleotides , at least five nucleotides or more . A RNAi agent of the invention includes a nucleotide mismatch nucleotide overhang can comprise or consist of a nucleotide ! in the sense strand . In some embodiments , the nucleotide nucleoside analog , including a deoxynucleotide /nucleoside . mismatch is , for example , within 5 , 4 , 3 , 2 , or 1 nucleotides The overhang ( s ) can be on the sense strand , the antisense from the 3 '- end of the iRNA . In another embodiment, the strand , or any combination thereof. Furthermore , the nucleo nucleotide mismatch is , for example , in the 3 ' - terminal tide ( s ) of an overhang can be present on the 5 ' - end , 3 ' - end , nucleotide of the iRNA. or both ends of either an antisense or sense strand of a dsRNA . In one embodiment of the dsRNA , at least one 10154 ] The term " sense strand ” or “ passenger strand ” as strand comprises a 3 ' overhang of at least 1 nucleotide . In used herein , refers to the strand of an iRNA that includes a another embodiment, at least one strand comprises a 3 ' region that is substantially complementary to a region of the overhang of at least 2 nucleotides , e . g . , 2 , 3 , 4 , 5 , 6 , 7 , 9 , 10 , antisense strand as that term is defined herein . 11, 12 , 13, 14 , or 15 nucleotides. In other embodiments , at [0155 ] As used herein , “ substantially all of the nucleotides least one strand of the RNAi agent comprises a 5 ' overhang are modified ” are largely but not wholly modified and can of at least 1 nucleotide . In certain embodiments , at least one include not more than 5 , 4 , 3 , 2 , or 1 unmodified nucleotides. strand comprises a 5 ' overhang of at least 2 nucleotides , e . g ., [ 0156 ] As used herein , the term “ cleavage region ” refers to 2 , 3 , 4 , 5 , 6 , 7 , 9 , 10 , 11, 12 , 13 , 14 , or 15 nucleotides. In still a region that is located immediately adjacent to the cleavage other embodiments , both the 3 ' and the 5 ' end of one strand site . The cleavage site is the site on the target at which of the RNAi agent comprise an overhang of at least 1 cleavage occurs. In some embodiments , the cleavage region nucleotide . comprises three bases on either end of, and immediately 10151] In certain embodiments , the antisense strand of a adjacent to , the cleavage site . In some embodiments , the dsRNA has a 1 - 10 nucleotide , e . g ., 0 - 3 , 1 - 3 , 2 - 4 , 2 - 5 , 4 - 10 , cleavage region comprises two bases on either end of, and 5 - 10 , 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , or 10 nucleotide , overhang at immediately adjacent to , the cleavage site . In some embodi the 3 '- end or the 5 '- end . In certain embodiments , the over ments , the cleavage site specifically occurs at the site bound hang on the sense strand or the antisense strand , or both , can by nucleotides 10 and 11 of the antisense strand , and the include extended lengths longer than 10 nucleotides , e . g . , cleavage region comprises nucleotides 11 , 12 and 13 . US 2018 /0201929 A1 Jul. 19 , 2018

[0157 ] As used herein , and unless otherwise indicated , the interest ( e . g ., an mRNA encoding an IGFALS gene or an term “ complementary, " when used to describe a first nucleo IGF - 1 gene ). For example , a polynucleotide is complemen tide sequence in relation to a second nucleotide sequence , tary to at least a part of an IGFALS or IGF - 1 mRNA if the refers to the ability of an oligonucleotide or polynucleotide sequence is substantially complementary to a non - inter comprising the first nucleotide sequence to hybridize and rupted portion of an mRNA encoding an IGFALS or IGF- 1 form a duplex structure under certain conditions with an gene . oligonucleotide or polynucleotide comprising the second [0162 ] Accordingly , in some embodiments , the sense nucleotide sequence , as will be understood by the skilled strand polynucleotides and the antisense polynucleotides person . Such conditions can , for example , be stringent disclosed herein are fully complementary to the target conditions , where stringent conditions can include : 400 mM IGFALS or IGF- 1 sequence . NaCl, 40 mM PIPES pH 6 . 4 , 1 mM EDTA , 50° C . or 70° C . [0163 ] In one embodiment, the antisense polynucleotides for 12 - 16 hours followed by washing ( see , e . g . , “ Molecular disclosed herein are fully complementary to the target Cloning: A Laboratory Manual, Sambrook , et al . ( 1989 ) IGFALS sequence . In other embodiments , the antisense Cold Spring Harbor Laboratory Press ). Other conditions, polynucleotides disclosed herein are substantially comple such as physiologically relevant conditions as can be mentary to the target IGFALS sequence and comprise a encountered inside an organism , can apply . The skilled contiguous nucleotide sequence which is at least about 80 % person will be able to determine the set of conditions most complementary over its entire length to the equivalent appropriate for a test of complementarity of two sequences region of the nucleotide sequence of any one of SEQ ID in accordance with the ultimate application of the hybridized NOs: 1 , 3 , 5 , 7 , or 9 , or a fragment of any one of SEO ID nucleotides . NOs : 1 , 3 , 5 , 7 , or 9 , such as about 85 % , about 86 % , about 10158 ] Complementary sequences within an iRNA , e . g ., 87 % , about 88 % , about 89 % , about 90 % , about % 91 % , within a dsRNA as described herein , include base -pairing of about 92 % , about 93 % , about 94 % , about 95 % , about 96 % , the oligonucleotide or polynucleotide comprising a first about 97 % , about 98 % , or about 99 % complementary . nucleotide sequence to an oligonucleotide or polynucleotide [0164 ] In other embodiments , the antisense polynucle comprising a second nucleotide sequence over the entire otides disclosed herein are substantially complementary to length of one or both nucleotide sequences . Such sequences the target IGFALS sequence and comprise a contiguous can be referred to as “ fully complementary ” with respect to nucleotide sequence which is at least about 80 % comple each other herein . However , where a first sequence is mentary over its entire length to any one of the sense strand referred to as “ substantially complementary ” with respect to nucleotide sequences in any one of Tables 3 , 5 , 6 , 8 , 12 , or a second sequence herein , the two sequences can be fully 14 , or a fragment of any one of the sense strand nucleotide complementary , or they can form one or more, but generally sequences in any one of Tables 3 , 5 , 6 , 8 , 12 , or 14 , such as not more than 5 , 4 , 3 , or 2 mismatched base pairs upon about 85 % , about 86 % , about 87 % , about 88 % , about 89 % , hybridization for a duplex up to 30 base pairs, while about 90 % , about % 91 % , about 92 % , about 93 % , about retaining the ability to hybridize under the conditions most 94 % , about 95 % , about 96 % , about 97 % , about 98 % , or relevant to their ultimate application , e . g ., inhibition of gene about 99 % complementary . expression via a RISC pathway . However , where two oli 10165 ]. In one embodiment, an RNAi agent of the inven gonucleotides are designed to form , upon hybridization , one tion includes a sense strand that is substantially complemen or more single stranded overhangs, such overhangs shall not tary to an antisense polynucleotide which , in turn , is comple be regarded as mismatches with regard to the determination mentary to a target IGFALS sequence and comprises a of complementarity . For example , a dsRNA comprising one contiguous nucleotide sequence which is at least about 80 % oligonucleotide 21 nucleotides in length and another oligo complementary over its entire length to any one of the sense nucleotide 23 nucleotides in length , wherein the longer strand nucleotide sequences in any one of Tables 3 , 5 , 6 , 8 , oligonucleotide comprises a sequence of 21 nucleotides that 12 , or 14 , or a fragment of any one of the sense strand is fully complementary to the shorter oligonucleotide , can nucleotide sequences in any one of Tables 3 , 5 , 6 , 8 , 12 , or yet be referred to as “ fully complementary ” for the purposes 14 , such as about 85 % , about 86 % , about 87 % , about 88 % , described herein . about 89 % , about 90 % , about % 91 % , about 92 % , about [0159 ] " Complementary ” sequences, as used herein , can 93 % , about 94 % , about 95 % , about 96 % , about 97 % , about also include, or be formed entirely from , non - Watson - Crick 98 % , or about 99 % complementary . base pairs or base pairs formed from non -natural and modi [0166 ] In one embodiment, the antisense polynucleotides fied nucleotides , in so far as the above requirements with disclosed herein are fully complementary to the target IGF- 1 respect to their ability to hybridize are fulfilled . Such non sequence . In other embodiments , the antisense polynucle Watson -Crick base pairs include , but are not limited to , G : U otides disclosed herein are substantially complementary to Wobble or Hoogstein base pairing . the target IGF - 1 sequence and comprise a contiguous [0160 ] The terms " complementary, " " fully complemen nucleotide sequence which is at least about 80 % comple tary ” and “ substantially complementary ” herein can be used mentary over its entire length to the equivalent region of the with respect to the base matching between the sense strand nucleotide sequence of any one of SEQ ID NOs: 11 , 13 , 15 , and the antisense strand of a dsRNA , or between the 17 , 19 , or 21 , or a fragment of any one of SEQ ID NOs: 11 , antisense strand of a double stranded RNAi agent and a 13 , 15 , 17 , 19 , or 21 , such as about 85 % , about 86 % , about target sequence , as will be understood from the context of 87 % , about 88 % , about 89 % , about 90 % , about % 91 % , their use . about 92 % , about 93 % , about 94 % , about 95 % , about 96 % , [0161 ] As used herein , a polynucleotide that is “ substan about 97 % , about 98 % , or about 99 % complementary . tially complementary to at least part of" a messenger RNA [0167 ] In other embodiments , the antisense polynucle (mRNA ) refers to a polynucleotide that is substantially otides disclosed herein are substantially complementary to complementary to a contiguous portion of the mRNA of the target IGF- 1 sequence and comprise a contiguous US 2018 /0201929 A1 Jul. 19 , 2018 20 nucleotide sequence which is at least about 80 % comple - the cell” by facilitating or effecting uptake or absorption into mentary over its entire length to any one of the sense strand the cell . Absorption or uptake of an iRNA can occur through nucleotide sequences in any one of Tables 9 , 11 , 15 , 17 , 18 , unaided diffusion or active cellular processes , or by auxiliary or 20 , or a fragment of any one of the sense strand nucleotide agents or devices. Introducing an iRNA into a cell may be sequences in any one of Tables 9 , 11 , 15 , 17 , 18 , or 20 , such in vitro or in vivo . For example , for in vivo introduction , as about 85 % , about 86 % , about 87 % , about 88 % , about iRNA can be injected into a tissue site or administered 89 % , about 90 % , about % 91 % , about 92 % , about 93 % , systemically . In vivo delivery can also be done by a beta about 94 % , about 95 % , about 96 % , about 97 % , about 98 % , glucan delivery system , such as those described in U . S . Pat. or about 99 % complementary . Nos . 5 , 032 , 401 and 5 ,607 ,677 , and US Publication No . [0168 ] In one embodiment , an RNAi agent of the inven 2005 / 0281781 , the entire contents of which are hereby tion includes a sense strand that is substantially complemen incorporated herein by reference . In vitro introduction into tary to an antisense polynucleotide which , in turn , is comple a cell includes methods known in the art such as electropo mentary to a target IGF - 1 sequence and comprises a ration and lipofection . Further approaches are described contiguous nucleotide sequence which is at least about 80 % herein below or are known in the art. complementary over its entire length to any one of the sense [0173 ] The term “ lipid nanoparticle ” or “ LNP” is a vesicle strand nucleotide sequences in any one of Tables 9 , 11 , 15 , comprising a lipid layer encapsulating a pharmaceutically 17 , 18 , or 20 , or a fragment of any one of the sense strand active molecule , such as a nucleic acid molecule , e . g ., an nucleotide sequences in any one of Tables 9 , 11 , 15 , 17 , 18 , iRNA or a plasmid from which an iRNA is transcribed . or 20 , such as about 85 % , about 86 % , about 87 % , about LNPs are described in , for example , U . S . Pat. Nos . 6 , 858 , 88 % , about 89 % , about 90 % , about % 91 % , about 92 % , 225 , 6 ,815 ,432 , 8 , 158 ,601 , and 8 ,058 ,069 , the entire con about 93 % , about 94 % , about 95 % , about 96 % , about 97 % , tents of which are hereby incorporated herein by reference . about 98 % , or about 99 % complementary . 10174 ] As used herein , a “ subject” is an animal, such as a 10169 ] In an aspect of the invention , an agent for use in the mammal, including a primate ( such as a human , a non methods and compositions of the invention is a single human primate , e . g . , a monkey, and a chimpanzee ) , a stranded antisense oligonucleotide molecule that inhibits a non - primate ( such as a cow , a pig , a camel, a llama , a horse , target mRNA via an antisense inhibition mechanism . The a goat, a rabbit , a sheep , a hamster, a guinea pig , a cat, a dog , single - stranded antisense oligonucleotide molecule is a rat , a mouse , a horse , and a whale ) , or a bird ( e . g . , a duck complementary to a sequence within the target mRNA . The or a goose ) that expresses the target gene , either endog single -stranded antisense oligonucleotides can inhibit trans enously or heterologously. It is understood that the sequence lation in a stoichiometric manner by base pairing to the of the PHD gene must be sufficiently complementary to the mRNA and physically obstructing the translation machinery , antisense strand of the iRNA agent for the agent to be used see Dias , N . et al. , ( 2002 ) Mol Cancer Ther 1 :347 - 355 . The in the indicated species . In certain embodiments , the subject single - stranded antisense oligonucleotide molecule may be is a human , such as a human being treated or assessed for a about 14 to about 30 nucleotides in length and have a disease , disorder or condition that would benefit from reduc sequence that is complementary to a target sequence . For tion in an IGFALS gene or an IGF - 1 gene expression or example , the single - stranded antisense oligonucleotide mol replication ; a human at risk for a disease , disorder or ecule may comprise a sequence that is at least 14 , 15 , 16 , 17 , condition that would benefit from reduction in IGFALS or 18 , 19 , 20 , or more contiguous nucleotides from any one of IGF - 1 gene expression ; a human having a disease , disorder the antisense sequences described herein . or condition that would benefit from reduction in IGFALS or [0170 ] The phrase " contacting a cell with an iRNA , ” such IGF - 1 gene expression ; or human being treated for a disease , as a dsRNA , as used herein , includes contacting a cell by any disorder or condition that would benefit from reduction in possible means. Contacting a cell with an iRNA includes IGFALS or IGF - 1 gene expression , as described herein . In contacting a cell in vitro with the iRNA or contacting a cell some embodiments , the subject is a female human . In other in vivo with the iRNA . The contacting may be done directly embodiments , the subject is a male human . or indirectly . Thus, for example , the iRNA may be put into [0175 ] As used herein , the terms “ treating " or " treatment" physical contact with the cell by the individual performing refer to a beneficial or desired result including, but not the method , or alternatively , the iRNA may be put into a limited to , alleviation or amelioration of one or more symp situation that will permit or cause it to subsequently come toms associated with IGFALS or IGF - 1 gene expression or into contact with the cell . IGFALS or IGF - 1 protein production , e . g ., acromegaly , [0171 ] Contacting a cell in vitro may be done, for cancer . “ Treatment" can also mean prolonging survival as example , by incubating the cell with the iRNA . Contacting compared to expected survival in the absence of treatment . a cell in vivo may be done , for example , by injecting the 101761. The term “ lower” or “ reduce ” in the context of the iRNA into or near the tissue where the cell is located , or by level of IGFALS or IGF - 1 gene expression or IGFALS or injecting the iRNA into another area , e . g . , the bloodstream IGF - 1 protein production in a subject, or a disease marker or or the subcutaneous space , such that the agent will subse symptom refers to a statistically significant decrease in such quently reach the tissue where the cell to be contacted is level. The decrease can be , for example , at least 30 % , 35 % , located . For example , the iRNA may contain or be coupled 40 % , 45 % , 50 % , 55 % , 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , to a ligand , e . g . , GalNAc3 , that directs the iRNA to a site of 90 % , or 95 % , or below the level of detection for the interest, e . g ., the liver. Combinations of in vitro and in vivo detection method . In certain embodiments , the decrease is methods of contacting are also possible . For example , a cell down to a level accepted as within the range of normal for may also be contacted in vitro with an iRNA and subse an individual without such disorder which can also be quently transplanted into a subject. referred to as a normalization of a level. For example , 10172 ] In certain embodiments , contacting a cell with an lowering cholesterol to 180 mg /dl or lower would be con iRNA includes “ introducing ” or “ delivering the iRNA into sidered to be within the range of normal for a subject. A US 2018 /0201929 A1 Jul. 19 , 2018 subject having a cholesterol level of 230 mg/ dl with a [0181 ] “ Prophylactically effective amount, " as used cholesterol level decreased to 210 mg/ dl would have a herein , is intended to include the amount of an iRNA that, cholesterol level that was decreased by 40 % ( 230 - 210 / 230 when administered to a subject who does not yet experience 180 = 20 / 50 = 40 % reduction ). In certain embodiments , the or display symptoms of acromealgy , cancer, or other IGF reduction is the normalization of the level of a sign or system - associated disease - associated diseases , but who may symptom of a disease , a reduction in the difference between be predisposed to an IGF system - associated disease - associ the subject level of a sign of the disease and the normal level ated disease, is sufficient to prevent or delay the develop of the sign for the disease ( e . g . , the upper level of normal ment or progression of the disease or one or more symptoms when the level must be reduced to reach a normal level, and of the disease for a clinically significant period of time . The the lower level of normal when the level must be increased “ prophylactically effective amount” may vary depending on to reach a normal level) . In certain embodiments , the meth the iRNA , how it is administered , the degree of risk of ods include a clinically relevant inhibition of expression of disease , and the history , age, weight, family history, genetic IGFALS or IGF- 1 , e . g . as demonstrated by a clinically makeup , the types of preceding or concomitant treatments , relevant outcome after treatment of a subject with an agent if any , and other individual characteristics of the patient to to reduce the expression of IGFALS or IGF - 1 . be treated . [ 0177 ] As used herein , " prevention " or " preventing, " [0182 ] A " therapeutically - effective amount ” or “ prophy when used in reference to a disease , disorder or condition lacticaly effective amount" also includes an amount of an thereof, that would benefit from a reduction in expression of iRNA that produces some desired local or systemic effect at an IGFALS gene or an IGF - 1 gene or production of an IGFALS or an IGF - 1 protein , refers to a reduction in the a reasonable benefit/ risk ratio applicable to any treatment. likelihood that a subject will develop a symptom associated iRNAs employed in the methods of the present invention with such a disease , disorder, or condition , e . g ., a symptom may be administered in a sufficient amount to produce a of IGFALS or IGF - 1 gene expression , such as the presence reasonable benefit/ risk ratio applicable to such treatment. of elevated levels of proteins in the IGF signaling pathway, [0183 ] The phrase " pharmaceutically acceptable ” is e . g ., acromegaly or cancer . The failure to develop a disease, employed herein to refer to those compounds , materials , disorder or condition , or the reduction in the development of compositions, or dosage forms which are , within the scope a symptom or comorbidity associated with such a disease , of sound medical judgment, suitable for use in contact with disorder or condition ( e . g ., by at least about 10 % on a the tissues of human subjects and animal subjects without clinically accepted scale for that disease or disorder ) , or the excessive toxicity , irritation , allergic response, or other exhibition of delayed symptoms or disease progression ( e .g ., problem or complication , commensurate with a reasonable delayed cancer progression as determined using RECIST benefit /risk ratio . criteria ) by days, weeks, months or years is considered [0184 ] The phrase " pharmaceutically - acceptable carrier " effective prevention . Prevention may require the adminis as used herein means a pharmaceutically -acceptable mate tration of more than one dose . rial, composition , or vehicle , such as a liquid or solid filler , [0178 ] As used herein , the term “ IGF system - associated diluent, excipient, manufacturing aid ( e . g ., lubricant, talc disease , ” used interchangeable with the terms “ insulin - like magnesium , calcium or zinc stearate , or steric acid ) , or growth factor binding protein , acid labile subunit - associated solvent encapsulating material, involved in carrying or disease, ” “ IGFALS - associated disease , " " IGF - associated transporting the subject compound from one organ , or disease , ” or “ IGF - 1 -associated disease ” is a disease or portion of the body , to another organ , or portion of the body . disorder that is caused by, or associated with IGFALS or IGF Each carrier must be “ acceptable ” in the sense of being gene expression or IGFALS or IGF protein production . The compatible with the other ingredients of the formulation and term “ IGF system -associated disease " includes a disease , not injurious to the subject being treated . Some examples of disorder or condition that would benefit from a decrease in materials which can serve as pharmaceutically -acceptable IGFALS or IGF- 1 gene expression , replication , or protein carriers include: ( 1 ) sugars , such as lactose , glucose and activity . Non -limiting examples of IGF system - associated sucrose ; ( 2 ) starches , such as corn starch and potato starch ; diseases include , for example , acromegaly, gigantism , and ( 3 ) cellulose , and its derivatives, such as sodium carboxym cancer, especially metastatic cancer. ethyl cellulose , ethyl cellulose and cellulose acetate ; ( 4 ) [ 0179 ] In certain embodiments , an IGF system -associated powdered tragacanth ; ( 5 ) malt ; ( 6 ) gelatin ; ( 7 ) lubricating disease -associated disease is acromegaly . agents , such as magnesium state , sodium lauryl sulfate and [0180 ] “ Therapeutically effective amount, ” as used herein , talc ; ( 8 ) excipients , such as cocoa butter and suppository is intended to include the amount of an iRNA that, when waxes; ( 9 ) oils , such as peanut oil, cottonseed oil, safflower administered to a patient for treating a subject having oil , sesame oil, olive oil , corn oil and soybean oil; ( 10 ) acromealgy, cancer , or IGF system - associated disease , is glycols , such as propylene glycol ; (11 ) polyols , such as sufficient to effect treatment of the disease ( e . g . , by dimin glycerin , sorbitol, mannitol and polyethylene glycol; ( 12 ) ishing , ameliorating or maintaining the existing disease or esters, such as ethyl oleate and ethyl laurate ; ( 13 ) agar; ( 14 ) one or more symptoms of disease or its related comorbidi buffering agents , such as magnesium hydroxide and alumi ties ) . The " therapeutically effective amount" may vary num hydroxide ; ( 15 ) alginic acid ; ( 16 ) pyrogen - free water ; depending on the iRNA , how it is administered , the disease ( 17 ) isotonic saline ; ( 18 ) Ringer ' s solution ; (19 ) ethyl alco and its severity and the history, age, weight, family history, hol; ( 20 ) pH buffered solutions ; ( 21) polyesters , polycar genetic makeup , stage of pathological processes mediated bonates and / or polyanhydrides; ( 22 ) bulking agents , such as by IGFALS or IGF - 1 gene expression , the types of preced polypeptides and amino acids (23 ) serum component, such ing or concomitant treatments , if any , and other individual as serum albumin , HDL and LDL ; and (22 ) other non -toxic characteristics of the patient to be treated . Treatment may compatible substances employed in pharmaceutical formu require the administration of more than one dose . lations . US 2018 /0201929 A1 Jul. 19 , 2018

[ 0185 ] The term “ sample ," as used herein , includes a region that is complementary to the antisense strand , such collection of similar fluids, cells , or tissues isolated from a that the two strands hybridize and form a duplex structure subject, as well as fluids , cells , or tissues present within a when combined under suitable conditions . As described subject . Examples of biological fluids include blood , serum elsewhere herein and as known in the art , the complemen and serosal fluids, plasma, cerebrospinal fluid , ocular fluids, tary sequences of a dsRNA can also be contained as self lymph , urine, saliva , and the like . Tissue samples may complementary regions of a single nucleic acid molecule , as include samples from tissues, organs, or localized regions . opposed to being on separate oligonucleotides. For example, samples may be derived from particular [0188 ] Generally , the duplex structure is about 15 to 30 organs, parts of organs, or fluids or cells within those organs. base pairs in length , e . g ., 15 - 29 , 15 - 28 , 15 - 27 , 15 - 26 , 15 - 25 , In certain embodiments , samples may be derived from the 15 - 24 , 15 - 23 , 15 - 22 , 15 - 21 , 15 - 20 , 15 - 19, 15 - 18 , 15 - 17 , liver ( e . g . , whole liver or certain segments of liver or certain 18 - 30 , 18 - 29 , 18 -28 , 18 - 27 , 18 - 26 , 18 -25 , 18 - 24 , 18 - 23 , types of cells in the liver , such as, e . g ., hepatocytes ) . A 18 - 22 , 18 - 21 , 18 -20 , 19 -30 , 19 - 29, 19 -28 , 19 - 27 , 19 - 26 , “ sample derived from a subject" can refer to blood drawn 19 - 25 , 19 -24 , 19 - 23 , 19 - 22 , 19 - 21 , 19 - 20 , 20 - 30 , 20 - 29 , from the subject , or plasma derived therefrom . In certain 20 - 28 , 20 -27 , 20 -26 , 20 -25 , 20 -24 , 20 -23 , 20 -22 , 20 -21 , embodiments when detecting a level of IGF - 1 , a " sample ” 21 - 30 , 21 - 29 , 21 - 28 , 21 - 27 , 21 - 26 , 21 - 25 , 21 - 24 , 21 -23 , or preferably refers to a tissue or body fluid from a subject in 21 -22 base pairs in length . Ranges and lengths intermediate which IGF - 1 is detectable prior to administration of an agent to the above recited ranges and lengths are also contem of the invention , e . g ., a liver biopsy from a subject with a plated to be part of the invention . acromegaly , a tumor. In certain subjects , e. g ., healthy sub [0189 ] Similarly , the region of complementarity to the jects , the level of IGF- 1 may not be detectable in a number target sequence is about 15 to 30 nucleotides in length , e . g . , of body fluids, cell types, and tissues. 15 - 29 , 15 -28 , 15 - 27 , 15 - 26 , 15 - 25 , 15 - 24 , 15 - 23 , 15 - 22 , 15 - 21, 15 - 20 , 15 - 19 , 15 - 18 , 15 - 17 , 18 -30 , 18 - 29 , 18 - 28 , I. iRNAs of the Invention 18 - 27 , 18 - 26 , 18 - 25 , 18 - 24 , 18 - 23 , 18 - 22 , 18 - 21 , 18 - 20 , [0186 ] The present invention provides iRNAs which 19 - 30 , 19 - 29 , 19 - 28 , 19 - 27 , 19 - 26 , 19 -25 , 19 - 24 , 19 - 23 , inhibit the expression of an IGFALS gene or an IGF - 1 gene . 19 - 22 , 19 - 21, 19 - 20 , 20 -30 , 20 - 29, 20 -28 , 20 - 27 , 20 - 26 , In preferred embodiments , the iRNA includes double 20 - 25 , 20 - 24 , 20 - 23 , 20 - 22 , 20 -21 , 21 - 30 , 21 - 29 , 21 - 28 , stranded ribonucleic acid (dsRNA ) molecules for inhibiting 21- 27 , 21 -26 , 21- 25 , 21 -24 , 21- 23 , or 21- 22 nucleotides in the expression of an IGFALS gene or an IGF - 1 gene in a length . Ranges and lengths intermediate to the above recited cell, such as a cell within a subject , e . g ., a mammal, such as ranges and lengths are also contemplated to be part of the a human having an IGF system -associated disease -associ invention . ated disease , e . g ., acromeagly. The dsRNAi agent includes [0190 ] In some embodiments , the dsRNA is about 15 to 23 an antisense strand having a region of complementarity nucleotides in length , or about 25 to 30 nucleotides in length . which is complementary to at least a part of an mRNA In general, the dsRNA is long enough to serve as a substrate formed in the expression of an IGFALS gene or an IGF - 1 for the Dicer enzyme. For example, it is well -known in the gene . The region of complementarity is about 30 nucleotides art that dsRNAs longer than about 21 - 23 nucleotides in or less in length ( e . g . , about 30 , 29 , 28 , 27 , 26 , 25 , 24 , 23 , length may serve as substrates for Dicer. As the ordinarily 22 , 21, 20 , 19 , or 18 nucleotides or less in length ) . Upon skilled person will also recognize , the region of an RNA contact with a cell expressing the IGFALS gene or the IGF - 1 targeted for cleavage will most often be part of a larger RNA gene , the iRNA inhibits the expression of the IGFALS gene molecule , often an mRNA molecule . Where relevant, a or the IGF- 1 gene ( e . g ., a human , a primate, a non - primate , " part ” of an mRNA target is a contiguous sequence of an or a bird IGFALS gene or IGF- 1 gene ) by at least 20 % , mRNA target of sufficient length to allow it to be a substrate preferably at least 30 % , as assayed by, for example, a PCR for RNAi- directed cleavage (i .e ., cleavage through a RISC or branched DNA (BDNA ) -based method , or by a protein pathway ) . based method , such as by immunofluorescence analysis , f0191 ] One of skill in the art will also recognize that the using , for example , western blotting or flowcytometric tech duplex region is a primary functional portion of a dsRNA , niques . In preferred embodiments , inhibition of expression e . g ., a duplex region of about 9 to about 36 base pairs , e . g . , is determined by the qPCR method provided in the 10 - 36 , 11 -36 , 12 -36 , 13 - 36 , 14 -36 , 15 -36 , 9 - 35 , 10 - 35 , examples . For in vitro assessment of activity , percent inhi 11 -35 , 12 -35 , 13 - 35 , 14 - 35 , 15 - 35 , 9 - 34 , 10 -34 , 11 - 34 , bition is determined using the methods provided in Example 12 - 34 , 13 - 34 , 14 - 34 , 15 - 34 , 9 - 33 , 10 - 33 , 11 - 33, 12 - 33 , 2 at a single dose at a 10 nM duplex final concentration . For 13 - 33 , 14 -33 , 15 -33 , 9 - 32 , 10 - 32 , 11 -32 , 12 - 32 , 13 - 32 , in vivo studies , the level after treatment can be compared to , 14 - 32 , 15 - 32 , 9 - 31, 10 - 31 , 11 - 31, 12 - 31, 13 - 32, 14 - 31 , for example , an appropriate historical control or a pooled 15 - 31 , 15 - 30 , 15 - 29, 15 -28 , 15 - 27 , 15 - 26 , 15 -25 , 15 - 24 , population sample control to determine the level of reduc 15 - 23 , 15 -22 , 15 -21 , 15 - 20 , 15 - 19 , 15 - 18 , 15 - 17 , 18 -30 , tion , e . g ., when a baseline value is no available for the 18 - 29 , 18 - 28 , 18 - 27 , 18 - 26 , 18 - 25 , 18 - 24 , 18 - 23 , 18 - 22, subject. 18 - 21 , 18 - 20 , 19 - 30 , 19 - 29 , 19 - 28 , 19 - 27 , 19 - 26 , 19 - 25 , [0187 ] A dsRNA includes two RNA strands that are 19 - 24 , 19 - 23 , 19 -22 , 19 - 21, 19 - 20 , 20 - 30 , 20 - 29 , 20 - 28 , complementary and hybridize to form a duplex structure 20 - 27 , 20 - 26 , 20 -25 , 20 - 24 , 20 - 23 , 20 - 22 , 20 - 21, 21 - 30 , under conditions in which the dsRNA will be used . One 21- 29 , 21- 28 , 21- 27 , 21 - 26 , 21 -25 , 21 -24 , 21 - 23 , or 21 - 22 strand of a dsRNA ( the antisense strand ) includes a region of base pairs . Thus , in one embodiment, to the extent that it complementarity that is substantially complementary , and becomes processed to a functional duplex, of e . g ., 15 - 30 generally fully complementary , to a target sequence . The base pairs , that targets a desired RNA for cleavage , an RNA target sequence can be derived from the sequence of an molecule or complex of RNA molecules having a duplex mRNA formed during the expression of an IGFALS gene or region greater than 30 base pairs is a dsRNA . Thus , an IGF -1 gene. The other strand (the sense strand ) includes a ordinarily skilled artisan will recognize that in one embodi US 2018 /0201929 A1 Jul. 19 , 2018 ment, a miRNA is a dsRNA . In another embodiment, a sequences, with one of the sequences being substantially dsRNA is not a naturally occurring miRNA . In another complementary to a sequence of an mRNA generated in the embodiment, an iRNA agent useful to target IGFALS or expression of an IGF - 1 gene . As such , in this aspect, a IGF - 1 gene expression is not generated in the target cell by dsRNA will include two oligonucleotides , where one oligo cleavage of a larger dsRNA . nucleotide is described as the sense strand in any one of [0192 ] A dsRNA as described herein can further include Table 9 , 11 , 15 , 17 , 18 , and 20 , and the second oligonucle one or more single -stranded nucleotide overhangs e . g . , 1 - 4 , otide is described as the corresponding antisense strand of 2 - 4 , 1 - 3 , 2 - 3 , 1 , 2 , 3 , or 4 nucleotides . dsRNAs having at the sense strand in any one of Table 9 , 11 , 15 , 17 , 18 , and 20 . least one nucleotide overhang can have superior inhibitory In certain embodiments, the substantially complementary properties relative to their blunt- ended counterparts . A sequences of the dsRNA are contained on separate oligo nucleotide overhang can comprise or consistof a nucleotide / nucleotides . In other embodiments , the substantially nucleoside analog , including a deoxynucleotide / nucleoside . complementary sequences of the dsRNA are contained on a The overhang ( s ) can be on the sense strand , the antisense single oligonucleotide. strand , or any combination thereof. Furthermore, the nucleo [0197 ] It will be understood that , although the sequences tide ( s ) of an overhang can be present on the 5 ' - end , 3 '- end , in Tables 3 , 6 , 9, 12 , 15 , and 18 are not described as modified or both ends of an antisense or sense strand of a dsRNA . or conjugated sequences , the RNA of the iRNA of the 0193 ] A dsRNA can be synthesized by standard methods invention e . g . , a dsRNA of the invention , may comprise any known in the art as further discussed below , e . g ., by use of one of the sequences set forth in any one of Tables 3 , 6 , 9 , an automated DNA synthesizer , such as are commercially 12 , 15 , and 18 , or the sequences of any one of Tables 5 , 8 , available from , for example , Biosearch , Applied Biosys 11 , 14 , 17 , and 20 that are modified , or the sequences of any tems, Inc . one of Tables 5 , 8 , 11 , 14 , 17 , and 20 that are conjugated to [ 0194 ] Double stranded RNAi compounds of the inven a ligand . In other words, the invention encompasses dsRNAS tion may be prepared using a two - step procedure . First , the of any one of Tables 3 , 5 , 6 , 8, 9 , 11, 12 , 14 , 15 , 17 , 18 , and individual strands of the double stranded RNA molecule are 20 which are un -modified , un -conjugated , modified , or prepared separately . Then , the component strands are conjugated , as described herein . annealed . The individual strands of the siRNA compound can be prepared using solution - phase or solid - phase organic [0198 ] The skilled person is well aware that dsRNAS synthesis or both . Organic synthesis offers the advantage having a duplex structure of between about 20 and 23 base that the oligonucleotide strands comprising unnatural or pairs , e . g . , 21 , base pairs have been hailed as particularly modified nucleotides can be easily prepared . Similarly , effective in inducing RNA interference ( Elbashir et al. , single - stranded oligonucleotides of the invention can be EMBO 2001, 20 :6877 -6888 ) . However, others have found prepared using solution -phase or solid - phase organic syn that shorter or longer RNA duplex structures can also be thesis or both . effective ( Chu and Rana (2007 ) RNA 14 : 1714 - 1719 ; Kim et [0195 ] In an aspect, a dsRNA of the invention for inhibing al. (2005 ) Nat Biotech 23 :222 - 226 ) . In the embodiments the expression of an IGFALS gene includes at least two described above , by virtue of the nature of the oligonucle nucleotide sequences , a sense sequence and an anti - sense otide sequences provided in any one of Tables 3 , 5 , 6 , 8 , 9 , sequence . The sense strand is selected from the group of 11 , 12 , 14 , 15 , 17 , 18 , and 20 , dsRNAs described herein can sequences provided in any one of Tables 3 , 5 , 6, 8 , 12, and include at least one strand of a length of minimally 21 14 , and the corresponding antisense strand of the sense nucleotides. It can be reasonably expected that shorter strand is selected from the group of sequences in any one of duplexes having one of the sequences of Tables 3 , 5 , 6 , 8, 9, Tables 3 , 5 , 6 , 8 , 12 , and 14 . In this aspect, one of the two 11 , 12 , 14 , 15 , 17 , 18 , and 20 minus only a few nucleotides sequences is complementary to the other of the two on one or both ends can be similarly effective as compared sequences , with one of the sequences being substantially to the dsRNAs described above. Hence , dsRNAs having a complementary to a sequence of an mRNA generated in the sequence of at least 15 , 16 , 17 , 18 , 19 , 20 , or more expression of an IGFALS gene . As such , in this aspect, a contiguous nucleotides derived from one of the sequences of dsRNA will include two oligonucleotides , where one oligo Tables 3 , 5 , 6 , 8 , 9 , 11, 12 , 14 , 15 , 17 , 18 , and 20 , and nucleotide is described as the sense strand in any one of differing in their ability to inhibit the expression of an Table 3 , 5 , 6 , 8 , 12 , and 14 , and the second oligonucleotide IGFALS gene or an IGF - 1 gene by not more than about 5 , is described as the corresponding antisense strand of the 10 , 15 , 20 , 25 , or 30 % inhibition from a dsRNA comprising sense strand in any one of Table 3 , 5 , 6 , 8 , 12 , and 14 . In the full sequence , are contemplated to be within the scope of certain embodiments , the substantially complementary the present invention . sequences of the dsRNA are contained on separate oligo [0199 ] In addition , the RNAs provided in Tables 3 , 5 , 6 , 8, nucleotides . In other embodiments , the substantially 9 , 11, 12 , 14 , 15 , 17 , 18 , and 20 identify a site ( s ) in an complementary sequences of the dsRNA are contained on a IGFALS transcript or IGF - 1 transcript that is susceptible to single oligonucleotide . RISC -mediated cleavage . As such , the present invention [0196 ] In an aspect , a dsRNA of the invention for inhibing further features iRNAs that target within one of these sites . the expression of an IGF - 1 gene includes at least two As used herein , an iRNA is said to target within a particular nucleotide sequences, a sense sequence and an anti -sense site of an RNA transcript if the iRNA promotes cleavage of sequence . The sense strand is selected from the group of the transcript anywhere within that particular site . Such an sequences provided in any one of Tables 9, 11, 15 , 17 , 18, iRNA will generally include at least about 15 contiguous and 20 , and the corresponding antisense strand of the sense nucleotides from one of the sequences provided in Tables 3 , strand is selected from the group of sequences in any one of 5 , 6 , 8 , 9 , 11 , 12 , 14 , 15 , 17 , 18 , and 20 coupled to additional Tables 9 , 11 , 15 , 17 , 18 , and 20 . In this aspect , one of the two nucleotide sequences taken from the region contiguous to sequences is complementary to the other of the two the selected sequence in an IGFALS gene or an IGF - 1 gene . US 2018 /0201929 A1 Jul. 19 , 2018 24

[0200 ] While a target sequence is generally about 15 - 30 described herein or methods known in the art can be used to nucleotides in length , there is wide variation in the suitabil determine whether an iRNA containing a mismatch to a ity of particular sequences in this range for directing cleav target sequence is effective in inhibiting the expression of an age of any given target RNA . Various software packages and IGFALS gene or IGF- 1 gene . Consideration of the efficacy the guidelines set out herein provide guidance for the of iRNAs with mismatches in inhibiting expression of an identification of optimal target sequences for any given gene IGFALS gene or an IGF - 1 gene is important, especially if target , but an empirical approach can also be taken in which the particular region of complementarity in an IGFALS gene a " window " or " mask " of a given size ( as a non - limiting or an IGF- 1 gene is known to have polymorphic sequence example , 21 nucleotides) is literally or figuratively ( includ variation within the population . ing, e . g . , in silico ) placed on the target RNA sequence to identify sequences in the size range that can serve as target II. Modified iRNAs of the Invention sequences . By moving the sequence " window " progres [0203 ] In certain embodiments , the RNA of the iRNA of sively one nucleotide upstream or downstream of an initial the invention e . g . , a dsRNA , is unmodified , and does not target sequence location , the next potential target sequence comprise , e . g ., chemical modifications or conjugations can be identified , until the complete set of possible known in the art and described herein . In other embodi sequences is identified for any given target size selected . ments , the RNA of an iRNA of the invention , e . g ., a dsRNA , This process, coupled with systematic synthesis and testing is chemically modified to enhance stability or other benefi of the identified sequences ( using assays as described herein cial characteristics. In certain embodiments of the invention , or as known in the art or provided herein ) to identify those substantially all of the nucleotides of an iRNA of the sequences that perform optimally can identify those RNA invention are modified . In other embodiments of the inven sequences that, when targeted with an iRNA agent, mediate tion , all of the nucleotides of an iRNA or substantially all of the best inhibition of target gene expression . Thus, while the the nucleotides of an iRNA are modified , i . e . , notmore than sequences identified , for example , in Tables 3 and 5 repre 5 , 4 , 3 , 2 , or 1 unmodified nucleotides are present in a strand sent effective target sequences, it is contemplated that fur of the iRNA . ther optimization of inhibition efficiency can be achieved by [0204 ] The nucleic acids featured in the invention can be progressively “ walking the window " one nucleotide synthesized or modified by methods well established in the upstream or downstream of the given sequences to identify art, such as those described in “ Current protocols in nucleic sequences with equal or better inhibition characteristics . acid chemistry , " Beaucage , S . L . et al. ( Edrs . ) , John Wiley & [0201 ]. Further, it is contemplated that for any sequence Sons , Inc . , New York , N . Y . , USA , which is hereby incor identified , e . g ., in Tables 3 , 5 , 6 , 8 , 9 , 11, 12 , 14 , 15 , 17 , 18 , porated herein by reference . Modifications include , for and 20 , further optimization could be achieved by system example , end modifications, e . g ., 5 ' - end modifications atically either adding or removing nucleotides to generate ( phosphorylation , conjugation , inverted linkages ) or 3 '- end longer or shorter sequences and testing those sequences modifications ( conjugation , DNA nucleotides , inverted link generated by walking a window of the longer or shorter size ages, etc . ) ; base modifications , e . g . , replacement with sta up or down the target RNA from that point. Again , coupling bilizing bases, destabilizing bases , or bases that base pair this approach to generating new candidate targets with with an expanded repertoire of partners , removal of bases testing for effectiveness of iRNAs based on those target ( abasic nucleotides ), or conjugated bases; sugar modifica sequences in an inhibition assay as known in the art or as tions ( e . g ., at the 2 ' - position or 4 ' -position ) or replacement of described herein can lead to further improvements in the the sugar ; or backbone modifications , including modifica efficiency of inhibition . Further still, such optimized tion or replacement of the phosphodiester linkages. Specific sequences can be adjusted by, e . g. , the introduction of examples of iRNA compounds useful in the embodiments modified nucleotides as described herein or as known in the described herein include , but are not limited to RNAS art, addition or changes in overhang , or other modifications containing modified backbones or no natural internucleoside as known in the art or discussed herein to further optimize linkages . RNAs having modified backbones include , among the molecule ( e . g . , increasing serum stability or circulating others, those that do not have a phosphorus atom in the half - life , increasing thermal stability , enhancing transmem backbone . For the purposes of this specification , and as brane delivery, targeting to a particular location or cell type , sometimes referenced in the art , modified RNAs that do not increasing interaction with silencing pathway enzymes, have a phosphorus atom in their internucleoside backbone increasing release from endosomes ) as an expression inhibi can also be considered to be oligonucleosides . In some tor. embodiments , a modified iRNA will have a phosphorus [0202 ] An iRNA as described herein can contain one or atom in its internucleoside backbone . more mismatches to the target sequence . In one embodi [ 0205 ] Modified RNA backbones include, for example , ment, an iRNA as described herein contains no more than 3 phosphorothioates, chiral phosphorothioates, phosphorodi mismatches . If the antisense strand of the iRNA contains thioates , phosphotriesters, aminoalkylphosphotriesters , mismatches to a target sequence , it is preferable that the area methyl and other alkyl phosphonates including 3 ' - alkylene of mismatch is not located in the center of the region of phosphonates and chiral phosphonates, phosphinates , phos complementarity . If the antisense strand of the iRNA con phoramidates including 3 ' -amino phosphoramidate and tains mismatches to the target sequence , it is preferable that aminoalkylphosphoramidates, thionophosphoramidates, the mismatch be restricted to be within the last 5 nucleotides thionoalkylphosphonates , thionoalkylphosphotriesters , and from either the 5 '- or 3' - end of the region of complemen boranophosphates having normal 3 '- 5 ' linkages, 2 - 5 - linked tarity . For example , for a 23 nucleotide iRNA agent the analogs of these , and those having inverted polarity wherein strand which is complementary to a region of an IGFALS the adjacent pairs of nucleoside units are linked 3 - 5 ' to 5 ' - 3 ' gene or an IGF - 1 gene , generally does not contain any or 2 - 5 ' to 5 ' - 2 ' . Various salts , mixed salts and free acid forms mismatch within the central 13 nucleotides . The methods are also included . US 2018 /0201929 A1 Jul. 19 , 2018 25

[0206 ] Representative US patents that teach the prepara - (CH3 ) CH2 and - N ( CH3) - CH2 CH2 [wherein the tion of the above phosphorus - containing linkages include , native phosphodiester backbone is represented as O P but are not limited to , U . S . Pat . Nos. 3 ,687 ,808 ; 4 , 469 ,863 ; O CH2 – ] of the above - referenced U . S . Pat . No . 5 , 489 , 4 ,476 , 301 ; 5 , 023 , 243 ; 5 , 177, 195 ; 5 , 188 ,897 ; 5 , 264 ,423 ; 677 , and the amide backbones of the above - referenced U . S . 5 , 276 , 019 ; 5 ,278 , 302 ; 5 , 286 ,717 ; 5 , 321 , 131 ; 5 ,399 ,676 ; Pat. No. 5 ,602 , 240 . In some embodiments , the RNAs fea 5 ,405 , 939 ; 5 , 453 ,496 ; 5 ,455 , 233 ; 5 , 466 ,677 ; 5 ,476 , 925 ; tured herein have morpholino backbone structures of the 5 ,519 , 126 ; 5 , 536 ,821 ; 5 , 541 , 316 ; 5 , 550 , 111 ; 5 , 563 , 253 ; above - referenced U . S . Pat. No . 5 ,034 , 506 . 5 , 571, 799 ; 5 ,587 ,361 ; 5 ,625 , 050 ; 6 , 028 , 188 ; 6 , 124 ,445 ; [0211 ] Modified RNAs can also contain one or more 6 , 160, 109 ; 6 , 169 , 170 ; 6 , 172, 209; 6 ,239 , 265 ; 6 , 277 ,603 ; substituted sugar moieties . The iRNAs, e . g ., dsRNAs , fea 6 , 326 , 199 ; 6 ,346 ,614 ; 6 ,444 , 423 ; 6 , 531, 590 ; 6 ,534 ,639 ; tured herein can include one of the following at the 2 -po 6 ,608 ,035 ; 6 ,683 , 167 ; 6 ,858 , 715 ; 6 , 867, 294 ; 6 , 878 , 805 ; sition : OH ; F ; O -, S - , or N -alkyl ; O , S -, or N -alkenyl ; O - , S 7 ,015 ,315 ; 7 ,041 , 816 ; 7 ,273 ,933 ; 7 , 321, 029 ; and U . S . Pat . or N - alkynyl; or O -alkyl - O - alkyl, wherein the alkyl , alkenyl RE39464 , the entire contents of each of which are hereby and alkynyl can be substituted or unsubstituted C? to C10 incorporated herein by reference . alkyl or C , to Co alkenyl and alkynyl . Exemplary suitable [0207 ] Modified RNA backbones that do not include a modifications include O [( CH2) mO ]mCH3 , O (CH2 ) ?OCH3, phosphorus atom therein have backbones that are formed by O (CH2 ) , NH2, O (CH2 ) - CH3, O ( CH2) ONH2, and O (CH2 ) short chain alkyl or cycloalkyl internucleoside linkages , „ ON [ (CH2 ) CH3) 2 , where n and m are from 1 to about 10 . mixed heteroatoms and alkyl or cycloalkyl internucleoside In other embodiments , dsRNAs include one of the following linkages, or one or more short chain heteroatomic or het at the 2 ' position : C , to C10 lower alkyl, substituted lower erocyclic internucleoside linkages . These include those hav alkyl, alkaryl, aralkyl , O - alkaryl or O - aralkyl, SH , SCH3 , ing morpholino linkages ( formed in part from the sugar OCN , CI, Br, CN , CF3, OCF3, SOCHZ, SO CH3, ONO2, portion of a nucleoside ) ; siloxane backbones ; sulfide, sul NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, amino foxide and sulfone backbones ; formacetyl and thioforma alkylamino, polyalkylamino , substituted silyl , an RNA cetyl backbones ; methylene formacetyl and thioformacetyl cleaving group , a reporter group , an intercalator, a group for backbones ; alkene containing backbones; sulfamate back improving the pharmacokinetic properties of an iRNA, or a bones; methyleneimino and methylenehydrazino back group for improving the pharmacodynamic properties of an bones ; sulfonate and sulfonamide backbones ; amide back iRNA, and other substituents having similar properties . In bones ; and others having mixed N , O , S , and CH , some embodiments , the modification includes a 2 '- methoxy component parts. ethoxy ( 2 - 0 _ CH _ CH _ OCHz, also known as 2 - 0 - ( 2 [0208 ] Representative US patents that teach the prepara methoxyethyl) or 2' -MOE ) (Martin et al. , Helv . Chim . Acta , tion of the above oligonucleosides include , but are not 1995 , 78 : 486 - 504 ) i. e ., an alkoxy - alkoxy group . Another limited to , U . S . Pat . Nos. 5 ,034 , 506 ; 5 , 166 , 315 ; 5 , 185 ,444 ; exemplary modification is 2 ' - dimethylaminooxyethoxy , i . e . , 5 ,214 , 134 ; 5 ,216 , 141 ; 5 , 235 , 033 ; 5 ,64 , 562 ; 5 , 264 ,564 ; a O ( CH2) 2ON (CH3 ) 2 group , also known as 2 - DMAOE , as 5 , 405 , 938 ; 5 , 434 , 257 ; 5 , 466 , 677 ; 5 , 470 , 967; 5 , 489 ,677 ; described in examples herein below , and 2 ' - dimethylamin 5 ,541 , 307 ; 5 , 561, 225 ; 5 ,596 , 086 ; 5 ,602 , 240 ; 5 ,608 , 046 ; oethoxyethoxy (also known in the art as 2 - O -dimethylam 5 ,610 ,289 ; 5 ,618 ,704 ; 5 ,623 , 070 ; 5 , 663, 312 ; 5 ,633 ,360 ; inoethoxyethyl or 2 -DMAEOE ) , i. e. , 2 - 0 - CH , — 0 5 ,677 ,437 ; and 5 ,677 ,439 , the entire contents of each of CH , — N (CH , ) . . Further exemplary modifications include : which are hereby incorporated herein by reference . 5 ' -Me - 2 - F nucleotides, 5 ' -Me - 2 ' -OMe nucleotides, 5 '- Me [0209 ] Suitable RNA mimetics are contemplated for use in 2 '- deoxynucleotides, ( both R and S isomers in these three iRNAs provided herein , in which both the sugar and the families) ; 2 ' - alkoxyalkyl; and 2 '- NMA ( N -methylacet internucleoside linkage , i. e ., the backbone , of the nucleotide amide ) . units are replaced with novel groups. The base units are [0212 ] Other modifications include 2' - methoxy (2 ' maintained for hybridization with an appropriate nucleic OCHZ) , 2 ' -aminopropoxy ( 2 -OCH _ CH _ CH _ NH , ) and acid target compound . One such oligomeric compound in 2 '- fluoro ( 2 ' - F ) . Similar modifications can also be made at which an RNA mimetic that has been shown to have other positions on the RNA of an iRNA , particularly the 3 ' excellent hybridization properties is referred to as a peptide position of the sugar on the 3 terminal nucleotide or in 21- 5 ' nucleic acid (PNA ) . In PNA compounds, the sugar backbone linked dsRNAs and the 5 ' position of 5 ' terminal nucleotide . of an RNA is replaced with an amide containing backbone , iRNAs can also have sugar mimetics such as cyclobutyl in particular an aminoethylglycine backbone . The nucle moieties in place of the pentofuranosyl sugar. Representa obases are retained and are bound directly or indirectly to tive US patents that teach the preparation of such modified aza nitrogen atoms of the amide portion of the backbone . sugar structures include, but are not limited to , U . S . Pat . Representative US patents that teach the preparation of PNA Nos . 4 , 981, 957 ; 5 , 118 , 800 ; 5 , 319 ,080 ; 5 ,359 , 044 ; 5 , 393 , compounds include, but are not limited to , U . S . Pat. Nos . 878 ; 5 ,446 , 137 ; 5 ,466 , 786 ; 5 ,514 , 785 ; 5 ,519 , 134 ; 5 , 567 , 5 ,539 , 082 ; 5 , 714 , 331; and 5 ,719 , 262, the entire contents of 811 ; 5 ,576 ,427 ; 5 ,591 , 722; 5 , 597 , 909; 5 ,610 , 300 ; 5 ,627 , each of which are hereby incorporated herein by reference . 053 ; 5 ,639 , 873 ; 5 ,646 , 265 ; 5 ,658 , 873 ; 5 ,670 ,633 ; and Additional PNA compounds suitable for use in the iRNAs of 5 , 700 , 920 , certain of which are commonly owned with the the invention are described in , for example , in Nielsen et al. , instant application . The entire contents of each of the Science , 1991 , 254 , 1497 - 1500 . foregoing are hereby incorporated herein by reference . [0210 ] Some embodiments featured in the invention [ 0213 ] An iRNA can also include nucleobase ( often include RNAs with phosphorothioate backbones and oligo referred to in the art simply as “ base” ) modifications or nucleosides with heteroatom backbones , and in particular substitutions. As used herein , " unmodified " or " natural" _ CH NH CH , — , CH?N ( CH ) 0 CH? nucleobases include the purine bases adenine ( A ) and gua fknown as a methylene (methylimino ) or MMI backbonel, nine ( G ) , and the pyrimidine bases thymine ( T ) , cytosine - CH2- O - N (CH3 ) - CH2 - , CH , N (CH3 ) N (C ), and uracil ( U ) . Modified nucleobases include other US 2018 /0201929 A1 Jul. 19 , 2018 synthetic and natural nucleobases such as deoxy - thymine removed , forming an unlocked “ sugar ” residue . In one (dT ) , 5 -methylcytosine ( 5 -me - C ) , 5 -hydroxymethyl cyto example, UNA also encompasses monomer with bonds sine , xanthine, hypoxanthine , 2 - aminoadenine, 6 -methyl and between C1 - C4 ' have been removed ( i. e . the covalent car other alkyl derivatives of adenine and guanine, 2 - propyl and bon -oxygen -carbon bond between the Cl' and C4 ' carbons) . other alkyl derivatives of adenine and guanine, 2 - thiouracil, In another example , the C2 -C3 ' bond ( i. e . the covalent 2 - thiothymine and 2 - thiocytosine, 5 -halouracil and cytosine , carbon - carbon bond between the C2' and C3 ' carbons ) of the 5 - propynyl uracil and cytosine , 6 - azo uracil, cytosine and sugar has been removed (see Nuc. Acids Symp. Series, 52 , thymine , 5 -uracil (pseudouracil ) , 4 - thiouracil , 8 -halo , 133 - 134 ( 2008 ) and Fluiter et al. , Mol. Biosyst. , 2009 , 10 , 8 - amino , 8 - thiol, 8 - thioalkyl, 8 -hydroxyl anal other 8 - sub 1039 hereby incorporated by reference ). stituted adenines and guanines, 5 -halo , particularly 5 -bromo , 5 - trifluoromethyl and other 5 - substituted uracils and cyto [ 0217 ] The RNA of an iRNA can also be modified to sines , 7 -methylguanine and 7 -methyladenine , 8 - azaguanine include one or more bicyclic sugar moities . A “ bicyclic and 8 -azaadenine , 7 - deazaguanine and 7 - daazaadenine and sugar” is a furanosyl ring modified by the bridging of two 3 - deazaguanine and 3 - deazaadenine . Further nucleobases atoms. A “ bicyclic nucleoside ” ( “ BNA ” ) is a nucleoside include those disclosed in U . S . Pat. No. 3 ,687 , 808, those having a sugar moiety comprising a bridge connecting two disclosed in Modified Nucleosides in Biochemistry , Bio carbon atoms of the sugar ring, thereby forming a bicyclic technology and Medicine , Herdewijn , P . ed . Wiley -VCH , ring system . In certain embodiments , the bridge connects the 2008 ; those disclosed in The Concise Encyclopedia Of 4 '- carbon and the 2 ' - carbon of the sugar ring. Thus, in some Polymer Science And Engineering , pages 858 -859 , Kro embodiments an agent of the invention may include one or schwitz , J . L , ed . John Wiley & Sons , 1990 , these disclosed more locked nucleic acids (LNA ) . A locked nucleic acid is by Englisch et al. , Angewandte Chemie , International Edi a nucleotide having a modified ribose moiety in which the tion , 1991, 30 , 613 , and those disclosed by Sanghvi, Y S . , ribose moiety comprises an extra bridge connecting the 2 Chapter 15, dsRNA Research and Applications , pages 289 and 4' carbons. In other words , an LNA is a nucleotide 302 , Crooke, S . T . and Lebleu , B ., Ed . , CRC Press , 1993 . comprising a bicyclic sugar moiety comprising a 4 ' -CH2 Certain of these nucleobases are particularly useful for 0 - 2 ' bridge . This structure effectively “ locks” the ribose in increasing the binding affinity of the oligomeric compounds the 3 '- endo structural conformation . The addition of locked featured in the invention . These include 5 -substituted nucleic acids to siRNAs has been shown to increase siRNA pyrimidines , 6 - azapyrimidines and N - 2 , N - 6 and 0 -6 sub stability in serum , and to reduce off - target effects ( Elmen , J . stituted purines, including 2 - aminopropyladenine, 5 - propy et al. , ( 2005 ) Nucleic Acids Research 33 ( 1 ) :439 -447 ; Mook , nyluracil and 5 - propynylcytosine . 5 -methylcytosine substi OR . et al. , ( 2007 ) Mol Canc Ther 6 ( 3 ) :833 - 843 ; Grunweller , A . et al ., ( 2003 ) Nucleic Acids Research 31 ( 12 ) :3185 - 3193 ) . tutions have been shown to increase nucleic acid duplex Examples of bicyclic nucleosides for use in the polynucle stability by 0 . 6 - 1 . 2° C . (Sanghvi , Y . S ., Crooke, S . T . and otides of the invention include without limitation nucleo Lebleu , B ., Eds. , dsRNA Research and Applications, CRC sides comprising a bridge between the 4 ' and the 2 ' ribosyl Press , Boca Raton , 1993 , pp . 276 -278 ) and are exemplary ring atoms. In certain embodiments , the antisense polynucle base substitutions , even more particularly when combined otide agents of the invention include one or more bicyclic with 2 - O -methoxyethyl sugar modifications. nucleosides comprising a 4 ' to 2 ' bridge. Examples of such 102141 Representative US patents that teach the prepara 4 ' to 2 ' bridged bicyclic nucleosides, include but are not tion of certain of the above noted modified nucleobases as limited to 4 '- (CH2 ) 0 - 2 ' (LNA ) ; 4 '- ( CH2) — S - 2 ' ; 4 '- ( CH2) well as other modified nucleobases include , but are not 2 - 0 - 2 ' (ENA ) ; 4 '- CH (CH3 ) 0 - 2 (also referred to as limited to , the above noted U . S . Pat. Nos . 3 ,687 , 808 , 4 , 845 , " constrained ethyl” or “ cEt” ) and 4 '- CH (CH OCH3) 40 - 2' 205 ; 5 , 130 , 30 ; 5 , 134 ,066 ; 5 , 175 ,273 ; 5 ,367 , 066 ; 5 ,432 ,272 ; (and analogs thereof; see, e . g . , U . S . Pat. No . 7 , 399 ,845 ) ; 5 , 457, 187 ; 5 ,459 , 255 ; 5 , 484 ,908 ; 5 , 502, 177 ; 5 ,525 ,711 ; 4 - C ( CH3) (CH3 ) 40 - 2 ' ( and analogs thereof; see e . g . , U . S . 5 ,552 ,540 ; 5 ,587 ,469 ; 5 ,594 , 121, 5 ,596 ,091 ; 5 ,614 ,617 ; Pat. No. 8 ,278 ,283 ) ; 4 ' - CH2 - N (OCHZ ) - 2 ' ( and analogs 5 ,681 , 941; 5 ,750 ,692 ; 6 ,015 , 886 ; 6 , 147 , 200 ; 6 , 166 , 197 ; thereof ; see e . g ., U . S . Pat. No . 8 , 278 , 425 ) ; 4 ' -CH , - 0 - N 6 , 222 ,025 ; 6 ,235 ,887 ; 6 , 380 , 368 ; 6 , 528 ,640 ; 6 ,639 ,062 ; (CH3 ) - 2' ( see, e .g ., US Patent Publication No . 2004 / 6 ,617 ,438 ; 7 ,045 ,610 ; 7 ,427 ,672 ; and 7 ,495 , 088 , the entire 0171570 ) ; 4 ' -CH2 - N ( R ) O - 2 ', wherein R is H , C1- C12 contents of each of which are hereby incorporated herein by alkyl, or a protecting group (see , e . g . , U . S . Pat. No. 7 ,427 , reference . 672 ) ; 4 ' -CH2 - C ( H )( CH3) - 2 ' ( see, e . g ., Chattopadhyaya et [ 0215 ] The RNA of an iRNA can also be modified to al. , J . Org . Chem . , 2009, 74 , 118 - 134 ) ; and 4 '- CH2 - C include one or more locked nucleic acids (LNA ). A locked F CH2) - 2 ' (and analogs thereof; see, e . g ., U . S . Pat. No. nucleic acid is a nucleotide having a modified ribose moiety 8 ,278 ,426 ). The entire contents of each of the foregoing are in which the ribose moiety comprises an extra bridge hereby incorporated herein by reference . connecting the 2 ' and 4 ' carbons. This structure effectively “ locks ” the ribose in the 3 ' - endo structural conformation . [0218 ] Additional representative US patents and US Pat The addition of locked nucleic acids to siRNAs has been ent Publications that teach the preparation of locked nucleic shown to increase siRNA stability in serum , and to reduce acid nucleotides include , but are not limited to , the follow off - target effects (Elmen , J . et al ., ( 2005 ) Nucleic Acids ing : U . S . Pat. Nos. 6 ,268 , 490 ; 6 , 525 , 191; 6 ,670 ,461 ; 6 ,770 , Research 33 ( 1 ) :439 -447 ; Mook , O R . et al ., (2007 ) Mol 748 ; 6 ,794 , 499 ; 6 , 998 , 484 ; 7 , 053 , 207 ; 7 , 034 , 133 ; 7 , 084 , Canc Ther 6 ( 3 ) :833 - 843 ; Grunweller, A . et al. , ( 2003 ) 125 ; 7 , 399 ,845 ; 7 ,427 ,672 ; 7 , 569, 686 ; 7 , 741 ,457 ; 8 ,022 , Nucleic Acids Research 31 ( 12 ): 3185 -3193 ). 193 ; 8 ,030 , 467 ; 8 , 278 , 425 ; 8 , 278 ,426 ; 8 , 278 , 283 ; US 2008 / [ 0216 ] In some embodiments , the iRNA of the invention 0039618 ; and US 2009 /0012281 , the entire contents of each comprises one or more monomers that are UNA (unlocked of which are hereby incorporated herein by reference . nucleic acid ) nucleotides . UNA is unlocked acyclic nucleic [0219 ] Any of the foregoing bicyclic nucleosides can be acid , wherein any of the bonds of the sugar has been prepared having one or more stereochemical sugar configu US 2018 /0201929 A1 Jul. 19 , 2018 rations including for example a -L - ribofuranose and B -D identical modifications on three consecutive nucleotides at ribofuranose (see WO 99 / 14226 ) . or near the cleavage site of at least one strand of a dsRNAI [ 0220 ] The RNA of an iRNA can also be modified to agent, the gene silencing activity of the dsRNAi agent was include one or more constrained ethyl nucleotides. As used observed . herein , a " constrained ethyl nucleotide ” or “ cEt” is a locked [0229 ] Accordingly, the invention provides double nucleic acid comprising a bicyclic sugar moiety comprising stranded RNAi agents capable of inhibiting the expression a 4 ' - CH (CH3 )40 - 2 ' bridge . In one embodiment, a con of a target gene ( i . e . , IGFALS or IGF - 1 gene ) in vivo . The strained ethyl nucleotide is in the S conformation referred to RNAi agent comprises a sense strand and an antisense herein as “ S - cEt. ” strand . Each strand of the RNAi agent may be , indepen [0221 ] An iRNA of the invention may also include one or dently , 12- 30 nucleotides in length . For example , each strand more “ conformationally restricted nucleotides” (“ CRN ” ) . may independently be 14 - 30 nucleotides in length , 17 - 30 CRN are nucleotide analogs with a linker connecting the C2 nucleotides in length , 25 - 30 nucleotides in length , 27 - 30 and C4' carbons of ribose or the C3 and -C5 ' carbons of nucleotides in length , 17 - 23 nucleotides in length , 17 - 21 ribose . CRN lock the ribose ring into a stable conformation nucleotides in length , 17 - 19 nucleotides in length , 19 - 25 and increase the hybridization affinity to mRNA. The linker nucleotides in length , 19 - 23 nucleotides in length , 19 - 21 is of sufficient length to place the oxygen in an optimal nucleotides in length , 21- 25 nucleotides in length , or 21 - 23 position for stability and affinity resulting in less ribose ring nucleotides in length . puckering . [0230 ] The sense strand and antisense strand typically [ 0222 ] Representative publications that teach the prepara form a duplex double stranded RNA (“ dsRNA” ) , also tion of certain of the above noted CRN include , but are not referred to herein as “ dsRNAi agent. ” The duplex region of limited to , US Patent Publication No . 2013 /0190383 ; and a dsRNAi agentmay be 12 - 30 nucleotide pairs in length . For PCT publication WO 2013 /036868 , the entire contents of example , the duplex region can be 14 - 30 nucleotide pairs in each of which are hereby incorporated herein by reference . length , 17 - 30 nucleotide pairs in length , 27 - 30 nucleotide [0223 ] Representative US publications that teach the pairs in length , 17 - 23 nucleotide pairs in length , 17 - 21 preparation of UNA include , but are not limited to , U . S . Pat. nucleotide pairs in length , 17 - 19 nucleotide pairs in length , No. 8 ,314 ,227 ; and US Patent Publication Nos. 2013 / 19 - 25 nucleotide pairs in length , 19 - 23 nucleotide pairs in 0096289 ; 2013 /0011922 ; and 2011 /0313020 , the entire con length , 19 - 21 nucleotide pairs in length , 21 - 25 nucleotide tents of each of which are hereby incorporated herein by pairs in length , or 21 - 23 nucleotide pairs in length . In reference . another example , the duplex region is selected from 15 , 16 , [0224 ] Potentially stabilizing modifications to the ends of 17 , 18 , 19, 20 , 21 , 22 , 23 , 24 , 25 , 26 , 27 , 28 , 29 , or 30 RNA molecules can include N - acetylaminocaproyl) -4 -hy nucleotides in length . droxyprolinol (Hyp - C6 -NHAC ) , N - ( caproyl- 4 -hydroxypro [0231 ] In certain embodiments , the sense and antisense linol (Hyp - C6 ) , N - acetyl- 4 -hydroxyprolinol (Hyp -NHAC ) , strands may be even longer. For example , in certain embodi thymidine - 2 - 0 -deoxythymidine ( ether ), N -( aminocaproyl) ments , the sense strand and the antisense strand are inde 4 -hydroxyprolinol (Hyp - C6 -amino ) , 2 -docosanoyl -uridine pendently 25 - 35 nucleotides in length . In certain embodi Z " - phosphate , inverted base dT ( idT ) and others . Disclosure ments , each the sense and the antisense strand are of this modification can be found in PCT Publication No . independently 27 - 53 nucleotides in length , e . g ., 27 -49 , WO 2011/ 005861 . 31 -49 , 33 -49 , 35 -49 , 37 -49 , and 39 -49 nucleotides in length . [0225 ] Othermodifications of the nucleotides of an iRNA In certain embodiments , the dsRNAi agent may contain one of the invention include a 5' phosphate or 5 ' phosphate or more overhang regions or capping groups at the 3' - end , mimic , e .g ., a 5 '- terminal phosphate or phosphate mimic on 5 ' - end , or both ends of one or both strands . The overhang can the antisense strand of an iRNA . Suitable phosphate mimics be , independently , 1 - 6 nucleotides in length , for instance 2 - 6 are disclosed in , for example US Patent Publication No . nucleotides in length , 1 - 5 nucleotides in length , 2 - 5 nucleo 2012 /0157511 , the entire contents of which are incorporated tides in length , 1 -4 nucleotides in length , 2 - 4 nucleotides in herein by reference . length , 1 - 3 nucleotides in length , 2 - 3 nucleotides in length , [0226 ] A . Modified iRNAs Comprising Motifs of the or 1 - 2 nucleotides in length . In certain embodiments , at least Invention one strand of the dsRNAi agent comprises a 3 ' overhang of [0227 ) In certain aspects of the invention , the double at least 1 nucleotide . In another embodiment, at least one stranded RNAi agents of the invention include agents with strand comprises a 3 ' overhang of at least 2 nucleotides , e . g . , chemical modifications as disclosed , for example , in 2 , 3 , 4 , 5 , 6 , 7 , 9 , 10 , 11 , 12 , 13, 14 , or 15 nucleotides. In WO2013 /075035 , the entire contents of each of which are other embodiments , at least one strand of the dsRNAi agent incorporated herein by reference. WO2013 /075035 provides comprises a 5 ' overhang of at least 1 nucleotide . In certain motifs of three identical modifications on three consecutive embodiments , at least one strand comprises a 5 ' overhang of nucleotides into a sense strand or antisense strand of a at least 2 nucleotides, e . g . , 2 , 3 , 4 , 5 , 6 , 7 , 9 , 10 , 11 , 12 , 13 , dsRNAi agent, particularly at or near the cleavage site . In 14 , or 15 nucleotides . In still other embodiments , both the 3 some embodiments , the sense strand and antisense strand of and the 5 ' end of one strand of the dsRNAi agent comprise the dsRNAi agent may otherwise be completely modified . an overhang of at least 1 nucleotide. The introduction of these motifs interrupts the modification [0232 ] In certain embodiments , the overhang regions can pattern , if present, of the sense or antisense strand . The include extended overhang regions as provided above . The dsRNAi agent may be optionally conjugated with a GalNAC overhangs can be the result of one strand being longer than derivative ligand , for instance on the sense strand . the other , or the result of two strands of the same length [0228 ] More specifically , when the sense strand and anti being staggered . The overhang can form a mismatch with sense strand of the double stranded RNAi agent are com the target mRNA or it can be complementary to the gene pletely modified to have one or more motifs of three sequences being targeted or can be another sequence . The US 2018 /0201929 A1 Jul. 19 , 2018 first and second strands can also be joined , e . g . , by additional methyl modifications on three consecutive nucleotides at bases to form a hairpin , or by other non -base linkers . positions 11 , 12 , 13 from the 5 'end , wherein one end of the 10233 ] In certain embodiments , the nucleotides in the RNAi agent is blunt, while the other end comprises a 2 overhang region of the dsRNAi agent can each indepen nucleotide overhang. Preferably , the 2 nucleotide overhang dently be a modified or unmodified nucleotide including , but is at the 3 '- end of the antisense strand . no limited to 2 ' - sugar modified , such as, 2 ' - F , 2 - O -methyl , [0240 ] When the 2 nucleotide overhang is at the 3' - end of thymidine (T ), 2 - O -methoxyethyl - 5 -methyluridine ( Teo ), the antisense strand , there may be two phosphorothioate 2 - O -methoxyethyladenosine (Aeo ) , 2 -0 -methoxyethyl - 5 internucleotide linkages between the terminal three nucleo methylcytidine (m5Ceo ), and any combinations thereof. For tides, wherein two of the three nucleotides are the overhang example , TT can be an overhang sequence for either end on nucleotides , and the third nucleotide is a paired nucleotide either strand . The overhang can form a mismatch with the next to the overhang nucleotide . In one embodiment, the target mRNA or it can be complementary to the gene RNAi agent additionally has two phosphorothioate inter sequences being targeted or can be another sequence. nucleotide linkages between the terminal three nucleotides [ 0234 ] The 5 - or 3 -overhangs at the sense strand , anti at both the 5 ' - end of the sense strand and at the 5 ' -end of the sense strand , or both strands of the dsRNAi agent may be antisense strand . In certain embodiments , every nucleotide phosphorylated . In some embodiments , the overhang region in the sense strand and the antisense strand of the dsRNAI ( s ) contains two nucleotides having a phosphorothioate agent, including the nucleotides that are part of the motifs between the two nucleotides , where the two nucleotides can are modified nucleotides . In certain embodiments each resi be the same or different. In some embodiments , the overhang due is independently modified with a 2 - O -methyl or is present at the 3 ' -end of the sense strand , antisense strand , 3 '- fluoro , e . g . , in an alternating motif . Optionally , the dsR or both strands . In some embodiments , this 3 ' - overhang is NAi agent further comprises a ligand (preferably GalNAcz) . present in the antisense strand. In some embodiments , this [ 0241 ] In certain embodiments , the dsRNAi agent com 3 ' - overhang is present in the sense strand . prises a sense and an antisense strand , wherein the sense [0235 ] The dsRNAi agent may contain only a single strand is 25 - 30 nucleotide residues in length , wherein start overhang, which can strengthen the interference activity of ing from the 5 ' terminal nucleotide (position 1 ) positions 1 the RNAi, without affecting its overall stability . For to 23 of the first strand comprise at least 8 ribonucleotides ; example , the single - stranded overhang may be located at the the antisense strand is 36 - 66 nucleotide residues in length 3 '- end of the sense strand or , alternatively , at the 3 '- end of the and , starting from the 3 ' terminal nucleotide , comprises at antisense strand . The RNAi may also have a blunt end , least 8 ribonucleotides in the positions paired with positions located at the 5 ' - end of the antisense strand (or the 3 '- end of 1 - 23 of sense strand to form a duplex ; wherein at least the the sense strand ) or vice versa . Generally, the antisense 3 ' terminal nucleotide of antisense strand is unpaired with strand of the dsRNAi agent has a nucleotide overhang at the sense strand , and up to 6 consecutive 3' terminal nucleotides 3 '- end , and the 5' - end is blunt. While not wishing to be are unpaired with sense strand , thereby forming a 3 ' single bound by theory , the asymmetric blunt end at the 5 '- end of stranded overhang of 1 - 6 nucleotides ; wherein the 5 ' termi the antisense strand and 3 ' - end overhang of the antisense nus of antisense strand comprises from 10 - 30 consecutive strand favor the guide strand loading into RISC process. nucleotides which are unpaired with sense strand , thereby 0236 . In certain embodiments , the dsRNAi agent is a forming a 10 - 30 nucleotide single stranded 5 ' overhang ; double ended bluntmer of 19 nucleotides in length , wherein wherein at least the sense strand 5 ' terminal and 3 ' terminal the sense strand contains at least one motif of three 2 - F nucleotides are base paired with nucleotides of antisense modifications on three consecutive nucleotides at positions strand when sense and antisense strands are aligned for 7 , 8 , 9 from the 5 'end . The antisense strand contains at least maximum complementarity, thereby forming a substantially one motif of three 2 - O -methyl modifications on three con duplexed region between sense and antisense strands ; and secutive nucleotides at positions 11, 12 , 13 from the 5 'end . antisense strand is sufficiently complementary to a target [ 0237 ] In other embodiments , the dsRNAi agent is a RNA along at least 19 ribonucleotides of antisense strand double ended bluntmer of 20 nucleotides in length , wherein length to reduce target gene expression when the double the sense strand contains at least one motif of three 2 - F stranded nucleic acid is introduced into a mammalian cell ; modifications on three consecutive nucleotides at positions and wherein the sense strand contains at least one motif of 8 , 9 , 10 from the 5 'end . The antisense strand contains at least three 2 ' - F modifications on three consecutive nucleotides , one motif of three 2 - O -methyl modifications on three con where at least one of the motifs occurs at or near the secutive nucleotides at positions 11, 12 , 13 from the 5' end . cleavage site . The antisense strand contains at least one [ 0238 ] In yet other embodiments , the dsRNAi agent is a motif of three 2 - O -methyl modifications on three consecu double ended bluntmer of 21 nucleotides in length , wherein tive nucleotides at or near the cleavage site . the sense strand contains at least one motif of three 2 '- F [ 0242 ] In certain embodiments , the dsRNAi agent com modifications on three consecutive nucleotides at positions prises sense and antisense strands , wherein the dsRNAi 9 , 10 , 11 from the 5' end . The antisense strand contains at agent comprises a first strand having a length which is at least one motif of three 2 - O -methyl modifications on three least 25 and at most 29 nucleotides and a second strand consecutive nucleotides at positions 11, 12 , 13 from the having a length which is at most 30 nucleotides with at least 5 'end . one motif of three 2 - O -methyl modifications on three con [ 0239 In certain embodiments , the dsRNAi agent com secutive nucleotides at position 11 , 12 , 13 from the 5 ' end ; prises a 21 nucleotide sense strand and a 23 nucleotide wherein the 3 ' end of the first strand and the 5 ' end of the antisense strand , wherein the sense strand contains at least second strand form a blunt end and the second strand is 1 - 4 one motif of three 2 - F modifications on three consecutive nucleotides longer at its 3 ' end than the first strand , wherein nucleotides at positions 9 , 10 , 11 from the 5 ' end ; the the duplex region region which is at least 25 nucleotides in antisense strand contains at least one motif of three 2 - 0 length , and the second strand is sufficiently complemenatary US 2018 /0201929 A1 Jul. 19 , 2018 to a target mRNA along at least 19 nucleotide of the second [0248 ] Like the sense strand , the antisense strand of the strand length to reduce target gene expression when the dsRNAi agent may contain more than one motif of three RNAi agent is introduced into a mammalian cell , and identical modifications on three consecutive nucleotides , wherein Dicer cleavage of the dsRNAi agent preferentially with at least one of the motifs occurring at or near the results in an siRNA comprising the 3 ' - end of the second cleavage site of the strand . This antisense strand may also strand , thereby reducing expression of the target gene in the contain one or more wing modifications in an alignment mammal. Optionally , the dsRNAi agent further comprises a similar to the wing modifications that may be present on the ligand. sense strand . [0243 ] In certain embodiments , the sense strand of the [02491 . In some embodiments , the wing modification on dsRNAi agent contains at least one motif of three identical the sense strand or antisense strand of the dsRNAi agent modifications on three consecutive nucleotides , where one typically does not include the first one or two terminal of the motifs occurs at the cleavage site in the sense strand . nucleotides at the 3 ' - end , 5 '- end , or both ends of the strand . [ 0244 ] In certain embodiments , the antisense strand of the [0250 ] In other embodiments , the wing modification on dsRNAi agent can also contain at least one motif of three the sense strand or antisense strand of the dsRNAi agent identical modifications on three consecutive nucleotides , typically does not include the first one or two paired nucleo where one of the motifs occurs at or near the cleavage site tides within the duplex region at the 3 ' -end , 5 ' - end , or both in the antisense strand . ends of the strand . [0245 ] For a dsRNAi agent having a duplex region of [ 0251 ] When the sense strand and the antisense strand of 17 - 23 nucleotides in length , the cleavage site of the anti the dsRNAi agent each contain at least one wing modifica sense strand is typically around the 10 , 11 , and 12 positions tion , the wing modifications may fall on the same end of the from the 5 ' - end . Thus the motifs of three identical modifi duplex region , and have an overlap of one, two , or three cations may occur at the 9 , 10 , 11 positions , the 10 , 11, 12 nucleotides . positions ; the 11, 12 , 13 positions; the 12 , 13 , 14 positions ; [0252 When the sense strand and the antisense strand of or the 13 , 14 , 15 positions of the antisense strand , the count the dsRNAi agent each contain at least two wing modifica starting from the first nucleotide from the 5 '- end of the tions , the sense strand and the antisense strand can be so antisense strand , or, the count starting from the first paired aligned that two modifications each from one strand fall on nucleotide within the duplex region from the 5' - end of the one end of the duplex region , having an overlap of one, two , antisense strand . The cleavage site in the antisense strand or three nucleotides ; two modifications each from one strand may also change according to the length of the duplex region fall on the other end of the duplex region , having an overlap of one , two or three nucleotides ; two modifications one of the dsRNAi agent from the 5 '- end . strand fall on each side of the lead motif , having an overlap [ 0246 ] The sense strand of the dsRNAi agent may contain of one, two or three nucleotides in the duplex region . at least one motif of three identicalmodifications on three [0253 ]. In some embodiments, every nucleotide in the consecutive nucleotides at the cleavage site of the strand ; sense strand and antisense strand of the dsRNAi agent , and the antisense strand may have at least one motif of three including the nucleotides that are part of the motifs , may be identical modifications on three consecutive nucleotides at modified . Each nucleotide may be modified with the same or or near the cleavage site of the strand . When the sense strand differentmodification which can include one or more altera and the antisense strand form a dsRNA duplex , the sense tion of one or both of the non - linking phosphate oxygens or strand and the antisense strand can be so aligned that one of one or more of the linking phosphate oxygens; alteration motif of the three nucleotides on the sense strand and one of a constituent of the ribose sugar, e . g . , of the 2 ' -hydroxyl motif of the three nucleotides on the antisense strand have at on the ribose sugar ; wholesale replacement of the phosphate least one nucleotide overlap , i. e ., at least one of the three moiety with “ dephospho ” linkers; modification or replace nucleotides of the motif in the sense strand forms a base pair ment of a naturally occurring base ; and replacement or with at least one of the three nucleotides of the motif in the modification of the ribose - phosphate backbone . antisense strand . Alternatively , at least two nucleotides may [0254 ] As nucleic acids are polymers of subunits , many of overlap , or all three nucleotides may overlap . the modifications occur at a position which is repeated [0247 ] In some embodiments , the sense strand of the within a nucleic acid , e . g . , a modification of a base , or a dsRNAi agent may contain more than one motif of three phosphate moiety , or a non - linking O of a phosphate moiety . identical modifications on three consecutive nucleotides . In some cases the modification will occur at all of the subject The first motif may occur at or near the cleavage site of the positions in the nucleic acid but in many cases it will not. By strand and the other motifs may be a wing modification . The way of example , a modification may only occur at a 3 '- or term “ wing modification ” herein refers to a motif occurring 5 ' - terminal position , may only occur in a terminal region , at another portion of the strand that is separated from the e . g . , at a position on a terminal nucleotide or in the last 2 , 3 , motif at or near the cleavage site of the same strand . The 4 , 5 , or 10 nucleotides of a strand . A modification may occur wing modification is either adjacent to the first motif or is in a double strand region , a single strand region , or in both . separated by at least one or more nucleotides . When the A modification may occur only in the double strand region motifs are immediately adjacent to each other then the of a dsRNAi agent or may only occur in a single strand chemistries of the motifs are distinct from each other, and region of a dsRNAi agent . For example , a phosphorothioate when the motifs are separated by one or more nucleotide modification at a non - linking O position may only occur at than the chemistries can be the same or different. Two or one or both ends, may only occur in a terminal region , e . g . , more wingmodifications may be present. For instance , when at a position on a terminal nucleotide , or in the last 2 , 3 , 4 , two wing modifications are present, each wing modification 5 , or 10 nucleotides of a strand , or may occur in double may occur at one end relative to the first motif which is at strand and single strand regions, particularly at the ends . The or near cleavage site or on either side of the lead motif . 5 '- end or ends can be phosphorylated . US 2018 /0201929 A1 Jul. 19 , 2018 30

[ 0255 ] It may be possible , e .g ., to enhance stability , to antisense strand may start with “BBAABBAA ” from 5 ' to 3' include particular bases in overhangs, or to include modified of the strand within the duplex region , so that there is a nucleotides or nucleotide surrogates , in single strand over complete or partial shift of the modification patterns hangs, e. g ., in a 5 '- or 3' - overhang , or in both . For example , between the sense strand and the antisense strand . it can be desirable to include purine nucleotides in over 10261] In some embodiments , the dsRNAi agent com hangs . In some embodiments all or some of the bases in a 3 ' prises the pattern of the alternating motif of 2 - O -methyl or 5 ' - overhang may be modified , e . g . , with a modification modification and 2 -F modification on the sense strand described herein . Modifications can include , e . g ., the use of initially has a shift relative to the pattern of the alternating modifications at the 2 ' position of the ribose sugar with motif of 2 '- O -methyl modification and 2 ' - F modification on modifications that are known in the art, e . g . , the use of the antisense strand initially , i . e . , the 2 - O -methyl modified deoxyribonucleotides , 2 ' - deoxy - 2 - fluoro ( 2 ' - F ) or 2 - 0 nucleotide on the sense strand base pairs with a 2 - F modi methyl modified instead of the ribosugar of the nucleobase , fied nucleotide on the antisense strand and vice versa . The 1 and modifications in the phosphate group , e. g . , phosphoro position of the sense strand may start with the 2 ' -F modifi thioate modifications. Overhangs need not be homologous cation , and the 1 position of the antisense strand may start with the target sequence . with the 2 - O -methyl modification . [0256 ] In some embodiments, each residue of the sense [0262 ]. The introduction of one or more motifs of three strand and antisense strand is independently modified with identical modifications on three consecutive nucleotides to LNA , CRN , CET, UNA , HNA , CENA , 2 '- methoxyethyl , the sense strand or antisense strand interrupts the initial 2 - O -methyl , 2 - O -ally1 , 2 - C — allyl, 2 '- deoxy , 2 ' -hydroxyl , modification pattern present in the sense strand or antisense or 2 - fluoro . The strands can contain more than one modi strand . This interruption of the modification pattern of the fication . In one embodiment, each residue of the sense strand sense or antisense strand by introducing one or more motifs and antisense strand is independently modified with 2 - O of three identical modifications on three consecutive nucleo methyl or 2 - fluoro . tides to the sense or antisense strand may enhance the gene [0257 ] At least two different modifications are typically silencing activity against the target gene. present on the sense strand and antisense strand . Those two [0263 ] In some embodiments , when the motif of three modifications may be the 2 ' - O -methyl or 2 ' - fluoro modifi identical modifications on three consecutive nucleotides is cations, or others . introduced to any of the strands, the modification of the [ 0258 ] In certain embodiments, the N , or No comprise nucleotide next to the motif is a different modification than modifications of an alternating pattern . The term “ alternat themodification of themotif . For example , the portion of the ing motif" as used herein refers to a motif having one or sequence containing the motif is “ . . . N , YYYN , . . . , " more modifications , each modification occurring on alter where “ Y ” represents the modification of the motif of three nating nucleotides of one strand . The alternating nucleotide identicalmodifications on three consecutive nucleotide , and may refer to one per every other nucleotide or one per every “ N , ” and “ N , ” represent a modification to the nucleotide three nucleotides , or a similar pattern . For example , if A , B next to the motif “ YYY ” that is different than the modifi and C each represent one type of modification to the cation of Y , and where N , and N , can be the same or different nucleotide, the alternating motif can be “ ABABABABA modifications . Alternatively , N , or N , may be present or BAB . . . “ AABBAABBAABB . . . ," absent when there is a wing modification present. “ AABAABAABAAB . . . ,” “ AAABAAABAAAB . . . ," [ 0264 ] The iRNA may further comprise at least one phos “ AAABBBAAABBB . . . , ” or “ ABCABCABCABC . . . , phorothioate or methylphosphonate internucleotide linkage . etc . The phosphorothioate or methylphosphonate internucleotide [0259 ] The type of modifications contained in the alter linkage modification may occur on any nucleotide of the nating motif may be the same or different. For example , if sense strand , antisense strand , or both strands in any position A , B , C , D each represent one type of modification on the of the strand . For instance , the internucleotide linkage nucleotide , the alternating pattern , i . e . , modifications on modification may occur on every nucleotide on the sense evevery other nucleotide, may be the same , but each of the strand or antisense strand ; each internucleotide linkage sense strand or antisense strand can be selected from several modification may occur in an alternating pattern on the sense possibilities of modifications within the alternating motif strand or antisense strand ; or the sense strand or antisense such as “ ABABAB . . . " , " ACACAC . . . ” “ BDBDBD . . strand may contain both internucleotide linkage modifica . ” or “ CDCDCD . . . ," etc . tions in an alternating pattern . The alternating pattern of the [ 0260 ] In some embodiments , the dsRNAi agent of the internucleotide linkage modification on the sense strand may invention comprises the modification pattern for the alter be the same or different from the antisense strand , and the nating motif on the sense strand relative to the modification alternating pattern of the internucleotide linkage modifica pattern for the alternating motif on the antisense strand is tion on the sense strand may have a shift relative to the shifted . The shift may be such that the modified group of alternating pattern of the internucleotide linkage modifica nucleotides of the sense strand corresponds to a differently tion on the antisense strand . In one embodiment, a double modified group of nucleotides of the antisense strand and stranded RNAi agent comprises 6 - 8phosphorothioate inter vice versa. For example , the sense strand when paired with nucleotide linkages . In some embodiments , the antisense the antisense strand in the dsRNA duplex , the alternating strand comprises two phosphorothioate internucleotide link motif in the sense strand may start with “ ABABAB ” from 5 ' ages at the 5 ' - end and two phosphorothioate internucleotide to 3 ' of the strand and the alternating motif in the antisense linkages at the 3 '- end , and the sense strand comprises at least strand may start with “ BABABA ” from 5 ' to 3 ' of the strand two phosphorothioate internucleotide linkages at either the within the duplex region . As another example , the alternat 5 ' - end or the 3 ' -end . ing motif in the sense strand may start with “ AABBAABB ” [ 0265 ] In some embodiments , the dsRNAi agent com from 5 ' to 3 ' of the strand and the alternating motif in the prises a phosphorothioate or methylphosphonate internucle US 2018 /0201929 A1 Jul. 19 , 2018 31 otide linkage modification in the overhang region . For at the 3 '- end of the antisense strand is deoxy - thymine ( dT ). example , the overhang region may contain two nucleotides For example, there is a short sequence of deoxy - thymine having a phosphorothioate or methylphosphonate inter - nucleotides, for example , two dT nucleotides on the 3 ' -end nucleotide linkage between the two nucleotides . Internucle of the sense , antisense strand , or both strands. otide linkage modifications also may be made to link the f0271] In certain embodiments , the sense strand sequence overhang nucleotides with the terminal paired nucleotides may be represented by formula ( I ) : within the duplex region . For example, at least 2 , 3 , 4 , or all the overhang nucleotides may be linked through phospho 5' ng - Na- ( XXX) - N YYY- NU- ( ZzZ) - Na- ng3' (1 ) rothioate or methylphosphonate internucleotide linkage , and [0272 ] wherein : optionally , there may be additional phosphorothioate or [0273 ] i and j are each independently 0 or 1 ; methylphosphonate internucleotide linkages linking the [0274 ] p and q are each independently 0 -6 ; overhang nucleotide with a paired nucleotide that is next to [0275 ] each N , independently represents an oligonucle the overhang nucleotide . For instance , there may be at least otide sequence comprising 0 - 25 modified nucleotides , each two phosphorothioate internucleotide linkages between the sequence comprising at least two differently modified terminal three nucleotides , in which two of the three nucleo nucleotides ; tides are overhang nucleotides, and the third is a paired [0276 ] each N , independently represents an oligonucle nucleotide next to the overhang nucleotide . These terminal otide sequence comprising 0 - 10 modified nucleotides; three nucleotides may be at the 3 ' - end of the antisense [0277 ] each n , and n , independently represent an over strand , the 3 '- end of the sense strand , the 5 ' - end of the hang nucleotide ; antisense strand , or the 5 'end of the antisense strand . [0278 ] wherein Nb and Y do not have the same modifi [0266 ] In some embodiments , the 2 - nucleotide overhang cation ; and is at the 3 '- end of the antisense strand , and there are two phosphorothioate internucleotide linkages between the ter [0279 ] XXX , YYY , and ZZZ each independently represent minal three nucleotides , wherein two of the three nucleo one motif of three identical modifications on three consecu tides are the overhang nucleotides, and the third nucleotide tive nucleotides . Preferably YYY is all 2 ' - F modified nucleo is a paired nucleotide next to the overhang nucleotide . tides . Optionally , the dsRNAi agent may additionally have two [ 0280 ] In some embodiments , the N , or N , comprises phosphorothioate internucleotide linkages between the ter modifications of alternating pattern . minal three nucleotides at both the 5 ' - end of the sense strand [0281 ] In some embodiments , the YYY motif occurs at or and at the 5 '- end of the antisense strand . near the cleavage site of the sense strand . For example , when [0267 ] In one embodiment, the dsRNAi agent comprises the dsRNAi agent has a duplex region of 17 - 23 nucleotides mismatch (es ) with the target, within the duplex , or combi in length , the YYY motif can occur at or the vicinity of the nations thereof. The mistmatch may occur in the overhang cleavage site ( e . g .: can occur at positions 6 , 7 , 8 ; 7 , 8 , 9 , 8 , region or the duplex region . The base pair may be ranked on 9 , 10 ; 9 , 10 , 11 ; 10 , 11, 12 ; or 11 , 12 , 13 ) of the sense strand , the basis of their propensity to promote dissociation or the count starting from the first nucleotide , from the 5 ' -end ; melting (e . g. , on the free energy of association or dissocia or optionally, the count starting at the first paired nucleotide tion of a particular pairing, the simplest approach is to within the duplex region , from the 5 '- end . examine the pairs on an individual pair basis, though next [0282 ] In one embodiment, i is 1 and j is 0 , or i is O and neighbor or similar analysis can also be used ) . In terms of j is 1 , or both i and j are 1 . The sense strand can therefore promoting dissociation : A :U is preferred over G : C ; G : U is be represented by the following formulas : preferred over G : C ; and I : C is preferred over G : C 5 'n , -Ne - YYY - N , -ZZZ - Na- 1 , 3 ' (Ib ); ( I = inosine ) . Mismatches, e . g ., non - canonical or other than canonical pairings (as described elsewhere herein ) are pre 5 'n , - N ,- XXX -Ny - YYY -N , - 1 , 3 ' ( Ic ) ; or ferred over canonical ( A : T , A : U , G : C ) pairings; and pairings which include a universal base are preferred over canonical 5' n , - N -XXX - Ny- YYY - Ny- ZZZ - Na- 1 3' (Id ). pairings . [0283 ] When the sense strand is represented by formula [0268 ] In certain embodiments , the dsRNAi agent com ( Ib ), N , represents an oligonucleotide sequence comprising prises at least one of the first 1 , 2 , 3 , 4 , or 5 base pairs within 0 - 10 , 0 - 7 , 0 - 5 , 0 - 4 , 0 - 2 , or o modified nucleotides. Each Na the duplex regions from the 5 '- end of the antisense strand independently can represent an oligonucleotide sequence independently selected from the group of: A : U , G : U , I : C , comprising 2- 20 , 2 -15 , or 2 - 10 modified nucleotides. and mismatched pairs, e . g ., non - canonical or other than [02841 . When the sense strand is represented as formula canonical pairings or pairings which include a universal ( Ic ) , N , represents an oligonucleotide sequence comprising base , to promote the dissociation of the antisense strand at 0 - 10 , 0 - 7 , 0 - 10 , 0 - 7 , 0 - 5 , 0 - 4 , 0 - 2 , or 0 modified nucleotides . the 5 '- end of the duplex . Each N , can independently represent an oligonucleotide [0269 ] In certain embodiments , the nucleotide at the 1 sequence comprising 2 - 20 , 2 - 15 , or 2 - 10 modified nucleo position within the duplex region from the 5 ' - end in the tides . antisense strand is selected from A , DA , DU , U , and dT. [0285 ] When the sense strand is represented as formula Alternatively , at least one of the first 1, 2 , or 3 base pair ( Id ) , each N , independently represents an oligonucleotide within the duplex region from the 5 ' - end of the antisense sequence comprising 0 - 10 , 0 - 7 , 0 - 5 , 0 -4 , 0 - 2 , or 0 modified strand is an AU base pair . For example, the first base pair nucleotides . Preferably, N , is 0 , 1 , 2 , 3 , 4 , 5 , or 6 Each Na within the duplex region from the 5 ' - end of the antisense can independently represent an oligonucleotide sequence strand is an AU base pair . comprising 2 -20 , 2 - 15, or 2 - 10 modified nucleotides. [0270 ] In other embodiments , the nucleotide at the 3' - end [0286 ] Each of X , Y and Z may be the same or different of the sense strand is deoxy - thymine (dT ) or the nucleotide from each other . US 2018 /0201929 A1 Jul. 19 , 2018 32.

[0287 ] In other embodiments , i is 0 and j is 0 , and the sense otide sequence comprising 0 - 10 , 0 - 7 , 0 -10 , 0 - 7, 0 - 5 , 0 -4 , strand may be represented by the formula : 0 - 2 , or o modified nucleotides. Each No' independently represents an oligonucleotide sequence comprising 2 -20 , 5' n , - N .- YYY - N ,- 1 ,3 " ( la ) . 2 - 15 , or 2 - 10 modified nucleotides . Preferably , N , is 0 , 1 , 2 , [ 0288 ] When the sense strand is represented by formula 3 , 4 , 5 , or 6 . ( la ), each N , independently can represent an oligonucleotide [0306 ] In other embodiments , k is () and 1 is O and the sequence comprising 2 - 20 , 2 - 15 , or 2 - 10 modified nucleo antisense strand may be represented by the formula : tides . [ 02891. In one embodiment, the antisense strand sequence 5' n ,- N _ - Y 'Y 'Y '- N , -19 . 30 (Ia ). of the RNAi may be represented by formula ( II) : [0307 ] When the antisense strand is represented as for ( II) mula ( Ila ) , each Na' independently represents an oligonucle 5' nc - N . - (Z ' Z 'Z ') x -N ,' - Y ' Y ' Y '- N ,' - (X 'X 'X ') - N ', - 1 ,' 3 ' otide sequence comprising 2 - 20 , 2 - 15 , or 2 - 10 modified 0290 ] wherein : nucleotides . Each of X ', Y ' and Z ' may be the same or [ 0291 ] k and 1 are each independently 0 or 1 ; different from each other . [ 0292] p ' and q ' are each independently 0 - 6 ; [0308 ] Each nucleotide of the sense strand and antisense [0293 ] each Nd' independently represents an oligonucle strand may be independently modified with LNA , CRN , otide sequence comprising 0 - 25 modified nucleotides , each UNA , cEt, HNA , CENA , 2' - methoxyethyl , 2 - O -methyl , sequence comprising at least two differently modified 2 - O -allyl , 2 -C — allyl, 2' - hydroxyl , or 2 - fluoro . For nucleotides ; example , each nucleotide of the sense strand and antisense [0294 ] each N ' independently represents an oligonucle strand is independently modified with 2 - O - methyl or otide sequence comprising 0 - 10 modified nucleotides ; 2 '- fluoro . Each X , Y , Z , X ', Y ', and Z ', in particular , may [0295 ] each n , ' and nn' independently represent an over represent a 2 - O -methyl modification or a 2 - fluoro modifi hang nucleotide ; cation . [ 0296 ] wherein N ' and Y ' do not have the same modifi [03091 . In some embodiments , the sense strand of the cation ; and dsRNAi agent may contain YYY motif occurring at 9 , 10 , [0297 ] X ' X ' X ', Y ' Y ' Y ', and Z ' Z' Z ' each independently rep and 11 positions of the strand when the duplex region is 21 resent one motif of three identical modifications on three nt, the count starting from the first nucleotide from the consecutive nucleotides. 5 '- end , or optionally , the count starting at the first paired [0298 ] In some embodiments , the N ' or N , ' comprises nucleotide within the duplex region , from the 5 '- end ; and Y modifications of alternating pattern . represents 2 ' - F modification . The sense strand may addition [0299 ] The Y ' Y 'Y 'motif occurs at or near the cleavage site ally contain XXX motif or ZZZ motifs as wing modifica of the antisense strand. For example , when the dsRNAI tions at the opposite end of the duplex region ; and XXX and agent has a duplex region of 17 - 23 nucleotides in length , the ZZZ each independently represents a 2 ' -OMe modification Y ' Y ' Y ' motif can occur at positions 9 , 10 , 11 , 10 , 11 , 12 , 11 , or 2 - F modification . 12 , 13 ; 12 , 13 , 14 ; or 13, 14 , 15 of the antisense strand , with [0310 ] In some embodiments the antisense strand may the count starting from the first nucleotide , from the 5 ' - end ; contain Y ' Y ' Y ' motif occurring at positions 11 , 12 , 13 of the or optionally , the count starting at the first paired nucleotide strand , the count starting from the first nucleotide from the within the duplex region , from the 5 '- end . Preferably, the 5 '- end , or optionally , the count starting at the first paired Y ' Y ' Y ' motif occurs at positions 11, 12 , 13 . nucleotide within the duplex region , from the 5 ' - end ; and Y ' [0300 ] In certain embodiments, Y ' Y ' Y ' motif is all 2 -OMe represents 2 - O -methyl modification . The antisense strand modified nucleotides . may additionally contain X ' X ' X ' motif or Z ' Z ' Z ' motifs as 10301 ] In certain embodiments , k is 1 and 1 is 0 , or k is 0 wing modifications at the opposite end of the duplex region ; and 1 is 1 , or both k and 1 are 1 . and X ' X ' X ' and Z ' Z ' Z ' each independently represents a [0302 ] The antisense strand can therefore be represented 2 ' -OMe modification or 2 '- F modification . by the following formulas: [0311 ] The sense strand represented by any one of the 5' n , - 1 , -Z 'Z 'Z - N ,' - Y' Y ' Y' - N -n ,. 3' (IIb ); above formulas ( la ) , ( Ib ) , (Ic ) , and ( Id ) forms a duplex with a antisense strand being represented by any one of formulas 5' ng - N - YYYY - N XXX - 23 ( IIC ) ; or ( Ila ), ( IIb ), ( IIC ), and ( IId ), respectively . [0312 ] Accordingly, the dsRNAi agents for use in the 5ng - N -ZZZ - NE- YYYYY - NU - XXX- Na- n - 3 ' (III ) . methods of the invention may comprise a sense strand and [ 0303] When the antisense strand is represented by for an antisense strand , each strand having 14 to 30 nucleotides , mula ( IIb ), N ,' represents an oligonucleotide sequence com the iRNA duplex represented by formula ( III) : prising 0 - 10 , 0 - 7 , 0 - 10 , 0 - 7 , 0 - 5 , 0 - 4 , 0 - 2 , or o modified nucleotides . Each N ' independently represents an oligo sense : 5 'n , - Na - ( XXX ), - N - YYY- NG - ( ZZZ ); - Na - 1 , 3" nucleotide sequence comprising 2 - 20 , 2 - 15 , or 2 - 10 modi antisense: 3' ng -Na - ( X 'X ' X ) - N -YYY - N -( ZZZ ) fied nucleotides. -- Na - ng '5 ' ( III) [ 0304 ] When the antisense strand is represented as for mula ( IIC ) , N ,' represents an oligonucleotide sequence 0313 ] wherein : comprising 0 - 10 , 0 - 7 , 0 - 10 , 0 -7 , 0 -5 , 0 - 4 , 0 - 2, or o modified [ 0314 ] j, k , and I are each independently 0 or 1 ; nucleotides . Each Na' independently represents an oligo [0315 ] p , p ', q , and q ' are each independently 0 - 6 ; nucleotide sequence comprising 2 -20 , 2 - 15 , or 2 - 10 modi [0316 ] each N , and Na' independently represents an oli fied nucleotides . gonucleotide sequence comprising 0 - 25 modified nucleo [ 0305 ] When the antisense strand is represented as for tides, each sequence comprising at least two differently mula ( IId ) , each N ' independently represents an oligonucle - modified nucleotides ; US 2018 /0201929 A1 Jul. 19 , 2018 33

[0317 ] each N , and N , ' independently represents an oli three of the Y nucleotides all form base pairs with the gonucleotide sequence comprising 0 - 10 modified nucleo corresponding Y ' nucleotides. tides ; 10328 ]. When the dsRNAi agent is represented by formula [0318 ] wherein each n ,' , n , , n ,' , and n ,, each of which may ( IIIb ) or ( IIId ) , at least one of the Z nucleotides may form a or may not be present, independently represents an overhang base pair with one of the Z ' nucleotides . Alternatively , at nucleotide ; and least two of the Z nucleotides form base pairs with the [0319 ] XXX , YYY, ZZZ , X ' X ' X ', Y ' Y ' Y ' , and Z ' Z ' Z ' each corresponding Z ' nucleotides; or all three of the Z nucleo independently represent one motif of three identical modi tides all form base pairs with the corresponding Z ' nucleo fications on three consecutive nucleotides . tides . [0320 ] In one embodiment, i is 0 and j is 0 ; or i is 1 and [0329 ] When the dsRNAi agent is represented as formula j is 0 ; or i is O and j is 1 ; or both i and j are 0 ; or both i and (IIIC ) or ( IIId ) , at least one of the X nucleotides may form j are 1 . In another embodiment, k is O and lis 0 ; orkis 1 and a base pair with one of the X ' nucleotides. Alternatively , at 1 is 0 ; k is 0 and 1 is 1 ; or both k and 1 are 0 ; or both k and least two of the X nucleotides form base pairs with the 1 are 1 . corresponding X ' nucleotides ; or all three of the X nucleo [ 0321 ] Exemplary combinations of the sense strand and tides all form base pairs with the corresponding X ' nucleo antisense strand forming an iRNA duplex include the for tides . mulas below : 10330 ] In certain embodiments , the modification on the Y nucleotide is different than the modification on the Y ' 5' n , -Ne - YYY- No - 1 ,3 ' nucleotide , the modification on the Z nucleotide is different than the modification on the Z ' nucleotide , and / or the modi 3 'n ,' - N - Y ' Y 'Y ' -N ,' n '5 ' (IIIa ) fication on the X nucleotide is different than themodification 5 'n , - N -YYY -N , ZZZ- N - 3' on the X ' nucleotide . [ 0331 ] In certain embodiments , when the dsRNAi agent is 3' n ,' - N - Y ' Y ' Y '- N ,' - Z 'Z ' Z' - No' ng ' 5 ' ( III ) represented by formula ( IIId ) , the N , modifications are 2 - O -methyl or 2 ' - fluoro modifications . In other embodi 5 'n , - N . -XXX -Ny - YYY- N -1 ,3 ' ments , when the RNAi agent is represented by formula (IIId ) , the Na modifications are 2 - O -methyl or 2 '- fluoro 3' n - N XXX- NU - YYYY - Nu- ng5 ' ( IIIC ) modifications and n , ' > 0 and at least one n , ' is linked to a neighboring nucleotide a via phosphorothioate linkage . In 5' ng - Na- XXX -N? - YYY- NU- ZZZ - Ngºn 3 yet other embodiments , when the RNAi agent is represented 3' n - N - XXX- NU - YYYY - N - ZZZ - N - n25' (IIId ) by formula ( IIId ) , the N a, modifications are 2 - O -methyl or 2 - fluoro modifications , n , ' > 0 and at least one n , ' is linked to [0322 ] When the dsRNAi agent is represented by formula a neighboring nucleotide via phosphorothioate linkage , and ( IIIa ), each N , independently represents an oligonucleotide the sense strand is conjugated to one or more GalNAC sequence comprising 2 -20 , 2 - 15 , or 2 - 10 modified nucleo derivatives attached through a monovalent, a bivalent or a tides . trivalent branched linker ( described below ) . In other [0323 ] When the dsRNAi agent is represented by formula embodiments , when the RNAi agent is represented by (IIIb ) , each N , independently represents an oligonucleotide formula ( IIId ), the N , modifications are 2 - O -methyl or sequence comprising 1 - 10 , 1 - 7 , 1 - 5 , or 1 - 4 modified nucleo 2 '- fluoro modifications, n , '> 0 and at least one n , ' is linked to tides. Each N , independently represents an oligonucleotide a neighboring nucleotide via phosphorothioate linkage , the sequence comprising 2 - 20, 2 - 15 , or 2 - 10 modified nucleo sense strand comprises at least one phosphorothioate link tides . age, and the sense strand is conjugated to one or more [ 0324 ]. When the dsRNAi agent is represented as formula GalNAc derivatives attached through a monovalent, a biva (IIIC ), each N , N , ' independently represents an oligonucle lent or a trivalent branched linker. otide sequence comprising 0 -10 , 0 - 7 , 0 -10 , 0 - 7 , 7 - 5 , -4 , [0332 ] In some embodiments , when the dsRNAi agent is 0 - 2 , or o modified nucleotides . Each Na independently represented by formula ( IIIa ) , the N , modifications are represents an oligonucleotide sequence comprising 2 - 20 , 2 - O -methyl or 2 - fluoro modifications , n , ' > 0 and at least one 2 - 15 , or 2 - 10 modified nucleotides. n ' is linked to a neighboring nucleotide via phosphoroth [0325 ] When the dsRNAi agent is represented as formula ioate linkage , the sense strand comprises at least one phos ( IIId ) , each N , , N , ' independently represents an oligonucle phorothioate linkage , and the sense strand is conjugated to otide sequence comprising 0 - 10 , 0 - 7 , 0 - 10 , 0 - 7 , 0 - 5 , 0 - 4 , one or more GalNAc derivatives attached through a mon 0 - 2 , or o modified nucleotides. Each N?, N ' independently ovalent, a bivalent or a trivalent branched linker . represents an oligonucleotide sequence comprising 2 - 20 , [ 0333 ] In some embodiments, the dsRNAi agent is a 2 - 15 , or 2 - 10 modified nucleotides. Each of N , N , ', N , and multimer containing at least two duplexes represented by N , independently comprises modifications of alternating formula ( III) , ( IIIa ) , ( IIIb ) , ( IIIC ) , and ( IIId ) , wherein the pattern . duplexes are connected by a linker . The linker can be [0326 ] Each of X , Y, and Z in formulas ( III ), ( IIIa ) , ( IIIb ), cleavable or non - cleavable . Optionally , the multimer further ( IIIC ), and ( IIId ) may be the same or different from each comprises a ligand . Each of the duplexes can target the same other. gene or two different genes ; or each of the duplexes can [ 0327 ] When the dsRNAi agent is represented by formula target same gene at two different target sites . ( III ), ( IIIa ), (IIIb ), (IIIc ) , and (IIId ) , at least one of the Y [0334 ] In some embodiments , the dsRNAi agent is a nucleotides may form a base pair with one of the Y ' multimer containing three , four, five, six , ormore duplexes nucleotides . Alternatively , at least two of the Y nucleotides represented by formula (III ), (IIIa ), ( IIIb ), ( IIIc ) , and (IIId ) , form base pairs with the corresponding Y ' nucleotides ; or all wherein the duplexes are connected by a linker. The linker US 2018 /0201929 A1 Jul. 19 , 2018 34 can be cleavable or non - cleavable . Optionally , the multimer ryl, and decalin ; preferably , the acyclic group is a serinol further comprises a ligand . Each of the duplexes can target backbone or diethanolamine backbone . the same gene or two different genes ; or each of the duplexes [0340 ] In certain embodiments , the iRNA for use in the can target same gene at two different target sites. methods of the invention for inhibiting the expression of an [ 0335 ]. In one embodiment, two dsRNAi agents repre IGFALS gene is an agent selected from the agents listed in sented by at least one of formulas ( III ), ( IIIa ), ( IIIb ) , ( IIIc ), any one of Tables 3 , 5 , 6 , 8 , 12 , and 14 . These agents may and ( IIId ) are linked to each other at the 5 ' end, and one or further comprise a ligand . These agents may further com both of the 3 ' ends, and are optionally conjugated to a ligand . prise a ligand . Each of the agents can target the same gene or two different [0341 ] In certain embodiments , the iRNA for use in the genes; or each of the agents can target same gene at two methods of the invention for inhibiting the expression of an different target sites. IGF - 1 gene is an agent selected from the agents listed in any [0336 ] Various publications describe multimeric iRNAs one of Tables 9 , 11 , 15 , 17 , 18 , and 20 . These agents may that can be used in the methods of the invention . Such further comprise a ligand . publications include U . S . Pat. No. 7 , 858 , 769, WO2007 / 091269, WO2010 / 141511, WO2007/ 117686 , WO2009 / III . iRNAs Conjugated to Ligands 014887 , and WO2011 /031520 the entire contents of each of [0342 ] Another modification of the RNA of an iRNA of which are hereby incorporated herein by reference . the invention involves chemically linking to the iRNA one [ 0337 ] As described in more detail below , the iRNA that or more ligands , moieties or conjugates that enhance the contains conjugations of one or more carbohydrate moieties activity , cellular distribution , or cellular uptake of the iRNA to an iRNA can optimize one or more properties of the e. g ., into a cell. For example , the ligand can be attached to iRNA . In many cases , the carbohydrate moiety will be the sense strand, antisense strand or both strands , at the attached to a modified subunit of the iRNA . For example, the 3 '- end , 5 '- end or both ends. For instance, the ligand may be ribose sugar of one or more ribonucleotide subunits of a conjugated to the sense strand . In preferred embodiments , iRNA can be replaced with another moiety , e .g ., a non the ligand is conjugated to the 3 '- end of the sense strand . carbohydrate (preferably cyclic ) carrier to which is attached Such moieties include but are not limited to lipid moieties a carbohydrate ligand . A ribonucleotide subunit in which the such as a cholesterol moiety (Letsinger et al . , Proc . Natl . ribose sugar of the subunit has been so replaced is referred Acid . Sci. USA , 1989 , 86 : 6553 -6556 ) , cholic acid (Mano to herein as a ribose replacement modification subunit haran et al ., Biorg . Med . Chem . Let. , 1994 , 4 : 1053 - 1060 ). In (RRMS ) . A cyclic carrier may be a carbocyclic ring system , certain embodiments , the modification can include a thio i .e . , all ring atoms are carbon atoms , or a heterocyclic ring ether, e. g ., beryl- S - tritylthiol (Manoharan et al ., Ann . N . Y. system , i. e. , one or more ring atoms may be a heteroatom , Acad . Sci. , 1992 , 660 :306 - 309 ; Manoharan et al . , Biorg . e . g ., nitrogen , oxygen , sulfur. The cyclic carrier may be a Med . Chem . Let. , 1993 , 3 : 2765 - 2770 ) , a thiocholesterol monocyclic ring system , or may contain two or more rings , (Oberhauser et al ., Nucl. Acids Res. , 1992 , 20 :533 -538 ) , an e . g . fused rings . The cyclic carrier may be a fully saturated aliphatic chain , e . g ., dodecandiol or undecyl residues ring system , or it may contain one or more double bonds. (Saison -Behmoaras et al. , EMBO J, 1991 , 10 : 1111 - 1118 ; [ 0338 ] The ligand may be attached to the polynucleotide Kabanov et al ., FEBS Lett. , 1990 , 259 : 327 - 330 ; Svinarchuk via a carrier. The carriers include ( i ) at least one “ backbone et al. , Biochimie , 1993 , 75: 49 - 54 ) , a phospholipid , e . g ., attachment point, ” preferably two “ backbone attachment di- hexadecyl - rac - glycerol or triethyl- ammonium 1 , 2 - di- O points ” and ( ii ) at least one “ tethering attachment point. ” A hexadecyl- rac - glycero - 3 -phosphonate (Manoharan et al. , “ backbone attachment point” as used herein refers to a Tetrahedron Lett. , 1995 , 36 : 3651 - 3654 ; Shea et al. , Nucl. functional group , e . g . a hydroxyl group , or generally , a bond Acids Res. , 1990 , 18 :3777 - 3783 ), a polyamine or a polyeth available for, and that is suitable for incorporation of the ylene glycol chain (Manoharan et al. , Nucleosides & carrier into the backbone, e . g ., the phosphate, or modified Nucleotides , 1995 , 14 : 969- 973 ) , or adamantane acetic acid phosphate , e. g ., sulfur containing , backbone, of a ribo (Manoharan et al. , Tetrahedron Lett. , 1995 , 36 : 3651 -3654 ) , nucleic acid . A “ tethering attachment point” ( TAP ) in some a palmityl moiety (Mishra et al. , Biochim . Biophys. Acta , embodiments refers to a constituent ring atom of the cyclic 1995 , 1264 : 229 - 237 ) , or an octadecylamine or hexylamino carrier , e . g ., a carbon atom or a heteroatom (distinct from an carbonyloxycholesterolmoiety ( Crooke et al ., J . Pharmacol. atom which provides a backbone attachment point) , that Exp . Ther. , 1996 , 277 : 923 -937 ) . connects a selected moiety . The moiety can be , e . g ., a [0343 ] In certain embodiments , a ligand alters the distri carbohydrate , e . g . monosaccharide, disaccharide, trisaccha bution , targeting or lifetime of an iRNA agent into which it ride, tetrasaccharide, oligosaccharide, or polysaccharide . is incorporated . In preferred embodiments a ligand provides Optionally, the selected moiety is connected by an interven an enhanced affinity for a selected target, e . g ., molecule, cell ing tether to the cyclic carrier. Thus , the cyclic carrier will or cell type , compartment, e . g . , a cellular or organ compart often include a functional group , e . g . , an amino group , or ment, tissue , organ or region of the body , as , e . g ., compared generally, provide a bond , that is suitable for incorporation to a species absent such a ligand . Preferred ligands do not or tethering of another chemical entity , e . g . , a ligand to the take part in duplex pairing in a duplexed nucleic acid . constituent ring. [0344 ] Ligands can include a naturally occurring sub [ 0339 ] The iRNA may be conjugated to a ligand via a stance , such as a protein ( e . g . , human serum albumin (HSA ) , carrier, wherein the carrier can be cyclic group or acyclic low - density lipoprotein ( LDL ), or globulin ); carbohydrate group ; preferably , the cyclic group is selected from pyrro ( e . g ., a dextran , pullulan , chitin , chitosan , inulin , cyclodex lidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazo trin , N - acetylgalactosamine , or hyaluronic acid ) ; or a lipid . lidinyl, piperidinyl, piperazinyl, [ 1, 3 ]dioxolane , oxazolidi The ligand can also be a recombinant or synthetic molecule , nyl, isoxazolidinyl, morpholinyl, thiazolidinyl, such as a synthetic polymer, e . g . , a synthetic polyamino acid . isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofu Examples of polyamino acids include polyamino acid is a US 2018 /0201929 A1 Jul. 19 , 2018 35

polylysine (PLL ) , poly L - aspartic acid , poly L - glutamic vincristine , vinblastine, cytochalasin , nocodazole , acid , styrene -maleic acid anhydride copolymer, poly (L - lac - japlakinolide, latrunculin A , phalloidin , swinholide A , tide- co - glycolied ) copolymer, divinyl ether -maleic anhy indanocine, or myoservin . dride copolymer , N - (2 -hydroxypropyl )methacrylamide [0349 ]. In some embodiments , a ligand attached to an copolymer (HMPA ), polyethylene glycol (PEG ) , polyvinyl iRNA as described herein acts as a pharmacokinetic modu alcohol (PVA ), polyurethane , poly ( 2 - ethylacryllic acid ) , lator ( PK modulator) . PK modulators include lipophiles , bile N - isopropylacrylamide polymers , or polyphosphazine . acids, steroids, phospholipid analogues , peptides, protein Example of polyamines include : polyethylenimine , polyly binding agents , PEG , vitamins etc . Exemplary PK modula sine (PLL ), spermine, spermidine , polyamine, pseudopep tors include , but are not limited to , cholesterol, fatty acids , tide - polyamine , peptidomimetic polyamine , dendrimer cholic acid , lithocholic acid , dialkylglycerides , diacylglyc polyamine , arginine , amidine , protamine, cationic lipid , cat eride , phospholipids, sphingolipids, naproxen , ibuprofen , ionic porphyrin , quaternary salt of a polyamine , or an alpha vitamin E , biotin etc . Oligonucleotides that comprise a helical peptide . number of phosphorothioate linkages are also known to bind [0345 ] Ligands can also include targeting groups, e . g ., a to serum protein , thus short oligonucleotides, e . g. , oligo cell or tissue targeting agent , e . g ., a lectin , glycoprotein , nucleotides of about 5 bases , 10 bases, 15 bases, or 20 bases , lipid or protein , e .g . , an antibody, that binds to a specified comprising multiple of phosphorothioate linkages in the cell type such as a kidney cell . A targeting group can be a backbone are also amenable to the present invention as thyrotropin , melanotropin , lectin , glycoprotein , surfactant ligands ( e . g . as PK modulating ligands) . In addition , aptam protein A , Mucin carbohydrate , multivalent lactose , mon ers that bind serum components ( e . g . serum proteins ) are ovalent or multivalent galactose , N -acetyl - galactosamine , also suitable for use as PK modulating ligands in the N - acetyl- glucoseamine multivalent mannose , multivalent embodiments described herein . fucose , glycosylated polyaminoacids, transferrin , bisphos [0350 ) Ligand - conjugated iRNAs of the invention may be phonate , polyglutamate , polyaspartate , a lipid , cholesterol, a synthesized by the use of an oligonucleotide that bears a steroid , bile acid , folate , vitamin B12 , vitamin A , biotin , or pendant reactive functionality, such as that derived from the an RGD peptide or RGD peptide mimetic . In certain attachment of a linking molecule onto the oligonucleotide embodiments , ligands include monovalent or multivalent ( described below ) . This reactive oligonucleotide may be galactose . In certain embodiments , ligands include choles reacted directly with commercially - available ligands , terol. ligands that are synthesized bearing any of a variety of [ 0346 ] Other examples of ligands include dyes, interca protecting groups, or ligands that have a linking moiety lating agents ( e . g . acridines ) , cross - linkers ( e . g . psoralene , attached thereto . mitomycin C ) , porphyrins ( TPPC4 , texaphyrin , Sapphyrin ), [0351 ] The oligonucleotides used in the conjugates of the polycyclic aromatic hydrocarbons ( e . g ., phenazine , dihydro present invention may be conveniently and routinely made phenazine ) , artificial endonucleases ( e . g . EDTA ), lipophilic through the well - known technique of solid - phase synthesis . molecules , e . g ., cholesterol, cholic acid , adamantane acetic Equipment for such synthesis is sold by several vendors acid , 1 - pyrene butyric acid , dihydrotestosterone , 1 , 3 -Bis - o including, for example , Applied Biosystems ( Foster City , ( hexadecyl ) glycerol, geranyloxyhexyl group , hexadecyl Calif . ) . Any other means for such synthesis known in the art glycerol, borneol, menthol, 1 , 3 -propanediol , heptadecyl may additionally or alternatively be employed . It is also group , palmitic acid , myristic acid , 03 - (oleoyl ) lithocholic known to use similar techniques to prepare other oligonucle acid , O3 - (oleoyl ) cholenic acid , dimethoxytrityl, or phenox otides, such as the phosphorothioates and alkylated deriva azine ) and peptide conjugates ( e .g ., antennapedia peptide , tives . Tat peptide ) , alkylating agents , phosphate , amino , mercapto , [0352 ] In the ligand - conjugated iRNAs and ligand -mol PEG ( e . g ., PEG - 40K ) , MPEG , [MPEG ] 2 , polyamino, alkyl, ecule bearing sequence -specific linked nucleosides of the substituted alkyl, radiolabeled markers , enzymes , haptens present invention , the oligonucleotides and oligonucleosides ( e . g . biotin ) , transport/ absorption facilitators ( e . g ., aspirin , may be assembled on a suitable DNA synthesizer utilizing vitamin E , folic acid ), synthetic ribonucleases (e . g. , imida standard nucleotide or nucleoside precursors , or nucleotide zole , bisimidazole , histamine , imidazole clusters , acridine or nucleoside conjugate precursors that already bear the imidazole conjugates , Eu3 + complexes of tetraazamacro linking moiety , ligand -nucleotide or nucleoside - conjugate cycles ), dinitrophenyl, HRP , or AP . precursors that already bear the ligand molecule , or non [ 0347 ] Ligands can be proteins, e . g. , glycoproteins, or nucleoside ligand -bearing building blocks . peptides, e . g ., molecules having a specific affinity for a [0353 ] When using nucleotide -conjugate precursors that co - ligand , or antibodies e. g ., an antibody, that binds to a already bear a linking moiety , the synthesis of the sequence specified cell type such as a hepatic cell. Ligands can also specific linked nucleosides is typically completed , and the include hormones and hormone receptors. They can also ligand molecule is then reacted with the linking moiety to include non -peptidic species , such as lipids, lectins , carbo form the ligand -conjugated oligonucleotide . In some hydrates , vitamins , cofactors , multivalent lactose , multiva embodiments , the oligonucleotides or linked nucleosides of lent galactose , N - acetyl- galactosamine, N -acetyl - gulu the present invention are synthesized by an automated cosamine multivalent mannose , or multivalent fucose . The synthesizer using phosphoramidites derived from ligand ligand can be , for example , a lipopolysaccharide, an activa nucleoside conjugates in addition to the standard phosphora tor of p38 MAP kinase , or an activator of NF -KB . midites and non - standard phosphoramidites that are com [ 0348 ] The ligand can be a substance , e . g . , a drug , which mercially available and routinely used in oligonucleotide can increase the uptake of the iRNA agent into the cell , for synthesis . example , by disrupting the cell' s cytoskeleton , e . g. , by [0354 ] A . Lipid Conjugates In certain embodiments , the disrupting the cell' s microtubules , microfilaments , or inter - ligand or conjugate is a lipid or lipid - based molecule . Such mediate filaments . The drug can be , for example , taxon , a lipid or lipid -based molecule preferably binds a serum US 2018 /0201929 A1 Jul. 19 , 2018 36 protein , e . g ., human serum albumin (HSA ) . An HSA binding phobic membrane translocation sequence (MTS ) . An exem ligand allows for distribution of the conjugate to a target plary hydrophobic MTS - containing peptide is RFGF having tissue , e .g ., a non -kidney target tissue of the body . For the amino acid sequence AAVALLPAVLLALLAP (SEQ ID example , the target tissue can be the liver, including paren NO : 24 ) . An RFGF analogue ( e . g . , amino acid sequence chymal cells of the liver. Other molecules that can bind HSA AALLPVLLAAP (SEQ ID NO : 25) containing a hydropho can also be used as ligands . For example , naproxen or bic MTS can also be a targeting moiety . The peptide moiety aspirin can be used . A lipid or lipid -based ligand can ( a ) can be a “ delivery ” peptide , which can carry large polar increase resistance to degradation of the conjugate, ( b ) molecules including peptides , oligonucleotides, and protein increase targeting or transport into a target cell or cell across cell membranes . For example , sequences from the membrane , or ( c ) can be used to adjust binding to a serum HIV Tat protein (GRKKRRORRRPPQ (SEQ ID NO : 26 ) protein , e . g . , HSA . and the Drosophila Antennapedia protein (RQIKIWFQN [0355 ] A lipid based ligand can be used to inhibit, e . g ., RRMKWKK (SEQ ID NO :27 ) have been found to be control the binding of the conjugate to a target tissue . For capable of functioning as delivery peptides. A peptide or example , a lipid or lipid -based ligand that binds to HSA peptidomimetic can be encoded by a random sequence of more strongly will be less likely to be targeted to the kidney DNA , such as a peptide identified from a phage - display and therefore less likely to be cleared from the body . A lipid library, or one- bead -one -compound (OBOC ) combinatorial or lipid -based ligand that binds to HSA less strongly can be library (Lam et al. , Nature , 354 : 82 -84 , 1991 ) . Examples of used to target the conjugate to the kidney . a peptide or peptidomimetic tethered to a dsRNA agent via [0356 ] In certain embodiments, the lipid based ligand an incorporated monomer unit for cell targeting purposes is binds HSA . Preferably , it binds HSA with a sufficient affinity an arginine - glycine - aspartic acid (RGD ) - peptide, or RGD such that the conjugate will be preferably distributed to a mimic . A peptide moiety can range in length from about 5 non - kidney tissue . However, it is preferred that the affinity amino acids to about 40 amino acids . The peptide moieties not be so strong that the HSA - ligand binding cannot be can have a structural modification , such as to increase reversed . stability or direct conformational properties . Any of the [0357 ] In other embodiments , the lipid based ligand binds structural modifications described below can be utilized . HSA weakly or not at all, such that the conjugate will be 10362 ] An RGD peptide for use in the compositions and preferably distributed to the kidney . Other moieties that methods of the invention may be linear or cyclic , and may target to kidney cells can also be used in place of, or in be modified , e . g ., glycosylated or methylated , to facilitate addition to , the lipid based ligand . targeting to a specific tissue ( s ) . RGD - containing peptides [0358 ] In another aspect, the ligand is a moiety , e .g . , a and peptidiomimemtics may include D - amino acids, as well vitamin , which is taken up by a target cell , e .g ., a prolifer as synthetic RGD mimics . In addition to RGD , one can use ating cell . These are particularly useful for treating disorders other moieties that target the integrin ligand . Preferred characterized by unwanted cell proliferation , e . g ., of the conjugates of this ligand target PECAM - 1 or VEGF. malignant or non -malignant type , e . g . , cancer cells . Exem [0363 ] A “ cell permeation peptide ” is capable of perme plary vitamins include vitamin A , E , and K . Other exemplary ating a cell, e . g ., a microbial cell , such as a bacterial or vitamins include are B vitamin , e . g ., folic acid , B12 , ribo fungal cell, or a mammalian cell, such as a human cell . A flavin , biotin , pyridoxal or other vitamins or nutrients taken microbial cell- permeating peptide can be, for example , an up by target cells such as liver cells . Also included are HSA a -helical linear peptide ( e . g ., LL - 37 or Ceropin P1 ) , a and low density lipoprotein (LDL ) . disulfide bond - containing peptide ( e . g . , a - defensin , B -de [0359 ] B . Cell Permeation Agents In another aspect, the fensin or bactenecin ) , or a peptide containing only one or ligand is a cell -permeation agent, preferably a helical cell two dominating amino acids ( e . g . , PR - 39 or indolicidin ) . A permeation agent. Preferably , the agent is amphipathic . An cell permeation peptide can also include a nuclear localiza exemplary agent is a peptide such as tat or antennopedia . If tion signal (NLS ) . For example , a cell permeation peptide the agent is a peptide, it can be modified , including a can be a bipartite amphipathic peptide, such as MPG , which peptidylmimetic , invertomers , non -peptide or pseudo - pep is derived from the fusion peptide domain of HIV - 1 gp41 tide linkages , and use of D - amino acids . The helical agent is and the NLS of SV40 large T antigen (Simeoni et al. , Nucl . preferably an alpha - helical agent, which preferably has a Acids Res . 31 :2717 - 2724 , 2003 ) . lipophilic and a lipophobic phase . [0364 ] C . Carbohydrate Conjugates [ 0360 ] The ligand can be a peptide or peptidomimetic . A [0365 ] In some embodiments of the compositions and peptidomimetic (also referred to herein as an oligopeptido methods of the invention , an iRNA further comprises a mimetic ) is a molecule capable of folding into a defined carbohydrate . The carbohydrate conjugated iRNA is advan three - dimensional structure similar to a natural peptide . The tageous for the in vivo delivery of nucleic acids, as well as attachment of peptide and peptidomimetics to iRNA agents compositions suitable for in vivo therapeutic use, as can affect pharmacokinetic distribution of the iRNA , such as described herein . As used herein , “ carbohydrate ” refers to a by enhancing cellular recognition and absorption . The pep compound which is either a carbohydrate per se made up of tide or peptidomimetic moiety can be about 5 -50 amino one or more monosaccharide units having at least 6 carbon acids long, e . g ., about 5 , 10 , 15, 20 , 25, 30 , 35 , 40 , 45 , or 50 atoms (which can be linear , branched or cyclic ) with an amino acids long . oxygen , nitrogen or sulfur atom bonded to each carbon [ 0361] A peptide or peptidomimetic can be, for example , atom ; or a compound having as a part thereof a carbohydrate a cell permeation peptide , cationic peptide , amphipathic moiety made up of one or more monosaccharide units each peptide , or hydrophobic peptide ( e . g . , consisting primarily having at least six carbon atoms (which can be linear, of Tyr, Trp , or Phe ) . The peptide moiety can be a dendrimer branched or cyclic ) , with an oxygen , nitrogen or sulfur atom peptide , constrained peptide or crosslinked peptide . In bonded to each carbon atom . Representative carbohydrates another alternative, the peptide moiety can include a hydro include the sugars (mono -, di- , tri- , and oligosaccharides US 2018 /0201929 A1 Jul. 19 , 2018 37 containing from about 4 , 5 , 6 , 7 , 8 , or 9 monosaccharide [0366 ] In certain embodiments , a carbohydrate conjugate units ), and polysaccharides such as starches , glycogen , cel for use in the compositions and methods of the invention is lulose and polysaccharide gums. Specific monosaccharides a monosaccharide . include C5 and above ( e . g . , C5 , C6 , C7 , or C8 ) sugars ; di- (0367 ] In other embodiments , a carbohydrate conjugate and trisaccharides include sugars having two or three mono for use in the compositions and methods of the invention is selected from the group : saccharide units ( e . g ., C5 , C6 , C7 , or C8 ) . Formula II HO OH

HO

AcHN

HO OH

. HO AcHN

HO OH N N AcHN Formula III HO HO HOTO

HO- HOOmust un NH HO HO HO HO

Formula IV Formula V OH OH HO HO

??)

NHAC NHAC HOOH Ni w OH HO HO NHAC HO .

NHAC US 2018 /0201929 A1 Jul. 19 , 2018 38

-continued Formula VI Formula VII HO OH HO OH HO HO NHAC HO OH NHAC HO OH 05 > M HO HO NH NHAC HO OH NHAC 03 HO .

NHAC

Formula VIII BzoBz0 BzO OBZ Bzo BzoBzO2 OBZ Bz0 Aco Bzo

Formula IX HO OH

HO AcHN

HO OH

me > HO AcHN

HO OH

HO , LumiinitAcHN N US 2018/ 0201929A1 Jul . 19 , 2018 39

- continued

Formula X HO OH

H0 ? ACHN

HO OH

H0 z? AcHN HO OH

H0 ? TZ AcHN

Formula XI P03 0 HU Ht )

P03 TZ 0 UH H0 H0??

o/?? Virg OoH } ? H0H }. ? ? US 2018/ 0201929A1 Jul . 19, 2018 40

- continued Formula XII P03 0 OH 1C0 ?

PO3°

H0 0 ?

P03 60 ? H0 H } .

Formula XIII HO OH

H0 ? AcHN 0g ACHN HO OH ??? ? H0?? AcHN HO OH

H0 AcHN Formula XIV Formula XV H0 ? OH HO OH

HO , OH H? OH H0?? AcHN AcHN H0 ?? H Ifr H Illll( AcHN nnnw AcHN in

Formula XVI Formula XVII HO OH OH

HOOH H { ?? OH _ HOI0 ? AcHN HI NH , H0 ?? llll AcHN ??ng nnnw US 2018 /0201929 A1 Jul. 19 , 2018 41

-continued szerint Formula XVIII: Formula XIX OH OH ?? ???? HO ???? . HCHOHO ?? 0 retrationN memoriesm

Formula XX Formula XXI HOITOAHO HOTOHO JIS OH HORHO OH NH ?????? NH m NH

Formula XXII HO OH

HOR OH HO NH NH

[ 0368 ] In certain embodiments , the ligand is an N -acetyl - [0370 ] In some embodiments , for example , when the two galactosamine (GalNAc ) or GalNAc derivative . In certain strands of an iRNA agent of the invention are part of one larger molecule connected by an uninterrupted chain of embodiments of the invention , the GalNAc or GalNAc nucleotides between the 3 ' - end of one strand and the 5 ' - end derivative is attached to an iRNA agent of the invention via of the respective other strand forming a hairpin loop com a monovalent linker. In some embodiments , the GalNAc or prising , a plurality of unpaired nucleotides , each unpaired GalNAc derivative is attached to an iRNA agent of the nucleotide within the hairpin loop may independently com invention via a bivalent linker. In yet other embodiments of prise a GalNAc or GalNAc derivative attached via a mon the invention , the GalNAc or GalNAc derivative is attached ovalent linker. The hairpin loop may also be formed by an to an iRNA agent of the invention via a trivalent linker. extended overhang in one strand of the duplex . [ 0369] In one embodiment, the double stranded RNAi . 10371 ] The GalNAc or GalNAc derivative may be conju agents of the invention comprise one GalNAc or GalNAC gated to the 3 ' end of the sense strand of the double stranded derivative attached to the iRNA agent . In another embodi RNAi agent, the 5 ' end of the sense strand of the double ment, the double stranded RNAi agents of the invention stranded RNAi agent, the 3 ' end of the antisense strand of the comprise a plurality (e . g ., 2 , 3 , 4 , 5 , or 6 ) GalNAc or double stranded RNAi agent , or the 5 ' end of the antisense GalNAc derivatives, each independently attached to a plu strand of the double stranded RNAi agent. In certain rality of nucleotides of the double stranded RNAi agent embodiments, the monosaccharide is an N -acetylgalac through a plurality of monovalent linkers . tosamine , such as USUS 2018 20180301928 /0201929 A A1 42 Jul. 19 , 2018

Formula I HO OH

HO AcHN

HO OH

mm HO N AcHN

HO OH

HenningAcHN

10372 ] Another representative carbohydrate conjugate for use in the embodiments described herein includes, but is not limited to , US 2018 /0201929 A1 Jul. 19 , 2018 43 storyTheY-0

HN W111111

=

O —

N HN wicht

OH AcHN ?? AcHN HO HON ?? HON OH AcHN HOhonen HO US 2018 /0201929 A1 Jul. 19 , 2018 44

[ 0373 ] ( Formula XXIII ) , when one of X or Y is an include : redox agents which are selected for particular oligonucleotide , the other is a hydrogen . substrates or which have no substrate specificity , including , [0374 ] In some embodiments , the carbohydrate conjugate e . g ., oxidative or reductive enzymes or reductive agents further comprises one or more additional ligands as such as mercaptans, present in cells , that can degrade a redox described above , such as , but not limited to , a PK modulator cleavable linking group by reduction ; esterases ; endosomes or a cell permeation peptide . or agents that can create an acidic environment, e . g . , those [ 0375 ] Additional carbohydrate conjugates suitable for that result in a pH of five or lower; enzymes that can use in the present invention include those described in PCT hydrolyze or degrade an acid cleavable linking group by Publication Nos . WO 2014 / 179620 and WO 2014 / 179627 , acting as a general acid , peptidases (which can be substrate the entire contents of each of which are incorporated herein specific ) , and phosphatases. by reference . [0381 ] A cleavable linkage group , such as a disulfide bond [ 0376 ] D . Linkers can be susceptible to pH . The pH of human serum is 7 . 4 , [ 0377 ] In some embodiments , the conjugate or ligand while the average intracellular pH is slightly lower, ranging described herein can be attached to an iRNA oligonucleotide from about 7 . 1 - 7 . 3 . Endosomes have a more acidic pH , in with various linkers that can be cleavable or non - cleavable . the range of 5. 5 -6 . 0 , and lysosomes have an even more [0378 ] The term " linker ” or “ linking group ” means an acidic pH at around 5 . 0 . Some linkers will have a cleavable organic moiety that connects two parts of a compound , e .g ., linking group that is cleaved at a preferred pH , thereby covalently attaches two parts of a compound . Linkers typi releasing a cationic lipid from the ligand inside the cell, or cally comprise a direct bond or an atom such as oxygen or into the desired compartment of the cell . sulfur, a unit such as NR8 , C (O ), C (O )NH , SO , SO2, SO NH [0382 ] A linker can include a cleavable linking group that or a chain of atoms, such as, but not limited to , substituted is cleavable by a particular enzyme. The type of cleavable or unsubstituted alkyl , substituted or unsubstituted alkenyl, linking group incorporated into a linker can depend on the substituted or unsubstituted alkynyl , arylalkyl, arylalkenyl, cell to be targeted . For example , a liver- targeting ligand can arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroaryl be linked to a cationic lipid through a linker that includes an alkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocy ester group . Liver cells are rich in esterases , and therefore clylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, the linker will be cleaved more efficiently in liver cells than cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylal in cell types that are not esterase - rich . Other cell - types rich kynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylal in esterases include cells of the lung , renal cortex , and testis . kynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylal [0383 ] Linkers that contain peptide bonds can be used kynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, when targeting cell types rich in peptidases , such as liver alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylhet cells and synoviocytes. eroarylalkenyl, alkenylheteroarylalkynyl , alkynylheteroary [0384 ] In general, the suitability of a candidate cleavable lalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, linking group can be evaluated by testing the ability of a alkylheterocyclylalkyl , alkylheterocyclylalkenyl, alkyl degradative agent ( or condition ) to cleave the candidate hererocyclylalkynyl , alkenylheterocyclylalkyl, alkenylhet linking group . It will also be desirable to also test the erocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylhet candidate cleavable linking group for the ability to resist erocyclylalkyl , alkynylheterocyclylalkenyl, cleavage in the blood or when in contact with other non alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alky target tissue. Thus, one can determine the relative suscep nylaryl, alkylheteroaryl, alkenylheteroaryl, alkynyl tibility to cleavage between a first and a second condition , hereroaryl, which one or more methylenes can be interrupted where the first is selected to be indicative of cleavage in a or terminated by O , S , S ( O ) , SO , , N ( R8 ) , C ( O ), substituted target cell and the second is selected to be indicative of or unsubstituted aryl, substituted or unsubstituted heteroaryl, cleavage in other tissues or biological fluids, e . g ., blood or or substituted or unsubstituted heterocyclic ; where R8 is serum . The evaluations can be carried out in cell free hydrogen , acyl, aliphatic , or substituted aliphatic . In one systems, in cells , in cell culture, in organ or tissue culture, embodiment, the linker is between about 1 - 24 atoms, 2 - 24 , or in whole animals . It can be useful to make initial 3 - 24 , 4 -24 , 5 - 24 , 6 - 24 , 6 - 18 , 7 - 18 , 8 - 18 , 7 - 17 , 8 - 17 , 6 - 16 , evaluations in cell- free or culture conditions and to confirm 7 -16 , or 8 - 16 atoms. by further evaluations in whole animals . In preferred [0379 ] A cleavable linking group is one which is suffi embodiments , useful candidate compounds are cleaved at ciently stable outside the cell , but which upon entry into a least about 2 , 4 , 10 , 20 , 30 , 40 , 50 , 60 , 70 , 80 , 90 , or 100 target cell is cleaved to release the two parts the linker is times faster in the cell ( or under in vitro conditions selected holding together. In a preferred embodiment, the cleavable to mimic intracellular conditions ) as compared to blood or linking group is cleaved at least about 10 times, 20 , times, serum (or under in vitro conditions selected to mimic 30 times, 40 times, 50 times, 60 times, 70 times, 80 times , extracellular conditions ) . 90 times, or 100 times faster in a target cell or under a first [ 0385 ] i . Redox Cleavable Linking Groups reference condition (which can , e . g . , be selected to mimic or [ 0386 ] In certain embodiments , a cleavable linking group represent intracellular conditions ) than in the blood of a is a redox cleavable linking group that is cleaved upon subject, or under a second reference condition (which can , reduction or oxidation . An example of reductively cleavable e .g ., be selected to mimic or represent conditions found in linking group is a disulphide linking group ( S S — ). To the blood or serum ) . determine if a candidate cleavable linking group is a suitable [ 0380 ] Cleavable linking groups are susceptible to cleav “ reductively cleavable linking group ,” or for example is age agents, e . g . , pH , redox potential , or the presence of suitable for use with a particular iRNA moiety and particular degradative molecules . Generally , cleavage agents are more targeting agent one can look to methods described herein . prevalent or found at higher levels or activities inside cells For example , a candidate can be evaluated by incubation than in serum or blood . Examples of such degradative agents with dithiothreitol (DTT ), or other reducing agent using US 2018 /0201929 A1 Jul. 19 , 2018 45

reagents know in the art, which mimic the rate of cleavage cell , specific low pH organelles , such as endosomes and which would be observed in a cell, e . g ., a target cell . The lysosomes can provide a cleaving environment for acid candidates can also be evaluated under conditions which are cleavable linking groups . Examples of acid cleavable link selected to mimic blood or serum conditions . In one, can ing groups include but are not limited to hydrazones , esters , didate compounds are cleaved by atmost about 10 % in the and esters of amino acids. Acid cleavable groups can have blood . In other embodiments , useful candidate compounds the general formula — C = NN — , C ( O ) O , or — OC ( O ) . A preferred embodiment is when the carbon attached to the are degraded at least about 2 , 4 , 10 , 20 , 30 , 40 , 50 , 60 , 70 , oxygen of the ester ( the alkoxy group ) is an aryl group , 80 , 90 , or about 100 times faster in the cell (or under in vitro substituted alkyl group , or tertiary alkyl group such as conditions selected to mimic intracellular conditions ) as dimethyl pentyl or t -butyl . These candidates can be evalu compared to blood ( or under in vitro conditions selected to ated using methods analogous to those described above . mimic extracellular conditions ) . The rate of cleavage of [0391 ] iv . Ester- Based Linking Groups candidate compounds can be determined using standard [0392 ] In other embodiments , a cleavable linker comprises enzyme kinetics assays under conditions chosen to mimic an ester - based cleavable linking group . An ester -based intracellular media and compared to conditions chosen to cleavable linking group is cleaved by enzymes such as mimic extracellular media . esterases and amidases in cells . Examples of ester- based [0387 ] ii . Phosphate -Based Cleavable Linking Groups cleavable linking groups include, but are not limited to , [0388 ] In other embodiments , a cleavable linker comprises esters of alkylene , alkenylene and alkynylene groups . Ester a phosphate -based cleavable linking group . A phosphate cleavable linking groups have the general formula - C ( O ) based cleavable linking group is cleaved by agents that 0 — , or — OC ( O ) - These candidates can be evaluated degrade or hydrolyze the phosphate group . An example of an using methods analogous to those described above . agent that cleaves phosphate groups in cells are enzymes [0393 ]. v . Peptide - Based Cleaving Groups such as phosphatases in cells . Examples of phosphate -based [0394 ] In yet other embodiments , a cleavable linker com linking groups are 0 P (O )( ORk )- 0 , 0 - P (S ) prises a peptide - based cleavable linking group . A peptide (ORk ) - 0 - , - O - P ( S ) (SRK ) - 0 , - S - P ( O ) (ORk ) - 0 , based cleavable linking group is cleaved by enzymes such as -OP ( O ) (ORK )- S — , -SP (O ) (ORY ) -S — , 40P(S ) peptidases and proteases in cells . Peptide- based cleavable ( OR ) - S — , - S — P ( S ) ( ORY ) - 0 , 40P ( O ) (Rk ) - 0 , linking groups are peptide bonds formed between amino - O — P ( S ) (Rk ) - 0 , SP( O ) ( Rk )- 0 — , SP( S ) acids to yield oligopeptides ( e. g ., dipeptides, tripeptides etc .) ( RK ) - 0 , - S - P ( O ) (RK ) - S — , - 0 — P ( S ) ( R ) - S — Pre and polypeptides . Peptide -based cleavable groups do not ferred embodiments are 0 P (O )( OH ) - 0 - , -O P include the amide group ( C ( O )NH — ) . The amide group ( S ) (OH ) – O , 0 P ( S ) (SH ) - 0 - , - S — P ( O ) (OH ) — can be formed between any alkylene , alkenylene or alkyne 0 0 - P ( O ) ( OH ) — 5 — , S — P ( O ) ( OH ) - S — , lene . A peptide bond is a special type of amide bond formed - O - P ( S ) (OH ) — S - , - S — P ( S ) (OH ) O - , - 0 — P ( O ) between amino acids to yield peptides and proteins . The ( H ) 0 % , 0 — P ( S ) ( H ) O - , - S — P (O ) ( H ) O , peptide based cleavage group is generally limited to the - S — P ( S )( H ) - 0 - , - S — P ( O ) ( H ) S — , and O — P (S ) peptide bond ( i. e ., the amide bond ) formed between amino ( H ) - S — . A preferred embodiment is –0 P ( O ) (OH ) — acids yielding peptides and proteins and does not include the 04 . These candidates can be evaluated using methods entire amide functional group . Peptide -based cleavable link analogous to those described above . ing groups have the general formula NHCHRAC ( O ) [ 0389 ] iii. Acid Cleavable Linking Groups NHCHRBC ( O ) - , where RA and RB are the R groups of the [ 0390 ] In other embodiments , a cleavable linker comprises two adjacent amino acids . These candidates can be evaluated an acid cleavable linking group . An acid cleavable linking using methods analogous to those described above . group is a linking group that is cleaved under acidic condi 10395 ] In some embodiments , an iRNA of the invention is tions. In preferred embodiments acid cleavable linking conjugated to a carbohydrate through a linker. Non - limiting groups are cleaved in an acidic environment with a pH of examples of iRNA carbohydrate conjugates with linkers of about 6 . 5 or lower ( e . g . , about 6 . 0 , 5 . 5 , 5 . 0 , or lower ) , or by the compositions and methods of the invention include , but agents such as enzymes that can act as a general acid . In a are not limited to , US 2018 /0201929 A1 Jul. 19 , 2018 46

XXIV)Formula(

w

HN

N

NH poustu

HOJonghuni HO HO AcHN >HO AcHN OH HO ??OH HO AcHN AfrensningHO US 2018/ 0201929A1 Jul . 19 , 2018 A7

(FormmlulaXXV) {FormulaXXVI)(FormulaXXVID

ingr 20-Y,

0

-X A

N

»

-continued -

x=1-30 15-1=y

? ????? OH H07_OH AcHN AcHN OH HO ?H0 ? ACHNAcHNOH OH HO H0 AcHN H0_OH AcHN AcHN HO HU H0 HO -UH US 2018 /0201929 A1 Jul. 19 , 2018 48

(FormulaXXVII) OY, (FormulaXXVIII)

,Y

X-O

HN

X-O

NH

-continued X=1-30 15-1=y 300-=x y=1-15

NH NH

ZI

ZI

N NH

OH OH AcHN ACHNOH OH OH AcHN HO HO AcHN HO HO OH AcHN HO HO AcHN HO HO HO HO Inline HO HO US 2018/ 0201929A1 Jul . 19 , 2018 49

(FormulaXXX) (FormulaXXX) and_,0X . ,

X-0

-0

X

-s?

sS-

-continued 301-=x 15-1=y z-120 x-030 lllly-115 z-120 * - N ????

OH ? OH OH, OH ACHNOH ?-HO HO 0)H AcHN HO ACHNOH AcHN AcHN HO H0 AcHN HO ?H00 HO H0 HO HU US 2018 /0201929 A1 Jul. 19 , 2018 50

(FormulaXXXI)

X-O

-continued x=1-30 15-1=y z=1-20

N

NH

ACHNOH OH InilynHO HO AcHN AcHN HO HO HOSnimyndyfodontoyht HO Iunimi US 2018 /0201929 A1 Jul. 19 , 2018 51

[ 0396 ] when one of X or Y is an oligonucleotide, the other -continued is a hydrogen . S - S [ 03971. In certain embodiments of the compositions and w w methods of the invention , a ligand is one or more “ GalNAC" ( N -acetylgalactosamine ) derivatives attached through a or heterocyclyl; monovalent , a bivalent or a trivalent branched linker. [ 0403 ] [ 24 , L2B , L 34 , L 3B , L 44, 14B , 154 , 15B, and L5C [ 0398 ] In certain embodiments , a dsRNA of the invention represent the ligand ; i .e . each independently for each occur is conjugated to a monovalent, a bivalent or a trivalent rence a monosaccharide (such as GalNAc ) , disaccharide , branched linker selected from the group of structures shown trisaccharide , tetrasaccharide, oligosaccharide , or polysac in any of formula (XXXII )- ( XXXV ) : charide ; and Ra is H or amino acid side chain . Trivalent conjugating GalNAc derivatives are particularly useful for use with RNAi agents for inhibiting the expression of a Formula XXXII [ P24 — Q24 — R24 124 T24 — L 24 , target gene , such as those of formula (XXXV ) :

w Formula XXXV PS4 — Q54 — R542. 54 154 — L 54 , p2B — Q2B — R2B 128 T2B — L 2B Formula XXXIII p5B - Q5B — R5BH T5B — L 5B m at 234pº4 -— 034Q3A _— DR34. 1. 34 T3A — L34 , na 7p3B — 238 – R3B 1, 38 T3B – L3B * PSC - QSC - R5C150 - 15C - 15C { p4 – Q* : — R44 T44 – 144 Formula XXXIV [ 0404 ] wherein L 54 , L 5B and L5C represent a monosaccha 4p4B – Q4B – R *B 548 - T4B — L 4B ride , such as GalNAc derivative . Formula XXXV [0405 ] Examples of suitable monovalent, bivalent and PS4 — Q54 – R541, 54T54 — [ 54 ; trivalent branched linker groups conjugating GalNAC derivatives include, but are not limited to , the structures L p 5B — Q5B – R5B 1, 58 T5B — L 5B recited above as formulas II , VII, XI, X , and XIII . 104061 Representative US patents that teach the prepara tion of RNA conjugates include , but are not limited to , U . S . Ypsc – QSC - R5C7, 5c - T5C L5C Pat . Nos. 4 ,828 , 979 ; 4 , 948 , 882 ; 5 ,218 , 105 ; 5 ,525 ,465 ; 5 , 541 , 313 ; 5 , 545 ,730 ; 5 , 552 , 538 ; 5 , 578 ,717 , 5 ,580 ,731 ; 5 ,591 ,584 ; 5 , 109 , 124 ; 5 , 118 , 802 ; 5 , 138 , 045 ; 5 ,414 ,077 ; wherein : 5 , 486 ,603 ; 5 ,512 ,439 ; 5 , 578 , 718 ; 5 ,608 ,046 ; 4 , 587 , 044 ; [0399 ] 22A , 2B , 93A , 23B , q4A , 24B , 254 , 25B and q5C 4 ,605 ,735 ; 4 , 667 ,025 ; 4 ,762 , 779 ; 4 ,789 ,737 ; 4 , 824 , 941 ; represent independently for each occurrence 0 -20 and 4 , 835 , 263; 4 , 876 , 335 ; 4 , 904 ,582 ; 4 , 958 ,013 ; 5 ,082 , 830 ; wherein the repeating unit can be the same or different ; 5 , 112 , 963 ; 5 , 214 , 136 ; 5 ,082 ,830 ; 5 , 112 , 963 ; 5 , 214 , 136 ; 10400 ) P24 , P2B , P34 , P3B , P44 , P4B , PS4 , PSB , PSC , T24 , 5 , 245 , 022 ; 5 , 254 ,469 ; 5 ,258 ,506 ; 5 , 262, 536 ; 5 , 272 , 250 ; T2B, T34 , 13B , T44 , T4B, T44 , T5B , TSC are each indepen 5 , 292 ,873 ; 5 ,317 ,098 ; 5 , 371, 241, 5 ,391 , 723 ; 5 ,416 , 203 , dently for each occurrence absent, CO , NH , O , S , OC (O ), 5 , 451 , 463 ; 5 , 510 ,475 ; 5 ,512 , 667; 5 ,514 ,785 ; 5 ,565 ,552 ; NHC ( O) , CHA , CHÚNH, or CH2O; 5 , 567, 810 ; 5 , 574 , 142 ; 5 ,585 ,481 ; 5 ,587 ,371 ; 5 , 595 ,726 ; [0401 ] 024, 023 , 034 , Q3B, 044 , Q4B , 254 , Q5B , Q5C are 5 ,597 ,696 ; 5 , 599 , 923 ; 5 ,599 , 928 ; 5 , 688 , 941 ; 6 ,294 ,664 ; independently for each occurrence absent, alkylene , substi 6 ,320 ,017 ; 6 ,576 ,752 ; 6 ,783 , 931; 6 , 900 ,297 ; 7 ,037 ,646 ; and tuted alkylene wherein one or more methylenes can be 8 , 106 , 022 , the entire contents of each of which are hereby interrupted or terminated by one or more of O , S , S ( O ) , SO2, incorporated herein by reference. N ( RM ) , C ( R ') = C ( R " ) , C = C , or C ( O ) ; [0407 ] It is not necessary for all positions in a given [0402 ] R24 , R2B , R34 , R3B , R44 , R4B , R54, R5B, R5C are compound to be uniformly modified , and in fact more than each independently for each occurrence absent, NH , O , S , one of the aforementioned modifications can be incorporated CH , C ( O ) O, C ( O) NH, NHCH ( R ^) C ( O ), C ( O ) CH in a single compound or even at a single nucleoside within an iRNA . The present invention also includes iRNA com ( R°) NH?, CO, CH?NO, pounds that are chimeric compounds. [0408 ] “ Chimeric ” iRNA compounds or “ chimeras ,” in the context of this invention , are iRNA compounds, preferably dsRNAi agents , that contain two ormore chemically distinct HO regions , each made up of at least one monomer unit, i . e . , a my nucleotide in the case of a dsRNA compound . These iRNAs m typically contain at least one region wherein the RNA is SS. modified so as to confer upon the iRNA increased resistance S - S to nuclease degradation , increased cellular uptake , or increased binding affinity for the target nucleic acid . An additional region of the iRNA can serve as a substrate for enzymes capable of cleaving RNA : DNA or RNA :RNA US 2018 /0201929 A1 Jul. 19 , 2018 hybrids . By way of example , RNase H is a cellular endo ormore vectors that encode and direct the expression of the nuclease which cleaves the RNA strand of an RNA : DNA iRNA . These alternatives are discussed further below . duplex . Activation of RNase H , therefore , results in cleavage of the RNA target, thereby greatly enhancing the efficiency [0411 ] In general , any method of delivering a nucleic acid of iRNA inhibition of gene expression . Consequently , com molecule ( in vitro or in vivo ) can be adapted for use with an parable results can often be obtained with shorter iRNAS iRNA of the invention ( see e . g ., Akhtar S . and Julian RL. when chimeric dsRNAs are used , compared to phosphoro ( 1992 ) Trends Cell. Biol. 2 ( 5 ) : 139 - 144 and W094 /02595 , thioate deoxy dsRNAs hybridizing to the same target region . which are incorporated herein by reference in their entire Cleavage of the RNA target can be routinely detected by gel ties ) . For in vivo delivery, factors to consider in order to electrophoresis and , if necessary , associated nucleic acid deliver an iRNA molecule include , for example , biological hybridization techniques known in the art. stability of the delivered molecule , prevention of non specific effects , and accumulation of the delivered molecule [0409 ] In certain instances , the RNA of an iRNA can be in the target tissue . The non - specific effects of an iRNA can modified by a non - ligand group . A number of non - ligand be minimized by local administration , for example, by direct molecules have been conjugated to iRNAs in order to injection or implantation into a tissue or topically adminis enhance the activity , cellular distribution or cellular uptake tering the preparation . Local administration to a treatment of the iRNA , and procedures for performing such conjuga site maximizes local concentration of the agent, limits the tions are available in the scientific literature . Such non exposure of the agent to systemic tissues that can otherwise ligand moieties have included lipid moieties , such as cho be harmed by the agent or that can degrade the agent, and lesterol (Kubo , T . et al . , Biochem . Biophys. Res. Comm . , permits a lower total dose of the iRNA molecule to be 2007 , 365 ( 1 ): 54 -61 ; Letsinger et al. , Proc. Natl. Acad . Sci. administered . Several studies have shown successful knock USA , 1989, 86 :6553 ) , cholic acid (Manoharan et al ., Bioorg . down of gene products when a dsRNAi agent is adminis Med . Chem . Lett. , 1994 , 4 : 1053 ) , a thioether, e . g . , hexyl- S tered locally . For example , intraocular delivery of a VEGF tritylthiol (Manoharan et al. , Ann . N . Y . Acad . Sci. , 1992 , dsRNA by intravitreal injection in cynomolgus monkeys 660 : 306 ; Manoharan et al. , Bioorg . Med . Chem . Let. , 1993 , ( Tolentino , MJ, et al ( 2004 ) Retina 24 : 132 - 138 ) and sub 3 :2765 ) , a thiocholesterol ( Oberhauser et al. , Nucl. Acids retinal injections in mice (Reich , S J . , et al ( 2003 ) Mol. Vis. Res. , 1992 , 20 : 533 ) , an aliphatic chain , e . g . , dodecandiol or 9 : 210 - 216 ) were both shown to prevent neovascularization undecyl residues ( Saison -Behmoaras et al . , EMBO J . , 1991 , in an experimental model of age - related macular degenera 10 : 111 ; Kabanov et al. , FEBS Lett ., 1990 , 259 :327 ; Svinar tion . In addition , direct intratumoral injection of a dsRNA in chuk et al. , Biochimie , 1993, 75 :49 ), a phospholipid , e. g. , mice reduces tumor volume (Pille , J ., et al (2005 ) Mol. Ther . di- hexadecyl - rac - glycerol or triethylammonium 1 , 2 -di - O 11 : 267 - 274 ) and can prolong survival of tumor -bearing mice hexadecyl- rac - glycero - 3 - H - phosphonate (Manoharan et al. , (Kim , W J. , et al ( 2006 ) Mol. Ther. 14 :343 -350 ; Li, S ., et al Tetrahedron Lett. , 1995 , 36 : 3651 ; Shea et al ., Nucl. Acids ( 2007) Mol. Ther. 15 :515 - 523 ). RNA interference has also Res. , 1990 , 18 : 3777 ) , a polyamine or a polyethylene glycol shown success with local delivery to the CNS by direct chain (Manoharan et al. , Nucleosides & Nucleotides, 1995 , injection (Dorn , G . , et al. ( 2004 ) Nucleic Acids 32: e49 ; Tan , 14 : 969 ), or adamantane acetic acid (Manoharan et al. , Tet PH . , et al (2005 ) Gene Ther. 12 :59 - 66 ; Makimura , H . , et al rahedron Lett. , 1995 , 36 :3651 ) , a palmityl moiety (Mishra et ( 2002 ) BMC Neurosci. 3 : 18 ; Shishkina , G T . , et al ( 2004 ) al. , Biochim . Biophys. Acta , 1995 , 1264 :229 ) , or an octa Neuroscience 129 :521 -528 ; Thakker, E R . , et al (2004 ) Proc. decylamine or hexylamino -carbonyl - oxycholesterol moiety Natl . Acad . Sci . U . S . A . 101 : 17270 - 17275 ; Akaneya , Y . , et al ( Crooke et al. , J . Pharmacol. Exp . Ther. , 1996 , 277 : 923 ). ( 2005 ) J . Neurophysiol. 93 : 594 -602 ) and to the lungs by Representative United States patents that teach the prepara intranasal administration (Howard , K A ., et al (2006 ) Mol. tion of such RNA conjugates have been listed above . Typical Ther. 14 :476 - 484 ; Zhang , X . , et al ( 2004 ) J. Biol. Chem . conjugation protocols involve the synthesis of RNAs bear 279 : 10677 - 10684 ; Bitko , V . , et al (2005 ) Nat . Med . 11 :50 ing an aminolinker at one or more positions of the sequence . 55 ) . For administering an iRNA systemically for the treat The amino group is then reacted with the molecule being ment of a disease , the RNA can be modified or alternatively conjugated using appropriate coupling or activating delivered using a drug delivery system ; both methods act to reagents . The conjugation reaction can be performed either prevent the rapid degradation of the dsRNA by endo - and with the RNA still bound to the solid support or following exo - nucleases in vivo . Modification of the RNA or the cleavage of the RNA , in solution phase . Purification of the pharmaceutical carrier can also permit targeting of the iRNA RNA conjugate by HPLC typically affords the pure conju to the target tissue and avoid undesirable off - target effects . gate . iRNA molecules can be modified by chemical conjugation to lipophilic groups such as cholesterol to enhance cellular IV . Delivery of an iRNA of the Invention uptake and prevent degradation . For example , an iRNA directed against ApoB conjugated to a lipophilic cholesterol [0410 ] The delivery of an iRNA of the invention to a cell moiety was injected systemically into mice and resulted in e . g ., a cell within a subject, such as a human subject ( e . g ., knockdown of apoB mRNA in both the liver and jejunum a subject in need thereof, such as a subject having a disease, ( Soutschek , J. , et al ( 2004 ) Nature 432 : 173 - 178 ) . Conjuga disorder, or condition associated with IGFALS gene or tion of an iRNA to an aptamer has been shown to inhibit IGF - 1 gene expression ) can be achieved in a number of tumor growth and mediate tumor regression in a mouse different ways . For example, delivery may be performed by model of prostate cancer (McNamara , JO , et al ( 2006 ) Nat. contacting a cell with an iRNA of the invention either in Biotechnol. 24 : 1005 - 1015 ). In an alternative embodiment, vitro or in vivo . In vivo delivery may also be performed the iRNA can be delivered using drug delivery systems such directly by administering a composition comprising an as a nanoparticle , a dendrimer, a polymer , liposomes, or a iRNA , e . g ., a dsRNA , to a subject. Alternatively , in vivo cationic delivery system . Positively charged cationic deliv delivery may be performed indirectly by administering one ery systems facilitate binding of an iRNA molecule (nega US 2018 /0201929 A1 Jul. 19 , 2018 53 tively charged ) and also enhance interactions at the nega - expression vectors are well known in the art and are avail tively charged cell membrane to permit efficient uptake of an able from a number of commercial sources . Typically, such iRNA by the cell. Cationic lipids , dendrimers , or polymers vectors are provided containing convenient restriction sites can either be bound to an iRNA , or induced to form a vesicle for insertion of the desired nucleic acid segment. Delivery of or micelle (see e . g ., Kim S H , et al ( 2008 ) Journal of iRNA expressing vectors can be systemic , such as by Controlled Release 129 ( 2 ) : 107 - 116 ) that encases an iRNA . intravenous or intramuscular administration , by administra The formation of vesicles or micelles further prevents deg tion to target cells ex -planted from the patient followed by radation of the iRNA when administered systemically . reintroduction into the patient, or by any other means that Methods for making and administering cationic - iRNA com allows for introduction into a desired target cell . plexes are well within the abilities of one skilled in the art 0416 ) Viral vector systems which can be utilized with the ( see e . g ., Sorensen , DR , et al (2003 ) J . Mol. Biol 327 : 761 methods and compositions described herein include , but are 766 ; Verma, U N , et al (2003 ) Clin . Cancer Res. 9 : 1291 not limited to , ( a ) adenovirus vectors ; (b ) retrovirus vectors , 1300 ; Arnold , A S et al (2007 ) J . Hypertens. 25 : 197 - 205 , including but not limited to lentiviral vectors , moloney which are incorporated herein by reference in their entirety ) . murine leukemia virus , etc . ; ( c ) adeno - associated virus vec Some non - limiting examples of drug delivery systems useful tors ; ( d ) herpes simplex virus vectors ; ( e ) SV 40 vectors ; ( f ) for systemic delivery of iRNAs include DOTAP (Sorensen , polyoma virus vectors ; ( g ) papilloma virus vectors ; ( h ) D R ., et al (2003 ) , supra ; Verma, U N , et al (2003 ) , supra ), picornavirus vectors ; (i ) pox virus vectors such as an Oligofectamine , “ solid nucleic acid lipid particles ” (Zim orthopox , e . g . , vaccinia virus vectors or avipox , e . g . canary mermann , TS, et al ( 2006 ) Nature 441 : 111 - 114 ), cardiolipin pox or fowl pox ; and (j ) a helper -dependent or gutless ( Chien ,PY , et al (2005 ) Cancer Gene Ther. 12 : 321 - 328 ; Pal, adenovirus . Replication - defective viruses can also be advan A , et al (2005 ) Int J . Oncol. 26 : 1087 - 1091) , polyethyl tageous . Different vectors will or will not become incorpo eneimine (Bonnet M E , et al ( 2008 ) Pharm . Res . August 16 rated into the cells ' genome. The constructs can include viral Epub ahead of print ; Aigner, A . ( 2006 ) J. Biomed . Biotech sequences for transfection , if desired . Alternatively , the nol. 71659 ) , Arg -Gly - Asp (RGD ) peptides (Liu , S . (2006 ) construct can be incorporated into vectors capable of epi Mol . Pharm . 3 :472 -487 ) , and polyamidoamines ( Tomalia , D somal replication , e. g. EPV and EBV vectors . Constructs for A , et al (2007 ) Biochem . Soc . Trans. 35 :61 -67 ; Yoo , H ., et the recombinant expression of an iRNA will generally al ( 1999 ) Pharm . Res . 16 : 1799 - 1804 ) . In some embodi ments , an iRNA forms a complex with cyclodextrin for require regulatory elements , e . g ., promoters , enhancers , etc . , systemic administration . Methods for administration and to ensure the expression of the iRNA in target cells . Other pharmaceutical compositions of iRNAs and cyclodextrins aspects to consider for vectors and constructs are known in can be found in U . S . Pat. No. 7 ,427 ,605 , which is herein the art . incorporated by reference in its entirety . [0412 ] A . Vector Encoded iRNAs of the Invention V . Pharmaceutical Compositions of the Invention [0413 ] iRNA targeting an IGFALS gene or an IGF - 1 gene [0417 ] The present invention also includes pharmaceutical can be expressed from transcription units inserted into DNA compositions and formulations which include the iRNAs of or RNA vectors ( see , e .g ., Couture , A , et al. , TIG . ( 1996 ), the invention . In one embodiment, provided herein are 12 :5 - 10 ; Skillern , A , et al ., International PCT Publication pharmaceutical compositions containing an iRNA , as No . WO 00 / 22113, Conrad , International PCT Publication described herein , and a pharmaceutically acceptable carrier. No . WO 00 / 22114 , and Conrad , U . S . Pat. No . 6 , 054 , 299 ) . The pharmaceutical compositions containing the iRNA are Expression can be transient ( on the order of hours to weeks ) useful for treating a disease or disorder associated with the or sustained (weeks to months or longer ), depending upon expression or activity of an IGFALS gene or an IGF- 1 gene. the specific construct used and the target tissue or cell type . Such pharmaceutical compositions are formulated based on These transgenes can be introduced as a linear construct, a the mode of delivery . One example is compositions that are circular plasmid , or a viral vector, which can be an integrat ing or non - integrating vector. The transgene can also be formulated for systemic administration via parenteral deliv constructed to permit it to be inherited as an extrachromo ery , e . g . , by subcutaneous (SC ) , intramuscular ( IM ) , or somal plasmid (Gassmann , et al. , Proc . Natl . Acad . Sci. USA intravenous (IV ) delivery . ( 1995 ) 92 : 1292 ) . [0418 ] The pharmaceutical compositions of the invention [0414 ] The individual strand or strands of an iRNA can be may be administered in dosages sufficient to inhibit expres transcribed from a promoter on an expression vector . Where sion of an IGFALS gene or an IGF - 1 gene . In general, a two separate strands are to be expressed to generate , for suitable dose of an iRNA of the invention will be in the range example , a dsRNA, two separate expression vectors can be of about 0 .001 to about 200 . 0 milligramsper kilogram body co - introduced ( e . g . , by transfection or infection ) into a target weight of the recipient per day, generally in the range of cell . Alternatively each individual strand of a dsRNA can be about 1 to 50 mg per kilogram body weight per day . transcribed by promoters both of which are located on the Typically , a suitable dose of an iRNA of the invention will same expression plasmid . In one embodiment, a dsRNA is be in the range of about 0 . 1 mg/ kg to about 5 . 0 mg/ kg , expressed as inverted repeat polynucleotides joined by a preferably about 0 . 3 mg /kg and about 3 . 0 mg/ kg . A repeat linker polynucleotide sequence such that the dsRNA has a dose regimen may include administration of a therapeutic stem and loop structure . amount of iRNA on a regular basis , such as every other day [0415 ] iRNA expression vectors are generally DNA plas or once a year. In certain embodiments, the iRNA is admin mids or viral vectors. Expression vectors compatible with istered about once per month to about once per quarter ( i . e . , eukaryotic cells , preferably those compatible with vertebrate about once every three months ). cells , can be used to produce recombinant constructs for the [0419 ] After an initial treatment regimen , the treatments expression of an iRNA as described herein . Eukaryotic cell can be administered on a less frequent basis . For example , US 2018 /0201929 A1 Jul. 19 , 2018 54 after administration weekly or biweekly for three months , mal patches, ointments , lotions, creams, gels , drops, sup administration can be repeated once per month , for six positories, sprays , liquids and powders . Conventional phar months, or a year; or longer . maceutical carriers , aqueous, powder or oily bases , [ 0420 ] The pharmaceutical composition can be adminis thickeners and the like can be necessary or desirable . Coated tered once daily , or the iRNA can be administered as two, condoms, gloves and the like can also be useful. Suitable three , or more sub - doses at appropriate intervals throughout topical formulations include those in which the iRNAs the day or even using continuous infusion or delivery featured in the invention are in admixture with a topical through a controlled release formulation . In that case , the delivery agent such as lipids , liposomes, fatty acids , fatty iRNA contained in each sub - dose must be correspondingly acid esters , steroids, chelating agents and surfactants . Suit smaller in order to achieve the total daily dosage . The dosage able lipids and liposomes include neutral ( e . g ., dioleoyl unit can also be compounded for delivery over several days, phosphatidylDOPE ethanolamine , dimyristoylphosphatidyl e. g. , using a conventional sustained release formulation choline DMPC , distearolyphosphatidyl choline ) negative which provides sustained release of the iRNA over a several ( e. g ., dimyristoylphosphatidyl glycerol DMPG ) and cationic day period . Sustained release formulations are well known (e . g. , dioleoyltetramethylaminopropyl DOTAP and dio in the art and are particularly useful for delivery of agents at leoylphosphatidyl ethanolamine DOTMA ). iRNAs featured a particular site , such as could be used with the agents of the in the invention can be encapsulated within liposomes or can present invention . In this embodiment, the dosage unit form complexes thereto , in particular to cationic liposomes. contains a corresponding multiple of the daily dose . Alternatively , iRNAs can be complexed to lipids, in par [ 0421 ] In other embodiments, a single dose of the phar ticular to cationic lipids. Suitable fatty acids and esters maceutical compositions can be long lasting , such that include but are not limited to arachidonic acid , oleic acid , subsequent doses are administered at not more than 3 , 4 , or eicosanoic acid , lauric acid , caprylic acid , capric acid , 5 day intervals , or at not more than 1 , 2 , 3 , or 4 week myristic acid , palmitic acid , stearic acid , linoleic acid , intervals . In some embodiments of the invention , a single linolenic acid , dicaprate , tricaprate , monoolein , dilaurin , dose of the pharmaceutical compositions of the invention is glyceryl 1 -monocaprate , 1 -dodecylazacycloheptan - 2 -one , administered once per week . In other embodiments of the an acylcarnitine , an acylcholine, or a C1- 20 alkyl ester ( e . g ., invention , a single dose of the pharmaceutical compositions isopropylmyristate IPM ) , monoglyceride , diglyceride or of the invention is administered bi- monthly . pharmaceutically acceptable salt thereof) . Topical formula [0422 ] The skilled artisan will appreciate that certain tions are described in detail in U . S . Pat. No . 6 ,747 ,014 , factors can influence the dosage and timing required to which is incorporated herein by reference . effectively treat a subject, including but not limited to the [0426 ] A . iRNA Formulations Comprising Membranous severity of the disease or disorder, previous treatments , the Molecular Assemblies general health or age of the subject, and other diseases [0427 ] An iRNA for use in the compositions and methods present. Moreover , treatment of a subject with a therapeu of the invention can be formulated for delivery in a mem tically effective amount of a composition can include a branous molecular assembly, e . g . , a liposome or a micelle . single treatment or a series of treatments . Estimates of As used herein , the term “ liposome” refers to a vesicle effective dosages and in vivo half - lives for the individual composed of amphiphilic lipids arranged in at least one iRNAs encompassed by the invention can be made using bilayer , e . g . , one bilayer or a plurality of bilayers . Liposomes conventional methodologies or on the basis of in vivo testing include unilamellar and multilamellar vesicles that have a using an appropriate animal model, as known in the art . For membrane formed from a lipophilic material and an aqueous example , a mouse model of acromegaly was developed by interior . The aqueous portion contains the iRNA . The lipo Kovacs et al . ( 1997 , Endocrinology ) the entire contents of philic material isolates the aqueous interior from an aqueous which are incorporated herein by reference . Bovine growth exterior, which typically does not include the iRNA com hormone transgenic mice also exhibit features of acro position , although in some examples , it may . Liposomes are megaly ( Palmiter et al. , Science ( 1983 ) , Olsson et al. , Am J useful for the transfer and delivery of active ingredients to Phys Endo Metab ( 2003 ), Berryman et al , GH and IGF Res the site of action . Because the liposomal membrane is ( 2004 ) , Izzard et al. , GH and IGF Res (2009 ) , Blutke et al ., structurally similar to biological membranes, when lipo Mol and Cell Endo ( 2014 ) ) . Multiple animal models of somes are applied to a tissue , the liposomal bilayer fuses cancer are known in the art . with bilayer of the cellular membranes . As the merging of [0423 ] The pharmaceutical compositions of the present the liposome and cell progresses, the internal aqueous con invention can be administered in a number of ways depend tents that include the iRNA are delivered into the cell where ing upon whether local or systemic treatment is desired and the iRNA can specifically bind to a target RNA and can upon the area to be treated . Administration can be topical mediate RNA interference . In some cases the liposomes are ( e . g . , by a transdermal patch ) , pulmonary, e . g . , by inhalation also specifically targeted , e . g . , to direct the iRNA to par or insufflation of powders or aerosols , including by nebu ticular cell types. lizer ; intratracheal, intranasal, epidermal and transdermal, [0428 ] A liposome containing an iRNA agent can be oral or parenteral . Parenteral administration includes intra prepared by a variety of methods. In one example, the lipid venous, intraarterial , subcutaneous, intraperitoneal , or intra component of a liposome is dissolved in a detergent so that muscular injection or infusion ; subdermal, e . g . , via an micelles are formed with the lipid component. For example , implanted device ; or intracranial, e . g . , by intraparenchymal, the lipid component can be an amphipathic cationic lipid or intrathecal or intraventricular administration . lipid conjugate . The detergent can have a high critical [0424 ] The iRNA can be delivered in a manner to target a micelle concentration and may be nonionic . Exemplary particular tissue ( e . g . , liver cells ) . detergents include cholate , CHAPS , octylglucoside, deoxy 10425 ) Pharmaceutical compositions and formulations for cholate , and lauroyl sarcosine . The iRNA agent preparation topical or transdermal administration can include transder - is then added to the micelles that include the lipid compo US 2018 /0201929 A1 Jul. 19 , 2018 55 nent. The cationic groups on the lipid interact with the iRNA bean PC , and egg PC . Another type is formed from mixtures agent and condense around the iRNA agent to form a of two or more of phospholipid , phosphatidylcholine , and liposome. After condensation , the detergent is removed , e .g ., cholesterol. by dialysis, to yield a liposomal preparation of iRNA agent. [0434 ] Examples of other methods to introduce liposomes into cells in vitro and in vivo include U . S . Pat. Nos . [0429 ] If necessary a carrier compound that assists in 5 , 283 , 185 and 5 , 171 , 678 ; WO 94 / 00569 ; WO 93 / 24640 ; condensation can be added during the condensation reaction , WO 91 / 16024 ; Felgner, J . Biol. Chem . 269 :2550 , 1994 ; e . g ., by controlled addition . For example , the carrier com Nabel , Proc. Natl. Acad . Sci. 90 :11307 , 1993 ; Nabel , pound can be a polymer other than a nucleic acid ( e . g ., Human Gene Ther. 3 :649 , 1992 ; Gershon , Biochem . spermine or spermidine) . pH can also adjusted to favor 32 :7143 , 1993 ; and Strauss EMBO J. 11 :417 , 1992 . condensation . [0435 ] Non - ionic liposomal systems have also been exam [ 0430 ] Methods for producing stable polynucleotide deliv ined to determine their utility in the delivery of drugs to the ery vehicles, which incorporate a polynucleotide / cationic skin , in particular systems comprising non - ionic surfactant lipid complex as structural components of the delivery and cholesterol. Non - ionic liposomal formulations compris vehicle , are further described in , e . g ., WO 96 / 37194 , the ing NovasomeTM I ( glyceryl dilaurate / cholesterol/ polyoxy entire contents of which are incorporated herein by refer ethylene - 10 - stearyl ether ) and NovasomeTM II ( glyceryl ence . Liposome formation can also include one or more distearate / cholesterol/ polyoxyethylene - 10 -stearyl ether ) aspects of exemplary methods described in Felgner, P . L . et were used to deliver cyclosporin - A into the dermis of mouse al ., Proc. Natl. Acad . Sci ., USA 8 :7413 - 7417 , 1987 ; U .S . Pat. skin . Results indicated that such non - ionic liposomal sys No . 4 , 897 , 355 ; U . S . Pat. No . 5 , 171 , 678 ; Bangham , et al. M . tems were effective in facilitating the deposition of Mol. Biol. 23 : 238 , 1965 ; Olson , et al. Biochim . Biophys . cyclosporine A into different layers of the skin (Hu et al. Acta 557 : 9 , 1979 ; Szoka , et al . Proc. Natl . Acad . Sci. 75 : S . T. P . Pharma . Sci. , 1994 , 4 (6 ) 466 ) . 4194 , 1978 ; Mayhew , et al . Biochim . Biophys. Acta 775 : 169, [0436 ] Liposomes also include " sterically stabilized ” lipo 1984 ; Kim , et al. Biochim . Biophys. Acta 728 : 339, 1983 ; and somes , a term which , as used herein , refers to liposomes Fukunaga , et al. Endocrinol. 115 : 757 , 1984 . Commonly comprising one or more specialized lipids that, when incor used techniques for preparing lipid aggregates of appropriate porated into liposomes, result in enhanced circulation life size for use as delivery vehicles include sonication and times relative to liposomes lacking such specialized lipids. freeze - thaw plus extrusion (see , e . g . , Mayer , et al. Biochim . Examples of sterically stabilized liposomes are those in Biophys. Acta 858: 161, 1986 ). Microfluidization can be used which part of the vesicle - forming lipid portion of the lipo when consistently small (50 to 200 nm ) and relatively some ( A ) comprises one or more glycolipids , such as uniform aggregates are desired (Mayhew , et al. Biochim . monosialoganglioside Gmi, or ( B ) is derivatized with one or Biophys. Acta 775 : 169 , 1984 ) . These methods are readily more hydrophilic polymers , such as a polyethylene glycol adapted to packaging iRNA agent preparations into lipo (PEG ) moiety . While not wishing to be bound by any somes . particular theory, it is thought in the art that, at least for [ 0431] Liposomes fall into two broad classes. Cationic sterically stabilized liposomes containing gangliosides , liposomes are positively charged liposomes which interact sphingomyelin , or PEG - derivatized lipids , the enhanced with the negatively charged nucleic acid molecules to form circulation half - life of these sterically stabilized liposomes a stable complex . The positively charged nucleic acid / derives from a reduced uptake into cells of the reticuloen liposome complex binds to the negatively charged cell dothelial system (RES ) ( Allen et al. , FEBS Letters, 1987 , surface and is internalized in an endosome. Due to the acidic 223 , 42 ; Wu et al. , Cancer Research , 1993 , 53 , 3765 ) . pH within the endosome, the liposomes are ruptured , releas [0437 ] Various liposomes comprising one or more glyco ing their contents into the cell cytoplasm (Wang et al. , lipids are known in the art . Papahadjopoulos et al . ( Ann . N . Y . Acad. Sci. , 1987 , 507 , 64 ) reported the ability of monosia Biochem . Biophys. Res. Commun ., 1987 , 147 , 980 - 985 ). loganglioside Gmi, galactocerebroside sulfate and phospha [0432 ] Liposomes which are pH - sensitive or negatively tidylinositol to improve blood half - lives of liposomes . These charged , entrap nucleic acids rather than complex with it . findings were expounded upon by Gabizon et al. ( Proc. Natl . Since both the nucleic acid and the lipid are similarly Acad . Sci. U . S . A . , 1988 , 85 , 6949 ) . U . S . Pat. No . 4 ,837 ,028 charged , repulsion rather than complex formation occurs . and WO 88/ 04924 , both to Allen et al ., disclose liposomes Nevertheless , some nucleic acid is entrapped within the comprising ( 1 ) sphingomyelin and ( 2 ) the ganglioside Gmi aqueous interior of these liposomes . pH - sensitive liposomes or a galactocerebroside sulfate ester. U . S . Pat . No . 5 , 543 , 152 have been used to deliver nucleic acids encoding the thy (Webb et al. ) discloses liposomes comprising sphingomy midine kinase gene to cellmonolayers in culture . Expression elin . Liposomes comprising 1 , 2 - sn - dimyristoylphosphati of the exogenous gene was detected in the target cells ( Zhou dylcholine are disclosed in WO 97 / 13499 (Lim et al ) . et al. , Journal of Controlled Release , 1992 , 19 , 269- 274 ) . [ 0438 ] In some embodiments , cationic liposomes are used . [ 0433] One major type of liposomal composition includes Cationic liposomes possess the advantage of being able to phospholipids other than naturally -derived phosphatidyl fuse to the cell membrane . Non - cationic liposomes, although choline . Neutral liposome compositions, for example , can be not able to fuse as efficiently with the plasmamembrane , are formed from dimyristoyl phosphatidylcholine ( DMPC ) or taken up by macrophages in vivo and can be used to deliver dipalmitoyl phosphatidylcholine (DPPC ) . Anionic liposome iRNA agents to macrophages. compositions generally are formed from dimyristoyl phos [0439 ] Further advantages of liposomes include: lipo phatidylglycerol, while anionic fusogenic liposomes are somes obtained from natural phospholipids are biocompat formed primarily from dioleoyl phosphatidylethanolamine ible and biodegradable ; liposomes can incorporate a wide (DOPE ) . Another type of liposomal composition is formed range of water and lipid soluble drugs ; liposomes can protect from phosphatidylcholine (PC ) such as , for example , soy encapsulated iRNAs in their internal compartments from US 2018 /0201929 A1 Jul. 19 , 2018 56 metabolism and degradation (Rosoff , in “ Pharmaceutical administered drug , increased accumulation of the adminis Dosage Forms, " Lieberman , Rieger and Banker ( Eds. ) , tered drug at the desired target, and the ability to administer 1988 , volume 1 , p . 245 ) . Important considerations in the iRNA agent into the skin . In some implementations, lipo preparation of liposome formulations are the lipid surface somes are used for delivering iRNA agent to epidermal cells charge, vesicle size, and the aqueous volume of the lipo and also to enhance the penetration of iRNA agent into somes . dermal tissues , e . g ., into skin . For example , the liposomes [ 0440 ] A positively charged synthetic cationic lipid , N -[ 1 can be applied topically . Topical delivery of drugs formu ( 2 , 3 - dioleyloxy ) propyl) - N , N , N -trimethylammonium chlo lated as liposomes to the skin has been documented ( see , ride (DOTMA ) can be used to form small liposomes that e .g ., Weiner et al ., Journal of Drug Targeting, 1992 , vol. interact spontaneously with nucleic acid to form lipid 2 ,405 -410 and du Plessis et al . , Antiviral Research , 18 , 1992 , nucleic acid complexes which are capable of fusing with the 259 - 265; Mannino , R . J . and Fould - Fogerite , S . , Biotech negatively charged lipids of the cell membranes of tissue niques 6 :682 -690 , 1988 ; Itani, T . et al. Gene 56 : 267 - 276 . culture cells , resulting in delivery of iRNA agent ( see , e . g . , 1987 ; Nicolau , C . et al. Meth . Enz. 149 : 157 - 176 , 1987 ; Felgner, P. L . et al. , Proc . Natl. Acad . Sci ., USA 8 :7413 Straubinger , R . M . and Papahadjopoulos, D . Meth . Enz . 7417 , 1987 and U . S . Pat. No. 4 ,897 , 355 for a description of 101 : 512 - 527 , 1983 ; Wang , C . Y . and Huang , L ., Proc . Natl. DOTMA and its use with DNA) . Acad . Sci . USA 84 :7851 -7855 , 1987 ) . [0441 ] A DOTMA analogue, 1 , 2 - bis ( oleoyloxy ) - 3 - ( trim [0445 ] Non - ionic liposomal systems have also been exam ethylammonia ) propane (DOTAP ) can be used in combina ined to determine their utility in the delivery of drugs to the tion with a phospholipid to form DNA -complexing vesicles . skin , in particular systems comprising non -ionic surfactant LipofectinTM (Bethesda Research Laboratories, Gaithers and cholesterol. Non -ionic liposomal formulations compris burg , Md. ) is an effective agent for the delivery of highly ing NovasomeTM I ( glyceryl dilaurate / cholesterol/ polyoxy anionic nucleic acids into living tissue culture cells that ethylene -10 - stearyl ether ) and NovasomeTM II ( glyceryl comprise positively charged DOTMA liposomes which distearate /cholesterol / polyoxyethylene - 10 -stearyl ether) interact spontaneously with negatively charged polynucle were used to deliver a drug into the dermis of mouse skin . otides to form complexes. When enough positively charged Such formulations with iRNA agent are useful for treating a liposomes are used , the net charge on the resulting com dermatological disorder. plexes is also positive . Positively charged complexes pre 10446 ) Liposomes that include iRNA can be made highly pared in this way spontaneously attach to negatively charged deformable . Such deformability can enable the liposomes to cell surfaces, fuse with the plasma membrane, and efficiently penetrate through pore that are smaller than the average deliver functional nucleic acids into , for example , tissue radius of the liposome. For example , transfersomes are a culture cells . Another commercially available cationic lipid , type of deformable liposomes . Transferosomes can be made 1 ,2 -bis (oleoyloxy ) -3 ,3 -( trimethylammonia )propane by adding surface edge activators , usually surfactants , to a (“ DOTAP ” ) (Boehringer Mannheim , Indianapolis , Ind . ) dif standard liposomal composition . Transfersomes that include fers from DOTMA in that the oleoyl moieties are linked by iRNAs can be delivered , for example , subcutaneously by ester , rather than ether linkages . infection in order to deliver iRNAs to keratinocytes in the [0442 ] Other reported cationic lipid compounds include skin . In order to cross intact mammalian skin , lipid vesicles those that have been conjugated to a variety of moieties must pass through a series of fine pores , each with a diameter including, for example , carboxyspermine which has been less than 50 nm , under the influence of a suitable transder conjugated to one of two types of lipids and includes mal gradient. In addition , due to the lipid properties, these compounds such as 5 - carboxyspermylglycine dioctaoleoyl transferosomes can be self- optimizing ( adaptive to the shape amide ( “ DOGS” ) ( TransfectamTM , Promega , Madison , Wis . ) of pores , e . g ., in the skin ) , self -repairing , and can frequently and dipalmitoylphosphatidylethanolamine 5 - carboxysper reach their targets without fragmenting , and often self myl- amide (“ DPPES ” ) ( see , e . g ., U . S . Pat . No. 5 , 171, 678 ) . loading . [ 0443 ] Another cationic lipid conjugate includes derivati [0447 ] Other formulations amenable to the present inven zation of the lipid with cholesterol (“ DC - Chol” ) which has tion are described in WO /2008 /042973 . been formulated into liposomes in combination with DOPE [0448 ] Transfersomes are yet another type of liposomes, (See , Gao , X . and Huang, L ., Biochim . Biophys. Res . Com and are highly deformable lipid aggregates which are attrac mun . 179 :280 , 1991) . Lipopolylysine, made by conjugating tive candidates for drug delivery vehicles . Transfersomes polylysine to DOPE , has been reported to be effective for can be described as lipid droplets which are so highly transfection in the presence of serum (Zhou , X . et al. , deformable that they are easily able to penetrate through Biochim . Biophys. Acta 1065 : 8 , 1991) . For certain cell lines , pores which are smaller than the droplet. Transfersomes are these liposomes containing conjugated cationic lipids, are adaptable to the environment in which they are used , e . g . , said to exhibit lower toxicity and provide more efficient they are self - optimizing ( adaptive to the shape of pores in transfection than the DOTMA - containing compositions . the skin ) , self -repairing , frequently reach their targets with Other commercially available cationic lipid products include out fragmenting , and often self - loading . To make transfer DMRIE and DMRIE -HP (Vical , La Jolla , Calif .) and Lipo somes it is possible to add surface edge - activators , usually fectamine (DOSPA ) (Life Technology , Inc ., Gaithersburg , surfactants , to a standard liposomal composition . Transfer Md . ) . Other cationic lipids suitable for the delivery of somes have been used to deliver serum albumin to the skin . oligonucleotides are described in WO 98 / 39359 and WO The transfersome- mediated delivery of serum albumin has 96 /37194 . been shown to be as effective as subcutaneous injection of [ 0444 ] Liposomal formulations are particularly suited for a solution containing serum albumin . topical administration , liposomes present several advantages [ 0449 ] Surfactants find wide application in formulations over other formulations. Such advantages include reduced such as emulsions ( including microemulsions) and lipo side effects related to high systemic absorption of the somes. The most common way of classifying and ranking US 2018 /0201929 A1 Jul. 19 , 2018 57

the properties of the many different types of surfactants , both lysine, polylysine , triolein , polyoxyethylene ethers and ana natural and synthetic , is by the use of the hydrophile ! logues thereof, polidocanol alkyl ethers and analogues lipophile balance (HLB ) . The nature of the hydrophilic thereof, chenodeoxycholate , deoxycholate, and mixtures group ( also known as the " head ” ) provides the most useful thereof. The micelle forming compounds may be added at means for categorizing the different surfactants used in the same time or after addition of the alkali metal alkyl formulations (Rieger , in “ Pharmaceutical Dosage Forms” , sulphate . Mixed micelles will form with substantially any Marcel Dekker, Inc. , New York , N . Y ., 1988 , p . 285 ) . kind of mixing of the ingredients but vigorous mixing in 10450 ) If the surfactant molecule is not ionized , it is order to provide smaller size micelles . classified as a nonionic surfactant. Nonionic surfactants find [0457 ] In one method a first micellar composition is wide application in pharmaceutical and cosmetic products prepared which contains the RNAi and at least the alkali and are usable over a wide range of pH values. In general metal alkyl sulphate . The first micellar composition is then their HLB values range from 2 to about 18 depending on mixed with at least three micelle forming compounds to their structure . Nonionic surfactants include nonionic esters form a mixed micellar composition . In another method , the such as ethylene glycol esters , propylene glycol esters , micellar composition is prepared by mixing the RNAi, the glyceryl esters , polyglyceryl esters , sorbitan esters , sucrose alkali metal alkyl sulphate and at least one of the micelle esters, and ethoxylated esters . Nonionic alkanolamides and forming compounds, followed by addition of the remaining ethers such as fatty alcohol ethoxylates, propoxylated alco micelle forming compounds, with vigorous mixing. hols , and ethoxylated /propoxylated block polymers are also [ 0458 ] Phenol or m -cresol may be added to the mixed included in this class . The polyoxyethylene surfactants are micellar composition to stabilize the formulation and protect the most popular members of the nonionic surfactant class . against bacterial growth . Alternatively , phenol or m - cresol 10451] If the surfactant molecule carries a negative charge may be added with the micelle forming ingredients . An when it is dissolved or dispersed in water , the surfactant is isotonic agent such as glycerin may also be added after classified as anionic . Anionic surfactants include carboxy formation of the mixed micellar composition . lates such as soaps, acyl lactylates , acyl amides of amino [ 0459 ] For delivery of the micellar formulation as a spray, acids , esters of sulfuric acid such as alkyl sulfates and the formulation can be put into an aerosol dispenser and the ethoxylated alkyl sulfates , sulfonates such as alkyl benzene dispenser is charged with a propellant. The propellant, which sulfonates, acyl isethionates , acyl taurates and sulfosucci is under pressure , is in liquid form in the dispenser. The nates , and phosphates . The most important members of the ratios of the ingredients are adjusted so that the aqueous and anionic surfactant class are the alkyl sulfates and the soaps . propellant phases become one , i . e . , there is one phase . If [0452 ] If the surfactant molecule carries a positive charge there are two phases, it is necessary to shake the dispenser when it is dissolved or dispersed in water, the surfactant is prior to dispensing a portion of the contents , e . g . , through a classified as cationic . Cationic surfactants include quater metered valve . The dispensed dose of pharmaceutical agent nary ammonium salts and ethoxylated amines. The quater is propelled from the metered valve in a fine spray . nary ammonium salts are the most used members of this 104601 Propellants may include hydrogen -containing class . chlorofluorocarbons, hydrogen - containing fluorocarbons, [ 0453) If the surfactant molecule has the ability to carry dimethyl ether and diethyl ether. In certain embodiments , either a positive or negative charge , the surfactant is clas HFA 134a ( 1, 1, 1, 2 tetrafluoroethane ) may be used . sified as amphoteric . Amphoteric surfactants include acrylic [0461 ] The specific concentrations of the essential ingre acid derivatives , substituted alkylamides , N - alkylbetaines dients can be determined by relatively straightforward and phosphatides. experimentation . For absorption through the oral cavities , it [0454 ] The use of surfactants in drug products , formula is often desirable to increase, e . g ., at least double or triple , tions and in emulsions has been reviewed (Rieger , in “ Phar the dosage for through injection or administration through maceutical Dosage Forms” , Marcel Dekker , Inc ., New York , the gastrointestinal tract . N . Y ., 1988, p . 285 ) . [0462 ] B . Lipid Particles [0455 ] The iRNA for use in the methods of the invention [0463 ] iRNAs, e . g ., dsRNAi agents of the invention may can also be provided as micellar formulations. “Micelles " be fully encapsulated in a lipid formulation , e . g . , a LNP, or are defined herein as a particular type ofmolecular assembly other nucleic acid - lipid particle . in which amphipathic molecules are arranged in a spherical [0464 ] As used herein , the term “ LNP ” refers to a stable structure such that all the hydrophobic portions of the nucleic acid - lipid particle . LNPs typically contain a cationic molecules are directed inward , leaving the hydrophilic por lipid , a non - cationic lipid , and a lipid that prevents aggre tions in contact with the surrounding aqueous phase . The gation of the particle ( e . g . , a PEG - lipid conjugate ). LNPs are converse arrangement exists if the environment is hydro extremely useful for systemic applications, as they exhibit phobic . extended circulation lifetimes following intravenous ( i. v .) [0456 ] A mixed micellar formulation suitable for delivery injection and accumulate at distal sites (e . g. , sites physically through transdermal membranes may be prepared by mixing separated from the administration site ). LNPs include an aqueous solution of iRNA , an alkali metal Cg to C22 alkyl “ PSPLP , ” which include an encapsulated condensing agent sulphate , and a micelle forming compounds. Exemplary nucleic acid complex as set forth in PCT Publication No. micelle forming compounds include lecithin , hyaluronic WO 00 / 03683 . The particles of the present invention typi acid , pharmaceutically acceptable salts of hyaluronic acid , cally have a mean diameter of about 50 nm to about 150 nm , glycolic acid , lactic acid , chamomile extract, cucumber more typically about 60 nm to about 130 nm , more typically extract , oleic acid , linoleic acid , linolenic acid , monoolein , about 70 nm to about 110 nm , most typically about 70 nm monooleates , monolaurates, borage oil, evening of primrose to about 90 nm , and are substantially nontoxic . In addition , oil , menthol, trihydroxy oxo cholanyl glycine and pharma the nucleic acids when present in the nucleic acid - lipid ceutically acceptable salts thereof, glycerin , polyglycerin , particles of the present invention are resistant in aqueous US 2018 /0201929 A1 Jul. 19 , 2018 58 solution to degradation with a nuclease . Nucleic acid - lipid dioleoylphosphatidylglycerol (DOPG ) , dipalmitoylphos particles and their method of preparation are disclosed in , phatidylglycerol (DPPG ) , dioleoyl- phosphatidyletha e . g ., U . S . Pat . Nos . 5 , 976 , 567 ; 5 , 981, 501 ; 6 ,534 ,484 ; 6 , 586 , nolamine (DOPE ) , palmitoyloleoylphosphatidylcholine 410 ; 6 ,815 ,432 ; US Publication No . 2010 / 0324120 and PCT Publication No . WO 96 /40964 . (POPC ), palmitoyloleoylphosphatidylethanolamine [ 0465 ] In one embodiment, the lipid to drug ratio (mass / (POPE ) , dioleoyl -phosphatidylethanolamine 4 -( N -maleim mass ratio ) ( e . g . , lipid to dsRNA ratio ) will be in the range idomethyl) -cyclohexane - l- carboxylate (DOPE -mal ) , of from about 1 : 1 to about 50 : 1 , from about 1 : 1 to about dipalmitoyl phosphatidyl ethanolamine (DPPE ) , dimyris 25 : 1, from about 3 : 1 to about 15 : 1, from about 4 : 1 to about toylphosphoethanolamine (DMPE ) , distearoyl- phosphati 10 : 1 , from about 5 : 1 to about 9 : 1 , or about 6 : 1 to about 9 :1 . dyl -ethanolamine (DSPE ), 16 - O -monomethyl PE , 16 -0 - di Ranges intermediate to the above recited ranges are also methyl PE , 18 - 1 - trans PE , 1 - stearoyl- 2 -oleoyl contemplated to be part of the invention . phosphatidyethanolamine (SOPE ) , cholesterol, or a mixture [0466 ] The cationic lipid can be, for example , N , N - diol thereof. The non -cationic lipid can be from about 5 mol % eyl- N , N -dimethylammonium chloride (DODAC ) , N , N - dis to about 90 mol % , about 10 mol % , or about 58 mol % if tearyl- N , N -dimethylammonium bromide (DDAB ), N -( I- ( 2 , cholesterol is included , of the total lipid present in the 3 -dioleoyloxy ) propyl) -N ,N ,N -trimethylammonium chloride particle . (DOTAP ) , N - ( 1 - ( 2 , 3 -dioleyloxy )propyl ) - N , N , N - trimethyl ammonium chloride ( DOTMA ), N , N -dimethyl - 2 ,3 -dioley [0470 ] The conjugated lipid that inhibits aggregation of loxy ) propylamine (DODMA ), 1 , 2 -DiLinoleyloxy - N , N - dim particles can be , for example , a polyethyleneglycol (PEG ) ethylaminopropane (DLinDMA ), 1 , 2 - Dilinolenyloxy - N , N lipid including , without limitation , a PEG -diacylglycerol dimethylaminopropane (DLenDMA ), 1 , 2 (DAG ), a PEG -dialkyloxypropyl (DAA ), a PEG -phospho Dilinoleylcarbamoyloxy - 3 - dimethylaminopropane (DLin lipid , a PEG -ceramide ( Cer) , or a mixture thereof. The C -DAP ) , 1, 2 - Dilinoleyoxy - 3 -( dimethylamino ) PEG -DAA conjugate can be , for example , a PEG -dilaury acetoxypropane (DLin - DAC ) , 1 , 2 -Dilinoleyoxy - 3 loxypropyl ( Ciz) , a PEG -dimyristyloxypropyl (Cid ), a PEG morpholinopropane (DLin -MA ), 1, 2 - Dilinoleoyl- 3 dipalmityloxypropyl ( Cic ), or a PEG - distearyloxypropyl dimethylaminopropane (DLinDAP ) , 1 , 2 - Dilinoleylthio - 3 ( C ] ). The conjugated lipid that prevents aggregation of dimethylaminopropane (DLin - S -DMA ) , 1 -Linoleoyl - 2 particles can be from 0 mol % to about 20 mol % or about linoleyloxy - 3 - dimethylaminopropane (DLin - 2 -DMAP ) , 2 mol % of the total lipid present in the particle . 1 , 2 -Dilinoleyloxy - 3 - trimethylaminopropane chloride salt (DLin - TMA .CI ) , 1, 2- Dilinoleoyl -3 -trimethylaminopropane [ 0471] In some embodiments , the nucleic acid - lipid par chloride salt (DLin - TAP. CI ) , 1 , 2 - Dilinoleyloxy - 3 - ( N -meth ticle further includes cholesterol at , e. g ., about 10 mol % to ylpiperazino ) propane (DLin -MPZ ) , or 3 - ( N , N - Dilinoley about 60 mol % or about 48 mol % of the total lipid present lamino ) - 1 , 2 -propanediol (DLinAP ), 3 - ( N , N - Dioleylamino ) in the particle. 1 ,2 -propanedio (DOAP ), 1, 2 -Dilinoleyloxo - 3 -( 2 - N , N [0472 ] In one embodiment, the lipidoid ND98 .4HCI (MW dimethylamino ) ethoxypropane (DLin -EG - DMA ) , 1 , 2 1487 ) (see US20090023673 , which is incorporated herein Dilinolenyloxy - N , N -dimethylaminopropane (DLinDMA ), by reference ) , Cholesterol (Sigma - Aldrich ) , and PEG - Cer 2 , 2 - Dilinoleyl- 4 - dimethylaminomethyl- [ 1 , 3 ] - dioxolane amide C16 ( Avanti Polar Lipids ) can be used to prepare (DLin - K - DMA ) or analogs thereof, ( 3aR , 5s, 6aS ) - N , N - dim lipid -dsRNA nanoparticles ( i. e ., LNP01 particles ). Stock ethyl- 2 , 2 - di( ( 9Z , 12Z ) - octadeca - 9 , 12 -dienyl ) tetrahydro solutions of each in ethanol can be prepared as follows: 3aH -cyclopenta [d ][ 1, 3 ]dioxol - 5 -amine (ALN100 ), (62 ,9Z , 287 ,31Z ) - heptatriaconta - 6 , 9 ,28 , 31 -tetraen - 19 - yl ND98 , 133 mg/ml ; Cholesterol , 25 mg/ ml , PEG - Ceramide 4 - ( dimethylamino )butanoate (MC3 ), 1 , 1 '- ( 2 - ( 4 - ( 2 - ( ( 2 -( bis C16 , 100 mg/ ml . The ND98 , Cholesterol, and PEG -Cer ( 2 - hydroxydodecyl) amino Jethyl) ( 2 -hydroxydodecyl ) amino ) amide C16 stock solutions can then be combined in a , e. g . , ethyl) piperazin - 1 -yl ) ethylazanediyl ) didodecan - 2 - ol ( Tech 42: 48 : 10 molar ratio . The combined lipid solution can be G1) , or a mixture thereof . The cationic lipid can comprise mixed with aqueous dsRNA ( e . g ., in sodium acetate pH 5 ) from about 20 mol % to about 50 mol % or about 40 mol % such that the final ethanol concentration is about 35 - 45 % of the total lipid present in the particle . and the final sodium acetate concentration is about 100 -300 [0467 ] In some embodiments , the compound 2 , 2 - Dilinol mM . Lipid -dsRNA nanoparticles typically form spontane eyl- 4 -dimethylaminoethyl - [ 1 , 3 ] - dioxolane can be used to ously upon mixing . Depending on the desired particle size prepare lipid - siRNA nanoparticles . distribution , the resultant nanoparticle mixture can be [0468 ] In some embodiments , the lipid - siRNA particle extruded through a polycarbonate membrane ( e .g ., 100 nm includes 40 % 2 , 2 -Dilinoleyl - 4 - dimethylaminoethyl - [ 1 , 3 ] cut- off ) using , for example , a thermobarrel extruder , such as dioxolane : 10 % DSPC : 40 % Cholesterol: 10 % PEG - C Lipex Extruder (Northern Lipids, Inc ). In some cases, the DOMG (mole percent ) with a particle size of 63. 0 + 20 nm extrusion step can be omitted . Ethanol removal and simul and a 0 .027 siRNA /Lipid Ratio . taneous buffer exchange can be accomplished by, for [0469 ] The ionizable /non - cationic lipid can be an anionic example , dialysis or tangential flow filtration . Buffer can be lipid or a neutral lipid including , but not limited to , dis exchanged with , for example , phosphate buffered saline tearoylphosphatidylcholine (DSPC ), dioleoylphosphatidyl (PBS ) at about pH 7 , e . g ., about pH 6 . 9 , about pH 7 . 0 , about choline (DOPC ), dipalmitoylphosphatidylcholine (DPPC ), pH 7. 1, about pH 7 .2 , about pH 7 . 3 , or about pH 7 .4 . US 2018 /0201929 A1 Jul. 19 , 2018 59

Formula 1

ZE NH w N ND98 Isomer I

[0473 ] LNP01 formulations are described , e .g ., in Inter national Application Publication No. WO 2008 /042973 , which is hereby incorporated by reference . [ 0474 ] Additional exemplary lipid - dsRNA formulations are described in Table 1. TABLE 1 Exemplary lipid formulations cationic lipid /non - cationic lipid / cholesterol/ PEG -lipid conjugate Ionizable /Cationic Lipid Lipid : siRNA ratio SNALP - 1 1, 2 -Dilinolenyloxy - N , N DLinDMA / DPPC /Cholesterol / PEG - CDMA dimethylaminopropane (DLinDMA ) (57 . 1 / 7 . 1 / 34 .4 / 1 . 4 ) lipid : siRNA ~ 7 : 1 2 - XTC 2 , 2 - Dilinoleyl- 4 - dimethylaminoethyl XTC / DPPC /Cholesterol / PEG -CDMA [ 1 , 3 ]- dioxolane (XTC ) 57 . 1 / 7 . 1 / 34 . 4 / 1 . 4 lipid :siRNA ~ 7 : 1 LNP05 2 , 2 - Dilinoleyl -4 -dimethylaminoethyl XTC /DSPC / Cholesterol/ PEG -DMG [ 1 , 3 ] - dioxolane (XTC ) 57 . 5 / 7 . 5 /31 . 5 / 3 . 5 lipid : siRNA - 6 : 1 LNP06 2 ,2 -Dilinoleyl - 4 -dimethylaminoethyl XTC /DSPC /Cholesterol / PEG - DMG [ 1 ,3 ]- dioxolane (XTC ) 57 . 5 / 7 . 5 / 31 . 5 / 3 . 5 lipid :siRNA ~ 11 : 1 LNP07 2 , 2 - Dilinoleyl- 4 - dimethylaminoethyl XTC / DSPC /Cholesterol / PEG - DMG [ 1, 3 ] -dioxolane (XTC ) 60 / 7 . 5 / 31/ 1 . 5 , lipid : siRNA - 6 : 1 LNP08 2 ,2 - Dilinoleyl -4 -dimethylaminoethyl XTC /DSPC / Cholesterol/ PEG -DMG [ 1 , 3 ] -dioxolane (XTC ) 60 / 7 .5 /31 / 1 . 5 , lipid : siRNA - 11 : 1 LNP09 2 , 2 - Dilinoleyl- 4 -dimethylaminoethyl XTC /DSPC / Cholesterol/ PEG -DMG [ 1 ,3 ]- dioxolane (XTC ) 50 / 10 / 38 . 5 / 1 . 5 Lipid : siRNA 10 : 1 LNP10 (3aR ,5s , 6aS ) - N , N -dimethyl - 2 ,2 ALN100 /DSPC / Cholesterol/ PEG - DMG di( ( 97 , 12Z ) - octadeca - 9 ,12 50 / 10 / 38 . 5 / 1 . 5 dienyl) tetrahydro -3aH Lipid :siRNA 10 :1 cyclopenta [ d ][ 1 , 3 ] dioxol- 5 - amine ( ALN100 ) LNP11 (62 , 92 , 282 , 31Z )- heptatriaconta MC - 3 /DSPC /Cholesterol /PEG - DMG 6 , 9 ,28 ,31 - tetraen - 19 -yl 4 50 / 10 / 38 . 5 / 1 . 5 ( dimethylamino )butanoate (MC3 ) Lipid :siRNA 10 :1 LNP12 1 , 1 '- ( 2 - ( 4 - ( 2 - ( ( 2 - ( bis ( 2 Tech G1 /DSPC / Cholesterol/ PEG - DMG hydroxydodecyl) amino )ethyl ) ( 2 50 / 10 /38 . 5 /1 . 5 hydroxydodecyl) amino) ethyl) piperazin - Lipid : siRNA 10 :1 1 - yl ) ethylazanediyl ) didodecan - 2 -ol ( Tech G1) LNP13 XTC XTC /DSPC /Chol / PEG -DMG 50 / 10 /38 . 5 / 1 . 5 Lipid :siRNA : 33 : 1 LNP14 MC3 MC3/ DSPC / Chol/ PEG -DMG 40 / 15 / 40 / 5 Lipid : siRNA : 11 : 1 US 2018 /0201929 A1 Jul. 19 , 2018 60

TABLE 1 - continued | Exemplary lipid formulations cationic lipid /non - cationic lipid /cholesterol / PEG - lipid conjugate Ionizable /Cationic Lipid Lipid :siRNA ratio LNP15 MC3 MC3/ DSPC /Chol / PEG - DSG /GalNAc - PEG DSG 50 / 10 / 35 / 4 . 5 /0 .5 Lipid :siRNA : 11 : 1 LNP16 MC3 MC3/ DSPC / Chol/ PEG -DMG 50 / 10 / 38 . 5 / 1 . 5 Lipid :siRNA : 7 : 1 LNP17 MC3 MC3/ DSPC /Chol / PEG - DSG 50 / 10 / 38 . 5 / 1 . 5 Lipid : siRNA : 10 : 1 LNP18 MC3 MC3/ DSPC /Chol / PEG - DMG 50 / 10 / 38 . 5 / 1 . 5 Lipid : siRNA : 12 : 1 LNP19 MC3 MC3/ DSPC /Chol / PEG -DMG 50 / 10 / 35 / 5 Lipid : siRNA : 8 : 1 LNP20 MC3 MC3 /DSPC /Chol /PEG - DPG 50 / 10 / 38 . 5 / 1 . 5 Lipid : siRNA : 10 : 1 LNP21 C12 -200 C12 - 200 /DSPC / Chol/ PEG - DSG 50 / 10 / 38 . 5 / 1 . 5 Lipid : siRNA : 7 : 1 LNP22 XTC XTC /DSPC / Chol/ PEG - DSG 50 / 10 / 38 . 5 / 1 . 5 Lipid :siRNA : 10 : 1

DSPC : distearoylphosphatidylcholine chelators. Suitable surfactants include fatty acids or esters or DPPC : dipalmitoylphosphatidylcholine salts thereof, bile acids or salts thereof. Suitable bile acids/ PEG - DMG : PEG - didimyristoyl glycerol (C14 - PEG , or salts include chenodeoxycholic acid (CDCA ) and ursode PEG -C14 ) (PEG with avg mol wt of 2000 ) oxychenodeoxycholic acid (UDCA ) , cholic acid , dehydro PEG -DSG : PEG - distyryl glycerol (C18 -PEG , or PEG -C18 ) cholic acid , deoxycholic acid , glucholic acid , glycholic acid , (PEG with avg mol wt of 2000 ) glycodeoxycholic acid , taurocholic acid , taurodeoxycholic PEG - CDMA : PEG - carbamoyl- 1 , 2 -dimyristyloxypropylam acid , sodium tauro - 24 ,25 - dihydro - fusidate and sodium gly ine (PEG with avg mol wt of 2000 ) codihydrofusidate . Suitable fatty acids include arachidonic SNALP ( 1 , 2 - Dilinolenyloxy - N , N - dimethylaminopropane acid , undecanoic acid , oleic acid , lauric acid , caprylic acid , (DLinDMA ) ) comprising formulations are described in capric acid , myristic acid , palmitic acid , stearic acid , linoleic International Publication No . WO2009 / 127060, filed Apr. acid , linolenic acid , dicaprate , tricaprate , monoolein , dilau 15 , 2009 , which is hereby incorporated by reference . rin , glyceryl 1 -monocaprate , 1 -dodecylazacycloheptan - 2 [0475 ] XTC comprising formulations are described , e . g . , one , an acylcarnitine , an acylcholine , or a monoglyceride , a in International Application No. PCT/ US2010 /022614 , filed diglyceride or a pharmaceutically acceptable salt thereof Jan . 29 , 2010 , which is hereby incorporated by reference . ( e . g ., sodium ) . In some embodiments, combinations of pen [0476 ] MC3 comprising formulations are described , e . g . , etration enhancers are used , for example, fatty acids/ salts in in US Patent Publication No . 2010 /0324120 , filed Jun . 10 , combination with bile acids/ salts . One exemplary combina 2010 , the entire contents of which are hereby incorporated tion is the sodium salt of lauric acid , capric acid and UDCA . by reference . Further penetration enhancers include polyoxyethylene - 9 [0477 ] ALNY- 100 comprising formulations are described , lauryl ether, polyoxyethylene - 20 - cetyl ether. DsRNAs fea e . g ., International patent application number PCT/ USO9 / tured in the invention can be delivered orally , in granular 63933 , filed on Nov. 10 , 2009, which is hereby incorporated form including sprayed dried particles , or complexed to by reference . form micro or nanoparticles. DsRNA complexing agents [0478 ] C12 - 200 comprising formulations are described in include poly - amino acids; polyimines ; polyacrylates; poly WO2010/ 129709, which is hereby incorporated by refer alkylacrylates, polyoxethanes, polyalkylcyanoacrylates; cat ence . ionized gelatins, albumins , starches , acrylates , polyethyl [ 04791 Compositions and formulations for oral adminis eneglycols (PEG ) , and starches; polyalkylcyanoacrylates ; tration include powders or granules, microparticulates , DEAE -derivatized polyimines, pollulans , celluloses, and nanoparticulates, suspensions , or solutions in water or non starches. Suitable complexing agents include chitosan , aqueous media , capsules , gel capsules, sachets , tablets or N -trimethylchitosan , poly - L - lysine, polyhistidine, polyorni minitablets . Thickeners , flavoring agents , diluents , emulsi thine, polyspermines, protamine , polyvinylpyridine, poly fiers, dispersing aids , or binders can be desirable . In some thiodiethylaminomethylethylene P ( TDAE ) , polyaminosty embodiments , oral formulations are those in which dsRNAS rene ( e . g . , p - amino ) , poly (methylcyanoacrylate ) , poly featured in the invention are administered in conjunction (ethylcyanoacrylate ), poly (butylcyanoacrylate ), poly with one or more penetration enhancer surfactants and (isobutylcyanoacrylate ), poly ( isohexylcynaoacrylate ) , US 2018 /0201929 A1 Jul. 19 , 2018

DEAE -methacrylate , DEAE - hexylacrylate, DEAE - acrylam - mixed and dispersed with each other. In general, emulsions ide , DEAE - albumin and DEAE - dextran , polymethylacry can be of either the water- in - oil ( w / o ) or the oil - in - water late , polyhexylacrylate , poly ( D , L - lactic acid ), poly (DL - lac ( o / w ) variety . When an aqueous phase is finely divided into tic -co - glycolic acid (PLGA ), alginate , and and dispersed as minute droplets into a bulk oily phase , the polyethyleneglycol (PEG ) . Oral formulations for dsRNAS resulting composition is called a water- in -oil (wlo ) emul and their preparation are described in detail in U . S . Pat. No . sion . Alternatively, when an oily phase is finely divided into 6 , 887, 906 , US Publn . No . 20030027780 , and U . S . Pat. No . and dispersed as minute droplets into a bulk aqueous phase , 6 , 747, 014 , each of which is incorporated herein by refer the resulting composition is called an oil - in -water ( o / w ) ence . emulsion . Emulsions can contain additional components in [ 0480 Compositions and formulations for parenteral, addition to the dispersed phases, and the active drug which intraparenchymal ( into the brain ) , intrathecal, intraventricu can be present as a solution either in the aqueous phase , oily lar, or intrahepatic administration can include sterile aque phase or itself as a separate phase . Pharmaceutical excipients ous solutions which can also contain buffers , diluents , and such as emulsifiers , stabilizers , dyes, and antioxidants can other suitable additives such as, but not limited to , penetra also be present in emulsions as needed . Pharmaceutical tion enhancers, carrier compounds , and other pharmaceuti emulsions can also be multiple emulsions that are comprised cally acceptable carriers or excipients . ofmore than two phases such as, for example , in the case of [ 0481] Pharmaceutical compositions of the present inven oil- in -water - in -oil ( o / w / o ) and water - in - oil - in -water ( w / o / w ) tion include , but are not limited to , solutions , emulsions , and emulsions . Such complex formulations often provide certain liposome- containing formulations . These compositions can advantages that simple binary emulsions do not. Multiple be generated from a variety of components that include , but emulsions in which individual oil droplets of an o / w emul are not limited to , preformed liquids , self - emulsifying sol sion enclose small water droplets constitute a w / o / w emul ids, and self - emulsifying semisolids . Formulations include sion . Likewise a system of oil droplets enclosed in globules those that target the liver when treating hepatic disorders of water stabilized in an oily continuous phase provides an such as hepatic carcinoma . o /w /o emulsion. [0482 ] The pharmaceutical formulations of the present [0487 ] Emulsions are characterized by little or no thermo invention , which can conveniently be presented in unit dynamic stability . Often , the dispersed or discontinuous dosage form , can be prepared according to conventional phase of the emulsion is well dispersed into the external or techniques well known in the pharmaceutical industry . Such continuous phase and maintained in this form through the techniques include the step of bringing into association the means of emulsifiers or the viscosity of the formulation . active ingredients with the pharmaceutical carrier ( s ) or Either of the phases of the emulsion can be a semisolid or a excipient( s ) . In general, the formulations are prepared by solid , as is the case of emulsion -style ointment bases and uniformly and intimately bringing into association the active creams. Other means of stabilizing emulsions entail the use ingredients with liquid carriers or finely divided solid car of emulsifiers that can be incorporated into either phase of riers or both , and then , if necessary, shaping the product. the emulsion . Emulsifiers can broadly be classified into four [ 0483 ] The compositions of the present invention can be categories : synthetic surfactants , naturally occurring emul formulated into any of many possible dosage forms such as, sifiers , absorption bases , and finely dispersed solids (see but not limited to , tablets , capsules , gel capsules, liquid e . g ., Ansel ' s Pharmaceutical Dosage Forms and Drug Deliv syrups, soft gels , suppositories, and enemas . The composi ery Systems, Allen , L V ., Popovich N G ., and Ansel H C . , tions of the present invention can also be formulated as 2004 , Lippincott Williams & Wilkins ( 8th ed . ), New York , suspensions in aqueous, non -aqueous or mixed media . N . Y . , Idson , in Pharmaceutical Dosage Forms, Lieberman , Aqueous suspensions can further contain substances which Rieger and Banker (Eds . ), 1988 , Marcel Dekker, Inc. , New increase the viscosity of the suspension including, for York , N . Y ., volume 1, p . 199 ) . example , sodium carboxymethylcellulose , sorbitol, or dex [0488 ] Synthetic surfactants , also known as surface active tran . The suspension can also contain stabilizers . agents , have found wide applicability in the formulation of [ 0484 ] C . Additional Formulations emulsions and have been reviewed in the literature (see e . g . , 104851 i . Emulsions Ansel' s Pharmaceutical Dosage Forms and Drug Delivery [0486 ] The iRNAs of the present invention can be pre Systems, Allen , L V ., Popovich N G ., and Ansel H C ., 2004 , pared and formulated as emulsions . Emulsions are typically Lippincott Williams & Wilkins (8th ed . ), New York , N . Y . ; heterogeneous systems of one liquid dispersed in another in Rieger , in Pharmaceutical Dosage Forms, Lieberman , the form of droplets usually exceeding 0 . 1 um in diameter Rieger and Banker (Eds . ), 1988 , Marcel Dekker, Inc ., New (see e . g . , Ansel' s Pharmaceutical Dosage Forms and Drug York , N . Y . , volume 1 , p . 285 ; Idson , in Pharmaceutical Delivery Systems, Allen , L V . , Popovich N G . , and Ansel H . Dosage Forms, Lieberman , Rieger and Banker (Eds . ) , Mar C . , 2004 , Lippincott Williams & Wilkins ( 8th ed . ), New cel Dekker, Inc . , New York , N . Y . , 1988 , volume 1 , p . 199 ) . York , N . Y .; Idson , in Pharmaceutical Dosage Forms, Lie Surfactants are typically amphiphilic and comprise a hydro berman , Rieger and Banker (Eds . ), 1988 , Marcel Dekker , philic and a hydrophobic portion . The ratio of the hydro Inc ., New York , N . Y ., volume 1 , p . 199 ; Rosoff, in Pharma philic to the hydrophobic nature of the surfactant has been ceutical Dosage Forms, Lieberman , Rieger and Banker termed the hydrophile /lipophile balance (HLB ) and is a ( Eds. ), 1988 , Marcel Dekker, Inc ., New York , N . Y ., Volume valuable tool in categorizing and selecting surfactants in the 1 , p . 245 ; Block in Pharmaceutical Dosage Forms, Lieber preparation of formulations. Surfactants can be classified man , Rieger and Banker ( Eds. ) , 1988 , Marcel Dekker , Inc ., into different classes based on the nature of the hydrophilic New York , N . Y. , volume 2, p . 335 ; Higuchi et al. , in group : nonionic , anionic , cationic , and amphoteric (see e. g. , Remington ' s Pharmaceutical Sciences , Mack Publishing Ansel' s Pharmaceutical Dosage Forms and Drug Delivery Co . , Easton , Pa . , 1985 , p . 301) . Emulsions are often biphasic Systems, Allen , L V ., Popovich N G ., and Ansel H C ., 2004 , systems comprising two immiscible liquid phases intimately Lippincott Williams & Wilkins (8th ed .) , New York , N . Y . US 2018 /0201929 A1 Jul. 19 , 2018

Rieger , in Pharmaceutical Dosage Forms, Lieberman , bioavailability standpoint (see e. g ., Ansel' s Pharmaceutical Rieger and Banker (Eds .) , 1988 , Marcel Dekker , Inc. , New Dosage Forms and Drug Delivery Systems, Allen , L V ., York , N . Y ., volume 1 , p . 285 ) . Popovich N G . , and Ansel H C ., 2004 , Lippincott Williams [0489 ] Naturally occurring emulsifiers used in emulsion & Wilkins ( 8th ed . ) , New York , N . Y . ; Rosoff , in Pharma formulations include lanolin , beeswax , phosphatides , leci ceutical Dosage Forms, Lieberman , Rieger and Banker thin , and acacia . Absorption bases possess hydrophilic prop (Eds . ) , 1988 , Marcel Dekker, Inc ., New York , N . Y . , volume erties such that they can soak up water to form wlo emul 1 , p . 245 ; Idson , in Pharmaceutical Dosage Forms, Lieber sions yet retain their semisolid consistencies, such as man , Rieger and Banker (Eds . ) , 1988 , Marcel Dekker , Inc . , anhydrous lanolin and hydrophilic petrolatum . Finely New York , N . Y . , volume 1 , p . 199 ) . Mineral - oil base laxa divided solids have also been used as good emulsifiers tives, oil- soluble vitamins, and high fat nutritive prepara especially in combination with surfactants and in viscous tions are among the materials that have commonly been preparations . These include polar inorganic solids, such as administered orally as o / w emulsions. heavy metal hydroxides, nonswelling clays such as benton [0494 ] ii . Microemulsions ite , attapulgite, hectorite , kaolin , montmorillonite , colloidal 10495 ] In one embodiment of the present invention , the aluminum silicate , and colloidal magnesium aluminum sili iRNAs are formulated as microemulsions . A microemulsion cate, pigments and nonpolar solids such as carbon or glyc can be defined as a system of water , oil, and amphiphile eryl tristearate . which is a single optically isotropic and thermodynamically [0490 ] A large variety of non - emulsifying materials are stable liquid solution ( see e. g ., Ansel' s Pharmaceutical Dos also included in emulsion formulations and contribute to the age Forms and Drug Delivery Systems, Allen , L V ., Pop properties of emulsions. These include fats , oils , waxes , ovich N G . , and Ansel H C ., 2004 , Lippincott Williams & fatty acids , fatty alcohols , fatty esters , humectants , hydro Wilkins ( 8th ed . ), New York , N . Y . ; Rosoff, in Pharmaceu philic colloids, preservatives, and antioxidants ( Block , in tical Dosage Forms, Lieberman , Rieger and Banker ( Eds . ) , Pharmaceutical Dosage Forms, Lieberman , Rieger and 1988 , Marcel Dekker , Inc. , New York , N . Y ., volume 1 , p . Banker (Eds . ) , 1988 , Marcel Dekker , Inc. , New York , N . Y . , 245 ). Typically microemulsions are systems that are pre volume 1 , p . 335 ; Idson , in Pharmaceutical Dosage Forms, pared by first dispersing an oil in an aqueous surfactant Lieberman , Rieger and Banker (Eds . ), 1988 , Marcel Dekker, solution and then adding a sufficient amount of a fourth Inc ., New York , N . Y . , volume 1 , p . 199 ) . component , generally an intermediate chain - length alcohol [0491 ] Hydrophilic colloids or hydrocolloids include natu to form a transparent system . Therefore, microemulsions rally occurring gums and synthetic polymers such as poly have also been described as thermodynamically stable , iso saccharides ( for example , acacia , agar, alginic acid , carra tropically clear dispersions of two immiscible liquids that geenan , guar gum , karaya gum , and tragacanth ) , cellulose are stabilized by interfacial films of surface - active molecules derivatives ( for example , carboxymethylcellulose and car (Leung and Shah , in : Controlled Release of Drugs : Polymers boxypropylcellulose ) , and synthetic polymers ( for example , and Aggregate Systems, Rosoff , M ., Ed ., 1989 , VCH Pub carbomers , cellulose ethers , and carboxyvinyl polymers ) . lishers , New York , pages 185 -215 ). Microemulsions com These disperse or swell in water to form colloidal solutions monly are prepared via a combination of three to five that stabilize emulsions by forming strong interfacial films components that include oil, water, surfactant, cosurfactant around the dispersed - phase droplets and by increasing the and electrolyte . Whether the microemulsion is of the water viscosity of the external phase . in - oil ( w / o ) or an oil - in -water ( o / w ) type is dependent on the [0492 ] Since emulsions often contain a number of ingre properties of the oil and surfactant used and on the structure dients such as carbohydrates , proteins , sterols and phospha and geometric packing of the polar heads and hydrocarbon tides that can readily support the growth of microbes , these tails of the surfactant molecules (Schott , in Remington ' s formulations often incorporate preservatives . Commonly Pharmaceutical Sciences , Mack Publishing Co ., Easton , Pa ., used preservatives included in emulsion formulations 1985 , p . 271) . include methyl paraben , propyl paraben , quaternary ammo [0496 ] The phenomenological approach utilizing phase nium salts , benzalkonium chloride , esters of p -hydroxyben diagrams has been extensively studied and has yielded a zoic acid , and boric acid . Antioxidants are also commonly comprehensive knowledge, to one skilled in the art , of how added to emulsion formulations to prevent deterioration of to formulate microemulsions ( see e . g . , Ansel ' s Pharmaceu the formulation . Antioxidants used can be free radical scav tical Dosage Forms and Drug Delivery Systems, Allen , L V ., engers such as tocopherols , alkyl gallates , butylated Popovich N G . , and Ansel H C ., 2004 , Lippincott Williams hydroxyanisole , butylated hydroxytoluene , or reducing & Wilkins (8th ed .) , New York , N . Y .; Rosoff, in Pharma agents such as ascorbic acid and sodium metabisulfite , and ceutical Dosage Forms, Lieberman , Rieger and Banker antioxidant synergists such as citric acid , tartaric acid , and (Eds . ), 1988 , Marcel Dekker , Inc . , New York , N . Y . , volume lecithin . 1 , p . 245 ; Block , in Pharmaceutical Dosage Forms, Lieber 0493 ] The application of emulsion formulations via der man , Rieger and Banker (Eds . ) , 1988 , Marcel Dekker, Inc . , matological, oral, and parenteral routes , and methods for New York , N . Y . , volume 1 , p . 335 ). Compared to conven their manufacture have been reviewed in the literature ( see tional emulsions, microemulsions offer the advantage of e . g . , Ansel' s Pharmaceutical Dosage Forms and Drug Deliv solubilizing water - insoluble drugs in a formulation of ther ery Systems, Allen , L V. , Popovich N G ., and Ansel H C ., modynamically stable droplets that are formed spontane 2004, Lippincott Williams & Wilkins (8th ed . ) , New York , ously . N . Y . ; Idson , in Pharmaceutical Dosage Forms, Lieberman , [0497 ) Surfactants used in the preparation of microemul Rieger and Banker ( Eds. ), 1988 , Marcel Dekker, Inc. , New sions include, but are not limited to , ionic surfactants , York , N . Y . , volume 1 , p . 199 ) . Emulsion formulations for non - ionic surfactants , Brij® 96 , polyoxyethylene oleyl oral delivery have been very widely used because of ease of ethers , polyglycerol fatty acid esters, tetraglycerol monolau formulation , as well as efficacy from an absorption and rate (ML310 ), tetraglycerol monooleate (MO310 ), US 2018 /0201929 A1 Jul. 19 , 2018 62 hexaglycerol monooleate ( PO310 ) , hexaglycerol pen [0500 ] iii. Microparticles taoleate (PO500 ) , decaglycerol monocaprate (MCA750 ) , [0501 ] An iRNA of the invention may be incorporated into decaglycerol monooleate (M0750 ) , decaglycerol sequi a particle , e . g ., a microparticle . Microparticles can be pro duced by spray -drying , but may also be produced by other oleate (S0750 ) , decaglycerol decaoleate (DA0750 ) , alone methods including lyophilization , evaporation , fluid bed or in combination with cosurfactants . The cosurfactant, drying , vacuum drying , or a combination of these tech usually a short -chain alcohol such as ethanol, 1- propanol , niques . and 1 -butanol , serves to increase the interfacial fluidity by (0502 ]. iv. Penetration Enhancers penetrating into the surfactant film and consequently creat [0503 ] In one embodiment, the present invention employs ing a disordered film because of the void space generated various penetration enhancers to effect the efficient delivery among surfactant molecules. Microemulsions can , however, of nucleic acids, particularly iRNAs, to the skin of animals . be prepared without the use of cosurfactants and alcohol Most drugs are present in solution in both ionized and free self -emulsifying microemulsion systems are known in nonionized forms. However, usually only lipid soluble or the art. The aqueous phase can typically be , but is not limited lipophilic drugs readily cross cell membranes. It has been to , water , an aqueous solution of the drug , glycerol, PEG300 , discovered that even non - lipophilic drugs can cross cell PEG400 , polyglycerols , propylene glycols , and derivatives membranes if the membrane to be crossed is treated with a of ethylene glycol. The oil phase can include , but is not penetration enhancer. In addition to aiding the diffusion of limited to , materials such as Captex® 300 , Captex® 355 , non - lipophilic drugs across cell membranes , penetration Capmul® MCM , fatty acid esters, medium chain (C8 -C12 ) enhancers also enhance the permeability of lipophilic drugs . mono , di, and tri - glycerides, polyoxyethylated glyceryl fatty [0504 ] Penetration enhancers can be classified as belong acid esters , fatty alcohols , polyglycolized glycerides, satu ing to one of five broad categories, i. e . , surfactants , fatty rated polyglycolized C8 - C10 glycerides , vegetable oils , and acids, bile salts , chelating agents , and non - chelating non silicone oil. surfactants ( see e . g . , Malmsten , M . Surfactants and poly mers in drug delivery , Informa Health Care , New York , N . Y . , [0498 ] Microemulsions are particularly of interest from 2002 ; Lee et al. , Critical Reviews in Therapeutic Drug the standpoint of drug solubilization and the enhanced Carrier Systems, 1991, p . 92 ) . Such compounds are well absorption of drugs . Lipid based microemulsions ( both o / w known in the art . and wlo ) have been proposed to enhance the oral bioavail (0505 ] v . Carriers ability of drugs , including peptides (see e .g ., U . S . Pat . Nos. 10506 ] Certain compositions of the present invention also 6 , 191, 105 ; 7 ,063 , 860 ; 7 ,070 ,802 ; 7 ,157 ,099 ; Constantinides incorporate carrier compounds in the formulation . As used et al . , Pharmaceutical Research , 1994 , 11 , 1385 - 1390 ; herein , " carrier compound ” or “ carrier” can refer to a nucleic Ritschel, Meth . Find . Exp . Clin . Pharmacol. , 1993 , 13, 205 ) . acid , or analog thereof, which is inert ( i. e ., does not possess Microemulsions afford advantages of improved drug solu biological activity per se ) but is recognized as a nucleic acid bilization , protection of drug from enzymatic hydrolysis , by in vivo processes that reduce the bioavailability of a possible enhancement of drug absorption due to surfactant nucleic acid having biological activity by, for example , induced alterations in membrane fluidity and permeability , degrading the biologically active nucleic acid or promoting ease of preparation , ease of oral administration over solid its removal from circulation . The coadministration of a dosage forms, improved clinical potency, and decreased nucleic acid and a carrier compound , typically with an toxicity (see e. g . , U . S . Pat. Nos . 6 , 191, 105 ; 7 , 063 , 860 ; excess of the latter substance , can result in a substantial 7 . 070 .802 ; 7 , 157 ,099 ; Constantinides et al ., Pharmaceutical reduction of the amount of nucleic acid recovered in the Research , 1994 , 11 , 1385 ; Ho et al. , J . Pharm . Sci. , 1996 , 85 , liver , kidney or other extracirculatory reservoirs , presum 138 - 143 ) . Often microemulsions can form spontaneously ably due to competition between the carrier compound and when their components are brought together at ambient the nucleic acid for a common receptor . For example , the temperature . This can be particularly advantageous when recovery of a partially phosphorothioate dsRNA in hepatic formulating thermolabile drugs, peptides or iRNAs. Micro tissue can be reduced when it is coadministered with emulsions have also been effective in the transdermal deliv polyinosinic acid , dextran sulfate , polycytidic acid or 4 -ac ery of active components in both cosmetic and pharmaceu etamido - 4' isothiocyano -stilbene - 2 ,2 -disulfonic acid (Miyao tical applications. It is expected that the microemulsion et al ., DsRNA Res. Dev. , 1995 , 5 , 115 - 121 ; Takakura et al. , compositions and formulations of the present invention will DsRNA & Nucl. Acid Drug Dev . , 1996 , 6 , 177 - 183 . facilitate the increased systemic absorption of iRNAs and 10507 ) vi. Excipients nucleic acids from the gastrointestinal tract , as well as (0508 ] In contrast to a carrier compound , a " pharmaceu improve the local cellular uptake of iRNAs and nucleic tical carrier ” or “ excipient” is a pharmaceutically acceptable acids. solvent, suspending agent, or any other pharmacologically [0499 ] Microemulsions of the present invention can also inert vehicle for delivering one or more nucleic acids to an contain additional components and additives such as sorbi animal . The excipient can be liquid or solid and is selected , tan monostearate (Grill® 3 ) , Labrasol® , and penetration with the planned manner of administration in mind , so as to enhancers to improve the properties of the formulation and provide for the desired bulk , consistency , etc . , when com to enhance the absorption of the iRNAs and nucleic acids of bined with a nucleic acid and the other components of a the present invention . Penetration enhancers used in the given pharmaceutical composition . Typical pharmaceutical microemulsions of the present invention can be classified as carriers include, but are not limited to , binding agents ( e . g ., belonging to one of five broad categories — surfactants , fatty pregelatinized maize starch , polyvinylpyrrolidone or acids, bile salts, chelating agents , and non -chelating non - hydroxypropyl methylcellulose , etc . ) ; fillers ( e . g . , lactose surfactants (Lee et al. , Critical Reviews in Therapeutic Drug and other sugars, microcrystalline cellulose, pectin , gelatin , Carrier Systems, 1991 , p . 92 ) . Each of these classes has been calcium sulfate , ethyl cellulose , polyacrylates or calcium discussed above . hydrogen phosphate , etc .) ; lubricants (e . g ., magnesium US 2018 /0201929 A1 Jul. 19 , 2018 64 stearate , talc , silica , colloidal silicon dioxide, stearic acid , therapeutic effects is the therapeutic index and it can be metallic stearates, hydrogenated vegetable oils , corn starch , expressed as the ratio LD50 / ED50 . Compounds that exhibit polyethylene glycols , sodium benzoate , sodium acetate , high therapeutic indices are preferred . etc .) ; disintegrants ( e. g. , starch , sodium starch glycolate , [0517 ] The data obtained from cell culture assays and etc . ) ; and wetting agents ( e . g . , sodium lauryl sulphate , etc ). animal studies can be used in formulating a range of dosage [0509 ] Pharmaceutically acceptable organic or inorganic for use in humans. The dosage of compositions featured excipients suitable for non - parenteral administration which herein in the invention lies generally within a range of do notdeleteriously react with nucleic acids can also be used circulating concentrations that include the ED50 with little to formulate the compositions of the present invention . or no toxicity . The dosage can vary within this range Suitable pharmaceutically acceptable carriers include , but depending upon the dosage form employed and the route of are not limited to , water , salt solutions , alcohols , polyeth administration utilized . For any compound used in the ylene glycols, gelatin , lactose, amylose , magnesium stearate , methods featured in the invention , the therapeutically effec talc , silicic acid , viscous paraffin , hydroxymethylcellulose , tive dose can be estimated initially from cell culture assays . polyvinylpyrrolidone, and the like. A dose can be formulated in animal models to achieve a [0510 ) Formulations for topical administration of nucleic circulating plasma concentration range of the compound or, acids can include sterile and non - sterile aqueous solutions , when appropriate, of the polypeptide product of a target non - aqueous solutions in common solvents such as alcohols , sequence (e .g . , achieving a decreased concentration of the or solutions of the nucleic acids in liquid or solid oil bases . polypeptide ) that includes the IC50 ( i . e . , the concentration The solutions can also contain buffers, diluents and other of the test compound which achieves a half- maximal inhi suitable additives . Pharmaceutically acceptable organic or bition of symptoms) as determined in cell culture. Such inorganic excipients suitable for non - parenteral administra information can be used to more accurately determine useful tion which do not deleteriously react with nucleic acids can doses in humans. Levels in plasma can be measured , for be used . example , by high performance liquid chromatography . [0511 ] Suitable pharmaceutically acceptable excipients 50518 ]. In addition to their administration , as discussed include , but are not limited to , water , salt solutions, alcohol, above , the iRNAs featured in the invention can be admin polyethylene glycols , gelatin , lactose , amylose , magnesium istered in combination with other known agents effective in stearate , talc , silicic acid , viscous paraffin , hydroxymethyl treatment of pathological processes mediated by IGFALS or cellulose , polyvinylpyrrolidone , and the like . IGF - 1 expression . In any event, the administering physician [ 0512 ] vii . Other Components can adjust the amount and timing of iRNA administration on [ 0513] The compositions of the present invention can the basis of results observed using standard measures of additionally contain other adjunct components convention efficacy known in the art or described herein . ally found in pharmaceutical compositions , at their art established usage levels . Thus , for example , the composi VI. Methods of the Invention tions can contain additional, compatible , pharmaceutically [0519 ] The present invention also provides methods of active materials such as , for example , antipruritics, inhibiting expression of an IGFALS gene or IGF - 1 gene in astringents , local anesthetics or anti -inflammatory agents , or a cell. The methods include contacting a cell with an RNAi can contain additional materials useful in physically formu agent, e . g ., double stranded RNAi agent, in an amount lating various dosage forms of the compositions of the effective to inhibit expression of IGFALS or IGF - 1 in the present invention, such as dyes, flavoring agents , preserva cell , thereby inhibiting expression of IGFALS or IGF - 1 in tives , antioxidants , opacifiers , thickening agents and stabi the cell. lizers . However, such materials , when added , should not [ 0520 ] Contacting of a cell with an iRNA , e . g ., a double unduly interfere with the biological activities of the com stranded RNAi agent, may be done in vitro or in vivo . ponents of the compositions of the present invention . The Contacting a cell in vivo with the iRNA includes contacting formulations can be sterilized and , if desired , mixed with a cell or group of cells within a subject, e . g . , a human auxiliary agents , e . g . , lubricants , preservatives , stabilizers , subject, with the iRNA . Combinations of in vitro and in vivo wetting agents , emulsifiers , salts for influencing osmotic methods of contacting a cell are also possible . Contacting a pressure , buffers , colorings , flavorings and / or aromatic sub cell may be direct or indirect, as discussed above . Further stances and the like which do not deleteriously interactwith more , contacting a cell may be accomplished via a targeting the nucleic acid ( s ) of the formulation . ligand , including any ligand described herein or known in [0514 ] Aqueous suspensions can contain substances the art. In preferred embodiments , the targeting ligand is a which increase the viscosity of the suspension including , for carbohydrate moiety , e . g . , a GalNAcz ligand , or any other example , sodium carboxymethylcellulose , sorbitol, or dex ligand that directs the RNAi agent to a site of interest. tran . The suspension can also contain stabilizers . [0521 ] The term " inhibiting, " as used herein , is used [ 0515 ]. In some embodiments, pharmaceutical composi interchangeably with “ reducing, " " silencing , " " downregu tions featured in the invention include ( a ) one ormore iRNA lating ” , “ suppressing” , and other similar terms, and includes and ( b ) one or more agents which function by a non - iRNA any level of inhibition . mechanism and which are useful in treating an IGFALS or 0522 The phrase " inhibiting expression of an IGFALS or IGF - 1 - associated disorder. " inhibiting expression of an IGF - 1” is intended to refer to [ 0516 ] Toxicity and therapeutic efficacy of such com inhibition of expression of any IGFALS gene or IGF- 1 gene pounds can be determined by standard pharmaceutical pro (such as , e . g ., a mouse IGFALS gene or IGF- 1 gene , a rat cedures in cell cultures or experimental animals , e . g ., for IGFALS gene or IGF - 1 gene , a monkey IGFALS gene or determining the LD50 ( the dose lethal to 50 % of the IGF- 1 gene , or a human IGFALS gene or IGF- 1 gene ) as population ) and the ED50 ( the dose therapeutically effective well as variants or mutants of an IGFALS gene or IGF - 1 in 50 % of the population ). The dose ratio between toxic and gene . Thus , the IGFALS gene or IGF - 1 gene may be a US 2018 /0201929 A1 Jul. 19 , 2018 65 wild -type IGFALS gene or IGF - 1 gene, a mutant IGFALS cell expressing IGFALS or IGF - 1 , either endogenous or gene or IGF- 1 gene ( such as a mutant IGFALS gene or heterologous from an expression construct, and by any assay IGF - 1 gene ) , or a transgenic IGFALS gene or IGF - 1 gene in known in the art. the context of a genetically manipulated cell, group of cells , [0528 ] Inhibition of the expression of an IGFALS or or organism . IGF- 1 protein may be manifested by a reduction in the level [ 0523] “ Inhibiting expression of an IGFALS gene” or of the IGFALS or IGF - 1 protein that is expressed by a cell " inhibiting expression of an IGF - 1 gene ” includes any level or group of cells ( e . g ., the level of protein expressed in a of inhibition of an IGFALS gene or an IGF- 1 gene, e . g . , at sample derived from a subject) . As explained above , for the least partial suppression of the expression of an IGFALS assessment of mRNA suppression , the inhibition of protein gene or an IGF - 1 gene . The expression of the IGFALS gene expression levels in a treated cell or group of cells may or an IGF - 1 genemay be assessed based on the level, or the similarly be expressed as a percentage of the level of protein change in the level , of any variable associated with IGFALS in a control cell or group of cells . gene or an IGF - 1 geneexpression , e . g . , IGFALS mRNA or [0529 ] A control cell or group of cells thatmay be used to IGF - 1 mRNA level or an IGFALS protein level or an IGF - 1 assess the inhibition of the expression of an IGFALS or protein level. This levelmay be assessed in an individual cell IGF - 1 gene includes a cell or group of cells that has not yet or in a group of cells , including, for example , a sample been contacted with an RNAi agent of the invention . For derived from a subject . example , the control cell or group of cells may be derived [ 0524 ) Inhibition may be assessed by a decrease in an from an individual subject ( e .g . , a human or animal subject ) absolute or relative level of one or more variables that are prior to treatment of the subject with an RNAi agent. associated with IGFALS or IGF - 1 expression compared with [0530 ] In certain embodiments , inhibition of expression of a control level . The control level may be any type of control an IGF - 1 gene may be manifested in a reduction in the level that is utilized in the art, e .g ., a pre -dose baseline level , difference between a normal level of IGF - 1 mRNA or or a level determined from a similar subject, cell , or sample protein and an abnormal level of IGF - 1 mRNA or protein in that is untreated or treated with a control ( such as , e. g. , a subject or in a specific tissue in the subject , e . g ., mRNA in buffer only control or inactive agent control) . the liver of the subject or IGF - 1 protein in subject serum . [0525 ] In some embodiments of the methods of the inven That is , inhibition may be manifested in a normalization of tion , expression of an IGFALS or IGF- 1 gene is inhibited by expression as compared to an appropriate control. at least 30 % , 35 % , 40 % , 45 % , 50 % , 55 % , 60 % , 65 % , 70 % , [0531 ] The level of IGFALS mRNA or IGF- 1 mRNA that 75 % , 80 % , 85 % , 90 % , or 95 % , or to below the level of is expressed by a cell or group of cells , or the level of detection of the assay . In some embodiments , the inhibition circulating IGFALS mRNA or IGF - 1 mRNA , may be deter of expression of an IGFALS gene or an IGF - 1 gene results mined using any method known in the art for assessing in normalization of the level of IGF- 1 such that the differ mRNA expression . In one embodiment, the level of expres ence between the level before treatment and a normal sion of IGFALS or IGF - 1 in a sample is determined by control level is reduced by at least 30 % , 35 % , 40 % , 45 % , detecting a transcribed polynucleotide , or portion thereof, 50 % , 55 % , 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , 90 % , or 95 % . e . g . , mRNA of the IGFALS gene or IGF - 1 gene . RNA may [ 0526 ] Inhibition of the expression of an IGFALS gene or be extracted from cells using RNA extraction techniques an IGF - 1 gene may be manifested by a reduction of the including, for example , using acid phenol/ guanidine isoth amount of mRNA expressed by a first cell or group of cells iocyanate extraction (RNAzol B ; Biogenesis ), RNeasyTM ( such cells may be present, for example , in a sample derived RNA preparation kits (Qiagen® ) or PAXgene (PreAnalytix , from a subject ) in which an IGFALS gene or an IGF - 1 gene Switzerland ) . Typical assay formats utilizing ribonucleic is transcribed and which has or have been treated ( e. g ., by acid hybridization include nuclear run - on assays , RT- PCR , contacting the cell or cells with an iRNA of the invention , or RNase protection assays , northern blotting , in situ hybrid by administering an iRNA of the invention to a subject in ization , and microarray analysis . Circulating IGFALS or which the cells are or were present) such that the expression IGF - 1 mRNA may be detected using methods the described of an IGFALS gene or an IGF- 1 gene is inhibited , as in PCT Publication WO2012 / 177906 , the entire contents of compared to a second cell or group of cells substantially which are hereby incorporated herein by reference . identical to the first cell or group of cells but which has not [0532 ] In some embodiments , the level of expression of or have not been so treated ( control cell ( s ) not treated with IGFALS or IGF - 1 is determined using a nucleic acid probe . an iRNA or not treated with an iRNA targeted to the gene of The term “ probe ” , as used herein , refers to any molecule that interest ) . In preferred embodiments , the inhibition is is capable of selectively binding to a specific IGFALS or assessed by the method provided in Example 2 and express IGF - 1 . Probes can be synthesized by one of skill in the art , ing the level of mRNA in treated cells as a percentage of the or derived from appropriate biological preparations. Probes level ofmRNA in control cells , using the following formula : may be specifically designed to be labeled . Examples of molecules that can be utilized as probes include , but are not limited to , RNA , DNA , proteins , antibodies , and organic (mRNA in control cells ) – (mRNA in treated cells ) 2 . 100 % molecules. (mRNA in control cells ) [0533 ] Isolated mRNA can be used in hybridization or amplification assays that include, but are not limited to , [0527 ] In other embodiments , inhibition of the expression Southern or northern analyses , polymerase chain reaction of an IGFALS gene or an IGF - 1 gene may be assessed in ( PCR ) analyses and probe arrays . One method for the terms of a reduction of a parameter that is functionally determination of mRNA levels involves contacting the iso linked to IGFALS or IGF- 1 gene expression , e . g ., IGFALS lated mRNA with a nucleic acid molecule (probe ) that can or IGF - 1 protein expression or IGF signaling pathways . hybridize to IGFALS mRNA or IGF - 1 mRNA . In one IGFALS or IGF - 1 gene silencing may be determined in any embodiment, the mRNA is immobilized on a solid surface US 2018 /0201929 A1 Jul. 19 , 2018 66 and contacted with a probe , for example by running the least one sign or symptom of acromegaly previously dis isolated mRNA on an agarose gel and transferring the played in the subject including , elevated IGF- 1 level, sleep mRNA from the gel to a membrane , such as nitrocellulose . apnea, joint pain , symptomatic carpal tunnel syndrome, In an alternative embodiment, the probe( s ) are immobilized hypertension , biventricular cardiac hypertrophy, cardiac on a solid surface and the mRNA is contacted with the arrhythmia , fatigue , and weakness . These symptomsmay be probe ( s ) , for example , in an Affymetrix gene chip array . A assessed in vitro or in vivo using any method known in the skilled artisan can readily adapt known mRNA detection art . Although the nadir GH suppression ofter administration methods for use in determining the level of IGFALS mRNA of glucose can be considered the “ gold standard ” test for or IGF - 1 mRNA. acromegaly (Katznelson et al. , 2011, Endocrine Practice ) , [0534 ] An alternative method for determining the level of suppression may not be observed after treatment with the expression of IGFALS or IGF - 1 in a sample involves the RNAi agents provided herein due to their proposed mecha process of nucleic acid amplification and / or reverse tran nism of action . Moreover, subjects may have accomplished scriptase ( to prepare cDNA ) of for example mRNA in the clinically relevant beneficial outcomes with lowering of sample , e . g ., by RT- PCR ( the experimental embodiment set IGF - 1 without reaching normal GH levels . forth in Mullis , 1987 , U . S . Pat . No. 4 ,683 , 202 ), ligase chain (0540 ] It is understood that normal IGF - 1 levels are reaction (Barany (1991 ) Proc . Natl. Acad . Sci. USA 88 : 189 dependent both on the age and gender of the subject, with 193 ) , self sustained sequence replication (Guatelli et al . younger subjects having lower IGF - 1 levels than older ( 1990 ) Proc . Natl. Acad . Sci. USA 87 : 1874 - 1878 ) , transcrip subjects . Therefore , when comparing IGF - 1 levels to deter tional amplification system (Kwoh et al . ( 1989) Proc . Natl . mine the lowering or normalizing of the level, an appropriate Acad . Sci. USA 86 : 1173 - 1177 ) , Q -Beta Replicase ( Lizardi et control must be selected . Appropriate controls include , for al. ( 1988 ) Bio / Technology 6 : 1197 ) , rolling circle replication example , an IGF - 1 level prior to treatment (when available ) ( Lizardi et al. , U . S . Pat. No. 5 ,854 ,033 ) or any other nucleic or an age and gender matched control. In certain embodi acid amplification method , followed by the detection of the ments , IGF - 1 levels are monitored or tested on multiple amplified molecules using techniques well known to those occasions to confirm a change in IGF - 1 level in a subject . In of skill in the art . These detection schemes are especially preferred embodiments , the IGF - 1 level is decreased suffi useful for the detection of nucleic acid molecules if such ciently to provide a clinically beneficial outcome for the molecules are present in very low numbers . In particular subject. aspects of the invention , the level of expression of IGFALS 10541 ] In some embodiments , the efficacy of the method or IGF- 1 is determined by quantitative fluorogenic RT- PCR of the invention in treatment of cancer can be monitored by ( . e . , the TaqManTM System ) . evaluating a subject for maintenance or preferably reduction [0535 ] The expression levels of IGFALS or IGF - 1 mRNA of tumor burden of the primary tumor or metastatic tumor ( s ) may be monitored using a membrane blot ( such as used in or the prevention of metastasis . Methods for detection and hybridization analysis such as northern , Southern , dot, and monitoring of tumor burden are known in the art, e . g . , the like ), or microwells , sample tubes , gels , beads or fibers RECIST criteria as provided in Eisenhauer et al. , 2009 , New ( or any solid support comprising bound nucleic acids ). See response evaluation criteria in solid tumours: Revised U . S . Pat. Nos. 5 ,770 ,722 , 5 ,874 ,219 , 5 , 744 ,305 , 5 ,677 , 195 RECIST guideline ( version 1 . 1 ) . Eur. J . Cancer. 45 : 228 - 247 . and 5 ,445 ,934 , which are incorporated herein by reference . [0542 ] In some embodiments of the methods of the inven The determination of IGFALS or IGF - 1 expression level tion , the iRNA is administered to a subject such that the may also comprise using nucleic acid probes in solution . iRNA is delivered to a specific site within the subject. The [0536 ] In preferred embodiments , the level of mRNA inhibition of expression of IGFALS or IGF - 1 may be expression is assessed using branched DNA (bDNA ) assays assessed using measurements of the level or change in the or real time PCR (qPCR ) . The use of these methods is level of IGFALS or IGF - 1 mRNA or IGFALS or IGF - 1 described and exemplified in the Examples presented herein . protein in a sample derived from fluid or tissue from the [0537 ] The level of IGFALS or IGF - 1 protein expression specific site within the subject. may be determined using any method known in the art for [ 0543 ] As used herein , the terms detecting or determining the measurement of protein levels . Such methods include , a level of an analyte are understood to mean performing the for example , electrophoresis , capillary electrophoresis , high steps to determine if a material, e . g ., protein , RNA , is performance liquid chromatography ( HPLC ), thin layer present. As used herein , methods of detecting or determining chromatography ( TLC ) , hyperdiffusion chromatography , include detection or determination of an analyte level that is fluid or gel precipitin reactions, absorption spectroscopy , a below the level of detection for the method used . colorimetric assays , spectrophotometric assays, flow cytom etry , immunodiffusion (single or double ) , immunoelectro VII. Methods of Treating or Preventing IGF phoresis , western blotting , radioimmunoassay (RIA ) , System -Associated Diseases enzyme- linked immunosorbent assays (ELISAs ) , immuno 0544 ] The present invention also provides methods of fluorescent assays , electrochemiluminescence assays, and using an iRNA of the invention or a composition containing the like . an iRNA of the invention to reduce or inhibit IGFALS or 0538 ] In some embodiments , the efficacy of the methods IGF - 1 expression in a cell . The methods include contacting of the invention in the treatment of an IGF system -associ the cell with a dsRNA of the invention and maintaining the ated disease is assessed by a decrease in IGFALS mRNA or cell for a time sufficient to obtain degradation of the mRNA IGF- 1 mRNA level (by liver biopsy ) or IGFALS or IGF - 1 transcript of an IGFALS gene or an IGF - 1 gene , thereby protein level, typically determined in serum . inhibiting expression of the IGFALS gene or an IGF - 1 gene [0539 ] In some embodiments , the efficacy of the methods in the cell . Reduction in gene expression can be assessed by of the invention in the treatment of acromegaly can be any methods known in the art. For example , a reduction in monitored by evaluating a subject for normalization of at the expression of IGFALS or IGF - 1 may be determined by US 2018 /0201929 A1 Jul. 19 , 2018 determining the mRNA expression level of IGFALS or subcutaneously implanted osmotic pump . In other embodi IGF- 1 , e . g ., in a liver sample , using methods routine to one ments , the pump is an infusion pump. An infusion pump may of ordinary skill in the art, e . g . , northern blotting , qRT- PCR ; be used for intravenous , subcutaneous , arterial, or epidural by determining the protein level of IGFALS or IGF - 1 using infusions. In preferred embodiments, the infusion pump is a methods routine to one of ordinary skill in the art , such as subcutaneous infusion pump . In other embodiments , the western blotting , immunological techniques. A reduction in pump is a surgically implanted pump that delivers the iRNA the expression of IGFALS or IGF - 1 may also be assessed to the liver . indirectly by measuring a decrease in biological activity of [0551 ] The mode of administration may be chosen based IGFALS or IGF - 1 or measuring the level of IGF - 1 in a upon whether local or systemic treatment is desired and subject sample ( e . g . , a serum sample ). based upon the area to be treated . The route and site of [0545 ] In the methods of the invention the cell may be administration may be chosen to enhance targeting . contacted in vitro or in vivo , i. e ., the cell may be within a [0552 ] In one aspect, the present invention also provides subject. methods for inhibiting the expression of an IGFALS or (0546 ] A cell suitable for treatment using the methods of IGF - 1 gene in a mammal. The methods include administer the invention may be any cell that expresses an IGFALS oring to the mammal a composition comprising a dsRNA that IGF - 1 gene , typically a liver cell. A cell suitable for use in targets an IGFALS or an IGF -1 gene in a cell of the mammal the methods of the invention may be a mammalian cell , e . g . , and maintaining the mammal for a time sufficient to obtain a primate cell ( such as a human cell or a non -human primate degradation of the mRNA transcript of the IGFALS gene or cell, e . g ., a monkey cell or a chimpanzee cell) , a non -primate the IGF - 1 gene , thereby inhibiting expression of the cell ( such as a cow cell, a pig cell, a camel cell, a llama cell , IGFALS gene or the IGF- 1 gene in the cell . Reduction in a horse cell , a goat cell , a rabbit cell , a sheep cell , a hamster, gene expression can be assessed by any methods known it a guinea pig cell, a cat cell, a dog cell, a rat cell , a mouse cell, the art and by methods, e . g . qRT- PCR , described herein . a lion cell , a tiger cell, a bear cell , or a buffalo cell ), a bird Reduction in protein production can be assessed by any cell ( e . g . , a duck cell or a goose cell ) , or a whale cell. In one methods known it the art and by methods, e . g . ELISA , embodiment, the cell is a human cell, e . g ., a human liver described herein . In one embodiment , a puncture liver cell. biopsy sample serves as the tissue material for monitoring [0547 ] IGFALS expression or IGF- 1expression is inhib the reduction in the IGFALS gene or the IGF- 1 gene or ited in the cell by at least 30 % , 35 % , 40 % , 45 % , 50 % , 55 % , protein expression . 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , 90 % , or 95 % , or to a level [ 0553 ] The present invention further provides methods of below the level of detection of the assay. IGFALS expres treatment of a subject in need thereof. The treatment meth sion or IGF - 1expression is inhibited in the cell such that the ods of the invention include administering an iRNA of the difference between the level of expression in a subject with invention to a subject, e . g ., a subject that would benefit from an IGF system -associated disease and the normal level of a reduction or inhibition of IGFALS or IGF - 1 expression , in expression is reduce by at least 30 % , 35 % , 40 % , 45 % , 50 % , a therapeutically effective amount of an iRNA targeting an 55 % , 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , 90 % , or 95 % . IGFALS gene or an IGF - 1 gene or a pharmaceutical com [0548 ] The in vivo methods of the invention may include position comprising an iRNA targeting an IGFALS gene or administering to a subject a composition containing an an IGF - 1 gene . iRNA , where the iRNA includes a nucleotide sequence that 10554 An iRNA of the invention may be administered as is complementary to at least a part of an RNA transcript of a " free iRNA .” A free iRNA is administered in the absence the IGFALS gene or IGF - 1 gene of the mammal to be of a pharmaceutical composition . The naked iRNA may be treated . When the organism to be treated is a mammal such in a suitable buffer solution . The buffer solution may com as a human , the composition can be administered by any prise acetate , citrate , prolamine , carbonate , or phosphate , or means known in the art including , but not limited to oral, any combination thereof. In one embodiment, the buffer intraperitoneal , or parenteral routes , including intracranial solution is phosphate buffered saline (PBS ). The pH and ( e . g . , intraventricular , intraparenchymal, and intrathecal) , osmolarity of the buffer solution containing the iRNA can be intravenous , intramuscular, subcutaneous, transdermal, air adjusted such that it is suitable for administering to a subject . way (aerosol ) , nasal , rectal, and topical ( including buccal [0555 ] Alternatively , an iRNA of the invention may be and sublingual ) administration . In certain embodiments , the administered as a pharmaceutical composition , such as a compositions are administered by intravenous infusion or dsRNA liposomal formulation . injection . In certain embodiments , the compositions are [0556 ] Subjects that would benefit from a reduction or administered by subcutaneous injection . inhibition of IGFALS gene or an IGF- 1 gene expression are 0549 ] In some embodiments , the administration is via a those having a disorder of elevated growth hormone, e . g . , depot injection . A depot injection may release the iRNA in acromegaly , or a disorder of elevated insulin signaling , e . g . , a consistent way over a prolonged time period . Thus, a depot cancer . In another embodiment, a subject having a disorder injection may reduce the frequency of dosing needed to of elevated growth hormone has one or more signs or obtain a desired effect , e . g . , a desired inhibition of IGFALS symptoms associated with acromegaly or elevated growth or IGF - 1 , or a therapeutic or prophylactic effect . A depot hormone including , but not limited to , elevated IGF - 1 level, injection may also provide more consistent serum concen somatic enlargement ( soft tissue and bony overgrowth ) , trations . Depot injections may include subcutaneous injec excessive sweating , jaw overgrowth , sleep apnea , osteoar tions or intramuscular injections . In preferred embodiments, thropathy, joint pain , symptomatic carpal tunnel syndrome, the depot injection is a subcutaneous injection . hypertension , biventricular cardiac hypertrophy , cardiac [0550 ] In some embodiments , the administration is via a arrhythmia , fatigue , weakness , diabetes mellitus, menstrual pump . The pump may be an external pump or a surgically irregularities in women and sexual dysfunction in men , implanted pump. In certain embodiments , the pump is a headache , and visual field loss ( attributable to optic chiasmal US 2018 /0201929 A1 Jul. 19 , 2018 compression ) and diplopia ( due to cranial nerve palsy ) ; in [0563 ] Efficacy of treatment or prevention of disease can conjunction with an elevated growth hormone level. Treat be assessed , for example by measuring disease progression , ment of a subject that would benefit from a reduction or disease remission , symptom severity , reduction in pain , inhibition of IGFALS or IGF - 1 gene expression and nor quality of life , dose of a medication required to sustain a malization of growth hormone levels includes therapeutic treatment effect , level of a disease marker, or any other treatment ( e . g . , of a subject is suffering from acromegaly ) measurable parameter appropriate for a given disease being and prophylactic treatment ( e . g ., of a subject does not meet treated or targeted for prevention . It is well within the ability the diagnostic criteria of acromegaly or may have elevated of one skilled in the art to monitor efficacy of treatment or or fluctuating growth hormone , or IGFALS , or IGF - 1 levels , prevention by measuring any one of such parameters , or any or a subject may be at risk of developing acromegaly ) . combination of parameters . For example , efficacy of treat Treatment of a subject that would benefit from a reduction ment of a disorder of IGF signaling may be assessed , for or inhibition of IGFALS gene expression or IGF - 1 gene example , by periodic monitoring of IGF - 1 or IGFALS expression can also include treatment of cancer. levels, e . g ., serum IGF - 1 or IGFALS levels . For subjects [0557 ] The invention further provides methods for the use suffering from acromegaly a decrease in one or more signs of an iRNA or a pharmaceutical composition thereof, e . g . , or symptoms including, but not limited to sleep apnea , joint for treating a subject that would benefit from reduction or pain , symptomatic carpal tunnel syndrome, hypertension , inhibition of IGFALS or IGF - 1 expression , e. g. , a subject biventricular cardiac hypertrophy, cardiac arrhythmia , having a disorder of elevated growth hormone , in combina fatigue , and weakness can be an indication of treatment of tion with other pharmaceuticals or other therapeutic meth acromegaly . Similarly a delay or lessening of the severity of ods, e .g ., with known pharmaceuticals or known therapeutic the co -morbidities associated with acromegaly such as methods , such as , for example , those which are currently hypertension , hypertrophy , stroke , diabetes , and sleep apnea employed for treating these disorders . For example , in can demonstrate efficacy of treatment. certain embodiments , an iRNA targeting IGFALS or IGF - 1 [0564 ] Efficacy of treatment of cancer can be demon is administered in combination with an agent useful in strated by stabilization or a decrease in tumor burden as treating a disorder of elevated growth hormone as described demonstrated by a stabilization or decrease in tumor burden elsewhere herein . of the primary tumor, metastatic tumors, or the delay or 10558 ) The invention provides methods for the treatment prevention of tumor metastasis . Diagnostic and monitoring of cancer, e . g . , IGF- 1 dependent cancer, IGF - 1 receptor methods are known in the art and are also provided herein . positive cancer, or metastatic or potentially metastatic can cer . In certain embodiments , the iRNAs of the invention are [0565 ] Comparisons of the later readings with the initial used in conjunction with various standards of treatment of readings provide a physician an indication of whether the cancer, e . g ., chemotherapeutic agents , surgery , radiation ; treatment is effective . It is well within the ability of one skilled in the art to monitor efficacy of treatment or preven and combinations thereof. tion by measuring any one of such parameters , or any [0559 ] The iRNA and additional therapeutic agents may combination of parameters . In connection with the admin be administered at the same time or in the same combina istration of an iRNA targeting IGFALS or IGF - 1 , or phar tion , e . g ., parenterally , or the additional therapeutic agent maceutical composition thereof, " effective against " an IGF can be administered as part of a separate composition or at system - associated disorder indicates that administration in a separate times or by another method known in the art or clinically appropriate manner results in a beneficial effect for described herein . at least a statistically significant fraction of patients , such as [0560 ] In one embodiment, the method includes adminis a improvement of symptoms, a cure , a reduction in disease , tering a composition featured herein such that expression of extension of life , improvement in quality of life, or other the target IGFALS gene or IGF - 1 gene is decreased , such as effect generally recognized as positive by medical doctors for about 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 12 , 16 , 18 , 24 hours, 28 , 32 , or about 36 hours. In one embodiment, expression of the familiar with treating IGF system - associated disorders. target IGFALS gene or IGF - 1 gene is decreased for an [0566 ] A treatment or preventive effect is evident when extended duration , e . g . , at least about two, three , four days there is a statistically significant improvement in one or or more , e . g ., about one week , two weeks , three weeks , or more parameters of disease status , or by a failure to worsen four weeks or longer . or to develop symptoms where they would otherwise be [ 0561] Preferably , the iRNAs useful for the methods and anticipated . As an example , a favorable change of at least compositions featured herein specifically target RNAs ( pri 10 % in a measurable parameter of disease , and preferably at mary or processed ) of the target IGFALS gene or IGF - 1 least 20 % , 30 % , 40 % , 50 % or more can be indicative of gene . Compositions and methods for inhibiting the expres effective treatment. Efficacy for a given iRNA drug or sion of these genes using iRNAs can be prepared and formulation of that drug can also be judged using an performed as described herein . experimental animal model for the given disease as known [0562 ] Administration of the iRNA according to the meth in the art . When using an experimental animal model, ods of the invention may result in a reduction of the severity, efficacy of treatment is evidenced when a statistically sig signs , symptoms, or markers of such diseases or disorders in nificant reduction in a marker or symptom is observed . a patient with a disorder of elevated growth hormone , [0567 ] Alternatively , the efficacy can be measured by a elevated IGFALS , elevated IGF - 1 , or an IGF - 1 responsive reduction in the severity of disease as determined by one tumor. By " reduction ” in this context is meant a statistically skilled in the art of diagnosis based on a clinically accepted significant decrease in such level. The reduction can be , for disease severity grading scale . Any positive change resulting example , at least about 30 % , 35 % , 40 % , 45 % , 50 % , 55 % , in e . g . , lessening of severity of disease measured using the 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , 90 % , or 95 % , or to below appropriate scale , represents adequate treatment using an the level of detection of the assay used . iRNA or iRNA formulation as described herein . US 2018 /0201929 A1 Jul. 19 , 2018 69

[0568 ] Subjects can be administered a therapeutic amount not be used interchangably . The nadir GH suppression after of iRNA , such as about 0 .01 mg/ kg to about 200 mg/ kg . administration of glucose has been considered the " gold [0569 ] The iRNA can be administered by intravenous standard ” test for acromegaly , however, a conflict exists infusion over a period of time, on a regular basis . In certain regarding the threshold for diagnosis . The panel recom embodiments , after an initial treatment regimen , the treat mends that GH measurements be performed at baseline , then ments can be administered on a less frequent basis . Admin every 30 minutes for a total of 120 minutes after adminis istration of the iRNA can reduce IGFALS or IGF - 1 levels , tration of glucose . The inability to suppress serum GH to less e . g ., in a cell , tissue, blood , urine , or other compartment of than 1 ng /mL after glucose administration is typically con the patient by at least 20 % , 25 % , 30 % , 35 % , 40 % , 45 % , sidered the diagnostic criterion for acromegaly , however, in 50 % , 55 % , 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , 90 % , or 95 % , a consensus guideline in 2000 , the diagnosis of acromegaly or below the level of detection of the assay method used . It was excluded if the patient had a random GH measurement is noted that a reduction in IGFALS will not likely result in less than 0 . 4 ng /mL and a normal IGF - I value . Although a a decrease in growth hormone levels in a subject with nadir GH concentration of less than 1 ng /mL after admin acromegaly . Administration of the iRNA can reduce the istration of glucose is the standard recommendation for a difference in the subject IGF - 1 levels and a normal IGF - 1 normal response , the 2011 panel suggests consideration of a level, e . g . , in a cell, tissue , blood , urine , or other compart lower nadir GH cut point at 0 . 4 ng /mL after glucose admin ment of the patient by at least 20 % , 25 % , 30 % , 35 % , 40 % , istration because of the enhanced assay sensitivity and more 45 % , 50 % , 55 % , 60 % , 65 % , 70 % , 75 % , 80 % , 85 % , 90 % , or frequent finding of modest GH hypersecretion . A diagnosis 95 % . of acromegaly will be made by one of skill in the art [0570 ] Before administration of a full dose of the iRNA , considering the totality of the evidence for the patient under patients can be administered a smaller dose , such as a 5 % consideration . infusion reaction , and monitored for adverse effects , such as [ 0574 ] Once a biochemical diagnosis of acromegaly has an allergic reaction . In another example , the patient can be been made , a magnetic resonance imaging (MRI ) scan of the monitoredm for unwanted immunostimulatory effects , such as pituitary gland should be performed because a pituitary increased cytokine ( e . g . , TNF- alpha or INF- alpha ) levels . GH - secreting adenoma is the most common cause of acro [ 0571 ] Alternatively , the iRNA can be administered sub megaly . Visual field testing should be performed if there is cutaneously , i . e . , by subcutaneous injection . One or more optic chiasmal compression noted on the MRI or if the injections may be used to deliver the desired daily dose of patient has complaints of reduced peripheral vision . Further iRNA to a subject . The injections may be repeated over a biochemical testing should include a serum prolactin level period of time. The administration may be repeated on a ( to evaluate for hyperprolactinemia ) and assessment of regular basis . In certain embodiments , after an initial treat anterior and posterior pituitary function ( for potential ment regimen , the treatments can be administered on a less hypopituitarism ) . frequent basis . A repeat- dose regimen may include admin [0575 ] The goals of therapy for acromegaly are to ( 1) istration of a therapeutic amount of iRNA on a regular basis , control biochemical indices of activity , ( 2 ) control tumor such as every other day or to once a year. In certain size and prevent local mass effects , ( 3 ) reduce signs and embodiments , the iRNA is administered about once per symptoms of disease , ( 4 ) prevent or improve medical month to about once per quarter (i . e ., about once every three comorbidities , and ( 5 ) prevent early mortality . The primary months) . mode of therapy is surgery , which is recommended for all patients with microadenomas and for all patients who have IX . Diagnostic Criteria and Treatment for macroadenomas with associated mass effects . In patients Acromegaly with macroadenomas without mass effects , and with low [0572 ] Diagnostic criteria for acromegaly are set forth in likelihood of surgical cure , a role for surgical de- bulking of the American Association of Clinical Endocrinologists macroadenomas to improve the response to subsequent Medical Guidelines for Clinical Practice for the Diagnosis medical therapy has been advocated , as well as primary and Treatment of Acromegaly — 2011 Update (Katznelson et medical therapy alone . Medical therapy is generally used in al. , Endocr. Pract . 17 (Suppl . 4 ) , incorporated herein by the adjuvant setting . Irradiation , either conventional frac reference . Further details and citations can be found therein . tionated RT or stereotactic radiosurgery , is largely relegated [ 0573 ] Acromegaly is a clinical syndrome that , depending to an adjuvant role . Availability of specific therapeutic on its stage of progression , may not manifest with clear options and cost of these interventions are taken into account diagnostic features . Diagnosis should be considered in with decisions regarding therapy . patients with 2 or more of the following comorbidities: [ 0576 ] The goal of surgical interventions is to decrease new - onset diabetes, diffuse arthralgias , new -onset or diffi tumor volume, thereby decreasing production of excess cult - to - control hypertension , cardiac disease including growth hormone and decompress the mass effect of mac biventricular hypertrophy and diastolic or systolic dysfunc roadenomas on any normal remaining pituitary gland tis tion , fatigue , headaches , carpal tunnel syndrome, sleep sues , optic nerve, or surrounding critical structures . Surgical apnea syndrome, diaphoresis, loss of vision , colon polyps, interventions can be curative for many subjects . Surgically and progressive jaw malocclusion . A serum IGF - I level , if resected tissue should be analyzed to understand the tumor accompanied by a large number of results from age - and biology to potentially provide guidance for treatment. Bio sex -matched normal subjects , is a good tool to assess chemical analyses are also performed post -operatively to integrated GH secretion and is excellent for diagnosis , assess the surgical outcome. monitoring , and especially screening . A random IGF - I value [0577 ] Medical therapy is used in conjunction with sur ( a marker of integrated GH secretion ) should be measured gery. Studies have provided conflicting results regarding the for diagnosis and for monitoring after a therapeutic inter benefits of treatment with medical interventions prior to vention . Serum GH assays are not standardized and should surgery to change the nature of the tumor. The iRNAs US 2018 /0201929 A1 Jul. 19 , 2018 70 provided herein can be used at any time in conjunction with tions can be treated with standard interventions and preven surgical intervention ( i. e ., before or after surgery ). tive strategies ( e . g ., influenza and pneumococcal vaccina [0578 ] Adjunctive medical therapy is used in patients who tions ) . Cardiovascular disease , hypertension , and stroke can cannot achieve a complete cure by surgical intervention . be managed using standard monitoring ( e. g. , blood pressure , Medical therapies fall into three categories : dopamine ago cholesterol, and lipid level monitoring ) and medical treat nists , somatostatin analogs ( SSAs ) , and a GH receptor ment. Subjects should be monitored for the development of antagonist . Each of the medical interventions presents dif type 2 diabetes and neoplasia , particularly colon polyps and ferent risks and benefits , including substantial costs of some neoplasia . Subjects should also be monitored for psycho of the therapies . logical complications related to the physical changes and [0579 ] Dopamine agonists include cabergoline and bro deformities that can occur with the disease . As used herein , mocriptine . The agents are a good first line therapy , espe treatment can include , but does not require , resolution of the cially in patients with mild biochemical activity , as they are co -morbidities of acromegaly . Treatment can include , but realtively inexpensive and orally administered . However, does not require , prevention or reduction of the development side effects include gastrointestinal upset, orthostatic of one or more of the comorbidities associated with acro hypotension , headache , and nasal congestion . megaly . As used herein , treatment for acromegaly can fur 10580 ] Somatostatin analogs (SSAs ) include octreotide ther include , but does not require , treatment of one or more ( Sandostatin® ) LAR ( long -acting release , administered as of the comorbidities associated with acromegaly . an intramuscular injection ) and lanreotide (Somatuline® ) Autogel (administered as a deep subcutaneous depot injec IX . Response Evaluation Criteria and Treatment of tion ) . SSAs are less convenient for use than dopamine Cancer agonists as they must be administered by injection ( 50 mcg [ 0586 ] Methods for detection of tumors and assessment of three times daily Sandostatin® Injection subcutaneously for tumor burden are well known in the art . For example , the 2 weeks followed by Sandostatin® LAR 20 mg intraglu Response Evaluation Criteria in Solid Tumors (RECIST ) teally every 4 weeks for 3 months; or 60 , 90 , or 120 mg of guidelines were revised in 2008 and are fully set forth in Somatuline® every 28 days by deep subcutaneous injec Eisenhauer et al ., 2009 , New response evaluation criteria in tion ). SSAs are effective in normalizing IGF - I and GH levels solid tumours: Revised RECIST guideline (version 1 . 1 ) . in approximately 55 % of patients . The clinical and bio Eur. J . Cancer . 45 :228 - 247 . These guidelines can be used to chemical responses to SSAs are inversely related to tumor determine if a subject has tumor regression or no tumor size and degree of GH hypersecretion . Octreotide LAR and progression as demonstrated by a complete response (CR ) or lanreotide Autogel have similar efficacy profiles . In patients partial response ( PR ) , or stable disease (SD ) , respectively , as with an inadequate response to SSAs, the addition of cab provided therein for at least a sufficient time that the CR , PR , ergoline or pegvisomant (Somavert® ) may be effective for or SD is detected meets the threshold of treatment or further lowering one or both of GH and IGF - 1 levels . effective treatment as provided herein . A subject with only Potential side effects of SSAs, include gastrointestinal upset, progressive disease (PD ) after administration of an iRNA malabsorption , constipation , gallbladder disease , hair loss , provided herein is not considered to have a favorable and bradycardia . response to or be effectively treated by the iRNA . The [0581 ] Pegvisomant, a GH receptor antagonist, is admin development of PD after a period of CR , PR , or PD is istered by daily subcutaneous injection . Side effects of understood as having been effectively treated by the iRNA pegvisomant, include flulike illness, allergic reactions, and provided herein . increase in liver enzymes. Patients treated with pegvisomant [0587 ] It is understood that the iRNA agents provided must undergo routine liver enzyme tests . Because endog herein can be used in conjunction with other interventions enous GH levels increase with pegvisomant administration for the treatment of cancer , e . g ., surgery , chemotherapy, or and pegvisomant may be cross -measured in GH assays, radiation . serum GH levels are not specific and should not be moni [0588 ] This invention is further illustrated by the follow tored in patients receiving pegvisomant. Instead , serum ing examples which should not be construed as limiting. The IGF - 1 levels are monitored . entire contents of all references , patents and published patent [ 0582] Combinations of variousmedical therapies may be applications cited throughout this application , as well as the useful in the treatment of some acromegaly patients . Figure and Sequence Listing , are hereby incorporated herein [ 0583] Radiation therapy is used as an adjunctive treat by reference . ment is patients who do not respond sufficiently to surgical or medical interventions. EXAMPLES [0584 ) Similar treatment strategies are used in children with gigantism , a type of acromegaly , which refers to excess Example 1 . iRNA Synthesis GH secretion that occurs during childhood when the growth plates are open , leading to accelerated vertical growth . Source of Reagents [ 0585 ] Some of the comorbidities of acromegaly resolve [0589 ] Where the source of a reagent is not specifically upon decreasing the level of GH or decreasing the respon given herein , such reagent can be obtained from any supplier siveness of the subject to GH . However, others are not. of reagents for molecular biology at a quality / purity standard Unlike soft tissue changes, bone enlargement is not revers for application in molecular biology . ible. Surgical interventions ( e . g . , carpal tunnel release , joint IGFALS Transcripts and siRNA Design replacement surgery ) , physical therapy , and analgesic medi [0590 ] A set of siRNAs targeting the human IGFALS , cations can be used to treat conditions associated with bone " insulin - like growth factor binding protein , acid labile sub or soft tissue overgrowth . Respiratory disorders including unit” , (human : NCBI refseqID NM _ 004970 ; NCBIGeneID : sleep apnea and higher susceptibility to respiratory infec 3483 ), as well as toxicology -species IGFALS orthologs US 2018 /0201929 A1 Jul. 19 , 2018

( cynomolgus monkey : XM _ 005590898 ; mouse : otide . The relative weight of the mismatches was 2 .8 ; 1. 2 :1 NM _ 008340 ; rat, NM _ 053329 ) were designed using custom for seed mismatches, cleavage site , and other positions up R and Python scripts . The human NM _ 004970 REFSEQ through antisense position 19 . Mismatches in the first posi mRNA has a length of 2168 bases. tion were ignored . A specificity score was calculated for [0591 ] The rationale and method for the set of siRNA each strand by summing the value of each weighted mis designs is as follows: the predicted efficacy for every poten match . Preference was given to siRNAs whose antisense tial 19mer siRNA from position 50 through position 2160 score in human and cynomolgus monkey was > = 3 . 0 and ( the coding region and 3' UTR ) was determined with a linear predicted efficacy was > = 70 % knockdown of the human model derived the direct measure of mRNA knockdown IGF1 transcripts . from more than 20 ,000 distinct siRNA designs targeting a [0596 ] A detailed list of the unmodified IGF - 1 sense and large number of vertebrate genes . Subsets of the IGFALS antisense strand sequences is shown in Tables 9 , 15 , and 18 . siRNAs were designed with perfect or near - perfect matches [0597 ] A detailed list of the modified IGF- 1 sense and between human , cynomolgus and rhesus monkey . A further antisense strand sequences is shown in Tables 11 , 17 , and 20 . subset was designed with perfect or near - perfect matches to siRNA Synthesis mouse and rat IGFALS orthologs. For each strand of the [0598 ] siRNA sequences were synthesized at 1 umol scale siRNA , a custom Python script was used in a brute force on a Mermade 192 synthesizer (BioAutomation using the search to measure the number and positions of mismatches solid support mediated phosphoramidite chemistry . The between the siRNA and all potential alignments in the target solid support was controlled pore glass (500 A ) loaded with species transcriptome. Extra weight was given to mis custom GalNAc ligand or universal solid support ( AM matches in the seed region , defined here as positions 2 - 9 of biochemical ). Ancillary synthesis reagents , 2' -F and 2 -0 the antisense oligonucleotide , as well the cleavage site of the Methyl RNA and deoxy phosphoramidites were obtained siRNA , defined here as positions 10 - 11 of the antisense from Thermo - Fisher (Milwaukee , Wis. ) and Hongene oligonucleotide . The relative weight of the mismatches was (China ). 2' F 2 - O -Methyl , GNA (glycol nucleic acids) , 2 . 8 ; 1 . 2 : 1 for seed mismatches, cleavage site , and other 5 ' phosphate and othermodifications are introduced using the positions up through antisense position 19 . Mismatches in corresponding phosphoramidites. Synthesis of 3 ' GalNAc the first position were ignored . A specificity score was conjugated single strands was performed on a GalNAC calculated for each strand by summing the value of each modified CPG support . Custom CPG universal solid support weighted mismatch . Preference was given to siRNAs whose was used for the synthesis of antisense single strands . antisense score in human and cynomolgus monkey was Coupling time for all phosphoramidites ( 100 mM in acetoni > = 2 . 0 and predicted efficacy was > = 50 % knockdown of the trile ) is 5 min employing 5 - Ethylthio - 1H - tetrazole (ETT ) as IGFALS transcript. activator ( 0 .6 M in acetonitrile ) . Phosphorothioate linkages 10592 ] A detailed list of the unmodified IGFALS sense and were generated using a 50 mM solution of 3 -( ( Dimethyl antisense strand sequences is shown in Tables 3 , 6 , and 12 . amino -methylidene ) amino ) - 3H - 1 , 2 , 4 - dithiazole - 3 - thione [0593 ] A detailed list of the modified IGFALS sense and (DDTT , obtained from Chemgenes (Wilmington , Mass. , antisense strand sequences is shown in Tables 5 , 8 , and 14 . USA ) in anhydrous acetonitrile /pyridine ( 1 : 1 v / v ) . Oxida IGF- 1 Transcripts and siRNA Design tion time was 3 minutes. All sequences were synthesized [0594 ] A set of siRNAs targeting the human insulin like with final removal of the DMT group (“ DMT off ” ) . growth factor 1 , " IGF1” (human : e . g . , NCBI refseqID [05991 Upon completion of the solid phase synthesis , NM _ 000618 ; NCBIGeneID : 3479 ) , as well as toxicology - oligoribonucleotides were cleaved from the solid support species IGF1 orthologs (cynomolgus monkey : e . g ., and deprotected in sealed 96 deep well plates using 200 uL XM _ 005572039 ; mouse : e . g ., NM _ 010512 ; rat, e . g ., Aqueous Methylamine reagents at 60° C . for 20 minutes . NM _ 178866 ) were designed using custom R and Python For sequences containing 2 ' ribo residues ( 2P -OH ) that are scripts . The human NM _ 00618 REFSEQ mRNA has a protected with a tert- butyl dimethyl silyl ( TBDMS) group , a length of 7366 bases . second step deprotection is performed using TEA. 3HF (tri [0595 ] The rationale and method for the set of siRNA ethylamine trihydro fluoride ) reagent. To the methylamine designs is as follows: the predicted efficacy for every poten deprotection solution , 200 uL of dimethyl sulfoxide tial 19mer siRNA from position 265 through position 7366 (DMSO ) and 300 ul TEA . 3HF reagent were added and the ( the coding region and 3 ' UTR ) was determined with a linear solution was incubated for additional 20 min at 60° C . At the model derived the direct measure of mRNA knockdown end of cleavage and deprotection step , the synthesis plate from more than 20 ,000 distinct siRNA designs targeting a was allowed to come to room temperature and is precipitated large number of vertebrate genes. Subsets of the IGF1 by addition of 1 mL of acetontile : ethanol mixture ( 9 : 1 ) . The siRNAs were designed with perfect or near -perfect matches plates are cooled at - 80 C for 2 hours , superanatant was between human and cynomolgus monkey . A further subset decanted carefully with the aid of a multi channel pipette . was designed with perfect or near -perfect matches to human , The oligonucleotide pellet was re -suspended in 20 mM cynomolgus monkey and mouse IGF1 orthologs . A further NaOAc buffer and is desalted using a 5 mL HiTrap size subset was designed with perfect or near- perfect matches to exclusion column (GE Healthcare ) on an AKTA Purifier mouse and rat IGF1 orthologs . For each strand of the siRNA, System equipped with an A905 autosampler and a Frac 950 a custom Python script was used in a brute force search to fraction collector. Desalted samples are collected in 96 -well measure the number and positions of mismatches between plates . Samples from each sequence were analyzed by the siRNA and all potential alignments in the target species LC -MS to confirm the identity , UV ( 260 nm ) for quantifi transcriptome. Extra weight was given to mismatches in the cation and a selected set of samples by IEX chromatography seed region , defined here as positions 2 - 9 of the antisense to determine purity . oligonucleotide , as well the cleavage site of the siRNA , [0600 ] Annealing of single strands was performed on a defined here as positions 10 - 11 of the antisense oligonucle Tecan liquid handling robot. Equimolar mixture of sense and US 2018 /0201929 A1 Jul. 19 , 2018 antisense single strands were combined and annealed in 96 # 04887301001 ). Real time PCR was done in a LightCy well plates . After combining the complementary single cler480 Real Time PCR system (Roche ) . Each duplex was strands , the 96 -well plate was sealed tightly and heated in an tested at least two times and data were normalized to naïve oven at 100° C . for 10 minutes and allowed to come slowly cells or cells transfected with a non - targeting control siRNA . to room temperature over a period 2 - 3 hours . The concen [0605 ] To calculate relative fold change , real time data tration of each duplex was normalized to 1004 in 1xPBS . were analyzed using the AACt method and normalized to assays performed with cells transfected with 10 nM Example 2 — In Vitro Screening AD - 1955 , or mock transfected cells . Cell Culture and Transfections TABLE 2 [0601 ] Hep3B (ATCC ) were transfected by adding 4 .9 ul Abbreviations of nucleotide monomers used in nucleic acid sequence of Opti -MEM plus 0 . 1 ul of Lipofectamine RNAiMax per representation . It will be understood that these monomers , when present well ( Invitrogen , Carlsbad Calif . cat # 13778 - 150 ) to 5 ul of in an oligonucleotide , are mutually linked by 5 ' - 3 '- phosphodiester bonds . siRNA duplexes per well into a 384 -well plate and incubated at room temperature for 15 minutes . Fifty ul of DMEM Abbreviation Nucleotide ( s ) containing ~ 5x103 cells were then added to the siRNA Adenosine- 3' - phosphate mixture . Cells were incubated for 24 hours prior to RNA Af 2 '- fluoroadenosine - 3 '- phosphate purification . Single dose experiments were performed at 10 Afs 2 ' - fluoroadenosine - 3 '- phosphorothioate As adenosine - 3' - phosphorothioate nM and 0 . 1 nM and in some cases 1 nM final duplex cytidine - 3 '- phosphate concentration . 2 '- fluorocytidine - 3 '- phosphate Cfs 2' - fluorocytidine - 3' - phosphorothioate Total RNA Isolation Using DYNABEADS mRNA Isolation cytidine- 3 '- phosphorothioate Kit guanosine - 3 ' -phosphate [0602 ] RNA was isolated using an automated protocol on Gf 2 '- fluoroguanosine - 3 '- phosphate a BioTek - EL406 platform using DYNABEADS ( Invitrogen , Gfs 2 '- fluoroguanosine - 3 '- phosphorothioate cat # 61012 ) . Briefly , 50 ul of Lysis /Binding Buffer and 25 ul Gs guanosine - 3 '- phosphorothioate ? . 5 '- methyluridine - 3 '- phosphate of lysis buffer containing 3 ul of magnetic beads were added Tf 2 ' - fluoro - 5 -methyluridine - 3 '- phosphate to the plate with cells . Plates were incubated on an electro Tfs 2 ' - fluoro - 5 -methyluridine - 3 '- phosphorothioate magnetic shaker for 10 minutes at room temperature and Ts 5 -methyluridine - 3 ' -phosphorothioate then magnetic beads were captured and the supernatant was U Uridine- 3 '- phosphate Uf 2' - fluorouridine- 3 ' - phosphate removed . Bead -bound RNA was then washed 2 times with Ufs 2' - fluorouridine- 3' - phosphorothioate 150 ul Wash Buffer A and once with Wash Buffer B . Beads uridine - 3 ' -phosphorothioate any nucleotide ( G , A , C , T or U ) were then washed with 150 ul Elution Buffer , re- captured 2 - O -methyladenosine - 3 '- phosphate and supernatant removed . 2 - O -methyladenosine - 3 '- phosphorothioate cDNA Synthesis Using ABI High Capacity cDNA Reverse Özeleno 2 '- O -methylcytidine - 3 '- phosphate Transcription Kit ( Applied Biosystems, Foster City , Calif. , 2 - O -methylcytidine - 3 '- phosphorothioate Cat # 4368813 ) bo 2 ' - O -methylguanosine - 3 '- phosphate 2 - O -methylguanosine - 3 ' -phosphorothioate [0603 ] Ten ul of a master mix containing 1 ul 10x Buffer, 2 - O -methyl - 5 -methyluridine - 3 '- phosphate 0 .4 ul 25xdNTPs, 1 ul 10x Random primers , 0 . 5 ul Reverse 2 - O -methyl - 5 -methyluridine - 3 ' -phosphorothioate Transcriptase , 0 . 5 ul RNase inhibitor and 6 . 6 ul of H , O per 2 - O -methyluridine - 3 '- phosphate reaction was added to RNA isolated above . Plates were us 2 '- O -methyluridine - 3' -phosphorothioate S phosphorothioate linkage sealed , mixed , and incubated on an electromagnetic shaker L96 N - [tris (GalNAc - alkyl ) - amidodecanoyl) ]- 4 -hydroxyprolinol for 10 minutes at room temperature , followed by 2 hours 37° Hyp - (GalNAcalkyl ) 3 C . Plates were then incubated at 81° C . for 8 minutes . dT 2 '- deoxythymidine - 3 '- phosphate dc 2 '- deoxycytidine - 3 '- phosphate Y44 inverted abasic DNA ( 2 - hydroxymethyl- tetrahydrofurane Real Time PCR 5 -phosphate ) ( Tgn ) Thymidine- glycol nucleic acid (GNA ) S - Isomer [ 0604 ] Two ul of cDNA were added to a master mix P Phosphate containing 0 . 5 ul of GAPDH TaqMan Probe (Hs99999905 VP Vinyl- phosphate ml) , 0 . 5 ul IGFALS probe ( HS00744047 Sl ) and 5 ul 2' - O - ( N -methylacetamide )adenosine - 3 ' -phosphate Lightcycler 480 probe master mix (Roche Cat (Aam ) # 04887301001) per well in a 384 well plates (Roche cat US 2018 /0201929 A1 Jul. 19 , 2018

SEO ID NO 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103

316-337C21A 324-345C21A 745-767C21A 746-768G21A 831-853G21A 842-864C21A 849-871G21A 870-891G21A 909-931G21A 919-940C21A 004970.2 194-216 201-223 547-568G21A 556-578 643-665 676-698 774-795 1045-1067 Position inNM UCCGGAUGCGGUUGUGGCCCAGC1041-1063C21A AntisenseSequence AAAGACGCUGAGCUCAUCUGUGU AACUGCAAAAGACGCUGAGCUCA UUUGUUGCCGUCCAGCCACAGGG UACGAGAGGUUGUUGCCGUCCAG UUCCAGCCUGCUCAGACGGUUGU UUCCAACCCAGGUUGAGGUCCCA AGGUAAGUCAGUUUGUUGCCAGC AGCCUGUUGCCCGCCAGCACCAG UCGUUCCUGCUCAGGUCCAGCUC UGCGUUCCUGCUCAGGUCCAGCU AACACGUUUGCCUUGAUGGCCCG UCACGGCAGCGAUGAGGUUGCGG UGCGCCCGGGGCCACGGCAGCGA UCAGGAAGGCGCCCGGGGCCACG UAUCGCAGCGCCUUCAGGCCCAG UCUCCAGGAGGCCAGCCACGCGG UAACGUGUCCUCCAGGAGGCCAG AGCUGCCGGAUGCGGUUGUGGCC Antisense name A-125827 A-125833 A-138234 A-138216 A-138210 A-125831 A-125821 A-125787 A-125839 A-125841 A-138232 A-125807 A-125797 A-125795 A-138230 A-125775 A-138196 A-125803A-125803 125789A- TABLE3 UnmodifiedSenseandAntisenseStrandSequencesofIGFALSdsRNAS SEQ ID NO 28 r 30 31 bon 33 34 el momento36 37 38 39 40 41 43 44 e 4545 46

318-337C21A 326-345C21A 549-568G21A 747-767C21A 748-768G21A 844-864C21A 851-871G21A 872-891G21A 911-931G21A 921-940C21A C21A10631043- 004970.2 196-216 223203- 558-578 645-665 678-698 776-795 833-853G21A 1047-1067 Position inNM SenseSequence ACAGAUGAGCUCAGCGUCUUU AGCUCAGCGUCUUUUGCAGUU CUGUGGCUGGACGGCAACAAA GGACGGCAACAACCUCUCGUA AACCGUCUGAGCAGGCUGGAA GGACCUCAACCUGGGUUGGAA UGGCAACAAACUGACUUACCU GGUGCUGGCGGGCAACAGGCU GCUGGACCUGAGCAGGAACGA CUGGACCUGAGCAGGAACGCA GGCCAUCAAGGCAAACGUGUU GCAACCUCAUCGCUGCCGUGA GCUGCCGUGGCCCCGGGCGCA UGGCCCCGGGCGCCUUCCUGA GGGCCUGAAGGCGCUGCGAUA GCGUGGCUGGCCUCCUGGAGA GGCCUCCUGGAGGACACGUUA UGGGCCACAACCGCAUCCGGA CCACAACCGCAUCCGGCAGCU Sense name A-125820 A-125838 A-125840 A-138231 A-125806 A-125794 A-125774 AD-62728A125826 AD-62741A125832 138233-68729AAD AD-68720A138215 AD-68717A138209 AD-62737A125830 AD-62742A125786 AD-62731A125796 AD-68727A138229 AD-68710A138195 AD-62743A125802 AD-62711A125788 Duplex name AD-62713 AD-62719 AD-62724 AD-68728 AD-62717 AD-62726 AD-62715 US 2018 /0201929 A1 Jul. 19 , 2018 74

SEQ ID NO 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126

1184-1205C21A 1192-1214C21A 1202-1224G21A 1327-1348C21A 1331-1353C21A 1386-1407C21A 004970. 1064-1085G21A 1108-1129G21A 1159-1181 1159-1181 1164-1185 1165-1186C21A 1176-1198 1186-1207G21A 1193-1214C21A 1195-1217 1197-1219C21A 1207-1228C21A 1208-1230G21A 1300-1322 G21A13251303- 1306-1328 1401-1423C21A Position inNM AntisenseSequence trandSequencesofIGFALSDERNAS UAAAGCUGCGCUCAGCCAGCUGC UUGGUUGUGGUCUAGCGUGAGCA AUGACCGCCACGUUGGUGAGGCC AUGACCGCCACGUUGGUGAGGCC UUCAUGACCGCCACGUUGGUGAG UUUCAUGACCGCCACGUUGGUGA AGUUCCCAGAGAGGUUCAUGACC UGAGACAGUUCCCAGAGAGGUUC UCGGAGACAGUUCCCAGAGAGGU UGAAGGUUCCGGAGACAGUUCCC UAAGGUUCCGGAGACAGUUCCCA UCCGGAAGGUUCCGGAGACAGUU UCUCCGGAAGGUUCCGGAGACAG UACCUGCUCCGGAAGGUUCCGGA UAACACCUGCUCCGGAAGGUUCC UCGGAACACCUGCUCCGGAAGGU UGUUCUUCGAUGCUGGAGAUGCU UUCUGUUCUUCGAUGCUGGAGAU AGGCUCUGUUCUUCGAUGCUGGA UAGGCCGUUGUCCUUGAGGAAGA UCCCACGAGGCCGUUGUCCUUGA UUCAGGUCGAGCUCCAGCAGCUC UCGUGAGCUGGUUGGAGGUCAGG UnmodifiedSenseandAntisenseStrandSequencesofIGFALSdsRNAS Antisense name A-138194 A-138224 A-125783 A-135416 A-138214 A-138200 A-125781 A-138198 A-138202 A-125813 A-138206 A-125785 A-125815 A-125805 A-138222 A-125801 A-125825 A-125835 A-125829 A-138212 A-125819 A-138218 A-125811 TABLE3-continued SEQ ID NO en hemen som49 man i 50 n 51 5252 53 5454 55 56 57 58 n59 59 60 one61 62 about63 64 to 65be to66 be67 68 6969

1305-1325G21A 004970.2 1066-1085G21A 1110-1129G21A 1161-1181 1161-1181 1166-1185 1167-1186C21A 1178-1198 1186-1205C21A 1188-1207G21A 1194-1214C21A 1195-1214C21A 1197-1217 1199-1219C21A 1204-1224G21A 1209-1228C21A 1210-1230G21A 1302-1322 1308-1328 1329-1348C21A 1333-1353C21A 1388-1407C21A 1403-1423C21A Position inNM SenseSequence AGCUGGCUGAGCGCAGCUUUA CUCACGCUAGACCACAACCAA CCUCACCAACGUGGCGGUCAU CCUCACCAACGUGGCGGUCAU CACCAACGUGGCGGUCAUGAA ACCAACGUGGCGGUCAUGAAA UCAUGAACCUCUCUGGGAACU ACCUCUCUGGGAACUGUCUCA CUCUCUGGGAACUGUCUCCGA GAACUGUCUCCGGAACCUUCA GGAACUGUCUCCGGAACCUUA CUGUCUCCGGAACCUUCCGGA GUCUCCGGAACCUUCCGGAGA CGGAACCUUCCGGAGCAGGUA AACCUUCCGGAGCAGGUGUUA CUUCCGGAGCAGGUGUUCCGA CAUCUCCAGCAUCGAAGAACA CUCCAGCAUCGAAGAACAGAA CAGCAUCGAAGAACAGAGCCU UUCCUCAAGGACAACGGCCUA AAGGACAACGGCCUCGUGGGA GCUGCUGGAGCUCGACCUGAA UGACCUCCAACCAGCUCACGA Sense name A-138223 A-125782 A-138213 A-138199 A-138201 A-125812 A-138205 A-125784 A-125814 A-138221 A-138211 A-125818 A-125810 AD-68709A138193 AD-68111A135415 AD-62730A125780 AD-68711A138197 AD-62712A125804 AD-62739A125800 AD-62723A125824 AD62745-A125834 AD-62733A125828 AD-68721A138217 Duplex name AD-68724 AD-62734 AD-68719 AD-68712 AD-68713 AD-62732 AD-68715 AD-62738 AD-62736 AD-68723 AD-68718 AD-62744 AD-62727 US 2018 /0201929 A1 Jul. 19 , 2018 75

SEQ ID NO 127 12128 129 130 131 132 133 134 135 136 137 138 139 140 141141

004970.2 1408-1430C21A 1458-1480C21A 1521-1543G21A 1522-1544 1534-1555C21A C21A15581536- 1575-1597 1613-1634C21A 1614-1635 G21A16361615- G21A17861764- 1954-1976C21A 2052-2073G21A 2057-2078 2063-2084C21A Position inNM AntisenseSequence UGCAGGUGCGUGAGCUGGUUGGA UGGAGAGCAGCAGGUACUCCAGC UCAGCCAGAAGGCCCGCUGCAGG UCCAGCCAGAAGGCCCGCUGCAG UUGCGAGACGUCCAGCCAGAAGG UGUUGUGCGAGACGUCCAGCCAG UCUGCAAGGAGUUAUUCCUGAGG UUGAGUUGUUCCUGAGGCUGAGG AGUGAGUUGUUCCUGAGGCUGAG UAGUGAGUUGUUCCUGAGGCUGA UCCCCUCACAGAUGGCCUGGACG UGACACUGAGGACCUGUCCCCAG UUUUGCCUUUAAUUGAUGACAGC AUUGCCUUUGCCUUUAAUUGAUG UAUUCGAUUGCCUUUGCCUUUAA UnmodifiedSenseandAntisenseStrandSequencesofIGFALSdsRNAS Antisense namename A-125817 A-125791 A-125779 A-125837 A-138208 A-125793 A-125823 A-138220 A-138226 A-138204 A-125809 A-125799 A-138238 A-138236 A-138228 TABLE3-continued SEQ ID NONO 70 72 73 74 75 76 77 78 79 80 81 82 84

tion 004970.2 1410-1430C21A 1460-1480C21A 1523-1543G21A 1524-1544 C21A15551536- 1538-1558C21A 1577-1597 1615-1634C21A 1616-1635 1617-1636G21A 1766-1786G21A 1956-1976C21A 2054-2073G21A 2059-2078 2065-2084C21A Position inNM SenseSequence CAACCAGCUCACGCACCUGCA UGGAGUACCUGCUGCUCUCCA UGCAGCGGGCCUUCUGGCUGA GCAGCGGGCCUUCUGGCUGGA UUCUGGCUGGACGUCUCGCAA GGCUGGACGUCUCGCACAACA UCAGGAAUAACUCCUUGCAGA UCAGCCUCAGGAACAACUCAA CAGCCUCAGGAACAACUCACU AGCCUCAGGAACAACUCACUA UCCAGGCCAUCUGUGAGGGGA GGGGACAGGUCCUCAGUGUCA UGUCAUCAAUUAAAGGCAAAA UCAAUUAAAGGCAAAGGCAAU AAAGGCAAAGGCAAUCGAAUA Sense name A-125790 A-125778 A-125836 A-138207 A-125822 A-138203 A-125798 A-138227 AD-62740A125816 AD-62721A125792 AD-68722A138219 138225-68725AAD AD-62722A125808 AD-68731A138237 AD-68730A138235 Duplex name AD-62716 AD-62725 AD-62714 AD-68716 AD-62718 AD-68714 AD-62735 AD-68726 US 2018 /0201929 A1 Jul. 19 , 2018 76

TABLE 4 TABLE 4 - continued IGFALS Single Dose Screen in Hep3B Cells IGFALS Single Dose Screen in Hep3B Cells Hep3B ??p3B 10 nM 10 nM 1 nM 1 nM 0 . 1 nM 0 . 1 nM 10 nM 10 nM 1 nM 1 nM 0 . 1 nM 0 . 1 nM DuplexID Avg SD Avg SD Avg SD DuplexID Avg SD Avg SD Avg SD AD -68729 53 . 9 16 . 0 57 . 5 3 . 8 97 . 4 7 . 0 AD - 62744 98 . 8 10 . 4 ND 139 . 1 24 . 7 AD - 68720 48 . 4 4 . 1 73 . 2 27 . 9 116 . 3 9 . 3 AD - 68721 61. 8 8 .0 81. 3 4 . 2 99 . 2 14 . 2 AD -68717 22. 6 5 . 6 55 . 4 8 . 3 101. 8 26 . 9 AD - 62727 91. 6 25 . 9 ND 86 . 6 46 . 5 AD - 62742 126 . 5 20 . 7 ND 124. 7 13 . 1 AD -62740 138 . 9 16 . 0 ND 117 . 3 55 . 5 AD - 62719 106 . 8 25 . 1 ND 66 . 5 4 . 7 AD -62716 81. 5 0 . 2 ND 127 . 8 20 . 9 AD - 62724 87. 8 8 . 4 ND 75 . 1 5 . 7 AD -62725 109 . 1 6 . 1 ND 103 . 8 17 . 0 AD - 68728 56 . 3 7 . 6 78 .6 4 . 4 110 . 6 26 . 0 AD -62714 73 . 9 8 .9 ND 64 . 0 16 . 0 AD -62717 98 . 6 1 . 7 ND 102. 9 56 . 2 AD -68716 18. 2 0 .3 222236328 . 6 17 . 6 40 . 2 10 . 8 AD - 62731 105 . 7 3 . 4 ND 51. 1 18. 3 AD - 62721 62. 0 7 . 7 ND 91 . 7 6 . 1 AD -62726 70 . 7 37 . 7 ND 93. 5 8 . 9 AD - 68722 19 . 2 0 . 5 51. 1 0 .7 53. 4 22 . 2 AD -68727 68 . 9 14 . 6 94 . 8 12 . 8 124 . 7 23 . 3 AD -68725 20 . 3 7 . 5 23 . 0 6 . 2 67 . 6 15 . 6 AD - 62715 118 . 5 41. 8 ND 128 . 4 17. 9 AD -68714 58 . 9 2 . 8 73 . 5 19 . 0 92. 6 8 . 9 AD -68710 91. 0 34 . 2 91 . 7 14 . 2 90 . 5 1 . 1 AD -62722 120 . 7 69 . 9 ND 115 . 0 25 . 4 AD -62743 81. 6 18 . 1 ND 123 . 9 20 . 9 AD - 62735 60 . 2 29 . 8 ND 100 . 2 22 . 6 AD -62711 107 . 0 11 . 3 ND 92 . 0 11 . 5 AD -68731 33 . 5 27 . 2 11 . 8 0 .9 26 . 6 7. 4 AD -68709 42 . 4 2 . 2 38 . 1 1 . 4 76 . 1 1 . 4 AD - 68730 14 . 5 0 . 9 24 . 5 7 . 5 44 . 4 8 . 3 AD -68724 53 . 5 16 . 7 40 . 9 7 . 9 73 . 8 1 . 2 AD -68726 17 . 0 10 . 0 28 . 6 11. 8 64. 5 3 . 7 AD -62734 43 . 1 29 . 6 ND 115 . 2 0 . 3 AD - 62728 46 . 3 20 . 5 ND 49 . 5 10 . 2 AD - 68111 29 . 5 14 . 8 37 . 5 0. 7 92 . 1 3 . 9 AD - 62741 116116 . 8 48 . 6 ND 143. 6 35 . 9 AD - 68719 45 . 4 18 . 9 59 . 6 5 .7 108 . 7 25 . 0 AD - 62737 94 . 7 8 . 6 ND 75 . 2 55 . 1 AD -68712 40 . 8 1 . 9 58 . 0 4. 7 97 . 4 13 . 1 AD -62713 83. 0 20 . 3 ND 89 . 3 31 . 9 AD - 62730 98 . 4 14 . 2 ND 119 . 5 17 . 2 AD -62723 103. 5 32 . 2 ND 66 . 5 22 . 2 AD - 68711 97 . 3 23 . 0 86 . 6 5 . 7 110 . 7 14 . 8 AD -62745 66 . 7 4 . 4 ND 85 . 7 61 . 2 AD -68713 79. 6 10 . 0 93 . 6 23 . 9 103. 3 4 . 2 AD -62733 107 . 1 1 . 3 ND 35 . 9 3 . 8 AD -62732 89. 0 13 . 3 ND 66 . 0 14 . 3 AD - 62718 129 . 6 42 . 7 ND 87 . 7 39 . 2 AD - 68715 48 . 7 13 . 1 71. 9 6 . 8 78 . 7 7 . 2 AD - 1955 102 . 5 25 . 0 AD -62738 133. 2 34 . 5 ND 123 . 4 13 . 0 Mock 103 . 0 18 .8 AD -62736 113. 6 22. 9 ND 84 . 9 13. 9 Naive 118 . 0 23 . 5 AD -62712 68 . 5 22. 6 ND 96 . 9 25 . 6 AD -68723 83 . 3 14 . 5 84. 4 13 . 8 71. 8 25 .4 AD - 62739 99 . 4 13. 8 ND 105. 6 24 .4 AD -68718 83. 1 6 . 8 78 . 2 0 . 1 119 . 8 36 . 8 Data are expressed as percent message remaining relative to AD - 1955 non - targeting control. US 2018 /0201929 A1 Jul. 19 , 2018

Positionin SEQIDNO:1 Start 316 324 547 676 745 746 774 831 842 849 870 909 919 1041 1045 1064 1108 1159 SEQ ID NO 199 200 201 asGfsccfugfuufgcfccgcfcAfgCfacicsasg202 usCfsgufucfcufgCfucaGfgufcCfagfcsusc203 usGfscGfuufccfuGfcucAfggfucfcAfgscsu204 205 uscfsacfggfcAfgCfgaugfagfgufugfcsgsg206 207 208 209 usCfsucfcAfggfagfgccAfgCfcAfcGfcsgsg210 211 uscfscGfgAfuGfcGfguuGfugfgcfccfasgsc212 213 214 215 216 AntisenseSequence usufsuguufgcfcfguccAfgCfcacagsgsg usAfscgagfagfGfuuguufgcfcguccsasg usufsccaGfccfUfgcucAfgAfcgguusgsu asAfscacGfuuTufgccuUfgAfuggccscsg usGfscGfccfcGfgfgccAfcGfgcfagfcsgsa usCfsafgAfaGfgcfgcccfgGfgGfccfascsg usAfsucgcfagfcfgccuufcAfggcccsasg usAfsacgufgUfCfcuccAfggfaggccsasg asGfscufgCfcGfgAfugeGfgufugfuGfgscsc usAfsaagfugfcfgcucAfgCfcagcusgsc usufsgguufgUfGfgucuAfgCfgugagscsa asUfsgAfcCfgcfcAfcguufggfugfagfgscsc

TABLE5 ModifiedSequences Antisense oligo Name A-138234 A-138216 A-138210 A-125787 A-125839 A-125841 A-138232 A-125807 A-125797 A-125795 A-138230 A-125775 A-138196 A-125803 A-125789 A-138194 A-138224 A-125783 SEQ ID NO 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159

SenseSequence A-125794UfsgsGfccfccfgGfGfcfgcfcUfucfcUfgAfL96 Sense Oligo Name AD-68729A138233csusguggCfuGfGfAfcggcaacaaaL96 AD-68720A138215gsgsacggCfaAfCfAfaccucucguaL96 AD-68717A138209asasccgucfuGfAfGfcaggcuggaaL96 AD-62742A125786GfsgsufgCfuGfgCfGfGfgCfaAfcAfgGfcUfL96 AD-62719A125838GfscsUfgGfaCfcufGfAfgCfaGfgAfaCfgAfL96 AD-62724A125840CfsusGfgAfcCfGfAfGfcAfggfaAfcGfcAfL96 AD-68728A138231gsgsccaucfaAfGfGfcaaacguguuL96 AD-62717A125806GfscsAfacfcUfcAfUfCfgCfugfcCfgufgAfL96 AD-62731A125796GfscsufgcfcGfugfgfcfccfcGfgGfcGfcAfL96 AD-68727A138229gsgsgccuGfaAfGfGfcgcugcgauaL96 AD-62715A125774GfscsGfugfgCfuGfGfCfcUfcCfuGfgAfgAfL96 AD-68710A138195gsgsccuccfuGfGfAfggacacguuaL96 AD-62743A125802UfsgsGfgCfcAfcAfAfCfcGfcAfucfcGfgAfL96 AD-62711A125788CfscsAfcAfacfcfcfAfucfcGfgcfagfcUfL96 AD-68709A138193asgscuggCfuGfAfGfcgcagcuuuaL96 AD-68724A138223csuscacgcfuAfGfAfccacaaccaal96 AD-62734A125782cfscsUfcAfcCfaAfCfGfugfgCfggfucfaUfL96

Duplex Nam AD-62726 US 2018 /0201929 A1 Jul. 19 , 2018

Positionin SEQIDNO:1 Start 1159 1164 1165 1176 1184 1186 1192 11931193 1195 1197 1202 1207 1208 1327 1331 1386 1401 1408 1458 1521 1522 1534 1536 SEO ID NO 217 218 219 220 221 222 usGfsaAfggfuufccfggagfacfagfuufcscsc223 224224 225 usCfsucfcGfgAfaGfguucfcGfgAfgAfcsasg226 228 usCfsgGfaAfcAfcCfugcUfcCfgGfaAfgsgsu229 usAfsggccfgUfUfguccUfugfaggaasgsa230 usCfscCfaCfgAfgGfccgUfugfucfcufusgsa231 232 usCfsgufgAfgCfuGfguuGfgAfgGfucfasgsg233 234 235 236 237 238 usGfsuUfgufgCfgAfgacGfucfcAfgCfcsasg239 AntisenseSequence asUfsgacCfgcfcfacguufgGfugaggscsc usufscaugfacfcfgccaCfgUfuggugsasg usufsucaufgAfcfcgccAfcGfuuggusgsa asGfsuufccfcAfgAfgagGfuufcAfugfascsc usGfsagacfagfUfucccAfgAfgaggususc usCfsggaGfacfAfguuccfcAfgagagsgsu usAfsaggUfucfcfggagAfcAfguuccscsa usCfscGfgAfaGfgUfuccGfgAfgAfcAfgsusu A-125805usAfsccfugfcUfccfggaAfgGfuufccfgsgsa227 usAfsacacfcUfGfcuccGfgAfagguuscsc usufscaggfuCfGfagcucfcAfgcagcsusc usGfscAfgGfugfcGfugaGfcUfggfuufgsgsa usGfsgAfgAfgCfagfcagGfuAfcUfccfasgsc uscfsagfccfagfaAfggcCfcGfcufgCfasgsg usCfscAfgCfcAfgAfaggcfccfgcfugfcsasg usufsgcgAfgAfCfguccAfgCfcagaasgsg

TABLE5-continued ModifiedSequences Antisense Oligo Name A-135416 A-138214 A-138200 A-125781 A-138198 A-138202 A-125813 A-138206 A-125785 A-125815 A-138222 A-125801 A-138212 A-125819 A-138218 A-125811 A-125817 A-125791 A-125779 A-125837 A-138208 A-125793 SEQ ID NO 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182

SenseSequence gsgsaacugfucfufcfcggaaccuuaL96 AD-68719A138213csasccaacfgUfGfGfcggucaugaal96 A-125780UfscsAfugfaAfccfufcfucfugfggfaAfcUfL96 A-125790UfsgsgfagfuAfccfUfGfcUfacfucfucfcAfL96 Sense Oligo Name AD-68111A135415cscsucacCfaAfCfGfuggeggucaul96 AD-68712A138199ascscaacgfuGfGfCfggucaugaaaL96 AD-68711A138197ascscucucfuGfGfGfaacugucucaL96 AD-68713A138201csuscucuGfgGfAfAfcugucuccgaL96 AD-62732A125812GfsasAfcufgUfcUfcfcfggfaAfcCfUUTCAFL96 AD-62738A125784CfsusGfucfucfcGfGfAfacfcUfucfcGfgAfL96 AD-62736A125814GfsusCfucfcGfgAfAfCfcUfucfcGfgAfgAfL96 AD-62712A125804CfsgsgfaAfcCfuufcfcfggfagfcAfgGfuAfL96 AD-68723A138221asasccuucfcGfGfAfgcagguguuaL96 AD-62739A125800CfsusufccfggfagfCfAfgGfugfuufcCfgAfL96 AD-68718A138211ususccucAfaGfGfAfcaacggccuaL96 AD-62744A125818AfsasGfgAfcAfaCfGfGfccfuCfgufgGfgAfL96 AD-68721A138217gscsugcuGfgAfGfCfucgaccugaaL96 AD-62727A125810UfsgsAfccfuCfcAfAfCfcAfgcfucfacfgAfL96 CfsasAfcCfagfcufCfAfcGfcAfcCfGfcAfL9662740A-125816AD AD-62725A125778UfsgsCfaGfcGfggfcfcfdacUfgGfcUfgAfL96 AD-62714A125836GfscsAfgCfgGfgCfCfUfucfuGfgCfuGfgAfL96 AD-68716A138207ususcuggCfuGfGfAfcgucucgcaa496 AD-62721A125792GfsgsCfuGfgAfcGfUfCfucfgcfacfaAfcAfL96 AD-68715A138205 Duplex Nam AD-62730 AD-62716 US 2018 /0201929 A1 Jul. 19 , 2018 6L

Positionin SEQIDNO:1 Start 1613 1614 1615 1764 1954 2052 2057 20632063 774 201 556 643 1300 1301 1306 1575 SEQ ID NO 240 241 242 uscfsccfcUfcAfcAfgauGfgcfcUfggfascsg243 usGfsacfacfugfagfgacCfugfucfccfcsasg244 245 246 247247 248 asAfscufgCfaAfaAfgacGfcufgAfgCfuscsa249 usufsccfaAfccfcAfgguUfgAfgGfucfcscsa250 251 252 253 asGfsgCfucfugfuufcuucfgAfuGfcufgsgsa254 uscfsuGfcAfaGfgAfguuAfuufccfugfasgsg255 AntisenseSequence UsUfsgagufuGfUfuccuGfaGfgcugasgsg asGfsugaGfuUfGfuuccufgAfggcugsasg usAfsgugAfgUfUfguuccfugfaggcusgsa usufsuugcfcUfUfuaauufgAfugacasgsc asufsugccfuufUfgccuufuAfauugasusg usAfsuucgfaUfUfgccuUfuffccuuusasa asAfsaGfacfgcfugfagcUfcAfucfugfusgsu asGfsgufaAfgUfcAfguuufgufuGfccfasgsc usGfsuufcUfucfgAfugcUfggfagfaufgscsu usufscUfgUfucfuufcgaUfgcfuGfgAfgsasu

TABLE5-continued ModifiedSequences Antisense Oligo Name A-138220 A-138226 A-138204 A-125809 A-125799 A-138238 A-138236 A-138228 A-125827 A-125833 A-125831 A-125821 A-125825 A-125835 A-125829 A-125823 SEQ ID NO 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198

SenseSequence fcAfacfaAfAfcfuGfacfuufacfcUfL96 Sense Oligo Name AD-68722A138219uscsagccUfcAfGfGfaacaacucaaL96 AD-68725A138225csasgccucfaGfGfAfacaacucacuL96 AD-68714A138203asgsccucAfgGfAfAfcaacucacuaL96 AD-62722A125808UfscscfagfgcfcAfUfCfugfugfagfggfgAfL96 AD-62735A125798GfsgsGfgAfcAfggfUfCfcUfcAfgufgUECAFL96 AD-68731A138237usgsucaucfaAfUfUfaaaggcaaaaL96 AD-68730A138235uscsaauuAfaAfGfGfcaaaggcaauL96 AD-68726A138227asasaggcAfaAfGfGfcaaucgaauaL96 AfscsAfgAfugfagfcfUfcAfgCfgufcUTUUfL9662728A-125826AD AD-62741A125832AfsgscfucfagfcGfUfCfuUfuufgcfagfuUfL96 AD-62737A125830GfsgsAfccfuCfaAfCfCfGfgGfuufgGfAfL96 A-125820 AD-62723A125824CfsasUfcUfccfagfCfAfucfgAfagfaAfcAfL96 AD-62745A125834CfsuscfcAfgCfaufCfGfaAfgAfacfagfaAfL96 AD-62733A125828cfsasGfcAfuCfgAfAfGfaAfcAfgAfgCfcUfL96 AD-62718A125822UfscsAfggfaAfuAfAfCfucfcUfugfcAfgAfL96

Duplex Nam AD-62713 US 2018 /0201929 A1 Jul. 19 , 2018 80

Example 3 — Knockdown of IGFALs Expression brate genes . The custom Python script built the set of agents with an IGFALS siRNA Decreases Expression of by systematically selecting a siRNA every 11 bases along IGF - 1 the target mRNA starting at position 10 . At each of the positions, the neighboring agent (one position to the 5 ' end [0606 ] A series of siRNAs targeting mouse IGFALS were of the mRNA , one position to the 3 ' end of the mRNA ) was designed and tested for the ability to knockdown expression swapped into the design set if the predicted efficacy was of IGFALs mRNA in 6 - 8 week old C57B1/ 6 female mice ( n = 3 per group ) . A single 10 mg/ kg dose of AD -62713 , better than the efficacy at the exact every - 11th siRNA . Low AD -62724 , AD -62745 , or AD -62728 ; or PBS control, was complexity agents , i. e ., those with Shannon Entropy mea administered subcutaneously on day 1 . On day 7 , the mice sures below 1 . 35 were excluded from the set . were sacrificed to assess knockdown of IGFLALS mRNA in In Vitro Dual -Glo® Screening liver and IGFALS and IGF - 1 protein in serum . [ 0607 ) AD -62728 was found to be most effective in Cell Culture and Transfections decreasing expression of IGFALS mRNA and protein . Spe [ 0613] Cos7 cells (ATCC , Manassas, Va. ) were grown to cifically , at day 7 , IFGALS mRNA expression in the liver near confluence at 37° C . in an atmosphere of 5 % CO , in was found to be about 15 % of the PBS control. At day 7 after DMEM ( ATCC ) supplemented with 10 % FBS , before being treatment with AD -62713 and AD -62745 , IGFALS mRNA released from the plate by trypsinization . Dual- Glo® expression in the liver was found to be about 65 % of the PBS Luciferase constructs were generated in the psiCHECK2 control for both duplexes . plasmid and contained approximately 2 . 0 kb (human ) [0608 ] decrease in serum IGFALS protein levels was IGFALS sequences (SEQ ID NO : 23 ) . Dual - luciferase plas found to correspond to the decrease in IGFALS mRNA in mids were co - transfected with double stranded agents into the liver . Specifically, AD -62728 decreased the serum 3000 cells using Lipofectamine RNAiMax (Invitrogen , IGFALS protein level to about 3 . 9 ug /ml , as compared to Carlsbad Calif. cat # 13778 - 150 ) . For each well of a 384 well about 6 . 4 ug /ml in the PBS control. AD -62713 and plate , 0 .1 ul of Lipofectamine was added to 3 ng of plasmid AD -62745 decreased the serum IGFALS level to about 5 . 2 vector and agent in 15 ul of Opti -MEM and allowed to ug/ ml and 4 . 6 ug /ml , respectively . complex at room temperature for 15 minutes. The mixture [ 0609] A decrease in serum IGF - 1 was also observed in was then added to the cells resuspended in 35 ul of fresh response to treatment with the duplexes . Specifically , complete media . Cells were incubated for 48 hours before AD -62727 decreased the serum IGF - 1 protein level to about luciferase was measured . Single dose experiments were 13 ng/ ml as compared to about 34 ng /ml in the PBS control. performed at 10 nM final duplex concentration . AD - 62713 and AD -62745 decreased serum IGF - 1 levels to about 20 ng /ml and 27 ng/ ml , respectively . Dual -Glo® Luciferase Assay 10610 ] Further , in a multidose study , AD -62728 was dem 10614 ] Forty - eight hours after the siRNAs were trans onstrated to be effective in knockdown of expression of fected , Firefly ( transfection control) and Renilla ( fused to IGFALS mRNA in liver in an expected dose response IGFALS target sequence in 3 ' UTR , SEQ ID NO : 23 ) manner . Specifically , C57B1/ 6 female mice, 6 - 8 weeks of luciferase were measured . First , media was removed from age ( n = 3 per group ) were administered either four doses of cells . Then Firefly luciferase activity was measured by AD -62728 at 1 mg/ kg or 3 mg/ kg once weekly , or two doses adding 20 ul of Dual -Glo® Luciferase Reagent mixed with at 3 mg/ kg or 10 mg/ kg every other week ; or a PBS control. 20 ul of complete media to each well . The mixture was IGFALS mRNA knockdown was observed in the expected incubated at room temperature for 30 minutes before lumi dose response manner. nescense (500 nm ) was measured on a Spectramax (Molecu lar Devices ) to detect the Firefly luciferase signal. Renilla Example 4 — In Vitro Screening luciferase activity was measured by adding 20 ul of room temperature of Dual -Glo® Stop & Glo® Reagent to each Bioinformatics well and the plates were incubated for 20 minutes before [ 0611 ] A set of double stranded RNAi agents targeting luminescence was again measured to determine the Renilla human IGFALS (human NCBI ref seq ID : NM _ 004970 ; luciferase signal. The Dual -Glo® Stop & Glo® Reagent NCBI GenelD : 3483 , SEQ ID NO : 1) were designed using quenched the firefly luciferase signal and sustained lumi custom R and Python scripts . The human IGFALS REFSEQ nescence for the Renilla luciferase reaction . Double stranded mRNA has a length of 2168 bases . RNAi agent activity was determined by normalizing the [0612 ] The rationale and method for the set of agent Renilla ( IGFALS ) signal to the Firefly ( control) signal designs is as follows: the predicted efficacy for every poten within each well. The magnitude of agent activity was then tial 19mer siRNA from position 10 through position 2168 assessed relative to cells that were transfected with the same was determined with a linear model derived the direct vector but were not treated with agent or were treated with measure of mRNA knockdown from more than 20 ,000 a non - targeting double stranded RNAi agent. All transfec distinct siRNA designs targeting a large number of verte - tions were done in quadruplicates . US 2018 /0201929 A1 Jul. 19 , 2018

SEQIDNO:1 Rangein 11-29 24-42 34-52 44-62 56-74 67-85 79-97 88-106 99-117 112-130 122-140 134-152 143-161 155-173 165-183 176-194 189-207 198-216 211-229 220-238 232-250 242-260 254-272

SEO ID NO 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 Antisenseoligosequence UGCCGGCCACCCCUGCCCU UGUACGUCUGCUGUGCCGG AGCGAGGGAGGGUACGUCU UCAGGCAGGCAGCGAGGGA UCAGGGCAGGCUGCAGGCA UCAUCCUGCAUGCAGGGCA CUUUCCUCAGGGCCAUCCU UCAGGCCUCCUUUCCUCAG UAGCGCCAGGGCCAGGCCU AGGACAGCAGCAGCAGCGC AGUGCCACCCAGGACAGCA UUGCGGGGGCCCAGUGCCA UCCUCCAGGCUGCGGGGGC UCGGGGUCUGCUCCCUCCA UCCCGGCGUUCCGGGGUCU UCCUCGGCUUCCCCCGGCG UGGGCACGCUGGGCCCUCG ACAGGCGGCCGGGCACGCU UGUAGCUGCAGACACAGGC UGUCGUCAUCGUAGCUGCA UGAGCUCAUCCGCGUCGUC UAGAAGACGCUGAGCUCAU UUCCUGGAGCUGCAGAAGA

Antisense Oligo Name A-147668 A-147670 A-147672 A-147674 A-147676 A-147678 A-147680 A-147682 A-147684 A-147686 A-147688 A-147690 A-147692 A-147694 A-147696 A-147698 A-147700 A-147702 A-147704 A-147706 A-147708 A-147710 A-147712 TABLE6 UnmodifiedSenseandAntisenseStrandSequencesofIGFALSdsRNAS Range 11-29 24-42 34-52 44-62 56-74 67-85 79-97 88-106 99-117 112-130 122-140 134-152 143-161 173155- 165-183 176-194 189-207 198-216 229211- 220-238 232-250 242-260 254-272

SEQ ID NO 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 Senseoligosequence AGGGCAGGGGUGGCCGGCA CCGGCACAGCAGACGUACA AGACGUACCCUCCCUCGCU UCCCUCGCUGCCUGCCUGA UGCCUGCAGCCUGCCCUGA UGCCCUGCAUGCAGGAUGA AGGAUGGCCCUGAGGAAAG CUGAGGAAAGGAGGCCUGA AGGCCUGGCCCUGGCGCUA GCGCUGCUGCUGCUGUCCU UGCUGUCCUGGGUGGCACU UGGCACUGGGCCCCCGCAA GCCCCCGCAGCCUGGAGGA UGGAGGGAGCAGACCCCGA AGACCCCGGAACGCCGGGA CGCCGGGGGAAGCCGAGGA CGAGGGCCCAGCGUGCCCA AGCGUGCCCGGCCGCCUGU GCCUGUGUCUGCAGCUACA UGCAGCUACGAUGACGACA GACGACGCGGAUGAGCUCA AUGAGCUCAGCGUCUUCUA UCUUCUGCAGCUCCAGGAA

Sense Oligo Name A-147667 A-147669 A-147671 A-147673 A-147675 A-147677 A-147679 A-147681 A-147683 A-147685 A-147687 A-147689 A-147691 A-147693 A-147695 A-147697 A-147699 A-147701 147703-A A-147705 A-147707 A-147709 A-147711

Duplex Name AD-73764 AD-73765 AD-73766 73767AD- AD-73768 AD-73769 AD-73770 AD-73771 AD-73772 AD-73773 AD-73774 AD-73775 AD-73776 AD-73777 AD-73778 AD-73779 AD-73780 AD-73781 73782AD- AD-73783 AD-73784 AD-73785 AD-73786 US 2018 /0201929 A1 Jul. 19 , 2018

SEQIDNO:1 RangeintoRangein 265-283 275-293 288-306 299-317 310-328 319-337 331-349 343-361 353-371 364-382 376-394 385-403 397-415 407-425 418-436 431-449 442-460 452-470 464-482 475-493 484-502 497-515 506-524

151SEQ ID NO 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 Antisenseoligosequence UGCGCGUGAGGUUCCUGGA UCAUCAGGCAGGCGCGUGA UCCGCCCGGGACUCCAUCA AGGGCUUGGGUGCCGCCCG UGUCCAGCCACAGGGCUUG UGUUGUUGCCGUCCAGCCA UGACGGACGAGAGGUUGUU AGGCUGCCGGGGGGACGGA AGGUUCUGGAAGGCUGCCG UCAGGCUGGAGAGGUUCUG UGUUGAGGAAGCCCAGGCU UGCCCUGCAGGUUGAGGAA UGCCCAGCUGGCCGCCCUG UGCUCCAGGCUGCCCAGCU UCAGCGCCUGUGGCUCCAG UUCUCUAGGCCCAGCAGCG UGUGGCACAGGUUCUCUAG UCCAGGUGCAGGUGGCACA AGCUGGUUCCGCUCCAGGU UCAGGCUGCGCAGCUGGUU UGCCGAGUGCCAGGCUGCG UUGUGUGCAAACGUGCCGA AGCGCGGGCGUGUGUGCAA

Antisense Oligo Name A-147714 A-147716 A-147718 A-147720 A-147722 A-147724 A-147726 A-147728 A-147730 A-147732 A-147734 A-147736 A-147738 A-147740 A-147742 A-147744 A-147746 A-147748 A-147750 A-147752 A-147754 A-147756 A-147758 TABLE6-continued UnmodifiedSenseandAntisenseStrandSequencesofIGFALSdsRNAS Range 265-283 275-293 288-306 299-317 310-328 319-337 331-349 343-361 353-371 364-382 376-394 385-403 397-415 407-425 418-436 431-449 442-460 452-470 464-482 475-493 484-502 497-515 506-524

SEQ ID NO 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 Senseoligosequence UCCAGGAACCUCACGCGCA UCACGCGCCUGCCUGAUGA UGAUGGAGUCCCGGGCGGA cGGGCGGCACCCAAGcccu CAAGCCCUGUGGCUGGACA UGGCUGGACGGCAACAACA AACAACCUCUCGUCCGUCA UCCGUCCCCCCGGCAGCCU CGGCAGCCUUCCAGAACCU CAGAACCUCUCCAGCCUGA AGCCUGGGCUUCCUCAACA UUCCUCAACCUGCAGGGCA CAGGGCGGCCAGCUGGGCA AGCUGGGCAGCCUGGAGCA CUGGAGCCACAGGCGCUGA CGCUGCUGGGCCUAGAGAA CUAGAGAACCUGUGCCACA UGUGCCACCUGCACCUGGA ACCUGGAGCGGAACCAGCU AACCAGCUGCGCAGCCUGA CGCAGCCUGGCACUCGGCA UCGGCACGUUUGCACACAA UUGCACACACGCCCGCGCU

Sense Oligo Name A-147713 A-147715 A-147717 A-147719 A-147721 A-147723 A-147725 A-147727 A-147729 A-147731 A-147733 A-147735 A-147737 A-147739 A-147741 A-147743 A-147745 A-147747 A-147749 A-147751 A-147753 A-147755 A-147757

Duplex Name AD-73787 AD-73788 AD-73789 AD-73790 AD-73791 AD-73792 AD-73793 AD-73794 AD-73795 AD-73796 AD-73797 AD-73798 AD-73799 AD-73800 AD-73801 AD-73802 AD-73803 AD-73804 AD-73805 AD-73806 AD-73807 AD-73808 AD-73809 US 2018 /0201929 A1 Jul. 19 , 2018 83

SEQIDNO:1 Rangein 517-535 529-547 541-559 562-580 574-592 583-601 614596- 607-625 616-634 629-647 640-658 649-667 662-680 673-691 682-700 694-712 704-722 716-734 726-744 737-755 748-766 760-778 772-790 781-799

SEQ ID NO 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 Antisenseoligosequence UGAGCGAGGCCAGCGCGGG UGUUGCUGAGGCCGAGCGA UGCUCAGACGGUUGUUGCU UGAAGAGCCCGUCCUCCAG UGCCGAGGCCCUCGAAGAG UCCAGAGGCUGCCGAGGCC UCGAGGUUGAGGUCCCAGA UGCUAUUCCAGCCGAGGUU UCACCGCCAGGCUAUUCCA UCCGCAUCGGGGAGCACCG UGCCGCGGAACGCCGCAUC UGCUGCCCAGGCCGCGGAA ACCAGCUCGCGCAGGCUGC UGCCCGCCAGCACCAGCUC UCAGCCUGUUGCCCGCCAG UCUGCAGGUAGGCCAGCCU AAGAGCGCGGGCUGCAGGU UCCAGGCCGCUGAAGAGCG UCGGAGCUCGGCCAGGCCG AGGUCCAGCUCCCGGAGCU UGUUCCUGCUCAGGUCCAG UGGCCCGCAGCGCGUUCCU UGUUUGCCUUGAUGGCCCG UCACGAACACGUUUGCCUU

Antisense Oligo Name A-147760 A-147762 A-147764 A-147768 A-147770 A-147772 A-147774 A-147776 A-147778 A-147780 A-147782 A-147784 A-147786 A-147788 A-147790 A-147792 A-147794 A-147796 A-147798 A-147800 A-147802 A-147804 A-147806 A-147808 TABLE6-continued UnmodifiedSenseandAntisenseStrandSequencesofIGFALSdsRNAS Range 517-535 529-547 541-559 562-580 574-592 583-601 596-614 607-625 616-634 647629- 640-658 667649- 662-680 673-691 682-700 694-712 704-722 716-734 726-744 737-755 748-766 760-778 772-790 781-799

SEQ ID NO 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 Senseoligosequence CCCGCGCUGGCCUCGCUCA UCGCUCGGCCUCAGCAACA AGCAACAACCGUCUGAGCA CUGGAGGACGGGCUCUUCA CUCUUCGAGGGCCUCGGCA GGCCUCGGCAGCCUCUGGA UCUGGGACCUCAACCUCGA AACCUCGGCUGGAAVAGCA UGGAAUAGCCUGGCGGUGA CGGUGCUCCCCGAUGCGGA GAUGCGGCGUUCCGCGGCA UUCCGCGGCCUGGGCAGCA GCAGCCUGCGCGAGCUGGU GAGCUGGUGCUGGCGGGCA CUGGCGGGCAACAGGCUGA AGGCUGGCCUACCUGCAGA ACCUGCAGCCCGCGCUCUU CGCUCUUCAGCGGCCUGGA CGGCCUGGCCGAGCUCCGA AGCUCCGGGAGCUGGACCU CUGGACCUGAGCAGGAACA AGGAACGCGCUGCGGGCCA CGGGCCAUCAAGGCAAACA AAGGCAAACGUGUUCGUGA

Sense Oligo Name A-147759 A-147761 A-147763 A-147767 A-147769 A-147771 A-147773 A-147775 A-147777 A-147779 A-147781 A-147783 A-147785 A-147787 A-147789 A-147791 A-147793 A-147795 A-147797 A-147799 A-147801 A-147803 A-147805 A-147807

Duplex Name AD-73810 AD-73811 AD-73812 AD-73813 AD-73814 AD-73815 AD-73816 AD-73817 AD-73818 73819AD- AD-73820 AD-73821 AD-73822 AD-73823 AD-73824 AD-73825 AD-73826 AD-73827 AD-73828 AD-73829 AD-73830 AD-73831 AD-73832 AD-73833 US 2018 /0201929 A1 Jul. 19 , 2018 84

SEQIDNO:1 RangeintoRangein 793-811 815-833 825-843 837-855 849-867 859-877 869-887 881-899 893-911 904-922 914-932 924-942 937-955 947-965 958-976 970-988 979-997 991-1009 1003-1021 1012-1030 1024-1042 1036-1054 1047-1065

151SEQ ID NO 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 53132 532 533 Antisenseoligosequence UCCGGGGCAGCUGCACGAA UGGUCCAGGUAGAGUUUCU UAUGAGGUUGCGGUCCAGG UGCCACGGCAGCGAUGAGG UAAGGCGCCCGGGGCCACG UCAGGCCCAGGAAGGCGCC UGCAGCGCCUUCAGGCCCA AGGUCCAGCCAUCGCAGCG UGGUUGUGGGACAGGUCCA UGCCAGCCACGCGGUUGUG UCCUCCAGGAGGCCAGCCA UGGGAACGUGUCCUCCAGG UGCCCAGCAGACCGGGGAA AGCACACGCAGGCCCAGCA UGGACAGCCGCAGCACACG UGAUGGCGUUGUGGGACAG UCAGGCUGGCGAUGGCGUU AGGUGCGGGGCCGCAGGCU UCAGGUCCUUGAAGGUGCG UCAGGAAGUGCAGGUCCUU UCUGCAGCUCCUCCAGGAA UGUUGUGGCCCAGCUGCAG UUGCCGGAUGCGGUUGUGG

Antisense Oligo Name A-147810 A-147814 A-147816 A-147818 A-147820 A-147822 A-147824 A-147826 A-147828 A-147830 A-147832 A-147834 A-147836 A-147838 A-147840 A-147842 A-147844 A-147846 A-147848 A-147850 A-147852 A-147854 A-147856 TABLE6-continued UnmodifiedSenseandAntisenseStrandSequencesofIGFALSdsRNAS Range 793-811 815-833 825-843 837-855 849-867 859-877 869-887 881-899 893-911 904-922 914-932 924-942 937-955 947-965 958-976 970-988 979-997 991-1009 10211003- 1012-1030 1024-1042 1036-1054 1047-1065

SEQ ID NO 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 Senseoligosequence UUCGUGCAGCUGCCCCGGA AGAAACUCUACCUGGACCA CCUGGACCGCAACCUCAUA CCUCAUCGCUGCCGUGGCA CGUGGCCCCGGGCGCCUUA GGCGCCUUCCUGGGCCUGA UGGGCCUGAAGGCGCUGCA CGCUGCGAUGGCUGGACCU UGGACCUGUCCCACAACCA CACAACCGCGUGGCUGGCA UGGCUGGCCUCCUGGAGGA CCUGGAGGACACGUUCCCA UUCCCCGGUCUGCUGGGCA UGCUGGGCCUGCGUGUGCU CGUGUGCUGCGGCUGUCCA CUGUCCCACAACGCCAUCA AACGCCAUCGCCAGCCUGA AGCCUGCGGCCCCGCACCU CGCACCUUCAAGGACCUGA AAGGACCUGCACUUCCUGA UUCCUGGAGGAGCUGCAGA CUGCAGCUGGGCCACAACA CCACAACCGCAUCCGGCAA

Sense Oligo Name A-147809 A-147813 A-147815 A-147817 A-147819 A-147821 A-147823 A-147825 A-147827 A-147829 A-147831 A-147833 A-147835 A-147837 A-147839 A-147841 A-147843 A-147845 A-147847 A-147849 A-147851 A-147853 A-147855

Duplex Name AD-73834 AD-73835 AD-73836 AD-73837 AD-73838 AD-73839 AD-73840 AD-73841 AD-73842 AD-73843 AD-73844 AD-73845 AD-73846 AD-73847 AD-73848 AD-73849 AD-73850 AD-73851 AD-73852 AD-73853 AD-73854 AD-73855 AD-73856 US 2018 /0201929 A1 Jul. 19 , 2018 85

SEQIDNO:1 Rangein 1058-1076 1067-1085 1078-1096 1091-1109 1100-1118 1111-1129 1123-1141 1133-1151 1145-1163 1156-1174 1168-1186 1178-1196 1189-1207 1200-1218 1211-1229 1221-1239 1234-1252 1244-1262 1266-1284 1277-1295 1289-1307 1298-1316 1309-1327 1321-1339

SEQ ID NO 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 5520 553 554 555 .556 557 Antisenseoligosequence UGCUCAGCCAGCUGCCGGA UCAAAGCUGCGCUCAGCCA UCCCCAGGCCCUCAAAGCU AGCACCUCAAGCUGCCCCA UCUAGCGUGAGCACCUCAA UCUGGUUGUGGUCUAGCGU UGACCUCCUGGAGCUGGUU UCGCCCGCCUUGACCUCCU AGGCCGAGGAAAGCGCCCG UCACGUUGGUGAGGCCGAG UGUUCAUGACCGCCACGUU UUCCCAGAGAGGUUCAUGA UCCGGAGACAGUUCCCAGA UUCCGGAAGGUUCCGGAGA UGGAACACCUGCUCCGGAA UCCCAGGCCCCGGAACACC UGCUGUGCAGCUUGCCCAG UCCAGGUGCAGGCUGUGCA UAUGCGUCCCAGGCAGCUG UUGUGCGGGCGGAUGCGUC AGGCCGGUGAAGGUGUGCG AGCCCCGAGAGGCCGGUGA AGAGUCGGCGGAGCCCCGA UGUCCUUGAGGAAGAGUCG

Antisense Oligo Name A-147858 A-147860 A-147862 A-147864 A-147866 147868A- A-147870 A-147872 A-147874 A-147876 A-147878 A-147880 A-147882 A-147884 A-147886 A-147888 A-147890 A-147892 A-147896 A-147898 A-147900 A-147902 A-147904 A-147906 TABLE6-continued UnmodifiedSenseandAntisenseStrandSequencesofIGFALSdsRNAS Range 1058-1076 1067-1085 10961078- 1091-1109 11181100- 11291111- 1123-1141 1133-1151 1145-1163 1156-1174 1168-1186 1178-1196 1189-1207 1200-1218 1211-1229 1221-1239 1234-1252 12621244- 1266-1284 1277-1295 1289-1307 1298-1316 1309-1327 1321-1339

SEQ ID NO 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372372 Senseoligosequence UCCGGCAGCUGGCUGAGCA UGGCUGAGCGCAGCUUUGA AGCUUUGAGGGCCUGGGGA UGGGGCAGCUUGAGGUGCU UUGAGGUGCUCACGCUAGA ACGCUAGACCACAACCAGA AACCAGCUCCAGGAGGUCA AGGAGGUCAAGGCGGGCGA CGGGCGCUUUCCUCGGCCU CUCGGCCUCACCAACGUGA AACGUGGCGGUCAUGAACA UCAUGAACCUCUCUGGGAA UCUGGGAACUGUCUCCGGA UCUCCGGAACCUUCCGGAA UUCCGGAGCAGGUGUUCCA GGUGUUCCGGGGCCUGGGA CUGGGCAAGCUGCACAGCA UGCACAGCCUGCACCUGGA CAGCUGCCUGGGACGCAUA GACGCAUCCGCCCGCACAA CGCACACCUUCACCGGCCU UCACCGGCCUCUCGGGGCU UCGGGGCUCCGCCGACUCU CGACUCUUCCUCAAGGACA

Sense Oligo Name A-147857 A-147859 A-147861 A-147863 A-147865 A-147867 A-147869 A-147871 A-147873 A-147875 A-147877 A-147879 A-147881 A-147883 A-147885 A-147887 A-147889 A-147891 A-147895 A-147897 A-147899 A-147901 A-147903 A-147905

Duplex Name AD-73857 AD-73858 AD-73859 AD-73860 AD-73861 AD-73862 AD-73863 AD-73864 AD-73865 AD-73866 AD-73867 AD-73868 AD-73869 AD-73870 AD-73871 AD-73872 AD-73873 AD-73874 AD-73875 AD-73876 AD-73877 AD-73878 AD-73879 AD-73880 US 2018 /0201929 A1 Jul. 19 , 2018 86

SEQIDNO:1 Rangein 1332-1350 1342-1360 1355-1373 1364-1382 1375-1393 1388-1406 1399-1417 1408-1426 1420-1438 1432-1450 14601442- 1454-1472 1465-1483 1474-1492 1485-1503 1496-1514 1507-1525 1519-1537 1529-1547 1541-1559 1553-1571 1564-1582 1575-1593

SEQ ID NO 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 Antisenseoligosequence UACGAGGCCGUUGUCCUUG UCUCAAUGCCCACGAGGCC UACAGGCUCUGCUCCUCAA UCCAGCCCCCACAGGCUCU UCAGCAGCUCCGCCAGCCC UUCAGGUCGAGCUCCAGCA UCUGGUUGGAGGUCAGGUC UGUGCGUGAGCUGGUUGGA UGCGGUGGGGCAGGUGCGU UGCCCUGGAAGAGGCGGUG AGCUUGCCCAGGCCCUGGA AGCAGGUACUCCAGCUUGC UGCGGGAGAGCAGCAGGUA UCAGGCGGUUGCGGGAGAG UGGCAGCUCUGCCAGGCGG AGGGCGUCCGCCGGCAGCU UCAGGGGGCCCAGGGCGUC AGAAGGCCCGCUGCAGGGG ACGUCCAGCCAGAAGGCCC UGGUUGUGCGAGACGUCCA AAUGCCUCCAGGCGGUUGU UGCUGUUGGGCAAUGCCUC UGGUGCCAAGAGGCUGUUG

Antisense Oligo Name A-147908 A-147910 A-147912 A-147914 A-147916 A-147918 147920A- A-147922 A-147924 A-147926 A-147928 A-147930 A-147932 A-147934 A-147936 A-147938 A-147940 A-147942 A-147944 A-147946 A-147948 A-147950 A-147952 TABLE6-continued UnmodifiedSenseandAntisenseStrandSequencesofIGFALSdsRNAS Range 1332-1350 1342-1360 1355-1373 1364-1382 1375-1393 14061388- 1399-1417 1408-1426 1420-1438 1432-1450 1442-1460 1454-1472 14831465- 14921474- 1485-1503 1496-1514 1507-1525 15371519- 1529-1547 1541-1559 1553-1571 1564-1582 1575-1593

SEQ ID NO 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 Senseoligosequence CAAGGACAACGGCCUCGUA GGCCUCGUGGGCAUUGAGA UUGAGGAGCAGAGCCUGUA AGAGCCUGUGGGGGCUGGA GGGCUGGCGGAGCUGCUGA UGCUGGAGCUCGACCUGAA GACCUGACCUCCAACCAGA UCCAACCAGCUCACGCACA ACGCAccucccccAccGCA CACCGCCUCUUCCAGGGCA UCCAGGGCCUGGGCAAGCU GCAAGCUGGAGUACCUGCU UACCUGCUGCUCUCCCGCA CUCUCCCGCAACCGCCUGA CCGCCUGGCAGAGCUGCCA AGCUGCCGGCGGACGCCCU GACGCCCUGGGCCCCCUGA CCCCUGCAGCGGGCCUUCU GGGCCUUCUGGCUGGACGU UGGACGUCUCGCACAACCA ACAACCGCCUGGAGGCAUU GAGGCAUUGCCCAACAGCA CAACAGCCUCUUGGCACCA

Sense Oligo Name A-147907 A-147909 A-147911 A-147913 A-147915 A-147917 A-147919 A-147921 A-147923 A-147925 A-147927 A-147929 A-147931 A-147933 A-147935 A-147937 A-147939 A-147941 A-147943 A-147945 A-147947 A-147949 A-147951

Duplex Name AD-73881 AD-73882 AD-73883 AD-73884 AD-73885 AD-73886 AD-73887 AD-73888 AD-73889 AD-73890 AD-73891 AD-73892 AD-73893 AD-73894 AD-73895 AD-73896 AD-73897 AD-73898 AD-73899 AD-73900 AD-73901 AD-73902 AD-73903 US 2018 /0201929 A1 Jul. 19 , 2018 28

SEQIDNO:1 Rangein 1585-1603 1595-1613 1606-1624 1619-1637 1629-1647 1639-1657 1651-1669 1661-1679 1672-1690 1684-1702 1694-1712 1705-1723 1718-1736 1729-1747 1738-1756 1749-1767 1761-1779 1773-1791 1783-1801 1795-1813 1805-1823 1816-1834 1828-1846 1838-1856

SEQ ID NO 581 582 5830 584 585 586 587 588 5890 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 Antisenseoligosequence UCCGCCCCAGUGGUGCCAA AGGUAGCGCAGCCGCCCCA UCCUGAGGCUGAGGUAGCG UGCAGUGAGUUGUUCCUGA UGUGAAGGUCCGCAGUGAG UGGGCUGCGGCGUGAAGGU UCUCCAGGCCCGGGGGCUG AGCCACAGGCGCUCCAGGC UGUUACCCUCCAGCCACAG UACAGUCCCAGGGGUUACC AGAGGGCAGCCACAGUCCC UCAGCGCCUUGAGAGGGCA AGGGCGAAGUCCCGCAGCG UGGGGUUCUGCAGGGCGAA UCACAGCACUGGGGUUCUG UACGAAGCGGGGCACAGCA ACAGAUGGCCUGGACGAAG AUCGUCCCCCUCACAGAUG UCGGCUGGCAAUCGUCCCC AGGUGUACGCGGGCGGCUG AUGUUGUUGUAGGUGUACG UGGCACAGGUGAUGUUGUU UCUCGGGCGGGCUGGCACA AGCCCCACGACCUCGGGCG

Antisense Oligo Name A-147954 A-147956 A-147958 A-147960 A-147962 A-147964 A-147966 A-147968 A-147970 A-147972 A-147974 A-147976 A-147978 A-147980 A-147982 A-147984 A-147986 A-147988 A-147990 A-147992 A-147994 A-147996 A-147998 A-148000 TABLE6-continued UnmodifiedSenseandAntisenseStrandSequencesofIGFALSdsRNAS Range 1585-1603 1595-1613 1606-1624 1619-1637 1629-1647 16571639- 1651-1669 1661-1679 1672-1690 1684-1702 1694-1712 1705-1723 1718-1736 1729-1747 1738-1756 1749-1767 1761-1779 1773-1791 18011783- 1795-1813 18231805- 1816-1834 1828-1846 1838-1856

SEQ ID NO 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413413 414 415 416 417 418 419419 Senseoligosequence UUGGCACCACUGGGGCGGA UGGGGCGGCUGCGCUACCU CGCUACCUCAGCCUCAGGA UCAGGAACAACUCACUGCA CUCACUGCGGACCUUCACA ACCUUCACGCCGCAGCCCA CAGCCCCCGGGCCUGGAGA GCCUGGAGCGCCUGUGGCU CUGUGGCUGGAGGGUAACA GGUAACCCCUGGGACUGUA GGGACUGUGGCUGCCCUCU UGCCCUCUCAAGGCGCUGA CGCUGCGGGACUUCGCCCU UUCGCCCUGCAGAACCCCA CAGAACCCCAGUGCUGUGA UGCUGUGCCCCGCUUCGUA CUUCGUCCAGGCCAUCUGU CAUCUGUGAGGGGGACGAU GGGGACGAUUGCCAGCCGA CAGCCGCCCGCGUACACCU CGUACACCUACAACAACAU AACAACAUCACCUGUGCCA UGUGCCAGCCCGCCCGAGA CGCCCGAGGUCGUGGGGCU

Sense Oligo Name A-147953 A-147955 A-147957 A-147959 A-147961 A-147963 A-147965 A-147967 A-147969 A-147971 A-147973 A-147975 A-147977 A-147979 A-147981 A-147983 A-147985 A-147987 A-147989 A-147991 A-147993 A-147995 A-147997 A-147999

Duplex Name AD-73904 AD-73905 AD-73906 AD-73907 AD-73908 AD-73909 AD-73910 AD-73911 AD-73912 AD-73913 AD-73914 AD-73915 AD-73916 AD-73917 AD-73918 AD-73919 AD-73920 AD-73921 AD-73922 AD-73923 AD-73924 AD-73925 AD-73926 AD-73927 US 2018 /0201929 A1 Jul. 19 , 2018

SEQIDNO:1 Rangein 1848-1866 1859-1877 1871-1889 1883-1901 19101892- 19231905- 1915-1933 1927-1945 1937-1955 1949-1967 1959-1977 1969-1987 1981-1999 1993-2011 2002-2020 2013-2031 2024-2042 20542036- 2048-2066 2059-2077 2070-2088

SEQ ID NO 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 Antisenseoligosequence UCGCAGGUCGAGCCCCACG UCGCUGAGGUCCCGCAGGU UCAAAGUGGGCCUCGCUGA UGUCAGCAGGGAGCAAAGU UGGGGACCUGGUCAGCAGG UGGGGCUUGAGUCCGGGGA UGCCUGAGUCCGGGGCUUG UAGCCAGGUGGGGGCCUGA AGCACAAGGUGAGCCAGGU UGACCUGUCCCCAGCACAA AGGACACUGAGGACCUGUC UAGGCCCCUGAGGACACUG AAGUGCACUGGGCAGGCCC UCGUCUUCCAGCAAGUGCA UAGGCCCUUGCGUCUUCCA UUCCACCCCAUCAGGCCCU UCCGCCAUGCCUUCCACCC ACAGCUGGGGGGGCCGCCA CUUUAAUUGAUGACAGCUG AUUGCCUUUGCCUUUAAUU UUUUAGAUUCGAUUGCCUU

Antisense Oligo Name A-148002 A-148004 A-148006 A-148008 A-148010 A-148012 A-148014 A-148016 A-148018 A-148020 A-148022 A-148024 A-148026 A-148028 A-148030 A-148032 A-148034 A-148036 A-148038 A-148040 A-148042 TABLE6-continued UnmodifiedSenseandAntisenseStrandSequencesofIGFALSdsRNAS Range 1848-1866 1859-1877 1871-1889 1883-1901 19101892- 1905-1923 1915-1933 1927-1945 1937-1955 1949-1967 1959-1977 19871969- 1981-1999 1993-2011 2002-2020 2013-2031 2024-2042 2036-2054 2048-2066 2059-2077 20882070-

SEQ ID NO 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 Senseoligosequence CGUGGGGCUCGACCUGCGA ACCUGCGGGACCUCAGCGA UCAGCGAGGCCCACUUUGA ACUUUGCUCCCUGCUGACA CCUGCUGACCAGGUCCCCA UCCCCGGACUCAAGCCCCA CAAGCCCCGGACUCAGGCA UCAGGCCCCCACCUGGCUA ACCUGGCUCACCUUGUGCU UUGUGCUGGGGACAGGUCA GACAGGUCCUCAGUGUCCU CAGUGUCCUCAGGGGCCUA GGGCCUGCCCAGUGCACUU UGCACUUGCUGGAAGACGA UGGAAGACGCAAGGGCCUA AGGGCCUGAUGGGGUGGAA GGGUGGAAGGCAUGGCGGA UGGCGGCCCCCCCAGCUGU CAGCUGUCAUCAAUUAAAG AAUUAAAGGCAAAGGCAAU AAGGCAAUCGAAUCUAAAA

Sense Oligo Name A-148001 A-148003 A-148005 A-148007 A-148009 A-148011 A-148013 A-148015 A-148017 A-148019 A-148021 148023A- A-148025 A-148027 A-148029 A-148031 A-148033 A-148035 A-148037 A-148039 A-148041

Duplex Name AD-73928 AD-73929 AD-73930 AD-73931 AD-73932 AD-73933 AD-73934 AD-73935 AD-73936 AD-73937 AD-73938 AD-73939 AD-73940 AD-73941 AD-73942 AD-73943 AD-73944 AD-73945 AD-73946 AD-73947 AD-73948 US 2018 /0201929 A1 Jul. 19 , 2018

TABLE 7 TABLE 7 - continued Human IGFALS Dual -Glo ® in vitro 10 nM screen Human IGFALS Dual- Glo ? in vitro 10 nM screen Duplex Name Average 10 nM STDEV 10 nM Duplex Name Average 10 nM STDEV 10 nM AD - 73764 46 . 26 12 .94 AD - 73837 43. 30 9 . 38 AD - 73765 15 . 98 9 . 39 AD - 73838 74 . 76 20 . 65 AD - 73766 27. 71 1 . 81 AD - 73839 78 . 85 7 . 72 AD - 73767 29 . 96 5 . 64 AD - 73840 43. 78 12 . 13 AD - 73768 53 .53 15 . 85 AD - 73841 40 . 30 13 . 20 AD - 73769 50 . 94 18 . 08 AD - 73842 43. 45 1 . 12 AD - 73770 35 . 55 11. 71 AD - 73843 47 .08 8 . 45 AD - 73771 30 .07 11 . 32 AD - 73844 110 . 22 43 .07 AD - 73772 33 .23 3 . 56 AD - 73845 53. 10 20 .78 AD - 73773 11 . 46 4 . 14 AD - 73846 100 . 03 52. 61 AD - 73774 58 .80 12 . 47 AD - 73847 59 . 82 19 . 09 AD - 73775 108 . 20 18 .60 AD - 73848 26 .03 3 . 83 AD - 73776 51. 88 20 . 74 AD - 73849 38 . 45 7 . 00 AD - 73777 30 .64 7 . 39 AD - 73850 86 .08 20 . 23 AD - 73778 81. 00 19 . 34 AD - 73851 61 .41 7 .67 AD - 73779 78 . 23 16 . 91 AD - 73852 53 . 33 19 . 36 AD - 73780 67 . 63 20 . 32 AD - 73853 85 . 67 29 . 83 AD - 73781 75 . 04 41. 97 AD - 73854 54 . 76 5 .66 AD - 73782 11 . 25 3 . 14 AD - 73855 104 .89 36 . 39 AD - 73783 84 .25 27 . 48 AD - 73856 57 . 24 13. 36 AD - 73784 31 . 16 3 . 50 AD - 73857 63 . 18 12 . 14 AD - 73785 40 . 36 15 . 91 AD - 73858 20 . 59 3 . 73 AD - 73786 26 . 61 4 . 91 AD - 73859 42 . 26 7 .68 AD - 73787 37 .73 13. 41 AD - 73860 94 .01 20 . 91 AD - 73788 41. 39 9 . 64 AD - 73861 45 .90 18 . 39 AD - 73789 69 .70 17 . 02 AD - 73862 26 . 77 5 . 70 AD - 73790 54 . 70 18 . 10 AD - 73863 39 . 07 19 . 21 AD - 73791 37 . 77 14 . 31 AD - 73864 59 . 26 14 . 59 AD - 73792 59 . 22 4 . 58 AD - 73865 41. 82 10 . 07 AD - 73793 30 .72 11 . 33 AD - 73866 60 . 91 19 . 05 AD - 73794 96 .09 23. 63 AD - 73867 35 . 80 9 . 83 AD - 73795 27 . 15 4 . 14 AD - 73868 46 .58 6 . 40 AD - 73796 44 . 57 8 . 83 AD - 73869 64 . 22 11 . 51 AD - 73797 22 . 69 5 . 07 AD - 73870 80 . 14 7 . 20 AD - 73798 52 . 76 11 . 72 AD - 73871 60 . 16 20 . 80 AD - 73799 69 . 71 10 . 21 AD - 73872 56 .05 24 . 26 AD - 73800 49 . 18 17 . 49 AD - 73873 68 . 99 18. 51 AD - 73801 59 . 80 17 . 00 AD - 73874 110 . 04 18 . 69 AD - 73802 28 . 96 1 .45 AD - 73875 45 . 34 19 . 36 AD - 73803 33 . 13 19 . 76 AD - 73876 51. 41 17 . 32 AD - 73804 40 . 68 7 .80 AD - 73877 48 . 52 10 . 40 AD - 73805 63. 69 6 . 82 AD - 73878 114 . 98 63 . 70 AD - 73806 66 .25 14 . 80 AD - 73879 60 . 09 8 . 24 AD - 73807 48 .62 17 . 85 AD - 73880 38 . 19 8 . 87 AD - 73808 25 . 07 4 . 32 AD - 73881 74 .45 6 .60 AD - 73809 68 .40 17 . 86 AD - 73882 33 . 01 9 . 79 AD - 73810 83. 96 14 . 19 AD - 73883 34 . 58 16 . 31 AD - 73811 64 . 13 17 . 42 AD - 73884 53. 88 4 . 17 AD - 73812 46 . 66 9 .77 AD - 73885 40 . 86 12 . 23 AD - 73813 44 . 50 17 . 35 AD - 73886 48 .81 15 . 26 AD - 73814 63. 89 24 . 44 AD - 73887 100 .05 43. 02 AD - 73815 52 . 18 19 . 16 AD - 73888 52 . 76 9 . 03 AD - 73816 46 . 10 24 . 18 AD - 73889 104 .07 24 . 09 AD - 73817 47 . 24 12 .69 AD - 73890 34 . 25 10 . 25 AD - 73818 26 .52 4 . 62 AD - 73891 59 .05 17 . 53 AD - 73819 48 .75 11 . 37 AD - 73892 43 . 11 18 . 36 AD - 73820 60 . 19 5 . 23 AD - 73893 74 . 85 51. 34 AD - 73821 94 . 35 26 . 80 AD - 73894 71 . 46 42 . 74 AD - 73822 84 . 38 36 . 20 AD - 73895 67. 51 15 . 16 AD - 73823 40 .82 16 . 47 AD - 73896 65 . 38 19 . 16 AD - 73824 73 . 14 20 . 30 AD - 73897 113. 90 19 . 73 AD - 73825 28 .56 4 . 59 AD - 73898 30 . 88 11. 29 AD - 73826 46 .85 5 . 02 AD - 73899 71 . 21 20 .59 AD - 73827 47 .58 13 . 90 AD - 73900 45 .87 8 . 22 AD - 73828 63 .46 15 . 46 AD - 73901 81 . 14 27 . 00 AD - 73829 95 . 35 32. 53 AD - 73902 57. 98 26 . 64 AD - 73830 58 .41 9 .47 AD - 73903 60 . 87 50 . 48 AD - 73831 76 . 16 9 . 56 AD - 73904 144 .84 56 .92 AD - 73832 66 .65 24 . 27 AD - 73905 80 . 06 7 .93 AD - 73833 48 .53 16 . 86 AD - 73906 25 .22 6 . 98 AD - 73834 61. 65 17 .68 AD - 73907 33 .52 8 . 04 AD - 73835 58 . 15 28 . 49 AD - 73908 88 . 78 21. 09 AD -73836 26 . 15 4 .79 AD - 73909 94 . 23 19 . 36 US 2018 /0201929 A1 Jul. 19 , 2018 90

TABLE 7 - continued TABLE 7 - continued Human IGFALS Dual- Glo ® in vitro 10 nM screen Human IGFALS Dual -Glo ® in vitro 10 nM screen Duplex Name Average 10 nM STDEV 10 nM Duplex Name Average 10 nM STDEV 10 nM AD - 73910 106 . 31 18. 12 AD - 73931 36 .71 9 . 74 AD - 73911 64 . 23 4 . 10 AD - 73932 37 .09 6 . 54 AD - 73912 25 .25 5 . 85 54 . 60 14 . 50 AD - 73913 42 . 38 3 . 07 AD - 73933 AD - 73914 38 . 34 6 .64 AD -73934 188 . 17 65 . 46 AD - 73915 61 . 19 28 . 72 AD - 73935 77. 02 12. 48 AD - 73916 71 . 86 28 .39 AD - 73936 71 . 96 24 .59 AD - 73917 95 . 24 18 . 35 AD - 73937 48 . 37 18 . 42 AD - 73918 80 .25 27 . 23 AD - 73938 47 . 06 6 . 65 AD - 73919 48 .91 6 . 14 AD - 73939 55 . 62 19 . 17 AD - 73920 39 .40 11 . 01 AD - 73940 74 . 83 6 . 45 AD - 73921 57 . 14 12 . 93 AD - 73941 41 . 91 18 . 36 AD - 73922 45 . 90 21. 00 AD - 73942 87 . 02 43 . 38 AD - 73923 56 .04 18 . 98 AD - 73943 47 .56 6 .76 AD - 73924 28 . 94 7 . 49 AD - 73944 39 . 62 7 . 36 AD - 73925 58 .43 28 . 38 61. 45 AD - 73926 102. 32 34 . 13 AD - 73945 10 . 10 AD - 73927 100 .65 27 . 38 AD - 73946 16 .22 4 . 18 AD - 73928 85 .51 11. 58 AD -73947 17 . 27 8 . 22 AD - 73929 51 . 54 4 . 93 AD - 73948 33 .62 7 .51 AD -73930 27 . 83 6 . 80 US 2018 /0201929 A1 Jul. 19 , 2018

SEQ ID 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 MRNAtargetsequence AGGGCAGGGGUGGCCGGCA CCGGCACAGCAGACGUACC AGACGUACCCUCCCUCGCU UCCCUCGCUGCCUGCCUGC UGCCUGCAGCCUGCCCUGC UGCCCUGCAUGCAGGAUGG AGGAUGGCCCUGAGGAAAG CUGAGGAAAGGAGGCCUGG AGGCCUGGCCCUGGCGCUG GCGCUGCUGCUGCUGUCCU UGCUGUCCUGGGUGGCACU UGGCACUGGGCCCCCGCAG GCCCCCGCAGCCUGGAGGG UGGAGGGAGCAGACCCCGG AGACCCCGGAACGCCGGGG CGCCGGGGGAAGCCGAGGG CGAGGGCCCAGCGUGCCCG AGCGUGCCCGGCCGCCUGU GCCUGUGUCUGCAGCUACG UGCAGCUACGAUGACGACG GACGACGCGGAUGAGCUCA AUGAGCUCAGCGUCUUCUG UCUUCUGCAGCUCCAGGAA SEQ ID 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 AntisenseOligoSeq UGCCGGCCACCCCUGCCCULTAT UGUACGUCUGCUGUGCCGGATAT AGCGAGGGAGGGUACGUCULTAT UCAGGCAGGCAGCGAGGGADTAT UCAGGGCAGGCUGCAGGCATAT UCAUCCUGCAUGCAGGGCAdTAT CUUUCCUCAGGGCCAUCCULTAT UCAGGCCUCCUUUCCUCAGATAT UAGCGCCAGGGCCAGGCCULTAT AGGACAGCAGCAGCAGCGCATAT AGUGCCACCCAGGACAGCATAT UUGCGGGGGCCCAGUGCCATAT UCCUCCAGGCUGCGGGGGCATAT UCGGGGUCUGCUCCCUCCANTAT UCCCGGCGUUCCGGGGUCULTAT UCCUCGGCUUCCCCCGGCGATAT UGGGCACGCUGGGCCCUCGATOT ACAGGCGGCCGGGCACGCULTAT UGUAGCUGCAGACACAGGCATAT UGUCGUCAUCGUAGCUGCANTAT UGAGCUCAUCCGCGUCGUCATAT UAGAAGACGCUGAGCUCAULTAT UUCCUGGAGCUGCAGAAGADTAT TABLE8 ModifiedSenseandAntisenseStrandSequencesofIGFALSdsRNAS Antisense Oligo Name A-147668 A-147670 A-147672 A-147674 A-147676 A-147678 147680A- A-147682 A-147684 A-147686 A-147688 A-147690 A-147692 A-147694 A-147696 A-147698 A-147700 A-147702 A-147704 A-147706 A-147708 A-147710 A-147712

SEQ ID 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 SenseOligoSequence AGGGCAGGGGUGGCCGGCAdTAT CCGGCACAGCAGACGUACATAT AGACGUACCCUCCCUCGCUSTAT UCCCUCGCUGCCUGCCUGATAT UGCCUGCAGCCUGCCCUGADTAT UGCCCUGCAUGCAGGAUGASTAT AGGAUGGCCCUGAGGAAAGATAT CUGAGGAAAGGAGGCCUGADTAT AGGCCUGGCCCUGGCGCUANTOT GCGCUGCUGCUGCUGUCCUSTAT UGCUGUCCUGGGUGGCACULTAT UGGCACUGGGCCCCCGCAATAT GCCCCCGCAGCCUGGAGGADTAT UGGAGGGAGCAGACCCCGATOT AGACCCCGGAACGCCGGGADTAT CGCCGGGGGAAGCCGAGGADTAT CGAGGGCCCAGCGUGCCCATAT AGCGUGCCCGGCCGCCUGUSTAT GCCUGUGUCUGCAGCUACATAT UGCAGCUACGAUGACGACASTAT GACGACGCGGAUGAGCUCANTAT AUGAGCUCAGCGUCUUCUALTAT UCUUCUGCAGCUCCAGGAASTAT Sense Oligo Name A-147667 A-147669 A-147671 A-147673 A-147675 A-147677 A-147679 A-147681 A-147683 A-147685 A-147687 A-147689 A-147691 A-147693 A-147695 A-147697 A-147699 A-147701 147703-A A-147705 A-147707 A-147709 A-147711

Duplex Name AD-73764 AD-73765 AD-73766 AD-73767 AD-73768 AD-73769 AD-73770 AD-73771 AD-73772 AD-73773 AD-73774 AD-73775 AD-73776 AD-73777 AD-73778 AD-73779 AD-73780 AD-73781 73782AD- AD-73783 AD-73784 AD-73785 AD-73786 US 2018 /0201929 A1 Jul. 19 , 2018 66

SEO ID 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 MRNAtargetsequence UCCAGGAACCUCACGCGCC UCACGCGCCUGCCUGAUGG UGAUGGAGUCCCGGGCGGC CGGGCGGCACCCAAGCCCU CAAGCCCUGUGGCUGGACG UGGCUGGACGGCAACAACC AACAACCUCUCGUCCGUCC UCCGUCCCCCCGGCAGCCU CGGCAGCCUUCCAGAACCU CAGAACCUCUCCAGCCUGG AGCCUGGGCUUCCUCAACC UUCCUCAACCUGCAGGGCG CAGGGCGGCCAGCUGGGCA AGCUGGGCAGCCUGGAGCC CUGGAGCCACAGGCGCUGC CGCUGCUGGGCCUAGAGAA CUAGAGAACCUGUGCCACC UGUGCCACCUGCACCUGGA ACCUGGAGCGGAACCAGCU AACCAGCUGCGCAGCCUGG CGCAGCCUGGCACUCGGCA UCGGCACGUUUGCACACAC UUGCACACACGCCCGCGCU SEQ ID 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 AntisenseoligoSeq UGCGCGUGAGGUUCCUGGADTAT UCAUCAGGCAGGCGCGUGADTAT UCCGCCCGGGACUCCAUCASTAT AGGGCUUGGGUGCCGCCCGSTAT UGUCCAGCCACAGGGCUUGATOT UGUUGUUGCCGUCCAGCCANTAT UGACGGACGAGAGGUUGUULTAT AGGCUGCCGGGGGGACGGADTAT AGGUUCUGGAAGGCUGCCGATOT UCAGGCUGGAGAGGUUCUGATT UGUUGAGGAAGCCCAGGCULTAT UGCCCUGCAGGUUGAGGAASTAT UGCCCAGCUGGCCGCCCUGATAT UGCUCCAGGCUGCCCAGCULTAT UCAGCGCCUGUGGCUCCAGATAT UUCUCUAGGCCCAGCAGCGATAT UGUGGCACAGGUUCUCUAGATAT UCCAGGUGCAGGUGGCACATAT AGCUGGUUCCGCUCCAGGUATAT UCAGGCUGCGCAGCUGGUUNTAT UGCCGAGUGCCAGGCUGCGATAT UUGUGUGCAAACGUGCCGADTAT AGCGCGGGCGUGUGUGCAAdTAT TABLE8-continued ModifiedSenseandAntisenseStrandSequencesofIGFALSdsRNAS Antisense Oligo Name A-147714 A-147716 A-147718 A-147720 A-147722 A-147724 A-147726 A-147728 A-147730 A-147732 A-147734 A-147736 A-147738 A-147740 A-147742 A-147744 A-147746 A-147748 A-147750 A-147752 A-147754 A-147756 A-147758

SEQ ID 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 SenseOligoSequence UCCAGGAACCUCACGCGCANTAT UCACGCGCCUGCCUGAUGASTAT UGAUGGAGUCCCGGGCGGADTAT cGGGCGGCACCCAAGcccu???? CAAGCCCUGUGGCUGGACASTOT UGGCUGGACGGCAACAACAATAT AACAACCUCUCGUCCGUCATAT UCCGUCCCCCCGGCAGCCULTAT CGGCAGCCUUCCAGAACCULTAT CAGAACCUCUCCAGCCUGATAT AGCCUGGGCUUCCUCAACAATAT UUCCUCAACCUGCAGGGCANTAT CAGGGCGGCCAGCUGGGCANTAT AGCUGGGCAGCCUGGAGCASTAT CUGGAGCCACAGGCGCUGADTAT CGCUGCUGGGCCUAGAGAAdTAT CUAGAGAACCUGUGCCACANTAT UGUGCCACCUGCACCUGGADTAT ACCUGGAGCGGAACCAGCULTAT AACCAGCUGCGCAGCCUGADTAT CGCAGCCUGGCACUCGGCAATAT UCGGCACGUUUGCACACAASTAT UUGCACACACGCCCGCGCUSTAT Sense Oligo Name A-147713 A-147715 A-147717 A-147719 A-147721 A-147723 A-147725 A-147727 A-147729 A-147731 A-147733 A-147735 A-147737 A-147739 A-147741 A-147743 A-147745 A-147747 A-147749 A-147751 A-147753 A-147755 A-147757

Duplex Name AD-73787 AD-73788 AD-73789 AD-73790 AD-73791 AD-73792 AD-73793 AD-73794 AD-73795 AD-73796 AD-73797 AD-73798 AD-73799 AD-73800 AD-73801 AD-73802 AD-73803 AD-73804 AD-73805 AD-73806 AD-73807 AD-73808 AD-73809 US 2018 /0201929 A1 Jul. 19 , 2018 6

SEQ 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 mRNAtargetsequence CCCGCGCUGGCCUCGCUCG UCGCUCGGCCUCAGCAACA AGCAACAACCGUCUGAGCA CUGGAGGACGGGCUCUUCG CUCUUCGAGGGCCUCGGCA GGCCUCGGCAGCCUCUGGG UCUGGGACCUCAACCUCGG AACCUCGGCUGGAAUAGCC UGGAAUAGCCUGGCGGUGC CGGUGCUCCCCGAUGCGGC GAUGCGGCGUUCCGCGGCC UUCCGCGGCCUGGGCAGCC GCAGCCUGCGCGAGCUGGU GAGCUGGUGCUGGCGGGCA CUGGCGGGCAACAGGCUGG AGGCUGGCCUACCUGCAGC ACCUGCAGCCCGCGCUCUU CGCUCUUCAGCGGCCUGGC CGGCCUGGCCGAGCUCCGG AGCUCCGGGAGCUGGACCU CUGGACCUGAGCAGGAACG AGGAACGCGCUGCGGGCCA CGGGCCAUCAAGGCAAACG AAGGCAAACGUGUUCGUGC SEQ ID 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 AntisenseOligoSeq UGAGCGAGGCCAGCGCGGGSTAT UGUUGCUGAGGCCGAGCGADTAT UGCUCAGACGGUUGUUGCULTAT UGAAGAGCCCGUCCUCCAGATAT UGCCGAGGCCCUCGAAGAGATAT UCCAGAGGCUGCCGAGGCCATAT UCGAGGUUGAGGUCCCAGADTAT UGCUAUUCCAGCCGAGGUULTAT UCACCGCCAGGCUAUUCCANTAT UCCGCAUCGGGGAGCACCGATAT UGCCGCGGAACGCCGCAUCATAT UGCUGCCCAGGCCGCGGAAdTAT ACCAGCUCGCGCAGGCUG????? UGCCCGCCAGCACCAGCUCITAT UCAGCCUGUUGCCCGCCAGATAT UCUGCAGGUAGGCCAGCCULTAT AAGAGCGCGGGCUGCAGGUATAT UCCAGGCCGCUGAAGAGCGATAT UCGGAGCUCGGCCAGGCCGATAT AGGUCCAGCUCCCGGAGCULTAT UGUUCCUGCUCAGGUCCAGATAT UGGCCCGCAGCGCGUUCCULTAT UGUUUGCCUUGAUGGCCCGATAT UCACGAACACGUUUGCCUUNTAT TABLE8-continued ModifiedSenseandAntisenseStrandSequencesofIGFALSdsRNAS Antisense Oligo Name A-147760 A-147762 A-147764 A-147768 A-147770 A-147772 A-147774 A-147776 A-147778 A-147780 A-147782 A-147784 A-147786 A-147788 A-147790 A-147792 A-147794 A-147796 A-147798 A-147800 A-147802 A-147804 A-147806 A-147808

SEQ ID 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 SenseOligoSequence CCCGCGCUGGCCUCGCUCATAT UCGCUCGGCCUCAGCAACAATAT AGCAACAACCGUCUGAGCAdTAT CUGGAGGACGGGCUCUUCATAT CUCUUCGAGGGCCUCGGCAdTAT GGCCUCGGCAGCCUCUGGADTAT UCUGGGACCUCAACCUCGAATAT AACCUCGGCUGGAAUAGCANTAT UGGAAUAGCCUGGCGGUGADTAT CGGUGCUCCCCGAUGCGGADTAT GAUGCGGCGUUCCGCGGCANTAT UUCCGCGGCCUGGGCAGCANTAT GCAGCCUGCGCGAGCUGGULTAT GAGCUGGUGCUGGCGGGCAdTdt CUGGCGGGCAACAGGCUGADTAT AGGCUGGCCUACCUGCAGADTAT ACCUGCAGCCCGCGCUCUUSTAT CGCUCUUCAGCGGCCUGGADTAT CGGCCUGGCCGAGCUCCGADTAT AGCUCCGGGAGCUGGACCULTAT CUGGACCUGAGCAGGAACANTAT AGGAACGCGCUGCGGGCCATAT CGGGCCAUCAAGGCAAACANTAT AAGGCAAACGUGUUCGUGADTAT Sense Oligo Name A-147759 A-147761 A-147763 A-147767 A-147769 A-147771 A-147773 A-147775 A-147777 A-147779 A-147781 A-147783 A-147785 A-147787 A-147789 A-147791 A-147793 A-147795 A-147797 A-147799 A-147801 A-147803 A-147805 A-147807

Duplex Name AD-73810 AD-73811 AD-73812 AD-73813 AD-73814 AD-73815 AD-73816 AD-73817 AD-73818 73819AD- AD-73820 AD-73821 AD-73822 AD-73823 AD-73824 AD-73825 AD-73826 AD-73827 AD-73828 AD-73829 AD-73830 AD-73831 AD-73832 AD-73833 US 2018 /0201929 A1 Jul. 19 , 2018 94

SEO ID 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 MRNAtargetsequence UUCGUGCAGCUGCCCCGGC AGAAACUCUACCUGGACCG CCUGGACCGCAACCUCAUC CCUCAUCGCUGCCGUGGCC CGUGGCCCCGGGCGCCUUC GGCGCCUUCCUGGGCCUGA UGGGCCUGAAGGCGCUGCG CGCUGCGAUGGCUGGACCU UGGACCUGUCCCACAACCG CACAACCGCGUGGCUGGCC UGGCUGGCCUCCUGGAGGA CCUGGAGGACACGUUCCCC UUCCCCGGUCUGCUGGGCC UGCUGGGCCUGCGUGUGCU CGUGUGCUGCGGCUGUCCC CUGUCCCACAACGCCAUCG AACGCCAUCGCCAGCCUGC AGCCUGCGGCCCCGCACCU CGCACCUUCAAGGACCUGC AAGGACCUGCACUUCCUGG UUCCUGGAGGAGCUGCAGC CUGCAGCUGGGCCACAACC CCACAACCGCAUCCGGCAG SEQ ID 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 AntisenseoligoSeq UCCGGGGCAGCUGCACGAASTAT UGGUCCAGGUAGAGUUUCULTAT UAUGAGGUUGCGGUCCAGGATAT UGCCACGGCAGCGAUGAGGSTAT UAAGGCGCCCGGGGCCACGATAT UCAGGCCCAGGAAGGCGCCATAT UGCAGCGCCUUCAGGCCCATAT AGGUCCAGCCAUCGCAGCGATAT UGGUUGUGGGACAGGUCCANTAT UGCCAGCCACGCGGUUGUGATAT UCCUCCAGGAGGCCAGCCANTAT UGGGAACGUGUCCUCCAGGATAT UGCCCAGCAGACCGGGGAASTAT AGCACACGCAGGCCCAGCATAT UGGACAGCCGCAGCACACGATAT UGAUGGCGUUGUGGGACAGATAT UCAGGCUGGCGAUGGCGUUSTAT AGGUGCGGGGCCGCAGGCULTAT UCAGGUCCUUGAAGGUGCGATT UCAGGAAGUGCAGGUCCUUSTAT UCUGCAGCUCCUCCAGGAASTAT UGUUGUGGCCCAGCUGCAGATAT UUGCCGGAUGCGGUUGUGGATAT TABLE8-continued ModifiedSenseandAntisenseStrandSequencesofIGFALSdsRNAS Antisense Oligo Name A-147810 A-147814 A-147816 A-147818 A-147820 A-147822 A-147824 A-147826 A-147828 A-147830 A-147832 A-147834 A-147836 A-147838 A-147840 A-147842 A-147844 A-147846 A-147848 A-147850 A-147852 A-147854 A-147856

SEQ ID 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 SenseOligoSequence UUCGUGCAGCUGCCCCGGADTAT AGAAACUCUACCUGGACCATAT CCUGGACCGCAACCUCAUANTAT CCUCAUCGCUGCCGUGGCASTOT CGUGGCCCCGGGCGCCUUASTAT GGCGCCUUCCUGGGCCUGADTAT UGGGCCUGAAGGCGCUGCAATAT CGCUGCGAUGGCUGGACCULTAT UGGACCUGUCCCACAACCATAT CACAACCGCGUGGCUGGCANTAT UGGCUGGCCUCCUGGAGGADTAT CCUGGAGGACACGUUCCCANTAT UUCCCCGGUCUGCUGGGCATAT UGCUGGGCCUGCGUGUGCULTAT CGUGUGCUGCGGCUGUCCATAT CUGUCCCACAACGCCAUCANTAT AACGCCAUCGCCAGCCUGATOT AGCCUGCGGCCCCGCACCULTAT CGCACCUUCAAGGACCUGATAT AAGGACCUGCACUUCCUGADTAT UUCCUGGAGGAGCUGCAGADTAT CUGCAGCUGGGCCACAACAATAT CCACAACCGCAUCCGGCAASTAT Sense Oligo Name A-147809 A-147813 A-147815 A-147817 A-147819 A-147821 A-147823 A-147825 A-147827 A-147829 A-147831 A-147833 A-147835 A-147837 A-147839 A-147841 A-147843 A-147845 A-147847 A-147849 A-147851 A-147853 A-147855

Duplex Name AD-73834 AD-73835 AD-73836 AD-73837 AD-73838 AD-73839 AD-73840 AD-73841 AD-73842 AD-73843 AD-73844 AD-73845 AD-73846 AD-73847 AD-73848 AD-73849 AD-73850 AD-73851 AD-73852 AD-73853 AD-73854 AD-73855 AD-73856 US 2018 /0201929 A1 Jul. 19 , 2018 S6

SEQ ID 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 mRNAtargetsequence UCCGGCAGCUGGCUGAGCG UGGCUGAGCGCAGCUUUGA AGCUUUGAGGGCCUGGGGC UGGGGCAGCUUGAGGUGCU UUGAGGUGCUCACGCUAGA ACGCUAGACCACAACCAGC AACCAGCUCCAGGAGGUCA AGGAGGUCAAGGCGGGCGC CGGGCGCUUUCCUCGGCCU CUCGGCCUCACCAACGUGG AACGUGGCGGUCAUGAACC UCAUGAACCUCUCUGGGAA UCUGGGAACUGUCUCCGGA UCUCCGGAACCUUCCGGAG UUCCGGAGCAGGUGUUCCG GGUGUUCCGGGGCCUGGGC CUGGGCAAGCUGCACAGCC UGCACAGCCUGCACCUGGA CAGCUGCCUGGGACGCAUC GACGCAUCCGCCCGCACAC CGCACACCUUCACCGGCCU UCACCGGCCUCUCGGGGCU UCGGGGCUCCGCCGACUCU CGACUCUUCCUCAAGGACA SEQ ID 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 AntisenseOligoSeq UGCUCAGCCAGCUGCCGGADTAT UCAAAGCUGCGCUCAGCCANTAT UCCCCAGGCCCUCAAAGCULTAT AGCACCUCAAGCUGCCCCATAT UCUAGCGUGAGCACCUCAAdTAT UCUGGUUGUGGUCUAGCGUSTAT UGACCUCCUGGAGCUGGUUSTOT UCGCCCGCCUUGACCUCCULTAT AGGCCGAGGAAAGCGCCCGATAT UCACGUUGGUGAGGCCGAGATAT UGUUCAUGACCGCCACGUUNTAT UUCCCAGAGAGGUUCAUGASTAT UCCGGAGACAGUUCCCAGADTAT UUCCGGAAGGUUCCGGAGADTAT UGGAACACCUGCUCCGGAASTAT UCCCAGGCCCCGGAACACCATAT UGCUGUGCAGCUUGCCCAGATAT UCCAGGUGCAGGCUGUGCATAT UAUGCGUCCCAGGCAGCUGATAT UUGUGCGGGCGGAUGCGUCATAT AGGCCGGUGAAGGUGUGCGATAT AGCCCCGAGAGGCCGGUGADTAT AGAGUCGGCGGAGCCCCGADTAT UGUCCUUGAGGAAGAGUCGATAT TABLE8-continued ModifiedSenseandAntisenseStrandSequencesofIGFALSdsRNAS Antisense Oligo Name A-147858 A-147860 A-147862 A-147864 A-147866 A-147868 A-147870 A-147872 A-147874 A-147876 A-147878 A-147880 A-147882 A-147884 A-147886 A-147888 A-147890 A-147892 A-147896 A-147898 A-147900 A-147902 A-147904 A-147906

SEQ ID 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 SenseOligoSequence UCCGGCAGCUGGCUGAGCATAT UGGCUGAGCGCAGCUUUGADTAT AGCUUUGAGGGCCUGGGGADTAT UGGGGCAGCUUGAGGUGCULTAT UUGAGGUGCUCACGCUAGADTAT ACGCUAGACCACAACCAGASTAT AACCAGCUCCAGGAGGUCATAT AGGAGGUCAAGGCGGGCGADTAT CGGGCGCUUUCCUCGGCCULTAT CUCGGCCUCACCAACGUGADTAT AACGUGGCGGUCAUGAACAATAT UCAUGAACCUCUCUGGGAASTAT UCUGGGAACUGUCUCCGGADTAT UCUCCGGAACCUUCCGGAASTAT UUCCGGAGCAGGUGUUCCANTAT GGUGUUCCGGGGCCUGGGADTAT CUGGGCAAGCUGCACAGCASTOT UGCACAGCCUGCACCUGGADTAT CAGCUGCCUGGGACGCAUANTAT GACGCAUCCGCCCGCACAASTAT CGCACACCUUCACCGGCCULTAT UCACCGGCCUCUCGGGGCUSTOT UCGGGGCUCCGCCGACUCULTAT CGACUCUUCCUCAAGGACANTAT Sense Oligo Name A-147857 A-147859 A-147861 A-147863 A-147865 A-147867 A-147869 A-147871 A-147873 A-147875 A-147877 A-147879 A-147881 A-147883 A-147885 A-147887 A-147889 A-147891 A-147895 A-147897 A-147899 A-147901 A-147903 A-147905

Duplex Name AD-73857 AD-73858 AD-73859 AD-73860 AD-73861 AD-73862 AD-73863 AD-73864 AD-73865 AD-73866 AD-73867 AD-73868 AD-73869 AD-73870 AD-73871 AD-73872 AD-73873 AD-73874 AD-73875 AD-73876 AD-73877 AD-73878 AD-73879 AD-73880 US 2018 /0201929 A1 Jul. 19 , 2018 06

SEO ID 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 MRNAtargetsequence CAAGGACAACGGCCUCGUG GGCCUCGUGGGCAUUGAGG UUGAGGAGCAGAGCCUGUG AGAGCCUGUGGGGGCUGGC GGGCUGGCGGAGCUGCUGG UGCUGGAGCUCGACCUGAC GACCUGACCUCCAACCAGC UCCAACCAGCUCACGCACC ACGCACCUGCCCCACCGCC CACCGCCUCUUCCAGGGCC UCCAGGGCCUGGGCAAGCU GCAAGCUGGAGUACCUGCU UACCUGCUGCUCUCCCGCA CUCUCCCGCAACCGCCUGG CCGCCUGGCAGAGCUGCCG AGCUGCCGGCGGACGCCCU GACGCCCUGGGCCCCCUGC CCCCUGCAGCGGGCCUUCU GGGCCUUCUGGCUGGACGU UGGACGUCUCGCACAACCG ACAACCGCCUGGAGGCAUU GAGGCAUUGCCCAACAGCC CAACAGCCUCUUGGCACCA SEQ ID 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 AntisenseoligoSeq UACGAGGCCGUUGUCCUUGATAT UCUCAAUGCCCACGAGGCCATAT UACAGGCUCUGCUCCUCAASTAT UCCAGCCCCCACAGGCUCULTAT UCAGCAGCUCCGCCAGCCCATAT UUCAGGUCGAGCUCCAGCATAT UCUGGUUGGAGGUCAGGUCATAT UGUGCGUGAGCUGGUUGGADTAT UGCGGUGGGGCAGGUGCGUSTAT UGCCCUGGAAGAGGCGGUGATAT AGCUUGCCCAGGCCCUGGADTAT AGCAGGUACUCCAGCUUGCATAT UGCGGGAGAGCAGCAGGUALTAT UCAGGCGGUUGCGGGAGAGATAT UGGCAGCUCUGCCAGGCGGATAT AGGGCGUCCGCCGGCAGCULTAT UCAGGGGGCCCAGGGCGUCATAT AGAAGGCCCGCUGCAGGGGSTAT ACGUCCAGCCAGAAGGCCCATAT UGGUUGUGCGAGACGUCCANTAT AAUGCCUCCAGGCGGUUGUATAT UGCUGUUGGGCAAUGCCUCdTdT UGGUGCCAAGAGGCUGUUGATT TABLE8-continued ModifiedSenseandAntisenseStrandSequencesofIGFALSdsRNAS Antisense Oligo Name A-147908 A-147910 A-147912 A-147914 A-147916 A-147918 A-147920 A-147922 A-147924 A-147926 A-147928 A-147930 A-147932 A-147934 A-147936 A-147938 A-147940 A-147942 A-147944 A-147946 A-147948 A-147950 A-147952

SEQ ID 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 SenseOligoSequence CAAGGACAACGGCCUCGUALTAT GGCCUCGUGGGCAUUGAGADTAT UUGAGGAGCAGAGCCUGUANTAT AGAGCCUGUGGGGGCUGGADTAT GGGCUGGCGGAGCUGCUGASTAT UGCUGGAGCUCGACCUGAASTAT GACCUGACCUCCAACCAGASTAT UCCAACCAGCUCACGCACATAT ACGCACCUGCCCCACCGCAATAT CACCGCCUCUUCCAGGGCANTAT UCCAGGGCCUGGGCAACULTAT GCAAGCUGGAGUACCUGCULTAT UACCUGCUGCUCUCCCGCATAT CUCUCCCGCAACCGCCUGADTAT CCGCCUGGCAGAGCUGCCATAT AGCUGCCGGCGGACGCCCULTAT GACGCCCUGGGCCCCCUGADTAT CCCCUGCAGCGGGCCUUCULTAT GGGCCUUCUGGCUGGACGUSTAT UGGACGUCUCGCACAACCATAT ACAACCGCCUGGAGGCAUULTAT GAGGCAUUGCCCAACAGCATAT CAACAGCCUCUUGGCACCANTAT Sense Oligo Name A-147907 A-147909 A-147911 A-147913 A-147915 A-147917 A-147919 A-147921 A-147923 A-147925 A-147927 A-147929 A-147931 A-147933 A-147935 A-147937 A-147939 A-147941 A-147943 A-147945 A-147947 A-147949 A-147951

Duplex Name AD-73881 AD-73882 AD-73883 AD-73884 AD-73885 AD-73886 AD-73887 AD-73888 AD-73889 AD-73890 AD-73891 AD-73892 AD-73893 AD-73894 AD-73895 AD-73896 AD-73897 AD-73898 AD-73899 AD-73900 AD-73901 AD-73902 AD-73903 US 2018 /0201929 A1 Jul. 19 , 2018 97

SEQ ID 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 1158 1159 mRNAtargetsequence UUGGCACCACUGGGGCGGC UGGGGCGGCUGCGCUACCU CGCUACCUCAGCCUCAGGA UCAGGAACAACUCACUGCG CUCACUGCGGACCUUCACG ACCUUCACGCCGCAGCCCC CAGCCCCCGGGCCUGGAGC GCCUGGAGCGCCUGUGGCU CUGUGGCUGGAGGGUAACC GGUAACCCCUGGGACUGUG GGGACUGUGGCUGCCCUCU UGCCCUCUCAAGGCGCUGC CGCUGCGGGACUUCGCCCU UUCGCCCUGCAGAACCCCA CAGAACCCCAGUGCUGUGC UGCUGUGCCCCGCUUCGUC CUUCGUCCAGGCCAUCUGU CAUCUGUGAGGGGGACGAU GGGGACGAUUGCCAGCCGC CAGCCGCCCGCGUACACCU CGUACACCUACAACAACAU AACAACAUCACCUGUGCCA UGUGCCAGCCCGCCCGAGG CGCCCGAGGUCGUGGGGCU SEQ ID 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 AntisenseOligoSeq UCCGCCCCAGUGGUGCCAASTAT AGGUAGCGCAGCCGCCCCANTAT UCCUGAGGCUGAGGUAGCGATAT UGCAGUGAGUUGUUCCUGADTAT UGUGAAGGUCCGCAGUGAGATAT UGGGCUGCGGCGUGAAGGUATAT UCUCCAGGCCCGGGGGCUGATOT AGCCACAGGCGCUCCAGGCdTdt UGUUACCCUCCAGCCACAGATAT UACAGUCCCAGGGGUUACCATAT AGAGGGCAGCCACAGUCCCATAT UCAGCGCCUUGAGAGGGCATAT AGGGCGAAGUCCCGCAGCGATAT UGGGGUUCUGCAGGGCGAAdTAT UCACAGCACUGGGGUUCUGATAT UACGAAGCGGGGCACAGCATAT ACAGAUGGCCUGGACGAAGSTAT AUCGUCCCCCUCACAGAUGSTAT UCGGCUGGCAAUCGUCCCCATAT AGGUGUACGCGGGCGGCUGATOT AUGUUGUUGUAGGUGUACGATAT UGGCACAGGUGAUGUUGUUNTAT UCUCGGGCGGGCUGGCACATAT AGCCCCACGACCUCGGGCGTDT TABLE8-continued ModifiedSenseandAntisenseStrandSequencesofIGFALSdsRNAS Antisense Oligo Name A-147954 A-147956 A-147958 A-147960 A-147962 A-147964 A-147966 A-147968 A-147970 A-147972 A-147974 A-147976 A-147978 A-147980 A-147982 A-147984 A-147986 A-147988 A-147990 A-147992 A-147994 A-147996 A-147998 A-148000

SEQ ID 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 SenseOligoSequence UUGGCACCACUGGGGCGGADTAT UGGGGCGGCUGCGCUACCULTAT CGCUACCUCAGCCUCAGGADTAT UCAGGAACAACUCACUGCASTAT CUCACUGCGGACCUUCACATAT ACCUUCACGCCGCAGCCCATAT CAGCCCCCGGGCCUGGAGASTAT GCCUGGAGCGCCUGUGGCULTAT CUGUGGCUGGAGGGUAACAATAT GGUAACCCCUGGGACUGUALTAT GGGACUGUGGCUGCCCUCULTAT UGCCCUCUCAAGGCGCUGADTAT CGCUGCGGGACUUCGCCCULTAT UUCGCCCUGCAGAACCCCATAT CAGAACCCCAGUGCUGUGADTAT UGCUGUGCCCCGCUUCGUALTAT CUUCGUCCAGGCCAUCUGUSTAT CAUCUGUGAGGGGGACGAUSTAT GGGGACGAUUGCCAGCCGADTAT CAGCCGCCCGCGUACACCULTAT CGUACACCUACAACAACAUSTAT AACAACAUCACCUGUGCCATAT UGUGCCAGCCCGCCCGAGADTAT CGCCCGAGGUCGUGGGGCULTAT Sense Oligo Name A-147953 A-147955 A-147957 A-147959 A-147961 A-147963 A-147965 A-147967 A-147969 A-147971 A-147973 A-147975 A-147977 A-147979 A-147981 A-147983 A-147985 A-147987 A-147989 A-147991 A-147993 A-147995 A-147997 A-147999

Duplex Name AD-73904 AD-73905 AD-73906 AD-73907 AD-73908 AD-73909 AD-73910 AD-73911 AD-73912 AD-73913 AD-73914 AD-73915 AD-73916 AD-73917 AD-73918 AD-73919 AD-73920 AD-73921 AD-73922 AD-73923 AD-73924 AD-73925 AD-73926 AD-73927 US 2018 /0201929 A1 Jul. 19 , 2018 98

SEO ID 1160 1161 1162 1163 1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175 1176 1177 1178 1179 1180 MRNAtargetsequence CGUGGGGCUCGACCUGCGG ACCUGCGGGACCUCAGCGA UCAGCGAGGCCCACUUUGC ACUUUGCUCCCUGCUGACC CCUGCUGACCAGGUCCCCG UCCCCGGACUCAAGCCCCG CAAGCCCCGGACUCAGGCC UCAGGCCCCCACCUGGCUC ACCUGGCUCACCUUGUGCU UUGUGCUGGGGACAGGUCC GACAGGUCCUCAGUGUCCU CAGUGUCCUCAGGGGCCUG GGGCCUGCCCAGUGCACUU UGCACUUGCUGGAAGACGC UGGAAGACGCAAGGGCCUG AGGGCCUGAUGGGGUGGAA GGGUGGAAGGCAUGGCGGC UGGCGGCCCCCCCAGCUGU CAGCUGUCAUCAAUUAAAG AAUUAAAGGCAAAGGCAAU AAGGCAAUCGAAUCUAAAA SEQ ID 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 AntisenseoligoSeq UCGCAGGUCGAGCCCCACGATAT UCGCUGAGGUCCCGCAGGUATAT UCAAAGUGGGCCUCGCUGATT UGUCAGCAGGGAGCAAAGUSTAT UGGGGACCUGGUCAGCAGGATAT UGGGGCUUGAGUCCGGGGADTAT UGCCUGAGUCCGGGGCUUGATT UAGCCAGGUGGGGGCCUGATT AGCACAAGGUGAGCCAGGUATAT UGACCUGUCCCCAGCACAAdTAT AGGACACUGAGGACCUGUCATAT UAGGCCCCUGAGGACACUGATOT AAGUGCACUGGGCAGGCCCATAT UCGUCUUCCAGCAAGUGCATAT UAGGCCCUUGCGUCUUCCANTAT UUCCACCCCAUCAGGCCCUSTAT UCCGCCAUGCCUUCCACCCATAT ACAGCUGGGGGGGCCGCCANTAT CUUUAAUUGAUGACAGCUGATAT AUUGCCUUUGCCUUUAAUUNTAT UUUUAGAUUCGAUUGCCUUSTOT TABLE8-continued ModifiedSenseandAntisenseStrandSequencesofIGFALSdsRNAS Antisense Oligo Name A-148002 A-148004 A-148006 A-148008 A-148010 A-148012 A-148014 A-148016 A-148018 A-148020 A-148022 A-148024 A-148026 A-148028 A-148030 A-148032 A-148034 A-148036 A-148038 A-148040 A-148042

SEQ ID 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 SenseOligoSequence CGUGGGGCUCGACCUGCGADTAT ACCUGCGGGACCUCAGCGADTAT UCAGCGAGGCCCACUUUGADTAT ACUUUGCUCCCUGCUGACASTAT CCUGCUGACCAGGUCCCCANTAT UCCCCGGACUCAAGCCCCATAT CAAGCCCCGGACUCAGGCAATAT UCAGGCCCCCACCUGGCUALTAT ACCUGGCUCACCUUGUGCULTAT UUGUGCUGGGGACAGGUCATAT GACAGGUCCUCAGUGUCCULTAT CAGUGUCCUCAGGGGCCUALTAT GGGCCUGCCCAGUGCACUULTAT UGCACUUGCUGGAAGACGADTAT UGGAAGACGCAAGGGCCUATOT AGGGCCUGAUGGGGUGGAAdTAT GGGUGGAAGGCAUGGCGGADTAT UGGCGGCCCCCCCAGCUGUSTAT CAGCUGUCAUCAAUUAAAGATAT AAUUAAAGGCAAAGGCAAUSTAT AAGGCAAUCGAAUCUAAAAdTAT Sense Oligo Name A-148001 A-148003 A-148005 A-148007 A-148009 A-148011 A-148013 A-148015 A-148017 A-148019 A-148021 148023A- A-148025 A-148027 A-148029 A-148031 A-148033 A-148035 A-148037 A-148039 A-148041

Duplex Name AD-73928 AD-73929 AD-73930 AD-73931 AD-73932 AD-73933 AD-73934 AD-73935 AD-73936 AD-73937 AD-73938 AD-73939 AD-73940 AD-73941 AD-73942 AD-73943 AD-73944 AD-73945 AD-73946 AD-73947 AD-73948