Cell Tissue Res (2016) 364:637–646 DOI 10.1007/s00441-015-2346-x REGULAR ARTICLE Forelimb contractures and abnormal tendon collagen fibrillogenesis in fibulin-4 null mice Dessislava Z. Markova1,5 & Te-Cheng Pan1 & Rui-Zhu Zhang1 & Guiyun Zhang2 & Takako Sasaki3 & Machiko Arita1,5 & David E. Birk4 & Mon-Li Chu1 Received: 4 August 2015 /Accepted: 10 December 2015 /Published online: 28 December 2015 # Springer-Verlag Berlin Heidelberg 2015 Abstract Fibulin-4 is an extracellular matrix glycoprotein es- fibrillogenesis in the absence of fibulin-4 as analyzed by trans- sential for elastic fiber formation. Mice deficient in fibulin-4 mission electron microscopy. Fewer fibrils were assembled, die perinatally because of severe pulmonary and vascular de- and fibrils were disorganized compared with wild-type con- fects associated with the lack of intact elastic fibers. Patients trols. The organization of developing tenocytes and compart- with fibulin-4 mutations demonstrate similar defects, and a mentalization of the extracellular space was also disrupted. significant number die shortly after birth or in early childhood Fibulin-4 was co-localized with fibrillin-1 and fibrillin-2 in from cardiopulmonary failure. The patients also demonstrate limb tendons by using immunofluorescence microscopy. skeletal and other systemic connective tissue abnormalities, Thus, fibulin-4 seems to play a role in regulating tendon col- including joint laxity and flexion contractures of the wrist. A lagen fibrillogenesis, in addition to its essential function in fibulin-4 null mouse strain was generated and used to analyze elastogenesis. the roles of fibulin-4 in tendon fibrillogenesis. This mouse model displayed bilateral forelimb contractures, in addition to pulmonary and cardiovascular defects. The forelimb and Keywords Elastic fiber . Cutis laxa . Fibrillin . Tendon . hindlimb tendons exhibited disruption in collagen Collagen fibrillogenesis Dessislava Z. Markova and Te-Cheng Pan contributed equally to this work. Research reported in this publication was supported by the National Institutes of Health under Award Number GM55625 (MLC) and AR44745 (DEB). The content is solely the responsibility of the authors and does not necessarily represent the official views of the National In- stitutes of Health. Electronic supplementary material The online version of this article (doi:10.1007/s00441-015-2346-x) contains supplementary material, which is available to authorized users. * Mon-Li Chu 3 Department of Biochemistry, Faculty of Medicine, Oita University, [email protected] Oita, Japan 4 Department of Molecular Pharmacology & Physiology, Morsani 1 Department of Dermatology and Cutaneous Biology, Sidney Kimmel College of Medicine, University of South Florida, Tampa FL 33612, Medical College, Thomas Jefferson University, 233 South 10th USA Street, Philadelphia PA 19107, USA 2 Department of Pathology, Anatomy and Cell Biology, Sidney 5 Present address: Department of Orthopaedic Surgery, Sidney Kimmel Medical College, Thomas Jefferson University, Kimmel Medical College, Thomas Jefferson University, Philadelphia PA 19107, USA Philadelphia PA 19107, USA 638 Cell Tissue Res (2016) 364:637–646 Abbreviations without aortic aneurysm and skeletal connective tissue ARCL Autosomal recessive cutis laxa abnormalities (Callewaert et al. 2013;Loeysetal.2002). BMP Bone morphogenetic protein Previous studies of fibulin-4 global and conditional null FDL Flexor digitorum longus mice have focused on the elastic fiber abnormalities in the LOX Lysyl oxidase vascular and pulmonary systems (Horiguchi et al. 2009; LTBP Latent TGF-β-binding protein Huang et al. 2010; McLaughlin et al. 2006). However, in these TGF Transforming growth factor studies, no determinations have been made as to whether the loss of fibulin-4 leads to skeletal and other systemic connec- tive tissue anomalies resembling those seen in human patients. To address this deficiency, a fibulin-4 null mouse strain that Introduction we have generated has been characterized. Our mouse model exhibits bilateral forelimb contractures, in addition to vascular Fibulin-4 is a secreted glycoprotein belonging to the and pulmonary defects. We have found that fibulin-4 co-lo- fibulin family, characterized by tandem repeats of calizes with fibrillin microfibrils in wild-type tendons. In the calcium-binding epidermal growth factor-like modules absence of fibulin-4, collagen fibrillogenesis is disrupted. and a C-terminal fibulin domain (de Vega et al. 2009; Fewer fibrils are assembled, and fibrils are disorganized com- Timpl et al. 2003). Within this protein family, fibulin-3, pared with wild-type controls. The developing tenocytes and -4, and -5 are relatively small in size (50–60 kDa) and compartmentalization of the extracellular space are also have essentially identical modular structures (Timpl et al. disrupted in the fibulin-4 null mice. Our studies demonstrate 2003; Yanagisawa and Davis 2010). Studies of knockout that fibulin-4 not only is essential for elastic fiber assembly, mice have demonstrated that both fibulin-4 and -5 are but also plays a specific role in regulating collagen indispensable for elastic fiber formation (McLaughlin fibrillogenesis during development. et al. 2006; Nakamura et al. 2002; Yanagisawa et al. 2002). However, loss of fibulin-4 results in a more severe phenotype than the absence of fibulin-5. Fibulin-4 null Materials and methods mice die perinatally and display pulmonary emphysema, aortic aneurysm, and artery anomalies (tortuous, dilation, Antibodies narrowing, rupture). By contrast, fibulin-5 null mice live into adulthood and show loose skin, pulmonary emphyse- A rabbit polyclonal antibody against full-length recombi- ma, and cardiovascular defects. nant mouse fibulin-4 was reported previously (Kobayashi In humans, mutations in fibulin-4 and -5 underlie au- et al. 2007). A guinea pig polyclonal antibody for fibulin- tosomal recessive cutis laxa (ARCL) type 1B and 1A, 4wasgeneratedbyusingtheN-terminalregionofmouse respectively (Urban and Davis 2014). ARCL is a hetero- fibulin-4 as the antigen by the custom antibody services geneous group of disorders characterized by loose skin of Cocalico Biologicals (Reamstown, Pa., USA). The an- with significant internal organ involvement. Like the phe- tigen corresponded to amino acids 28–203 of mouse notypes of the knockout mice, notable differences are fibulin-4 and was produced in HEK293 cells by the found in the clinical manifestations of ARCL 1A and methods described previously (Kobayashi et al. 2007). ARCL 1B patients. A significant proportion of patients with fibulin-4 mutations die shortly after birth or in early childhood because of cardiopulmonary failure (Al- Targeted inactivation of Fbln4/Efemp2 gene Hassnan et al. 2012; Dasouki et al. 2007;Ericksonetal. 2012;Hebsonetal.2014; Hoyer et al. 2009; A 10-kb XbaI genomic fragment containing the 5′ portion of the Hucthagowder et al. 2006; Iascone et al. 2012; Fbln4/Efemp2 gene kindly provided by Dr. Günter Kostka was Kappanayil et al. 2012;Renardetal.2010;Sawyer used to construct the gene-targeting vector. Generation of the et al. 2013). The common pathological findings are pul- fibulin-4 null mice was as described in Supplementary Material, monary emphysema, arterial tortuosity, and aortic aneu- Fig. S1. Genotyping of mutant mice was performed by poly- rysm. In addition, patients show skeletal and other sys- merase chain reaction (PCR) analysis of tail DNA. Forward temic connective tissue abnormalities, including bone fra- primer CCTCTCTGCAGATGTCAACG and reverse primer gility, joint laxity, arachnodactyly, pectus excavatum, flex- GAGGCAGGCAGATTTCTGAG generated a 358-bp PCR ion contracture of wrists, feet abnormalities, hypotonia, product from the wild-type allele. The same reverse primer and diaphragmatic and inguinal hernias. On the other and forward primer TAAAGCGCATGCTCCAGACTGC hand, patients with fibulin-5 mutations present with cutis yielded a ∼310 bp PCR product from the targeted allele. All laxa, emphysema, and supravalvular aortic stenosis, but animal experiments were performed under animal protocols Cell Tissue Res (2016) 364:637–646 639 640 Cell Tissue Res (2016) 364:637–646 Fig. 1 Phenotypes of fibulin-4 null mice. a Photographs of eight processed for paraffin embedding. Cryosections (8 μm) +/- embryos at embryonic day 19 dissected from a pregnant Fbln4 were fixed with methanol and used for immunostaining female. All three Fbln4-/- embryos (nos. 3, 4, 5) showed bilateral forelimb contractures. One of the three Fbln4+/- embryos (no. 7) had a with a polyclonal antibody against fibulin-4 (Kobayashi unilateral forelimb contracture. Note that the Fbln4-/- embryos were of the et al. 2007) and Cy3-labeled secondary antibody (Jackson same size as the wild-type littermates, and the skin in their chests ImmunoResearch Laboratories). Paraffin-embedded sec- appeared translucent, and thus, their rib cages were visible. b tions (5 μm) were subject to Verhoeff-Van Gieson elastin Diaphragmatic hernia in a representative newborn Fbln4-/- mouse. Abdominal organs, liver, and intestine were found in the chest cavity. c, staining. Samples were viewed by using a Zeiss Axioskop d Forelimb skeletons of newborn Fbln4+/+ (c) and Fbln4-/- (d) mice epifluorescence microscope with a Toshiba 3CCD camera stained with alcian blue and alizarin red. e–g Aortas from E18 and ImagePro software (Media Cybernetics, Rockville, +/+ +/- -/- Fbln4 , Fbln4 ,andFbln4 embryos stained with the rabbit Md., USA). polyclonal antibody for