DOCSLIB.ORG

Forelimb Contractures and Abnormal Tendon Collagen Fibrillogenesis in Fibulin-4 Null Mice

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Forelimb Contractures and Abnormal Tendon Collagen Fibrillogenesis in Fibulin-4 Null Mice Cell Tissue Res (2016) 364:637–646 DOI 10.1007/s00441-015-2346-x REGULAR ARTICLE Forelimb contractures and abnormal tendon collagen fibrillogenesis in fibulin-4 null mice Dessislava Z. Markova1,5 & Te-Cheng Pan1 & Rui-Zhu Zhang1 & Guiyun Zhang2 & Takako Sasaki3 & Machiko Arita1,5 & David E. Birk4 & Mon-Li Chu1 Received: 4 August 2015 /Accepted: 10 December 2015 /Published online: 28 December 2015 # Springer-Verlag Berlin Heidelberg 2015 Abstract Fibulin-4 is an extracellular matrix glycoprotein es- fibrillogenesis in the absence of fibulin-4 as analyzed by trans- sential for elastic fiber formation. Mice deficient in fibulin-4 mission electron microscopy. Fewer fibrils were assembled, die perinatally because of severe pulmonary and vascular de- and fibrils were disorganized compared with wild-type con- fects associated with the lack of intact elastic fibers. Patients trols. The organization of developing tenocytes and compart- with fibulin-4 mutations demonstrate similar defects, and a mentalization of the extracellular space was also disrupted. significant number die shortly after birth or in early childhood Fibulin-4 was co-localized with fibrillin-1 and fibrillin-2 in from cardiopulmonary failure. The patients also demonstrate limb tendons by using immunofluorescence microscopy. skeletal and other systemic connective tissue abnormalities, Thus, fibulin-4 seems to play a role in regulating tendon col- including joint laxity and flexion contractures of the wrist. A lagen fibrillogenesis, in addition to its essential function in fibulin-4 null mouse strain was generated and used to analyze elastogenesis. the roles of fibulin-4 in tendon fibrillogenesis. This mouse model displayed bilateral forelimb contractures, in addition to pulmonary and cardiovascular defects. The forelimb and Keywords Elastic fiber . Cutis laxa . Fibrillin . Tendon . hindlimb tendons exhibited disruption in collagen Collagen fibrillogenesis Dessislava Z. Markova and Te-Cheng Pan contributed equally to this work. Research reported in this publication was supported by the National Institutes of Health under Award Number GM55625 (MLC) and AR44745 (DEB). The content is solely the responsibility of the authors and does not necessarily represent the official views of the National In- stitutes of Health. Electronic supplementary material The online version of this article (doi:10.1007/s00441-015-2346-x) contains supplementary material, which is available to authorized users. * Mon-Li Chu 3 Department of Biochemistry, Faculty of Medicine, Oita University, [email protected] Oita, Japan 4 Department of Molecular Pharmacology & Physiology, Morsani 1 Department of Dermatology and Cutaneous Biology, Sidney Kimmel College of Medicine, University of South Florida, Tampa FL 33612, Medical College, Thomas Jefferson University, 233 South 10th USA Street, Philadelphia PA 19107, USA 2 Department of Pathology, Anatomy and Cell Biology, Sidney 5 Present address: Department of Orthopaedic Surgery, Sidney Kimmel Medical College, Thomas Jefferson University, Kimmel Medical College, Thomas Jefferson University, Philadelphia PA 19107, USA Philadelphia PA 19107, USA 638 Cell Tissue Res (2016) 364:637–646 Abbreviations without aortic aneurysm and skeletal connective tissue ARCL Autosomal recessive cutis laxa abnormalities (Callewaert et al. 2013;Loeysetal.2002). BMP Bone morphogenetic protein Previous studies of fibulin-4 global and conditional null FDL Flexor digitorum longus mice have focused on the elastic fiber abnormalities in the LOX Lysyl oxidase vascular and pulmonary systems (Horiguchi et al. 2009; LTBP Latent TGF-β-binding protein Huang et al. 2010; McLaughlin et al. 2006). However, in these TGF Transforming growth factor studies, no determinations have been made as to whether the loss of fibulin-4 leads to skeletal and other systemic connec- tive tissue anomalies resembling those seen in human patients. To address this deficiency, a fibulin-4 null mouse strain that Introduction we have generated has been characterized. Our mouse model exhibits bilateral forelimb contractures, in addition to vascular Fibulin-4 is a secreted glycoprotein belonging to the and pulmonary defects. We have found that fibulin-4 co-lo- fibulin family, characterized by tandem repeats of calizes with fibrillin microfibrils in wild-type tendons. In the calcium-binding epidermal growth factor-like modules absence of fibulin-4, collagen fibrillogenesis is disrupted. and a C-terminal fibulin domain (de Vega et al. 2009; Fewer fibrils are assembled, and fibrils are disorganized com- Timpl et al. 2003). Within this protein family, fibulin-3, pared with wild-type controls. The developing tenocytes and -4, and -5 are relatively small in size (50–60 kDa) and compartmentalization of the extracellular space are also have essentially identical modular structures (Timpl et al. disrupted in the fibulin-4 null mice. Our studies demonstrate 2003; Yanagisawa and Davis 2010). Studies of knockout that fibulin-4 not only is essential for elastic fiber assembly, mice have demonstrated that both fibulin-4 and -5 are but also plays a specific role in regulating collagen indispensable for elastic fiber formation (McLaughlin fibrillogenesis during development. et al. 2006; Nakamura et al. 2002; Yanagisawa et al. 2002). However, loss of fibulin-4 results in a more severe phenotype than the absence of fibulin-5. Fibulin-4 null Materials and methods mice die perinatally and display pulmonary emphysema, aortic aneurysm, and artery anomalies (tortuous, dilation, Antibodies narrowing, rupture). By contrast, fibulin-5 null mice live into adulthood and show loose skin, pulmonary emphyse- A rabbit polyclonal antibody against full-length recombi- ma, and cardiovascular defects. nant mouse fibulin-4 was reported previously (Kobayashi In humans, mutations in fibulin-4 and -5 underlie au- et al. 2007). A guinea pig polyclonal antibody for fibulin- tosomal recessive cutis laxa (ARCL) type 1B and 1A, 4wasgeneratedbyusingtheN-terminalregionofmouse respectively (Urban and Davis 2014). ARCL is a hetero- fibulin-4 as the antigen by the custom antibody services geneous group of disorders characterized by loose skin of Cocalico Biologicals (Reamstown, Pa., USA). The an- with significant internal organ involvement. Like the phe- tigen corresponded to amino acids 28–203 of mouse notypes of the knockout mice, notable differences are fibulin-4 and was produced in HEK293 cells by the found in the clinical manifestations of ARCL 1A and methods described previously (Kobayashi et al. 2007). ARCL 1B patients. A significant proportion of patients with fibulin-4 mutations die shortly after birth or in early childhood because of cardiopulmonary failure (Al- Targeted inactivation of Fbln4/Efemp2 gene Hassnan et al. 2012; Dasouki et al. 2007;Ericksonetal. 2012;Hebsonetal.2014; Hoyer et al. 2009; A 10-kb XbaI genomic fragment containing the 5′ portion of the Hucthagowder et al. 2006; Iascone et al. 2012; Fbln4/Efemp2 gene kindly provided by Dr. Günter Kostka was Kappanayil et al. 2012;Renardetal.2010;Sawyer used to construct the gene-targeting vector. Generation of the et al. 2013). The common pathological findings are pul- fibulin-4 null mice was as described in Supplementary Material, monary emphysema, arterial tortuosity, and aortic aneu- Fig. S1. Genotyping of mutant mice was performed by poly- rysm. In addition, patients show skeletal and other sys- merase chain reaction (PCR) analysis of tail DNA. Forward temic connective tissue abnormalities, including bone fra- primer CCTCTCTGCAGATGTCAACG and reverse primer gility, joint laxity, arachnodactyly, pectus excavatum, flex- GAGGCAGGCAGATTTCTGAG generated a 358-bp PCR ion contracture of wrists, feet abnormalities, hypotonia, product from the wild-type allele. The same reverse primer and diaphragmatic and inguinal hernias. On the other and forward primer TAAAGCGCATGCTCCAGACTGC hand, patients with fibulin-5 mutations present with cutis yielded a ∼310 bp PCR product from the targeted allele. All laxa, emphysema, and supravalvular aortic stenosis, but animal experiments were performed under animal protocols Cell Tissue Res (2016) 364:637–646 639 640 Cell Tissue Res (2016) 364:637–646 Fig. 1 Phenotypes of fibulin-4 null mice. a Photographs of eight processed for paraffin embedding. Cryosections (8 μm) +/- embryos at embryonic day 19 dissected from a pregnant Fbln4 were fixed with methanol and used for immunostaining female. All three Fbln4-/- embryos (nos. 3, 4, 5) showed bilateral forelimb contractures. One of the three Fbln4+/- embryos (no. 7) had a with a polyclonal antibody against fibulin-4 (Kobayashi unilateral forelimb contracture. Note that the Fbln4-/- embryos were of the et al. 2007) and Cy3-labeled secondary antibody (Jackson same size as the wild-type littermates, and the skin in their chests ImmunoResearch Laboratories). Paraffin-embedded sec- appeared translucent, and thus, their rib cages were visible. b tions (5 μm) were subject to Verhoeff-Van Gieson elastin Diaphragmatic hernia in a representative newborn Fbln4-/- mouse. Abdominal organs, liver, and intestine were found in the chest cavity. c, staining. Samples were viewed by using a Zeiss Axioskop d Forelimb skeletons of newborn Fbln4+/+ (c) and Fbln4-/- (d) mice epifluorescence microscope with a Toshiba 3CCD camera stained with alcian blue and alizarin red. e–g Aortas from E18 and ImagePro software (Media Cybernetics, Rockville, +/+ +/- -/- Fbln4 , Fbln4 ,andFbln4 embryos stained with the rabbit Md., USA). polyclonal antibody for
Load more

Recommended publications
  • Assembly of Fibrillin Microfibrils Governs Extracellular Deposition of Latent TGF
    3006 Research Article Assembly of fibrillin microfibrils governs extracellular deposition of latent TGF Teresa Massam-Wu*, Maybo Chiu*, Rawshan Choudhury, Shazia S. Chaudhry, Andrew K. Baldwin, Amanda McGovern, Clair Baldock, C. Adrian Shuttleworth and Cay M. Kielty‡ Wellcome Trust Centre for Cell-Matrix Research, Faculty of Life Sciences, University of Manchester, Manchester M13 9PT, UK *These authors contributed equally to this work ‡Author for correspondence ([email protected]) Accepted 18 May 2010 Journal of Cell Science 123, 3006-3018 © 2010. Published by The Company of Biologists Ltd doi:10.1242/jcs.073437 Summary Control of the bioavailability of the growth factor TGF is essential for tissue formation and homeostasis, yet precisely how latent TGF is incorporated into the extracellular matrix is unknown. Here, we show that deposition of a large latent TGF complex (LLC), which contains latent TGF-binding protein 1 (LTBP-1), is directly dependent on the pericellular assembly of fibrillin microfibrils, which interact with fibronectin during higher-order fibrillogenesis. LTBP-1 formed pericellular arrays that colocalized with microfibrils, whereas fibrillin knockdown inhibited fibrillar LTBP-1 and/or LLC deposition. Blocking 51 integrin or supplementing cultures with heparin, which both inhibited microfibril assembly, disrupted LTBP-1 deposition and enhanced Smad2 phosphorylation. Full-length LTBP-1 bound only weakly to N-terminal pro-fibrillin-1, but this association was strongly enhanced by heparin. The microfibril- associated glycoprotein MAGP-1 (MFAP-2) inhibited LTBP-1 binding to fibrillin-1 and stimulated Smad2 phosphorylation. By contrast, fibulin-4, which interacted strongly with full-length LTBP-1, did not induce Smad2 phosphorylation.
    [Show full text]
  • New Insights Into the Secretory Functions of Brown Adipose Tissue
    243 2 Journal of J Villarroya et al. Secretory functions of brown 243:2 R19–R27 Endocrinology adipose tissue REVIEW New insights into the secretory functions of brown adipose tissue Joan Villarroya, Rubén Cereijo, Aleix Gavaldà-Navarro, Marion Peyrou, Marta Giralt and Francesc Villarroya Departament de Bioquímica i Biomedicina Molecular and Institut de Biomedicina (IBUB), Universitat de Barcelona, Barcelona, Catalonia, Spain CIBER Fisiopatología de la Obesidad y Nutrición, Barcelona, Catalonia, Spain Correspondence should be addressed to F Villarroya: [email protected] Abstract In recent years, an important secretory role of brown adipose tissue (BAT) has emerged, Key Words which is consistent, to some extent, with the earlier recognition of the important f brown adipose tissue secretory role of white fat. The so-called brown adipokines or ‘batokines’ may play an f brown adipokine autocrine role, which may either be positive or negative, in the thermogenic function f batokine of brown adipocytes. Additionally, there is a growing recognition of the signalling f thermogenesis molecules released by brown adipocytes that target sympathetic nerve endings (such as neuregulin-4 and S100b protein), vascular cells (e.g., bone morphogenetic protein-8b), and immune cells (e.g., C-X-C motif chemokine ligand-14) to promote the tissue remodelling associated with the adaptive BAT recruitment in response to thermogenic stimuli. Moreover, existing indications of an endocrine role of BAT are being confirmed through the release of brown adipokines acting on other distant tissues and organs; a recent example is the recognition that BAT-secreted fibroblast growth factor-21 and myostatin target the heart and skeletal muscle, respectively.
    [Show full text]
  • Altered Adipose Tissue and Adipocyte Function in the Pathogenesis of Metabolic Syndrome
    Altered adipose tissue and adipocyte function in the pathogenesis of metabolic syndrome C. Ronald Kahn, … , Guoxiao Wang, Kevin Y. Lee J Clin Invest. 2019;129(10):3990-4000. https://doi.org/10.1172/JCI129187. Review Series Over the past decade, great progress has been made in understanding the complexity of adipose tissue biology and its role in metabolism. This includes new insights into the multiple layers of adipose tissue heterogeneity, not only differences between white and brown adipocytes, but also differences in white adipose tissue at the depot level and even heterogeneity of white adipocytes within a single depot. These inter- and intra-depot differences in adipocytes are developmentally programmed and contribute to the wide range of effects observed in disorders with fat excess (overweight/obesity) or fat loss (lipodystrophy). Recent studies also highlight the underappreciated dynamic nature of adipose tissue, including potential to undergo rapid turnover and dedifferentiation and as a source of stem cells. Finally, we explore the rapidly expanding field of adipose tissue as an endocrine organ, and how adipose tissue communicates with other tissues to regulate systemic metabolism both centrally and peripherally through secretion of adipocyte-derived peptide hormones, inflammatory mediators, signaling lipids, and miRNAs packaged in exosomes. Together these attributes and complexities create a robust, multidimensional signaling network that is central to metabolic homeostasis. Find the latest version: https://jci.me/129187/pdf REVIEW SERIES: MECHANISMS UNDERLYING THE METABOLIC SYNDROME The Journal of Clinical Investigation Series Editor: Philipp E. Scherer Altered adipose tissue and adipocyte function in the pathogenesis of metabolic syndrome C. Ronald Kahn,1 Guoxiao Wang,1 and Kevin Y.
    [Show full text]
  • Tendon Extracellular Matrix Remodeling and Defective Cell Polarization in the Presence of Collagen VI Mutations
    cells Article Tendon Extracellular Matrix Remodeling and Defective Cell Polarization in the Presence of Collagen VI Mutations Manuela Antoniel 1,2, Francesco Traina 3,4, Luciano Merlini 5 , Davide Andrenacci 1,2, Domenico Tigani 6, Spartaco Santi 1,2, Vittoria Cenni 1,2, Patrizia Sabatelli 1,2,*, Cesare Faldini 7 and Stefano Squarzoni 1,2 1 CNR-Institute of Molecular Genetics “Luigi Luca Cavalli-Sforza”-Unit of Bologna, 40136 Bologna, Italy; [email protected] (M.A.); [email protected] (D.A.); [email protected] (S.S.); [email protected] (V.C.); [email protected] (S.S.) 2 IRCCS Istituto Ortopedico Rizzoli, 40136 Bologna, Italy 3 Ortopedia-Traumatologia e Chirurgia Protesica e dei Reimpianti d’Anca e di Ginocchio, Istituto Ortopedico Rizzoli di Bologna, 40136 Bologna, Italy; [email protected] 4 Dipartimento di Scienze Biomediche, Odontoiatriche e delle Immagini Morfologiche e Funzionali, Università Degli Studi Di Messina, 98122 Messina, Italy 5 Department of Biomedical and Neuromotor Sciences, University of Bologna, 40123 Bologna, Italy; [email protected] 6 Department of Orthopedic and Trauma Surgery, Ospedale Maggiore, 40133 Bologna, Italy; [email protected] 7 1st Orthopaedic and Traumatologic Clinic, IRCCS Istituto Ortopedico Rizzoli, 40136 Bologna, Italy; [email protected] * Correspondence: [email protected]; Tel.: +39-051-6366755; Fax: +39-051-4689922 Received: 20 December 2019; Accepted: 7 February 2020; Published: 11 February 2020 Abstract: Mutations in collagen VI genes cause two major clinical myopathies, Bethlem myopathy (BM) and Ullrich congenital muscular dystrophy (UCMD), and the rarer myosclerosis myopathy. In addition to congenital muscle weakness, patients affected by collagen VI-related myopathies show axial and proximal joint contractures, and distal joint hypermobility, which suggest the involvement of tendon function.
    [Show full text]
  • Spontaneous Right Ventricular Pseudoaneurysms and Increased Arrhythmogenicity in a Mouse Model of Marfan Syndrome
    International Journal of Molecular Sciences Article Spontaneous Right Ventricular Pseudoaneurysms and Increased Arrhythmogenicity in a Mouse Model of Marfan Syndrome Felke Steijns 1, Marjolijn Renard 1, Marine Vanhomwegen 1, Petra Vermassen 1, 2 2 2,3 3 1,4, Jana Desloovere , Robrecht Raedt , Lars E. Larsen ,Máté I. Tóth , Julie De Backer y 1, , and Patrick Sips * y 1 Center for Medical Genetics, Department of Biomolecular Medicine, Ghent University, 9000 Ghent, Belgium; [email protected] (F.S.); [email protected] (M.R.); [email protected] (M.V.); [email protected] (P.V.); [email protected] (J.D.B.) 2 4BRAIN, Department of Head and Skin, Ghent University, 9000 Ghent, Belgium; [email protected] (J.D.); [email protected] (R.R.); [email protected] (L.E.L.) 3 Institute Biomedical Technology, Ghent University, 9000 Ghent, Belgium; [email protected] 4 Department of Cardiology, Ghent University Hospital, 9000 Ghent, Belgium * Correspondence: [email protected] These authors share last authorship. y Received: 27 June 2020; Accepted: 22 September 2020; Published: 24 September 2020 Abstract: Patients with Marfan syndrome (MFS), a connective tissue disorder caused by pathogenic variants in the gene encoding the extracellular matrix protein fibrillin-1, have an increased prevalence of primary cardiomyopathy, arrhythmias, and sudden cardiac death. We have performed an in-depth in vivo and ex vivo study of the cardiac phenotype of Fbn1mgR/mgR mice, an established mouse model of MFS with a severely reduced expression of fibrillin-1. Using ultrasound measurements, we confirmed the presence of aortic dilatation and observed cardiac diastolic dysfunction in male Fbn1mgR/mgR mice.
    [Show full text]
  • Fibrillin and Elastin Expression in Skin Regenerating from Cultured
    Fibrillin and Elastin Expression in Skin Regenerating Frotn Cultured Keratinocyte Autografts: Morphogenesis of Microfibrils Begins At the Dertno-epidertnal Junction and Precedes Elastic Fiber Fortnation Michael Raghunath, Thomas Bachi, * Martin Meuli, -r Stefan Altermatt, t l:tita Gobet, t Leena Bruckner-Tuderman,:j: and Beat SteinmalID tDivision of Metabolj c and Molecular Disease and Pedi atric Bum Ccnter of the Ulljvcrsity Children's Hospital Ztirich, "' Electron microscopic Central Laboratory of the University of Ziirich, Switzerland; and t Departlllcnt of Dermatology at the University of Mtinstcr, F.R.G. The tetnporo-spatial expression of fibrillin and elas­ horizontailly undulating microfibrils of the neoder­ tin in skin regenerating frotn autologous keratino­ mis which had developed independently. Elastin was cyte grafts was studied in three burned children. Skin first identified in the deeper neodermis 1 month after biopsies taken between 5 days and 17 months after grafting as granular aggregates and 4 months after grafting were investigated by conventional immuno­ grafting on fibrillar structures and surrounding cap­ fluorescence, confocal laser scanning, and electron illaries of the upper neodermis. Association of elastin microscopy. Fibrillin, the major component of 10- with microfibrils in the papillary dermis was not 12-nm microfibrils, appeared 5 days after grafting in detectable before month 17. Our findings suggest a band-like fashion similar to collagen VII at the that the cutaneous microfibrillar apparatus develops prospective basctnent membrane, and then formed simultaneously at both the dermo-epidermal junc­ the characteristic tnicrofibrillar candelabra at the tion and the reticular dermis and is a prerequisite for dermo-epidermal junction by fusion of several fine elastic fiber formation.
    [Show full text]
  • Muscle Fibrillin Deficiency in Marfan's Syndrome Myopathy
    J Neurol Neurosurg Psychiatry: first published as 10.1136/jnnp.74.5.633 on 1 May 2003. Downloaded from 633 PAPER Muscle fibrillin deficiency in Marfan’s syndrome myopathy W M H Behan, C Longman,RKHPetty, P Comeglio, A H Child, M Boxer, P Foskett, D G F Harriman ............................................................................................................................. J Neurol Neurosurg Psychiatry 2003;74:633–639 See end of article for authors’ affiliations Objective: To report a family with Marfan’s syndrome in whom a myopathy was associated with res- ....................... piratory failure; muscle biopsies from affected individuals were examined to determine whether there Correspondence to: were abnormalities in fibrillin. ProfessorWMHBehan, Methods: 21 family members underwent detailed clinical examination, including neurological and Department of Pathology, pulmonary assessment. Muscle biopsies in the most severely affected cases were immunostained using Western Infirmary, monoclonal antibodies to specific fibrillin components. Genomic DNA from all 21 members was ana- Glasgow G11 6NT, UK; lysed for mutations in the fibrillin gene, FBN1, on 15q21. [email protected] Results: 13 individuals had a C4621T base change in exon 37 of the FBN1 gene, which in four cases Received 29 August 2002 segregated with muscle weakness or evidence of respiratory muscle dysfunction or both. Their muscle In revised form biopsies revealed an abnormality in fibrillin immunoreactivity. 10 December 2002 Accepted Conclusions: Abnormalities in fibrillin can be detected in muscle biopsies from patients with Marfan’s 11 December 2002 syndrome who have myopathy. This pedigree, with a point mutation in FBN1, also draws attention to ....................... the potential for respiratory failure associated with myopathy. arfan’s syndrome is the commonest autosomal domi- and abnormal fibrillin immunoreactivity in the endomysium nant inherited disorder of connective tissue, with a and perimysium.
    [Show full text]
  • Lessons from Tracheal Tube Development for Understanding Congenital Tracheal Malformations
    EDITORIAL | BASIC SCIENCE Lessons from tracheal tube development for understanding congenital tracheal malformations Heena Kumra1,3, Neha E.H. Dinesh1,3 and Dieter P. Reinhardt 1,2 Affiliations: 1Faculty of Medicine, Dept of Anatomy and Cell Biology, McGill University, Montreal, QC, Canada. 2Faculty of Dentistry, McGill University, Montreal, QC, Canada. 3Both authors contributed equally. Correspondence: Dieter P. Reinhardt, Dept of Anatomy and Cell Biology, McGill University, 3640 University Street, Montreal, Quebec H3A 0C7, Canada. E-mail: [email protected] @ERSpublications Novel functions of the extracellular protein fibrillin-2 were discovered in tracheal tube development: fibrillin-2 has important roles in tracheal cartilage development and smooth muscle cell orientation and polarity, all required for tracheal contraction http://ow.ly/rn3Z30nId3N Cite this article as: Kumra H, Dinesh NEH, Reinhardt DP. Lessons from tracheal tube development for understanding congenital tracheal malformations. Eur Respir J 2019; 53: 1900127 [https://doi.org/10.1183/ 13993003.00127-2019]. Fibrillins constitute a family of extracellular proteins critical for the biogenesis of elastic fibres and for the activity regulation of growth factors of the transforming growth factor (TGF)-β superfamily. All three fibrillins are present during development of tissues and organs, including lung, aorta, bones and skin [1–3]. Typically, fibrillin-2 and -3 expression is limited to prenatal and early postnatal development in humans, whereas fibrillin-1 expression persists throughout adulthood. In mouse, the situation is simplified by the fact that fibrillin-3 is not expressed due to chromosomal rearrangement events [4]. In the developing mouse embryo, fibrillin-1 and -2 co-distribute in elastic and non-elastic tissues, with fibrillin-2 accumulating preferentially in elastic fibre-rich matrices [1].
    [Show full text]
  • A Heart for Fibrillin: Spatial Arrangement in Adult Wild-Type Murine Myocardial Tissue
    Histochemistry and Cell Biology https://doi.org/10.1007/s00418-018-1686-5 ORIGINAL PAPER A heart for fibrillin: spatial arrangement in adult wild-type murine myocardial tissue Felke Steijns1 · Jolanda van Hengel2 · Patrick Sips1 · Julie De Backer1,3 · Marjolijn Renard1 Accepted: 5 June 2018 © Springer-Verlag GmbH Germany, part of Springer Nature 2018 Abstract Fibrillins are major constituents of microfibrils, which are essential components of the extracellular matrix of connective tissues where they contribute to the tissue homeostasis. Although it is known that microfibrils are abundantly expressed in the left ventricle of the heart, limited data are available about the presence of microfibrils in the other parts of the myo- cardial tissue and whether there are age or sex-related differences in the spatial arrangement of the microfibrils. This basic knowledge is essential to better understand the impact of fibrillin-1 pathogenic variants on the myocardial tissue as seen in Marfan related cardiomyopathy. We performed histological analyses on wild-type male and female murine myocardial tissue collected at different time-points (1, 3 and 6 months). Fibrillin-1 and -2 immunofluorescence stainings were performed on cross-sections at the level of the apex, the mid-ventricles and the atria. In addition, other myocardial matrix components such as collagen and elastin were also investigated. Fibrillin-1 presented as long fibres in the apex, mid-ventricles and atria. The spatial arrangement differed between the investigated regions, but not between age groups or sexes. Collagen had a similar broad spatial arrangement to that of fibrillin-1, whereas elastic fibres were primarily present in the atria and the vessels.
    [Show full text]
  • Enhanced Fibrillin-2 Expression Is a General Feature of Wound
    Laboratory Investigation (2010) 90, 739–752 & 2010 USCAP, Inc All rights reserved 0023-6837/10 $32.00 Enhanced fibrillin-2 expression is a general feature of wound healing and sclerosis: potential alteration of cell attachment and storage of TGF-b Ju¨rgen Brinckmann1,2, Nico Hunzelmann3, Birgit Kahle1,Ju¨rgen Rohwedel2, Jan Kramer2,4, Mark A Gibson5, Dirk Hubmacher6 and Dieter P Reinhardt6 Wound healing and sclerosis are characterized by an increase of extracellular matrix proteins, which are characteristically expressed in the embryo–fetal period. We analyzed the expression of fibrillin-2, which is typically found in embryonic tissues, but only scarcely in adult skin. In wound healing and sclerotic skin diseases such as lipodermatosclerosis and scleroderma, a marked increase of fibrillin-2 expression was found by immunohistology. Double labelling of fibrillin-2 and tenascin-C, which is also expressed in wound healing and sclerosis, showed co-localization of both proteins. Solid-phase and slot blot-overlay assays showed a dose-dependent binding of the recombinant N-terminal half of fibrillin-2 (rFBN2-N) to tenascin-C. Real-time PCR showed an increase of the fibrillin-2 gene expression in cell culture triggered by typical mediators for fibroblast activation such as serum, IL-4, and TGF-b. By contrast, prolonged hypoxia is not associated with changes in fibrillin-2 expression. Tenascin-C is an anti-adhesive substrate for fibroblasts, whereas fibrillin-2 stimulates cell attachment. Attachment assays using mixed substrates showed decreased cell attachment when tenascin-C and rFBN2-N were coated together, compared with the attachment to rFBN2-N alone.
    [Show full text]
  • Fibrosis in Connective Tissue Disease: the Role of the Myofibroblast and Fibroblast-Epithelial Cell Interactions Thomas Krieg1, David Abraham2 and Robert Lafyatis3
    Available online http://arthritis-research.com/content/9/S2/S4 Review Fibrosis in connective tissue disease: the role of the myofibroblast and fibroblast-epithelial cell interactions Thomas Krieg1, David Abraham2 and Robert Lafyatis3 1Department of Dermatology, University of Köln, Kerpener Strasse, D-50924 Köln, Germany 2Department of Medicine, Centre for Rheumatology and Connective Tissue Diseases, Royal Free and University College, Rowland Hill Street, London, NW3 2PF, UK 3Rheumatology Department, Boston University of Medicine, Albany Street, Boston, Massachusetts 02118-2394, USA Corresponding author: Thomas Krieg, [email protected] Published: 15 August 2007 Arthritis Research & Therapy 2007, 9(Suppl 2):S4 (doi:10.1186/ar2188) This article is online at http://arthritis-research.com/content/9/S2/S4 © 2007 BioMed Central Ltd Abstract cellular and molecular events associated with the initiation Fibrosis, characterized by excessive extracellular matrix accumu- and maintenance of fibrosis in CTDs. lation, is a common feature of many connective tissue diseases, notably scleroderma (systemic sclerosis). Experimental studies Initiators of fibrosis in connective tissue suggest that a complex network of intercellular interactions diseases involving endothelial cells, epithelial cells, fibroblasts and immune Fibrosis arises from excessive collagen synthesis by cells, using an array of molecular mediators, drives the pathogenic fibroblasts [3]. Of the many potential mediators of fibrosis in events that lead to fibrosis. Transforming growth factor-β and endothelin-1, which are part of a cytokine hierarchy with connec- CTDs, three molecular entities appear to be of particular tive tissue growth factor, are key mediators of fibrogenesis and are importance: transforming growth factor (TGF)-β, endothelin primarily responsible for the differentiation of fibroblasts toward a (ET)-1 and connective tissue growth factor (CTGF/CCN2).
    [Show full text]
  • Novel Adipokine Asprosin Modulates Browning and Adipogenesis in White Adipose Tissue
    249 2 Journal of Y Miao, H Qin et al. Asprosin modulates browning 249:2 83–93 Endocrinology and adipogenesis RESEARCH Novel adipokine asprosin modulates browning and adipogenesis in white adipose tissue Yanli Miao1,*, Haojie Qin1,*, Yi Zhong1, Kai Huang1 and Caijun Rao 2 1Department of Cardiology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China 2Department of Geriatrics, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China Correspondence should be addressed to K Huang or C Rao: [email protected] or [email protected] *(Y Miao and H Qin contributed equally to this work) Abstract Obesity is an increasingly serious epidemic worldwide characterized by an increase in Key Words the number and size of adipocytes. Adipose tissue maintains the balance between lipid f adipokine storage and energy utilization. Therefore, adipose metabolism is of great significance f asprosin for the prevention, treatment and intervention of obesity. Asprosin, a novel adipokine, f adipose browning is a circulating hormone mainly secreted by white adipose tissue. Previous studies have f adipogenesis shown that asprosin plays a role in fasting-induced homeostasis, insulin resistance, f Nrf2 and glucose tolerance. However, whether it can regulate the metabolism of adipose tissue itself has not been studied. This study intended to examine the roles and potential mechanisms of asprosin in adipose regulation. We first demonstrated that the expression level of asprosin was significantly downregulated in subcutaneous white adipose tissue (scWAT) of high-fat diet (HFD)-fed or cold-stimulated mice. Overexpression of asprosin in scWAT reduced heat production, decreased expression of the browning marker uncoupling protein 1 (UCP1) and other browning-related genes, along with upregulation of adipogenic gene expression.
    [Show full text]