Proc. Nati. Acad. Sci. USA Vol. 88, pp. 8958-8962, October 1991 Biochemistry Functional map of the a subunit of RNA polymerase: Two modes of transcription activation by positive factors (positive control/subunit assembly/transcription factor/protein-protein contact/deletion mutant) KAZUHIKO IGARASHIt, AKEMI HANAMURAt§, Kozo MAKINO¶, HIROFUMI AIBAII, HIROJI AIBA*§, TAKESHI MIZUNOII, ATSUO NAKATA¶, AND AKIRA ISHIHAMAt** tNational Institute of , Department of Molecular Genetics, Mishima, Shizuoka 411, Japan; *Tsukuba University, Department of Chemistry, Tsukuba, Ibaraki 305, Japan; 1Osaka University, Institute of Microbial Diseases, Suita, Osaka 565, Japan; and 1Nagoya University, School of Agriculture, Chikusa, Nagoya 464, Japan Communicated by Motoo Kimura, June 24, 1991

ABSTRACT The role of the a subunit of Escherichia coli subunit is involved in positive control by certain transcription RNA polymerase in transcription activation by positive factors activators (10-14). was investigated using two reconstituted mutant RNA poly- In the present study, we extended this line of experiments merases (containing C-terminally truncated a subunits) and to type II CRP-dependent promoters. Most CRP-dependent three positive factors [the cAMP receptor protein (CRP), promoters can be classified into two types depending on the OmpR, and PhoB]. The mutant RNA polymerases did not location of the CRP site relative to the transcription start site respond to transcription activation by activator proteins that (15, 16). Type I promoters are associated with a CRP site that bind upstream of the respective promoters. Transcription by is separated from the basic (-10 and -35 signals) these mutant enzymes was, however, activated in the cases and include the lac P1 and uxuAB promoters. On type II where activators bind to target sites that overlap the promoter promoters, the CRP site is centered around -41/-42 and therefore partially overlaps the basic promoter at the -35 -35 region. Two different mechanisms are proposed for the region. In addition, we examined the responsiveness of the positive control of transcription by activator proteins, one mutant RNA polymerases to transcription stimulation by two requiring the C-terminal domain of the a subunit, and the other activators, PhoB, an activator of the phosphate regu- other not requiring it. lon, and OmpR, which is involved in osmoregulation of the ompF and ompC genes (reviewed in ref. 17). The results Positive control of transcription is one of the common suggest the presence oftwo different mechanisms for positive mechanisms of regulated in both prokary- control of transcription by activator proteins: one requires otes and eukaryotes. Two mechanisms have been proposed the C-terminal domain of the a subunit, and the other does for this activation, (i) activator-induced conformational not. change of DNA structure around the promoter and (ii) direct contact between activator and RNA polymerase on the DNA MATERIALS AND METHODS (for review see ref. 1). Several mutants ofA repressor protein or cAMP receptor protein (CRP) that still bind to their RNA Polymerases. Wild-type and mutant RNA polymer- respective target sites but are unable to activate transcription ases were assembled in vitro from individually overproduced have been isolated, indicating direct interaction between and purified (3, (3', and (770 subunits and one of the wild-type these activator proteins and RNA polymerase (2-5). or mutant a subunits, as described by Igarashi and Ishihama RNA polymerase of Escherichia coli is composed of four (9). different subunits, a, (3, (3', and one of a variety ofao subunits Transcription Factors. CRP was purified as described (18). (reviewed in ref. 6). One major function of the a subunit is to Purification of OmpR protein and the truncated form of a mediate the assembly ofthe two large subunits, (3and (3', into mutant EnvZll protein, EnvZll*, was described previously the core enzyme structure (7, 8). A set of mutant RNA (19, 20). EnvZll* lacks the N-terminal hydrophobic region. polymerases were constructed that were assembled in vitro Overproduction and purification of PhoB protein and from wild-type ,(, (3', and a,70 subunits and a mutant a subunit PhoR1084, a truncated form of PhoR lacking the N-terminal lacking the C-terminal 73 or 94 amino acid residues (9). The hydrophobic region, were described previously (21, 22). mutant RNA polymerase core enzymes containing C-termi- Template DNAs. All the truncated DNA templates used are nally truncated a subunits exhibited essentially the same illustrated in Fig. 1A. The 240-bp Hpa II fragment containing specific activity of RNA synthesis as the native enzyme. the gal promoter region was isolated from pBdCl o70 (23). The 344-bp Hinfl fragment containing the pBR-P4 After addition of subunit, these mutant holoenzymes were promoter was isolated from plasmid pBR322 (24). The 516-bp able to initiate transcription accurately from certain promot- HindII1 fragment containing the ompC promoter region was ers. However, they did not respond to transcription activa- obtained from plasmid pUCI-OL (25). The 115-bp BamHI- tion by cAMP/CRP at two type I CRP-dependent promoters HindIII fragment containing the pstS promoter was obtained on the lac and uxuAB genes (9). These results led us to from plasmid pOS1 (26), and its ends were filled-in using the conclude that the C-terminal domain (residues 257-329) ofthe Klenow fragment of DNA polymerase I. The 205-bp EcoRI a subunit is involved in the response of RNA polymerase to fragment containing the lacUV5 promoter was obtained from transcriptional activation by cAMP/CRP. Phenotypes result- plasmid pKB252 (27). ing from known rpoA mutations also suggest that the a Abbreviation: CRP, cAMP receptor protein. The publication costs of this article were defrayed in part by page charge §Present address: Nagoya University, Faculty of Science, Chikusa, payment. This article must therefore be hereby marked "advertisement" Nagoya 464, Japan. in accordance with 18 U.S.C. §1734 solely to indicate this fact. **To whom reprint requests should be addressed. 8958 Biochemistry: Igarashi et al. Proc. Natl. Acad. Sci. USA 88 (1991) 8959

A pBR P4 I.: 344 bp S-----lAl-l 241 b gal I- 240 b~p -d 45 b (P1) 6 50 b (P2) ompC 516 bp - 98 b

pstS .Z1J 15 bp 41 b

B3 ux uAB GAGTGAAATTGTTGTGATGTGGTTAACCCAATTAGAATTCGGGATTGACATGTCTTACCAAAAGGTAGAACTTATACGC CRP site -35 -10 lac P1 AATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA CRP site 35 -10 pBR P4 CGGTATTTTCTCCTTACGCATCTGTiG-CGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTfG CRP site -10 gal P1 TCTTGTGTAAACGATTCCACTAATTTATTTCCATGTCACACTTTTCGCATCTTTGTTATGCTATGGTTATTTCA ompC CRP site "10 TTGCATTTANCAT T TTGAAACATCTATAGCGATAAATGAAACATCTTAAAAGTTTTAGTATCATATTCGTGTTGGATTATTCTGCAT TTTTGGCGAGAAGGACT OrnpR site OmpR site OmpR site .735 - 1 0M pstS TCICTCTGTCATAAAACTGTCATATTCCTTACATATAACTGTCACCTGTTTGTCCTATTTTGCTTCTCG PhoB site PhoB site 0 FIG. 1. Activator-dependent E. coli promoters. (A) Truncated DNA templates used for in vitro transcription. DNA fragments, each carrying a promoter(s) (black areas) and an activator binding site(s) (gray areas), were prepared as described in Materials and Methods. Transcripts from these templates are shown by filled arrows indicating the direction of transcription. bp, Base pairs; b, bases. (B) Nucleotide sequences of the uxuAB, lac, pBR-P4, gal, ompC and pstS promoter regions. Transcription initiation sites are marked by stars. Basic promoter elements (-10 and -35 signals) are underlined by black bars. The binding sites for CRP, OmpR, and PhoB are underlined by gray bars. The nucleotides homologous to the consensus CRP-binding site, OmpR-binding site, and PhoB-binding sites (pho box) are indicated by dashed overlines. The predicted lengths of the run-off transcripts are 45 and mutant RNA polymerases containing a-235 or a-256. Basal 50 nucleotides from the gal P1 and P2 promoters, respec- transcription from P2 in the absence of cAMP/CRP was tively; 241 nucleotides from the pBR-P4; 98 nucleotides from weaker with the mutant enzymes than that with the wild-type the ompC promoter; 41 nucleotides from the pstS promoter; enzymes. When the DNA fragment was preincubated with and 63 nucleotides from the lacUV5 promoter (see Fig. 1). cAMP/CRP, transcription from P1 was markedly stimulated In Vitro Transcription. In vitro transcription from the gal not only for the wild-type but also the mutant enzymes. and pBR-P4 promoters was carried out according to Kajitani Although the basal transcription from P2 was weaker for the and Ishihama (27) with some modifications (9). Transcription mutant enzymes, the level of induced P1 transcription was from the ompC promoter was carried out essentially as almost the same as that by the wild-type enzymes. Inhibition described by Aiba and Mizuno (28), while transcription from ofinitiation at P2 is due to interference with RNA polymerase the pstS promoter was carried out as described by Makino et binding by cAMP/CRP, which attaches to the -35 region of al. (22). RNA products were purified by ethanol precipitation the P2 promoter. and analyzed by electrophoresis in polyacrylamide gels con- Fig. 2B shows transcription from the pBR-P4 promoter. taining 8 M urea. This promoter resembles gal P1 with respect to the location ofthe CRP site relative to the transcription start site (see Fig. 1). Again, transcription from pBR-P4 was stimulated by RESULTS cAMP/CRP with all the enzymes used, although the level of cAMP/CRP-Dependent Transcription. RNA polymerase induced transcription was somewhat lower with the mutant holoenzymes containing C-terminally truncated a subunits enzymes than with the wild-type enzymes. a-256 and a-235 (the number represents the amino acid These results are in sharp contrast to the previous obser- residues remaining, counting from the N terminus) are active vations obtained using the lac and uxuAB promoters: the in in vitro RNA synthesis directed by activator-independent mutant RNA polymerases are defective in their response to promoters such as those of lacUV5 and trp but are inactive transcription activation by cAMP/CRP on these type I pro- in transcription from cAMP/CRP-dependent type I promot- moters (9). We conclude that the C-terminal domain of RNA ers such as those of lac and uxuAB (9). In this study, we polymerase a subunit is needed for transcription activation examined cAMP/CRP-dependent type II promoters. The by cAMP/CRP bound at a CRP site upstream of the -35 DNA fragment first used contains two promoters of the gal promoter signal, but not when cAMP/CRP binds at a CRP operon, the cAMP/CRP-dependent downstream promoter site that overlaps the -35 region. P1 (Fig. 1) and the cAMP/CRP-independent upstream pro- OmpR-Dependent Transcription. Next, we examined moter P2 (29). The transcription initiation site of P2 is 5 whether the C-terminal domain ofa subunit is also necessary nucleotides upstream from that of P1. Fig. 2A shows tran- for transcription activation by activator proteins other than scription patterns of this fragment by wild-type or mutant cAMP/CRP. OmpR is an activator protein involved in os- RNA polymerases. moregulation of expression of the genes encoding the porin Without cAMP/CRP, transcription from P2 was dominant proteins OmpC and OmpF (reviewed in ref. 17). When OmpR for all the enzymes examined-namely, native and reconsti- is phosphorylated by EnvZ protein, this activator binds to tuted wild-type RNA polymerases and two reconstituted upstream regions of the ompC and ompF promoters (see Fig. 8960 Biochemistry: Igarashi et al. Proc. Nati. Acad. Sci. USA 88 (1991)

A B cAMP/CRP cAMP/CRP + 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 I>.*;M. .-.

_ - _~~~~P2P1 FIG. 2. In vitro transcription ofthe gal (A) or pBR-P4 (B) promoter fragments. RNA polymerases used were as follows: lanes 1 and 5, native core enzyme (0.37 pg); lanes 2 and 6, reconstituted core enzyme with-wild-type a subunit (0.37 ,ug); lanes 3 and 7, reconstituted a-256 core enzyme (1.5 A.g); and lanes 4 and 8, reconstituted a-235 core enzyme (1.5 j.g). Each enzyme was preincubated with a 4-fold molar excess of a-7O subunit. For lanes 5-8 cAMP/CRP was added to the reaction mixtures. Specific transcripts are indicated by arrowheads. A slowly migrating band in each autoradiogram represents a template-sized end-to-end product. 1) and activates transcription from both promoters (20, 28). unpublished observation) is repressed by the addition ofboth Mixed transcription ofthe lacUV5 and ompC promoters was OmpR and EnvZ. OmpR and EnvZ did not affect transcrip- carried out in the absence or presence of purified OmpR and tion from the lacUV5 promoter. These results indicate that EnvZ (Fig. 3). the two mutant RNA polymerases are incapable of respond- When enzyme containing the wild-type a subunit was used, ing to transcription activation by the phosphorylated form of transcription from the ompC promoter was activated by OmpR. addition of both OmpR and EnvZ. OmpR alone gave no PhoB-Dependent Transcription. We also examined re- stimulation, indicating that its activity depends on its phos- sponse of the mutant RNA polymerases to transcription phorylation by EnvZ. In contrast, the mutant enzymes were activation by PhoB, an activator of the phosphate regulon not activated by addition of OmpR/EnvZ; instead, the tran- (reviewed in ref. 17). In this study, we used the promoter of scription level from the authentic ompC promoter remained the pstS gene, which consists oftwo elements, the -10 signal at the basal level. In all these cases, transcription from a and a pair of "pho boxes" (binding sites for PhoB protein; cryptic promoter that overlaps the OmpR-binding site (T.M., ref. 26 and Fig. 1). The first pho box is located 10 bases upstream from the -10 signal. This is a typical configuration -+ - + - + EnvZll1 of promoters for the genes of the phosphate regulon (30). _+ + - + + - + + Onp PhoB activates transcription by binding to the pho boxes when it is phosphorylated by the protein kinase PhoR (22). When both PhoB and PhoR were added, all the enzymes exhibited significant transcription from the pstS promoter (Fig. 4). In contrast, no pstS transcription was detected for any of the enzymes in the absence of both PhoB and PhoR. PhoB alone gave only weak activation (data not shown). The kinetics of the transition from closed to open com- cryptic plexes on the pstS and lacUV5 promoters in the presence of PhoB and PhoR were essentially the same for wild-type and mutant RNA polymerases (data not shown). Thus, we con- ~~a~~*~ompC- a ... cluded that the C-terminal deletion mutations ofthe subunit did not affect transcription activation by PhoB. EacUV5 DISCUSSION 2 3 4 5 6 7 8 9 On the basis of in vitro transcription studies using promoters ofthe lac and uxuAB operons, a previous report (9) proposed FIG. 3. In vitro mixed transcription of the ompC and lacUV5 that the C-terminal domain (residues 257-329) of a subunit is promoter fragments. Mixtures of 0.3 pmol of ompC promoter and involved in transcription activation by cAMP/CRP. To our 0.05 pmol of lacUV5 promoter were preincubated at 37rC for 1 min surprise, however, the present experiments, performed using in the presence or absence of OmpR (10 pmol) and autophosphory- two other cAMP/CRP-dependent promoters, gal P1 and lated EnvZ* (25 pmol). The following RNA polymerases were added: pBR-P4, showed that these mutant RNA polymerases can lanes 1-3, reconstituted core enzyme with wild-type a subunit (1.1 respond to transcription activation by cAMP/CRP at these jig); lanes 4-6, reconstituted a-256 core enzyme (0.74 ,ug); and lanes 7-9, reconstituted a-235 core enzyme (0.74 ,ug). Each enzyme was promoters. Thus, cAMP/CRP-dependent promoters can be preincubated with a 4-fold molar excess of oa70 subunit. Open classified into two groups with respect to the influence of complex formation was allowed to occur for 10 min at 370C, followed C-terminal deletion mutations truncating the a subunit. Both by RNA synthesis for 5 min. Specific transcripts are indicated by the lac P1 and uxuAB promoters contain a single CRP site, arrowheads. which is separated from the -35 signal and is centered at Biochemistry: Igarashi et al. Proc. Natl. Acad. Sci. USA 88 (1991) 8961 PhoB PhoR 1084 suggests that CRP can use different contacts and/or confor- _ +~~~~~~1 mations during transcription activation at these two types of 1 2 3 4 5 6 7 8 promoter. Thus, a correlation exists between the difference in cAMP/CRP responsiveness of the truncated a subunits and the difference in mechanisms of cAMP/CRP action. The C-terminal domain of a might provide a contact site on RNA polymerase, which we propose to designate "contact site I" (or "communication site I"), for one of two activation domains on CRP. To understand whether contact site I is responsible for _ PstS interaction with other regulatory proteins, we examined two transcription activator proteins, PhoB and OmpR. Both PhoB/ PhoR and OmpR/EnvZ are two-component systems that reg- ulate transcription in response to environmental stimuli. Acti- vators classified in such two-component systems share some common characteristics: the primary structures are similar to each other, sharing two homologous domains (reviewed in ref. 17) and both DNA-binding and transcription activation func- tions depend on their phosphorylation by respective modula- FIG. 4. In vitro transcription of the pstS promoter fragment. A tors, such as phosphorylation of PhoB and OmpR proteins by DNA fragment carrying thepstS promoter (0.1 pmol) was preincubated PhoR and EnvZ, respectively (22, 28). In spite of the basic for 10 min at 37"C in the presence (lanes 5-8) or absence (lanes 1-4) of similarities between phoB and ompR regulatory systems, the PhoB (8 pmol), PhoR1084 (8 pmol), and 0.12 mM ATP. Open complex mutant RNA polymerases with C-terminally truncated a sub- formation was carried out for another 10 min after addition of the units responded differently: the mutant enzymes were activated following RNA polymerases: lanes 1-5, native core enzyme (0.37 ,ug); by PhoB but not by OmpR. Here again, we realized that there lanes 2 and 6, reconstituted core enzyme with wild-type a subunit (0.37 is a close relationship between the organization of promoter/ jtg); lanes 3 and 7, reconstituted a-256 core enzyme (1.5 ,.g); and lanes activator-binding site and the responsiveness of the 4 and 8, reconstituted a-235 core enzyme (1.5 ,ug). Each enzyme was mutant preincubated with a 4-fold molar excess of o7O subunit. RNA polymerases (see Fig. 5). The ompC gene carries OmpR- binding sites that are separated from the basic promoterelement -61.5 and -58.5, respectively, from the transcription start (-10 and -35 signals) (32). On the other hand, all the PhoB- dependent promoters so far identified are linked withpho boxes site (Fig. 1). On the other hand, both the gal P1 and pBR-P4 that overlap the -35 signal, beginning 10 bases upstream ofthe promoters contain a single CRP site that overlaps the respec- -10 signal (30). The mutant RNA polymerases are able to tive -35 signal, centered at -41.5 of gal P1 and at -42.5 of respond to PhoB because the PhoB-binding site overlaps the pBR-P4 (Fig. 1). -35 region, whereas they fail to respond to OmpR because the Gaston et al. (31) showed that cAMP/CRP activates initial OmpR-binding site is located upstream ofthe -35 signal. Thus, binding of RNA polymerase to a promoter with the CRP site OmpR might also interact with the contact site I located on the at -61.5 whereas it accelerates isomerization of closed to C-terminal domain of the RNA polymerase a subunit while open complexes at a promoter with the CRP site at -41.5. PhoB interacts with the as yet unidentified contact site II. Bell et al. (5) isolated a mutant CRP that can activate Several chromosomal mutations of the rpoA gene have transcription from a promoter with the CRP site at -41.5, but been isolated that result in defect in the expression of some not from a promoter with the CRP site at -61.5, which systems positively controlled at the transcriptional level. Transcription Activation (CRP, PhoB and OmpR) Reconstituted RNA Polymerase P1 gal CRP site promoter N-wt :t-256 x-235 + -10-1_..:-_ + pBR P4 + + -10 -.- lac P1 :...... _...... + -35 -10 .:...... uxuAB

.-... , - _ _ _ _ ... + -35 -10 .....-_ . S pst PhoB site -10 ± .* O ompC OmpR site u - -35 -10

-100 -90 -80 -70 -60 -50 -40 -30 -20 -10 - 1

FIG. 5. Promoter organization of the activator-dependent genes and the responsiveness of the reconstituted wild-type (wt) and mutant RNA polymerases to transcription activation by positive factors. The basic promoters (-10 and -35 signals) are shown by black bars, while the target sites of activator protein binding, as determined by nuclease protection assays, are shown by gray bars. Conserved sequences of signals for transcription activation exist within each activator protein binding site as indicated. 8%2 Biochemistry: Igarashi et al. Proc. NatL. Acad. Sci. USA 88 (1991) Among these mutations, the rpoA341 and rpoA109 alleles are Minchin, S., Williams, J. & Busby, S. (1990) Nucleic Acids Res. well characterized. The rpoA341 mutation interferes with 18,7243-7250. expression of the cysA locus, araBAD operon, and mel 6. Yura, T. & Ishihama, A. (1979) Annu. Rev. Genet. 13, 59-97. operon (14). The rpoA109 mutation inhibits the expression of 7. Ishihama, A. (1981) Adv. Biophys. 14, 1-35. 8. Igarashi, K., Fujita, N. & Ishihama, A. (1990) Nucleic Acids late genes of P2 (10) and P4 (11) phages and is suppressed by Res. 18, 5945-5948. mutation in the P2 ogr gene (10) or in the P4 8 gene (33), both 9. Igarashi, K. & Ishihama, A. (1991) Cell 65, 1015-1022. of which encode transcriptional activators of the late genes. 10. Sunshine, M. G. & Sauer, B. (1975) Proc. Natl. Acad. Sci. The rpoA341 and rpoA109 mutations cause a single amino USA 72, 2770-2774. acid substitution at residue 271 (35) and at residue 289 or 290 11. Dale, E. C., Christie, G. E. & Calendar, R. (1986) J. Mol. Biol. (34), respectively, both substitution sites being within the 192, 793-803. C-terminal region of the a subunit. These observations and 12. Garrett, S. & Silhavy, T. J. (1987) J. Bacteriol. 169, 1379-1385. 13. Matsuyama, S. & Mizushima, S. (1987) J. Mol. Biol. 195, our findings indicate that the C-terminal region of RNA 847-853. polymerase a carries a contact site (site I) for some, ifnot all, 14. Giffard, P. M. & Booth, I. R. (1988) Mol. Gen. Genet. 214, of the transcription activators that bind DNA sites located 148-152. upstream ofthe basic promoter elements. As a consequence, 15. de Crombrugghe, B., Busby, S. & Buc, H. (1984) Science 224, a model arises in which RNA polymerase binds to promoters 831-838. with 83p' at the leading edge and a at the tail, in good 16. Aiba, H., Hanamura, A. & Tobe, T. (1989) Gene 85, 91-97. agreement with the previous model of the RNA polymerase 17. Stock, J. B., Ninfa, A. J. & Stock, A. M. (1989) Microbiol. Rev. 53, 450-490. topology on promoters (18). The location of the putative 18. Aiba, H. (1985) J. Biol. Chem. 260, 3063-3070. secondary site (contact site II) on RNA polymerase, which is 19. Jo, Y.-L., Nara, F., Ichihara, S., Mizuno, T. & Mizushima, S. involved in communication with regulatory proteins bound (1986) J. Biol. Chem. 261, 15252-15256. on promoter sequences, remains to be determined. 20. Aiba, H., Nakasai, F., Mizushima, S. & Mizuno, T. (1989) J. In addition to the direct protein-protein contact between Biochem. 106, 5-7. the regulatory proteins and contact site I on RNA polymerase 21. Makino, K., Shinagawa, H., Amemura, M., Kimura, S., Na- a, at least two possibilities should be considered to explain kata, A. & Ishihama, A. (1988) J. Mol. Biol. 203, 85-95. 22. Makino, K., Shinagawa, H., Amemura, M., Kawamoto, T., our observations: (i) conformational change ofthe C-terminal Yamada, M. & Nakata, A. (1989) J. Mol. Biol. 210, 551-559. region is involved in transcription activation, but this change 23. Taniguchi, T., O'Neill, M. & de Crombrugghe, B. (1989) Proc. is induced by interaction between RNA polymerase and Natl. Acad. Sci. USA 76, 5090-5094. activators at a putative contact site(s) on other regions of 24. Queen, C. & Rosenberg, M. (1981) Nucleic Acids Res. 9, RNA polymerase, and (ii) the C-terminal region of a is 3365-3377. involved in proper binding of RNA polymerase to "activat- 25. Maeda, S., Ozawa, Y., Mizuno, T. & Mizushima, S. (1988) J. ed" promoters that is elicited by binding of activators to Mol. Biol. 202, 433-441. DNA. In the a subunit to an 26. Kimura, S., Makino, K., Shinagawa, H., Amemura, M. & nearby any case, appears play Nakata, A. (1989) Mol. Gen. Genet. 215, 374-380. essential role in communication between activator proteins 27. Kajitani, M. & Ishihama, A. (1983) Nucleic Acids Res. 11, and RNA polymerase on certain promoters. 671-686. 28. Aiba, H. & Mizuno, T. (1990) FEBS Lett. 261, 19-22. We thank R. S. Hayward for critical reading ofthe manuscript and 29. Musso, R. E., DiLauro, R., Adhya, S. & de Crombrugghe, B. for discussion. We thank N. Fujita, K. Nagata, and M. Yamagishi for (1977) Cell 12, 847-854. discussions and suggestions. This work was supported by grants-in- 30. Makino, K., Shinagawa, H., Amemura, M. & Nakata, A. (1986) aid from the Ministry of Education, Science, and Culture of Japan. J. Mol. Biol. 190, 37-44. 31. Gaston, K., Bell, A., Kolb, A., Buc, H. & Busby, S. (1990) Cell 1. Adhya, S. & Garges, S. (1990) J. Biol. Chem. 265, 10797-10800. 62, 733-743. 2. Hawley, D. K. & McClure, W. R. (1983) Cell 32, 327-333. 32. Maeda, S. & Mizuno, T. (1990) J. Bacteriol. 172, 501-503. 3. Hochschild, A., Irwin, N. & Ptashne, M. (1983) Cell 32, 33. Halling, C., Sunshine, M. G., Lane, K. B., Six, E. W. & 319-325. Calendar, R. (1990) J. Bacteriol. 172, 3541-3548. 4. Irwin, N. & Ptashne, M. (1987) Proc. Natl. Acad. Sci. USA 84, 34. Fujiki, H., Palm, P., Zillig, W., Calendar, R. & Sunshine, M. 8315-8319. (1976) Mol. Gen. Genet. 145, 19-22. 5. Bell, A., Gaston, K., Williams, K., Kolb, A., Buc, H., 35. Thomas, M. S. & Glass, R. E. (1991) Mol. Microbiol. , in press.